CN103981212B - The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown - Google Patents
The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown Download PDFInfo
- Publication number
- CN103981212B CN103981212B CN201410210447.1A CN201410210447A CN103981212B CN 103981212 B CN103981212 B CN 103981212B CN 201410210447 A CN201410210447 A CN 201410210447A CN 103981212 B CN103981212 B CN 103981212B
- Authority
- CN
- China
- Prior art keywords
- rice
- oscad2
- seqidno
- gene
- target fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the breeding method that a kind of clever shell color by the rice varieties of yellow grain husk shell changes brown into, comprise following step: determine that gene OsCAD2 exon district chooses target fragment and builds plant CRISPR/Cas9 target practice recombinant vectors in grain husk shell color, Introduced into Rice cell also regenerates seedling, by the order-checking to regeneration strain genome target fragment, obtain the strain carried the position OsCAD2 genes such as two and occur afunction to suddenly change simultaneously, through phenotypic evaluation, it is achieved the change of grain husk shell color. Experiment shows, present method can change the clever shell color of rice varieties fast.
Description
Technical field
The present invention relates to rice biological technology breeding field, being specifically related to a kind of clever shell color improvement by the rice varieties of existing yellow grain husk shell is the breeding method of brown.
Background technology
The breeding technology for hybrid rice of China was through the researchdevelopment of more than 30 years, and not only seeding technique is ripe, and, hybrid seed yield also significantly improves, for the lasting raising of the main crop yield of China serves keying action. But, the problems such as it is not high that breeding technology for hybrid rice still exists seed production efficiency, and labour intensity is big, and seed quality is difficult to control, and seed production is unstable. The active path addressed these problems is the Mixed plant realizing entire mechanization. Owing to there are father and mother in Mixed plant, this is planted with the mixed receipts of hybrid strain are mixed, it is necessary to suitable mark distinguishes cenospecies and parent. At present, one of the color of rice glume differentiation mark being considered as most practical application foreground, the breeding technique therefore developing quick transformation rice varieties grain husk shell color will effectively promote the development of hybrid rice seed breedoing by mixed planted.
Part is clear and definite at present for the hereditary mechanism of rice glume color. Unconventional rice glume color mainly comprises dark golden yellow (brown) and black, and the proterties of its performance is subject to different generegulation. OsCAD2 is a kind of gene that can control separately rice glume color. A kind of cinnamyl-alcohol dehydrogenase of OsCAD2 coding, can catalytic pyrolysis hydroxycinnamaldehyde, be the committed step in biosynthetic pathway of lignin. Have been reported and show, in the mutant gh2 of rice variety Zhejiang spoke 802, in OsCAD2 gene the 4th exon, the G sudden change of the 554th is A, corresponding glycine in OsCAD2 albumen is caused to turn into aspartic acid, cause the forfeiture of cinnamyl-alcohol dehydrogenase activity, thus the clever shell color causing gh2 mutant turns brown; And in japonica rice variety Japan is fine, retrotransposon Tos17 inserts and causes OsCAD2 to express premature termination, also result in the proterties that same grain husk shell color is deepened.
In modern crop breeding, there is the improvement demand for single proterties. In this time, the focusing ability of the traditional breeding method based on hybridizing-backcrossing shows slightly not enough, and breeding cycle length, cost are also very high. Different with it, the gene targeting that Protocols in Molecular Biology, particularly latest developments go out can fast and accurately for the change of single-gene provides effective solution. Particularly within 2013, work the CRISPR/Cas9 technology developed, there is high-throughput, the good characteristics such as simple to operate, will play a significant role in Molecular design breeding.
Summary of the invention
The present invention provides the breeding method that a kind of clever shell color by the rice varieties of yellow grain husk shell changes brown into, it is characterised in that, described method comprises the steps:
Step 1, determine gene OsCAD2 exon district chooses using the DNA fragmentation of base NGG ending as target fragment in rice glume color, wherein, N represents any one in base A, G, C, T, and described target fragment is positioned on described OsCAD2 gene extron;
Step 2, utilize described target fragment, build the CRISPR/Cas9 recombinant vectors being used for rice Os CAD2 gene targeting, wherein said recombinant vectors comprises the guide rna expression frame and Cas9 enzyme nucleic acid expression frame with described target fragment;
Step 3, by described recombinant vectors Introduced into Rice cell, induction contains guide rna expression frame and Cas9 enzyme nucleic acid expression frame co expression in rice cell of described target fragment, under the acting in conjunction of guide rna expression frame and Cas9 enzyme nucleic acid expression frame, shear the double-strand target fragment of OsCAD2 gene, again by the DNA repairing effect of rice cell self, in target site radom insertion or disappearance base, it is achieved the afunction sudden change of OsCAD2 gene in rice cell;
Step 4, with import described recombinant vectors rice cell regenerate some rice plants;
Step 5, the region of DNA section order-checking that OsCAD2 gene in the rice plant of regeneration is comprised target fragment;
All there is the regeneration strain that afunction suddenlys change in the position OsCAD2 genes such as step 6, selection two, and carry out phenotype observation, choose the strain that grain husk shell color turns brown.
In one implementation, a chain in described target fragment has 5 '-(N)X-NGG-3 ' structure, (N)XRepresent that number is a base sequence { N of X1,N2����Nx, N1,N2����NxIn each represent any one in A, G, C, T.
In one implementation, X is 19 or 20.
Further, there is terminator or frame shift for normal OsCAD2 encoding sequence in target site in the sudden change of described afunction.
In one implementation, described recombinant vectors comprises the guide rna expression frame can expressed in rice cell, its nucleotide sequence is as shown in SeqIDNo.1, described recombinant vectors also comprises the Cas9 enzyme nucleic acid expression frame can expressed in rice cell, and its nucleotide sequence is as shown in SeqIDNo.2.
In one implementation, described guide rna expression frame comprises: paddy rice U6 promotor, and its nucleotide sequence is as shown in SeqIDNo.1 the 1 to 246; Constitutional features is (N)XTarget sequence and the sgRNA frame sequence of synthetic, its nucleotide sequence is as shown in SeqIDNo.1 the 267 to 350; And Poly-T terminator, its nucleotide sequence is as shown in SeqIDNo.1 the 351 to 358.
In one implementation, described Cas9 enzyme nucleic acid expression frame comprises corn ZmUBI promotor, its nucleotide sequence as shown in SeqIDNo.2 the 1 to 2031, the improved Cas9 encoding sequence of plant-preferred codons, its nucleotide sequence is as shown in SeqIDNo.2 the 2034 to 6305; And tNOS terminator, its nucleotide sequence is as shown in SeqIDNo.2 the 6347 to 6599.
In one implementation, step 2 specifically comprises: put in order according to the nucleic acid of target sequence, builds the CRISPR/Cas9 recombinant vectors being used for rice Os CAD2 gene targeting. Guide rna expression frame is made up of (for the gene targeting of different loci, sgRNA immobilizes, and CrRNA is the different changes according to target site) CRISPRRNA (crRNA) and sgRNA. In described recombinant vectors, CRISPRRNA (crRNA) sequence is (N) in target section 5 ' described in step 1-(N) X-NGG-3 'XOr the sequence of complementation with it.
In the method, it is rice protoplast instantaneous conversion or the conversion of agriculture bacillus mediated rice callus tissue stabilization of PEG mediation by the method for recombinant vectors Introduced into Rice cell.
Described step 5 comprises and comprises the region of DNA section of target fragment by OsCAD2 gene in Genomic PCR method clone's regeneration plant, and is checked order by amplified production. Described Genomic PCR method is, for the genome area comprising target fragment, design site-specific primer, taking the genomic dna of regeneration plant as template, comprises the genome area of target fragment described in amplification. The order-checking of described amplified production refers to, is checked order by the object band in PCR primer.
Described in the method, the position OsCAD2 genes such as two all occur that afunction sudden change refers to that two kinds of afunction mutant nucleotide sequences occurs in OsCAD2 gene target site in sequencing result, and wild-type sequence do not occur; The sudden change of wherein said afunction refers to that terminator or frame shift occurs in target site in normal OsCAD2 encoding sequence.
The present invention can by the shearing to specific gene, it is achieved transgenation, and then changes grain husk shell color. The present invention is directed to the characteristic specialized designs of paddy rice guide RNA and Cas9 enzyme nucleic acid expression frame, realize the object of the present invention.
The nucleotides sequence of the guide rna expression frame adopted in a kind of implementation of the present invention is classified as:
The nucleotides sequence of the Cas9 enzyme nucleic acid expression frame adopted in a kind of implementation of the present invention is classified as:
Accompanying drawing explanation
Fig. 1 mediates, by PEG, the partial results figure that protoplastis instantaneous conversion regenerates OsCAD2 site-directed point mutation order-checking detection in rice strain, wherein WT represents for wild type gene, "-", represents the sequence that there occurs and delete sudden change, "+", represents the sequence that there occurs insertion sudden change, and the numeral of "-/+" back is deleted or the Nucleotide quantity of insertion;
Fig. 2 by the phenotype of the brown shell rice material rice paddy seed of initiative, A represents for donor material, and namely kind Anhui round-grained rice 97, B for grain husk shell color Improvement in Shape is Anhui round-grained rice 97 material that donor Anhui round-grained rice 97 has brown grain husk shell after orientation improves.
Embodiment
The test method used in following embodiment if no special instructions, is ordinary method. The material that uses in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The selection of target fragment
Determining that gene OsCAD2 (LOC_Os02g09490.1) exon district chooses target fragment in rice glume color, a chain of selected double-strand target fragment to be had 5 '-(N)X-NGG-3 ' structure, (N)XRepresent that number is a base sequence { N of X1,N2����Nx, N1,N2����NxIn each represent any one in A, G, C, T. N in NGG is any one in A, G, C, T. On described OsCAD2 gene extron, have described (N)XWhat the fragment of-NGG-3 ' structure was chosen as target has 96.
In the present embodiment, the nucleotide sequence CCGCCGAGAAGACCGTCACC of the upper 14-36 position after translation initiation codon ATG of rice Os CAD2 gene (LOC_Os02g09490.1) the first exon is selectedGGG, (underscore part is NGG part in described 5 '-(N) X-NGG-3 ' structure), as target practice site.
For the preparation of the recombinant vectors of rice Os CAD2 gene targeting
A. by selected target site synthesis (Hua Da genome company) just to oligonucleotide chain (OsCAD2KO1P1) and reverse oligonucleotide chain (OsCAD2KO1P2) complementary with it,
Concrete sequence is:
OsCAD2KO1P1:TGTGCCGCCGAGAAGACCGTCACC;
OsCAD2KO1P2:AAACGGTGACGGTCTTCTCGGCGG��
The part wherein not marked by underscore is remove sequence or the complementary sequence of NGG in above-mentioned target site, and having underscore part is the sticky end for connection carrier.
B. OsCAD2KO1P1 and OsCAD2KO1P2 is carried out cycle of annealing, the annealing of OsCAD2KO1P1 and OsCAD2KO1P2 two chain is formed the double-stranded DNA with sticky end, as the insertion fragment building recombinant vectors.
C. cut at 37 DEG C of enzymes with BsaI restriction endonuclease (producing by NEB company) and comprise guide rna expression frame (nucleotide sequence is as shown in SeqIDNo.1) can expressed in rice cell and paddy rice CRISPR/Cas9 engineering carrier (nucleotide sequence is as shown in SeqIDNo.2) of Cas9 enzyme nucleic acid expression frame can expressed in rice cell. The present inventor have devised such carrier, but carrier structure and construction process are with reference to existing document (Xuetal, GenetargetingusingtheAgrobacteriumtumefaciens-mediatedCR ISPR-Cassysteminrice, RICE, 2014) shown in, using BsaI endonuclease digestion paddy rice CRISPR/Cas9 engineering carrier 2 hours, 65 DEG C of fermentoids cut system 10 minutes, as the skeleton fragment building recombinant vectors.
D. with T4 ligase enzyme (NEB company), recombinant vectors skeleton fragment is connected with insertion fragment, proceeds in intestinal bacteria. To products therefrom after sequence verification, extract its positive transformant, it is configured for the transfer vector plasmid that rice Os CAD2 gene C RISPR/Cas9 practices shooting.
Rice Os CAD2 gene targeting and the brown shell material of protoplastis instantaneous conversion mediation obtain��
1, utilizing PEG method that the transfer vector plasmid that rice Os CAD2 gene C RISPR/Cas9 practices shooting that is used for obtained is converted into paddy rice Anhui round-grained rice 97 protoplastis above, rice protoplast transforms detailed process and with reference to experimental technique disclosed in " Ahighlyefficientricegreentissueprotoplastsystemfortransi entgeneexpressionandstudyinglight/chloroplast-relatedpro cesses. " PlantMethod (2011) of the people such as document Zhang.
2, utilize the rice protoplast after transforming in step 1, obtain reuse water rice plants (totally 18 strain). Rice protoplast transform and plant regeneration detailed process with reference to " APolyethyleneGlycol-MediatedProtoplastTransformationSyst emforProductionofFertileTransgenicRicePlants " PlantPhysiology (1990) such as document Hayashimoto. disclosed in experimental technique.
3, utilize Plant Genome Mini Kit (producing by Tian Gen biochemical corp), extract the genomic dna being obtained 18 regeneration plants. Taking this DNA as template, comprising the sequence in target region with Phusion high-fidelity DNA polymerase (NEB company) pcr amplification, the primer that wherein pcr amplification is used is:
OsCAD2KO1genomecheckFP:GAGAGAGAGCGAATCAGCCACT
OsCAD2KO1genomecheckRP:GTAGTAGAACGCATGTACCAGA
4, obtained pcr amplified fragment taking OsCAD2KO1genomecheckFP by primer pair directly to check order, analyzed the sudden change in target site. Sequencing result shows, is being surveyed in 18 plant, and 9 plant are with the sudden change in OsCAD2 gene target sequence, and mutation efficiency is 50%; The form of sudden change comprises insertion and/or the disappearance of base. Partial results is as shown in Figure 1; Wherein the position OsCAD2 genes such as two all occur that the regeneration strain that afunction suddenlys change is 4 strains, occur that allelotrope efficiency is 44.4% simultaneously. In Fig. 1, the CCGCCGAGAAGACCGT----CACC part of band shade is target practice target bit.
5, observe there is the seed color that the regeneration strain that afunction suddenlys change all occur in the position OsCAD2 genes such as two, the seed of all 4 strain paddy rice all shows as Vandyke brown, shows that described 4 strains have the position OsCAD2 genes such as two and all occur that the clever shell color of the regeneration strain that afunction suddenlys change successfully obtains transformation.
The breeding method of the present invention has the following advantages relative to traditional breeding way:
1., breeding cycle is short, about 7 months consuming time of the directed initiative process of whole material, and the conventional hybridization-method that backcrosses at least needed for 3��5 years.
2., only change a gene of acceptor kind, obtained material other economical characters except grain husk shell color constant, and the tradition method that backcrosses can import other genes chain with OsCAD2, it is possible to affect the economical character of acceptor kind.
The present invention adopts the carrier of particular design to carry out CRISPR/Cas9 target practice, directionally realizes the sudden change of specific gene, is with a wide range of applications. The experiment proved that, adopting in this way, mutation efficiency is obviously higher than ordinary method.
Although specific embodiment is described by the preferred implementation above with reference to the present invention, but those skilled in the art should understand that, above-described embodiment is only exemplarily, and the scope of the present invention is not brought restriction.
Claims (6)
1. the clever shell color of rice varieties by yellow grain husk shell changes the breeding method of brown into, it is characterised in that, described method comprises the steps:
Step 1, determine gene OsCAD2 exon district chooses using the DNA fragmentation of base NGG ending as target fragment in rice glume color, wherein, N represents any one in base A, G, C, T, and described target fragment is positioned on described OsCAD2 gene extron;
Step 2, utilize described target fragment, build the CRISPR/Cas9 recombinant vectors being used for rice Os CAD2 gene targeting, wherein said recombinant vectors comprises the guide rna expression frame and Cas9 enzyme nucleic acid expression frame with described target fragment, described guide rna expression frame can be expressed in rice cell, its nucleotide sequence is as shown in SeqIDNo.1, described Cas9 enzyme nucleic acid expression frame can be expressed in rice cell, and its nucleotide sequence is as shown in SeqIDNo.2;
Step 3, by described recombinant vectors Introduced into Rice cell, induction contains guide rna expression frame and Cas9 enzyme nucleic acid expression frame co expression in rice cell of described target fragment, shear the double-strand target fragment of OsCAD2 gene, again by the DNA repairing effect of rice cell self, in target site radom insertion or disappearance base, it is achieved the afunction sudden change of OsCAD2 gene in rice cell;
Step 4, with import described recombinant vectors rice cell regenerate some rice plants;
Step 5, the region of DNA section order-checking that OsCAD2 gene in the rice plant of regeneration is comprised described target fragment;
All there is the regeneration strain that afunction suddenlys change in the position OsCAD2 genes such as step 6, selection two, and carry out phenotype observation, choose the strain that grain husk shell color turns brown.
2. breeding method according to claim 1, it is characterised in that, a chain in described target fragment has 5 '-(N)X-NGG-3 ' structure, (N)XRepresent that number is a base sequence { N of X1,N2����Nx, N1,N2����NxIn each represent any one in A, G, C, T.
3. breeding method according to claim 2, it is characterised in that, X is 19 or 20.
4. breeding method according to claim 1, it is characterised in that, there is terminator or frame shift for normal OsCAD2 encoding sequence in target site in the sudden change of described afunction.
5. breeding method according to claim 1, it is characterised in that,
Described guide rna expression frame comprises: paddy rice U6 promotor, and its nucleotide sequence is as shown in SeqIDNo.1 the 1 to 246; Constitutional features is (N)XTarget sequence and the sgRNA frame sequence of synthetic, its nucleotide sequence is as shown in SeqIDNo.1 the 267 to 350; And Poly-T terminator, its nucleotide sequence is as shown in SeqIDNo.1 the 351 to 358.
6. breeding method according to claim 1, it is characterised in that,
Described Cas9 enzyme nucleic acid expression frame comprises corn ZmUBI promotor, its nucleotide sequence as shown in SeqIDNo.2 the 1 to 2031, the improved Cas9 encoding sequence of plant-preferred codons, its nucleotide sequence is as shown in SeqIDNo.2 the 2034 to 6305; And tNOS terminator, its nucleotide sequence is as shown in SeqIDNo.2 the 6347 to 6599.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410210447.1A CN103981212B (en) | 2014-05-16 | 2014-05-16 | The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410210447.1A CN103981212B (en) | 2014-05-16 | 2014-05-16 | The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103981212A CN103981212A (en) | 2014-08-13 |
| CN103981212B true CN103981212B (en) | 2016-06-01 |
Family
ID=51273384
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410210447.1A Active CN103981212B (en) | 2014-05-16 | 2014-05-16 | The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103981212B (en) |
Families Citing this family (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US20150044192A1 (en) | 2013-08-09 | 2015-02-12 | President And Fellows Of Harvard College | Methods for identifying a target site of a cas9 nuclease |
| US9359599B2 (en) | 2013-08-22 | 2016-06-07 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US9340799B2 (en) | 2013-09-06 | 2016-05-17 | President And Fellows Of Harvard College | MRNA-sensing switchable gRNAs |
| US9526784B2 (en) | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US9388430B2 (en) | 2013-09-06 | 2016-07-12 | President And Fellows Of Harvard College | Cas9-recombinase fusion proteins and uses thereof |
| US9840699B2 (en) | 2013-12-12 | 2017-12-12 | President And Fellows Of Harvard College | Methods for nucleic acid editing |
| EP3177718B1 (en) | 2014-07-30 | 2022-03-16 | President and Fellows of Harvard College | Cas9 proteins including ligand-dependent inteins |
| EP3365356B1 (en) | 2015-10-23 | 2023-06-28 | President and Fellows of Harvard College | Nucleobase editors and uses thereof |
| CN106939316B (en) * | 2016-01-05 | 2020-08-11 | 复旦大学 | Method for site-directed knockout of rice OsPDCD5 gene second exon by CRISPR/Cas9 system |
| GB2568182A (en) | 2016-08-03 | 2019-05-08 | Harvard College | Adenosine nucleobase editors and uses thereof |
| AU2017308889B2 (en) | 2016-08-09 | 2023-11-09 | President And Fellows Of Harvard College | Programmable Cas9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| KR102622411B1 (en) | 2016-10-14 | 2024-01-10 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | AAV delivery of nucleobase editor |
| WO2018119359A1 (en) | 2016-12-23 | 2018-06-28 | President And Fellows Of Harvard College | Editing of ccr5 receptor gene to protect against hiv infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| WO2018165629A1 (en) | 2017-03-10 | 2018-09-13 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| EP3601562A1 (en) | 2017-03-23 | 2020-02-05 | President and Fellows of Harvard College | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| WO2018209320A1 (en) | 2017-05-12 | 2018-11-15 | President And Fellows Of Harvard College | Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| CN108034656A (en) * | 2017-08-16 | 2018-05-15 | 四川省农业科学院生物技术核技术研究所 | SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application |
| EP3676376A2 (en) | 2017-08-30 | 2020-07-08 | President and Fellows of Harvard College | High efficiency base editors comprising gam |
| KR20200121782A (en) | 2017-10-16 | 2020-10-26 | 더 브로드 인스티튜트, 인코퍼레이티드 | Uses of adenosine base editor |
| BR112021018606A2 (en) | 2019-03-19 | 2021-11-23 | Harvard College | Methods and compositions for editing nucleotide sequences |
| DE112021002672T5 (en) | 2020-05-08 | 2023-04-13 | President And Fellows Of Harvard College | METHODS AND COMPOSITIONS FOR EDIT BOTH STRANDS SIMULTANEOUSLY OF A DOUBLE STRANDED NUCLEOTIDE TARGET SEQUENCE |
| CN116814841B (en) * | 2023-08-16 | 2024-02-06 | 湖北省农业科学院粮食作物研究所 | Primer group for identifying rice black brown glume gene HK4, and method and application thereof |
-
2014
- 2014-05-16 CN CN201410210447.1A patent/CN103981212B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| CRISPR／Cas9新型基因打靶系统的研究进展;李辉等;《江苏农业学报》;20131231;第29卷(第4期);907-911 * |
| Gene targeting using the Agrobacterium tumefaciens-mediated CRISPR-Cas system in rice;Rongfang Xu等;《Rice》;20140502;第7卷(第5期);1-4 * |
| GOLD HULL AND INTERNODE2 Encodes a Primarily Multifunctional Cinnamyl-Alcohol Dehydrogenase in Rice;Kewei Zhang等;《Plant Physiology》;20060331;第140卷;972–983 * |
| OsCAD2 is the major CAD gene responsible for monolignol biosynthesis in rice culm;Ko Hirano等;《Plant Cell Rep》;20121231;第31卷;91-101 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103981212A (en) | 2014-08-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981212B (en) | The clever shell color of the rice varieties of yellow grain husk shell is changed into the breeding method of brown | |
| CN104017821B (en) | Directed editor's grain husk shell color determines the gene OsCHI method formulating brown shell rice material | |
| CN104004782B (en) | A kind of breeding method extending paddy rice breeding time | |
| CN103981211A (en) | Breeding method for preparing closed glume pollination rice material | |
| KR101829885B1 (en) | A method for preparing a genome-edited plant from protoplasts | |
| Turyagyenda et al. | Genetic diversity among farmer-preferred cassava landraces in Uganda | |
| CN103981215B (en) | A kind of for engineered key plasmid vector and application | |
| CN104846010A (en) | Method for deleting selection marker gene of transgenic rice | |
| CN102154282B (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN101802181A (en) | Transgenic sweet sorghum with altered lignin composition and process of preparation thereof | |
| CN106282231A (en) | The construction method of mucopolysaccharidosis II type animal model and application | |
| CN107177667B (en) | Wheat head density QTL (quantitative trait locus) linked HRM (high resolution melting) molecular marker and application thereof | |
| CN105274141A (en) | Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof | |
| CN106893750A (en) | A kind of external seamless integration method of macromolecular DNA | |
| CN102628057A (en) | Vector for non-background directed cloning of PCR products, preparation method thereof and application thereof | |
| KR102648886B1 (en) | Method for modifying a target nucleic acid in the genome of a cell | |
| CN109468330A (en) | Elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application | |
| CN115786559A (en) | Indel marker of corn drought response gene miR528b promoter and application thereof | |
| CN111171121B (en) | Transcription factor and application thereof in activating expression of banana MaSBE2.3 | |
| CN111979261A (en) | Multi-gene editing carrier and method for creating tomato fruit color material | |
| CN106591355B (en) | Breeding method of high-content 4-methyl sulfur oxygen butyl thioglycoside cabbage crop | |
| US20210254086A1 (en) | Composition For Editing Flavonoid Biosynthetic Gene By Using CRISPR/CAS9 System, And Use Thereof | |
| CN109097456A (en) | Single molecule high fidelity amplification method | |
| CN103880936B (en) | Control GPA2 gene and the application thereof of plant grain number per spike | |
| CN113897361A (en) | Eef1b2 gene knockout zebra fish epilepsy model and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |