CN108034656A - SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application - Google Patents
SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application Download PDFInfo
- Publication number
- CN108034656A CN108034656A CN201711258265.1A CN201711258265A CN108034656A CN 108034656 A CN108034656 A CN 108034656A CN 201711258265 A CN201711258265 A CN 201711258265A CN 108034656 A CN108034656 A CN 108034656A
- Authority
- CN
- China
- Prior art keywords
- sgrna
- rice
- cas9
- crispr
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses sgRNA, CRISPRCas9 carrier related with rice bronzing glume character, vector construction, application, overcomes needs to be all mutated the defects of just obtaining brown shell rice in two allele of OsCHI.The present invention：SgRNA fragments are provided, include the gRNA of selectively targeted the 5th extron of rice cinnamyl-alcohol dehydrogenase CAD genes.The sgRNA is specifically T1, T2, T3.The CRISPR/Cas9 gene editings carrier and its construction method for including above-mentioned sgRNA fragments, the carrier editable rice cinnamyl-alcohol dehydrogenase CAD genes are provided.Application of these fragments with carrier in obtaining with bronzing glume and stem knot character rice material is provided.The primer sequence for being used for detecting CRISPR/Cas9 CAD genetic recombination is provided.The present invention can reduce traditional breeding method cost, improve breeding of hybrid rice Mechanization Level, shorten breeding cycle.
Description
Technical field
The present invention relates to a kind of sgRNA fragment related with bronzing glume character rice, CRISPR/Cas9 to edit load
Body, carrier construction method, and application.Belong to genetic engineering field.
Background technology
The breeding material of a small amount of different glume colors can be obtained using natural mutation and artificial mutation, in Rice Germplasm Resources
Material.By glume different colours can in the rice mechanization production of hybrid seeds by the hybrid tied on sterile line with together being received with harvester
The restorer seed obtained separates exactly, thus different glume colors have very high technological value in breeding of hybrid rice.
But if do not changed using the method for traditional conventional hybridization, backcrossing by shell color character transformation to restorer, maintainer and original
The characteristic of material, it is necessary to the time of last decade could realize.
Authorization Notice No. discloses a kind of orientation editor glume color for the Chinese invention patent of 104017821 B of CN and determines
Determine the method that gene OsCHI formulates brown shell rice material.This method main contents are included in glume color and determine outside gene OsCHI
Aobvious sub-district chooses target fragments and builds plant CRISPR/Cas9 target practice recombinant vectors, by the recombinant vector Introduced into Rice cell
And regenerate seedling, rice cell is sheared under the action of expression cassette in the carrier, triggering rice cell DNA self
Repair function.Again by the sequencing to regenerating strain genome target fragment, obtain two equipotential OsCHI genes of carrying and send out at the same time
The strain of raw afunction mutation, is the brown shell rice material formulated by glume color identification.This method shortcoming
It is：Need all to be mutated in two allele of OsCHI and could produce brown shell rice, while to effect that two genes are mutated
Rate is relatively low, it is difficult to obtains the Mutants homozygous of two gene mutations.
The content of the invention
The purpose of the present invention is aiming at the deficiencies in the prior art, there is provided one kind can quickly obtain bronzing glume character
The technical solution of rice material.
To achieve the above object, present invention firstly provides a kind of sgRNA fragments, the sgRNA fragments can be directed to same base
Because as follows into edlin, its technical solution：
A kind of sgRNA fragments, it is characterised in that：Include the 5th of selectively targeted rice cinnamyl-alcohol dehydrogenase CAD genes
The gRNA of a extron.
The gRNA that above-mentioned sgRNA fragments include is selectively targeted in rice cinnamyl-alcohol dehydrogenase CAD genes (Oryza
Sativa (indica cultivar-group) cinnamyl-alcohol dehydrogenase (CAD) gene, GenBank:
DQ234272.1 the 5th extron), base sequence such as SEQ ID NO.6.
Above-mentioned sgRNA fragments, including three sgRNA fragments, are respectively：It is named as the sgRNA fragments of T1, base sequence
Such as SEQ ID NO.1；It is named as the sgRNA fragments of T2, base sequence such as SEQ ID NO.2；The sgRNA fragments of T3 are named as,
Base sequence such as SEQ ID NO.3.
Above three sgRNA fragments are selection rice cinnamyl-alcohol dehydrogenase CAD genes (Oryza sativa (japonica
Cultivar-group) cinnamyl alcohol dehydrogenase (CAD) gene) on three sgRNA targeting position
Point, with reference to http://cbi.hzau.edu.cn/cgi-bin/CRISPR target position point prediction and design, use http://
Www.rgenome.net/cas-offinder/ network address analyzes undershooting-effect, and final choice determines.
Above-mentioned sgRNA fragments can be used for preparing rice cinnamyl-alcohol dehydrogenase gene C RISPR/Cas9 gene editing carriers.
The present invention further provides technical solution：Above-mentioned sgRNA is preparing rice cinnamyl-alcohol dehydrogenase gene C RISPR/Cas9 genes volume
Collect the application in carrier.
Present invention simultaneously provides the CRISPR/Cas9 gene editing carriers comprising above-mentioned sgRNA fragments.
Above-mentioned CRISPR/Cas9 gene editings carrier is nuclease-mediated rice cinnamyl-alcohol dehydrogenase (CAD) bases of Cas9
Because editing carrier, including three expression expressed respectively by OsU6a, OsU6b, OsU6c promoter regulation T1, T2, T3sgRNA
Frame, the expression cassette expressed by maize ubiquitin Ubiquitin (Ubi) promoter regulations Cas9.
Present invention simultaneously provides the construction method for including above-mentioned CRISPR/Cas9 gene editings carrier, its technical solution is such as
Under：
Above-mentioned CRISPR/Cas9 gene editings carrier construction method, it is characterised in that：By respectively connect promoter T1,
T2, T3 are connected into pYLCRISPR/Cas 9P by Bsa I enzymesubi- H plasmids, structure obtain Pubi::Cas9-OsU6a::T1-
OsU6b::T2-OsU6c::T3 expression cassettes, obtain pYLCRISPR/Pubi::Cas9-OsU6a::T1-OsU6b::T2-
OsU6c::T3 edits the final carrier of gene.
Present invention simultaneously provides above-mentioned CRISPR/Cas9 gene editings carrier to be specifically directed to rice cinnamyl-alcohol dehydrogenase base
Because carrying out the application of gene editing.
Further, the application process of above-mentioned CRISPR/Cas9 gene editings carrier, is that the carrier that will be built is transferred to agriculture
Bacillus EHA105 is used for agriculture bacillus mediated rice Nipponbare callus genetic transformation, and induction of callus is obtained
Regeneration plant.
Further, gained regeneration plant can obtain the bronzing glume character without transgenic fragment through selfing screening
Rice strain/material；Also improvement restorer can be obtained through backcross transformation.
SgRNA fragments of the present invention, CRISPR/Cas9 gene editings carrier prepare bronzing glume character rice strain/
Application in material；Rice strain/material of the bronzing glume character contains or does not contain SgRNA:Cas9:HPT turns
Genetic fragment.The application process is particular by structure SgRNA:Cas9:HPT fragments are applied to rice cinnamyl-alcohol dehydrogenase base
Because being mutated rice strain.
To detect CRISPR/Cas9-CAD genetic recombination, the present invention also provides corresponding primer sequence, its technical solution is such as
Under：
Primer for detecting CRISPR/Cas9-CAD genetic recombination combines 1F, 1R, it is characterised in that 1F, 1R base sequence
Row are respectively as shown in SEQ ID NO.4, SEQ ID NO.5.
Compared with prior art, the beneficial effects of the invention are as follows：(1) the present invention provides a kind of sgRNA fragments, it is wrapped
Selectively targeted the 5th extron (SEQ IDNO.6) in rice cinnamyl-alcohol dehydrogenase CAD genes of gRNA contained.The sgRNA
Fragment specifically includes T1 (the 156th~176 of SEQ IDNO.6), T2 (SEQ IDNO.6 the 226th~246), T3 (SEQ
IDNO.6 the 516th~536) three sgRNA fragments.(2) the CRISPR/Cas9 gene editings of sgRNA fragments of the present invention are included
Carrier can carry out gene editing to rice cinnamyl-alcohol dehydrogenase (CAD) gene (SEQ IDNO.7).(3) sgRNA fragments of the present invention
It is applied to obtain the rice material with bronzing glume and stem knot character with CRISPR/Cas9 gene editings carrier.(4) originally
The primer that invention provides for detecting CRISPR/Cas9-CAD genetic recombination combines.(5) the method for the present invention only needs induction one
The mutation of a allele just can obtain bronzing glume and stem knot character rice material, without obtaining Mutants homozygous, method
It is efficient.(6) mutant that the present invention obtains can be by hybridizing and being selfed separation SgRNA:Cas9:HPT transgenic fragments, a side
Face is to remove the transgenic fragment so as to obtain the gene editing mutant of no transgene component；On the other hand can be by SgRNA:
Cas9:HPT transgenic fragments are imported in new rice sterile line or restorer, can continue to carry out CAD genes to new acceptor
Editor, so as to obtain the new sterile line with bronzing glume, restorer.The present invention is applied to agricultural production, can save biography
The manpower and time cost of system breeding, improve the Mechanization Level of breeding of hybrid rice, shorten breeding cycle.
Brief description of the drawings
Fig. 1 is gene editing vector construction figure.
Fig. 2 transgenic lines are identified.
Fig. 3 gene editings site citing (T2 and T3 are two sgRNA editing sites of design respectively, with Fig. 1 a).
Fig. 4 is phenotype after CAD gene editings (WT is Nipponbare, and cad is the mutant after CAD genes are undergone mutation).
Fig. 5 is rice paddy seed phenotype (WT is Nipponbare, and cad is the mutant after CAD gene mutations).
Fig. 6 is that the selfing of Crispr/Cas9 gene editings strain removes transgene component analysis chart.
Fig. 7 is backcross transformation improvement restorer analysis chart.
Fig. 8 is rice mechanization production of hybrid seeds brown glume screening technique line map.
Embodiment
Below in conjunction with the accompanying drawings, the preferred embodiment of the present invention is further described.
Embodiment one
As shown in Figure 1a, sgRNA fragments design of the present invention.
Genetic material：Rice cinnamyl-alcohol dehydrogenase (CAD) gene, the gene entitled Oryza sativa (japonica entirely
Cultivar-group) cinnamyl alcohol dehydrogenase (CAD) gene, GenBank:BK003969.1, is shown in
http://www.ncbi.nlm.nih.gov/nuccore/64519465.Gene coding region base sequence such as SEQ ID NO.7.
Three sgRNA target sites on rice cinnamyl-alcohol dehydrogenase (CAD) gene are selected, with reference to http://
Cbi.hzau.edu.cn/cgi-bin/CRISPR target position point prediction and design, use http://www.rgenome.net/cas-
Offinder/ network address analyzes undershooting-effect.It finally have selected three sgRNA and be respectively designated as T1, T2, T3 (Fig. 1 a).T1、T2、
The base sequence of T3 is respectively as shown in SEQ ID NO.1,2,3.
The 5th of the selectively targeted rice cinnamyl-alcohol dehydrogenase CAD genes of the gRNA that three sgRNA fragments include
Extron (SEQ IDNO.6).T1 is the 156th~176 of SEQ IDNO.6, T2 be SEQ IDNO.6 the 226th~246,
T3 is SEQ IDNO.6 the 516th~536.
Embodiment two
As shown in Figure 1, structure includes the CRISPR/Cas9 gene editing carriers of sgRNA fragments of the present invention.
Three sgRNA fragments of the gained of embodiment one are connected into rice Os U6a (1~485 in SEQ ID NO.8 respectively
Position), OsU6b (1~371 in SEQ ID NO.13), under three promoters of OsU6c (1~780 in SEQ ID NO.18)
Trip, behind respectively immediately following Ploy-T terminators (505~628 in SEQ ID NO.8,391~515 in SEQ ID NO.13
800~923 in position, SEQ ID NO.18).Concrete operations are by taking T1 as an example, first respectively with the primer SEQ ID containing T1 sequences
The primer and SEQ ID NO.11 and SEQ IDNO.12 of NO.10 and SEQ IDNO.9 carries out first round PCR, obtains two PCR
Product, then again using the two PCR products as template, SEQ IDNO.9 and SEQ IDNO.12 carry out the second wheel PCR for primer,
Obtain OsU6a::T1(SEQ ID NO.8).Similarly OsU6b can be obtained by two-wheeled PCR::T2(SEQ ID NO.13)、
OsU6c::T3(SEQ ID NO.18).Expression cassette OsU6a is obtained after sequencing is correct::T1(SEQ ID NO.8)、OsU6b::T2
(SEQ ID NO.13)、OsU6c::T3 (SEQ ID NO.18).There are the Bsa I that end is matched two-by-two at three expression cassette both ends
Restriction enzyme site.
Gained expression cassette is connected into plasmid pYLCRISPR/Cas9Pubi-H's (referring to reference paper 1) by Bsa I enzymes
On Bsa I restriction enzyme sites (6471~6176 positions and 7148~7152 positions in SEQ ID NO.23), Pubi is formed::
Cas9-OsU6a::T1-OsU6b::T2-OsU6c::T3 expression cassettes, obtain pYLCRISPR/Pubi::Cas9-OsU6a::T1-
OsU6b::T2-OsU6c::T3 edits the final carrier (Fig. 1) of gene.Cas9 (SEQ in plasmid pYLCRISPR/Cas9Pubi-H
1973~6175 positions in ID NO.23) gene is by maize ubiquitin promoter Ubiqutin (1~1972 in SEQ ID NO.23
Put) driving.The different cohesive ends produced after same Bsa I digestions are shown in Fig. 1 b.
Reference paper 1：Ma,X.,Zhang,Q.,Zhu,Q.,Liu,W.,Chen,Y.,Qiu,R.,Wang,B.,Yang,
Z.,Li,H.,Lin,Y.,Xie,Y.,Shen,R.,Chen,S.,Wang,Z.,Chen,Y.,Guo,J.,Chen,L.,Zhao,
X.,Dong,Z.and Liu,Y.G.(2015)A Robust CRISPR/Cas9System for Convenient, High-
Efficiency Multiplex Genome Editing in Monocot and Dicot Plants.Mol Plant8,
1274-1284.
Embodiment three
CRISPR/Cas9 gene editings carrier of the present invention is specifically carrying out gene volume for rice cinnamyl-alcohol dehydrogenase gene
The application collected.
Vegetable material：Rice Nipponbare (Oryza.Sativa L.spp.japonica)
It is using the final carrier conversion bacillus coli DH 5 alpha of the gained of embodiment two, the sequencing of picking monoclonal that sequencing is correct
Bacterial strain expansion is numerous, and extraction plasmid is transferred in agrobacterium strains EHA105, obtains the bacterium solution for disseminating.
Using Nipponbare mature seed as material, seed is sterilized with 1 ‰ mercuric chloride, it is sterile washing five times after culture in MS culture mediums
On, evoked callus.30 DEG C of illumination cultivation fortnights obtain rice Nipponbare mature embryo callus.Callus is cut into
The particle of 2mm~3mm sizes, is incubated on fresh MS culture mediums.
After 4 days, rice Nipponbare mature embryo callus particle is disseminated with EHA105 bacterium solutions, it is specific to disseminate operating method ginseng
See reference file 2.
Culture terminates to obtain 60 plants of transgenic lines.Transgenic line genomic DNA is extracted, with primer 1F (SEQ ID
NO.4), 1R (SEQ ID NO.5) amplifications include the sequence (long 580bp) in sgRNA mutational sites, carry out transgenic line identification.
It was found from Fig. 2, Fig. 3, purpose fragment has deletion mutation and insertion icon.By Fig. 2 obtain containing mutational site
Fragment rubber tapping sequencing, with DSDecodeM (http://skl.scau.edu.cn/home/) analysis 60 transgenic lines volume
The situation of collecting, wherein there is a strain not edit, remaining has different degrees of editor (Fig. 3).Wherein No. 7 and No. 55 are
There occurs the Mutants homozygous of about 200bp missings.
Qualification result shows that, using CRISPR/Cas9 gene editings carrier of the present invention, it is right in rice Nipponbare to succeed
Purpose rice cinnamyl-alcohol dehydrogenase (CAD) gene has been inserted into or has been lacked into edlin, editor's target site of the gene
Mutation.
Fig. 4 is that (WT is Nipponbare to phenotype after rice cinnamyl-alcohol dehydrogenase (CAD) gene editing, and cad is that CAD genes occur
Mutant after mutation), Fig. 5 be rice paddy seed phenotype (WT is Nipponbare, and cad is the mutant after CAD gene mutations).Fig. 4,
Fig. 5 is shown, after producer editor, the stem knot and glume of rice Nipponbare are all bronzing.Phenotype after the gene mutation is simultaneously
Do not influence the normal growth and yield of plant, thus can in the case where not influencing other characters, by the gene it is other not
It is to be mutated with restorer to educate, so as to be used in breeding.Glume face can be especially used in the paddy machinery production of hybrid seeds
Color is to be applied in selection markers.
Reference paper 2：Agrobacterium-mediated transformation of Japonica
cv.Nipponbare callus tissue and recovery of transgenic rice plants. http://
ptf.agron.iastate.edu/protocol/Rice.PDF
Application examples one
Fig. 6 is that the selfing of Crispr/Cas9 gene editings strain removes transgene component analysis chart.Analysis shows, the present invention
The restructuring rice strain that editor is completed to target gene obtained can be filtered out by selfing does not contain SgRNA:Cas9:HPT turns
The plant of genetic fragment.
Application examples two
Fig. 7 is backcross transformation improvement restorer analysis chart.Analysis shows, can be by SgRNA:Cas9:HPT transgenic fragments
The editor completed to target gene rice cinnamyl-alcohol dehydrogenase (CAD) gene of new material is imported in new material.
Application examples three
SgRNA fragments of the present invention, CRISPR/Cas9 edit carrier and are applied to the paddy machinery production of hybrid seeds, itself and application examples one, two
Something in common is not repeated.
As shown in figure 8, in the paddy machinery production of hybrid seeds, genetic transformation is carried out to maintainer with the inventive technique scheme, is imported
CRISPR/Cas9 edits carrier, to target gene rice cinnamyl-alcohol dehydrogenase (CAD) gene in maintainer into edlin；Editor
After the completion of by selfing isolate homozygosis cad mutant strains, and retain contain SgRNA:Cas9:HPT transgenic fragment strains
System；During hybridizing with sterile line, edit rice cinnamyl-alcohol dehydrogenase (CAD) gene in sterile line, and from
In filter out the mutant of homozygosis, while abandon containing SgRNA:Cas9:The strain of HPT transgenic fragments, so that it is obtained
Bronzing glume character, and do not contain transgene component.
The sterile line and restorer Mixed plant improved with this, mechanical harvesting can be removed extensive by the color of glume afterwards
The seed of multiple system's selfing, what is left is all hybrid seeding F1 generation.
The maximum difficult point that the rice mechanization production of hybrid seeds at present faces is how the hybrid tied on sterile line is received with together using
The restorer seed of cutting mill harvest separates exactly.The method of the present invention is used to be carried to solve this problem in the mechanical production of hybrid seeds
For effective means, mechanism seed production efficiency and seed purity are greatly improved.
Sequence table
SEQ ID NO.1：
gctgctgtgcgccgggctga
SEQ ID NO.2：
cgcggcggcgtcctggggct
SEQ ID NO.3：
gctgagcttcatctcgccca
SEQ ID NO.4：
5’-atccacctgcctaatctgaaag-3’
SEQ ID NO.5：
5’-agttgagcacctcctccgtct-3’
SEQ ID NO.6：
aatccacctgcctaatctgaaagttgtcacgtcttaaaaagattaaaatatttggttagtgagatggtaagaaacta
gtaaaaaaagtaatgaatttgtgtgcaggaagtttgtggtgaagatcccggcggggctagcgccggagcagg
cggcgccgctgctgtgcgccgggctgacggtgtacagcccactgaagcacttcgggctgatgtcgccaggt
ctccgcggcggcgtcctggggctcggcggcgtggggcacatgggcgtgaaggtggccaagtcgatgggg
caccacgtgacggtgatcagctcgtcggcgaggaagcgcggcgaggccatggacgacctgggcgccgac
gcctacctcgtcagctccgacgcggcggcgatggcggccgccggcgactcgctggactacatcatcgacac
cgtgccggtgcaccacccgctggagccgtacctggcgctgctgaagctggacgggaagctgatcctgatgg
gggtgatcaaccagccgctgagcttcatctcgcccatggtgatgctcggccggaaggccatcaccggcagct
tcatcgggagcatggccgagacggaggaggtgctcaacttctgcgtcgacaaggggctcacctcccagatc
gaggtcgtcaagatggactacgtcaaccaggccctcgagcgcctcgagcgcaacgacgtccgctaccgctt
cgtcgtcgacgtcgccggcagcaacatcgacgacgccgacgcgccgcccgcctga
SEQ ID NO.7：
atgggcagcctcgccgccgagaagaccgtcaccgggtgggccgccagggacgcctccggccacctcacc
ccctacaactacaccctcaggaagactgggcctgaagatgtggtggtgaaggttttgtattgtggtatctgccat
actgacatccaccaggccaagaaccaccttggtgcttccaagtaccccatggtccctggccatgaggtggtcg
gcgaggtggtggaggtcgggccggaggtgaccaagtacagcgccggcgacgtcgtcggcgtcggcgtca
tcgtcggctgctgccgcgagtgccatccgtgcaaggccaatgtggagcagtactgcaacaagaggatttggt
cctacaacgacgtctacaccgacggccggccaacccagggcggcttcgcctccgccatggtcgtcgaccag
aagtttgtggtgaagatcccggcggggctagcgccggagcaggcggcgccgctgctgtgcgccgggctga
cggtgtacagcccactgaagcacttcgggctgatgtcgccaggtctccgcggcggcgtcctggggctcggc
ggcgtggggcacatgggcgtgaaggtggccaagtcgatggggcaccacgtgacggtgatcagctcgtcgg
cgaggaagcgcggcgaggccatggacgacctgggcgccgacgcctacctcgtcagctccgacgcggcgg
cgatggcggccgccggcgactcgctggactacatcatcgacaccgtgccggtgcaccacccgctggagcc
gtacctggcgctgctgaagctggacgggaagctgatcctgatgggggtgatcaaccagccgctgagcttcat
ctcgcccatggtgatgctcggccggaaggccatcaccggcagcttcatcgggagcatggccgagacggag
gaggtgctcaacttctgcgtcgacaaggggctcacctcccagatcgaggtcgtcaagatggactacgtcaac
caggccctcgagcgcctcgagcgcaacgacgtccgctaccgcttcgtcgtcgacgtcgccggcagcaacat
cgacgacgccgacgcgccgcccgcctga
SEQ ID NO.8：
Ttcagaggtctctctcgaactggaatcggcagcaaaggattttttcctgtagttttcccacaaccattttttaccat
ccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccg
aatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagta
ggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacgg
aataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctct
cagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctaga
gcaaactggactgccttatatgcgcgggtgctggcttggctgccgctgctgtgcgccgggctgagttttagag
ctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttca
agagcttggagtggatggtgtgttgcgagacccacgct
SEQ ID NO.9：
5’gcgcggtctctctcgaactggaatcggcagcaaagga 3’
SEQ ID NO.10：
5’tcagcccggcgcacagcagcgaccaatgttgctccctc3’
SEQ ID NO.11：
5’gctgctgtgcgccgggctgagttttagagctagaaatag 3’
SEQ ID NO.12：
5’gcgcggtctcgcaacacaccatccactccaagctc 3’
SEQ ID NO.13：
Ttcagaggtctctgttgaactggaatcggcagcaaaggatgcaagaacgaactaagccggacaaaaaaaaa
aggagcacatatacaaaccggttttattcatgaatggtcacgatggatgatggggctcagacttgagctacgag
gccgcaggcgagagaagcctagtgtgctctctgcttgtttgggccgtaacggaggatacggccgacgagcgt
gtactaccgcgcgggatgccgctgggcgctgcgggggccgttggatggggatcggtgggtcgcgggagc
gttgaggggagacaggtttagtaccacctcgcctaccgaacaatgaagaacccaccttataaccccgcgcgc
tgccgcttgtgttggcggcgtcctggggctcgggttttagagctagaaatagcaagttaaaataaggctagtcc
gttatcaacttgaaaaagtggcaccgagtcggtgctttttttcaagagcttggagtggatggtgttcagcgagac
ccacgct
SEQ ID NO.14：
5’gcgcggtctctgttgaactggaatcggcagcaaagga 3’
SEQ ID NO.15：
5’ccgagccccaggacgccgccaacacaagcggcagcgc 3’
SEQ ID NO.16：
5’ggcggcgtcctggggctcgggttttagagctagaaatag3’
SEQ ID NO.17：
5’gcgcggtctcgctgaacaccatccactccaagctc 3’
SEQ ID NO.18：
ttcagaggtctcttcagaactggaatcggcagcaaaggactcattagcggtatgcatgttggtagaagtcggag
atgtaaataattttcattatataaaaaaggtacttcgagaaaaataaatgcatacgaattaattctttttatgtttt
ttaa accaagtatatagaatttattgatggttaaaatttcaaaaatatgacgagagaaaggttaaacgtacggcat
atac ttctgaacagagagggaatatggggtttttgttgctcccaacaattcttaagcacgtaaaggaaaaaagcac
att atccacattgtacttccagagatatgtacagcattacgtaggtacgttttctttttcttcccggagagatgat
acaat aatcatgtaaacccagaatttaaaaaatattctttactataaaaattttaattagggaacgtattattttt
tacatgaca ccttttgagaaagagggacttgtaatatgggacaaatgaacaatttctaagaaatgggcatatgact
ctcagtac aatggaccaaattccctccagtcggcccagcaatacaaagggaaagaaatgagggggcccacaggcca
cg gcccacttttctccgtggtggggagatccagctagaggtccggcccacaagtggcccttgccccgtgggacg
gtgggattgcagagcgcgtgggcggaaacaacagtttagtaccacctcgctcacgcaacgacgcgaccactt
gcttataagctgctgcgctgaggctcagctgagcttcatctcgcccagttttagagctagaaatagcaagttaaa
ataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttcaagagcttggagtggatggt
gtcggtcgagacccacgct
SEQ ID NO.19：
5’gcgcggtctcttcagaactggaatcggcagcaaagga 3’
SEQ ID NO.20：
5’tgggcgacctcagctgagcctcagcgcagcag 3’
SEQ ID NO.21：
5’gctgagcttcatctcgcccagttttagagctagaaatag 3’
SEQ ID NO.22：
5’gcgcggtctcgaccgacaccatccactccaagctc 3’
SEQ ID NO.23：
gcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaagttataaaaaattaccacatattttt
tttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaataatataatc
tatagt actacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattga
gtatttt gacaacaggactctacagttttatctttttagtgtgcatgtgttctcctttttttttgcaaatagcttc
acctatataata cttcatccattttattagtacatccatttagggtttagggttaatggtttttatagactaattt
ttttagtacatctattttat tctattttagcctctaaattaagaaaactaaaactctattttagtttttttattta
ataatttagatataaaatagaataaa ataaagtgactaaaaattaaacaaataccctttaagaaattaaaaaaact
aaggaaacatttttcttgtttcgagta gataatgccagcctgttaaacgccgtcgacgagtctaacggacaccaac
cagcgaaccagcagcgtcgcgt cgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctc
tcgagagttccgctccac cgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcggcagacgtga
gccggcacggcag gcggcctcctcctcctctcacggcacggcagctacgggggattcctttcccaccgctccttcg
ctttcccttcct cgcccgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggag
cgcacacaca cacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtacgccgctcgtcctcc
ccccccc cccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttca
tgtttgtgtt agatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagac
acgttctgat tgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggat
cgatttcatg attttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgca
cttgtttgtcgggtcat cttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttct
agatcggagtagaattctgttt caaactacctggtggatttattaattttggatctgtatgtgtgtgccatacata
ttcatagttacgaattgaagatgat ggatggaaatatcgatctaggataggtatacatgttgatgcgggttttact
gatgcatatacagagatgctttttgtt cgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttct
agatcggagtagaatactgtttcaaact acctggtgtatttattaattttggaactgtatgtgtgtgtcatacatc
ttcatagttacgagtttaagatggatggaaa tatcgatctaggataggtatacatgttgatgtgggttttactgat
gcatatacatgatggcatatgcagcatctattc atatgctctaaccttgagtacctatctattataataaacaagt
atgttttataattattttgatcttgatatacttggatga tggcatatgcagcagctatatgtggatttttttagcc
ctgccttcatacgctatttatttgcttggtactgtttcttttgtc gatgctcaccctgttgtttggtgttacttct
gcagatggctcctaagaagaagcggaaggttggtattcacgggg tgcctgcggctgacaagaagtactccatcggc
ctcgacatcggcaccaacagcgtcggctgggcggtgatc accgacgagtacaaggtcccgtccaagaagttcaagg
tcctgggcaacaccgaccgccactccatcaagaa gaacctcatcggcgccctcctcttcgactccggcgagacggc
ggaggcgacccgcctcaagcgcaccgcc cgccgccgctacacccgccgcaagaaccgcatctgctacctccaggag
atcttctccaacgagatggcgaa ggtcgacgactccttcttccaccgcctcgaggagtccttcctcgtggaggagg
acaagaagcacgagcgccaccccatcttcggcaacatcgtcgacgaggtcgcctaccacgagaagtaccccactatc
taccaccttcgtaag aagcttgttgactctactgataaggctgatcttcgtctcatctaccttgctctcgctcaca
tgatcaagttccgtggt cacttccttatcgagggtgaccttaaccctgataactccgacgtggacaagctcttcat
ccagctcgtccagacc tacaaccagctcttcgaggagaaccctatcaacgcttccggtgtcgacgctaaggcgatc
ctttccgctaggct ctccaagtccaggcgtctcgagaacctcatcgcccagctccctggtgagaagaagaacggtc
ttttcggtaac ctcatcgctctctccctcggtctgacccctaacttcaagtccaacttcgacctcgctgaggacgc
taagcttcag ctctccaaggatacctacgacgatgatctcgacaacctcctcgctcagattggagatcagtacgct
gatctcttc cttgctgctaagaacctctccgatgctatcctcctttcggatatccttagggttaacactgagatca
ctaaggctcc tctttctgcttccatgatcaagcgctacgacgagcaccaccaggacctcaccctcctcaaggctct
tgttcgtca gcagctccccgagaagtacaaggagatcttcttcgaccagtccaagaacggctacgccggttacatt
gacggt ggagctagccaggaggagttctacaagttcatcaagccaatccttgagaagatggatggtactgaggagc
ttc tcgttaagcttaaccgtgaggacctccttaggaagcagaggactttcgataacggctctatccctcaccagat
c caccttggtgagcttcacgccatccttcgtaggcaggaggacttctaccctttcctcaaggacaaccgtgagaa
gatcgagaagatccttactttccgtattccttactacgttggtcctcttgctcgtggtaactcccgtttcgcttgga
t gactaggaagtccgaggagactatcaccccttggaacttcgaggaggttgttgacaagggtgcttccgccca
gtccttcatcgagcgcatgaccaacttcgacaagaacctccccaacgagaaggtcctccccaagcactccctc
ctctacgagtacttcacggtctacaacgagctcaccaaggtcaagtacgtcaccgagggtatgcgcaagcctg
ccttcctctccggcgagcagaagaaggctatcgttgacctcctcttcaagaccaaccgcaaggtcaccgtcaa
gcagctcaaggaggactacttcaagaagatcgagtgcttcgactccgtcgagatcagcggcgttgaggaccg
tttcaacgcttctctcggtacctaccacgatctcctcaagatcatcaaggacaaggacttcctcgacaacgagg
agaacgaggacatcctcgaggacatcgtcctcactcttactctcttcgaggatagggagatgatcgaggagag
gctcaagacttacgctcatctcttcgatgacaaggttatgaagcagctcaagcgtcgccgttacaccggttggg
gtaggctctcccgcaagctcatcaacggtatcagggataagcagagcggcaagactatcctcgacttcctcaa
gtctgatggtttcgctaacaggaacttcatgcagctcatccacgatgactctcttaccttcaaggaggatattcag
aaggctcaggtgtccggtcagggcgactctctccacgagcacattgctaaccttgctggttcccctgctatcaa
gaagggcatccttcagactgttaaggttgtcgatgagcttgtcaaggttatgggtcgtcacaagcctgagaaca
tcgtcatcgagatggctcgtgagaaccagactacccagaagggtcagaagaactcgagggagcgcatgaag
aggattgaggagggtatcaaggagcttggttctcagatccttaaggagcaccctgtcgagaacacccagctcc
agaacgagaagctctacctctactacctccagaacggtagggatatgtacgttgaccaggagctcgacatcaa
caggctttctgactacgacgtcgaccacattgttcctcagtctttccttaaggatgactccatcgacaacaaggtc
ctcacgaggtccgacaagaacaggggtaagtcggacaacgtcccttccgaggaggttgtcaagaagatgaa
gaactactggaggcagcttctcaacgctaagctcattacccagaggaagttcgacaacctcacgaaggctga
gaggggtggcctttccgagcttgacaaggctggtttcatcaagaggcagcttgttgagacgaggcagattacc
aagcacgttgctcagatcctcgattctaggatgaacaccaagtacgacgagaacgacaagctcatccgcgag
gtcaaggtgatcaccctcaagtccaagctcgtctccgacttccgcaaggacttccagttctacaaggtccgcga
gatcaacaactaccaccacgctcacgatgcttaccttaacgctgtcgttggtaccgctcttatcaagaagtaccc
taagcttgagtccgagttcgtctacggtgactacaaggtctacgacgttcgtaagatgatcgccaagtccgagc
aggagatcggcaaggccaccgccaagtacttcttctactccaacatcatgaacttcttcaagaccgagatcacc
ctcgccaacggcgagatccgcaagcgccctcttatcgagacgaacggtgagactggtgagatcgtttgggac
aagggtcgcgacttcgctactgttcgcaaggtcctttctatgcctcaggttaacatcgtcaagaagaccgaggt
ccagaccggtggcttctccaaggagtctatccttccaaagagaaactcggacaagctcatcgctaggaagaa
ggattgggaccctaagaagtacggtggtttcgactcccctactgtcgcctactccgtcctcgtggtcgccaagg
tggagaagggtaagtcgaagaagctcaagtccgtcaaggagctcctcggcatcaccatcatggagcgctcct
ccttcgagaagaacccgatcgacttcctcgaggccaagggctacaaggaggtcaagaaggacctcatcatca
agctccccaagtactctcttttcgagctcgagaacggtcgtaagaggatgctggcttccgctggtgagctccag
aagggtaacgagcttgctcttccttccaagtacgtgaacttcctctacctcgcctcccactacgagaagctcaag
ggttcccctgaggataacgagcagaagcagctcttcgtggagcagcacaagcactacctcgacgagatcatc
gagcagatctccgagttctccaagcgcgtcatcctcgctgacgctaacctcgacaaggtcctctccgcctaca
acaagcaccgcgacaagcccatccgcgagcaggccgagaacatcatccacctcttcacgctcacgaacctc
ggcgcccctgctgctttcaagtacttcgacaccaccatcgacaggaagcgttacacgtccaccaaggaggttc
tcgacgctactctcatccaccagtccatcaccggtctttacgagactcgtatcgacctttcccagcttggtggtga
taagcgtcctgctgccaccaaaaaggccggacaggctaagaaaaagaagtaggatcctcccgatcgttcaaa
catttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaatt
acg ttaagcatgtaataattaacatgtaatgcatgacgttatttatgaggtgggtttttatgattagagtcccgca
attata catttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatct
atgtt actagatcgggagcaccggtaaggcgcgccgtagtgctcgagagacctctgaagtggccgattcattaatg
c agctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcact
cattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttca
cacaagaaacagctatgaccatgattacgccaagctatttaggtgacactatagaatactcaagctatgcatcaa
gctcaatgggtctagtctgtagatacccatcacactggcgaccgctcgaacatcagtttaaggtttacacctata
aaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgccggggcgacggatggtg
atccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcgggga
tgaaagctggcgcatgatgaccaccgatatggccagtgtgcctgtctccgttatcggggaagaagtggctgat
ctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggcctga
atggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgagcgtgggtctcgcggtatcattg g
Sequence table
<110>Institute of Nuclear and Biotechnology, Sichuan Academy of Agriculture Science
<120>SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application
<130> 20170816
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>" artificial sequence " ()
<400> 1
gctgctgtgc gccgggctga 20
<210> 2
<211> 20
<212> DNA
<213>" artificial sequence " ()
<400> 2
cgcggcggcg tcctggggct 20
<210> 3
<211> 20
<212> DNA
<213>" artificial sequence " ()
<400> 3
gctgagcttc atctcgccca 20
<210> 4
<211> 22
<212> DNA
<213>" artificial sequence " ()
<400> 4
atccacctgc ctaatctgaa ag 22
<210> 5
<211> 21
<212> DNA
<213>" artificial sequence " ()
<400> 5
agttgagcac ctcctccgtc t 21
<210> 6
<211> 769
<212> DNA
<213> Oryza sativa (japonica cultivar-group)
<400> 6
aatccacctg cctaatctga aagttgtcac gtcttaaaaa gattaaaata tttggttagt 60
gagatggtaa gaaactagta aaaaaagtaa tgaatttgtg tgcaggaagt ttgtggtgaa 120
gatcccggcg gggctagcgc cggagcaggc ggcgccgctg ctgtgcgccg ggctgacggt 180
gtacagccca ctgaagcact tcgggctgat gtcgccaggt ctccgcggcg gcgtcctggg 240
gctcggcggc gtggggcaca tgggcgtgaa ggtggccaag tcgatggggc accacgtgac 300
ggtgatcagc tcgtcggcga ggaagcgcgg cgaggccatg gacgacctgg gcgccgacgc 360
ctacctcgtc agctccgacg cggcggcgat ggcggccgcc ggcgactcgc tggactacat 420
catcgacacc gtgccggtgc accacccgct ggagccgtac ctggcgctgc tgaagctgga 480
cgggaagctg atcctgatgg gggtgatcaa ccagccgctg agcttcatct cgcccatggt 540
gatgctcggc cggaaggcca tcaccggcag cttcatcggg agcatggccg agacggagga 600
ggtgctcaac ttctgcgtcg acaaggggct cacctcccag atcgaggtcg tcaagatgga 660
ctacgtcaac caggccctcg agcgcctcga gcgcaacgac gtccgctacc gcttcgtcgt 720
cgacgtcgcc ggcagcaaca tcgacgacgc cgacgcgccg cccgcctga 769
<210> 7
<211> 1092
<212> DNA
<213> Oryza sativa (japonica cultivar-group)
<400> 7
atgggcagcc tcgccgccga gaagaccgtc accgggtggg ccgccaggga cgcctccggc 60
cacctcaccc cctacaacta caccctcagg aagactgggc ctgaagatgt ggtggtgaag 120
gttttgtatt gtggtatctg ccatactgac atccaccagg ccaagaacca ccttggtgct 180
tccaagtacc ccatggtccc tggccatgag gtggtcggcg aggtggtgga ggtcgggccg 240
gaggtgacca agtacagcgc cggcgacgtc gtcggcgtcg gcgtcatcgt cggctgctgc 300
cgcgagtgcc atccgtgcaa ggccaatgtg gagcagtact gcaacaagag gatttggtcc 360
tacaacgacg tctacaccga cggccggcca acccagggcg gcttcgcctc cgccatggtc 420
gtcgaccaga agtttgtggt gaagatcccg gcggggctag cgccggagca ggcggcgccg 480
ctgctgtgcg ccgggctgac ggtgtacagc ccactgaagc acttcgggct gatgtcgcca 540
ggtctccgcg gcggcgtcct ggggctcggc ggcgtggggc acatgggcgt gaaggtggcc 600
aagtcgatgg ggcaccacgt gacggtgatc agctcgtcgg cgaggaagcg cggcgaggcc 660
atggacgacc tgggcgccga cgcctacctc gtcagctccg acgcggcggc gatggcggcc 720
gccggcgact cgctggacta catcatcgac accgtgccgg tgcaccaccc gctggagccg 780
tacctggcgc tgctgaagct ggacgggaag ctgatcctga tgggggtgat caaccagccg 840
ctgagcttca tctcgcccat ggtgatgctc ggccggaagg ccatcaccgg cagcttcatc 900
gggagcatgg ccgagacgga ggaggtgctc aacttctgcg tcgacaaggg gctcacctcc 960
cagatcgagg tcgtcaagat ggactacgtc aaccaggccc tcgagcgcct cgagcgcaac 1020
gacgtccgct accgcttcgt cgtcgacgtc gccggcagca acatcgacga cgccgacgcg 1080
ccgcccgcct ga 1092
<210> 8
<211> 628
<212> DNA
<213> Oryza sativa
<400> 8
ttcagaggtc tctctcgaac tggaatcggc agcaaaggat tttttcctgt agttttccca 60
caaccatttt ttaccatccg aatgatagga taggaaaaat atccaagtga acagtattcc 120
tataaaattc ccgtaaaaag cctgcaatcc gaatgagccc tgaagtctga actagccggt 180
cacctgtaca ggctatcgag atgccataca agagacggta gtaggaacta ggaagacgat 240
ggttgattcg tcaggcgaaa tcgtcgtcct gcagtcgcat ctatgggcct ggacggaata 300
ggggaaaaag ttggccggat aggagggaaa ggcccaggtg cttacgtgcg aggtaggcct 360
gggctctcag cacttcgatt cgttggcacc ggggtaggat gcaatagaga gcaacgttta 420
gtaccacctc gcttagctag agcaaactgg actgccttat atgcgcgggt gctggcttgg 480
ctgccgctgc tgtgcgccgg gctgagtttt agagctagaa atagcaagtt aaaataaggc 540
tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttttttca agagcttgga 600
gtggatggtg tgttgcgaga cccacgct 628
<210> 9
<211> 37
<212> DNA
<213>Artificial sequence ()
<400> 9
gcgcggtctc tctcgaactg gaatcggcag caaagga 37
<210> 10
<211> 38
<212> DNA
<213>Artificial sequence ()
<400> 10
tcagcccggc gcacagcagc gaccaatgtt gctccctc 38
<210> 11
<211> 39
<212> DNA
<213>Artificial sequence ()
<400> 11
gctgctgtgc gccgggctga gttttagagc tagaaatag 39
<210> 12
<211> 35
<212> DNA
<213>Artificial sequence ()
<400> 12
gcgcggtctc gcaacacacc atccactcca agctc 35
<210> 13
<211> 514
<212> DNA
<213>Artificial sequence ()
<400> 13
ttcagaggtc tctgttgaac tggaatcggc agcaaaggat gcaagaacga actaagccgg 60
acaaaaaaaa aaggagcaca tatacaaacc ggttttattc atgaatggtc acgatggatg 120
atggggctca gacttgagct acgaggccgc aggcgagaga agcctagtgt gctctctgct 180
tgtttgggcc gtaacggagg atacggccga cgagcgtgta ctaccgcgcg ggatgccgct 240
gggcgctgcg ggggccgttg gatggggatc ggtgggtcgc gggagcgttg aggggagaca 300
ggtttagtac cacctcgcct accgaacaat gaagaaccca ccttataacc ccgcgcgctg 360
ccgcttgtgt tggcggcgtc ctggggctcg ggttttagag ctagaaatag caagttaaaa 420
taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgcttt ttttcaagag 480
cttggagtgg atggtgttca gcgagaccca cgct 514
<210> 14
<211> 37
<212> DNA
<213>Artificial sequence ()
<400> 14
gcgcggtctc tgttgaactg gaatcggcag caaagga 37
<210> 15
<211> 37
<212> DNA
<213>Artificial sequence ()
<400> 15
ccgagcccca ggacgccgcc aacacaagcg gcagcgc 37
<210> 16
<211> 39
<212> DNA
<213>Artificial sequence ()
<400> 16
ggcggcgtcc tggggctcgg gttttagagc tagaaatag 39
<210> 17
<211> 35
<212> DNA
<213>Artificial sequence ()
<400> 17
gcgcggtctc gctgaacacc atccactcca agctc 35
<210> 18
<211> 923
<212> DNA
<213>Artificial sequence ()
<400> 18
ttcagaggtc tcttcagaac tggaatcggc agcaaaggac tcattagcgg tatgcatgtt 60
ggtagaagtc ggagatgtaa ataattttca ttatataaaa aaggtacttc gagaaaaata 120
aatgcatacg aattaattct ttttatgttt tttaaaccaa gtatatagaa tttattgatg 180
gttaaaattt caaaaatatg acgagagaaa ggttaaacgt acggcatata cttctgaaca 240
gagagggaat atggggtttt tgttgctccc aacaattctt aagcacgtaa aggaaaaaag 300
cacattatcc acattgtact tccagagata tgtacagcat tacgtaggta cgttttcttt 360
ttcttcccgg agagatgata caataatcat gtaaacccag aatttaaaaa atattcttta 420
ctataaaaat tttaattagg gaacgtatta ttttttacat gacacctttt gagaaagagg 480
gacttgtaat atgggacaaa tgaacaattt ctaagaaatg ggcatatgac tctcagtaca 540
atggaccaaa ttccctccag tcggcccagc aatacaaagg gaaagaaatg agggggccca 600
caggccacgg cccacttttc tccgtggtgg ggagatccag ctagaggtcc ggcccacaag 660
tggcccttgc cccgtgggac ggtgggattg cagagcgcgt gggcggaaac aacagtttag 720
taccacctcg ctcacgcaac gacgcgacca cttgcttata agctgctgcg ctgaggctca 780
gctgagcttc atctcgccca gttttagagc tagaaatagc aagttaaaat aaggctagtc 840
cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt tttcaagagc ttggagtgga 900
tggtgtcggt cgagacccac gct 923
<210> 19
<211> 37
<212> DNA
<213>Artificial sequence ()
<400> 19
gcgcggtctc ttcagaactg gaatcggcag caaagga 37
<210> 20
<211> 32
<212> DNA
<213>Artificial sequence ()
<400> 20
tgggcgacct cagctgagcc tcagcgcagc ag 32
<210> 21
<211> 39
<212> DNA
<213>Artificial sequence ()
<400> 21
gctgagcttc atctcgccca gttttagagc tagaaatag 39
<210> 22
<211> 35
<212> DNA
<213>Artificial sequence ()
<400> 22
gcgcggtctc gaccgacacc atccactcca agctc 35
<210> 23
<211> 7176
<212> DNA
<213>Artificial sequence ()
<400> 23
gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta agttataaaa 60
aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta tctttataca 120
tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa tatcagtgtt 180
ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga gtattttgac 240
aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt ttttgcaaat 300
agcttcacct atataatact tcatccattt tattagtaca tccatttagg gtttagggtt 360
aatggttttt atagactaat ttttttagta catctatttt attctatttt agcctctaaa 420
ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata taaaatagaa 480
taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa aactaaggaa 540
acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga cgagtctaac 600
ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga cggcacggca 660
tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg acttgctccg 720
ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac ggcaggcggc 780
ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg ctccttcgct 840
ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt tccccaacct 900
cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac ccgtcggcac 960
ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct tctctagatc 1020
ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt tgtgttagat 1080
ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc tgtacgtcag 1140
acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg atggctctag 1200
ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata gggtttggtt 1260
tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca tcttttcatg 1320
cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct agatcggagt 1380
agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat gtgtgtgcca 1440
tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta ggataggtat 1500
acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc gcttggttgt 1560
gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag aatactgttt 1620
caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata catcttcata 1680
gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg ttgatgtggg 1740
ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct ctaaccttga 1800
gtacctatct attataataa acaagtatgt tttataatta ttttgatctt gatatacttg 1860
gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc atacgctatt 1920
tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg ttacttctgc 1980
agatggctcc taagaagaag cggaaggttg gtattcacgg ggtgcctgcg gctgacaaga 2040
agtactccat cggcctcgac atcggcacca acagcgtcgg ctgggcggtg atcaccgacg 2100
agtacaaggt cccgtccaag aagttcaagg tcctgggcaa caccgaccgc cactccatca 2160
agaagaacct catcggcgcc ctcctcttcg actccggcga gacggcggag gcgacccgcc 2220
tcaagcgcac cgcccgccgc cgctacaccc gccgcaagaa ccgcatctgc tacctccagg 2280
agatcttctc caacgagatg gcgaaggtcg acgactcctt cttccaccgc ctcgaggagt 2340
ccttcctcgt ggaggaggac aagaagcacg agcgccaccc catcttcggc aacatcgtcg 2400
acgaggtcgc ctaccacgag aagtacccca ctatctacca ccttcgtaag aagcttgttg 2460
actctactga taaggctgat cttcgtctca tctaccttgc tctcgctcac atgatcaagt 2520
tccgtggtca cttccttatc gagggtgacc ttaaccctga taactccgac gtggacaagc 2580
tcttcatcca gctcgtccag acctacaacc agctcttcga ggagaaccct atcaacgctt 2640
ccggtgtcga cgctaaggcg atcctttccg ctaggctctc caagtccagg cgtctcgaga 2700
acctcatcgc ccagctccct ggtgagaaga agaacggtct tttcggtaac ctcatcgctc 2760
tctccctcgg tctgacccct aacttcaagt ccaacttcga cctcgctgag gacgctaagc 2820
ttcagctctc caaggatacc tacgacgatg atctcgacaa cctcctcgct cagattggag 2880
atcagtacgc tgatctcttc cttgctgcta agaacctctc cgatgctatc ctcctttcgg 2940
atatccttag ggttaacact gagatcacta aggctcctct ttctgcttcc atgatcaagc 3000
gctacgacga gcaccaccag gacctcaccc tcctcaaggc tcttgttcgt cagcagctcc 3060
ccgagaagta caaggagatc ttcttcgacc agtccaagaa cggctacgcc ggttacattg 3120
acggtggagc tagccaggag gagttctaca agttcatcaa gccaatcctt gagaagatgg 3180
atggtactga ggagcttctc gttaagctta accgtgagga cctccttagg aagcagagga 3240
ctttcgataa cggctctatc cctcaccaga tccaccttgg tgagcttcac gccatccttc 3300
gtaggcagga ggacttctac cctttcctca aggacaaccg tgagaagatc gagaagatcc 3360
ttactttccg tattccttac tacgttggtc ctcttgctcg tggtaactcc cgtttcgctt 3420
ggatgactag gaagtccgag gagactatca ccccttggaa cttcgaggag gttgttgaca 3480
agggtgcttc cgcccagtcc ttcatcgagc gcatgaccaa cttcgacaag aacctcccca 3540
acgagaaggt cctccccaag cactccctcc tctacgagta cttcacggtc tacaacgagc 3600
tcaccaaggt caagtacgtc accgagggta tgcgcaagcc tgccttcctc tccggcgagc 3660
agaagaaggc tatcgttgac ctcctcttca agaccaaccg caaggtcacc gtcaagcagc 3720
tcaaggagga ctacttcaag aagatcgagt gcttcgactc cgtcgagatc agcggcgttg 3780
aggaccgttt caacgcttct ctcggtacct accacgatct cctcaagatc atcaaggaca 3840
aggacttcct cgacaacgag gagaacgagg acatcctcga ggacatcgtc ctcactctta 3900
ctctcttcga ggatagggag atgatcgagg agaggctcaa gacttacgct catctcttcg 3960
atgacaaggt tatgaagcag ctcaagcgtc gccgttacac cggttggggt aggctctccc 4020
gcaagctcat caacggtatc agggataagc agagcggcaa gactatcctc gacttcctca 4080
agtctgatgg tttcgctaac aggaacttca tgcagctcat ccacgatgac tctcttacct 4140
tcaaggagga tattcagaag gctcaggtgt ccggtcaggg cgactctctc cacgagcaca 4200
ttgctaacct tgctggttcc cctgctatca agaagggcat ccttcagact gttaaggttg 4260
tcgatgagct tgtcaaggtt atgggtcgtc acaagcctga gaacatcgtc atcgagatgg 4320
ctcgtgagaa ccagactacc cagaagggtc agaagaactc gagggagcgc atgaagagga 4380
ttgaggaggg tatcaaggag cttggttctc agatccttaa ggagcaccct gtcgagaaca 4440
cccagctcca gaacgagaag ctctacctct actacctcca gaacggtagg gatatgtacg 4500
ttgaccagga gctcgacatc aacaggcttt ctgactacga cgtcgaccac attgttcctc 4560
agtctttcct taaggatgac tccatcgaca acaaggtcct cacgaggtcc gacaagaaca 4620
ggggtaagtc ggacaacgtc ccttccgagg aggttgtcaa gaagatgaag aactactgga 4680
ggcagcttct caacgctaag ctcattaccc agaggaagtt cgacaacctc acgaaggctg 4740
agaggggtgg cctttccgag cttgacaagg ctggtttcat caagaggcag cttgttgaga 4800
cgaggcagat taccaagcac gttgctcaga tcctcgattc taggatgaac accaagtacg 4860
acgagaacga caagctcatc cgcgaggtca aggtgatcac cctcaagtcc aagctcgtct 4920
ccgacttccg caaggacttc cagttctaca aggtccgcga gatcaacaac taccaccacg 4980
ctcacgatgc ttaccttaac gctgtcgttg gtaccgctct tatcaagaag taccctaagc 5040
ttgagtccga gttcgtctac ggtgactaca aggtctacga cgttcgtaag atgatcgcca 5100
agtccgagca ggagatcggc aaggccaccg ccaagtactt cttctactcc aacatcatga 5160
acttcttcaa gaccgagatc accctcgcca acggcgagat ccgcaagcgc cctcttatcg 5220
agacgaacgg tgagactggt gagatcgttt gggacaaggg tcgcgacttc gctactgttc 5280
gcaaggtcct ttctatgcct caggttaaca tcgtcaagaa gaccgaggtc cagaccggtg 5340
gcttctccaa ggagtctatc cttccaaaga gaaactcgga caagctcatc gctaggaaga 5400
aggattggga ccctaagaag tacggtggtt tcgactcccc tactgtcgcc tactccgtcc 5460
tcgtggtcgc caaggtggag aagggtaagt cgaagaagct caagtccgtc aaggagctcc 5520
tcggcatcac catcatggag cgctcctcct tcgagaagaa cccgatcgac ttcctcgagg 5580
ccaagggcta caaggaggtc aagaaggacc tcatcatcaa gctccccaag tactctcttt 5640
tcgagctcga gaacggtcgt aagaggatgc tggcttccgc tggtgagctc cagaagggta 5700
acgagcttgc tcttccttcc aagtacgtga acttcctcta cctcgcctcc cactacgaga 5760
agctcaaggg ttcccctgag gataacgagc agaagcagct cttcgtggag cagcacaagc 5820
actacctcga cgagatcatc gagcagatct ccgagttctc caagcgcgtc atcctcgctg 5880
acgctaacct cgacaaggtc ctctccgcct acaacaagca ccgcgacaag cccatccgcg 5940
agcaggccga gaacatcatc cacctcttca cgctcacgaa cctcggcgcc cctgctgctt 6000
tcaagtactt cgacaccacc atcgacagga agcgttacac gtccaccaag gaggttctcg 6060
acgctactct catccaccag tccatcaccg gtctttacga gactcgtatc gacctttccc 6120
agcttggtgg tgataagcgt cctgctgcca ccaaaaaggc cggacaggct aagaaaaaga 6180
agtaggatcc tcccgatcgt tcaaacattt ggcaataaag tttcttaaga ttgaatcctg 6240
ttgccggtct tgcgatgatt atcatataat ttctgttgaa ttacgttaag catgtaataa 6300
ttaacatgta atgcatgacg ttatttatga ggtgggtttt tatgattaga gtcccgcaat 6360
tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc 6420
gcgcggtgtc atctatgtta ctagatcggg agcaccggta aggcgcgccg tagtgctcga 6480
gagacctctg aagtggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa 6540
agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc 6600
tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca 6660
cacaagaaac agctatgacc atgattacgc caagctattt aggtgacact atagaatact 6720
caagctatgc atcaagctca atgggtctag tctgtagata cccatcacac tggcgaccgc 6780
tcgaacatca gtttaaggtt tacacctata aaagagagag ccgttatcgt ctgtttgtgg 6840
atgtacagag tgatattatt gacacgccgg ggcgacggat ggtgatcccc ctggccagtg 6900
cacgtctgct gtcagataaa gtctcccgtg aactttaccc ggtggtgcat atcggggatg 6960
aaagctggcg catgatgacc accgatatgg ccagtgtgcc tgtctccgtt atcggggaag 7020
aagtggctga tctcagccac cgcgaaaatg acatcaaaaa cgccattaac ctgatgttct 7080
ggggaatata aatgtcaggc ctgaatggcg aatggacgcg ccctgtagcg gcgcattaag 7140
cgcggcgggt gagcgtgggt ctcgcggtat cattgg 7176
Claims (10)
1.sgRNA fragments, it is characterised in that：It is aobvious outside the 5th comprising selectively targeted rice cinnamyl-alcohol dehydrogenase CAD genes
The gRNA of son.
2. sgRNA fragments according to claim 1, it is characterised in that：Including being named as T1, base sequence such as SEQ ID
The sgRNA of NO.1, is named as the sgRNA of T2, base sequence such as SEQ ID NO.2, is named as T3, base sequence such as SEQ ID
The sgRNA of NO.3.
3. include the CRISPR/Cas9 gene editing carriers of the sgRNA fragments described in claim 2.
4. CRISPR/Cas9 gene editings carrier according to claim 3, it is characterised in that：Including by OsU6a promoters
Regulate and control the expression cassette OsU6a of T1 sgRNA fragment expressions::T1, the expression by OsU6b promoter regulation T2 sgRNA fragment expressions
Frame OsU6b::T2, the expression cassette OsU6c by OsU6c promoter regulation T3 sgRNA fragment expressions::T3, by maize ubiquitin
The expression cassette of Ubiqutin promoter regulations Cas9 expression.
5. the construction method of the CRISPR/Cas9 gene editing carriers described in claim 3 or 4, it is characterised in that：It will connect respectively
Connect OsU6a, OsU6b, OsU6c promoter and T1, T2, T3 of Ploy-T terminators are connected into pYLCRISPR/Cas by Bsa I enzymes
9Pubi- H plasmids, structure obtain Pubi::Cas9-OsU6a::T1-OsU6b::T2-OsU6c::T3 expression cassettes, obtain
pYLCRISPR/Pubi::Cas9-OsU6a::T1-OsU6b::T2-OsU6c::T3 edits the final carrier of gene.
6. the CRISPR/Cas9 gene editings carrier described in claim 3 or 4 is specifically being directed to rice cinnamyl-alcohol dehydrogenase gene
Carry out the application of gene editing.
7. application process according to claim 6, it is characterised in that：The carrier built is transferred to Agrobacterium EHA105 to use
In agriculture bacillus mediated rice Nipponbare callus genetic transformation, and induction of callus is obtained into regeneration plant.
8. the CRISPR/Cas9 gene editings carrier described in sgRNA fragments, claim 4 described in claim 1 or 2 is being made
Application in standby bronzing glume character rice material；The bronzing glume character rice material contains or does not contain
SgRNA:Cas9:HPT transgenic fragments.
9. the CRISPR/Cas9 gene editing carriers described in sgRNA fragments, claim 4 described in claim 1 or 2 are in water
Application in the rice machinery production of hybrid seeds.
10. primer combination 1F, 1R for detecting CRISPR/Cas9-CAD genetic recombination, it is characterised in that 1F, 1R base sequence
Row are respectively as shown in SEQ ID NO.4, SEQ ID NO.5.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2017107027390 | 2017-08-16 | ||
| CN201710702739 | 2017-08-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108034656A true CN108034656A (en) | 2018-05-15 |
Family
ID=62094780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711258265.1A Pending CN108034656A (en) | 2017-08-16 | 2017-12-04 | SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108034656A (en) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750063A (en) * | 2019-03-19 | 2019-05-14 | 广西大学 | The CRISPR_Cas9 vector construction of histone deacetylase gene HDA19 a kind of and its application |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| CN110250000A (en) * | 2019-07-31 | 2019-09-20 | 湖南杂交水稻研究中心 | The method for improving rice genetic engineering line with genic sterile seed precision of color separation using recessive glume color trait |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981212A (en) * | 2014-05-16 | 2014-08-13 | 安徽省农业科学院水稻研究所 | Breeding method capable of changing glume color of rice varieties with yellow glume to brownness |
| CN104017821A (en) * | 2014-05-16 | 2014-09-03 | 安徽省农业科学院水稻研究所 | Method for directionally editing chaff-color-determining gene OsCHI for creating brown-chaff rice material |
| CN105063026A (en) * | 2015-07-28 | 2015-11-18 | 华南农业大学 | Rice thousand kernel weight gene TGW6 guided RNA target sequence and application thereof |
| CN105543228A (en) * | 2016-01-25 | 2016-05-04 | 宁夏农林科学院 | Method for transforming rice into fragrant rice rapidly |
-
2017
- 2017-12-04 CN CN201711258265.1A patent/CN108034656A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981212A (en) * | 2014-05-16 | 2014-08-13 | 安徽省农业科学院水稻研究所 | Breeding method capable of changing glume color of rice varieties with yellow glume to brownness |
| CN104017821A (en) * | 2014-05-16 | 2014-09-03 | 安徽省农业科学院水稻研究所 | Method for directionally editing chaff-color-determining gene OsCHI for creating brown-chaff rice material |
| CN105063026A (en) * | 2015-07-28 | 2015-11-18 | 华南农业大学 | Rice thousand kernel weight gene TGW6 guided RNA target sequence and application thereof |
| CN105543228A (en) * | 2016-01-25 | 2016-05-04 | 宁夏农林科学院 | Method for transforming rice into fragrant rice rapidly |
Non-Patent Citations (6)
| Title |
|---|
| HIRANO K 等: "OsCAD2 is the major CAD gene responsible for monolignol biosynthesis in rice culm", 《PLANT CELL REP》 * |
| WANG PING 等: "A single nucleotide mutation in the fourth exon of RBH1 is responsible for brown hull phenotype in rice", 《MOLECULAR BREEDING》 * |
| ZHANG KEWEI 等: "Gold hull and internode2 encodes a primarily multifunctional innamyl-alcohol dehydrogenase In rice", 《PLANT PHYSIOL》 * |
| 李秋圆: "一个水稻金黄色颖壳与节间基因的定位与功能分析", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
| 李远华: "《茶叶生物技术》", 30 June 2017 * |
| 王宏 等: "控制水稻金黄色颖壳与节间基因OsCAD2的图位克隆", 《中国水稻科学》 * |
Cited By (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN109750063A (en) * | 2019-03-19 | 2019-05-14 | 广西大学 | The CRISPR_Cas9 vector construction of histone deacetylase gene HDA19 a kind of and its application |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| CN110250000A (en) * | 2019-07-31 | 2019-09-20 | 湖南杂交水稻研究中心 | The method for improving rice genetic engineering line with genic sterile seed precision of color separation using recessive glume color trait |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108034656A (en) | SgRNA, CRISPR/Cas9 carrier related with rice bronzing glume character, vector construction, application | |
| Sallaud et al. | Highly efficient production and characterization of T-DNA plants for rice (Oryza sativa L.) functional genomics | |
| Che et al. | Developing a rapid and highly efficient cowpea regeneration, transformation and genome editing system using embryonic axis explants | |
| US10856481B2 (en) | Use of genic male sterility gene and mutation thereof in hybridization | |
| Qi et al. | Genome editing enables next-generation hybrid seed production technology | |
| CN108103092A (en) | System and its application for downgrading rice are obtained using CRISPR-Cas systems modification OsHPH genes | |
| CN101374408A (en) | Increased seed size and seed number through transgenic over expression of a growth and/or development related gene during early embryo development | |
| CN111206031A (en) | Nucleic acid sequence for detecting corn plant NAZ-4 and detection method thereof | |
| CN110331161B (en) | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing dominant black glume characters | |
| CN102432679B (en) | Rice extensin OsPEX1 and application thereof | |
| CN111406117A (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof | |
| CN111206047B (en) | OsSWEET13 gene mutant and application thereof in increasing rice yield | |
| Gisler et al. | The role of double‐strand break‐induced allelic homologous recombination in somatic plant cells | |
| CN110250000B (en) | Method for improving color selection precision of rice genetic engineering genic male sterile line seeds by utilizing recessive glume color characters | |
| KR20230163460A (en) | Increased transformability and haploid induction in plants | |
| CN109112158B (en) | Method for creating intelligent sterile line based on toxic detoxification genes | |
| Zhang et al. | A straight‐forward seed production technology system for foxtail millet (Setaria italica) | |
| CN111304241B (en) | Method for improving yield of upland rice by polygene editing | |
| CN110724693B (en) | Method for improving dendrocalamus latiflorus plant type by GRG1 gene and application | |
| CN112680460B (en) | Male sterile gene ZmTGA9 and application thereof in creating male sterile line of corn | |
| CN114350673B (en) | Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof | |
| CN113493803B (en) | Alfalfa CRISPR/Cas9 genome editing system and application thereof | |
| CN112430684B (en) | Nucleic acid sequence for detecting rice plant H23 and detection method thereof | |
| CN109504703B (en) | Method for creating maize dominant nuclear male sterile line by using p5126-ZmMs1D construct and breeding application method thereof | |
| CN112481295A (en) | Transposable element vector and method for obtaining selectable marker-free transgenic offspring thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Pu Zhigang Inventor after: Xiang Xiaoli Inventor after: Hu Binhua Inventor after: Wang Ping Inventor before: Pu Zhigang Inventor before: Xiang Xiaoli Inventor before: Wang Ping |
|
| CB03 | Change of inventor or designer information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180515 |
|
| RJ01 | Rejection of invention patent application after publication |