CN104548134A - Application of miR-144 and inhibitor thereof - Google Patents
Application of miR-144 and inhibitor thereof Download PDFInfo
- Publication number
- CN104548134A CN104548134A CN201510004955.9A CN201510004955A CN104548134A CN 104548134 A CN104548134 A CN 104548134A CN 201510004955 A CN201510004955 A CN 201510004955A CN 104548134 A CN104548134 A CN 104548134A
- Authority
- CN
- China
- Prior art keywords
- mir
- oxidative stress
- damage
- myocardial
- myocardium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biological medicines. That miR-144 can specifically inhibit the gene expression of Nrf2 is disclosed for the first time, the expression of miR-144 is closely related to heart disease, and the high expression of miR-144 can promote myocardial oxidative stress to cause myocardial damage related diseases. The invention provides miR-144 and application of an inhibitor of miR-144 in preparation of medicines for preventing or treating myocardial oxidative stress and damage diseases, especially diabetes caused myocardial oxidative stress and damage diseases; a new target spot is provided for the diagnosis and prevention and treatment of heart diseases.
Description
Technical field
The present invention relates to the research field of biotechnology microRNA, more particularly, relate to miR-144 and the application of inhibitor in preparation treatment heart disease medicine thereof.
Background technology
MicroRNA be the class be found in the multiple life entities such as fruit bat, nematicide, mice and people in recent years have transcribe after regulate active microRNA.A large amount of discoveries of this endogenic microRNA have benefited from two kinds of technology, and a kind of is structure and the sequencing technologies of microRNA cDNA library; Another kind is that biotin labeled oligonucleotide probe is caught, and is carried out the technology of pcr amplification by adapter-primer.By structure and the order-checking in library, people have grasped a large amount of sequence informations of microRNA, by carrying out bioinformatics compare of analysis to these sequences, it is found that most of microRNA high conservative between species, very high homology in evolution.
Genome about microRNAs is located, and generally believes that it is positioned at intergenic region in early days, but research in recent years finds that most of microRNAs is arranged in the intron of gene, and transcribing and transcribe with host gene, has similar express spectra to host gene; Another part cluster exist microRNAs, can transcribe separately, its expression is subject to the adjustment of many factors.The transcription product of these microRNAs genes must could form ripe microRNAs through multistep shearing, and then plays its biological function.First, microRNAs gene is transcribed through RNA polymerase II, forms Pri-microRNA, then shears through Drosha, defines the Pre-microRNA with hairpin structure; After it is transported to endochylema from karyon by Exportin 5, shear through Dicer enzyme, become double-strand microRNA molecule; Finally, double-strand is separated, and one is degraded, and another becomes ripe microRNAs, and together form with other molecule the silencing complex (RISC) that RNA induces.RISC, by holding noncoding region to interact with 3 ' of mRNA, causes the degraded of mRNA or the suppression of translation process, thus expresses in post-transcriptional level negativity Function protein matter.
Bioinformatic analysis finds the expression of a microRNA possibility direct regulation and control up to a hundred genes, and then has regulated and controled many important cellular pathways and pathological processes.Such as: MicroRNAs can the division of regulating cell, differentiation, proliferation and apoptosis; The growth of embryo, the energy metabolism of body, hormone secretion and hemopoietic function and answering pressure such as to coerce at the physiological process; The pathological processes such as tumor generation and myocardial hypertrophy.In cardiovascular system, microRNAs take part in the disease generating process of heart and blood vessel.The disorder that MicroRNAs expresses, participates in the generating process of multiple cardiovascular disease.
The functional study of MicroRNAs in myocardium oxidative stress and damage contributes to us and better understands its pathogeny, myocardial damage relevant disease is found to be correlated with (especially diabetic cardiomyopathy further, comprise ischemic heart desease, hypertensive heart disease, specificity cardiomyopathy etc. in addition) drug target, thus provide effective approach for the prevention of this kind of disease or treatment.
MicroRNA-144 (miR-144) is a kind of microRNA known in the art (miRNA) micromolecule, and it is useful for rna regulation.But, current and unclear for miR-144 biological function in prior art.
Apply for before the applicant and obtained Chinese invention patent CN201010193055.0, denomination of invention is " application of miR-199a and inhibitor thereof ", publication number is CN102266569A, disclose the application of miR-199a in preparation treatment treating myocardial ischemia damage medicine, and miR-199a inhibitor suppresses the application in cardiac myocyte hypertrophy and chronic heart failure medicine in preparation treatment.
Oxidative stress is because activity in vivo oxygen-derived free radicals (ROS) produces too much and/or oxidation resistance reduction, silicosis oxidant and anti-oxidant system Balance disorders, thus the pathological process causing latent injury.Chronic or the acute excessive generation of ROS plays an important role in the developing of cardiovascular disease: active oxygen is by many A signal pathways mediation cardiac myocyte hypertrophy and apoptosis; Endothelial Dysfunction is caused by mechanism such as deactivation nitric oxide.In the pathophysiology of some Main Cardiovascular Diseases such as atherosclerosis, myocardial ischemia reperfusion injury, hypertension, heart failure, oxidative stress all plays the part of pivotal player, is not limited to the myocardial ischemia, hypertrophy and the chronic heart failure that relate in the existing patented technology of the applicant.Oxidative stress process may be the risk factor of cardiomyocyte apoptosis, but the two is distinct two pathophysiological processes.Cardiomyocyte apoptosis is under certain physiology or pathological conditions, specific program in myocardial cell active cell, finally by activation endogenous dna restriction endonuclease, causes natural cell death, be positive, accuracy controlling, a catabiotic process, to Ventricular Remodeling, there is important effect.And the reactive oxygen free radical produced in oxidative stress process can not only mediating apoptosis, all has important function to cardiac myocyte hypertrophy, Endothelial Dysfunction, myocardial inflammation, Cardiac Fibroblasts Proliferation and activation.Oxidative stress plays an important role in the generation, development of the multiple cardiovascular disease such as arteriosclerosis, essential hypertension, myocardial ischemia/reperfusion injury, atrial fibrillation, cardiomyopathy, and therefore the Cardiovarscular aspect that is applied in of antioxidant seems particularly important.Desirable antioxidant, can reduce the production of oxygen-derived free radicals, alleviates it to cardiovascular damage, thus more cardiovascular patient is benefited.Therefore, to study and the medicine preparing anti-myocardium oxidativestress damage has very important clinical meaning and value.
There is no both at home and abroad about the miR-144 bibliographical information relevant to myocardium oxidativestress damage at present.
Summary of the invention
The object of the present invention is to provide the medical usage of miR-144 and inhibitor thereof.
A first aspect of the present invention, provides the application that miR-144 prevents in preparation or treats in myocardium oxidative stress and damage disease medicine.
The concrete sequence of described miR-144 is as follows:
UACAGUAUAGAUGAUGUACU(SEQ ID NO:1)。
MiR-144 of the present invention, from separated cell, or can obtain by the mode of synthetic.
Further, the application that described miR-144 prevents in preparation or treats in the medicine of myocardium oxidative stress and damage disease, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are caused by diabetes.Also namely, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are merged by diabetes.
A second aspect of the present invention, provides the application that miR-144 inhibitor prevents in preparation or treats in myocardium oxidative stress and damage disease medicine.
Mir-144 inhibitor of the present invention can the myocardium oxidative stress of specific suppression.
Further, the application that described miR-144 inhibitor prevents in preparation or treats in the medicine of myocardium oxidative stress and damage disease, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are caused by diabetes.Also namely, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are merged by diabetes.
Described miR-144 inhibitor includes but not limited to: the albumen of specific binding miR-144, and the minor interference molecule of specificity interference miR-144 gene expression, processing, as siRNA molecule, miRNA molecule, antisense nucleotide etc.
Preferably, described miR-144 inhibitor is selected from siRNA molecule or the antisense nucleotide of specificity interference miR-144 gene expression.
In a preferred embodiment of the invention, the concrete sequence of described miR-144 inhibitor is as follows:
5’-AGTACATCATCTATACTGTA-3’(SEQ ID NO:2)。
As optimal way of the present invention, the inhibitor of described miR-144 is antisense nucleotide; Or the homogeny that the sequence of sequence and its antisense nucleotide has more than 80% (preferably has the homogeny of more than 85%, more preferably there is the homogeny of more than 90%, there is the homogeny of more than 95% best, as having the homogeny of more than 96%, 97%, 98% or 99%) antisense nucleotide; They all have the identical function of miR-144 antisense nucleotide.
The inhibitor of described miR-144 can be the antisense nucleotide of miR-144.From theory, the antisense molecule obtained according to antisense technology can be used for treating any disease caused by gene expression or gene delection.Described " antisense nucleotide " also comprises modified antisense nucleotide, and described modification does not change the activity of antisense nucleotide substantially, and more preferably, described modification can improve the activity of antisense nucleotide, stability or therapeutic effect.The modification of antisense nucleotide is included but not limited to: methoxylation modification, the modification of lock nucleic acid, peptide nucleic acid(PNA) modification, thio-modification, phosphate backbones are replaced by phospholipid connecting framework.
The preparation method of the present invention to siRNA has no particular limits, and includes but not limited to: chemical synthesis, in vitro transcription method etc.Should be understood that those skilled in the art are after the sequence obtaining cicada antisense nucleotide provided by the present invention, the antisense nucleotide described in can preparing easily with various approach or express.Such as, in a kind of preference of the present invention, described antisense nucleotide is chemosynthesis.
Described antisense nucleotide is transported in cell by adopting suitable transfection reagent, or multiple technologies known in the art also can be adopted to be transported in cell.
As used herein, the inhibitor of described miR-144 includes antagonist, lower adjustment, blocker, blocker etc.The activity of any miR-144 of reduction, reduce miR-144 stability, suppress the expression of miR-144, reduce the effective acting time of miR-144 or suppress the material of transcribing and processing of miR-144 all to can be used for the present invention, as can be used for preventing or the active substance for the treatment of heart disease.The inhibitor of described miR-144 also can be through the form of modification.
After obtaining the effect of cicada miR-144 for myocardium oxidative stress, those skilled in the art can learn generation or the development that can be prevented and treated myocardial injury disease by miR-144 inhibitor easily.Therefore, the inhibitor of any miR-144 all can be used for the present invention.According to the characteristic of miR-144, those skilled in the art can obtain the inhibitor of multiple miR-144.
The present invention is by building diabetes mice myocardial injury models, carry out the analysis that in cardiac muscular tissue, microRNAs expresses, wherein miR-199a, miR-101, miR-499 etc. express and significantly reduce, and miR-144, miR-21, miR-22, miR-155, miR-15a, miR-125 etc. express remarkable rising.After this, the obvious miRNA of above-mentioned differential expression is verified further in the cell model of the myocardium oxidativestress damage of the high sugar induction of 25mM, find miR-199a, miR-101, miR-499 (express reduce), and miR-144, miR-155, miR-15a (express and increase) in animal and cell model comparatively matched group express larger change (>2 doubly) all occur.
The myocardial cell of inducing with height sugar under basic condition is after miR-144mimic transfection, and prompting myocardial cell oxidative stress level (ROS content) increases.Same method detects miR-199a, miR-101, because of its down-regulated expression in Diabetic myocardial injury model, respectively by miR-199a mimic, miR-101 mimic transfection to cultivate cardiac muscle, detect cellular oxidation stress level under contrast and high sugar stimulate, result does not find that significant change occurs ROS.Research shows in addition, miR-155, miR-15a etc. are mainly present in Cardiac Fibroblasts, not in myocardial cell, so, only have miR-144 to express in myocardial cell oxidativestress damage significantly raise and oxidative stress level can be affected, possess myocardial cell simultaneously and express relative specificity.
The present inventor has been separated myocardial cell and the fibroblast of normal mouse hearts, and confirmed by quantifying PCR method, miR-144 mainly detects at myocardial cell, and lower at fibroblast expression, specifically has myocardial cell to express relative specificity.
The present invention inquires into the unconventionality expression of miR-144 in whole myocardium oxidative stress process further, explores the pathology sense that it is possible, finds that miR-144 may play critical function at the generating process of Diabetic myocardial injury.
The present invention is reticent by miR-144 process LAN, miR-144 again, observes myocardial cell oxidative stress level under high sugared environment.Find, process LAN miR-144 level in myocardial cell: the myocardial cell of inducing with height sugar under basic condition is after miR-144 mimic transfection, and prompting myocardial cell oxidative stress level increases.And in cultured myocyte, after the antisense RNA 48h of transfection miR-144, result shows: compared with matched group, the oxidative stress level of myocardial cell is subject to obvious suppression.
A third aspect of the present invention, additionally provides the application of miR-144 in the preparation myocardium oxidative stress of diagnosis and damage disease reagent or test kit.
Described reagent, for detecting the reagent of miR-144 effective dose.
Described test kit, comprises the reagent detecting miR-144 effective dose.
Described test kit, it comprises: (i) detect miR-144 effective dose one or more reagent; (ii) one or more materials of lower group are selected from: container, operation instructions, positive control, negative control thing, buffer agent, auxiliary agent or solvent, such as the solution of suspendible or fixed cell, detectable label or tag, nucleic acid is made to be easy to the solution of hybridizing, for the solution of cell lysis, or for the solution of nucleic acid purification.
The present invention is by process LAN in myocardial cell and suppress mir-144 to show, mir-144 can promote myocardium oxidative stress.Further analysis confirms, process LAN mir-144 can suppress the mrna expression of Nrf2, and the latter has important protective effect in the myocardium oxidative stress of high sugar stimulation; Bioinformatics and reporter gene result prompting Nrf2 are the potential target gene of mir-144, the myocardium protecting action that prompting mir-144 normal expression or expression by inhibitation system are unique under may having high sugared environment.In addition, in animal model, blood plasma mir-144 increases the weight of to fade with diabetes cardiac function along with myocardial damage, and its level raises gradually, and prompting blood plasma mir-144 level may as the important marker of EARLY RECOGNITION Diabetic myocardial injury.For treated as soon as possible with delay myocardial damage and provide diagnosis basis and action target spot.
In preference of the present invention, described medicine is pharmaceutical composition, and described pharmaceutical composition contains the described miR-144 inhibitor of effective dose, and pharmaceutically acceptable carrier.
The composition of described " pharmaceutically acceptable " is applicable to people and/or animal and without excessive bad side reaction (as toxicity, stimulation and allergy), namely has the material of rational benefit/risk ratio.
Described " effective dose " refer to can to people and/or animal produce function or activity and can by people and/or animal the amount that accepts.
Described " pharmaceutically acceptable carrier " refers to the carrier being used for the treatment of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carrier is well known to those of ordinary skill in the art.Discussing fully about pharmaceutically acceptable excipient can be found in Remington ' s Pharmaceutical Sciences (Mack Pub.Co., N.J.1991).Pharmaceutically acceptable carrier can contain liquid, as water, saline, glycerol and ethanol in the composition.In addition, in these carriers, also may there is complementary material, as filler, lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance etc.
The effective dose of miR-144 inhibitor of the present invention can change with order of severity of the pattern of administration and disease to be treated etc.The selection of preferred effective dose can be determined (such as passing through clinical trial) according to various factors by those of ordinary skill in the art.Described factor includes but not limited to: pharmacokinetic parameter such as bioavailability, metabolism, the half-life etc. of miR-144 inhibitor; The disease that patient will treat, the body weight of patient, the immune state of patient, the approach etc. of administration.Usually, when miR-144 inhibitor of the present invention gives with the dosage of about 0.001-100mg/kg (preferably 0.01-20mg/kg) the weight of animals every day, gratifying effect can be obtained, preferably give with the dosage that 2-4 time is separated every day, or with sustained release forms administration.For most of large mammal, the accumulated dose of every day is about 0.005-100mg, is preferably about 0.008-50mg.This dosage of scalable is replied to provide optimal treatment.Such as, by an urgent demand for the treatment of situation, the dosage that several times separate can be given every day, or dosage is reduced pari passu.
Any applicable route of administration is all fine, and includes but not limited to: oral, intravenous injection, subcutaneous injection, muscle gives, local gives, implant, slow release gives, give in heart; Preferably, described administering mode is that non-bowel gives.
A fourth aspect of the present invention, provide a kind of method of screening the potential material preventing or treat myocardium oxidativestress damage, described method comprises:
(1) system of miR-144 is expressed with candidate substances process;
(2) expression or the activity of miR-144 in described system is detected;
Wherein, if described candidate substances can reduce expression or the activity of miR-144, then show that this candidate substances is the potential material of prevention or treatment heart disease.
In a preference, step (1) comprising: in test group, candidate substances is joined in the system suppressing miR-144; And/or
Step (2) comprising: the expression or the activity that detect miR-144 in the system of test group, and compares with matched group, and wherein said matched group is the system of the suppression miR-144 not adding described candidate substances;
If in test group the expression of miR-144 or activity statistically lower than (preferably remarkable lower than, as low by more than 20%, preferably low by more than 50%; Better is low by more than 80%) matched group, just show that this material standed for is prevention or the potential material for the treatment of myocardium oxidativestress damage.
Described system includes but not limited to: solution system, subcellular fraction system, cell system, organizational framework, organ systems or animal system.
In another preference, described method also comprises: carry out further cell experiment and/or animal experiment to the potential material obtained, to select further from candidate substances and determine for prevention or treat the useful material of myocardium oxidativestress damage.
On the other hand, what the present invention adopted described screening technique to obtain can be used for the potential material preventing or treat myocardial injury disease, and the material that these Preliminary screening go out can form a screening storehouse, so that people finally can therefrom filter out really useful material.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Beneficial effect
The present inventor is through deep research, disclose the gene expression that miR-144 can suppress Nrf2 specifically first, and the expression and the heart disease that disclose miR-144 are first closely related, its high expressed promotes myocardium oxidative stress, thus myocardial damage relevant disease (especially diabetic cardiomyopathy comprises ischemic heart desease, hypertensive heart disease, specificity cardiomyopathy etc. in addition) can be brought out.The present invention is that the control of above-mentioned heart disease provides new target spot.
In the present invention by the expression of lowering miR-144 in described mammalian body to suppress the generation of myocardium oxidative stress can in case or treatment cardiac muscle of mammal damage.
Accompanying drawing explanation
After the success of Fig. 1 diabetic cardiomyopathy mouse modeling, compared with Normal group mice, cardiac muscle performance under Electronic Speculum and ultrasoundcardiogram results contrast, wherein A shows under control group mice cardiac muscle Electronic Speculum, B shows under diabetic cardiomyopathy mouse cardiac muscle Electronic Speculum, visible myocardial damage arrangement disorder, mitochondrial swelling; C is Normal group mice ultrasoundcardiogram result (FS57.9 ± 5.2%, EF83.5 ± 5.8%), D is diabetic cardiomyopathy mice ultrasoundcardiogram result (FS40.6 ± 3.5%, EF67.9 ± 5.2%), and prompting poor heart function is in matched group.
The expression of Fig. 2 miR-144 in diabetic cardiomyopathy mouse heart and myocardial cell express relative specificity analysis, wherein A is the Microarray results of diabetic cardiomyopathy mice compared with miRNA differential expression > 2 times in control group mice heart tissue, B is the differential expression analysis of miR-144 in normal mouse myocardial cell and Cardiac Fibroblasts, and visible miR-144 is mainly expressed in myocardial cell.
Fig. 3 miR-144 expression in Diabetic myocardial injury pathological process raises gradually.
Fig. 4 miR-144 process LAN is by myocardial cell oxidative stress level under the high sugared environment of suppression Nrf2 promotion.Under process LAN miR-144 promotes high sugared environment, myocardial cell ROS generates (representing oxidative stress level), if give Dh404 (Nrf2 agonist), the oxidative stress that Dh404 can suppress miR-144 process LAN to cause simultaneously.In figure, " control " refers to blank group.
Fig. 5 miR-144 silence suppresses diabetic mice (STZ group) the myocardium oxidative stress level of STZ induction.A is the transfection efficiency of miR-144 in cardiac muscle after mouse tail vein injection miR-144 inhibitor, B generates (representing oxidative stress level) for suppressing miR-144 to reduce the myocardium ROS of STZ group, and C generates (representing oxidative stress level) for suppressing miR-144 to reduce the myocardium MDA of STZ group.
Fig. 6 miR-144 is by the myocardial cell oxidative stress of the high sugar induction of Nrf2 regulation and control.A is by luciferase reporter gene, and find that Nrf2 is the potential target gene of miR-144, B is after myocardial cell transfection miR-144mimic, Nrf2 expresses minimizing, C is after myocardial cell transfection miR-144 inhibitor, and while miR-144 expression inhibiting, Nrf2 content increases.In figure, " control " refers to blank group.
Fig. 7 process LAN miR-199a and miR-101 has no significant effect myocardial cell oxidative stress level under the sugared environment of height.A is ROS level after myocardial cell transfection miR-199a mimic, and B is ROS level after myocardial cell transfection miR-101 mimic.In figure, " control " refers to blank group.
Detailed description of the invention
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.
The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: lab guide (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
MicroRNAs expression analysis in embodiment 1, Diabetic myocardial injury model
Multiple abundant microRNAs is there is in cardiac muscular tissue.This experiment adopts classical STZ abductive approach, and successfully establish Diabetic myocardial injury mouse model, construction method is as follows:
Choose male C57BL/6 mice, in 8 week age, be divided into two groups at random.Weigh after fasting 12h before modeling, measure fasting blood sugar.Wherein one group of lumbar injection streptozotocin (STZ) solution (with pH 4.5 citric acid-sodium citrate buffer), every disposable injection 150mg/kg of mice; Negative control group is single intraperitoneal injection equal-volume citric acid-sodium citrate buffer then.Tail vein blood after one week, blood glucose meter measures blood glucose, continuous detecting two days whole blood blood glucose >=18.6mol/L, the glucose in urine positives, and have obvious polydipsia, polyphagia, polyuria symptom be selected in, continue raising be successfully established through Color Sonography, heart tissue sections, electron microscopic examination results verification diabetic cardiomyopathy model after 8 weeks.
Myocardial damage companion arrangement disorder under Electronic Speculum, mitochondrial swelling, ultrasoundcardiogram prompting cardiac function decline prompting successfully constructs (Figure 1A: show under control group mice cardiac muscle Electronic Speculum, Figure 1B: show under diabetic cardiomyopathy mouse cardiac muscle Electronic Speculum, visible myocardial damage arrangement disorder, mitochondrial swelling; Fig. 1 C: Normal group mice ultrasoundcardiogram result (FS57.9 ± 5.2%, EF83.5 ± 5.8%), Fig. 1 D: diabetic cardiomyopathy mice ultrasoundcardiogram result (FS40.6 ± 3.5%, EF67.9 ± 5.2%), prompting poor heart function is in matched group.)
When diabetic mice modeling successful subsequent continues raising 8 weeks, TRIzol (Invitrogen) is utilized to carry out RNA extracting (concrete steps are in accordance with reagent description) to left room cardiac muscle.Adopt Denmark ExiqonmiRNA chip technology to carry out expression pattern analysis, and utilize quantitative PCR to verify further result.
Real-time fluorescence quantitative PCR: conventional method extracting RNA, by the corresponding microRNA of Auele Specific Primer reverse transcription of neck ring structure, then real-time fluorescence quantitative PCR detection is carried out, quantitative with two standard curve method, analyze the microRNA concentration of each sample, and by the specificity of solubility curve and agarose gel electrophoresis determination gene amplification.
Found that diabetic cardiomyopathy mice comparatively control group mice heart microRNAs express spectra change, wherein miR-199a, miR-101, miR-499 etc. express and significantly reduce, and the expression such as miR-144, miR-21, miR-22, miR-155, miR-15a, miR-125 significantly raises (as Fig. 2 A).
After this, the obvious miRNA of above-mentioned differential expression is verified further in the cell model of the myocardium oxidativestress damage of the high sugar induction of 25mM, by in animal and cell model comparatively matched group express miR-199a, miR-101, miR-499 (express and reduce) that larger change (>2 doubly) all occurs, and miR-144, miR-155, miR-15a (express and increase) are as next embodiment object of study.
Abundant miRNA and miR-144 of embodiment 2, heart is mainly expressed in myocardial cell
Myocardial cells culture: digest with 0.2% trypsin and 0.1% collagenase, stick adherent method with differential and purify myocardial cell, use IMDM culture medium culturing, observe under inverted microscope, do myocardial cell quality evaluation with trypan blu e staining, myocardial cell carries out Actin SABC, Myoglobin immunohistochemistry and electronic microscope photos.
Cardiac Fibroblasts is cultivated: adopt enzymic digestion+differential attachment method original cuiture mouse cardiac muscle fibroblast, according to myocardial cell and the difference of Cardiac Fibroblasts adherent time, the adherent speed of fibroblast, at the bottom of first investing bottle, adopt differential velocity adherent 1h repeatedly, obtain fibroblast, and observation of cell morphological characteristic and immunocytochemical stain checking cell purity (Cardiac Fibroblasts Vimentin is strong positive reaction, actin be negative reaction).
The present inventor has been separated myocardial cell and the fibroblast of normal mouse hearts, and have detected the expression of miR-144.Confirmed by quantitative PCR (method is with embodiment 1), miR-144 mainly detects at myocardial cell, and at fibroblast expression lower (Fig. 2 B), specifically has myocardial cell to express relative specificity.Therefore the result of the present inventor shows, miR-144 is mainly expressed in myocardial cell.
Same method detects the relative specificity of the obvious miRNA of other differential expressions in myocardial cell, result prompting miR-199a, miR-101 express relative abundance in myocardial cell, and miR-155, miR-15a etc. are mainly present in Cardiac Fibroblasts, miR-499 expresses and there is no significant difference in the two.Therefore, cardiac muscle is expressed relatively special miR-144, miR-199a, miR-101 and include further embodiment in.
Embodiment 3, miR-144 express in Diabetic myocardial injury pathogenesis to be increased gradually
Method is with example 1,2
In last work, we carry out microRNAs detection of expression by quantitative PCR to Diabetic myocardial injury mouse model left ventricular tissues, find that miR-144 abnormal expression is comparatively obvious and existence cardiac muscle expresses relative specificity; And blood plasma miR-144 level also comparatively matched group obviously raise.We, by inquiring into the unconventionality expression of miR-144 in whole myocardium oxidative stress process further, explore the pathology sense that it is possible.Result shows: miR-144 did not change 1 week time, express when 4 weeks and start to raise 1.5 times that reach sham group, the expression of 12 weeks reaches sham group about 3 times, and prompting miR-144 may play critical function (Fig. 3) at the generating process of Diabetic myocardial injury.
Myocardial cell oxidative stress level under the high sugared environment of embodiment 4, miR-144 process LAN promotion
The method of miR-144 process LAN: use Lipofectamine RNAiMAX Reagent by specification by miR-144 analogies (miR-144 mimic) transfection to cultured myocyte.
Oxidative stress measures: after cultured myocyte being given respectively the stimulations such as the high sugar of miR-144 mimic, 25mM, illustrate survey ROS content by test kit.
The myocardial cell of inducing with height sugar under basic condition is after miR-144 mimic transfection, and prompting myocardial cell oxidative stress level (ROS content) (Fig. 4) increases.
Same method detects embodiment 2 cardiac myocyte and expresses relatively special miR-199a, miR-101, because of its down-regulated expression in Diabetic myocardial injury model, we respectively by miR-199a, miR-101 analogies (miR-199a mimic, miR-101 mimic) transfection to cultivate cardiac muscle, detect cellular oxidation stress level under contrast and high sugar stimulate, result does not find that significant change (Fig. 7) occurs ROS.So far, object of study is locked as miR-144 by us.
Embodiment 5, the diabetic mice cardiac muscle oxidative stress suppressing miR-144 expression minimizing STZ to induce
The design of miR-144 antisense sequences and silence efficiency analysis: Mirbase obtain miR-144 mature sequence, design its antisense complementarity RNA, this sequence of chemosynthesis, and the 2 ' methoxy carrying out base is modified.Be cloned in slow virus carrier, 293 cells are packed in transfection, and results virion, qRT-PCR detects the expression of miR-144.Suppress miR-144 level in Mice Body by tail vein injection approach, and utilize its silence efficiency of quantitative PCR analysis.
Heart tissue ROS measures: after getting the fresh left ventricular tissues homogenate of mice, illustrates measure ROS content according to test kit.
Heart tissue MDA measures: malonic acid (malonaldehyde, MDA) is lipid peroxidation, is also a biomarker of cell oxidative damage.MDA content is measured by illustrating according to test kit after fresh for mice left ventricle homogenate.
Front portion experimental result shows, miR-144 process LAN can significantly promote myocardial cell oxidative stress.For better inquiring into the endogenous function of miR-144, this work is by animal model experiment in vivo, the antisense RNA fullness and distention in the chest and abdomen poisonous carrier (miR-144 inhibitor) of transfection miR-144, and then the miR-144 of silencing endogenous (Fig. 5 shows anti-miR144).Shown by quantitative PCR detection: the antisense RNA of miR-144 significantly can suppress the level (Fig. 5 A) of the endogenic miR-144 of heart.In the diabetic mouse model (Fig. 5 shows STZ) of STZ induction, after the antisense RNA slow virus carrier of transfection miR-144, result shows: compared with matched group, and the oxidative stress level (Fig. 5 B-C) of diabetic mice group (being shown as STZ in figure) its cardiac muscle of STZ induction is subject to obvious suppression.
The searching of embodiment 6, MiR-144 effect target gene and checking
The target gene of bioinformatics method prediction microRNAs: utilize microRNA microRNA target prediction website and the softwares such as TargetScan, Bibiserve, Pictar, forecast analysis is carried out to the secondary structure of the microRNA of rat and target gene, finds that sequences match degree is high, secondary structure is stablized, the gene of target sequence high conservative between species carries out subsequent authentication.
Two fluorescent reporter gene method detects the target gene of microRNA: by 3' untranslated region (the Untranslated Region of target gene, UTR) in can with the 3'UTR of luciferase in the interactional sequence clone of microRNA to pGL3 plasmid, build restructuring luciferase reporter plasmid.By itself and the pSuper carrier corotation 293T cell according to a certain percentage of expressing corresponding microRNA.Cell lysis after 24 hours, adopt two fluorescent reporter gene detection system to detect the expression of luciferase, thus can reflection microRNA regulate target gene expression in vitro system.
By bioinformatic analysis and luciferase reporter gene, find that Nrf2 is the potential target gene (Fig. 6 A) of miR-144.After myocardial cell transfection miR-144 mimic, Nrf2 expresses and reduces (Fig. 6 B); Otherwise after myocardial cell transfection miR-144 inhibitor, while miR-144 expression inhibiting, Nrf2 content increases (Fig. 6 C).By while process LAN miR-144 and Nrf2 (utilizing Nrf2 agonist: Dh404) further checking miR-144 regulate myocardial cell oxidative stress level by Nrf2 approach.Found that give miR-144 mimic and Dh404 (Nrf2 agonist), the oxidative stress (Fig. 4) that Dh404 can suppress miR-144 process LAN to cause simultaneously in myocardial cell.
MiR-144 is suppressed to improve diabetic cardiomyopathy mouse core function in embodiment 7, body
Suppress miR-144 method with embodiment 5 in body.
The testing index of diabetic cardiomyopathy mouse model cardiac shape and function: mice after 2% isoflurane anesthesia, utilize noinvasive through breast color ultrasound (
770) carry out measurement related data, all data at least repeat 5 times.Result prompting suppresses miR-144 level can effectively improve mouse core function in the diabetic cardiomyopathy mouse model body of STZ induction.(table 1:*P < 0.05, compares with matched group Con;
#p < 0.05, compares with STZ.FS: left LVSF, EF: Left Ventricular Ejection Fraction)
Suppress miR-144 level on the impact of cardiac function in the diabetic cardiomyopathy Mice Body that table 1 STZ induces
This work mainly utilizes chip technology in the animal model of diabetic cardiomyopathy, screen the obvious miRNA of differential expression, and verifies through quantitative PCR.Choose the relatively special miRNA of myocardium expression as object of study simultaneously, confirm further in the myocardial cell injury model that high sugar stimulates, found that mir-144 equal up-regulated in the animal and cell model of diabetes merging myocardial damage.Point out mir-144 may merge in the pathological process of myocardial damage in diabetes to play a role.
Shown by process LAN and suppression mir-144 in the diabetic cardiomyopathy mice of myocardial cell and STZ induction, mir-144 can promote myocardium oxidative stress.Further analysis confirms, process LAN mir-144 can suppress the mrna expression of Nrf2, and the latter has important protective effect in the myocardium oxidative stress of high sugar stimulation; Bioinformatics and reporter gene result prompting Nrf2 are the potential target gene of mir-144, the myocardium protecting action that prompting mir-144 normal expression or expression by inhibitation system are unique under may having high sugared environment.
In addition, in animal model, blood plasma mir-144 increases the weight of to fade with diabetes cardiac function along with myocardial damage, and its level raises gradually, and prompting blood plasma mir-144 level may as the important marker of EARLY RECOGNITION Diabetic myocardial injury.For treated as soon as possible with delay myocardial damage and provide diagnosis basis and action target spot.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (8)
- The application that 1.miR-144 prevents in preparation or treats in myocardium oxidative stress and damage disease medicine, the sequence of described miR-144 is as shown in SEQ ID NO:1.
- 2. miR-144 according to claim 1 is in the application preparing prevention or treat in myocardium oxidative stress and damage disease medicine, and it is characterized in that, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are caused by diabetes.
- The application that 3.miR-144 inhibitor prevents in preparation or treats in myocardium oxidative stress and damage disease medicine.
- 4. miR-144 inhibitor according to claim 3 is in the application preparing prevention or treat in the medicine of myocardium oxidative stress and damage disease, and it is characterized in that, described myocardium oxidative stress and damage are the myocardium oxidative stress and damage that are caused by diabetes.
- 5. miR-144 inhibitor according to claim 3 is in the application preparing prevention or treat in the medicine of myocardium oxidative stress and damage disease, and it is characterized in that, the sequence of described miR-144 inhibitor is as shown in SEQ IDNO:2.
- The application of 6.miR-144 in the preparation myocardium oxidative stress of diagnosis and damage disease reagent or test kit.
- 7. the application of miR-144 in the preparation myocardium oxidative stress of diagnosis and damage disease reagent or test kit according to claim 6, it is characterized in that, described reagent is the reagent detecting miR-144 effective dose.
- 8. the application of miR-144 in the preparation myocardium oxidative stress of diagnosis and damage disease reagent or test kit according to claim 6, it is characterized in that, described test kit comprises the reagent detecting miR-144 effective dose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510004955.9A CN104548134A (en) | 2015-01-04 | 2015-01-04 | Application of miR-144 and inhibitor thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510004955.9A CN104548134A (en) | 2015-01-04 | 2015-01-04 | Application of miR-144 and inhibitor thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104548134A true CN104548134A (en) | 2015-04-29 |
Family
ID=53065898
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510004955.9A Pending CN104548134A (en) | 2015-01-04 | 2015-01-04 | Application of miR-144 and inhibitor thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104548134A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713972A (en) * | 2016-03-16 | 2016-06-29 | 上海中医药大学 | Application of miRNA to preparation of drug-induced heart disease biomarkers |
| CN105854017A (en) * | 2016-03-01 | 2016-08-17 | 扬州大学 | Reagent for treating beta-thalassemia and application thereof |
| CN108992457A (en) * | 2018-01-15 | 2018-12-14 | 广东省实验动物监测所 | The application of miR-144-3p and its target gene in the drug that preparation adjusts human heart Fibroblast Function |
| CN113913506A (en) * | 2021-09-30 | 2022-01-11 | 吉林大学 | Application of miR-144-3p in preparation of reagent or medicine for diagnosing or treating myocardial injury |
| CN114245747A (en) * | 2019-07-18 | 2022-03-25 | M·欧阿迪 | Medical use, method and use |
| CN114807139A (en) * | 2022-05-11 | 2022-07-29 | 上海海洋大学 | Regenerative micromolecule miRNA-XU2 and application thereof |
| WO2023092927A1 (en) * | 2021-09-08 | 2023-06-01 | 中国人民解放军空军军医大学 | Small rna for relieving stress hypertension vascular endothelial dysfunction and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102266569A (en) * | 2010-06-04 | 2011-12-07 | 中国人民解放军第二军医大学 | Application of miR-199a and inhibitor thereof |
| CN103874770A (en) * | 2011-08-08 | 2014-06-18 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarker compositions and methods |
-
2015
- 2015-01-04 CN CN201510004955.9A patent/CN104548134A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102266569A (en) * | 2010-06-04 | 2011-12-07 | 中国人民解放军第二军医大学 | Application of miR-199a and inhibitor thereof |
| CN103874770A (en) * | 2011-08-08 | 2014-06-18 | 卡里斯生命科学卢森堡控股有限责任公司 | Biomarker compositions and methods |
Non-Patent Citations (5)
| Title |
|---|
| AGUIAR VALLIM TQ ET AL: "Mus musculus microRNA 144 (Mir144), microRNA", 《NCBI REFERENCE SEQUENCE: NR_029556.1》 * |
| CAROLYN SANGOKOYA ET AL: "microRNA miR-144 modulates oxidative stress tolerance and associates with anemia severity in sickle cell disease", 《BLOOD》 * |
| XIAOWEI ZHANG ET AL: "Synergistic effects of the GATA-4-mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion-induced cardiomyocyte death", 《JOURNAL OF MOLECULAR AND CELLULAR CARDIOLOGY》 * |
| 张玥 等: "2型糖尿病大鼠心肌氧化应激与抗氧化能力的研究", 《中国慢性病预防与控制》 * |
| 赵海苹 等: "微小RNA-144的研究进展", 《首都医科大学学报》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105854017A (en) * | 2016-03-01 | 2016-08-17 | 扬州大学 | Reagent for treating beta-thalassemia and application thereof |
| CN105713972A (en) * | 2016-03-16 | 2016-06-29 | 上海中医药大学 | Application of miRNA to preparation of drug-induced heart disease biomarkers |
| CN108992457A (en) * | 2018-01-15 | 2018-12-14 | 广东省实验动物监测所 | The application of miR-144-3p and its target gene in the drug that preparation adjusts human heart Fibroblast Function |
| CN114245747A (en) * | 2019-07-18 | 2022-03-25 | M·欧阿迪 | Medical use, method and use |
| WO2023092927A1 (en) * | 2021-09-08 | 2023-06-01 | 中国人民解放军空军军医大学 | Small rna for relieving stress hypertension vascular endothelial dysfunction and application thereof |
| CN113913506A (en) * | 2021-09-30 | 2022-01-11 | 吉林大学 | Application of miR-144-3p in preparation of reagent or medicine for diagnosing or treating myocardial injury |
| CN114807139A (en) * | 2022-05-11 | 2022-07-29 | 上海海洋大学 | Regenerative micromolecule miRNA-XU2 and application thereof |
| CN114807139B (en) * | 2022-05-11 | 2023-11-24 | 上海海洋大学 | Regenerated small molecule miRNA-XU2 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104548134A (en) | Application of miR-144 and inhibitor thereof | |
| Eulalio et al. | Functional screening identifies miRNAs inducing cardiac regeneration | |
| CN102421917B (en) | Means and methods for counteracting, preventing and/or determining heart failure, or a risk of heart failure | |
| Care et al. | MicroRNA-133 controls cardiac hypertrophy | |
| Bernardo et al. | Silencing of miR-34a attenuates cardiac dysfunction in a setting of moderate, but not severe, hypertrophic cardiomyopathy | |
| Guo et al. | Cardiomyocyte‐specific role of miR‐24 in promoting cell survival | |
| CA3134991A1 (en) | Pharmaceutical composition for treating cancer comprising microrna as active ingredient | |
| DK2794882T3 (en) | Micro-RNAs for cardiac regeneration by induction of cardiac myocyte proliferation | |
| WO2008084319A2 (en) | Novel nucleic acid | |
| Evangelista et al. | miR-222 contributes to sex-dimorphic cardiac eNOS expression via ets-1 | |
| US20190153446A1 (en) | Mir-149-3p and method for treating metabolic disease using the same | |
| Fang et al. | miR-696 plays a role in hepatic gluconeogenesis in ob/ob mice by targeting PGC-1α | |
| CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
| CN112430665B (en) | Molecular biomarker for diagnosing and treating triple negative breast cancer and application thereof | |
| CN108841864A (en) | A kind of molecule sensor using RNA interference mechanism | |
| CN102266569B (en) | Application of miR-199a and inhibitor thereof | |
| WO2011111715A1 (en) | Nucleic acid capable of regulating cell cycle | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN109706241B (en) | Medicine for treating dilated cardiomyopathy and screening and preparation method thereof | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN102188441A (en) | Minimal molecule RNA-155 having medical purpose of antiatherosclerotic | |
| CN103272248B (en) | The application of miR-15b in preparation treatment of diabetes preparation | |
| CN103800918B (en) | The application in preparing anti-tumor drug of a kind of Microrna | |
| CN104031987B (en) | MiRNA application in myocardial fibrosis disease treatment | |
| CN105603115B (en) | Lung squamous cancer shifts diagnosis and treatment marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150429 |