CN102858985A - Method for genome editing - Google Patents

Abstract

The present invention encompasses a method for creating an animal or cell with at least one chromosomal edit. In particular, the invention relates to the use of targeted zinc finger nucleases to edit chromosomal sequences. The invention further encompasses an animal or a cell created by a method of the invention.

Description

The genome edit methods

The sequence table reference

The paper-copy of sequence table and the computer-reader form of same sequence table invest hereinafter and are incorporated to by reference this paper.According to 37 C.F.R.1.821 (f), the information recorded in computer-reader form is identical with written sequence table.

Invention field

The present invention includes a kind of animal for generation of thering is at least one karyomit(e) editor or the method for cell.Particularly, the present invention relates to edit chromosome sequence with the target Zinc finger nuclease.

Background of invention

Reasonably genome project has huge potentiality in fundamental research, drug discovery and the medicine based on cell.The method that existing target gene knocks out or the locus specificity gene inserts depends on homologous recombination.Yet, in some cell type, the spontaneous restructuring of low ratio has been general genome editor's huge obstacle.The scale of screening operation and required time of separate targets event make us hanging back.Thereby, exist for can promptly in the most cell types high speed, also effectively completing the strong needs of genome editor's technology, in order to greatly reduce integrated engineering work.

Summary of the invention

One aspect of the present invention comprises a kind of for editing the method for chromosome sequence.Described method partly comprise (a) to introduce in the cell that comprises chromosome sequence target sequence at least one code identification chromosome sequence and can the cracking chromosome sequence in the nucleic acid of Zinc finger nuclease of cracking site, with optional (i) at least one donor sequences that comprises the confession integration, the donor polynucleotide of upstream sequence and downstream sequence, wherein the both sides of donor sequences are upstream sequence and downstream sequence, and wherein the either side of upstream sequence and downstream sequence and cracking site has significant sequence identity, or (ii) at least one the exchange polynucleotide, it comprises with the part that is positioned at cracking site of chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes, (b) culturing cell is to allow to express Zinc finger nuclease, so that Zinc finger nuclease is introduced chromosome sequence by double-strand break at cracking site, and wherein double-strand break is by following process reparation: (i) non-homologous end joining repair process, introduce chromosome sequence so that will suddenly change, or optionally (ii) homology mediates repair process, so that be incorporated in chromosome sequence by donor sequences or make turnaround sequence and the exchange of the part of chromosome sequence.

Another aspect of the present invention comprises a kind of non-human animal.Described non-human animal can partly produce by following steps: (a) to introduce in the cell that comprises chromosome sequence target sequence at least one code identification chromosome sequence and can the cracking chromosome sequence in the nucleic acid of Zinc finger nuclease of cracking site, with optional (i) at least one donor sequences that comprises the confession integration, the donor polynucleotide of upstream sequence and downstream sequence, wherein the both sides of donor sequences are upstream sequence and downstream sequence, and wherein the either side of upstream sequence and downstream sequence and cracking site has significant sequence identity, or (ii) at least one the exchange polynucleotide, it comprises with the part that is positioned at cracking site of chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes, (b) culturing cell is to allow to express Zinc finger nuclease, so that Zinc finger nuclease is introduced chromosome sequence by double-strand break at cracking site, and wherein double-strand break is by following process reparation: (i) non-homologous end joining repair process, introduce chromosome sequence so that will suddenly change, or optionally (ii) homology mediates repair process, so that be incorporated in chromosome sequence by donor sequences or make turnaround sequence and the exchange of the part of chromosome sequence.

Another aspect of the present invention comprises a kind of cell.Described cell can partly produce by following steps: (a) to introduce in the cell that comprises chromosome sequence target sequence at least one code identification chromosome sequence and can the cracking chromosome sequence in the nucleic acid of Zinc finger nuclease of cracking site, with optional (i) at least one donor sequences that comprises the confession integration, the donor polynucleotide of upstream sequence and downstream sequence, wherein the both sides of donor sequences are upstream sequence and downstream sequence, and wherein the either side of upstream sequence and downstream sequence and cracking site has significant sequence identity, or (ii) at least one the exchange polynucleotide, it comprises with the part that is positioned at cracking site of chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes, (b) culturing cell is to allow to express Zinc finger nuclease, so that Zinc finger nuclease is introduced chromosome sequence by double-strand break at cracking site, and wherein double-strand break is by following process reparation: (i) non-homologous end joining repair process, introduce chromosome sequence so that will suddenly change, or optionally (ii) homology mediates repair process, so that be incorporated in chromosome sequence by donor sequences or make turnaround sequence and the exchange of the part of chromosome sequence.

Another aspect of the present invention comprises a kind of embryo.Usually, described embryo comprise target sequence at least one code identification chromosome sequence and can the cracking chromosome sequence in the nucleic acid of Zinc finger nuclease of cracking site, with optional (i) at least one donor sequences that comprises the confession integration, the donor polynucleotide of upstream sequence and downstream sequence, wherein the both sides of donor sequences are upstream sequence and downstream sequence, and wherein the either side of upstream sequence and downstream sequence and cracking site has significant sequence identity, or (ii) at least one the exchange polynucleotide, it comprises with the part that is positioned at cracking site of chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes.

Other side of the present invention and repeat to be described below more fully.

The coloured picture reference

Present specification contains at least one the photo made from colour.The copy with photochrome of this public announcement of a patent application will be provided by office when requesting by letter and pay essential cost.

The accompanying drawing summary

Fig. 1 is the schematic diagram of describing the reparation result after double-strand break that target ZFN induces.Bar with shade represents the donor fragment, and the target site of white bars describing Z FN double-strand break.

Fig. 2 is the schematic diagram of describing the structure of RFLP donor plasmid.Shown plasmid and with left side and the right side pcr amplified fragment of integrating the target site homology.Indicated the restriction enzyme for the clone.The left side fragment is used KpnI and NotI or PmeI.The right side fragment is used NotI or PmeI and SacII.

Fig. 3 is the schematic diagram of structure of describing to express the donor plasmid of GFP.The GFP box also is cloned in NotI RFLP donor with the NotI site through pcr amplification from existing plasmid.

Fig. 4 describes to detect that (A) RFLP integrates and restriction enzyme digests and (B) schematic diagram of the method for the integration of GFP expression cassette with pcr amplification.

Fig. 5 is the photographs of the fluorescent dye PCR fragment analyzed on sepharose.Leftmost swimming lane contains DNA ladder shape band (DNA ladder).Swimming lane 1 to 6 contains the PCR fragment of using mouse Mdr1a Auele Specific Primer to increase from whole or a part of mouse blastocyst.Swimming lane 1 and 2 is respectively from 5/6 and 1/6 blastocyst amplification.Swimming lane 3 is from a complete blastocyst.Swimming lane 4 to 6 is respectively from 1/2,1/3 and 1/6 same blastocyst.Swimming lane 7 contains the positive control PCR fragment of use same primers as from extracted mouse toe DNA cloning.

Fig. 6 is the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.Leftmost swimming lane contains DNA ladder shape band.(A) swimming lane 1 to 39 contains use mMdr1a Auele Specific Primer, from microinjection for the ZFN RNA of mouse Mdr1a with the PCR fragment of 37 mice embryonics amplifications of vitro culture thering is the RFLP donor in NotI site, and for a positive control and a negative control of pcr amplification.(B) swimming lane 1 to 39 contains the PCR fragment in (A) after carrying out Surveyor sudden change and detecting test.

Fig. 7 is the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.Far Left and rightmost swimming lane contain DNA ladder shape band.(A) swimming lane contains and uses the mMdr1a Auele Specific Primer, from the PCR fragment of Fig. 6 small mouse embryo amplification, and in the situation that purified pcr product not it is digested with NotI.Fig. 7 B is the long period operation of the same gel in Fig. 7 A.The PCR product of not cutting is about 1.8kb, and is the band of two about 900bp through the product of digestion.

Fig. 8 is the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.Leftmost swimming lane contains DNA ladder shape band.Swimming lane 1 to 6 contains PCR product some PCR fragments from Fig. 7 with NotI digestion after column purification, and column purification in order to can play a role NotI in its optimized buffer liquid.Swimming lane 7 and 8 is with two in the sample of NotI digestion as Fig. 7.This gel shows that the NotI digestion in the PCR reaction is completely.

Fig. 9 is the photographs of the fluorescent dye PCR fragment analyzed on sepharose.Leftmost swimming lane contains DNA ladder shape band.Swimming lane 1 to 5 contains use PXR Auele Specific Primer, from the PCR fragment of 1,1/2,1/6,1/10,1/30 rat blastocyst amplification.Swimming lane 6 is to use same primers as, from the positive control of purified Sprague Dawley genomic dna amplification.

Figure 10 is the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.Far Left and rightmost swimming lane contain DNA ladder shape band.(A) swimming lane contains use PXR Auele Specific Primer, the PCR fragment that the rat embryo of vitro culture increases and digests through NotI from microinjection PXR ZFN mRNA and NotI RFLP donor.(B) swimming lane contain carry out Surveyor sudden change detect after test as the identical PCR fragment in Figure 10 A.

Figure 11 is the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.After the embryo of injection mMdr1a ZFN mRNA and NotI RFLP donor becomes pregnant 12.5 days, 4 swimming lanes from 4 well-developed fetus pcr amplifications.Digest this PCR with NotI.Swimming lane 4 is positive swimming lanes.Swimming lane 5-8 is 4 and ends the decidua of implanting.All four is all negative.

Figure 12 is schematic diagram and the photographs of the fluorescent dye DNA fragmentation analyzed on sepharose.(A) schematic diagram of the position of used primer is shown.Figure (B) and (C) result from primer PF and GR is shown.Figure (D) and (E) result from primer PR+GF is shown.Estimate that clip size is 2.4kb.Two in 40 fetuses are positive for GFP.

Figure 13 is the photographs of the DNA fragmentation analyzed on sepharose.The 13dpc fetus that swimming lane 8 representatives are positive for the NotI site.

Figure 14 has illustrated that measuring institute as Cel-1 surveyor nuclease is detected, the SMAD4 cracking that in people and cat cell, ZFN mediates.G=GFP (there is no the ZFN contrast).Z=SMAD4 ZFN (191160/19159).Arrow indication split product.

Figure 15 describes to determine that the Cel-1 of the SMAD4ZFN activity in the cat embryo measures.

Figure 16 has illustrated the Fel d1 cracking in the AKD cell.The Cel-1 screening of the Fel d1ZFN of chain 1-exons 1 to 17,18 cracking is provided.

Figure 17 has illustrated in the AKD cell by Fel d1ZFN 7, the 9 Fel d1 chain 1-exon 2 cracking of carrying out.

Figure 18 has described the Cel-1 analysis of the Fel d1ZFN of the chain 1-exon 2 in the AKD cell to 12/13 cracking.

Figure 19 has illustrated the cracking to the Fel d1 locus in 17,18 and 12, the 13 cat embryos that carry out by ZFN. Swimming lane 1,2,7 and 8 contains the sample from indivedual blastocysts of the embryo who comes from injection 40ng/ μ LZFN.Swimming lane 3 shows the sample from the embryo's who comes from injection 20ng/ μ LZFN blastocyst.Swimming lane 4,9 and 10 contains the indivedual morular sample from the embryo who comes from injection 40ng/ μ LZFN.Swimming lane 3 shows the morular sample from the embryo who comes from injection 20ng/ μ LZFN.The sample that swimming lane 6 shows from the contrast blastocyst.

Figure 20 is presented at the DNA sequence dna through editor Fel d1 locus that comprises 4541bp disappearance (SEQ ID NO:51) between the district of coding strand 2 and chain 1.

Figure 21 will comprise comparing through editor's Fel d1 locus (indicate with red dotted line, be denoted as " sample 5 ") and the sequence (SEQ ID NO:52) of wild-type Fel d1 locus of 4541bp disappearance.In the sample through editor, the binding site of ZFN 13 is by brachymemma (and the binding site of ZFN 12 lose), but ZFN is complete to 17,18 binding site.

Figure 22 describes the cauxin locus cracking that Procaine esterase cauxin ZFN carries out 17/18 (swimming lane 5) 9/10 (swimming lane 4) and ZFN 1/2 (swimming lane 2), ZFN of passing through in the AKD cell.Swimming lane 1 and 3 contains the sample from contrast (GFP) cell.

The cauxin locus cracking that Figure 23 explanation is carried out 29/30 (swimming lane 2) by cauxin ZFN.Swimming lane 2 contains contrast (GFP) sample.

Figure 24 describes the integration at TUBA1B locus place.(A) be the chromosome sequence (SEQ ID NO:85) that the target area of the integration that supplies allogeneic coding sequence is shown, the schematic diagram of ZFN binding site (yellow sequence), ZFN cleavage site (yellow arrows) and integration site (green arrow) on the karyomit(e) target area.(B) show the design of TUBA1B locus, integration site, SH2 biosensor and successfully integrate the schematic diagram of the protein of expression afterwards.(C) provide wild-type and through the image of the western blotting of integrator cell.

Figure 25 describes and to comprise the figure of donor plasmid that both sides have the SH2 biosensor sequence of the TUBA1A sequence that is positioned at target area.

Differential (DIC) and the fluorescence microscopy images of the cell clone of indivedual separation of Figure 26 Explicit Expression GFP-2xSH2-Grb1-2A protein.Fluoroscopic image illustrates the time course that is exposed to 100ng/mL EGF biosensor transposition afterwards.

Figure 27 describes and to comprise the figure of donor plasmid that both sides have the SH2 biosensor sequence of the ACTB sequence that is positioned at target area.

Figure 28 describes the fluorescence microscopy images of expressing GFP-2xSH2-Grb1-2A (upper figure) and indivedual cell clones that separate of RFP-beta-actin (figure below).Show and be exposed to 100ng/mLEGF time course afterwards.

Figure 29 shows two DNA sequence dnas through editor LRRK2 locus.Top sequence (SEQ ID NO:92) has the 10bp disappearance in the target sequence of exon 30, and below sequence (SEQ ID NO:93) has the 8bp disappearance in the target sequence of exon 30.Exon illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 30 shows two DNA sequence dnas through editor ApoE locus.Top sequence (SEQ ID NO:114) has the 16bp disappearance in the target sequence of exon 2, and below sequence (SEQ ID NO:115) has the 1bp disappearance in the target sequence of exon 2.Exon sequence illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 31 illustrates the DNA sequence dna through editor's leptin gene seat.Show the wherein leptin gene seat district (SEQ ID NO:116) of disappearance 151bp from exons 1 and introne 1.Exon illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 32 provides the DNA sequence dna through editor's app gene seat shown in two animals.(A) the rat app gene seat district (SEQ ID NO:127) of disappearance 292bp from exon 9 is shown.(B) be presented in exon 9 the rat app gene seat district (SEQ ID NO:128) that has the 309bp disappearance.Exon illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 33 shows the DNA sequence dna through editor Rag1 locus in two animals.Top sequence (SEQ ID NO:131) has the 808bp disappearance in exon 2, and below sequence (SEQ ID NO:132) has the 29bp disappearance in exon 2.Exon sequence illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 34 shows the DNA sequence dna through editor Rag2 locus in two animals.Top sequence (SEQ ID NO:133) has the 13bp disappearance in the target sequence of exon 3, and below sequence (SEQ ID NO:134) has the 2bp disappearance in the target sequence of exon 2.Exon sequence illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 35 shows the DNA sequence dna through editor Mdr1a locus in two animals.Top sequence (SEQ ID NO:157) has the 20bp disappearance in exon 7, and below sequence (SEQ ID NO:158) has the 15bp disappearance in exon 7 and 3bp inserts (GCT).Exon sequence illustrates with green; Target sequence shows with yellow, and disappearance illustrates with mazarine.

Figure 36 illustrates knocking out of Mdr1a gene in rat.What show different amounts knocks out the colon lysate of rat and the western blotting of compared with control cells lysate from Mdr1a.Relative position at image left side indication Mdr1a albumen and Actin muscle.

Figure 37 shows the DNA sequence dna through editor Mrp1 locus in two animals.Top sequence (SEQ ID NO:159) has the 43bp disappearance in exon 11, and below sequence (SEQ ID NO:160) has the 14bp disappearance in exon 11.Exon sequence illustrates with green; Target sequence shows with yellow, lacks and illustrates with mazarine; And overlapping between target sequence and exon shows with grey.

Figure 38 illustrates the DNA sequence dna through editor Mrp2 locus.Sequence (SEQ ID NO:161) has the 726bp disappearance in exon 7.Exon illustrates with green; Target sequence shows with yellow, and disappearance illustrates with mazarine.

Figure 39 shows the DNA sequence dna through editor BCRP locus in two animals.(A) be illustrated in exon 7 the rat BCRP locus district (SEQ ID NO:162) that comprises the 588bp disappearance.(B) be presented in exon 7 the rat BCRP locus district (SEQ ID NO:163) that comprises the 696bp disappearance.Exon sequence illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 40 shows that the target site of Mdr1a and two extra gene Jag1 and Notch3 and ZFN confirm.(A) the ZFN target sequence is shown.The ZFN binding site underlines.(B) be illustrated in the NIH3T3 cell result that the sudden change that confirms ZFN mRNA activity detects test.By each ZFN mRNA to cotransfection to the NIH3T3 cell.Transfectional cell is gathered in the crops after 24h.Detect the analysis of experiments genomic dna to detect the NHEJ product of indication ZFN activity with sudden change.M, the PCR molecular weight standard; G ( swimming lane 1,3 and 5): GFP transfection contrast; Z ( swimming lane 2,4 and 6), ZFN transfection sample.Indicate corresponding size that do not cut and band cracking with base pair.

Figure 41 shows that the use sudden change detects the genetically engineered Mdr1a of test for identification source kind animal (founder).Indicate corresponding size that do not cut and band cracking with base pair.The band of cracking shows that there is sudden change in target site.M, the PCR molecular weight standard.1-44,44 cubs of being born from the ovum through injection.The numbering of source kind animal underlines.

Figure 42 shows the amplification of the larger disappearance in the kind animal of Mdr1a source.With the primer that the is positioned at ZFN target site upstream and downstream 800bp place PCR product that increases.Show the larger disappearance in the target gene seat than the remarkable less band of 1.6kb wild-type band.Unidentified four source kind animals in Fig. 7 are underlined.

Figure 43 shows that 44 sudden changes through the Mdr1b site of injection Mdr1a ZFN cub detect the result of test.M, the PCR molecular weight standard; WT, from the toe DNA of the FVB/N mouse of not injecting Mdr1a ZFN; 3T3, through the NIH3T3 cell in contrast of Mdr1a ZFN transfection.

Figure 44 be presented at Mdr1a-/-detect Mdr1a with RT-PCR in mouse to express.(A) be Mdr1a genome around target site and the schematic view illustrating of mRNA structure.Exon is meaned by the hollow rectangle with corresponding numbering.The size meaned with base pair of each exon directly is indicated in below.Intron sequences means with the bar disconnected, and the base pair size below.ZFN target site in exon 7 is indicated with Filled Rectangle.396bp disappearance position in the kind animal #23 of source indicates above intron 6 and exon 7.RT-F and RT-R are the primers in exon 5 and 9 that lays respectively at used in RT-PCR.In the RT reaction, the total RNA of 40ng is as template.By in the situation that exist or do not exist RT to carry out the normalization method that GAPDH increases to confirm to input RNA.

Figure 45 be presented at Mdr1a-/-separate in sample and the material of purifying wild-type size after the band result of separating, then this material is used as the template of nest-type PRC.

Figure 46 illustrates the DNA sequence dna through editor BDNF locus in two animals.Top sequence (SEQ ID NO:211) has the 14bp disappearance in the target sequence of exon 2, and below sequence (SEQ ID NO:212) has the 7bp disappearance in the target sequence of exon 2.Exon illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 47 shows the DNA sequence dna through editor DISC1 locus.Show the rat DISC1 district (SEQ ID NO:225) that exists 20bp to lack in the target sequence of exon 5.Exon illustrates with green; Target site shows with yellow, and disappearance illustrates with mazarine.

Figure 48 illustrates the editor of the p53 locus in rat.Shown that the existence indication p53 gene of split product obtains editor's Cel-1 detection.

Figure 49 illustrates knocking out of p53 gene in rat.Demonstration knocks out kidney (K) and the tenuigenin of liver (L) sample and the western blotting of karyolysis product of (KO 733RP) animal from wild-type (WT 731RP) and p53.Relative position at each image right side indication p53 albumen and Actin muscle.

Describe in detail

The disclosure provides to produce and comprises at least one genetically modified animal through editor's chromosome sequence or the method for zooblast.Through editor's chromosome sequence can (1) through inactivation, (2) modified or (3) comprise integration sequence.The inactivation chromosome sequence through changing so that do not produce functional protein or control sequence is no longer brought into play the function identical with the wild-type control sequence.Thereby the genetically modified animal that comprises the inactivation chromosome sequence can be called as " knocking out " or " conditionality knocks out ".Similarly, the genetically modified animal that comprises integration sequence can be called as " knocking in " or " conditionality is knocked in ".As detailed below, knock in animal and can be the humanization animal.In addition, the genetically modified animal that comprises modified chromosome sequence can comprise target site sudden change or other modification so that produce the protein through changing.Usually edit chromosome sequence by Zinc finger nuclease-mediated process.Briefly, described process comprises by the nucleic acid of at least one coding target Zinc finger nuclease with optionally at least one auxiliary polynucleotide introducing cell.Described method also comprises that incubated cell is allow to express Zinc finger nuclease, wherein by Zinc finger nuclease, introduces the DNA repair process that the double-strand break of targeting staining body sequence mediates by the non-homologous end joining DNA repair process of easily makeing mistakes or homology and repairs.In exemplary embodiment, cell is the embryo.Using the method for target Zinc finger nuclease technical editor chromosome sequence as described herein is rapidly, accurately and efficiently.

In addition, the present invention includes and comprise at least one animal or cell through editor's chromosome sequence.Below more detailed description method of the present invention, animal of the present invention, cell of the present invention and its application.

1. karyomit(e) editor's method

One aspect of the present invention comprises a kind of karyomit(e) editor method.As used herein " karyomit(e) editor " refer to editor's chromosome sequence so that sequence (1) through inactivation, (2) modified or (3) comprise integration sequence.In general, the method of editor's chromosome sequence comprises: (a) to introduce in cell target sequence at least one code identification chromosome sequence and can the cracking chromosome sequence in the nucleic acid of Zinc finger nuclease in site, with optional (i) at least one donor polynucleotide that comprise the sequence that supplies integration, the both sides of described sequence are upstream sequence and downstream sequence, the either side of described upstream sequence and downstream sequence and cracking site has significant sequence identity, or (ii) at least one the exchange polynucleotide, it comprises with the part that is positioned at cracking site of chromosome sequence basically same and further comprise the sequence that at least one Nucleotide changes, (b) culturing cell is to allow to express Zinc finger nuclease, so that Zinc finger nuclease is introduced double-strand break in chromosome sequence, and wherein double-strand break is by following process reparation: (i) non-homologous end joining repair process, introduce chromosome sequence so that will suddenly change, or (ii) homology mediation repair process optionally, so that be incorporated in chromosome sequence by the sequence in the donor polynucleotide or the sequence that makes to exchange in polynucleotide exchanges with the part of chromosome sequence.

Below be described in more detail the integral part of Zinc finger nuclease-mediated editor's chromosome sequence method.

(a) nucleic acid of coding Zinc finger nuclease

Described method partly comprises introduces cell by the nucleic acid of at least one coding Zinc finger nuclease.Generally, Zinc finger nuclease comprises DNA in conjunction with territory (that is, zinc refers to) and cracking territory (that is, nuclease).DNA combination and cracking territory are below described.The nucleic acid of coding Zinc finger nuclease can comprise DNA or RNA.For example, the nucleic acid of coding Zinc finger nuclease can comprise mRNA.When the nucleic acid of coding Zinc finger nuclease comprises mRNA, the mRNA molecule can add cap 5 '.Similarly, when the nucleic acid of coding Zinc finger nuclease comprises mRNA, the mRNA molecule can be through polyadenylation.According to the exemplary nucleic acid of described method be the coding Zinc finger nuclease add cap and polyadenylation mRNA molecule.The method that makes mRNA add cap and polyadenylation is known in the art.

In general, once Zinc finger nuclease of the present invention is introduced cell, just in chromosome sequence, produce double-strand break.In certain embodiments, double-strand break can be repaired so that will suddenly change and introduce in chromosome sequence by the non-homologous end joining repair process of cell.In other embodiments, as described below, edit chromosome sequence with homology mediation repair process.

(i) zinc refers in conjunction with territory

Zinc refers to can be through through engineering approaches to identify and to be incorporated into selected any nucleotide sequence in conjunction with territory.Referring to such as (2002) Nat.Biotechnol.20:135-141 such as Beerli; Pabo etc. (2001) Ann.Rev.Biochem.70:313-340; Isalan etc. (2001) Nat.Biotechnol.19:656-660; Segal etc. (2001) Curr.Opin.Biotechnol.12:632-637; Choo etc. (2000) Curr.Opin.Struct.Biol.10:411-416; Zhang etc. (2000) J.Biol.Chem.275 (43): 33850-33860; Doyon etc. (2008) Nat.Biotechnol.26:702-708; With (2008) Proc.Natl.Acad.Sci.USA 105:5809-5814 such as Santiago.With naturally occurring zinc finger protein matter, compare, through engineering approaches zinc refers to can have novel binding specificity in conjunction with territory.Engineering method includes but not limited to appropriate design and various types of selection.Reasonably design comprises for example using and comprises the database that doublet, triplet and/or tetrad nucleotide sequence and indivedual zinc refer to aminoacid sequence, and one or more aminoacid sequences that wherein each doublet, triplet or tetrad nucleotide sequence refer to zinc in conjunction with specific triplet or tetrad sequence are relevant.Referring to for example United States Patent (USP) the 6th, 453,242 and 6,534, No. 261, its disclosed full content is incorporated herein by reference.For example, at United States Patent (USP) the 6th, the algorithm of describing in 453, No. 242 can be used to design zinc and refers in conjunction with territory with the previously selected sequence of target.Alternative method, also can be used to design zinc such as the appropriate design of using nondegenerate cognizance code table and refer in conjunction with territory with the specific sequence of target (Sera etc. (2002) Biochemistry 41:7074-7081).Disclose and availablely refer to can be found in respectively www.zincfingertools.org and bindr.gdcb.iastate.edu/ZiFiT/ (Mandell etc. (2006) Nuc.Acid Res.34:W516-W523 in conjunction with the instrument based on World Wide Web in territory for the potential target site of identifying DNA sequence dna and design zinc; Sander etc. (2007) Nuc.Acid Res.35:W599-W605) in.

Zinc-finger DNA binding domain can be take identification length as about 3 Nucleotide to about 21 Nucleotide through design, or length approximately 8 to the DNA sequence dnas in about 19 Nucleotide scopes.Usually, the zinc of Zinc finger nuclease disclosed herein refers to that comprising at least three zinc in conjunction with territory refers to cog region (that is, zinc refers to).In one embodiment, zinc refers to that can comprise four zinc in conjunction with territory refers to cog region.In another embodiment, zinc refers to that can comprise five zinc in conjunction with territory refers to cog region.In another embodiment, zinc refers to that can comprise six zinc in conjunction with territory refers to cog region.Zinc refers to can be through design with in conjunction with any suitable target DNA sequence in conjunction with territory.Referring to for example United States Patent (USP) the 6th, 607,882,6,534,261 and 6,453, No. 242, its disclosed full content is incorporated herein by reference.

Select zinc to refer to that the illustrative methods of cog region can comprise phage display and two-hybrid system, and be disclosed in United States Patent (USP) the 5th, 789,538,5,925,523,6,007,988,6,013,453,6,410,248,6,140,466,6,200,759 and 6,242, No. 568 and WO98/37186, WO98/53057, WO00/27878, WO01/88197 and GB2, in 338,237, its full content separately is incorporated herein by reference.In addition, zinc refers to that enhancing in conjunction with the binding specificity in territory for example has been described in WO02/077227.

The zinc of design and structure fusion rotein (with its coded polynucleotide) refer in conjunction with territory and method be those skilled in the art oneself know, and be described in detail in U.S. Patent Application Publication the 20050064474th and No. 20060188987, its full content separately is incorporated herein by reference.Can use suitable connexon sequence (comprising that for example length is five or more amino acid whose connexon) zinc is referred to cog region and/or refer to that zinc finger protein links together more.The unrestricted example that is six or more amino acid whose connexon sequences about length, referring to United States Patent (USP) the 6th, 479,626,6,903,185 and 7,153, No. 949, its disclosed full content is incorporated herein by reference.Zinc as herein described refers to can comprise in conjunction with territory the combination of the suitable connexon between indivedual zinc finger proteins.

In some embodiments, Zinc finger nuclease can further comprise nuclear localization signal or sequence (NLS).NLS contributes to the Zinc finger nuclease targeting proteins to nucleus in order to introduce the aminoacid sequence of double-strand break at chromosomal target sequence place.Nuclear localization signal is well known in the art.Referring to such as (1996) Current Biology 6:1025-1027 such as Makkerh.

(ii) cracking territory

Zinc finger nuclease also comprises the cracking territory.The cracking territory part of Zinc finger nuclease disclosed herein can obtain from any endonuclease or exonuclease.The limiting examples that can produce the endonuclease in cracking territory includes but not limited to restriction endonuclease and homing endonuclease.Referring to for example 2002-2003 Catalog, New England Biolabs, Beverly, Mass.; With (1997) Nucleic Acids Res.25:3379-3388 or www.neb.com such as Belfort.Other enzyme of crack DNA is that oneself knows (for example S1 nuclease, mung-bean nuclease, pancreas DNA enzyme I, micrococcal nuclease, yeast HO endonuclease).Also referring to (volume) Nucleases such as Linn, Cold Spring Harbor Laboratory Press, 1993.One or more sources that can be used as the cracking territory in these enzymes (or its function fragment).

The cracking territory also can derive from enzyme as above or its part that lytic activity needs dimerisation.Cracking may need two Zinc finger nucleases, because each nuclease comprises the dimeric monomer of organized enzyme.In addition, single Zinc finger nuclease can comprise two monomers in order to produce the organized enzyme dimer.As used herein " organized enzyme dimer " be can the cracking nucleic acid molecule the enzyme dimer.Two cracking monomers can derive from identical nucleic acid restriction endonuclease (or its function fragment), or each monomer can derive from different endonucleases (or its function fragment).

When with two cracking monomers, forming the organized enzyme dimer, the recognition site of two Zinc finger nucleases preferably through arranging so that two Zinc finger nucleases with its separately recognition site in conjunction with the cracking monomer is formed in the dimeric dimensional orientation of organized enzyme by for example dimerization in permission cracking monomer each other.Therefore, the proximal of recognition site can be by approximately 5 extremely approximately 18 Nucleotide separations.For example, proximal can be separated by approximately 5,6,7,8,9,10,11,12,13,14,15,16,17 or 18 Nucleotide.Yet, should understand any integer Nucleotide or nucleotide pair and can insert between two recognition sites (for example, approximately 2 to about 50 nucleotide pairs or more).Such as example, the proximal of the recognition site of Zinc finger nuclease can be by 6 Nucleotide separations as described in detail herein.Usually, cracking site is between recognition site.

Limiting acid endo enzyme (restriction enzyme) is present in many species, and can be incorporated into DNA (at the recognition site place) in sequence-specific mode, and the binding site place or near crack DNA.Some restriction enzyme (for example, the IIS type) is at the site crack DNA away from recognition site, and has separable combination and cracking territory.For example, IIS type enzyme FokI is at 9 Nucleotide places of recognition site on a chain apart from it, and in the double-stranded cracking of 13 Nucleotide place catalytic dnas of recognition site on another chain apart from it.Referring to for example United States Patent (USP) the 5th, 356,802,5,436,150 and 5,487, No. 994; And (1992) Proc.Natl.Acad.Sci.USA 89:4275-4279 such as Li; Li etc. (1993) Proc.Natl.Acad.Sci.USA 90:2764-2768; Kim etc. (1994a) Proc.Natl.Acad.Sci.USA 91:883-887; Kim etc. (1994b) J.Biol.Chem.269:31,978-31,982.Therefore, Zinc finger nuclease can comprise cracking territory and one or more can or can the finger in conjunction with territory without the zinc of through engineering approaches through through engineering approaches from least one IIS type restriction enzyme.Exemplary IIS type restriction enzyme is described in for example international publication WO07/014, and in 275, its disclosed full content is incorporated herein by reference.Other restriction enzyme also contains separable combination and cracking territory, and these enzymes are also forgiven in the disclosure.Referring to such as (2003) Nucleic Acids Res.31:418-420 such as Roberts.

The cracking territory is FokI with the exemplary IIS type restriction enzyme separated in conjunction with territory.This certain enzyme has as dimeric activity (Bitinaite etc. (1998) Proc.Natl.Acad.Sci.USA 95:10,570-10,575).Therefore, for the purpose of this disclosure, the part of the FokI enzyme used in Zinc finger nuclease is considered to the cracking monomer.Therefore, for the double-stranded cracking of the target that uses FokI cracking territory, can rebuild the organized enzyme dimer with the Zinc finger nuclease of two each self-contained FokI cracking monomers.In addition, also can use and contain zinc and refer to the single peptide molecule in conjunction with territory and two FokI cracking monomers.

In certain embodiments, the cracking territory can comprise one or more through engineering approaches cracking monomers that reduce to greatest extent or prevent homodimerization, described in No. the 20050064474th, 20060188987 and 20080131962, U.S. Patent Publication for example, its full content separately is incorporated herein by reference.As unrestricted example, the position 446,447,479,483,484,486,487,490,491,496,498,499,500,531,534,537 of FokI and 538 amino-acid residue are all the targets that affects the dimerisation in FokI cracking half territory.The exemplary through engineering approaches cracking monomer that forms the FokI of obligate heterodimer comprises paired monomer, the sudden change that the amino acid residue position 490 that wherein the first cracking monomer comprises FokI and the sudden change at 538 places and the second cracking monomer comprise amino acid residue position 486 and 499 places.

Therefore, in one embodiment, the sudden change at amino acid position 490 places replaces with Lys (K) by Glu (E); The sudden change at amino-acid residue 538 places replaces with Lys (K) by Iso (I); The sudden change at amino-acid residue 486 places replaces with Glu (E) by Gln (Q); And the sudden change at 499 places, position replaces with Lys (K) by Iso (I).Specifically, can prepare by the following method by through engineering approaches cracking monomer: in a cracking monomer, position 490 is sported to K and sports K by 538 from I from E and produce the through engineering approaches cracking monomer that is called " E490K:I538K ", and in another cracking monomer, position 486 is E and sports L by 499 from I and produce the through engineering approaches cracking monomer that is called " Q486E:I499L " from Q-spoiling.Through engineering approaches cracking monomer described above is the obligate heterodimer mutant that abnormal cracking is minimized or eliminates.Through engineering approaches cracking monomer can be used appropriate method, and for example prepared by the site-directed mutagenesis by wild-type cracking monomer (FokI), and as U.S. Patent Publication, No. 20050064474 (referring to embodiment 5) described.

Zinc finger nuclease as above can be through through engineering approaches to integrate target site introducing double-strand break.Double-strand break can integrated target site, or it can reach 1,2,3,4,5,10,15,20,25,30,35,40,45,50,100 or 1000 Nucleotide places away from integration site.In some embodiments, double-strand break can reach 1,2,3,4,5,10,15 or 20 Nucleotide places away from integration site.In other embodiments, double-strand break can reach 10,15,20,25,30,35,40,45 or 50 Nucleotide places away from integration site.In other embodiments, double-strand break can reach 50,100 or 1000 Nucleotide places away from integration site.

(iii) exemplary Zinc finger nuclease

This paper provides identification and is combined in the limiting examples of the Zinc finger nuclease of the target sequence of finding in various animal chromosome sequences.For example, Zinc finger nuclease of the present invention can have the aminoacid sequence same with a sequence at least 80%, described sequence be selected from have be selected from 53,54, the Zinc finger nuclease of the SEQ ID NO of 57-62,69-76,104-113,123-126,147-156,201-210,219-222,223-224,230-233,240-243.In other embodiments, sequence identity can be approximately 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%.

In addition, by being selected from 53, 54, 57-62, 69-76, 104-113, 123-126, 147-156, 201-210, 219-222, 223-224, 230-233, the Zinc finger nuclease of the SEQ ID NO coding of 240-243 can be identified and combination and karyomit(e) SEQ ID NO 55, 56, 63-68, 77-84, 86-91, 94-103, 117-122, 129, 130, 135, 136, 137, 138, 139-146, 164-173, 213-218, 226-229, 234, 235, 236, 237, 238, 239 have at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, the chromosome sequence of 99% or 100% sequence identity.

(iv) other method of targeted cleavage

Any nuclease with the target site in karyomit(e) can be used in method disclosed herein.For example, homing endonuclease and meganuclease have extremely long recognition sequence, and the some of them sequence may occur once according to statistics in the genome of mankind's scale.Replace Zinc finger nuclease or, except Zinc finger nuclease, can carry out chromosomal targeted cleavage with any this type of nuclease with the unique target site in genome.

The limiting examples of homing endonuclease comprises I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-Scell, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII and I-TevIII.The recognition sequence of these enzymes is well known in the art.Also referring to United States Patent (USP) the 5th, 420, No. 032; United States Patent (USP) the 6th, 833, No. 252; Belfort etc. (1997) Nucleic Acids Res.25:3379-3388; Dujon etc. (1989) Gene 82:115-118; Perler etc. (1994) Nucleic Acids Res.22,1125-1127; Jasin (1996) Trends Genet.12:224-228; Gimble etc. (1996) J.Mol.Biol.263:163-180; (1998) J.Mol.Biol.280:345-353 such as Argast and New England Biolabs catalogue.

Although the cracking specificity of most of homing endonucleases is not absolute with respect to its recognition site, described site has sufficient length so that can be by the cell of the single copy containing its recognition site, homing endonuclease being expressed to obtain the genomic single cracking event of each Mammals scale.The specificity of also having reported homing endonuclease and meganuclease can be through through engineering approaches with in conjunction with the non-natural target site.Referring to such as (2002) Molec.Cell 10:895-905 such as Chevalier; Epinat etc. (2003) Nucleic Acids Res.31:2952-2962; Ashworth etc. (2006) Nature 441:656-659; Paques etc. (2007) Current Gene Therapy 7:49-66.

(b) optional exchange polynucleotide

The method of editor's chromosome sequence also can comprise to introducing at least one exchange polynucleotide in cell, and it comprises with the chromosome sequence at cracking site place basically same and further comprise the sequence that at least one specific nucleotide changes.

Generally, the exchange polynucleotide will be DNA.The exchange polynucleotide can be DNA plasmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), virus vector, linear DNA fragment, PCR fragment, naked nucleic acid or the nucleic acid compound with delivery vehicle (such as liposome or poloxamer (poloxamer)).Exemplary exchange polynucleotide can be the DNA plasmid.

Sequence in the exchange polynucleotide is basically consistent with the part that is positioned at cracking site of chromosome sequence.Usually, the sequence identity that the sequence of exchange polynucleotide will be total enough with chromosome sequence is so that two sequences can exchange by homologous recombination.For example, the sequence in the exchange polynucleotide can be same at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with the district of chromosome sequence.

Importantly, the sequence in the exchange polynucleotide comprises at least one specific nucleotide variation with respect to the sequence of corresponding chromosome sequence.For example, specific cryptosystem a the Nucleotide different amino acid that can more become another Nucleotide so that codon is encoded.In one embodiment, the sequence in the exchange polynucleotide can comprise a specific nucleotide variation so that coded protein comprises an amino acid variation.In other embodiments, the sequence of exchange in polynucleotide can comprise that two, three, four or more specific Nucleotide change and change so that coded protein comprises one, two, three, four or more amino acid.In other embodiments, the sequence of exchange in polynucleotide can comprise the disappearance of three Nucleotide or insertion so that do not change the reading frame (and can produce functional protein) that coding is read.Yet expressed protein will comprise the single amino acids disappearance or insert.

Exchange in polynucleotide with a part that is positioned at cracking site chromosome sequence basically the length of same sequence can and will change.Usually, the length of the sequence of exchange in polynucleotide can be at about 25bp to approximately 10, in the 000bp scope.In each embodiment, the length of the sequence of exchange in polynucleotide can be approximately 50,100,200,400,600,800,1000,1200,1400,1600,1800,2000,2200,2400,2600,2800,3000,3200,3400,3600,3800,4000,4200,4400,4600,4800 or 5000bp.In other embodiments, the length of the sequence of exchange in polynucleotide can be approximately 5500,6000,6500,6000,6500,7000,7500,8000,8500,9000,9500 or 10,000bp.

Those skilled in the art can build and exchange as described herein polynucleotide (referring to such as Sambrook etc., 2001 and Ausubel etc., 1996) with the standard recombinant technology of knowing.

In the method for the modification chromosome sequence of above detailed description, the double-strand break of introducing in chromosome sequence by Zinc finger nuclease is repaired via the homologous recombination of utilizing the exchange polynucleotide, so that the sequence in the exchange polynucleotide can exchange with the part of chromosome sequence.Double-strand break have a reparation that helps homologous recombination and fracture.The exchange polynucleotide can be integrated or alternatively, exchange the template that polynucleotide can be used as repairing fracture by entity, cause exchanging sequence information and the exchange of the sequence information in the described part in chromosome sequence in polynucleotide.Therefore, the part of intrinsic staining body sequence is convertible into the sequence of exchange polynucleotide.The Nucleotide changed can the cracking site place or near.In addition, the Nucleotide of variation can be in any position in turnaround sequence.Yet, due to exchange, chromosome sequence is modified.

(c) optional donor polynucleotide

The method of editor's chromosome sequence alternately comprises at least one is comprised for the donor polynucleotide of the sequence of integrating and introduces in cell.The donor polynucleotide comprise at least three components: both sides have upstream sequence and downstream sequence sequence to be integrated, wherein the either side consensus sequence similarity of the integration site in upstream and downstream sequence and karyomit(e).

Generally, the donor polynucleotide are DNA.The donor polynucleotide can be DNA plasmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), virus vector, linear DNA fragment, PCR fragment, naked nucleic acid or the nucleic acid compound with delivery vehicle (such as liposome or poloxamer).Exemplary donor polynucleotide can be the DNA plasmid.

The donor polynucleotide comprise for the sequence of integrating.Can be the endogenous sequence of animal or cell or it can be exogenous sequence for the sequence of integrating.For example, for sequence codified protein or the non-coding RNA (Microrna) integrated.Therefore, for the sequence of integrating, can be operably connected with one or more suitable control sequences.In addition, can provide adjusting function for the sequence of integrating.Therefore, the size for the sequence of integrating can and will change.Usually, can be at an about Nucleotide in millions of Nucleotide scopes for the sequence of integrating.

The donor polynucleotide also are included in the upstream and downstream sequence of sequence both sides to be integrated.Upstream and downstream sequence in selection donor polynucleotide is to promote the restructuring between target chromosome sequence and donor polynucleotide.As used herein upstream sequence refers to the nucleotide sequence with the chromosome sequence consensus sequence similarity of integrating the target site upstream.Similarly, downstream sequence refers to the nucleotide sequence with the chromosome sequence consensus sequence similarity of integrating the target site downstream.Upstream and downstream sequence in the donor polynucleotide can have approximately 75%, 80%, 85%, 90%, 95% or 100% sequence identity with the target chromosome sequence.In other embodiments, the upstream and downstream sequence in the donor polynucleotide can have approximately 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the target chromosome sequence.In exemplary embodiment, the upstream and downstream sequence in the donor polynucleotide can have approximately 99% or 100% sequence identity with the target chromosome sequence.

Upstream or downstream sequence can comprise about 20bp to about 2500bp.In each embodiment, upstream or downstream sequence can comprise approximately 50,100,200,300,400,500,600,700,800,900,1000,1100,1200,1300,1400,1500,1600,1700,1800,1900,2000,2100,2200,2300,2400 or 2500bp.Exemplary upstream or downstream sequence can comprise about 200bp to about 2000bp, about 600bp to about 1000bp, or more specifically about 700bp to about 1000bp.

In some embodiments, the donor polynucleotide can further comprise mark.This type of mark can make the screening targeted integration become and be easier to.The limiting examples of appropriate flags comprises restriction site, fluorescence protein or selective marker.

Those skilled in the art can build as described herein donor polynucleotide (referring to such as Sambrook etc., 2001 and Ausubel etc., 1996) with the standard recombinant technology of knowing.

Above detailed description edit the method for chromosome sequence by integration sequence, the double-strand break of introducing in chromosome sequence by Zinc finger nuclease repairs so that sequence is integrated in karyomit(e) via the homologous recombination of utilizing the donor polynucleotide.Double-strand break have an integration that helps sequence.The donor polynucleotide can be integrated by entity, or alternatively, the donor polynucleotide can be used as repairing the template of fracture, cause in all or part of introducing karyomit(e) of the upstream and downstream sequence of described sequence and donor polynucleotide.Therefore, intrinsic staining body sequence is convertible into the sequence of donor polynucleotide.

(d) nucleic acid is introduced to cell

In order to mediate Zinc finger nuclease genome editor, by the nucleic acid molecule of at least one coding Zinc finger nuclease with optionally at least one exchange polynucleotide or at least one donor polynucleotide introducing cell.Any zooblast that comprises chromosome sequence contained in as used herein term " cell ".In some embodiments, term " cell " can refer to the embryo.At some, in exemplary embodiment, the embryo is the unicellular stage embryo of fertilization.At other, in exemplary embodiment, the embryo can be the embryo in any stage.

The nucleic acid that nucleic acid introduces that transfection, positively charged ion transfection, liposome transfection, tree shaped polymer transfection, heat-shocked transfection, the consideration convey that appropriate method in embryo or cell can comprise microinjection, electroporation, sonoporation, particle bombardment, calcium phosphate mediation dyes, (impalefection), light transfection are paid in magnetic transfection, lipofection, gene, patent strengthens is absorbed, and send via liposome, immunoliposome, virion or artificial virus particle.In one embodiment, nucleic acid can be introduced in the embryo by microinjection.But the nucleic acid microinjection is to embryo's nucleus or tenuigenin.In another embodiment, nucleic acid can dye and introduce in cell by consideration convey.

To encode the therein nucleic acid of Zinc finger nuclease and exchange (or donor) polynucleotide are introduced in the embodiment of embryo or cell, the ratio of exchange (or donor) polynucleotide and the nucleic acid of coding Zinc finger nuclease can approximately 1: 10 to about 10: 1 scopes.In each embodiment, exchange (or donor) polynucleotide can be approximately 1: 10,1: 9,1: 8,1: 7,1: 6,1: 5,1: 4,1: 3,1: 2,1: 1,2: 1,3: 1,4: 1,5: 1,6: 1,7: 1,8: 1,9: 1 or 10: 1 with the ratio of the nucleic acid of coding Zinc finger nuclease.In one embodiment, ratio can be approximately 1: 1.

In the embodiment of the nucleic acid by more than one coding Zinc finger nucleases and choose any one kind of them above exchange (or donor) polynucleotide introducing embryo or cell, nucleic acid can be introduced simultaneously or in succession.For example, coding can be had respectively for the nucleic acid of the specific Zinc finger nuclease of different recognition sequences and optional exchange (or donor) polynucleotide and introduces simultaneously.In addition, the nucleic acid of every kind of coding Zinc finger nuclease and optional exchange (or donor) polynucleotide can be introduced in succession.

In one embodiment, the nucleic acid molecule of at least one coding Zinc finger nuclease is introduced in cell.In another embodiment, by least 2 kinds, 3 kinds, 4 kinds, more than 5 kinds or 5 kinds, the nucleic acid molecule of coding Zinc finger nuclease is introduced in cell.In each of above embodiment, also can be as mentioned above with about 1: 10 ratio to approximately 10: 1 donors or exchange polynucleotide and Zinc finger nuclease nucleic acid by one or more corresponding donors or exchange polynucleotide introducing cell.

(e) culturing cell

The method of by Zinc finger nuclease-mediated as described herein process, editing chromosome sequence also comprise cultivate comprise introduced nucleic acid cell so that express at least one Zinc finger nuclease.

But the Application standard program is cultivated the cell that comprises introduced nucleic acid so that express Zinc finger nuclease.The standard cell lines culture technique is described in such as (2008) PNAS 105:5809-5814 such as Santiago; Moehle etc. (2007) PNAS 104:3055-3060; Urnov etc. (2005) Nature 435:646-651; With (2007) Nat.Biotechnology 25:1298-1306 such as Lombardo.The method that those skilled in the art will recognize that culturing cell is well known in the art, and can and will depend on cell type or cell species and change.In all cases, can be identified for by conventional optimum seeking method the best technology of particular cell types.

At cell, be in embryo's a embodiment, embryo's (for example,, in cell culture) in vitro cultivates.Generally, at suitable temperature and have in the appropriate culture medium of necessary O2/CO2 ratio one period short period of embryo culture so that express Zinc finger nuclease.Those skilled in the art will recognize that culture condition can and will depend on embryo's species and change.In all cases, can be identified for by conventional optimum seeking method the best culture condition of specific embryo's species.In some cases, clone can derive from embryo's (for example, embryonic stem cell line) of vitro culture.

Preferably, by the uterus that the embryo is transferred to female host, the embryo being cultivated in vivo.In general, female host from the same or analogous species of embryo.Preferably, female host is false pregnancy.The method for preparing the false pregnancy female host is known in the art.In addition, the method embryo is transferred in female host is that oneself knows.The embryo is cultivated in vivo and makes the embryo to grow, and can cause deriving from embryo's animal life birth.This type of animal will comprise the chromosome sequence of upsetting in each cell in its body usually.

After at least one Zinc finger nuclease of cells, can be edited the chromosome sequence of cell.In the situation that comprising expressed Zinc finger nuclease, cell do not comprise exchange (or donor) polynucleotide, the target sequence in Zinc finger nuclease identification, combination and cracking target chromosome sequence.The double-strand break of being introduced by Zinc finger nuclease is repaired by the non-homologous end joining DNA repair process of easily makeing mistakes.Therefore, can in chromosome sequence, introduce the disappearance that causes missense or nonsense mutation or insertion so that make described sequence inactivation.

In the situation that embryo or cell comprise expressed Zinc finger nuclease and exchange (or donor) polynucleotide, the target sequence in Zinc finger nuclease identification, combination and cracking karyomit(e).The double-strand break of being introduced by Zinc finger nuclease is repaired via the homologous recombination with exchange (or donor) polynucleotide, so that the part of chromosome sequence converts the sequence in the exchange polynucleotide to or the sequence in the donor polynucleotide is incorporated in chromosome sequence.Therefore, chromosome sequence is edited.

Genetically modified animal disclosed herein can hybridize to produce comprise more than one through the animal of editor's chromosome sequence or produce about one or more through editor's chromosome sequence, be the animal of isozygotying.Those skilled in the art will recognize that many combinations are possible.In addition, genetically modified animal disclosed herein can be with other animal hybridization combining through editor's chromosome sequence and other genetic background.As limiting examples, suitable genetic background comprises wild-type, produce oneself knows spontaneous mutation, the integration of targeting staining body, non-targeted integration of phenotype etc.

(f) karyomit(e) editor's type

As mentioned above, method of the present invention can be used to (1) makes chromosome sequence inactivation, (2) modify chromosome sequence, or (3) are integrated into sequence in karyomit(e).Each in these purposes discusses in more detail hereinafter.

i makes the sequence inactivation

In one embodiment, can make through editor's chromosome sequence inactivation so that sequence not transcribed, do not produce coded protein, or sequence can not work as wild-type sequence.For example, can make the protein coding sequence inactivation so that do not produce protein.In addition, can make Microrna encoding sequence inactivation so that do not produce Microrna.In addition, can make the control sequence inactivation so that it no longer serves as control sequence.As used herein " control sequence " refers to any nucleotide sequence of realizing the transcribing of nucleotide sequence, translation or accessibility.As unrestricted example, promotor, transcription terminator and enhanser are control sequences.(the chromosome sequence of inactivation can comprise deletion mutantion, lack one or more Nucleotide), insertion mutation (, insert one or more Nucleotide) or nonsense mutation (that is, the single core thuja acid is replaced to another Nucleotide so that introduce terminator codon).In some embodiments, the chromosome sequence of inactivation can be called as " knocking out ".In a repetition of the present invention, " knocking out " animal produced by method of the present invention does not comprise any exogenous sequence.

ii. sequence is modified

In another embodiment, can be modified so that the gene product that its coding changes or the function of sequence are changed through editor's chromosome sequence.The chromosome sequence of coded protein can be modified with comprise at least one Nucleotide through changing so that the codon that comprises the Nucleotide through changing is encoded different amino acid.Therefore, the protein that produces comprises at least one amino acid variation.In addition, protein coding sequence can be modified so that do not change the reading frame of sequence and produce modified protein by inserting or lacking.In this type of embodiment, modified sequence can produce phenotype and change.

In addition, serving as the chromosome sequence of control sequence can be modified.For example, promotor can be modified so that it always has activity or by exogenous signals-modulating.

In another embodiment, the chromosome sequence of at least one coding target protein can be through editor so that change the protein expression pattern.For example, control the control region of protein expression, can change so that excessively produce target protein such as promotor or transcription factor binding site point, or change tissue specificity or the temporal expression of protein, or its combination.

iii. integration sequence

The sequence that through editor's chromosome sequence, can comprise in another embodiment, integration.This type of sequence codified endogenous protein, exogenous or foreign protein matter, wild-type protein, modified protein, fusion rotein, Microrna etc.Integral protein matter encoding sequence can be connected with the reporter gene sequence (the reporter gene sequence can be connected to protein coding sequence at 5 ' or 3 ' end).Integral protein matter encoding sequence also can the control in internal promoter under, can be operatively connected with exogenous promotor, or can be with the endogenous protein encoding sequence at the frame endomixis.In addition, integration sequence can serve as controlling elements.Therefore, integration sequence can be endogenous or ectogenic with respect to cell.The animal that comprises this type of integration sequence or cell can be called as " knocking in ".In a repetition of above embodiment, should understand and not have selective marker.

In certain embodiments, sequence can be through integrating to change the expression pattern of target protein.For example, can produce conditionality and knock out system.

a. conditional mutation

In certain embodiments, sequence can be through editor to change the expression pattern of target protein.For example, can produce conditionality and knock out system.

As used herein " conditionality knocks out " system is with in whole animal, and/or forms contrast in the sequential control mode, the model that wherein expression of nucleic acid molecule in certain organs, tissue or cell type upset.Conditionality knocks out to make can be for example even upsets research gene function can be fatal the time in the integral body of gene.

The unrestricted example that conditionality knocks out system comprises the Cre-lox recombination system.The Cre-lox recombination system comprises the Cre recombinase, but it is the locus specificity DNA recombinase of the nucleotide sequence restructuring between the specific site (lox site) in catalytic nucleic acid molecule.Use this system to be well known in the art with the method that produces sequential and tissue specific expression.Usually, utilize the lox site of side joint target chromosome sequence to produce genetically modified cell.Comprise have with the genetically modified animal of the cell of the target chromosome sequence of lox side joint then can with the genetically modified animal hybridization of another kind at one or more cells Cre recombinase.Then produce and comprise one or more and comprise and the cell of the chromosome sequence of lox side joint and the filial generation animal of one or more cells that comprise the Cre recombinase.In the cell comprised with the chromosome sequence of lox side joint and Cre recombinase, the chromosome sequence with the lox side joint of coding target protein is recombinated, chromosome sequence disappearance or the inversion of the target protein that causes encoding.The expression of can be chronologically and regulating and controlling conditionally the Cre recombinase is carried out chronologically and regulation and control with good conditionsi the restructuring of the chromosome sequence of coding target protein realizing.

a. upset the integration of endogenous gene seat

In another embodiment, method of the present invention can be used for integrating the sudden change that upsets the endogenous gene seat.For example, chromosome sequence can be upset by by exogenous sequence, replacing the endogenous sequence, so that under the control of exogenous sequence in internal promoter.In these embodiments, the endogenous sequence of upsetting will not be expressed, but the exogenous sequence of integrating will be expressed.Exogenous sequence can be the homologue of endogenous sequence.For example, when the endogenous sequence is non-human sequence, exogenous sequence can be the human sequence.In some embodiments, exogenous sequence can be irrelevant with the endogenous sequence of its replacement.For example, the endogenous sequence can replace so that when internal promoter has activity with exogenous mark, and mark is detectable.In some embodiments, but mark can be the enzyme labelling of the detectable signal of magnifying tags.

In addition, in some embodiments, method of the present invention can be used to replace internal promoter or other regulating and controlling sequence with exogenous promotor or regulating and controlling sequence.In these embodiments, with internal promoter or regulating and controlling sequence, form and contrast, the expression pattern of locus will be controlled by exogenous promotor or regulating and controlling sequence.This type of exogenous promotor or regulating and controlling sequence can be the homologue of internal promoter or regulating and controlling sequence.For example, when the endogenous sequence is non-human sequence, exogenous sequence can be the human sequence.In some embodiments, exogenous sequence can be irrelevant with the endogenous sequence of its replacement.

c. the integration of Exogenous Nucleic Acid sequence

In addition, replace upsetting locus, method of the present invention is used in the situation that has or do not exist promotor and exogenous sequence is incorporated in chromosome sequence and does not upset the expression of endogenous gene seat.In some embodiments, this type of integration can be arranged in " SP Safe port " locus, such as the hprt gene seat (or the equivalent in another kind of animal) on the X chromosome in the Rosa26 locus in rat (or the equivalent in another kind of animal) or rat.

In one embodiment, the box that comprises the exogenous promotor be operatively connected with the Exogenous Nucleic Acid sequence can be incorporated in the SP Safe port locus.In certain embodiments, exogenous promotor can be opportunistic.For example, the conditionality promotor can be tissue-specific promoter, organ specific promoters or cell type specificity promotor (such as stem cell promoter, B cell promotor, hair cell promotor etc.) or inducible promoters.As used herein inducible promoters is the activated promotor of tool when having predetermined substance (such as microbiotic, medicine or other exogenous compounds) only.The integration of the box that in some embodiments, comprises the conditionality promotor can be used to the track cells pedigree.

In another embodiment, can integrate the Exogenous Nucleic Acid sequence to serve as the detectable label of specific nucleic acid sequence.

d. humanization

In another embodiment, genetically modified animal can be " humanization " animal of the sequence of the encoding function human protein that comprises at least one chromosomal integration.The functional human proteinoid may not have corresponding lineal homologue in genetically modified animal.In addition, the wild-type animal of generation genetically modified animal can comprise the ortholog thing corresponding with functional human protein.In this case, make the ortholog sequence inactivation in " humanization " animal so that do not produce the endogenous functional protein, and the sequence of " humanization " animal encoding human protein of comprising at least one chromosomal integration.Those skilled in the art will recognize that " humanization " animal can hybridize to produce by making knock-out animal and the animal of knocking in that comprises the chromosomal integration sequence.

(g) a plurality of karyomit(e) editors

The further embodiment of foregoing invention comprises carries out method of the present invention continuously, so that have more than one karyomit(e) editor's cell, is grown.For example, can cultivate the animal that embryo with the first editor comprises the first genome editor with generation.Then the embryo who derives from this animal can be used in method of the present invention to produce the second genome editor.Can repeat identical process with generation there are three kinds, four kinds, five kinds, six kinds, seven kinds, eight kinds, nine kinds, genome editor's embryo more than ten kinds or ten kinds.

In addition, can be by every kind be had for specific more than one Zinc finger nucleases of different editing sites and introduces to make the cell with several genes group editor to be grown simultaneously.Also optionally introduce donor and/or the exchange polynucleotide of respective number.The number of introducing Zinc finger nuclease in cell and optional corresponding donor or exchange polynucleotide can be two kinds, three kinds, four kinds, more than five kinds or five kinds.

II. be derived from the application of method of the present invention

Method of the present invention can be used for producing animal or the cell comprised through editor's chromosome sequence.This type of animal or cell can be used for several different application, comprise that for example research application, domestic animal application, pet application or biomolecules produce application.The limiting examples of this type of application describes in detail in following (a)-(d) part.

(a) research application

In certain embodiments, method of the present invention can be used for producing animal or the cell that can use in the research application.This type of application can comprise disease model, pharmacology model, development model, cell function model and humanized model, its each described in detail hereinafter.

i. disease model

Method of the present invention can be used for producing animal or the cell that can be used as disease model.As used herein " disease " refers to experimenter's disease, illness or indication.For example, in one embodiment, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in the nucleotide sequence of one or more and disease-related.This type of nucleotide sequence codified disease-associated protein sequence or can be the disease-related control sequence.

In one embodiment, the animal produced by method of the present invention or cell can be used for by using normally used tolerance in the research of disease to study the effect of sudden change for animal or cell and disease generation and/or progress.In addition, this type of animal or cell can be used for studying the effect of pharmaceutically active compound for disease.

In another embodiment, the effect that the animal produced by method of the present invention or cell can be used for assessing the latent gene therapeutic strategy.That is to say, coding can be modified so that disease occurs and/or progress is inhibited or reduces with the chromosome sequence of the protein of disease-related.Especially, described method comprises that the chromosome sequence of editor coding and the protein of disease-related is so that can mutagenic protein, and therefore, animal or cell have the reaction of change.Therefore, in some embodiments, genetically modified animal can be compared so that can assess the effect of gene therapy event with the animal of susceptible disease.

In certain embodiments, method of the present invention can be used for producing animal or the cell of the disease model can be used as in Table A listing disease.Comprise the karyomit(e) editor in the gene that this type of animal or cell can be listed at Table A.In another embodiment, method of the present invention can be used for producing animal or the cell of listing the disease model of disease in available tabulation B.This type of animal or cell can comprise the karyomit(e) editor in the gene that table B lists.In table B, six bit digital of the entry back in disease/illness/indication row are OMIM number (the Online Mendelian Inheritance in Man that can obtain on World Wide Web, OMIM (TM) .McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD).Whether the numeral indication sudden change in the parenthesis of each illness title back is by wild type gene is mapped (1), and by disease phenotype itself is mapped (2), or these two kinds of methods (3) are located.For example, " (3) " mean the wild type gene mapping, and displaying occurs suddenling change with the gene that illness interrelates.

Other limiting examples of the disease model produced by method of the present invention comprises Parkinson disease model, the habituation model, inflammatory model, the cardiovascular disorder model, the A Zihaimo disease model, autism pedigree Disorder Model, the macular degeneration model, the schizophrenia model, the tumor suppression model, trinucleotide repeats the illness model, neurotransmission illness model, Secretases associated conditions model, the ALS model, the prion disease model, abc transporter protein associated conditions model and immune deficiency model.Each example discusses in more detail hereinafter.

a. Parkinson's disease

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to Parkinson's disease (PD) is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In some embodiments, protein that can be relevant to PD to one or more codings or the chromosome sequence of control sequence are edited.PD related protein or the control sequence empirical correlation based on PD related protein or control sequence and PD are usually selected.As limiting examples, with respect to the colony of not suffering from PD, production rate or the circulation composition of suffering from the PD related protein in the colony of PD can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.As unrestricted example, the protein relevant to Parkinson's disease includes, but are not limited to alpha-synapse nucleoprotein, DJ-1, LRRK2, PINK1, Parkin, UCHL1, Synphilin-1 and NURR1.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used measure in research PD to study the effect of sudden change for animal and PD development and/or progress.The method of the PD progress of measuring and zoologizeing is well known in the art.In research PD normally used measure can include, without being limited to that amyloid generation or protein aggregation, Dopamine HCL are replied, the generation of nerve degeneration, plastosome correlation function obstacle phenotype, and function, pathology or biochemical measurement.Other related index about PD development or progress comprises coordination, balance, gait, motion infringement, tremble and tic, stiff, hypokinesia and cognitive impairment.Can relatively carry out this type of mensuration with the wild-type littermate.

b. habituation

As used herein habituation is defined as the chronic disease in the related Neurons loop comprised in award in brain, motivation, memory and various brain structure.The specific examples that can experience the handicapped brain structure relevant to the habituation illness comprises volt core, ventral pallidum, dorsal thalamus, prefrontal cortex, striatum, black substance, formatio reticularis pontis, amygdala and ventral tegmental area territory.The dysfunction of these neural circuits can cause various biologies, psychology, social activity and the behavior symptom of habituation.

The biological symptom of habituation can comprise the excessive generation of one or more habituation related proteins or produce not enough; One or more habituation related proteins distributing again in brain; Development tolerance, reverse tolerance or for other variation of the susceptibility of the effect of the neurotransmitter in habituation material or brain; Hypertension; And Withrawal symptom, such as insomnia, be on tenterhooks, poor appetite, depression, weakness, excitability, indignation, misery and serious hope.

The mental symptoms of habituation can be depending on specific habituation material and habituation time length and changes.The unrestricted example of the mental symptoms of habituation comprises anxious state of mind, vain hope, insomnia, psychosis, schizophrenia, tachycardia panic attack, cognitive impairment and can cause the sharply personality of aggressiveness, mandatory, crime and/or irregular behavior to change.

The social symptom of habituation can comprise feel oneself inferior, the ignorant of speech hostility, intercourse Method, specific anxiety such as anthropophobia, rigid interpersonal behavior, behavior is very strange, converse and the understanding of the major issue of individual behavior and interpersonal relation reduces.

The unrestricted example of the behavior symptom of habituation comprises that behavior is controlled infringement, can not be given up all the time the circulation of using habituation material, recurrence and alleviation, risk taking behavior, look for distractions behavior, the behavior of looking for novelty of hunting for novelty, find the amusement behavior and find the award behavior.

Habituation can be usually relevant to taking in habituation material substance addiction.The habituation material can comprise can cross hemato encephalic barrier the temporary transient material that affects spirit that changes the chemical environment of brain.The unrestricted example of habituation material comprises alcohol; Opioid compounds, such as opium and heroine; Tranquilizer, hypnosis or anxiety compound, such as benzene phenodiazine and barbituric acid salt compound; Cocaine and related compound; Hemp and related compound; Amphetamine and Amphetamine sample compound; The fantasy compound; Inhalation, such as jelly or aerosol propellant; Phencyclidine or phencyclidine sample compound; And nicotine.In addition, habituation can be to and the behavior habituation that is associated of immaterial relevant impulsion, such as problem gambling and computer habituation.

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein the relevant chromosome sequence of at least one habituation is edited.Suitable editor can include but not limited to the editing type described in detail in above part I (f).

The habituation associated nucleic acid sequences be one group from easy development habituation, the different sequences that habituation, habituation seriousness or its any combination are relevant appear.The habituation associated nucleic acid sequences empirical correlation based on habituation associated nucleic acid sequences and habituation illness is usually selected.Habituation associated nucleic acid sequences codified habituation related protein or can be habituation relevant control sequence.As unrestricted example, with respect to the colony that there is no the habituation illness, in the colony of suffering from the habituation illness, the production rate of habituation related protein or circulation composition can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of habituation related protein comprises ABAT (4-Aminobutanoicacid transaminase); ACN9 (ACN9 homologue (yeast saccharomyces cerevisiae)); ADCYAP1 (adenylate cyclase activated polypeptides 1); ADH1B (alcoholdehydrogenase IB (I class), beta polypeptides); ADH1C (alcoholdehydrogenase 1C (I class), γ polypeptide); ADH4 (alcoholdehydrogenase 4); ADH7 (alcoholdehydrogenase 7 (IV class), μ or σ polypeptide); ADORA1 (adenosine A 1 receptor); ADRA1A (suprarenin, α-1A-, acceptor); ALDH2 (aldehyde dehydrogenase 2 families); ANKK1 (ankyrin repeat, TaqIA1 allelotrope); ARC (activity regulation cytoskeleton related protein matter); ATF2 (corticotropin releasing factor(CRF)); AVPR1A (arginine vasopressin acceptor 1); BDNF (Brain Derived Neurotrophic Factor); BMAL1 (aromatic hydrocarbon receptor importin sample); CDK5 (cyclin dependent kinase 5); CHRM2 (cholinergic receptor, muscarine 2); CHRNA3 (α 3 for cholinergic receptor, nicotine); CHRNA4 (α 4 for cholinergic receptor, nicotine); CHRNA5 (α 5 for cholinergic receptor, nicotine); CHRNA7 (α 7 for cholinergic receptor, nicotine); CHRNB2 (β 2 for cholinergic receptor, nicotine); CLOCK (Clock homologue (mouse)); CNR1 (cannabinoid receptors 1); CNR2 (cannabinoid receptors type 2); COMT (catechol-O-methyltransferase); CREB1 (cAMP response element Binding Protein 1); CREB2 (activating transcription factor 2); CRHR1 (corticotropin releasing hormone acceptor 1); CRY1 (cryptochrome 1); CSNK1E (Casein kinase 1, ε); CSPG5 (chondroitin sulfate proteoglycan 5); CTNNB1 (catenin (cadherin related protein), β 1,88kDa); DBI (diazepam (diazepam) is in conjunction with supressor); DDN (dendrin); DRD1 (Dopamine Receptors D1); DRD2 (Dopamine Receptors D2); DRD3 (Dopamine Receptors D3); DRD4 (Dopamine Receptors D4); EGR1 (early growth replys 1); ELTD1 (EGF contains spider venom rabphilin Rab and seven-transmembrane territory 1); FAAH (lipid acid amide hydrolysis enzyme); FOSB (FBJ Muridae osteosarcoma virus oncogene homologue); FOSB (FBJ Muridae osteosarcoma virus oncogene homologue B); GABBR2 (γ-aminobutyric acid (GABA) B acceptor, 2); GABRA2 (γ-aminobutyric acid (GABA) A acceptor, α 2); GABRA4 (γ-aminobutyric acid (GABA) acceptor, α 4); GABRA6 (γ-aminobutyric acid (GABA) acceptor, α 6); GABRB3 (γ-aminobutyric acid (GABA) acceptor, α 3); GABRE (γ-aminobutyric acid (GABA) A acceptor, ε); GABRG1 (γ-aminobutyric acid (GABA) A acceptor, γ 1); GAD1 (L-Glutamic decarboxylase 1); GAD2 (L-Glutamic decarboxylase 2); GAL (galanin prepropeptide); GDNF (being derived from the neurotrophic factor of spongiocyte); GRIA1 (glutamate receptor, ionic, AMPA1); GRIA2 (glutamate receptor, ionic, AMPA2); GRIN1 (glutamate receptor, ionic, N-methyl D-Asp salt 1); GRIN2A (glutamate receptor, ionic, N-methyl D-Asp salt 2); GRM2 (glutamate receptor, metabotropic 2, mGluR2); GRM5 (metabotropic glutamate receptor 5); GRM6 (glutamate receptor, metabotropic 6); GRM8 (glutamate receptor, metabotropic 8); HTR1B (serotonin (thrombotonin) acceptor 1B); HTR3A (serotonin (thrombotonin) acceptor 3); IL1 (interleukin 1); IL15 (interleukin 15); IL1A (interleukin 1 α); IL1B (interleukin-1 beta); KCNMA1 (the large electricity of potassium is led the calcium active channel, subfamily M, α member 1); LGALS1 (combination of lectin galactoside, solvable 1); MAOA (monoamine oxidase); MAOB (monoamine oxidase-B); MAPK1 (mitogen activated protein kinase 1); MAPK3 (mitogen activated protein kinase 3); MBP (myelin basic protein); MC2R (melanocyte adrenal cortical hormone receptor type 2); MGLL (monoglyceride lipase); MOBP (myelin be correlated with oligodendrocyte basic protein); NPY (neuropeptide tyrosine); NR4A1 (member 1 for nuclear receptor subfamily 4, group A); NR4A2 (member 2 for nuclear receptor subfamily 4, group A); NRXN1 (neuronin 1); NRXN3 (neuronin 3); NTRK2 (neurotrophy Tyrosylprotein kinase, acceptor, type 2); NTRK2 (Tyrosylprotein kinase B neurotrophic factor acceptor); OPRD1 (δ-opioid receptor); OPRK1 (κ-opioid receptor); OPRM1 (μ-opioid receptor); PDYN (dynorphin); PENK (enkephalin); PER2 (cycle homologue 2 (fruit bat)); PKNOX2 (PBX/ have joint 1 with source capsule 2); PLP1 (proteolipid protein matter 1); POMC (proopiomelanocortin); PRKCE (protein kinase C, ε); PROKR2 (front dynein receptor 2); RGS9 (regulatory factor 9 of G protein signal transduction); RIMS2 (regulation and control synaptic membrane exocytosis 2); SCN9A (the valtage-gated type I X alpha subunit in sodium channel); SLC17A6 (solute carrier family 17 (sodium rely on inorganic phosphoric acid ester cotransport body), the member 6); SLC17A7 (solute carrier family 17 (sodium rely on inorganic phosphoric acid ester cotransport body), the member 7); SLC1A2 (solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 2); SLC1A3 (solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 3); SLC29A1 (solute carrier family 29 (nucleoside transporting body), the member 1); SLC4A7 (member 7 for solute carrier family 4, the sodium bicarbonate body that cotransports); SLC6A3 (solute carrier family 6 (neurotransmitter transporter, Dopamine HCL), the member 3); SLC6A4 (solute carrier family 6 (neurotransmitter transporter, thrombotonin), the member 4); SNCA (synapse nucleoprotein, α (the non-A4 component of amyloid precursor)); TFAP2B (transcription factor AP-1-2 β); And TRPV1 (member 1 for transient receptor potential cationic channel, subfamily V).

Preferably the habituation related protein can comprise ABAT (4-Aminobutanoicacid transaminase), DRD2 (Dopamine Receptors D2), DRD3 (Dopamine Receptors D3), DRD4 (Dopamine Receptors D4), GRIA1 (glutamate receptor, ionic, AMPA 1), GRIA2 (glutamate receptor, ionic, AMPA 2), GRIN1 (glutamate receptor, ionic, N-methyl D-Asp 1), GRIN2A (glutamate receptor, ionic, N-methyl D-Asp 2A), GRM5 (metabotropic glutamate receptor 5), HTR1B (serotonin (thrombotonin) acceptor 1B), PDYN (dynorphin), PRKCE (protein kinase C, ε), LGALS1 (lectin galactoside combination, solvable 1), TRPV1 (transition receptor potential cationic channel subfamily V member 1), SCN9A (the valtage-gated type I X alpha subunit in sodium channel), OPRD1 (opioid receptor δ 1), OPRK1 (opioid receptor κ 1), OPRM1 (opioid receptor μ 1) and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used as the model of habituation illness indication, and to be the observed value of the mensuration by obtaining from the genetically modified animal through editor's chromosome sequence that comprises at least one coding habituation related protein relatively carry out with the observed value of mensuration with the wild-type animal for this.Comprise that for assessment of the unrestricted example of the mensuration of habituation illness indication behavior determination, physiological measurement, whole animal mensuration, tissue test, raji cell assay Raji, biomarker measure and combination.But the naturally-occurring of habituation illness indication, or can promote by being exposed to exogenous material (such as habituation material or habituation related protein).In addition, habituation illness indication can be induced by giving up habituation material or other compound (the habituation related protein of using such as external source).

Another aspect of the present disclosure comprises the method for the effect of the treatment of assessing the Addictive Behaviors that comprises at least one genetically modified animal through editor chromosome sequence relevant to habituation for inhibition and/or reducing its Withrawal symptom.Appreciable addiction therapy comprises novel combination, novel method for the treatment of and its any combination of using one or more candidate new treatment compounds, determining the treatment compound.Novel method for the treatment of can comprise nanotechnology application, surgical operation and the combination thereof in various drug delivery mechanisms, pharmacotherapy.

The performance testing that comprises at least one genetically modified animal through editor's habituation related protein and/or wild-type animal can be used to the side effect of assessment treatment compound or therapeutic combination.Genetically modified animal and optionally the wild-type animal can and stand performance testing with the treatment for the treatment of compound or therapeutic combination.Performance testing can be assessed behavior, includes but not limited to study, memory, anxiety, depression, habituation and sensation-motor function.

Another aspect provides the method for the treatment potentiality of assessment medicament in animal, it can comprise the genetically modified animal through editor's chromosome sequence that contact comprises at least one coding habituation related protein, and the result obtained with the wild-type animal that never contacts identical medicament with the result that will select parameter relatively.Selected parameter includes but not limited to a) spontaneous behavior; B) performance during performance testing; C) physically different; D) tissue or cell is abnormal; E) biochemical function; And f) molecular structure.

c. inflammation

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to inflammation is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to inflammation.The relevant chromosome sequence of the inflammation empirical correlation based on inflammation correlated series and inflammatory condition is usually selected.Inflammation correlated series codified inflammation related protein or can be inflammation relevant control sequence.For example, with respect to the colony that there is no inflammatory condition, in suffering from the colony of inflammatory condition, the production rate of inflammation related protein or circulation composition can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of the editable inflammation related protein of chromosome sequence comprises the monocyte chemoattractant protein-1 (MCP1) of Ccr2 genes encoding, the C-C Chemokine Receptors type 5 (CCR5) of Ccr5 genes encoding, the IgG receptor II B (FCGR2b is also referred to as CD32) of Fcgr2b genes encoding, Fc ε R1g (FCER1g) protein of Fcer1g genes encoding, the jaw frame N1 transcription factor (FOXN1) of FOXN1 genes encoding, the interferon-γ of IFNg genes encoding (IFN-γ), the interleukin-4 of IL-4 genes encoding (IL-4), the perforin of PRF-1 genes encoding-1, the cyclooxygenase 1 protein (COX1) of COX1 genes encoding, epoxidase 2 protein (COX2) of COX2 genes encoding, T-box transcription factor (TBX21) protein of TBX21 genes encoding, signal transduction amboceptor 1 protein (SH2BPSM1) that contains the SH2-BPH territory of SH2B1 gene (being also referred to as SH2BPSM1) coding, the fibroblast growth factor acceptor 2 of FGFR2 genes encoding (FGFR2) protein, solute carrier family 22 member 1 (SLC22A1) protein of OCT1 gene (being also referred to as SLC22A1) coding, the peroxisome proliferation activated receptor alpha protein of PPARA genes encoding (PPAR-α, be also referred to as nuclear receptor subfamily 1, group C, and the member 1, NR1C1), the Phosphoric acid esterase of PTEN genes encoding and tensin homologue protein (PTEN), the interleukin 1 α of IL-1A genes encoding (IL-1 α), the interleukin-1 beta of IL-1B genes encoding (IL-1 β), the interleukin 6 of IL-6 genes encoding (IL-6), the interleukin 10 of IL-10 genes encoding (IL-10), the interleukin 12 α of IL-12A genes encoding (IL-12 α), the interleukin 12 β of IL-12B genes encoding (IL-12 β), the interleukin-13 of IL-13 genes encoding (IL-13), the IL-17 A of IL-17A genes encoding (IL-17A is also referred to as CTLA8), the IL-17 B (IL-17B) of IL-17B genes encoding, the IL-17 C (IL-17C) of IL-17C genes encoding, the IL-17 D (IL-17D) of IL-17D genes encoding, the IL-17 F (IL-17F) of IL-17F genes encoding, the interleukin 23 of IL-23 genes encoding (IL-23), the chemokine of CX3CR1 genes encoding (C-X3-C motif) acceptor 1 protein (CX3CR1), the chemokine of CX3CL1 genes encoding (C-X3-C motif) ligand 1 protein (CX3CL1), recombination activating gene 1 protein (RAG1) of RAG1 genes encoding, recombination activating gene 2 protein (RAG2) of RAG2 genes encoding, the protein kinase of PRKDC (DNAPK) genes encoding, DNA activating catalytic polypeptide 1 (PRKDC), non-acceptor type 22 protein of the Protein Tyrosine Phosphatases of PTPN22 genes encoding (PTPN22), the tumor necrosis factor alpha of TNFA genes encoding (TNF α), what NOD2 gene (being also referred to as CARD15) was encoded contains Nucleotide in conjunction with 2 protein (NOD2) in oligomerization territory or the cytotoxin T-lymphocyte antigen april protein (CTLA4 is also referred to as CD152) of CTLA4 genes encoding.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used measure in the research inflammation to study the effect of sudden change for animal and inflammation development and/or progress.In addition, the animal that method of the present invention produces can be used for by using normally used measure in the described disease condition of research or illness to study the effect of sudden change for the progress of the disease condition be associated with the inflammation related protein or illness.The unrestricted example of spendable measure comprises biological chemistry or the molecular difference between abnormal and genetically modified animal and the wild-type animal of the spontaneous behavior, the performance during performance testing of genetically modified animal, physically different, different responses for compound, tissue or cell.

d. cardiovascular disorder

Cardiovascular disorder generally includes hypertension, heart attack, heart failure and apoplexy and TIA.In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to cardiovascular disorder is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

The protein that relates to any chromosome sequence of cardiovascular disorder or relate to any chromosome sequence coding of cardiovascular disorder can be used in method of the present invention.Cardiovascular correlated series can be selected based on cardiovascular correlated series and the empirical correlation of development cardiovascular disorder usually.The cardiovascular related protein of cardiovascular associated nucleic acid sequences codified or can be cardiovascular relevant control sequence.For example, with respect to the colony that there is no cardiovascular disorder, in suffering from the colony of cardiovascular disorder, the production rate of cardiovascular related protein or circulation composition can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

For instance, chromosome sequence can include, but are not limited to, and IL1B (interleukin 1, β), XDH (xanthine dehydrogenase), TP53 (oncoprotein matter p53), PTGIS (prostacyclin I2 (prostacyclin) synzyme), MB (myoglobins), IL4 (interleukin-4), ANGPT1 (Ang-1), ABCG8 (ATP is in conjunction with box, subfamily G (WHITE), the member 8), CTSK (cathepsin K), PTGIR (prostacyclin I2 (prostacyclin) acceptor (IP)), KCNJ11 (member 11 for potassium inward rectification passage, subfamily J), INS (insulin), CRP (C reactive protein matter, PTX-3 is relevant), PDGFRB (being derived from hematoblastic growth factor receptors, beta polypeptides), CCNA2 (cyclin A2), PDGFB (being derived from hematoblastic growth factor beta polypeptides (ape sarcoma virus (v-sis) oncogene homologue)), KCNJ5 (member 5 for potassium inward rectification passage, subfamily J), KCNN3 (in potassium/and the small-conductance calcium active channel, subfamily N, the member 3), CAPN10 (calpain 10), PTGES (Prostaglandin E Synthase), ADRA2B (adrenaline, α-2B-, acceptor), ABCG5 (member 5 for ATP-binding cassette, subfamily G (WHITE)), PRDX2 (peroxide oxygen is enzyme 2 also), CAPN5 (calpain 5), PARP14 (poly-(ADP-ribose) polymerase family, the member 14), MEX3C (mex-3 homologue C (Caenorhabditis elegans)), ACE angiotensin I invertase (peptidyl-dipeptidase) 1), TNF (TNF (TNF Superfamily, the member 2)), IL6 (interleukin-6 (interferon, β 2)), STN (his spit of fland), SERPINE1 (member 1 for serpin peptide enzyme inhibition factor, differentiation branch E (connecting albumen, plasminogen activator inhibiting factor Class1)), ALB (albumin), ADIPOQ (adiponectin contains C1Q and collagen territory), APOB (apolipoprotein B (comprising Ag (x) antigen)), APOE (apo E), LEP (leptin), MTHFR (5,10-CH2-THFA reductase (NADPH)), APOA1 (apolipoprotein A-1), EDN1 (Endothelin 1), NPPB (natriuretic peptide (natriuretic peptide) precursor B), NOS3 (nitric oxide synthase 3 (endothelial cell)), PPARG (peroxisome proliferator-activated receptor γ), PLAT (plasminogen activator, tissue), PTGS2 (prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and cyclooxygenase)), CETP (cholesteryl transesterify protein, blood plasma), AGTR1 (angiotensin II acceptor, Class1), HMGCR (3-hydroxy-3-methyl glutaryl-CoA-reductase), IGF1 (type-1 insulin like growth factor (somatomedin C)), SELE (selecting plain E), REN (feritin), PPARA (Peroxisome proliferator activated receptors α), PON1 (PON1), KNG1 (Prokineticin 1), CCL2 (chemotactic factor (CF) (C-C motif) part 2), LPL (lipoprotein lipase), VWF (vWF ELISA), F2 (prothrombin (fibrin ferment)), ICAM1 (ICAM-1), TGFB1 (TGF, β 1), NPPA (natriuretic peptide precursor), IL10 (interleukin 10), EPO (hematopoietin A), SOD1 (superoxide dismutase 1, solvable), VCAM1 (Vcam1), IFNG (interferon, γ), LPA (lipoprotein, Lp (a)), MPO (myeloperoxidase), ESR1 (ERs 1), MAPK1 (mitogen activated protein kinase 1), HP (hoptoglobin), F3 (thromboplastin (factor I, tissue factor)), CST3 (bladder chalone C), COG2 (oligomeric Golgi complex component 2), MMP9 (matrix metal peptase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V clostridiopetidase A)), SERPINC1 (member 1 for serpin peptide enzyme inhibition factor, differentiation branch C (antithrombase)), F8 (blood coagulation factor VIII, short blood coagulation component), HMOX1 (Heme oxygenase (unlinking) 1), APOC3 (apoC-III), IL8 (interleukin 8), PROK1 (front dynein 1), CBS (cystathionine-beta-synthetase), NOS2 (nitric oxide synthase 2 can be induced), TLR4 (Toll sample acceptor 4), SELP (selecting plain P (membrane granulosa protein matter 140kDa, antigens c D62)), ABCA1 (member 1 for ATP-binding cassette, subfamily (ABC1)), AGT (angiotensinogenJiao Ducuojue (member 8 for serpin peptide enzyme inhibition factor, differentiation branch A)), LDLR (low density lipoprotein acceptor), GPT (glutamic-pyruvic transaminase (alanine aminotransferase)), VEGFA (VEGF-A), NR3C2 (member 2 for nuclear receptor subfamily 3, group C), IL18 (interleukin-18 (interferon-γ-inducible factor)), NOS1 (nitric oxide synthase 1 (neuron)), NR3C1 (nuclear receptor subfamily 3, group C, member 1 (GCR)), FGB (fibrinogen β chain), HGF (HGF (HGF A (hepapoietin A), dispersion factor)), IL1A (interleukin 1, α), RETN (phylaxin), AKT1 (v-akt Muridae thymoma Viral Carcinogenesis gene homologue 1), LIPC (lipase, liver), HSPD1 (heat shock 60kDa protein 1 (chaperone)), MAPK14 (mitogen activated protein kinase 14), SPP1 (secretion phosphoprotein 1), ITGB3 (integrin, β 3 (platelet glycoprotein IIIa, antigens c D61)), CAT (catalase), UTS2 (urotensin 2), THBD (thrombomodulin), F10 (Stuart factor), CP (ceruloplasmin (ferrous oxidase)), TNFRSF11B (Tumor Necrosis Factor Receptors Superfamily, member 11b), EDNRA (endothelin receptor type A), EGFR (EGF-R ELISA (EBL virus (v-erb-b) oncogene homologue, birds)), MMP2 (matrix metal peptase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V clostridiopetidase A)), PLG (plasminogen), NPY (neuropeptide tyrosine), RHOD (ras homologue gene family, member D), MAPK8 (mitogen activated protein kinase 8), MYC (v-myc myelocytomatosis Viral Carcinogenesis gene homologue (birds)), FN1 (fibronectin 1), CMA1 (chymotrypsin 1, mast cell), PLAU (plasminogen activator, urokinase), GNB3 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 3), ADRB2 (adrenaline, β-2-, acceptor, surface), APOA5 (aPoA-V), SOD2 (superoxide dismutase 2, mitochondria), F5 (labile factor (labile factor proaccelerin, instability factor)), VDR (vitamin D (1,25-dihydroxyvitamin D3) acceptor), ALOX5 (Arachidonate 5-lipoxygenase), HLA-DRB1 (major histocompatibility complex, class II, DR β 1), PARP1 (poly-(ADP-ribose) polymerase 1), CD40LG (CD40L), PON2 (paraoxonase 2), AGER (terminal glycosylation end product specific receptor), IRS1 (substrate 1), PTGS1 (prostaglandin-endoperoxide synthetase 1 (prostaglandin G/H sythase and cyclooxygenase)), ECE1 (endothelin converting enzyme 1), F7 (proconvertin (convertin)), IL1RN (IL-1 R antagonist), EPHX2 (EH 2, cytoplasm), IGFBP1 (IGFBP-1), MAPK10 (mitogen activated protein kinase 10), FAS (FAS (TNF acceptor Superfamily, the member 6)), ABCB1 (member 1 for ATP-binding cassette, subfamily B (MDR/TAP)), JUN (jun oncogene), IGFBP3 (IBP3), CD14 (CD14 molecule), PDE5A (PDE5, cGMP-specificity), AGTR2 (angiotensin II acceptor, type 2), CD40 (CD40 molecule, TNF acceptor Superfamily member 5), LCAT (lecithin cholesterol acyltransferase), CCR5 (chemotactic factor (CF) (C-C motif) acceptor 5), MMP1 (matrix metal peptase 1 (interstitial collagen enzyme)), TIMP1 (TIMP TIMP metallopeptidase inhibitor 1), ADM (adrenomedulin), DYT10 (dystonia 10), STAT3 (signal transduction and transcription activating body 3 (Acute Phase response factor)), MMP3 (matrix metal peptase 3 (Stromelysin-1, front gelatinase)), ELN (elastin laminin), USF1 (UBF 1), CFH (complement factor H), HSPA4 (heat shock 70kDa protein 4), MMP12 (matrix metal peptase 12 (MMP12)), MME (membrane metallo-endopeptidase), F2R (prothrombin (fibrin ferment) acceptor), SELL (selecting plain L), CTSB (cathepsin B), ANXA5 (annexin A5), ADRB1 (adrenaline, β-1-, acceptor), CYBA (cytochrome b-245, α polypeptide), FGA (fibrinogen α chain), GGT1 (gamma glutamyltransferase 1), LIPG (lipase, endothelium), HIF1A (oxygen deficient induction factor 1, alpha subunit (basic helix-loop-helix transcription factor)), CXCR4 (chemotactic factor (CF) (C-X-C motif) acceptor 4), PROC (protein C (clotting factor inactivator VA and VIIIa)), SCARB1 (scavenger receptor (scavenger receptor) type B, the member 1), CD79A (CD79a molecule, immunoglobulin (Ig) be correlated with α), PLTP (PLTP matter), ADD1 (adducin 1 (α)), FGG (fibrinogen γ chain), SAA1 (Serum Amyloid A 1), KCNH2 (member 2 for potassium voltage-gated channel, subfamily H (eag is relevant)), DPP4 (dipeptidyl peptidase 4), G6PD (G-6-P ester dehydrogenase), NPR1 (natriuratic peptide receptor A/ guanylate cyclase (atrial natriuretic peptide acceptor A)), VTN (vitronectin), KIAA0101 (KIAA0101), FOS (FBJ Muridae osteosarcoma virus oncogene homologue), TLR2 (Toll sample acceptor 2), PPIG (peptide acyl prolyl isomerase G (cyclophilin G)), IL1R1 (interleukin 1 receptor, type I), AR (androgen receptor), CYP1A1 (Cytochrome P450, family 1, subfamily, polypeptide 1), SERPINA1 (member 1 for serpin peptide enzyme inhibition factor, differentiation branch A (α-1 antiprotease, antitrypsin)), MTR (5-methyltetrahydrofolate-homocysteine methyl transferase), RBP4 (RBP ELISA 4, blood plasma), APOA4 (apolipoprotein A-1 V), CDKN2A (cyclin dependent kinase inhibiting factor 2A (melanoma, p16 suppress CDK4)), FGF2 (FGF2 (alkalescence)), EDNRB (endothelin receptor type B), ITGA2 (integrin, α 2 (CD49B, α 2 VLA-2 of subunit acceptors)), CABIN1 (calcineurin Binding Protein 1), SHBG (sex hormone binding globulin), HMGB1 (high fluidity group box 1), HSP90B2P (heat shock protein 90kDa β (Grp94), member 2 (pseudogene)), CYP3A4 (Cytochrome P450, family 3, subfamily, polypeptide 4), GJA1 (gap junction protein, α Isosorbide-5-Nitrae 3kDa), CAV1 (caveolin-1, caveolin matter, 22kDa), ESR2 (estrogen receptor 2 (ER β)), LTA (lymphotoxin α (TNF Superfamily, the member 1)), GDF15 (growth and differentiation factor 15), BDNF (being derived from the neurotrophic factor of brain), CYP2D6 (Cytochrome P450, family 2, subfamily D, polypeptide 6), NGF (nerve growth factor (beta polypeptides)), SP1 (Sp1 transcription factor), TGIF1 (factor that TGFB induces is with source capsule 1), SRC (v-src sarcoma (Schmidt-Ruppin-2) Viral Carcinogenesis gene homologue (birds)), EGF (EGF (β-anthelone)), PIK3CG (phosphoinositide-3-kinases, catalysis, γ polypeptide), HLA-A (major histocompatibility complex, class I), KCNQ1 (member 1 for potassium voltage-gated channel, KQT sample subfamily), CNR1 (Cannabined receptor 1 (brain)), FBN1 (fibrin 1), CHKA (choline kinase α), BEST1 (spot wither albumen 1), APP (amyloid (A4) precursor protein), CTNNB1 (catenin (cadherin related protein), β 1,88kDa), IL2 (interleukin 2), CD36 (CD36 molecule (thrombospondin acceptor)), PRKAB1 (protein kinase, AMP-activation, β 1 on-catalytic subunit), TPO (thyroid peroxidase), ALDH7A1 (aldehyde dehydrogenase 7 families, member A1), CX3CR1 (chemotactic factor (CF) (C-X3-C motif) acceptor 1), TH (tyrosine hydroxylase), F9 (plasma thromboplastin component), GH1 (growth hormone 1), TF (transferrins), HFE (hemochromatosis), IL17A (IL-17), PTEN (phosphatase and tensin homologue), GSTM1 (glutathione S-transferase μ 1), DMD (dystrophin), GATA4 (GATA conjugated protein 4), F13A1 (factor XIII, A1 polypeptide), TTR (transthyretin), FABP4 (FABP4, adipocyte), PON3 (PON3), APOC1 (apoC-I), INSR (insulin receptor), TNFRSF1B (Tumor Necrosis Factor Receptors Superfamily, member 1B), HTR2A (serotonin (thrombocytin) acceptor 2A), CSF3 (colony stimulating factor 3 (granulocyte)), CYP2C9 (Cytochrome P450, family 2, subfamily C, polypeptide 9), TXN (thioredoxin), CYP11B2 (Cytochrome P450, family 11, subfamily B, polypeptide 2), PTH (parathormone), CSF2 (colony stimulating factor 2 (GM)), KDR (kinases inserts domain receptor (type-iii receptor tyrosine kinase)), PLA2G2A (phospholipase A2, group IIA (blood platelet, synovia)), B2M (beta-2-microglobulin), THBS1 (thrombospondin 1), GCG (glucagons), RHOA (ras homologue gene family, member A), ALDH2 (aldehyde dehydrogenase 2 families (mitochondria)), TCF7L2 (transcription factor 7 samples 2 (T-cell-specific, HMG-box)), BDKRB2 (bradykinin acceptor B2), NFE2L2 (nuclear factor (being derived from red blood cell 2) sample 2), NOTCH1 (Notch homologue 1, transposition be correlated with (fruit bat)), UGT1A1 (UDP glucuronyl transferase 1 family, polypeptide A 1), IFNA1 (interferon, α 1), PPARD (peroxisome proliferator-activated receptor δ), SIRT1 (deacetylase (reticent mating type Information Regulating 2 homologues) 1 (saccharomyces cerevisiae)), GNRH1 (gonadotropin-releasing hormone (GRH) 1 (short Luteinizing hormone releasing hormone)), PAPPA (PAPP matter A, pappus element 1), ARR3 (CKIs 3, retina (X-CKIs)), NPPC (natriuretic peptide precursor C), AHSP (hemoglobin alpha stable protein), PTK2 (PTK2 protein tyrosine kinase 2), IL13 (interleukin-13), MTOR (the mechanism target (serine/threonine kinase) of rapamycin), ITGB2 (integrin β 2 (complement component 3 acceptors 3 and 4 subunits)), GSTT1 (glutathione S-transferase θ 1), IL6ST (interleukin-6 signal transduction body (gp130, oncostatinM receptor)), CPB2 (protaminase 2 (blood plasma)), CYP1A2 (Cytochrome P450, family 1, subfamily, polypeptide 2), HNF4A (Hepatocyte nuclear factor 4, α), SLC6A4 (solute carrier family 6 (neurotransmitter transporter, thrombocytin), the member 4), PLA2G6 (phospholipase A2, group VI (cytoplasm, calcium is irrelevant)), TNFSF11 (TNF (part) Superfamily, the member 11), SLC8A1 (solute carrier family 8 (sodium/calcium exchanger), the member 1), F2RL1 (prothrombin (fibrin ferment) acceptor sample 1), AKR1A1 (aldehyde-one reductase family 1, member A1 (aldehyde reductase)), ALDH9A1 (aldehyde dehydrogenase 9 families, member A1), BGLAP (bone Gla (gla) protein), MTTP (microsome triglyceride transferring protein), MTRR (5-methyltetrahydrofolate-homocysteine methyl transferase reductase), SULT1A3 (sulfotransferase family, cytoplasm, 1A, phenol-preferably, the member 3), RAGE (nephroncus antigen), C4B (complement component 4B (Chido blood group), P2RY12 (purinoceptor P2Y, G-albumen coupling, 12), RNLS (kidney enzyme, FAD-relies on amine oxidase), CREB1 (cAMP response element Binding Protein 1), POMC (POMC), RAC1 (ras be correlated with C3 botulin toxin substrate 1 (rho family, little gtp binding protein Rac1)), LMNA (Lamin A/C), CD59 (CD59 molecule, CCP matter), SCN5A (sodium channel, valtage-gated, type V, alpha subunit), CYP1B1 (Cytochrome P450, family 1, subfamily B, polypeptide 1), MIF (macrophage migration inhibitory factor (glycosylation-inhibiting factor)), MMP13 (matrix metal peptase 13 (clostridiopetidase A 3)), TIMP2 (TIMP metallopeptidase inhibiting factor 2), CYP19A1 (Cytochrome P450, family 19, subfamily A, polypeptide 1), CYP21A2 (Cytochrome P450, family 21, subfamily A, polypeptide 2), PTPN22 (protein tyrosine phosphatase, non-acceptor type 22 (lymph)), MYH14 (myosin, heavy chain 14, non-muscle), MBL2 (mannan-binding lectin (protein C) 2, solvable (opsonin defect)), SELPLG (selecting plain P part), AOC3 (amine oxidase, 3 (the blood vessel attachment proteins matter 1) that contain copper), CTSL1 (cathepsin L 1), PCNA (PCNA), IGF2 (IMA-IGF2BP3-001 (SM-A)), ITGB1 (integrin, β 1 (antigens c D29 comprises MDF2, MSK12 for fibronection receptor, beta polypeptides)), CAST (calpastatin), CXCL12 (chemotactic factor (CF) (C-X-C motif) ligand 12 (being derived from the factor 1 of stroma cell)), IGHE (the constant ε of heavy chain immunoglobulin), KCNE1 (member 1 for potassium voltage-gated channel, the Isk family that is correlated with), TFRC (TfR (p90, CD71)), COL1A1 (α 1 for collagen, type I), COL1A2 (α 2 for collagen, type I), IL2RB (Interleukin-2 Receptor, β), PLA2G10 (phospholipase A2, group X), ANGPT2 (ANG2), PROCR (protein C acceptor, endothelium (EPCR)), NOX4 (nadph oxidase 4), HAMP (iron is adjusted plain antibacterial peptide), PTPN11 (protein tyrosine phosphatase, non-acceptor type 11), SLC2A1 (solute carrier family 2 (promotion glucose transporter), the member 1), IL2RA (Interleukin-2 Receptor, α), CCL5 (chemotactic factor (CF) (C-C motif) part 5), IRF1 (interferon regulatory factor 1), CFLAR (CASP8 and FADD like cell apoptotic effector), CALCA (calcitonin related polypeptide α), EIF4E (eukaryotic translation initiation factor 4E), GSTP1 (glutathione S-transferase π 1), JAK2 (Janus kinases 2), CYP3A5 (Cytochrome P450, family 3, subfamily A, polypeptide 5), HSPG2 (Heparan sulfate proteoglycan 2), CCL3 (chemotactic factor (CF) (C-C motif) part 3), MYD88 (marrow differentiation primary response gene (88)), VIP (vasoactive intestinal peptide), SOAT1 (sterol O-acyltransferase 1), ADRBK1 (adrenaline, β, receptor kinase 1), NR4A2 (member 2 for nuclear receptor subfamily 4, group A), MMP8 (matrix metal peptase 8 (neutrophil collagenase)), NPR2 (natriuratic peptide receptor B/ guanylate cyclase B (atrial natriuretic peptide acceptor B)), GCH1 (GTP cyclization hydrolase 1), EPRS (glutamy-prolyl-tRNA synzyme), PPARGC1A (peroxisome proliferator-activated receptor γ, conactivator 1 α), F12 (Hageman factor (the Hageman factor)), PECAM1 (blood platelet/endothelial cell adhesion molecule), CCL4 (chemotactic factor (CF) (C-C motif) part 4), SERPINA3 (member 3 for serpin peptide enzyme inhibition factor, differentiation branch A (α-1 antiprotease, antitrypsin)), CASR (calcium-sensing receptor), GJA5 (gap junction protein, α 5,40kDa), FABP2 (fatty acid binding protein 2, intestines), TTF2 (transcription termination factor, rna plymerase ii), PROS1 (protein s (α)), CTF1 (cardiotrophin research 1), SGCB (sarcoglycan, β (43kDa dystrophin associated glycoprotein)), YME1L1 (YME1 sample 1 (saccharomyces cerevisiae)), CAMP (Ka Telanshi peptide antibacterial peptide), ZC3H12A (containing the 12A that zinc refers to the CCCH type), AKR1B1 (aldehyde-one reductase family 1, member B1 (aldose reductase)), DES (desmin), MMP7 (matrix metal peptase 7 (matrix crack protein (matrilysin), uterus)), AHR (aromatic hydrocarbon receptor), CSF1 (colony-stimulating factor 1 (macrophage)), HDAC9 (histone deacetylase 9), CTGF (CTGF, KCNMA1 (the large electricity of potassium is led calcium-activated passage, subfamily M, α member 1), UGT1A (UDP glucuronyl transferase 1 family, polypeptide A complex locus), PRKCA (protein kinase C, α), COMT (catechol O-methyltransferase), S100B (S100 calbindin B), EGR1 (early growth replys 1), PRL (lactogen), IL15 (interleukin 15), DRD4 (dopamine receptor D4), CAMK2G (calcium/calmodulin-dependent protein kinase ii γ), SLC22A2 (solute carrier family 22 (Organic Cation Transporter Gene), the member 2), CCL11 (chemotactic factor (CF) (C-C motif) ligand 1 1), PGF (B321 placenta growth factor), THPO (TPO), GP6 (Glycoprotein VI (blood platelet)), TACR1 (tachykinin receptor 1), NTS (neurotensin), HNF1A (HNF1 is with source capsule A), SST (somatostatin), KCND1 (member 1 for potassium voltage-gated channel, the Shal subfamily of being correlated with), LOC646627 (phosphatidase inhibiting factor), TBXAS1 (thromboxane A synthetase 1 (blood platelet)), CYP2J2 (Cytochrome P450, family 2, subfamily J, polypeptide 2), TBXA2R (thromboxane A2 acceptor), ADH1C (alcohol dehydrogenase 1C (class I), γ polypeptide), ALOX12 (Arachidonate 12-lipoxygenase), AHSG (α-2-HS-glycoprotein), BHMT (betaine-homocysteine methyl transferase), GJA4 (gap junction protein, α 4,37kDa), SLC25A4 (solute carrier family 25 (mitochondrial carriers, adenylic acid transposition albumen), the member 4), ACLY (ATP citrate-lyase), ALOX5AP (Arachidonate 5-lipoxygenase-activation of protein), NUMA1 (nuclear mitotic apparatus protein matter 1), CYP27B1 (Cytochrome P450, family 27, subfamily B, polypeptide 1), CYSLTR2 (cysteinyl-leukotriene receptor 2), SOD3 (superoxide dismutase 3, born of the same parents are outer), LTC4S (leukotriene C synzyme), UCN (Ucn), GHRL (motilin/obestatin prepropeptide), APOC2 (apoC-II), CLEC4A (C-type lectin domain family 4, member A), KBTBD10 (the kelch repetitive sequence and contain BTB (POZ) territory 10), TNC (tenascin C), TYMS (thymidine synzyme), SHC1 (SHC (containing Src homology 2 territories) transforming protein matter 1), LRP1 (low density lipoprotein receptor associated protein white matter 1), SOCS3 (suppressor 3 of cytokine signaling), ADH1B (alcohol dehydrogenase 1B (class I), beta polypeptides), KLK3 (kallikrein be correlated with peptase 3), HSD11B1 (hydroxy steroid (11-β) dehydrogenase 1), VKORC1 (vitamin K epoxide reductase complex, subunit 1), SERPINB2 (member 2 for serpin peptide enzyme inhibition factor, differentiation branch B (ovalbumin)), TNS1 (tensin 1), RNF19A (ring finger protein 19), EPOR (EPO Receipter), ITGAM (integrin, α M (complement component 3 acceptor 3 subunits)), PITX2 (sample homeodomain 2 in pairs), MAPK7 (mitogen activated protein kinase 7), FCGR3A (the Fc fragment of IgG, low-affinity IIIa, acceptor (CD16a)), LEPR (leptin receptor), ENG (endothelial factor (endoglin)), GPX1 (glutathione peroxidase 1), GOT2 (glutamic-oxaloacetic transaminase 2, mitochondria (aspartate transaminase 2)), HRH1 (histamine H_1 receptor), NR1I2 (member 2 for nuclear receptor subfamily 1, group I), CRH (corticoliberim), HTR1A (serotonin (thrombocytin) acceptor 1), VDAC1 (voltage-dependence anion channel 1), HPSE (heparinase), SFTPD (surface reactive material protein D), TAP2 (transporter 2, ATP-binding cassette, subfamily B (MDR/TAP)), RNF123 (ring finger protein 123), PTK2B (PTK2B protein tyrosine kinase 2 β), NTRK2 (neurotrophy EGFR-TK, acceptor, type 2), IL6R (interleukin-6 receptor), ACHE (acetylcholine esterase (acetylcholine esterase (Yt blood group)), GLP1R (glucagon-like peptide 1 acceptor), GHR (growth hormone receptor), GSR (glutathione reductase), NQO1 (NAD (P) H dehydrogenase, quinone 1), NR5A1 (member 1 for nuclear receptor subfamily 5, group A), GJB2 (gap junction protein, β 2,26kDa), SLC9A1 (solute carrier family 9 (sodium/hydrogen exchanger), the member 1), MAOA (monoamine oxidase), PCSK9 (proprotein convertases subtilopeptidase A/can glad (kexin) type 9), FCGR2A (the Fc fragment of IgG, low-affinity IIa, acceptor (CD32)), SERPINF1 (member 1 for serpin peptide enzyme inhibition factor, differentiation branch F (α-2 antifibrinolysin, pigment epidermal derived factors)), EDN3 (Endothelin 3), DHFR (dihyrofolate reductase), GAS6 (growth retardation-specificity 6), SMPD1 (sphingomyelin phosphodiesterase 1, sour lysosome), UCP2 (Uncoupling Proteins 2 (mitochondria, proton carrier)), TFAP2A (transcription factor AP-1-2 α (activation enhancer binding protein 2 α)), (complement component 4 is in conjunction with albumen, α) for C4BPA, SERPINF2 (member 2 for serpin peptide enzyme inhibition factor, differentiation branch F (α-2 antifibrinolysin, pigment epidermal derived factors)), TYMP (thymidine phosphorylase), ALPP (alkaline phosphatase, placenta (Regan isoenzymes)), CXCR2 (chemotactic factor (CF) (C-X-C motif) acceptor 2), SLC39A3 (solute carrier family 39 (zinc transporter), the member 3), ABCG2 (member 2 for ATP-binding cassette, subfamily G (WHITE)), ADA (adenosine deaminase), JAK3 (JAK3), HSPA1A (heat shock 70kDa protein 1A), FASN (fatty acid synthetase), FGF1 (desmocyte growth factor-21 (acidity)), F11 (plasma thromboplastin antecedent), ATP7A (ATP enzyme, Cu++ transports, the α polypeptide), CR1 (complement component (3b/4b) acceptor 1 (Knops blood group)), GFAP (glial fibrillary acidic protein matter), ROCK1 (Rho is relevant, and coiled coil contains protein kinase 1), (methyl CpG is in conjunction with albumen 2 (Rett autism for MECP2, dementia and ataxia syndrome)), MYLK (MLCK), BCHE (butyrylcholine esterase), LIPE (lipase, hormone-sensitivity), PRDX5 (peroxide oxygen is enzyme 5 also), ADORA1 (adenosine A 1 receptor), WRN (Werner syndrome, RecQ unwindase sample), CXCR3 (chemotactic factor (CF) (C-X-C motif) acceptor 3), CD81 (CD81 molecule), SMAD7 (SMAD family member 7), LAMC2 (laminin, γ 2), MAP3K5 (mitogen activated protein kinase kinase kinase 5), CHGA (Chromogranin A (parathyroid secretory protein 1)), IAPP (IAPP), RHO (rhodopsin), ENPP1 (the outer pyrophosphatase/phosphodiesterase 1 of nucleotides), PTHLH (parathormone sample hormone), NRG1 (neuregulin 1), VEGFC (vascular endothelial growth factor C), ENPEP (glutamyl aminopeptidase (Aminopeptidase A)), CEBPB (CCAAT/ enhancer binding protein (C/EBP), β), NAGLU (the N-acetyl-glucosamine glycosidase, α-), F2RL3 (prothrombin (fibrin ferment) acceptor sample 3), CX3CL1 (chemotactic factor (CF) (C-X3-C motif) ligand 1), BDKRB1 (bradykinin acceptor B1), ADAMTS13 (the ADAM metallopeptidase with thrombospondins type 1 motif, 13), ELANE (elastoser, neutrophil leucocyte is expressed), ENPP2 (the outer pyrophosphatase/phosphodiesterase 2 of nucleotides), CISH (protein of the SH2 that contains cytokine induction), GAST (gastrin), MYOC (actin, trabecular network can induce glucocorticoid to reply), ATP1A2 (ATP enzyme, Na+/K+ transports, α 2 polypeptide), NF1 (neurofibromin 1), GJB1 (gap junction protein, β 1,32kDa), MEF2A (myocyte enhancer factor 2), VCL (vinculin), BMPR2 (skeletal form generation protein acceptor, Type II (serine/threonine kinase)), TUBB (tubulin, β), CDC42 (CDC 42 (gtp binding protein, 25kDa)), KRT18 (Keratin 18), HSF1 (Features of The Heat Shock Transcription Factor 1), MYB (v-MYB medulloblastoma virus oncogene homologue (birds)), PRKAA2 (protein kinase, AMP-activation, α 2 catalytic subunits), ROCK2 (Rho is relevant, the protein kinase 2 that contains coiled coil), TFPI (tissue factor approach inhibition factor (lipoprotein be correlated with coagulation inhibitor)), PRKG1 (protein kinase, cGMP-dependence, type I), BMP2 (skeletal form generation protein 2), CTNND1 (catenin (cadherin related protein), δ 1), CTH (cystathionase (cystathionine γ-lyase)), CTSS (cathepsin S), VAV2 (vav2 guanine nucleotide exchange factor), NPY2R (neuropeptide Y receptor Y2), IGFBP2 (IGFBP2,36kDa), CD28 (CD28 molecule), GSTA1 (glutathione S-transferase α 1), PPIA (peptide acyl prolyl isomerase (Cyclophilin A)), APOH (Apolipoprotein H (β-2-glycoprotein I)), S100A8 (S100 calbindin A8), IL11 (interleukin-11), ALOX15 (Arachidonate 15-lipoxygenase), FBLN1 (fine albumen 1), NR1H3 (member 3 for nuclear receptor subfamily 1, group H), SCD (stearoyl-coa desaturase (δ-9-desaturase)), GIP (gastric inhibitory polypepitde), CHGB (chromograin B (secretogranin 1)), PRKCB (protein kinase C, β), SRD5A1 (steroids-5-5 alpha-reductases, α polypeptide 1 (3-oxo-5 α-steroids δ 4-dehydrogenase α 1)), HSD11B2 (hydroxy steroid (11-β) dehydrogenase 2), CALCRL (calcitonin acceptor sample), GALNT2 (UDP-N-acetyl-α-D-Gal: polypeptide N-acetylamino galactosamine transferase 2 (GalNAc-T2)), ANGPTL4 (angiopoietin-like 4), KCNN4 (in potassium/and small-conductance calcium-active channel, subfamily N, the member 4), PIK3C2A (phosphoinositide-3-kinases, class 2, α polypeptide), HBEGF (heparin-in conjunction with the EGF like growth factor), CYP7A1 (Cytochrome P450, family 7, subfamily A, polypeptide 1), HLA-DRB5 (major histocompatibility complex, class II, DR β 5), BNIP3 (BCL2/ adenovirus E 1 B19kDa interaction protein 3), GCKR (glucokinase (hexokinase 4) regulatory factor), S100A12 (S100 calbindin A12), PADI4 (Peptidylarginine deiminase, type I V), HSPA14 (heat shock 70kDa protein 14), CXCR1 (chemotactic factor (CF) (C-X-C motif) acceptor 1), H19 (H19, the maternal expression transcription product of trace (nonprotein coding)), KRTAP19-3 (keratin related protein 19-3), IDDM2 (IDD 2), RAC2 (ras be correlated with C3 botulin toxin substrate 2 (rho family, little gtp binding protein Rac2)), RYR1 (blue Buddhist nun's alkali acceptor 1 (bone)), CLOCK (clock homologue (mouse)), NGFR (trk C (TNFR Superfamily, the member 16)), DBH (dopamine β-hydroxylase (dopamine β-monooxygenase)), CHRNA4 (α 4 for cholinergic recepter, nicotine), CACNA1C (calcium channel, voltage-dependence, L type, α 1C subunit), PRKAG2 (protein kinase, AMP-activation, γ 2 on-catalytic subunits), CHAT (cholinacetyltranslase), PTGDS (PGD2 synzyme 21kDa (brain)), NR1H2 (member 2 for nuclear receptor subfamily 1, group H), TEK (TEK EGFR-TK, endothelium), VEGFB (vascular endothelial growth factor B), MEF2C (myocyte enhancer factor 2C), MAPKAPK2 (mitogen activated protein kinase-activated protein kinase 2), TNFRSF11A (NFKB activates body for Tumor Necrosis Factor Receptors Superfamily, member 11a), HSPA9 (heat shock 70kDa protein 9 (mortalin)), CYSLTR1 (cysteinyl-CysLT1R), MAT1A (methionine adenosyltransferase I, α), OPRL1 (anesthetic acceptor sample 1), IMPA1 (inositol (muscle)-1 (or 4)-monophosphate enzyme 1), CLCN2 (chloride channel 2), DLD (dihydrolipoamide dehydrogenase), PSMA6 (protease (precursor, huge protein factor) subunit, α type, 6), PSMB8 (proteasome (precursor, huge protein factor) subunit, beta type, 8 (large multifunctional polypeptide enzymes 7)), CHI3L1 (chitinase 3 samples 1 (cartilage glycoprotein-39)), ALDH1B1 (aldehyde dehydrogenase 1 family, member B1), PARP2 (poly-(ADP-ribose) polymerase 2), STAR (the acute regulation protein of steroids), LBP (liopopolysaccharides is in conjunction with albumen), ABCC6 (member 6 for ATP-binding cassette, subfamily C (CFTR/MRP)), RGS2 (G-protein signal transduction regulatory factor 2,24kDa), EFNB2 (pterinophore-B2), GJB6 (gap junction protein, β 6,30kDa), APOA2 (apolipoprotein A-1 I), AMPD1 (adenylic acid deaminase 1), DYSF (dysferlin albumen, limb-girdle muscular dystrophy 2B (autosomal recessive)), FDFT1 (farnesyl-diphosphonic acid farnesyl transferase 1), EDN2 (Endothelin 2), CCR6 (chemotactic factor (CF) (C-C motif) acceptor 6), GJB3 (gap junction protein, β 3,31kDa), IL1RL1 (interleukin 1 receptor sample 1), ENTPD1 (outer ribonucleoside triphosphote diphosphonic acid hydrolase 1), BBS4 (Bardet-Biedl syndrome 44), CELSR2 (cadherin, EGFLAG seven-transmembrane district G-type receptors 2 (flamingo homologue, fruit bat)), F11R (F11 acceptor), RAPGEF3 (Rap guanine nucleotide exchange factor (GEF) 3), HYAL1 (hyaluronoglucosaminidase 1), ZNF259 (zinc-finger protein 25 9), ATOX1 (anti-oxidant protein 1 homologue of ATX1 (yeast)), ATF6 (transcriptional factors 6), KHK (ketohexokinase fructokinase (fructokinase)), SAT1 (spermidine/spermine N1-transacetylase 1), GGH (gamma-Glutamyl hydrolase (desmoenzyme, the leaf acyl gathers gamma-Glutamyl hydrolase)), TIMP4 (TIMP metallopeptidase inhibiting factor 4), SLC4A4 (member 4 for solute carrier family 4, the sodium acid carbonate body that cotransports), PDE2A (phosphodiesterase 2, cGMP-stimulates), PDE3B (phosphodiesterase 3B, cGMP-suppresses), FADS1 (fatty acid desaturase 1), FADS2 (FADS2), TMSB4X (extrasin beta 4, X-is chain), TXNIP (thioredoxin interacting protein), LIMS1 (LIM and Senescent cell antigen sample territory 1), RHOB (ras homologue gene family, member B), LY96 (lymphocyte antigen 96), FOXO1 (jaw frame O1), PNPLA2 (containing patatin sample phosphatidase territory 2), TRH (thyrotropin-releasing hormone (TRH)), GJC1 (gap junction protein, γ Isosorbide-5-Nitrae 5kDa), SLC17A5 (solute carrier family 17 (anion/sugar transport body), the member 5), FTO (fat mass is relevant with obesity), GJD2 (gap junction protein, δ 2,36kDa), PSRC1 (coiled coil 1 of Pro-rich/serine), CASP12 (caspase 12 (gene/pseudogene)), GPBAR1 (G protein coupling cholic acid acceptor 1), PXK (serine/threonine kinase that contains the PX territory), IL33 (interleukin Ⅲ 3), TRIB1 (tribbles homologue 1 (fruit bat)), PBX4 (the pre B cell leukaemia is with source capsule 4), NUPR1 (nucleoprotein, transcription regulatory factor, 1), 15-Sep (15kDa selenoprotein), CILP2 (cartilage intermediate layer protein matter 2), TERC (end ribozyme component), GGT2 (gamma glutamyltransferase 2), MT-CO1 (mitochondria Codocyte pigment C oxidizing ferment I) and UOX (lithate oxidizing ferment, pseudogene).

In another embodiment, chromosome sequence can further be selected from Pon1 (PON1), LDLR (ldl receptor), ApoE (apo E), Apo B-100 (Apolipoprotein B-100), ApoA (lipophorin (a)), ApoA1 (Apolipoprotein A1), CBS (cystathionine B-synthetic enzyme), glycoprotein IIB/IIb, MTHRF (5,10-CH2-THFA reductase enzyme (NADPH) and combination thereof.In a repetition, relate to the chromosome sequence of cardiovascular disorder and the protein of chromosome sequence coding and can be selected from Cacna1C, Sod1, Pten, Ppar (α), ApoE, leptin and combination thereof.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in the Research on Cardiovascular disease to study the effect of sudden change for animal and cardiovascular disorder development and/or progress.For example, suitable disease tolerance can comprise and can or measure behavior, electrophysiology, neurochemistry, biological chemistry or the cell dysfunction of assessing with any many diagnostic tests of knowing.

e. A Zihaimo disease

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to A Zihaimo sick (AD) is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In some embodiments, one or more chromosome sequences relevant to AD can be through editor.The AD associated nucleic acid sequences empirical correlation based on AD associated nucleic acid sequences and AD illness is usually selected.AD associated nucleic acid sequences codified AD related protein or can be AD relevant control sequence.For example, with respect to the colony that there is no the AD illness, in the colony of suffering from the AD illness, the production rate of AD related protein or circulation composition can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

As unrestricted example, the protein relevant to AD includes but not limited to the very low density lipoprotein receptor albumen (VLDLR) of VLDLR genes encoding, the Ubiquitin like modifier activating enzymes 1 (UBA1) of UBA1 genes encoding, NEDD8-activating enzymes E1 catalytic subunit's protein (UBE1C) of UBA3 genes encoding, aquaporin 1 protein (AQP1) of AQP1 genes encoding, the ubiquitin carboxyl of UCHL1 genes encoding-terminal esterase L1 protein (UCHL1), the ubiquitin carboxyl of UCHL3 genes encoding-terminal lytic enzyme isozyme L3 protein (UCHL3), the ubiquitin B protein (UBB) of UBB genes encoding, the microtubule-associated proteins τ (MAPT) of MAPT genes encoding, the Protein Tyrosine Phosphatases acceptor type A protein (PTPRA) of PTPRA genes encoding, the phosphatidylinositols of PICALM genes encoding is in conjunction with clathrin assembly protein (PICALM), the clusterin of CLU genes encoding (claiming again SP-40), presenilin 1 protein of PSEN1 genes encoding, presenilin 2 protein of PSEN2 genes encoding, the protein that contains sorting protein associated receptor L (DLR class) A repeat sequence protein (SORL1) of SORL1 genes encoding, the amyloid precursor protein (APP) of app gene coding, the apo E precursor (APOE) of APOE genes encoding or the neurotrophic factor that is derived from brain (BDNF) or its combination of BDNF genes encoding.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research AD to study the effect of sudden change for animal and AD development and/or progress.In research AD, normally used tolerance includes, without being limited to learning and Memory, anxiety, depression, habituation and sensation-motor function, and function, pathology, metabolism or biochemical measurement.Those skilled in the art are familiar with other suitable tolerance or index of AD.Usually, can relatively carry out this type of measurement with the wild-type littermate.

Other tolerance of behavior can comprise assessment spontaneous behavior.Any or several different methods that spontaneous behavior can be observed by spontaneous behavior as known in the art is assessed.Usually, the own knowing and doing of observable animal is any spontaneous behavior in set, comprises motion, posture, social interaction, raising, sleep, nictation, takes food, drinks, urinates, defecation, mating and attack.The a series of extensive observation that quantizes Mouse and rat spontaneous behavior is known in the art, include but not limited to that cage observes, such as position, breathing, nervous involuntary movement, abnormal motor behavior such as pacing or waving, catatonia behavior, sounding, catacleisis, mating frequency, runner behavior, nest and aggressive interactional frequency.

In another embodiment, animal of the present invention can be used for using in the described disease condition of research or illness normally used tolerance to study sudden change for the effect of the progress of the disease condition relevant with the AD related protein or illness also still except AD.The disease condition except AD that can be relevant with the AD related protein or the unrestricted example of illness comprise paralysis, Pick disease, male sterile, prostate gland and breast cancer, squamous cell carcinoma, lymphoma, leukemia and arteriosclerosis on dementia, congenital cerebellar ataxia, mental retardation such as learning and Memory defect, agyria, Protein tau pathology or fibrosis, amyloidosis, nerve degeneration, Parkinsonism, carrying out property core.

Another aspect comprises the method for assessment latent gene therapeutic strategy effect.That is to say, the chromosome sequence of the protein relevant to AD of encoding can be modified so that compare with unprocessed animal, and genetically modified animal can have replying of change for AD development and/or progress.Alternatively say, the mutator gene that makes animal easily suffer from AD can come by gene therapy " rectification ".

f. autism pedigree obstacle

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to autism pedigree obstacle (ASD) is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to ASD.ASD related protein or the control sequence empirical correlation based on protein or control sequence and ASD sickness rate or indication are usually selected.For example, with respect to the colony that there is no ASD, in suffering from the colony of ASD, with production rate or the circulation composition of ASD related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

Chromosome sequence may and will change with the identity ASD related protein through editor.In preferred embodiments, chromosome sequence can be benzodiazepine receptors (on every side) related protein 1 (BZRAP1) of BZRAP1 genes encoding through editor's with the ASD related protein, AF4/FMR2 family member 2 protein (AFF2) of AFF2 gene (being also referred to as MFR2) coding, fragile X mental retardation euchromosome homologue 1 protein (FXR1) of FXR1 genes encoding, fragile X mental retardation euchromosome homologue 2 protein (FXR2) of FXR2 genes encoding, solid 2 protein (MDGA2) of the glycosyl-phosphatidyl inositol anchor that contains the MAM territory of MDGA2 genes encoding, the methyl CpG of MECP2 genes encoding is in conjunction with albumen 2 (MECP2), the metabotropic glutamate receptor 5 (MGLUR5) of MGLUR5-1 gene (being also referred to as GRM5) coding, neuronin 1 protein of NRXN1 genes encoding or brain signal albumen-5 protein (SEMA5A) of SEMA5A genes encoding.

Chromosome sequence through editor or integration can the modified change protein relevant to ASD with coding.With the unrestricted example of sudden change in the ASD related protein comprise wherein with the sudden change of the L18Q in the leucic neuronin 1 of glutamine displacement position 18, wherein with arginic nerve of halfcystine displacement position 451 is connected R451C sudden change in albumen 3, wherein with the arginic neural R87W connected in albumen 4 of tryptophane displacement position 87, suddenly change and makings that use the I425V in the Serotonin transporter of Isoleucine of α-amino-isovaleric acid displacement position 425 to suddenly change.Many other sudden changes and chromosome rearrangement in the relevant chromosome sequence of ASD are associated with ASD and are well known in the art.Referring to such as (2010) Eur.Child.Adolesc.Psychiatry 19:169-178 such as Freitag, and (2009) PLoS Genetics 5:e1000536 such as Bucan, the disclosure of described reference is incorporated herein by reference.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research ASD to study the effect of sudden change for animal and ASD development and/or progress.

g. macular degeneration

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to macular degeneration (MD) is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to MD.MD related protein or the control sequence empirical correlation based on MD related protein and MD illness are usually selected.For example, with respect to the colony that there is no the MD illness, in the colony of suffering from the MD illness, with production rate or the circulation composition of MD related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

Chromosome sequence may and will change with the identity MD related protein through editor.In preferred embodiments, chromosome sequence can be ATP-binding cassette through editor's with the MD related protein, the subfamily of ABCR genes encoding (ABC1) member's april protein (ABCA4), the apo E protein (APOE) of APOE genes encoding, (CCL2) chemokine of CCL2 genes encoding (C-C motif) part 2 protein, the chemokine of CCR2 genes encoding (C-C motif) acceptor 2 protein (CCR2), the ceruloplasmin protein (CP) of CP genes encoding, cathepsin D's protein (CTSD) of CTSD genes encoding or the metalloprotease initiator 3 protein (TIMP3) of TIMP3 genes encoding.

In certain embodiments, the genetically modified animal produced by method of the present invention can be used for by using normally used tolerance in research MD to study the effect of sudden change for the MD progress.In addition, the genetically modified animal that method of the present invention produces can be used for by using normally used tolerance in the described disease condition of research or illness to study the effect of sudden change for the progress of the disease condition be associated with the MD related protein or illness.The unrestricted example of spendable tolerance comprises that the glassy membrane wart is piled up, lipofuscin is piled up, Bruch's membrane thickens, biological chemistry or molecular difference or its combination between retinal degeneration, choroid neovascularization, the different responses for compound, tissue or cellular abnormality, genetically modified animal and wild-type animal.

h. schizophrenia

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to schizophrenia is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to schizophrenia.Schizophrenia related protein or the control sequence empirical correlation based on schizophrenia related protein and schizophrenia development or progress are usually selected.For example, with respect to there is no schizoid colony, in suffering from schizoid colony, with production rate or the circulation composition of schizophrenia related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.Comprise NRG1, ErbB4, CPLX1, TPH1, TPH2, NRXN1, GSK3A, BDNF, DISC1, GSK3B and combination thereof to the exemplary unrestricted example of the relevant chromosome sequence of schizophrenia, its each be described in more detail hereinafter.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research MD to study the effect of sudden change for animal and MD development and/or progress.

The morbidity of schizophrenia or associated conditions or indication can naturally-occurrings in genetically modified animal.In addition, the morbidity of schizophrenia or associated conditions or indication can be facilitated by being exposed to destructive medicament.The unrestricted example of destructive medicament comprises such as any as above and schizophrenia related protein, medicine, toxin, chemical, activation retrovirus and environmental stress.The unrestricted example of environmental stress comprises forced swimming, cold water swimming, the stimulation of platform vibrator, loud noise and Restraint Stress.

i. tumor suppression

Tumor suppressor gene is the gene that its protein Cell protection avoids developing into cancer.The sudden change of tumor suppressor gene can cause the defencive function loss of its protein or reduce, thereby increase, forms the swollen neoplastic possibility that causes cancer, usually also has other gene to change.The protein of tumor suppressor gene coding has elimination or the effect suppressed or promotes apoptosis for cell cycle regulating, and two kinds of effects have sometimes.Tumor suppressor proteins relates to and checks the cell cycle and continue necessary gene; Cell cycle and DNA damage are connected so that the cell cycle can continue; If damage can not be repaired with regard to the active cell apoptosis; And relate to cell adhesion to prevent the tumour diffusion, thereby prevent from the caused loss of contact inhibition and suppress shifting.

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to tumor suppression is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to tumor suppression.Tumor suppression related protein or the control sequence empirical correlation of based target protein and cancer are usually selected.For example, with respect to the colony that there is no spiritual cancer, in suffering from the colony of cancer, with production rate or the circulation composition of tumor suppression related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

For instance, the protein that relates to tumor suppression can include but not limited to TNF (TNF (TNF Superfamily, the member 2)), TP53 (oncoprotein matter p53), ERBB2 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 2, nerve/spongioblastoma derives oncogene homologue (birds)), FN1 (fibronectin 1), TSC1 (tuberous sclerosis 1), PTGS2 (prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and cyclooxygenase)), PTEN (phosphatase and tensin homologue), PCNA (PCNA), COL18A1 (α 1 for collagen, type XVIII), TSSC4 (the transferable candidate gene 4 of tumor suppression), JUN (jun oncogene), MAPK8 (mitogen activated protein kinase 8), TGFB1 (TGF, β 1), IL6 (interleukin-6 (interferon, β 2)), IFNG (interferon, γ), BRCA1 (mammary cancer 1 is early sent out), TSPAN32 (four revolve protein 32), BCL2 (B cell CLL/ lymthoma 2), NF2 (neurofibromin 2 (merlin)), GJB1 (gap junction protein, β 1,32kDa), MAPK1 (mitogen activated protein kinase 1), CD44 (CD44 molecule (India's blood group)), PGR (progesterone acceptor), TNS1 (tensin 1), PROK1 (front dynein 1), SIAH1 (seven in absentia homologue 1 (fruit bat)), ENG (endothelium glycoprotein), TP73 (oncoprotein matter p73), APC (adenoma polyposis Escherichia coli), BAX (BCL2 be correlated with X protein matter), SRC (v-src sarcoma (Schmidt-Ruppin A-2) Viral Carcinogenesis gene homologue (birds)), VHL (von Hippel-Lindau tumor suppressor gene), FHIT (Relationship between Fragile Histidine Triad Gene), NFKB1 (nuclear factor of the κ light chain polypeptide genetic enhancer in B-cell 1), IFNA1 (interferon, α 1), TGFBR1 (TGF, beta receptor 1), PRKCD (protein kinase C, δ), TGIF1 (the TGFB inducible factor is with source capsule 1), DLC1 (lacking 1 in liver cancer), SLC22A18 (solute carrier family 22, the member 18), VEGFA (VEGF-A), MME (film metal-endopeptidase), IL3 (interleukin Ⅲ (colony-stimulating factor, various)), MKI67 (Monoclonal antibody Ki-67 identification antigen), HSPD1 (heat shock 60kDa protein 1 (chaperone)), HSPB1 (heat shock 27kDa protein 1), HSP90B2P (heat shock protein 90kDa β (Grp94), member 2 (pseudogene)), MBL2 (mannan-binding lectin (protein C) 2, solvable (opsonin defect)), ZFYVE9 (zinc refers to, contains FYVE territory 9), TERT (telomerase reverse transcriptase), PML (progranulocyte leukemia), SKP2 (S-phase kinase-associated protein matter 2 (p45)), CYCS (cromoci, body cell), MAPK10 (mitogen activated protein kinase 10), PAX7 (box 7 in pairs), YAP1 (Yes related protein 1), PARP1 (poly-(ADP-ribose) polymerase 1), MIR34A (microRNA 34), PRKCA (protein kinase C, α), FAS (FAS (TNF acceptor Superfamily, the member 6)), SYK (spleen tyrosine kinase), GSK3B (glycogen synthase kinase 3 β), PRKCE (protein kinase C, ε), CYP19A1 (Cytochrome P450, family 19, subfamily A, polypeptide 1), ABCB1 (member 1 for ATP-binding cassette, subfamily B (MDR/TAP)), NFKBIA (nuclear factor of the κ light chain polypeptide genetic enhancer in B-cytostatic factor α), RUNX1 (dwarf's associated transcription factor 1), PRKCG (protein kinase C, γ), RELA (v-rel reticuloendotheliosis virus oncogene homologue A (birds)), PLAU (plasminogen activation body, urokinase), BTK (Bruton agamaglobulinemia EGFR-TK), PRKCB (protein kinase C, β), CSF1 (colony-stimulating factor 1 (macrophage)), POMC (POMC), CEBPB (CCAAT/ enhancer binding protein (C/EBP), β), ROCK1 (Rho is relevant, the protein kinase 1 that contains coiled coil), KDR (kinases inserts domain receptor (a type-iii receptor tyrosine kinase)), NPM1 (nuclear phosphoprotein (nucleolar phosphoprotein white matter B23, nuclear matrix protein)), ROCK2 (Rho is relevant, the protein kinase 2 that contains coiled coil), PRKAB1 (protein kinase, AMP-activation, β 1 on-catalytic subunit), BAK1 (BCL2-antagonist/kill and wound 1), AURKA (aurora kinases), NTN1 (nerve growth factor 1), FLT1 (fms be correlated with EGFR-TK 1 (VEGF/vascular permeability factor acceptor)), NBN (disconnected albumen), DNM3 (dynamin 3), PRDM10 (PR contains 10 in territory), PAX5 (box 5 in pairs), EIF4G1 (the eucaryon rotaring intertranslating start factor 4 γ, 1), KAT2B (K (lysine) transacetylase 2B), TIMP3 (TIMP metallopeptidase initiator 3), CCL22 (chemotactic factor (CF) (C-C motif) part 22), GRIN2B (glutamate receptor, ionic, N-methyl D-Asp 2B), CD81 (CD81 molecule), CCL27 (chemotactic factor (CF) (C-C motif) part 27), MAPK11 (mitogen activated protein kinase 11), DKK1 (dickkopf homologue 1 (Africa xenopus)), HYAL1 (hyaluronoglucosaminidase 1), CTSL1 (cathepsin L 1), PKD1 (POLYCYSTIC KIDNEY DISEASE 1 (autosomal dominant)), BUB1B (budding (yeast) that not suppressed by benzimidazole 1 homologue β), MPP1 (memebrane protein, palmitoylation 1,55kDa), SIAH2 (seven in absentia homologue 2 (fruit bat)), DUSP13 (dual specificity phosphatase 13), CCL21 (chemotactic factor (CF) (C-C motif) part 21), RTN4 (reticuloprotein 4), SMO (level and smooth homologue (fruit bat)), CCL19 (chemotactic factor (CF) (C-C motif) ligand 1 9), CSTF2 (the cracking stimulating factor, 3 ' front RNA, subunit 2,64kDa), RSF1 (reinventing and interval factor 1), EZH2 (enhancer of zeste homologue 2 (fruit bat)), AK1 (adenylate kinase 1), CKM (creatine kinase, muscle), HYAL3 (hyaluronoglucosaminidase 3), ALOX15B (Arachidonate 15-lipoxygenase, type B), PAG1 (phosphoprotein be correlated with glycosyl sphingolipid microcell 1), MIR21 (microRNA 21), S100A2 (S100 calbindin A2), HYAL2 (hyaluronoglucosaminidase 2), CSTF1 (the cracking stimulating factor, 3 ' front RNA, subunit 1,50kDa), PCGF2 (combing protein groups fourth finger 2) more, THSD1 (thrombospondin, type I contain territory 1), HOPX (the same source capsule of HOP), SLC5A8 (solute carrier family 5 (iodide transporter), the member 8), EMB (embigin homologue (mouse)), PAX9 (box 9 in pairs), ARMCX3 (contain the tatou repetitive sequence, X-chain 3), ARMCX2 (contain the tatou repetitive sequence, X-chain 2), ARMCX1 (contain the tatou repetitive sequence, X-chain 1), RASSF4 (associated (RalGDS/AF-6) the territory family member 4 of Ras), MIR34B (microRNA 34b), MIR205 (microRNA 205), RB1 (retinoblastoma 1), DYT10 (tension force abnormal 10), CDKN2A (cyclin-dependent kinase enzyme inhibition factor 2 (melanoma, p16 suppress CDK4)), CDKN1A (cyclin-dependent kinase enzyme inhibition factor 1 (p21, Cip1)), CCND1 (cyclin D1), AKT1 (v-akt Muridae thymoma Viral Carcinogenesis gene homologue 1), MYC (v-myc myelocytomatosis Viral Carcinogenesis gene homologue (birds)), CTNNB1 (catenin (cadherin related protein), β 1,88kDa), MDM2 (Mdm2p53 is in conjunction with albumen homologue (mouse)), SERPINB5 (member 5 for serpin peptide enzyme inhibition factor, differentiation branch B (ovalbumin)), EGF (EGF (β-anthelone)), FOS (FBJ Muridae osteosarcoma virus oncogene homologue), NOS2 (nitric oxide synthase 2 can be induced), CDK4 (cyclin-dependant kinase 4), SOD2 (superoxide dismutase 2, mitochondria), SMAD3 (SMAD family member 3), CDKN1B (cyclin-dependent kinase enzyme inhibition factor 1B (p27, Kip1)), SOD1 (superoxide dismutase 1, solvable), CCNA2 (cyclin A2), LOX (lysyl oxidase), SMAD4 (SMAD family member 4), HGF (HGF (hepatocyte growth factor A, dispersion factor)), THBS1 (thrombospondin 1), CDK6 (cyclin-dependant kinase 6), ATM (ataxia-telangiectasia sudden change), STAT3 (signal transduction and transcription activating body 3 (Acute Phase response factor)), HIF1A (oxygen deficient induction factor 1, alpha subunit (basic helix-loop-helix transcription factor)), IGF1R (type-1 insulin like growth factor acceptor), MTOR (the mechanism target (serine/threonine kinase) of rapamycin), TSC2 (tuberous sclerosis 2), CDC42 (CDC 42 (gtp binding protein, 25kDa)), ODC1 (ornithine decarboxylase 1), SPARC (secretory protein, acidity are rich in cysteine (osteonectin)), HDAC1 (histone deacetylase 1), CDK2 (cyclin-dependent kinase 2), BARD1 (the relevant RING of BRCA1 territory 1), CDH1 (cadherin 1, Class1, CAM 120/80 (epithelium)), EGR1 (early growth replys 1), INSR (insulin receptor), IRF1 (interferon regulatory factor 1), PHB (antiproliferative protein), PXN (paxillin), HSPA4 (heat shock 70kDa protein 4), TYR (tyrosinase (eyelid albinism IA)), CAV1 (caveolin-1, caveolin matter, 22kDa), CDKN2B (cyclin-dependent kinase enzyme inhibition factor 2B (p15 suppresses CDK4)), FOXO3 (jaw frame O3), HDAC9 (histone deacetylase 9), FBXW7 (F-box and contain WD duplicate domain 7), FOXO1 (jaw frame O1), E2F1 (E2F transcription factor 1), STK11 (serine/threonine kinase 11), BMP2 (skeletal form generation protein 2), HSP90AA1 (heat shock protein 90kDa α (cytoplasm), class A member 1), HNF4A (Hepatocyte nuclear factor 4, α), CAMK2G (calcium/calmodulin-dependent protein kinase ii γ), TP53BP1 (oncoprotein matter p53 Binding Protein 1), CRYAB (crystalline protein, α B), HMGCR (3-hydroxy-3-methylglutaric acid base-CoA-reductase), PLAUR (plasminogen activation body, urokinase receptor), MCL1 (bone marrow cell leukaemia sequence 1 (BCL2 is relevant)), NOTCH1 (Notch homologue 1, transposition be correlated with (fruit bat)), RASSF1 (associated (RalGDS/AF-6) the territory family member 1 of Ras), GSN (gelsolin), CADM1 (cell adhesion molecule 1), ATF2 (transcriptional factors 2), IFNB1 (interferon, β 1, fibroblast), DAPK1 (death-associated protein kinase 1), CHFR (containing jaw and fourth finger territory prosecution point gene), KITLG (KIT part), NDUFA13 (nadh dehydrogenase (ubiquinone) 1 α complex, 13), DPP4 (two peptidyls-peptase 4), GLB1 (galactosidase, β 1), IKZF1 (IKAROS family zinc refers to 1 (Ikaros)), ST5 (suppressing tumorigenicity 5), TGFA (TGF, α), EIF4EBP1 (eukaryotic translation initiation factor 4E Binding Protein 1), TGFBR2 (TGF, beta receptor II (70/80kDa)), EIF2AK2 (eukaryotic translation initiation factor 2-alpha kinase 2), GJA1 (gap junction protein, α Isosorbide-5-Nitrae 3kDa), MYD88 (marrow differentiation primary response gene (88)), IFI27 (interferon, but α-induced protein 27), RBMX (RNA binding motif protein, X-is chain), EPHA1 (EPH acceptor A1), TWSG1 (reverse primitive gut and form homologue 1 (fruit bat)), H2AFX (H2A histone family, member X), LGALS3 (agglutinin, galactoside-combination, solvable, 3), MUC3A (MUC-3, cell surface is relevant), ILK (integrin-chain kinases), APAF1 (the apoptosis peptide enzyme activation factor 1), MAOA (MAOA), ERBB3 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 3 (birds)), EIF2S1 (the eucaryon rotaring intertranslating start factor 2,1 α, the 35kDa of subunit), PER2 (cycle homologue 2 (fruit bat)), IGFBP7 (PSF), KDM5B (lysine (K)-specificity demethylase 5B), SMARCA4 (SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily a, the member 4), NME1 (non-metastatic cell 1, protein (NM23A) is expressed), F2RL1 (prothrombin (fibrin ferment) acceptor sample 1), ZFP36 (zinc finger protein matter 36, C3H type, homologue (mouse)), HSPA8 (heat shock 70kDa protein 8), WNT5A (aptery-type MMTV integration site family, the member 5), ITGB4 (integrin, β 4), RARB (retinoid receptor, β), VEGFC (vascular endothelial growth factor C), CCL20 (chemotactic factor (CF) (C-C motif) part 20), EPHB2 (EPH acceptor B2), CSNK2A1 (casein kinase 2, α 1 polypeptide), PSMD9 (protease (precursor, huge protein factor) 26S subunit, non--ATP enzyme, 9), SERPINB2 (member 2 for serpin peptide enzyme inhibition factor, differentiation branch B (ovalbumin)), RHOB (ras homologue gene family, member B), DUSP6 (dual specificity phosphatase 6), CDKN1C (cyclin-dependent kinase enzyme inhibition factor agent 1C (p57, Kip2)), SLIT2 (slit homologue 2 (fruit bat)), CEACAM1 (carcinomebryonic antigen relevant cell adhesion molecule 1 (biliary glycoprotein)), UBC (ubiquitin C), STS (steoid sulfatase (microsome), isoenzymes S), FST (follistatin), KRT1 (Keratin 1), EIF6 (eukaryotic translation initiation factor 6), JUP (connection plakoglobin), HDAC4 (histone deacetylase 4), NEDD4 (neural precursor is expressed, and grows and lowers 4), KRT14 (Keratin 14), GLI2 (GLI family zinc refers to 2), MYH11 (myosin, heavy chain 11, smooth muscle), MAPKAPK5 (mitogen activated protein kinase-activated protein kinase 5), MAD1L1 (defect sample 1 (yeast) stagnated in MAD1 mitosis), TNFAIP3 (TNF, α-induced protein 3), WEE1 (WEE1 homologue (fission yeast)), BTRC (containing β-transducin repetitive sequence), NKX3-1 (NK3 is with source capsule 1), GPC3 (glypican-3), CREB3 (the cAMP response element is in conjunction with albumen 3), PLCB3 (phospholipase C, β 3 (phosphatidylinositols-specificity)), DMPK (tonicity muscular dystrophy-protein kinase), BLNK (B cell attachment), PPIA (peptidyl prolyl isomerase A (Cyclophilin A)), DAB2 (defective homologue 2, mitogen-reply phosphoprotein (fruit bat)), KLF4 (Kruppel like factor 4 (internal organ)), RUNX3 (dwarf's associated transcription factor 3), FLG (poly-keratin microfilament), IVL (involurin), CCT5 (chaperone contains TCP1, subunit 5 (ε)), LRPAP1 (low density lipoprotein receptor associated protein white matter related protein matter 1), IGF2R (IMA-IGF2BP3-001 acceptor), PER1 (cycle homologue 1 (fruit bat)), BIK (BCL2-interacts and kills and wounds thing (cell death inducing)), PSMC4 (protease (precursor, huge protein factor) 26S subunit, ATP enzyme, 4), USF2 (UBF 2, c-fos interacts), GAS1 (growth retardation-specificity 1), LAMP2 (lysosome related membrane protein matter 2), PSMD10 (protease (precursor, huge protein factor) 26S subunit, non ATP enzyne, 10), IL24 (interleukin 24), GADD45G (can induce, γ) by growth retardation and DNA damage, ARHGAP1 (RhoGTP enzyme activation protein 1), CLDN1 (sealing element 1), ANXA7 (annexin A7), CHN1 (chimericin 1), TXNIP (thioredoxin interacting protein), PEG3 (paternal expression 3), EIF3A (the eucaryon rotaring intertranslating start factor 3, subunit), CASC5 (cancer susceptible candidate gene 5), TCF4 (transcription factor 4), CSNK2A2 (casein kinase 2, the initial polypeptide of α), CSNK2B (casein kinase 2, beta polypeptides), CRY1 (cryptochrome 1 (photolyase sample)), CRY2 (cryptochrome 2 (photolyase sample)), EIF4G2 (the eucaryon rotaring intertranslating start factor 4 γ, 2), LOXL2 (lysyl oxidase sample 2), PSMD13 (protease (precursor, huge protein factor) 26S subunit, non ATP enzyne, 13), ANP32A (acid (being rich in leucine) nuclear phosphoprotein matter 32 families, member A), COL4A3 (collagen, type I V, α 3 (empsyxis ephritis antigen)), SCGB1A1 (secretion globulin, family 1, member 1 (uteroglobin)), BNIP3L (BCL2/ adenovirus E 1 B19kDa interacting protein 3 samples), MCC (colorectal cancer sudden change), EFNB3 (pterinophore-B3), RBBP8 (retinoblastoma is in conjunction with albumen 8), PALB2 (BRCA2 collocation thing and localization thing), HBP1 (HMG-box transcription factor 1), MRPL28 (mitochondrial ribosomal protein L28), KDM5A (lysine (K)-specificity demethylase 5), QSOX1 (static agent Q6 thiol oxidase 1), ZFR (zinc refers to rna binding protein), MN1 (meningioma (balanced translocation upset) 1), SMYD4 (containing SET and MYND territory 4), USP7 (ubiquitin-specific peptase 7 (herpesviral is relevant)), STK4 (serine/threonine kinase 4), THY1 (Thy-1 cell surface antigen), PTPRG (protein tyrosine phosphatase, acceptor type, G), E2F6 (E2F transcription factor 6), STX11 (syntaxin 11), CDC42BPA (CDC42 bindin kinase α (DMPK sample)), MYOCD (short VSMC differentiation factor), DAP (dead related protein), LOXL1 (lysyl oxidase sample 1), RNF139 (ring finger protein 139), HTATIP2 (HIV-1 Tat interacting protein 2,30kDa), AIM1 (melanoma lacks the factor 1), BCCIP (BRCA2 and CDKN1A interacting protein), LOXL4 (lysyl oxidase sample 4), WWC1 (containing WW and C2 territory 1), LOXL3 (lysyl oxidase sample 3), CENPN (kinetochore protein N), TNS4 (tensin 4), SIK1 (salt inducible kinase 1), PCGF6 (combing protein groups fourth finger 6) more, PHLDA3 (member 3 for pleckstrin homology sample territory, family), IL32 (interleukin Ⅲ 2), LATS1 (LATS, large tumor suppressor gene, homologue 1 (fruit bat)), COMMD7 (containing COMM territory 7), CDHR2 (cadherin be correlated with family member 2), LELP1 (late period, angling shell sample Pro-rich 1), NCRNA00188 (nonprotein coding RNA 188) and ENSG00000131023.

The exemplary unrestricted example of Tumor suppressor proteins comprises ATM (ataxia-telangiectasia sudden change), ATR (ataxia-telangiectasia is relevant with Rad3), EGFR (EGF-R ELISA), ERBB2 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 2), ERBB3 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 3), ERBB4 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 4), Notch1, Notch2, Notch3, Notch4, ATK1 (v-akt Muridae thymoma Viral Carcinogenesis gene homologue 1), ATK2 (v-akt Muridae thymoma Viral Carcinogenesis gene homologue 2), ATK3 (v-akt Muridae thymoma Viral Carcinogenesis gene homologue 3), (oxygen deficient induction factor 1 a) for HIF1a, (oxygen deficient induction factor 1 a) for HIF3a, Met (met proto-oncogene), HRG (being rich in Histidine glycoprotein), Bc12, PPAR (α) (Peroxisome proliferator activated receptors α), Ppar (γ) (peroxisome proliferator-activated receptor γ), WT1 (Wilmus tumour 1), FGF1R (desmocyte growth factor-21 acceptor), FGF2R (desmocyte growth factor-21 acceptor), FGF3R (fibroblast growth factor 3 acceptors), FGF4R (fibroblast growth factor 4 acceptors), FGF5R (FGF5 acceptor), CDKN2a (cyclin-dependent kinase enzyme inhibition factor 2), APC (adenoma polyposis intestinal bacteria), Rb1 (retinoblastoma 1), MEN1 (various internal secretion tumorigenesis 1), VHL (von-Hippel-Lindau tumor suppressor gene), BRCA1 (mammary cancer 1), BRCA2 (mammary cancer 2), AR (androgen receptor), TSG101 (Tumor susceptibility gene 101), Igf1 (type-1 insulin like growth factor), Igf2 (IMA-IGF2BP3-001), Igf1R (type-1 insulin like growth factor acceptor), Igf2R (IMA-IGF2BP3-001 acceptor), Bax (BCL-2 be correlated with X protein matter), CASP1 (caspase 1), CASP2 (caspase 2), CASP3 (Caspase-3), CASP4 (caspase 4), CASP6 (caspase 6), CASP7 (caspase 7), CASP8 (caspase 8), CASP9 (caspase 9), CASP12 (caspase 12), Kras (v-Ki-ras2 Kirsten rat sarcoma virus oncogene homologue), PTEN (phosphoric acid ester and tensin homologue), BCRP (mammary cancer receptor protein), p53 and combination thereof.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in the research tumor suppression to study the effect of sudden change for animal and tumor suppression.In one embodiment, the genetically modified animal that comprises the inactivation chromosome sequence that relates to tumor suppression can be used for determining the susceptibility of development tumour.Described method comprises that genetically modified animal and the wild-type animal that will comprise inactivation tumor suppressor gene sequence are exposed to carcinogenic substance, then monitor tumor development.The tumour that the animal that comprises inactivation tumor suppressor gene sequence can have increase forms risk.In addition, the animal of isozygotying for inactivation tumor suppressor gene sequence can have the risk of increase with respect to the animal of identical inactivation sequence heterozygosis, and described heterozygosis animal transfers can have the risk of increase with respect to the wild-type animal.Similarity method can be used for screening spontaneous tumor, and wherein animal as above is not exposed to carcinogenic substance.

In another embodiment, the animal that comprises the inactivation chromosome sequence relevant to tumor suppression can be used for assessing the carcinogenic possibility of test substances.Described method comprises that the genetically modified animal that will comprise inactivation tumor suppressor gene sequence contacts with test substances with the wild-type animal, then monitors the development of tumour.If with respect to the wild-type animal, the animal that comprises inactivation tumor suppressor gene sequence has the tumor incidence of increase, and test substances can be carinogenicity.

j. Secretases associated conditions

Secretases forms a different set of protein, and it affects for the susceptibility of many illnesss, the appearance of illness, seriousness or its any combination of illness.Secretases be can cut off another transmembrane protein than the enzyme of small segment.Secretases relates to many illnesss, comprises for example A Zihaimo disease.In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence be associated with the Secretases associated conditions is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences that are associated with the Secretases associated conditions.The Secretases associated conditions empirical correlation that protein or control sequence can be usually occur based on Secretases related protein and Secretases illness that is associated is selected.For example, with respect to the colony that there is no the Secretases illness, in the colony of suffering from the Secretases illness, with production rate or the circulation composition of Secretases illness related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

As unrestricted example, the protein relevant to the Secretases illness comprises PSENEN (presenilin enhanser 2 homologues (Caenorhabditis elegans)), CTSB (cathepsin B), PSEN1 (presenilin 1), APP (amyloid (A4) precursor protein), APH1B (anterior pharynx defect 1 homologue B (Caenorhabditis elegans)), PSEN2 (presenilin 2 (A Zihaimo disease 4)), BACE1 (β-site APP-lyase 1), ITM2B (integral membrane protein matter 2B), CTSD (cathepsin D), NOTCH1 (Notch homologue 1, transposition be correlated with (fruit bat)), TNF (tumour necrosis factor (TNF Superfamily, the member 2)), INS (Regular Insulin), DYT10 (tension force abnormal 10), ADAM17 (ADAM metallopeptidase territory 17), APOE (apo E), ACE (angiotensin I saccharase (peptidyl-dipeptidase A) 1), STN (statin), TP53 (oncoprotein matter p53), IL6 (interleukin 6 (Interferon, rabbit, β 2)), NGFR (trk C (TNFR Superfamily, the member 16)), IL1B (interleukin 1, β), ACHE (acetylcholinesterase (Yt blood group)), CTNNB1 (catenin (cadherin related protein), β 1,88kDa), IGF1 (type-1 insulin like growth factor (somatomedin C)), IFNG (Interferon, rabbit, γ), NRG1 (neuregulin 1), CASP3 (Caspase-3, apoptosis be correlated with halfcystine peptase), MAPK1 (mitogen activated protein kinase 1), CDH1 (cadherin 1, Class1, CAM 120/80 (epithelium)), APBB1 (amyloid (A4) precursor protein-combination, the B of family, member 1 (Fe65)), HMGCR (3-hydroxy-3-methylglutaric acid base-CoA-reductase), CREB1 (cAMP response element Binding Protein 1), PTGS2 (prostaglandin(PG)-endoperoxide synthetic enzyme 2 (prostaglandin G/H sythase and cyclooxygenase)), HES1 (crinosity and enhanser, rupture 1, (fruit bat)), CAT (catalase), TGFB1 (transforming growth factor, β 1), ENO2 (Hydratase, phosphoenolpyruvate 2 (γ, neurone)), ERBB4 (v-erb-a EBL Viral Carcinogenesis gene homologue 4 (birds)), TRAPPC10 (protein particulate complex body 10 shuttles back and forth), MAOB (monoamine oxidase-B), NGF (nerve growth factor (beta polypeptides)), MMP12 (matrix metal peptase 12 (MMP12)), JAG1 (spination 1 (Alagille syndrome)), CD40LG (CD40L), PPARG (peroxisome proliferator-activated receptor γ), FGF2 (FGF2 (alkalescence)), IL3 (interleukin Ⅲ (colony-stimulating factor, various)), LRP1 (low density lipoprotein receptor associated protein white matter 1), NOTCH4 (Notch homologue 4 (fruit bat)), MAPK8 (mitogen activated protein kinase 8), PREP (prolyl endopeptidase), NOTCH3 (Notch homologue 3 (fruit bat)), PRNP (prion protein), CTSG (cathepsin G), EGF (Urogastron (β-urogastrone)), REN (feritin), CD44 (CD44 molecule (India's blood group)), SELP (selecting plain P (membrane granulosa protein matter 140kDa, antigens c D62)), GHR (growth hormone receptor), ADCYAP1 (adenylate cyclase activated polypeptides 1 (hypophysis)), INSR (insulin receptor), GFAP (glial fibrillary acidic protein matter), MMP3 (matrix metal peptase 3 (Stromelysin-1, front gelatinase)), MAPK10 (mitogen activated protein kinase 10), SP1 (Sp1 transcription factor), MYC (v-myc myelocytomatosis Viral Carcinogenesis gene homologue (birds)), CTSE (cathepsin E), PPARA (Peroxisome proliferator activated receptors α), JUN (jun oncogene), TIMP1 (TIMP TIMP metallopeptidase inhibitor 1), IL5 (t cell growth factor (colony-stimulating factor, eosinophilic granulocyte)), IL1A (interleukin 1, α), MMP9 (matrix metal peptase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V collagenase)), HTR4 (serotonin (thrombotonin) acceptor 4), HSPG2 (Suleparoid protein-polysaccharide 2), Kras (v-Ki-ras2Kirsten rat sarcoma virus oncogene homologue), CYCS (cytochrome C, somatocyte), SMG1 (SMG1 homologue, phosphatidyl-inositol 3-kinase associated kinase (Caenorhabditis elegans)), IL1R1 (interleukin 1 receptor, type I), PROK1 (front dynein 1), MAPK3 (mitogen activated protein kinase 3), NTRK1 (neurotrophy Tyrosylprotein kinase, acceptor, Class1), IL13 (interleukin-13), MME (film metal-endopeptidase), TKT (transketolase), CXCR2 (chemokine (C-X-C motif) acceptor 2), IGF1R (type-1 insulin like growth factor acceptor), RARA (retinoid receptor, α), CREBBP (CREB is in conjunction with albumen), PTGS1 (prostaglandin(PG)-endoperoxide synthetase 1 (prostaglandin G/H sythase and cyclooxygenase)), GALT (galactose-1-phosphate ester uridine base saccharase), CHRM1 (cholinergic receptor, muscarine 1), ATXN1 (ataxia albumen 1), PAWR (PRKC, apoptosis, WT1, regulatory factor), NOTCH2 (Notch homologue 2 (fruit bat)), M6PR (Man-6-P ester acceptor (positively charged ion dependency)), CYP46A1 (Cytochrome P450, family 46, subfamily a, polypeptide 1), CSNK1D (Casein kinase 1, δ), MAPK14 (mitogen activated protein kinase 14), PRG2 (protein-polysaccharide 2, marrow (natural killer cell activation body, eosinophil particle major basic protein)), PRKCA (protein kinase C, α), L1CAM (L1 cell adhesion molecule), CD40 (CD40 molecule, TNF acceptor Superfamily member 5), NR1I2 (member 2 for nuclear receptor subfamily 1, group I), JAG2 (spination 2), CTNND1 (catenin (cadherin related protein), δ 1), CDH2 (cadherin 2, Class1, N-cadherin (neurone)), CMA1 (Chymotrypsin 1, mastocyte), SORT1 (sorting protein 1), DLK1 (δ sample 1 homologue (fruit bat)), THEM4 (thioesterase Superfamily member 4), JUP (connection plakoglobin), CD46 (CD46 molecule, CCP matter), CCL11 (chemokine (C-C motif) ligand 1 1), CAV3 (caveolin 3), RNASE3 (ribo nucleo tidase, RNA enzyme family, 3 (eosinophil cationic proteins)), HSPA8 (heat-shocked 70kDa protein 8), CASP9 (caspase 9, apoptosis be correlated with halfcystine peptase), CYP3A4 (Cytochrome P450, family 3, subfamily A, polypeptide 4), CCR3 (chemokine (C-C motif) acceptor 3), TFAP2A (transcription factor AP-1-2 α (activation enhancer binding protein 2 α)), SCP2 (sterol carrier protein matter 2), CDK4 (cyclin-dependant kinase 4), HIF1A (oxygen deficient induction factor 1, alpha subunit (alkaline helix-loop-helix transcription factor)), TCF7L2 (transcription factor 7 samples 2 (T-cell-specific, HMG-box)), IL1R2 (interleukin 1 receptor, Type II), B3GALTL (β 1,3-galactosyltransferase sample), MDM2 (Mdm2 p53 is in conjunction with albumen homologue (mouse)), RELA (v-rel reticuloendotheliosis virus oncogene homologue A (birds)), CASP7 (caspase 7, apoptosis be correlated with halfcystine peptase), IDE (Regular Insulin-degrading enzyme), FABP4 (FABP4, adipocyte), CASK (calcium/calmodulin-dependency serineprotein kinase (MAGUK family)), ADCYAP1R1 (adenylate cyclase activated polypeptides 1 (hypophysis) acceptor type I), ATF4 (transcriptional factors 4 (tax-replys enhancer element B67)), PDGFA (thrombocyte-derivative growth factor α polypeptide), C21orf33 (karyomit(e) 21 open reading frame 33), SCG5 (secretogranin V (7B2 protein)), RNF123 (ring finger protein 123), NFKB1 (Nuclear factor kappa light chain polypeptide genetic enhancer B-cell 1), ERBB2 (v-erb-b2 EBL Viral Carcinogenesis gene homologue 2, nerve/glioblastoma derives oncogene homologue (birds)), CAV1 (caveolin-1, caveolin matter, 22kDa), MMP7 (matrix metal peptase 7 (matrix crack protein, uterus)), TGFA (transforming growth factor, α), RXRA (retinoids X acceptor, α), STX1A (syntaxin 1A (brain)), PSMC4 (proteasome (precursor, huge protein factor) 26S subunit, ATP enzyme, 4), P2RY2 (purinoceptor P2Y, G-albumen coupling, 2), TNFRSF21 (Tumor Necrosis Factor Receptors Superfamily, the member 21), DLG1 (discs, large homologue 1 (fruit bat)), NUMBL (numb homologue (fruit bat) sample), SPN (sialophorin), PLSCR1 (phosphatide splicing enzyme 1), UBQLN2 (ubiquinone protein 2), UBQLN1 (ubiquinone protein 1), PCSK7 (proprotein convertases subtilisin/can glad type 7), SPON1 (vertebra albumen 1, extracellular matrix proteins), SILV (silver-colored homologue (mouse)), QPCT (glutaminyl-peptide cyclotransferase), HES5 (crinosity and enhanser, 5 (fruit bats) of rupturing), GCC1 (GRIP and contain coiled coil territory 1) and its any combination.

The preferred protein relevant to the Secretases illness comprises APH-1A (anterior pharynx-defect 1, α), APH-1B (anterior pharynx-defect 1, β), PSEN-1 (presenilin-1), NCSTN (slow-witted albumen), PEN-2 (presenilin toughener 2) and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research Secretases illness to study the effect of sudden change for animal and the development of Secretases associated conditions and/or progress.

The morbidity of Secretases illness or indication can naturally-occurrings in genetically modified animal.In addition, the morbidity of Secretases illness or indication can be facilitated by being exposed to destructive medicament.The unrestricted example of destructive medicament comprises such as any protein relevant to the Secretases illness as above, medicine, toxin, chemical, activation retrovirus and environmental stress.The unrestricted example of environmental stress comprises forced swimming, cold water swimming, the stimulation of platform vibrator, loud noise and Restraint Stress.

k. amyotrophic lateral sclerosis

The protein of some nucleotide sequence and its coding is relevant to the motor neuron illness.These sequences form a different set of sequence, the seriousness of the susceptibility of its motor neuron illness that interferes with the development, the existence of motor neuron illness, motor neuron illness or its any combination.In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to special exercise neurone illness amyotrophic lateral sclerosis (ALS) is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to ALS.The chromosome sequence relevant to the ALS empirical correlation based on ALS correlated series and ALS usually selected.ALS associated nucleic acid sequences codified ALS related protein or can be ALS relevant control sequence.For example, with respect to the colony that there is no ALS, in suffering from the colony of ALS, with production rate or the circulation composition of ALS related protein, can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

As unrestricted example, the protein relevant to ALS includes but not limited to SOD1 (superoxide dismutase 1), ALS2 (amyotrophic lateral sclerosis 2), FUS (sarcoma fusion gene), TARDBP (tar dna is in conjunction with albumen), VAGFA (VEGF-A), VAGFB (vascular endothelial growth factor B) and VAGFC (vascular endothelial growth factor C) and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research ALS to study the effect of sudden change for animal and ALS development and/or progress.

l. prion disease

The PrPC illness is the protein conformation disease seemingly, and it causes abnormal protein to be assembled.In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to prion disease is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In some embodiments, protein that can be relevant to the Protein virus illness to one or more codings or the chromosome sequence of control sequence are edited.The Protein virus illness associated nucleic acid sequences empirical correlation based on Protein virus illness associated nucleic acid sequences and Protein virus illness is usually selected.Protein virus illness associated nucleic acid sequences codified Protein virus illness related protein or its isotype, or can be Protein virus illness relevant control sequence.For example, with respect to the colony that there is no the Protein virus illness, in the colony of suffering from the Protein virus illness, production rate or the circulation composition of Protein virus illness related protein can raise or reduce.The difference of protein or some isotype level can be assessed with proteomic techniques, and described technology includes but not limited to western blotting, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA) and mass spectroscopy.In addition, Protein virus illness related protein can identify by the gene expression profile that obtains the gene of coded protein by genome-based technologies, and described technology includes but not limited to DNA microarray analysis, serial analysis of gene expression (SAGE) and quantitative real-time polymerase chain reaction (Q-PCR).

The unrestricted example of Protein virus illness related protein comprises PrP ^cwith its isotype, PrP ^scwith its isotype, HECTD2 (e3-ubiquitin ligase protein), STI1 (pressure inducement protein 1), DPL (residue Doppel protein, by the Prnd coding), APOA1 (Apolipoprotein A1), BCL-2 (B cell lymphoma 2), HSP60 (heat-shocked 60kDa protein), BAX-inhibiting peptide (Bcl-2-be correlated with X protein matter supressor), NRF2 (the core breathing factor 2), NCAM (nerve cell adhesion molecule), heparin, ln and laminin receptor.

The unrestricted example of gene that in addition, can be relevant to the neurodegeneration symptom of prion illness comprises A2M (α-2-macroglobulin), AATF (Apoptosis antagonism transcription factor), ACPP (acid phosphatase prostate), ACTA2 (actin α 2 smooth muscle sustainers), ADAM22 (ADAM metallopeptidase territory), ADORA3 (adenosine A 3 receptor), ADRA1D (α of α-1D adrenocepter-1D adrenocepter), AHSG (α-2-HS-glycoprotein), AIF1 (allograft inflammatory factor 1), ALAS2 (δ-aminolevulinic acid synzyme 2), AMBP (α-1-microglobulin/bikunin precursor), ANK3 (Ankryn 3), ANXA3 (annexin A 3), APCS (amyloid P component serum), APOA1 (Apolipoprotein A1), APOA12 (ApoA2), APOB (apolipoprotein B), APOC1 (ApoC1), APOE (apo E), APOH (Apolipoprotein H), APP (amyloid precusor protein), ARC (activity-regulating cell skeleton related protein), ARF6 (ADP-ribosylation factor 6), ARHGAP5 (Rho GTP enzyme activation protein 5), ASCL1 (Achaete-scute homologue 1), B2M (beta-2 microglobulin), B4GALNT1 (β-Isosorbide-5-Nitrae-N-acetyl group-galactosaminyl transferase 1), BAX (Bcl-2-be correlated with X protein matter), BCAT (branched-chain amino acid transaminase 1 cytoplasm), BCKDHA (BCKA dehydrogenase E1 α), BCKDK (branched-chain alpha-keto acid dehydrogenase kinases), BCL2 (B cell lymphoma 2), BCL2L1 (BCL2 sample 1), BDNF (being derived from the neurotrophic factor of brain), BHLHE40 (kind E bHLH protein matter 40), BHLHE41 (kind E bHLH protein matter 41), BMP2 (bone morphogenetic protein-2 A), BMP3 (bone morphogenetic protein 3), BMP5 (bone morphogenetic protein 5), BRD1 (containing Bu Luomo domain 1), BTC (second born of the same parents' element), BTNL8 (butyrophilin sample protein 8), CALB1 (calbindin 1), CALM1 (calmodulin 1), CAMK1 (calcium/calmodulin-deopendent protein kinase type I), CAMK4 (calcium/calmodulin-deopendent protein kinase type I V), CAMKIIB (calcium/calmodulin-deopendent protein kinase Type II B), CAMKIIG (calcium/calmodulin-deopendent protein kinase Type II G), CASP11 (caspase-1 0), CASP8 (caspase 8 Apoptosis be correlated with cysteine peptase), CBLN1 (cerebellin 1 precursor), CCL2 (chemotactic factor (CF) (C-C motif) part 2), CCL22 (chemotactic factor (CF) (C-C motif) part 22), CCL3 (chemotactic factor (CF) (C-C motif) part 3), CCL8 (chemotactic factor (CF) (C-C motif) part 8), CCNG1 (cyclin-G1), CCNT2 (cyclin T2), CCR4 (C-C chemokine receptors type 4 (CD194)), CD58 (CD58), CD59 (protection element), CD5L (CD5 antigen sample), CD93 (CD93), CDKN2AIP (CDKN2A interacting protein), CDKN2B (cyclin-dependent kinase enzyme inhibition factor 2B), CDX1 (homology frame protein C DX-1), CEA (carcinomebryonic antigen), CEBPA (CCAAT/ enhancer-bindin alpha), CEBPB (CCAAT/ enhancer binding protein C/EBP β), CEBPB (the CCAAT/ enhancer-in conjunction with albumen β), CEBPD (the CCAAT/ enhancer-in conjunction with albumen δ), CEBPG (the CCAAT/ enhancer-in conjunction with albumen γ), CENPB (kinetochore PROTEIN B), CGA (glycoprotein hormones α chain), CGGBP1 (CGG triplet repetitive sequence-Binding Protein 1), CHGA (Chromogranin A), CHGB (secretoneurin), CHN2 (β-chimericin), CHRD (element occurs notochord), CHRM1 (cholinergic recepter muscarine 1), CITED2 (Cbp/p300-interaction trans-activating factor 2), CLEC4E (the 4 member E of C-type lectin domain family), CMTM2 (protein 2 that the CKLF sample contains the MARVEL membrane-spanning domain), CNTN1 (contactin 1), CNTNAP1 (contactin related protein sample 1), CR1 (red blood cell complement receptor 1), CREM (the cAMP-response element is regulated son), CRH (cortin releasing hormone), CRHR1 (cortin releasing hormone receptor 1), CRKRS (CDC 2 related protein kinases 7), CSDA (DNA-is in conjunction with albumen), CSF3 (granulocyte colony stimulating factor 3), CSF3R (G-CSF 3 acceptors), CSP (chemosensory protein matter), CSPG4 (chondroitin sulfate proteoglycan 4), CTCF (CCCTC-binding factor zinc finger protein matter), CTGF (CTGF), CXCL12 (Chemokines CC-X-C motif ligand 1 2), DAD1 (the dead factor 1 of anti-cell), DAXX (dead related protein 6), DBN1 (Drebrin1), DBP (the D site of albumin promoter-albumin D-box binding protein), DDR1 (discoidin domain receptor family member 1), DDX14 (DEAD/DEAH box unwindase), DEFA3 (sozin α 3 neutrophil leucocytes-specificity), DVL3 (dsh homologue 3 at random), EDN1 (Endothelin 1), EDNRA (endothelin receptor type A), EGF (EGF), EGFR (EGF-R ELISA), EGR1 (early growth response protein matter 1), EGR2 (early growth response protein matter 2), EGR3 (early growth response protein matter 3), EIF2AK2 (eukaryotic translation initiation factor 2-alpha kinase 2), ELANE (expression of elastoser neutrophil leucocyte), ELK1 (the ELK1 member of ETS oncogene family), ELK3 (ELK3ETS-territory protein (SRF auxiliary protein 2)), EML2 (echinoderm microtubule-associated proteins sample 2), EPHA4 (EPH acceptor A4), ERBB2 (V-erb-b2 EBL Viral Carcinogenesis gene homologue 2), ERBB3 (receptor tyrosine-protein kinase erbB-3), ESR2 (estrogen receptor 2), ESR2 (estrogen receptor 2), ETS1 (V-ets erythroblastosis virus E26 oncogene homologue 1), ETV6 (ETS variant 6), FASLG (FasL TNF Superfamily member 6), FCAR (the Fc fragment of IgA acceptor), FCER1G (the Fc fragment of the IGE high-affinity I acceptor of γ polypeptide), FCGR2A (the Fc fragment-CD32 of IgG low-affinity IIa acceptor), FCGR3B (the Fc fragment-CD16b of IgG low-affinity IIIb acceptor), FCGRT (the Fc fragment of IgG acceptor transporter α), FGA (alkaline fiber proteinogen), FGF1 (acid fibroblast growth factor 1), FGF14 (fibroblast growth factor 14), FGF16 (desmocyte growth factor-21 6), FGF18 (fibroblast growth factor 18), FGF2 (HBGH-2), FIBP (acid fibroblast growth factor ICBP), FIGF (growth factor that C-fos induces), FMR1 (fragile X mental retardation 1), FOSB (FBJ Muridae osteosarcoma virus oncogene homologue B), FOXO1 (jaw frame O1), FSHB (follicle-stimulating hormone (FSH) beta polypeptides), FTH1 (the heavy polypeptide 1 of ferritin), FTL (ferritin light polypeptide), G1P3 (but interferon-' alpha '-induced protein 6), G6S (2-Acetamido-2-deoxy-D-glucose-6-sulfatase), GABRA2 (GABA A receptor alpha 2), GABRA3 (GABA A receptor alpha 3), GABRA4 (GABA A receptor alpha 4), GABRB1 (GABA A receptor β 1), GABRG1 (GABA A receptor y 1), GADD45A (growth retardation and DNA-wound inducement α), GCLC (Glutamate-cysteine ligase catalytic subunit), GDF15 (growth and differentiation factor 15), GDF9 (growth differentiation factor 9), GFRA1 (GDNF family receptors α 1), GIT1 (G albumen-coupled receptor kinase interacts sub 1), GNA13 (guanylic acid-in conjunction with albumen/G protein alpha 13), GNAQ (guanine-nucleotide-binding protein/G albumen q polypeptide), GPR12 (G albumen-coupled receptor 12), GPR18 (G albumen-coupled receptor 18), GPR22 (G albumen-coupled receptor 22), GPR26 (G albumen-coupled receptor 26), GPR27 (G albumen-coupled receptor 27), GPR77 (G albumen-coupled receptor 77), GPR85 (G albumen-coupled receptor 85), GRB2 (growth factor receptors-in conjunction with albumen 2), GRLF1 (glucocorticoid receptor dna binding factor 1), GST (glutathione S-transferase), GTF2B (general transcription factor IIB), GZMB (granzyme B), HAND1 (heart and neural crest derivative express 1), HAVCR1 (hepatitis viruse cell receptor 1), HES1 (crinosity and enhancer rupture 1), HES5 (crinosity and enhancer rupture 5), HLA-DQA1 (major histocompatibility complex class IIDQ α), HOXA2 (homology frame A2), HOXA4 (homology frame A4), HP (hoptoglobin), HPGDS (prostaglandin-D synzyme), HSPA8 (heat shock 70kDa protein 8), HTR1A (5-hydroxytryptamine receptor 1), HTR2A (5-hydroxytryptamine receptor 2A), HTR3A (5-hydroxytryptamine receptor 3A), ICAM1 (ICAM-1 (CD54)), IFIT2 (thering is interferon-induced protein multiple 2 that the triangle tetrapeptide is heavy), IFNAR2 (interferon α/β/Ω acceptor 2), IGF1 (type-1 insulin like growth factor), IGF2 (IMA-IGF2BP3-001), IGFBP2 (IGFBP2,36kDa), IGFBP7 (PSF), IL10 (interleukin 10), IL10RA (Interleukin 10 receptor α), IL11 (interleukin-11), IL11RA (interleukin-11 receptor alpha), IL11RB (interleukin-11 receptor β), IL13 (interleukin-13), IL15 (interleukin 15), IL17A (IL-17), IL17RB (IL-17 acceptor B), IL18 (interleukin-18), IL18RAP (interleukin 18 receptor auxiliary protein), IL1R2 (interleukin 1 receptor Type II), IL1RN (IL-1 R antagonist), IL2RA (interleukin 2 receptor α), IL4R (interleukin-4 acceptor), IL6 (interleukin-6), IL6R (interleukin-6 receptor), IL7 (interleukin-17), IL8 (interleukin 8), IL8RA (interleukin 8 receptor alpha), IL8RB (interleukin 8 receptor β), ILK (integrin-chain kinases), INPP4A (inositol polyphosphate-4-phosphatase type I, 107kDa), INPP4B (inositol polyphosphate-4-phosphatase type I β), INS (insulin), IRF2 (interferon regulatory factor 2), IRF3 (interferon regulatory factor 3), IRF9 (interferon regulatory factor 9), IRS1 (substrate 1), ITGA4 (integrin alpha-4), ITGA6 (beta 2 integrin alpha-6), ITGAE (beta 2 integrin alpha E), ITGAV (beta 2 integrin alpha-V), JAG1 (zigzag 1), JAK1 (Janus kinases 1), JDP2 (Jun dimerization protein 2), JUN (Jun oncogene), JUNB (JunB former-oncogene), KCNJ15 (potassium inward rectification passage subfamily J member 15), KIF5B (kinesin family member 5B), KLRC4 (killer cell agglutinin receptor subfamily C member 4), KRT8 (CK8), LAMP2 (lysosome related membrane protein matter 2), LEP (leptin), LHB (luteinizing hormone(LH beta polypeptides), LRRN3 (being rich in leucic repetitive sequence neuron 3), MAL (MA1 T-Cell Differentiation protein), MAN1A1 (mannosidase α class 1 member 1), MAOB (MAO-B), MAP3K1 (mitogen activated protein kinase kinase kinase 1), MAPK1 (mitogen activated protein kinase 1), MAPK3 (mitogen activated protein kinase 3), MAPRE2 (microtubule-associated proteins RP/EB family member 2), MARCKS (myristoylation alanine-be rich in protein kinase C substrate), MAS1 (MAS1 oncogene), MASL1 (MAS1 oncogene sample), MBP (MBP ELISA), MCL1 (bone marrow cell leukaemia sequence 1), MDMX (MDM2 sample p53-is in conjunction with albumen), MECP2 (methyl CpG is in conjunction with albumen 2), MFGE8 (milk globules-EGF factor 8 protein), MIF (macrophage migration inhibitory factor), MMP2 (matrix metal peptase 2), MOBP (myelin be correlated with oligodendrocyte basic protein), MUC16 (cancer antigen 125), MX2 (myxovirus (influenza virus) resistance 2), MYBBP1A (MYB Binding Protein 1), NBN (Nibrin), NCAM1 (N-CAM 1), NCF4 (neutrophil leucocyte cytoplasmic factor 440kDa), NCOA1 (nuclear receptor conactivator 1), NCOA2 (nuclear receptor conactivator 2), NEDD9 (neural precursor is expressed to grow and lowered 9), NEUR (neuraminidase), NFATC1 (nuclear factor of activation T-cell, cytoplasm calcineurin-dependence 1), NFE2L2 (red blood cell-derivative nuclear factor 2 samples 2), NFIC (nuclear factor I/C), NFKBIA (nuclear factor of the kappa light polypeptide genetic enhancer in B-cytostatic factor α), NGFR (trk C), NIACR2 (niacin receptor 2), NLGN3 (the neural albumen 3 that connects), NPFFR2 (neuropeptide FF receptor 2), NPY (neuropeptide tyrosine), NR3C2 (3 groups of C members 2 of nuclear receptor subfamily), NRAS (neuroblastoma RAS virus (v-ras) oncogene homologue), NRCAM (neuronal cell adhesion molecule), NRG1 (neuregulin 1), NRTN (neural order albumen), NRXN1 (neuronin 1), NSMAF (neutral sphingomyelinase enzyme activation correlation factor), NTF3 (NT-3), NTF5 (neurotrophin 4/5), ODC1 (ornithine decarboxylase 1), OR10A1 (olfactory receptor 10A1), OR1A1 (the 1 subfamily a member 1 of olfactory receptor family), OR1N1 (the 1 subfamily N member 1 of olfactory receptor family), OR3A2 (the 3 subfamily a members 2 of olfactory receptor family), OR7A17 (the 7 subfamily A members 17 of olfactory receptor family), ORM1 (AGP1), OXTR (ocytocin receptor), P2RY13 (purinoceptor P2YG-albumen coupling 13), P2Y12 (purinoceptor P2YG-protein coupling 12), P70S6K (P70S6 kinases), PAK1 (P21/Cdc42/Rac1-activated protein kinase 1), PAR1 (Prader-Willi/Angelman district-1), PBEF1 (pre B cell colony promoting factor 1), PCAF (P300/CBP correlation factor), PDE4A (cAMP-specificity 3 ', 5 '-cPDE 4), PDE4B (PDE4B cAMP-specificity), PDE4B (PDE4B cAMP-specificity), PDE4D (phosphodiesterase 4 DcAMP-specificity), PDGFA (blood platelet-derivative growth factor α polypeptide), PDGFB (blood platelet-derivative growth factor beta polypeptides), PDGFC (platelet-derived growth factor C), PDGFRB (β-type blood platelet-derived growth factor receptor), PDPN (flatfoot albumen), PENK (enkephalins), PER1 (cycle homologue 1), PLA2 (phospholipase A2), PLAU (plasminogen activation body urokinase), PLXNC1 (clump PROTEIN C 1), PMVK (phosphomevalonate kinase), PNOC (front former pain albumen), POLH (polymerase (DNA mediation) eta), POMC (POMC (corticotropin/β-cytokinesin/α-melanocyte-stimulatinghormone/β-melanocyte stimulating hormone/beta-endorphin)), POU2AF1 (POU territory class 2 associated factor 1s), PRKAA1 (5 '-the AMP-activated protein kinase α of catalytic subunit-1), PRL (lactogen), PSCDBP (born of the same parents' MUC-1 interacting protein), PSPN (Persephin), PTAFR (blood platelet-activation factor acceptor), PTGS2 (prostaglandin-endoperoxide synzyme 2), PTN (PTN), PTPN11 (the non-acceptor type 11 of protein tyrosine phosphatase), PYY (PYY), RAB11B (RAB11B member RAS oncogene family), RAB6A (RAB6A member RAS oncogene family), RAD17 (RAD17 homologue), RAF1 (RAF former-oncogene serine/threonine-protein kinase), RANBP2 (RAN is in conjunction with albumen 2), RAP1A (the RAS oncogene RAP1A member of family), RB1 (retinoblastoma 1), RBL2 (retinoblastoma sample 2 (p130)), RCVRN (recoverin), REM2 (RAS/RAD/GEM sample GTP is in conjunction with 2), RFRP (RF acid amides related peptide), RPS6KA3 (ribosomal protein S6K 90kDa polypeptide 3), RTN4 (reticuloprotein 4), RUNX1 (dwarf's associated transcription factor 1), S100A4 (S100A4), S1PR1 (sphingosine-1-phosphate ester acceptor 1), SCG2 (secretogranin II), SCYE1 (I inducing cell factor subfamily E member 1), SELENBP1 (selenium Binding Protein 1), SGK (serum/glucocorticoid regulation and control kinases), SKD1 (K+ transportation growth defect suppressor 1), SLC14A1 (member 1 of solute carrier family 14 (urea transporter) (Kidd blood group)), SLC25A37 (25 members 37 of solute carrier family), SMAD2 (SMAD family member 2), SMAD5 (SMAD family member 5), SNAP23 (synapse-related protein matter 23kDa), SNCB (synapse nucleoprotein β), SNF1LK (SNF1 sample kinases), SORT1 (sorting protein 1), SSB (Sjogren syndrome antigen B), STAT1 (signal transduction and transcription activating body 1,91kDa), STAT5A (signal transduction and transcription activating body 5), STAT5B (signal transduction and transcription activating body 5B), TX16 (syntaxin 16), TAC1 (tachykinin precursor 1), TBX1 (T box 1), TEF (TH embryo factor), TF (transferrins), TGFA (transforming growth factor α), TGFB1 (transforminggrowthfactor-β1), TGFB2 (transforming grouth factor beta 2), TGFB3 (transforming growth factor β 3), TGFBR1 (transforming growth factor β receptor I), TGM2 (TGase 2), THPO (TPO), TIMP1 (TIMP TIMP metallopeptidase inhibitor 1), TIMP3 (TIMP metallopeptidase initiator 3), TMEM129 (transmembrane protein 129), TNFRC6 (TNFR/NGFR is rich in the cysteine district), TNFRSF10A (Tumor Necrosis Factor Receptors Superfamily member 10a), TNFRSF10C (Tumor Necrosis Factor Receptors Superfamily member 10c become rusty erbium, there is no the cell internal area), TNFRSF1A (Tumor Necrosis Factor Receptors Superfamily member 1A), TOB2 (transformation factor 2 of ERBB2), TOP1 (topoisomerase (DNA) I), TOPOII (topoisomerase 2), TRAK2 (transport protein matter kinesin is in conjunction with 2), TRH (thyrotropin-releasing hormone (TRH)), TSH (thyroid gland-stimulation hormone α), TUBA1A (tubulin α 1), TXK (TXK EGFR-TK), TYK2 (EGFR-TK 2), UCP1 (Uncoupling Proteins 1), UCP2 (Uncoupling Proteins 2), ULIP (Unc-33 sample phosphoprotein), UTRN (dystrophin related protein), VEGF (VEGF), VGF (the VGF nerve growth factor can be induced), VIP (vasoactive intestinal peptide), VNN1 (Vanin1), VTN (vitronectin), WNT2 (aptery type MMTV integration site family member 2), XRCC6 (the staggered complementary gene 6 of repairing of x-ray), ZEB2 (zinc refers to that the combination of E-box is with source capsule 2) and ZNF461 (zinc finger protein matter 461).

Exemplary Protein virus illness related protein comprises PrP ^cwith its isotype, PrP ^scwith its isotype, HECTD2 (e3-ubiquitin ligase protein), STI1 (pressure inducement protein 1), DPL (residue Doppel protein, by the Prnd coding), APOA1 (Apolipoprotein A1), BCL-2 (B cell lymphoma 2), HSP60 (heat-shocked 60kDa protein), BAX-inhibiting peptide (Bcl-2-be correlated with X protein matter supressor), NRF2 (the core breathing factor 2), NCAM (neurocyte-adhesion molecule), heparin, ln and laminin receptor and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research Protein virus illness to study the effect of sudden change for animal and the development of Protein virus illness and/or progress.

m. immune deficiency

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to immune deficiency is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to immune deficiency.Immune deficiency protein or control sequence are protein or the control sequences that activity change is relevant to immune deficiency, and it can be Animal diseases or symptom, primary or the Secondary Symptom of preferred mammal (for example people) disease or symptom.The immune deficiency sequence can be usually based on immune deficiency sequence and immune deficiency disorder or symptom, and especially the empirical correlation of Mammals (for example people) disease or symptom is selected.For example, with respect to the colony that there is no disease or symptom, in the colony of suffering from immune deficiency disorder or symptom, the immune deficiency protein expression in particular organization can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of human immune deficiency gene comprises A2M[α-2-macroglobulin]; AANAT[aralkylamine N-acetyl-transferase]; ABCA1[ATP-is in conjunction with box, subfamily (ABC1), the member 1]; ABCA2ATP-is in conjunction with box, subfamily (ABC1), the member 2]; ABCA3[ATP-is in conjunction with box, subfamily (ABC1), the member 3]; ABCA4[ATP-is in conjunction with box, subfamily (ABC1), the member 4]; ABCB1[ATP-is in conjunction with box, subfamily B (MDR/TAP), the member 1]; ABCC1[ATP-is in conjunction with box, subfamily C (CFTR/MRP), the member 1]; ABCC2[ATP-is in conjunction with box, subfamily C (CFTR/MRP), the member 2]; ABCC3[ATP-is in conjunction with box, subfamily C (CFTR/MRP), the member 3]; ABCC4[ATP-is in conjunction with box, subfamily C (CFTR/MRP), the member 4]; ABCC8[ATP-is in conjunction with box, subfamily C (CFTR/MRP), the member 8]; ABCD2[ATP-is in conjunction with box, subfamily D (ALD), the member 2]; ABCD3[ATP-is in conjunction with box, subfamily D (ALD), the member 3]; ABCG1[ATP-is in conjunction with box, subfamily G (WHITE), the member 1]; ABCG2[ATP-is in conjunction with box, subfamily G (WHITE), the member 2]; ABCG5[ATP-is in conjunction with box, subfamily G (WHITE), the member 5]; ABCG8[ATP-is in conjunction with box, subfamily G (WHITE), the member 8]; ABHD2[contains from hydrolase territory 2]; ABL1[c-abl oncogene 1, receptor tyrosine kinase]; ABO[ABO blood group (transferase A, α 1-3-N-acetylamino galactosamine transferase; Transferase B, α 1-3-galactosyltransferase)]; ABP1[amiloride Binding Protein 1 (amine oxidase (cupric))]; ACAA1[acetyl group-coacetylase acyltransferase 1]; ACACA[acetyl group-coacetylase carboxylase α]; ACAN[proteoglycans]; ACAT1[acetyl group-coacetylase transacetylase 1]; ACAT2[acetyl group-coacetylase transacetylase 2]; ACCN5[amiloride-responsive cationic channel 5, intestines]; ACE[angiotensin I invertase (peptidyl-dipeptidase A) 1]; ACE2[angiotensin I invertase (peptidyl-dipeptidase A) 2]; ACHE[acetylcholine esterase (Yt blood group)]; ACLY[ATP citrate lyase]; ACOT9[acyl group-CoA thioesterase enzyme 9]; ACOX1[acyl group-coacetylase oxidizing ferment 1, palmityl]; ACP1[acid phosphatase 1, solvable]; ACP2[acid phosphatase 2, lysosome]; ACP5[acid phosphatase 5, the tartaric acid resistance]; The ACPP[acid phosphatase, prostate]; ACSL3[acyl group-coacetylase synzyme long-chain family member 3]; ACSM3[acyl group-coacetylase synzyme medium chain family member 3]; The ACTA1[actin, α 1, skeletal muscle]; The ACTA2[actin, α 2, smooth muscle, sustainer]; The ACTB[actin, β]; The ACTC1[actin, α, cardiac muscle 1]; The ACTG1[actin, γ 1]; The ACTN1[actinine, α 1]; The ACTN2[actinine, α 2]; The ACTN4[actinine, α 4]; ACTR2[ARP2 actinrelated proteins 2 homologues (yeast)]; The ACVR1[activin receptor, type I]; The ACVR1B[activin receptor, type I B]; ACVRL1[activin receptor Type II-sample 1]; ACY1[amino-acylase 1]; ADA[adenosine deaminase]; ADAM10[ADAM metallopeptidase territory 10]; ADAM12[ADAM metallopeptidase territory 12]; ADAM17[ADAM metallopeptidase territory 17]; ADAM23[ADAM metallopeptidase territory 23]; ADAM33[ADAM metallopeptidase territory 33]; ADAM8[ADAM metallopeptidase territory 8]; ADAM9[ADAM metallopeptidase territory 9 (unwinding protein enzyme γ)]; ADAMTS1[has the ADAM metallopeptidase of thrombospondins type 1 motif, 1]; ADAMTS12[has the ADAM metallopeptidase of thrombospondins type 1 motif, 12]; ADAMTS13[has the ADAM metallopeptidase of thrombospondins type 1 motif, 13]; ADAMTS15[has the ADAM metallopeptidase of thrombospondins type 1 motif, 15]; ADAMTSL1[ADAMTS-sample 1]; ADAMTSL4[ADAMTS-sample 4]; The ADAR[adenosine deaminase, the RNA-specificity]; ADCY1[adenyl cyclase 1 (brain)]; ADCY10[adenyl cyclase 10 (solvable)]; ADCY3[adenyl cyclase 3]; ADCY9[adenyl cyclase 9]; ADCYAP1[adenyl cyclase activated polypeptides 1 (hypophysis)]; ADCYAP1R1[adenyl cyclase activated polypeptides 1 (hypophysis) acceptor type I]; ADD1[adducin 1 (α)]; ADH5[alcohol dehydrogenase 5 (class III), the X polypeptide]; The ADIPOQ[adiponectin, contain C1Q and collagen territory]; ADIPOR1[adiponectin receptors 1]; ADK[adenosine kinase]; ADM[adrenomedulin]; ADORA1[adenosine A 1 receptor]; ADORA2A[Adenosine A2a acceptor]; ADORA2B[adenosine A 2b acceptor]; ADORA3[adenosine A 3 receptor]; ADRA1B[adrenaline, α-1B-, acceptor]; ADRA2A[adrenaline, α-2A-, acceptor]; ADRA2B[adrenaline, α-2B-, acceptor]; ADRB1[adrenaline, β-1-, acceptor]; ADRB2[adrenaline, β-2-, acceptor, surface]; ADSL[adenylosuccinate lyase]; ADSS[adenylosuccinate synthase]; AEBP1[AE Binding Protein 1]; AFP[α-fetoprotein]; AGER[terminal glycosylation end product-specific receptor]; AGMAT[agmatine urea hydrolase (agmatine enzyme)]; AGPS[alkyl glycerol ketone phosphonate ester synthetase]; AGRN[agrin]; AGRP[agouti related protein homologue (mouse)]; AGT[angiotensinogenJiao Ducuojue (member 8 for serpin peptide enzyme inhibition factor, clade A)]; AGTR1[angiotensin II acceptor, Class1]; AGTR2[angiotensin II acceptor, type 2]; AHCY[adenosyl homocysteinase]; AHI1[Abelson assists integration site 1]; AHR[aromatic hydrocarbon receptor]; AHSP[hemoglobin alpha stable protein]; AICDA[activates-guides the cytidine deaminase]; The AIDA[axin interaction factor, dorsalization is relevant]; AIMP1[aminoacyl tRNA synthetase complex-interaction multifunctional protein 1]; AIRE[autoimmunity regulatory factor]; AK1[adenylate kinase 1]; AK2[adenylate kinase 2]; AKR1A1[aldehyde-one reductase family 1, member A1 (aldehyde reductase)]; AKR1B1[aldehyde-one reductase family 1, member B1 (aldose reductase)]; AKR1C3[aldehyde-one reductase family 1, member C3 (3-α hydroxysteroid dehydrogenase, Type II)]; AKT1[v-akt Muridae thymoma Viral Carcinogenesis gene homolog 1]; AKT2[v-akt Muridae thymoma Viral Carcinogenesis gene homolog 2]; AKT3[v-akt Muridae thymoma Viral Carcinogenesis gene homolog 3 (protein kinase B, γ)]; ALB[albumin]; ALCAM[activation leukocyte cell adhesion molecule]; ALDH1A1[aldehyde dehydrogenase 1 family, member A1]; ALDH2[aldehyde dehydrogenase 2 families (mitochondria)]; ALDH3A1[aldehyde dehydrogenase 3 families, member A1]; ALDH7A1[aldehyde dehydrogenase 7 families, member A1]; ALDH9A1[aldehyde dehydrogenase 9 families, member A1]; ALG1[asparagine-connection glycosylation 1, β-Isosorbide-5-Nitrae-mannose transferase homologue (saccharomyces cerevisiae)]; ALG12[asparagine-connection glycosylation 12, α-1,6-mannose transferase homologue (saccharomyces cerevisiae)]; ALK[anaplasia lymthoma receptor tyrosine kinase]; ALOX12[Arachidonate 12-lipoxygenase]; ALOX15[Arachidonate 15-lipoxygenase]; The ALOX15B[Arachidonate 15-lipoxygenase, type B]; ALOX5[Arachidonate 5-lipoxygenase]; ALOX5AP[Arachidonate 5-lipoxygenase-activation of protein]; The ALPI[alkaline phosphatase, intestines]; The ALPL[alkaline phosphatase, liver/bone/kidney]; The ALPP[alkaline phosphatase, placenta (Regan isoenzymes)]; AMACR[Alpha-Methyl acyl group-coacetylase racemase]; AMBP[α-1-microglobulin/bikunin precursor]; AMPD3[adenylic acid deaminase 3]; The ANG[angiogenin, ribalgilase, RNaseA family, 5]; ANGPT1[Ang-1]; ANGPT2[ANG2]; ANK1[ankyrin 1, red blood cell]; The ANKH[anchylosis, carrying out property homologue (mouse)]; ANKRD1[ankyrin duplicate domain 1 (cardiac muscle)]; ANPEP[Anpep]; ANTXR2[anthrax toxin acceptor 2]; ANXA1[annexin A1]; ANXA2[ANX2L4]; ANXA5[annexin A5]; ANXA6[ANXA6]; AOAH[carboxylic acyl hydrolase (neutrophil leucocyte)]; The AOC2[amine oxidase, cupric 2 (retina-specificity)]; AP2B1[is connected factor relative protein matter complex 2, β 1 subunit]; AP3B1[is connected factor relative protein matter complex 3, β 1 subunit]; APC[adenoma polyposis Escherichia coli]; APCS[amyloid P component, serum]; APEX1[APEX nuclease (multifunctional dna repairase) 1]; APLNR[apelin acceptor]; APOA1[apolipoprotein A-1]; APOA2[apolipoprotein A-1 I]; APOA4[apolipoprotein A-1 V]; APOB[apolipoprotein B (comprising Ag (x) antigen)]; APOBEC1[apolipoprotein B mRNA editing enzymes, catalytic polypeptide 1]; APOBEC3G[apolipoprotein B mRNA editing enzymes, catalytic polypeptide-sample 3G]; APOC3[apoC-III]; APOD[Apolipoprotein D]; APOE[apo E]; APOH[Apolipoprotein H (β-2-glycoprotein I)]; APP[amyloid (A4) precursor protein]; APRT[adenine phosphoribosyl transferase]; APTX[aprataxin]; AQP1[aquaporin 1 (Colton blood group)]; AQP2[aquaporin 2 (collecting pipe)]; AQP3[aquaporin 3 (Gill blood group)]; AQP4[aquaporin 4]; AQP5[aquaporin 5]; AQP7[aquaporin 7]; AQP8[aquaporin 8]; AR[androgen receptor]; AREG[amphiregulin]; ARF6[ADP-ribosylation factor 6]; The ARG1[arginase, liver]; The ARG2[arginase, Type II]; ARHGAP6[Rho GTP enzyme activation protein 6]; ARHGEF2[Rho/RAC guanine nucleotide exchange factor (GEF) 2]; ARHGEF6[RAC/Cdc42 guanine nucleotide exchange factor (GEF) 6]; ARL13B[ADP-ribosylation factor-sample 13B]; ARNT[aromatic hydrocarbon receptor nuclear translocation albumen]; ARNTL[aromatic hydrocarbon receptor nuclear translocation albumen-sample]; The ARRB1[CKIs, β 1]; The ARRB2[CKIs, β 2]; ARSA[ARSA]; ARSB[ARB]; ARSH[aromatic yl acid ester enzyme family, member H]; ART1[ADP-ribosyltransferase 1]; ASAH1[N-acyl sphingosine amidohydrolase (sour ceramidase) 1]; ASAP1[ArfGAP, have SH3 territory, ankyrin repeat and PH territory 1]; ASGR2[asialoglycoprotein receptor 2]; ASL[arginosuccinate lyase]; ASNS[asparagine synthetase]; ASPA[Aspartoacylase (sword bean disease)]; ASPG[asparaginase homologue (saccharomyces cerevisiae)]; ASPH[aspartic acid B-hydroxylase]; ASRGL1[asparaginase sample 1]; ASS1[argininosuccinate synthetase 1]; ATF1[transcriptional factors 1]; ATF2[transcriptional factors 2]; ATF3[transcriptional factors 3]; ATF4[transcriptional factors 4 (tax-replys and strengthens subfraction B67)]; The ATG16L1[ATG16 autophagy 16-sample 1 (saccharomyces cerevisiae) of being correlated with]; ATM[ataxia-telangiectasia sudden change]; ATMIN[ATM interacts sub]; ATN1[Dystroglycan 1]; ATOH1[is without adjusting homologue 1 (fruit bat)]; The ATP2A2[ATP enzyme, Ca++ transports, cardiac muscle, slowly ballism 2]; The ATP2A3[ATP enzyme, Ca++ transports, ubiquitous]; The ATP2C1[ATP enzyme, Ca++ transports, type 2C, the member 1]; The ATP5E[ATP synzyme, H+ transports, mitochondria F1 complex, ε subunit]; The ATP7B[ATP enzyme, Cu++ transports, beta polypeptides]; The ATP8B1[ATP enzyme, class I, type 8B, the member 1]; ATPAF2[ATP synzyme mitochondria F 1 complex assembly factor 2]; The ATR[ataxia-telangiectasia is relevant with Rad3]; ATRIP[ATR interacting protein]; ATRN[attractin albumen]; AURKA[aurora kinases]; AURKB[aurora kinase b]; AURKC[aurora kinase c]; AVP[arginine vasopressin]; AVPR2[arginine vasopressin acceptor 2]; AXL[AXL receptor tyrosine kinase]; AZGP1[α-2-glycoprotein 1, zinc-combination]; B2M[beta-2-microglobulin]; B3GALTL[β 1,3-galactosyltransferase-sample]; B3GAT1[β-1,3-glucuronyl transferase 1 (glucoside acyltransferase P)]; B4GALNT1[β-Isosorbide-5-Nitrae-N-acetyl group-galactosaminyl transferase 1]; B4GALT1[UDP-GAL: β G1cNAc β Isosorbide-5-Nitrae-galactosyltransferase, polypeptide 1]; BACE1[β-site APP-lyases 1]; BACE2[β-site APP-lyases 2]; BACH1[BTB and CNC homology 1, alkaline leucine zipper transcription factor 1]; The BCL2 of the BAD[cell death antagonism factor of being correlated with]; BAIAP2[BAI1 related protein 2]; BAK1[BCL2-antagonist/kill agent 1]; BARX2[BARX homology frame 2]; BAT1[HLA-B associated retroviral product 1]; BAT2[HLA-B associated retroviral thing 2]; The BAX[BCL2 X protein matter of being correlated with]; BBC3[BCL2 is in conjunction with component 3]; BCAR1[breast cancer anti-estrogen resistance 1]; BCAT1[side chain transaminase 1, cytoplasm]; BCAT2[side chain transaminase 2, mitochondria]; BCHE[butyrylcholine esterase]; BCL10[B cell CLL/ lymthoma 10]; BCL11B[B cell CLL/ lymthoma 11B (zinc finger protein matter)]; BCL2[B cell CLL/ lymthoma 2]; BCL2A1[BCL2 related protein A1]; BCL2L1[BCL2-sample 1]; BCL2L11[BCL2-sample 11 (Apoptosis promotes son)]; BCL3[B cell CLL/ lymthoma 3]; BCL6[B cell CLL/ lymthoma 6]; BCR[breakaway poing Cu Ji district]; BDKRB1[bradykinin acceptor B1]; BDKRB2[bradykinin acceptor B2]; BDNF[neurotrophic factor derived from brain]; BECN1[benzyl chlorine element 1, autophagy is relevant]; The BEST1[spot albumen 1 that withers]; The difunctional apoptosis regulation factor of BFAR[]; BGLAP[bone Gla (gla) protein]; BHMT[betaine-homocysteine methyl transferase]; The dead antagonism factor in BID[BH3 interaction territory]; BIK[CL2-interacts and kills and wounds (Apoptosis-inducing)]; BIRC2[contains baculoviral IAP repetitive sequence 2]; BIRC3[contains baculoviral IAP repetitive sequence 3]; BIRC5[contains baculoviral IAP repetitive sequence 5]; BLK[B lymphocyte EGFR-TK]; The BLM[Bloom runting syndrome, RecQ unwindase-sample]; BLNK[B cell connexon]; BLVRB[biliverdin reductase B (riboflavin reductase (NADPH))]; BMI1[BMI1 combs albumen fourth finger oncogene more]; BMP1[skeletal form generation protein 1]; BMP2[skeletal form generation protein 2]; BMP4[skeletal form generation protein 4]; BMP6[skeletal form generation protein 6]; BMP7[skeletal form generation protein 7]; BMPR1A[skeletal form generation protein acceptor, type I A]; BMPR1B[skeletal form generation protein acceptor, type I B]; BMPR2[skeletal form generation protein acceptor, Type II (serine/threonine kinase)]; BPI[bactericidal/permeability-increase protein]; The BRCA1[mammary cancer 1, early send out]; BRCA2[breast cancer 2, early send out]; BRCC3[contains the BRCA1/BRCA2 complex, subunit 3]; BRD8[contains Bu Luomo domain 8]; BRIP1[BRCA1 interacting protein C-terminal unwindase 1]; BSG[basigin (Ok blood group)]; BSN[bassoon (presynaptic cell matter stroma protein)]; BSX[brain specificity homology frame]; BTD[biotinidase]; BTK[Bruton agamaglobulinemia EGFR-TK]; BTLA[B is relevant with the T lymphocyte]; BTNL2[butyrophilin-sample 2 (MHC class II is relevant)]; BTRC[contains β-transducin repetitive sequence]; C10orf67[chromosome 10 ORFs 67]; C11orf30[chromosome 11 ORFs 30]; C11orf58[chromosome 11 ORFs groups 58]; C13orf23[chromosome 13 ORFs 23]; C13orf31[chromosome 13 ORFs 31]; C15orf2[chromosome 15 ORFs 2]; C16orf75[chromosome 16 ORFs 75]; C19orf10[chromosome 19 ORFs 10]; C1QA[complement component 1, q subfraction, A chain]; C1QB[complement component 1, q subfraction, B chain]; C1QC[complement component 1, q subfraction, C chain]; C1QTNF5[C1q and TNF related protein 5]; C1R[complement component 1, the r subfraction]; C1S[complement component 1, the s subfraction]; C2[complement component 2]; C20orf29[chromosome 20 ORFs 29]; C21orf33[chromosome 21 ORFs 33]; C3[complement component 3]; C3AR1[complement component 3 acceptors 1]; C3orf27[chromosome 3 ORFs 27]; C4A[complement component 4 (Rodgers blood group)]; C4B[complement component 4B (Chido blood group)]; C4BPA[complement component 4 is in conjunction with albumen, α]; C4BPB[complement component 4 is in conjunction with albumen, β]; C5[complement component 5]; C5AR1[complement component 5 acceptors 1]; C5orf56[chromosome 5 ORFs 56]; C5orf62[chromosome 5 ORFs 62]; C6[complement component 6]; C6orf142[chromosome 6 ORFs 142]; C6orf25[chromosome 6 ORFs 25]; C7[complement component 7]; C7orf72[chromosome 7 ORFs 72]; C8A[complement component 8, the α polypeptide]; C8B[complement component 8, beta polypeptides]; C8G[complement component 8, the γ polypeptide]; C8orf38[chromosome 8 ORFs 38]; C9[complement component 9]; CA2[carbonic anhydrase II]; CA6[carbonic anhydrase VI]; CA8[carbonic anhydrase VIII]; CA9[carbonic anhydrase IX]; CABIN1[calcineurin Binding Protein 1]; The CACNA1C[calcium channel, voltage-dependence, L type, α 1C subunit]; The CACNA1S[calcium channel, voltage-dependence, L type, α 1S subunit]; CAD[carbamoyl-phosphonate ester synthetase 2, aspartate carbamyl-transferase, and dihydroora tase]; CALB1[calbindin 1,28kDa]; CALB2[calbindin 2]; CALCA[calcitonin related polypeptide α]; CALCRL[calcitonin acceptor-sample]; CALD1[caldesmon 1]; CALM1[calmodulin 1 (phosphorylase kinase, δ)]; CALM2[calmodulin 2 (phosphorylase kinase, δ)]; CALM3[calmodulin 3 (phosphorylase kinase, δ)]; CALR[calprotectin]; CAMK2G[calcium/calmodulin-dependent protein kinase ii γ]; CAMP[cathelicidin antibacterial peptide]; CANT1[calcium activation nucleotidase 1]; CANX[calnexin]; CAPN1[calpain 1, (μ/I) large subunit]; The CARD10[caspase is raised territory family, and the member 10]; The CARD16[caspase is raised territory family, and the member 16]; The CARD8[caspase is raised territory family, and the member 8]; The CARD9[caspase is raised territory family, and the member 9]; CASP1[caspase 1, the Apoptosis cysteine peptase (interleukin 1, β, invertase) of being correlated with]; CASP10[caspase 10, the Apoptosis cysteine peptase of being correlated with]; CASP2[caspase 2, the Apoptosis cysteine peptase of being correlated with]; The CASP3[Caspase-3, the Apoptosis cysteine peptase of being correlated with]; CASP5[caspase 5, the Apoptosis cysteine peptase of being correlated with]; CASP6[caspase 6, the Apoptosis cysteine peptase of being correlated with]; CASP7[caspase 7, the Apoptosis cysteine peptase of being correlated with]; CASP8[caspase 8, the Apoptosis cysteine peptase of being correlated with]; CASP8AP2[caspase 8 related proteins 2]; CASP9[caspase 9, the Apoptosis cysteine peptase of being correlated with]; CASR[calcium-sensing receptor]; CAST[calpastatin]; CAT[catalase]; The CAV1[caveolin-1, caveolae protein, 22kDa]; CAV2[caveolin 2]; CBL[Cas-Br-M (Muridae) ectropic retrovirus transforming sequence]; CBS[cystathionie-beta-synthetase]; CBX5[colouration box homologue 5 (HP1 α homologue, fruit bat)]; CC2D2A[contains coiled coil and C2 territory 2A]; CCBP2[chemokine binding protein 2]; CCDC144A[contains coiled coil territory 144]; CCDC144B[contains coiled coil territory 144B]; CCDC68[contains coiled coil territory 68]; CCK[CCK]; CCL1[chemotactic factor (CF) (C-C motif) ligand 1]; CCL11[chemotactic factor (CF) (C-C motif) ligand 1 1]; CCL13[chemotactic factor (CF) (C-C motif) ligand 1 3]; CCL14[chemotactic factor (CF) (C-C motif) ligand 1 4]; CCL17[CCL17]; CCL18[chemotactic factor (CF) (C-C motif) ligand 18 (lung and activation-regulation and control)]; CCL19[chemotactic factor (CF) (C-C motif) ligand 1 9]; CCL2[chemotactic factor (CF) (C-C motif) part 2]; CCL20[chemotactic factor (CF) (C-C motif) part 20]; CCL21[chemotactic factor (CF) (C-C motif) part 21]; CCL22[chemotactic factor (CF) (C-C motif) part 22]; CCL24[CCL24]; CCL25[chemotactic factor (CF) (C-C motif) part 25]; CCL26[chemotactic factor (CF) (C-C motif) part 26]; CCL27[chemotactic factor (CF) (C-C motif) part 27]; CCL28[chemotactic factor (CF) (C-C motif) part 28]; CCL3[chemotactic factor (CF) (C-C motif) part 3]; CCL4[chemotactic factor (CF) (C-C motif) part 4]; CCL4L1[chemotactic factor (CF) (C-C motif) part 4-sample 1]; CCL5[chemotactic factor (CF) (C-C motif) part 5]; CCL7[chemotactic factor (CF) (C-C motif) part 7]; CCL8[chemotactic factor (CF) (C-C motif) part 8]; CCNA1[cyclin A1]; CCNA2[cyclin A2]; CCNB1[cell periodic protein B 1]; CCNB2[mitotic cycle protein B 2]; CCNC[cyclin C]; CCND1[cyclin D1]; CCND2[Cyclin D2]; CCND3[cyclinD3]; CCNE1[Cyclin E1]; CCNG1[Cyclin G 1]; CCNH[cyclin H]; CCNT1[Cyclin T1]; CCNT2[cyclin T2]; CCNY[cyclin Y]; CCR1[chemotactic factor (CF) (C-C motif) acceptor 1]; CCR2[chemotactic factor (CF) (C-C motif) acceptor 2]; CCR3[chemotactic factor (CF) (C-C motif) acceptor 3]; CCR4[chemotactic factor (CF) (C-C motif) acceptor 4]; CCR5[chemotactic factor (CF) (C-C motif) acceptor 5]; CCR6[chemotactic factor (CF) (C-C motif) acceptor 6]; CCR7[chemotactic factor (CF) (C-C motif) acceptor 7]; CCR8[chemotactic factor (CF) (C-C motif) acceptor 8]; CCR9[chemotactic factor (CF) (C-C motif) receptor 9]; CCRL1[chemotactic factor (CF) (C-C motif) acceptor-sample 1]; CD14[CD14 molecule]; CD151[CD151 molecule (Raph blood group)]; CD160[CD160 molecule]; CD163[CD163 molecule]; CD180[CD180 molecule]; CD19[CD19 molecule]; CD1A[CD1a molecule]; CD1B[CD1b molecule]; CD1C[CD1c molecule]; CD1D[CD1d molecule]; CD2[CD2 molecule]; CD200[CD200 molecule]; The CD207[CD207 molecule, pancreas islet albumen]; CD209[CD209 molecule]; CD22[CD22 molecule]; CD226[CD226 molecule]; CD24[CD24 molecule]; The CD244[CD244 molecule, Natural Killer Cell Receptors 2B4]; CD247[CD247 molecule]; CD27[CD27 molecule]; CD274[CD274 molecule]; CD28[CD28 molecule]; CD2AP[CD2 related protein]; CD300LF[CD300 molecule-sample family member f]; CD34[CD34 molecule]; CD36[CD36 molecule (thrombospondin acceptor)]; CD37[CD37 molecule]; CD38[CD38 molecule]; The CD3E[CD3e molecule, ε (CD3-TCR complex)]; CD4[CD4 molecule]; The CD40[CD40 molecule, TNF acceptor Superfamily member 5]; CD40LG[CD40 part]; CD44[CD44 molecule (India's blood group)]; The CD46[CD46 molecule, CCP matter]; CD47[CD47 molecule]; CD48[CD48 molecule]; CD5[CD5 molecule]; CD52[CD52 molecule]; CD53[CD53 molecule]; The CD55[CD55 molecule, complement decline accelerated factor (Cromer blood group)]; CD58[CD58 molecule]; The CD59[CD59 molecule, CCP matter]; CD63[CD63 molecule]; CD68[CD68 molecule]; CD69[CD69 molecule]; CD7[CD7 molecule]; CD70[CD70 molecule]; CD72[CD72 molecule]; The CD74[CD74 molecule, major histocompatibility complex, class II invariant chain]; The CD79A[CD79a molecule, the immunoglobulin (Ig) α that is correlated with]; The CD79B[CD79b molecule, the immunoglobulin (Ig) β that is correlated with]; CD80[CD80 molecule]; CD81[CD81 molecule]; CD82[CD82 molecule]; CD83[CD83 molecule]; CD86[CD86 molecule]; CD8A[CD8a molecule]; CD9[CD9 molecule]; CD93[CD93 molecule]; CD97[CD97 molecule]; CDC20[CDC 20 homologues (saccharomyces cerevisiae)]; CDC25A[CDC 25 homologue A (fission yeast)]; CDC25B[CDC 25 homologue B (fission yeast)]; CDC25C[CDC 25 homologue C (fission yeast)]; CDC42[CDC 42 (gtp binding protein, 25kDa)]; CDC45[CDC45 CDC 45 homologues (saccharomyces cerevisiae)]; CDC5L[CDC5 CDC 5-sample (fission yeast)]; CDC6[CDC 6 homologues (saccharomyces cerevisiae)]; CDC7[CDC 7 homologues (saccharomyces cerevisiae)]; CDH1[cadherin 1, Class1, CAM 120/80 (epithelium)]; CDH2[cadherin 2, Class1, N-cadherin (neuron)]; CDH26[cadherin 26]; CDH3[cadherin 3, Class1, P-cadherin (placenta)]; CDH5[cadherin 5, type 2 (blood vessel endothelium)]; CDIPT[CDP-diglyceride-inositol 3-phosphatidyl transferring enzyme (phosphatidylinositols synzyme)]; CDK1[cyclin-dependant kinase 1]; CDK2[cyclin-dependant kinase 2]; CDK4[cyclin-dependant kinase 4]; CDK5[cyclin-dependant kinase 5]; CDK5R1[cyclin-dependant kinase 5, regulation and control subunit 1 (p35)]; CDK7[cyclin-dependant kinase 7]; CDK9[cyclin-dependant kinase 9]; The CDKAL1[CDK5 regulation and control related protein 1-of subunit sample 1]; CDKN1A[cyclin-dependent kinase enzyme inhibition factor 1 (p21, Cip1)]; CDKN1B[cyclin-dependent kinase enzyme inhibition factor 1B (p27, Kip1)]; CDKN1C[cyclin-dependent kinase enzyme inhibition factor 1C (p57, Kip2)]; CDKN2A[cyclin-dependent kinase enzyme inhibition factor 2 (melanoma, p16 suppress CDK4)]; CDKN2B[cyclin-dependent kinase enzyme inhibition factor 2B (p15 suppresses CDK4)]; CDKN3[cyclin-dependant kinase initiator 3]; CDR2[cerebellum degeneration related protein 2,62kDa]; The license of CDT1[chromatin and the DNA replication dna factor 1]; CDX2[tail type homology frame 2]; CEACAM1[carcinomebryonic antigen relevant cell adhesion molecule 1 (biliary glycoprotein)]; CEACAM3[carcinomebryonic antigen relevant cell adhesion molecule 3]; CEACAM5[CEA-006]; CEACAM6[carcinomebryonic antigen relevant cell adhesion molecule 6 (non--specificity cross reacting antigen)]; CEACAM7[carcinomebryonic antigen relevant cell adhesion molecule 7]; CEBPB[CCAAT/ enhancer binding protein (C/EBP), β]; CEL[carboxyl ester lipase (bile salt-stimulation lipase)]; CENPJ[kinetochore protein J]; CENPV[kinetochore protein V]; CEP290[centrosome protein 290kDa]; CERK[ceramide kinase]; CETP[cholesteryl transesterify protein, blood plasma]; CFB[complement factor B]; CFD[Complement Factor D (lipase)]; CFDP1[Craniofacial growth protein 1]; CFH[complement factor H]; CFHR1[complement factor H relevant 1]; CFHR3[complement factor H relevant 3]; CFI[CFI]; CFL1[Cofilin 1 (non-muscle)]; CFL2[Cofilin 2 (muscle)]; CFLAR[CASP8 and FADD-like cell apoptotic effector]; CFP[complement factor properdin]; CFTR[cystic fibrosis transmembrane conductance regulatory factor (ATP-binding cassette subfamily C, the member 7)]; The CGA[glycoprotein hormones, the α polypeptide]; The CGB[HCG, beta polypeptides]; The CGB5[HCG, beta polypeptides 5]; CHAD[chondroprotein]; The CHAF1A[Chromatin assembly factor 1, subunit A (p150)]; The CHAF1B[Chromatin assembly factor 1, the B of subunit (p60)]; CHAT[cholinacetyltranslase]; CHD2[Chromodomain unwindase DBP 2]; CHD7[Chromodomain unwindase DBP 7]; CHEK1[CHK1 prosecution point homologue (fission yeast)]; CHEK2[CHK2 prosecution point homologue (fission yeast)]; CHGA[Chromogranin A (parathyroid secretory protein 1)]; CHGB[chromograin B (secretogranin 1)]; CHI3L1[chitinase 3-sample 1 (cartilage glycoprotein-39)]; The CHIA[chitinase, acidity]; CHIT1[chitinase 1 serving (chitotriso glycosides enzyme)]; CHKA[choline kinase α]; CHML[choroideremia-sample (Rab escorts protein 2)]; CHRD[tendon albumen]; CHRDL1[tendon albumen-sample 1]; The CHRM1[cholinergic recepter, muscarine 1]; The CHRM2[cholinergic recepter, muscarine 2]; The CHRM3[cholinergic recepter, muscarine 3]; The CHRNA3[cholinergic recepter, nicotine, α 3]; The CHRNA4[cholinergic recepter, nicotine, α 4]; The CHRNA7[cholinergic recepter, nicotine, α 7]; The conservative helix-loop-helix of CHUK[is all at kinases]; CIB1[calcium and integrin are in conjunction with 1 (calcium and integrin)]; CIITA[class II, major histocompatibility complex, trans-activating factor]; CILP[cartilage intermediate layer protein matter, the nucleotides pyrophosphohydrolase]; The SH2-containing protein matter of CISH[cytokine induction]; The CKB[creatine kinase, brain]; CKLF[chemotactic factor (CF)-like factor]; The CKM[creatine kinase, muscle]; CLC[Charcot-Leyden crystallization of protein]; CLCA1[chloride channel auxiliary 1]; CLCN1[chloride channel 1, skeletal muscle]; CLCN3[chloride channel 3]; CLDN1[sealing element 1]; CLDN11[sealing element 11]; CLDN14[sealing element 14]; CLDN16[sealing element 16]; CLDN19[sealing element 19]; CLDN2[sealing element 2]; CLDN3[sealing element 3]; CLDN4[sealing element 4]; CLDN5[sealing element 5]; CLDN7[sealing element 7]; CLDN8[sealing element 8]; CLEC12A[C-type lectin domain family 12, member A]; CLEC16A[C-type lectin domain family 16, member A]; CLEC4A[C-type lectin domain family 4, member A]; CLEC4D[C-type lectin domain family 4, member D]; CLEC4M[C-type lectin domain family 4, member M]; CLEC7A[C-type lectin domain family 7, member A]; The linker protein matter 2 that CLIP2[contains the CAP-GLY territory]; CLK2[CDC-sample kinases 2]; CLSPN[claspin homologue (Africa xenopus)]; CLSTN2[calcium is with linear protein 2]; The CLTCL1[clathrin, heavy chain-sample 1]; CLU[clusterin]; CMA1[chymotrypsin 1, mast cell]; CMKLR1[chemotactic factor (CF)-sample acceptor 1]; CNBP[CCHC-type zinc refers to, nucleic acid binding protein]; CNDP2[CNDP dipeptidase 2 (metallopeptidase M20 family)]; CNN1[Calponin 1, alkalescence, smooth muscle]; CNP[2 ', 3 '-cyclic nucleotide 3 ' phosphodiesterase]; CNR1[Cannabined receptor 1 (brain)]; CNR2[Cannabined receptor 2 (macrophage)]; CNTF[CNTF]; CNTN2[contactin 2 (aixs cylinder)]; The component 1 of the oligomeric Golgi complex of COG1[]; The component 2 of the oligomeric Golgi complex of COG2[]; COIL[annular solid albumen]; The COL11A1[collagen, type XI, α 1]; The COL11A2[collagen, type XI, α 2]; The COL17A1[collagen, type XVII, α 1]; The COL18A1[collagen, type XVIII, α 1]; The COL1A1[collagen, type I, α 1]; The COL1A2[collagen, type I, α 2]; The COL2A1[collagen, Type II, α 1]; The COL3A1[collagen, type-iii, α 1]; The COL4A1[collagen, type I V, α 1]; The COL4A3[collagen, type I V, α 3 (Goodpasture antigen)]; The COL4A4[collagen, type I V, α 4]; The COL4A5[collagen, type I V, α 5]; The COIAA6[collagen, type I V, α 6]; The COL5A1[collagen, type V, α 1]; The COL5A2[collagen, type V, α 2]; The COL6A1[collagen, type VI, α 1]; The COL6A2[collagen, type VI, α 2]; The COL6A3[collagen, type VI, α 3]; The COL7A1[collagen, type VII, α 1]; The COL8A2[collagen, type VIII, α 2]; The COL9A1[collagen, type I X, α 1]; COMT[catechol O-methyltransferase]; COQ3[CoQ3 homologue, transmethylase (saccharomyces cerevisiae)]; COQ7[CoQ7 homologue, ubiquinone (yeast)]; The CORO1A[coronin, actin binding protein, 1]; The COX10[COX10 homologue, cytochrome C oxidase assembly protein, heme A: farnesyl transferase (yeast)]; The COX15[COX15 homologue, cytochrome C oxidase assembly protein (yeast)]; The COX5A[cytochrome c oxidase Va of subunit]; The COX8A[cytochrome c oxidase VIIIA of subunit (all over)]; CP[ceruloplasmin (ferrous oxidase)]; CPA1[Carboxypeptidase A 1 (pancreas)]; CPB2[protaminase 2 (blood plasma)]; The CPN1[carboxypeptidase N, polypeptide 1]; CPOX[COPRO-O]; CPS1[carbamoyl-phosphonate ester synthetase 1, mitochondria]; CPT2[carnitine palmitoyltransferase 2]; CR1[complement component (3b/4b) acceptor 1 (Knops blood group)]; CR2[complement component (3d/Epstein Barr virus) acceptor 2]; CRAT[carnitine O-transacetylase]; CRB1[crumbs homologue 1 (fruit bat)]; CREB1[cAMP response element Binding Protein 1]; CREBBP[CREB is in conjunction with albumen]; The CREM[cAMP response element is regulated son]; CRH[cortin releasing hormone]; CRHR1[cortin releasing hormone receptor 1]; CRHR2[cortin releasing hormone receptor 2]; CRK[v-crk sarcoma virus CT10 oncogene homologue (birds)]; CRKL[v-crk sarcoma virus CT10 oncogene homologue (birds)-sample]; CRLF2[cytokine receptor-like factor 2]; CRLF3[cytokine receptor-like factor 3]; CROT[carnitine O-caprylyl transferase]; The CRP[C-reactive protein, PTX-3 is relevant]; CRX[cone body of rod homology frame]; CRY2[cryptochrome 2 (photolyase-sample)]; The CRYAA[crystalline protein, α A]; The CRYAB[crystalline protein, α B]; CS[citrate synthase]; CSF1[colony-stimulating factor 1 (macrophage)]; CSF1R[colony-stimulating factor 1 acceptor]; CSF2[colony stimulating factor 2 (GM)]; CSF2RB[colony stimulating factor 2 acceptors, β, low-affinity (GM)]; CSF3[colony stimulating factor 3 (granulocyte)]; CSF3R[colony stimulating factor 3 acceptors (granulocyte)]; CSK[c-src EGFR-TK]; The various territory 3 of CSMD3[CUB and sushi]; CSN1S1[alfa-s1-casein]; CSN2[casein β]; The CSNK1A1[Casein kinase 1, α 1]; CSNK2A1[casein kinase 2, α 1 polypeptide]; CSNK2B[casein kinase 2, beta polypeptides]; CSPG4[chondroitin sulfate proteoglycan 4]; CST3[bladder chalone C]; CST8[cystatin 8 (cystatin be correlated with epididymis specificity)]; CSTA[cystatin (stefin A)]; CSTB[cystatin B (stefin B)]; CTAGE1[skin T-cell lymphoid tumor related antigen 1]; CTF1[cardiotrophin research 1]; CTGF[CTGF]; CTH[cystathionase (cystathionine γ-lyase)]; CTLA4[cytotoxin T-lymphocyte related protein 4]; CTNNA1[catenin (cadherin related protein), α 1,102kDa]; CTNNA3[catenin (cadherin related protein), α 3]; CTNNAL1[catenin (cadherin related protein), α-sample 1]; CTNNB1[catenin (cadherin related protein), β 1,88kDa]; CTNND1[catenin (cadherin related protein), δ 1], the CTNS[cystinosis; ephrosis]; CTRL[chymotrypsin-sample], CTSB[cathepsin B], CTSC[cathepsin C]; CTSD[cathepsin D]; CTSE[cathepsin E], CTSG[cathepsin G], CTSH[Cathepsin H]; the CTSK[cathepsin K], the CTSL1[cathepsin L 1]; CTTN[cortex actin]; CUL1[hysteresis protein 1]; CUL2[hysteresis protein 2]; CUL4A[hysteresis protein 4A]; CUL5[hysteresis protein 5]; CX3CL1[chemotactic factor (CF) (C-X3-C motif) ligand 1]; CX3CR1[chemotactic factor (CF) (C-X3-C motif) acceptor 1]; CXADR[Coxsackie virus and adenovirus receptor]; CXCL1[chemotactic factor (CF) (C-X-C motif) ligand 1 (melanoma growth-stimulating activity, α)]; CXCL10[IP10]; CXCL11[chemotactic factor (CF) (C-X-C motif) ligand 1 1]; CXCL12[chemotactic factor (CF) (C-X-C motif) ligand 12 (stroma cell-derived factor-1)]; CXCL13[chemotactic factor (CF) (C-X-C motif) ligand 1 3]; CXCL2[chemotactic factor (CF) (C-X-C motif) part 2]; CXCL5[chemotactic factor (CF) (C-X-C motif) part 5]; CXCL6[chemotactic factor (CF) (C-X-C motif) part 6 (granulocyte chemoattractant protein matter 2)]; CXCL9[CXCL9]; CXCR1[chemotactic factor (CF) (C-X-C motif) acceptor 1]; CXCR2[chemotactic factor (CF) (C-X-C motif) acceptor 2]; CXCR3[chemotactic factor (CF) (C-X-C motif) acceptor 3]; CXCR4[chemotactic factor (CF) (C-X-C motif) acceptor 4]; CXCR5[chemotactic factor (CF) (C-X-C motif) acceptor 5]; CXCR6[chemotactic factor (CF) (C-X-C motif) acceptor 6]; CXCR7[chemotactic factor (CF) (C-X-C motif) acceptor 7]; CXorf40A[chromosome x ORFs 40]; CYB5A[cytochrome b5 type A (microsome)]; CYB5R3[cytochrome b5 reductase 3]; CYBA[cytochrome b-245, the α polypeptide]; CYBB[cytochrome b-245, beta polypeptides]; CYC1[cytochrome c-1]; The CYCS[cytochrome c, body cell]; CYFIP2[cytoplasm FMR1 interacting protein 2]; The CYP11A1[Cytochrome P450, family 11, subfamily A, polypeptide 1]; The CYP11B1[Cytochrome P450, family 11, subfamily B, polypeptide 1]; The CYP11B2[Cytochrome P450, family 11, subfamily B, polypeptide 2]; The CYP17A1[Cytochrome P450, family 17, subfamily A, polypeptide 1]; The CYP19A1[Cytochrome P450, family 19, subfamily A, polypeptide 1]; The CYP1A1[Cytochrome P450, family 1, subfamily A, polypeptide 1]; The CYP1A2[Cytochrome P450, family 1, subfamily A, polypeptide 2]; The CYP1B1[Cytochrome P450, family 1, subfamily B, polypeptide 1]; The CYP21A2[Cytochrome P450, family 21, subfamily A, polypeptide 2]; The CYP24A1[Cytochrome P450, family 24, subfamily A, polypeptide 1]; The CYP27A1[Cytochrome P450, family 27, subfamily A, polypeptide 1]; The CYP27B1[Cytochrome P450, family 27, subfamily B, polypeptide 1]; The CYP2A6[Cytochrome P450, family 2, subfamily A, polypeptide 6]; The CYP2B6[Cytochrome P450, family 2, subfamily B, polypeptide 6]; The CYP2C19[Cytochrome P450, family 2, subfamily C, polypeptide 19]; The CYP2C8[Cytochrome P450, family 2, subfamily C, polypeptide 8]; The CYP2C9[Cytochrome P450, family 2, subfamily C, polypeptide 9]; The CYP2D6[Cytochrome P450, family 2, subfamily D, polypeptide 6]; The CYP2E1[Cytochrome P450, family 2, subfamily E, polypeptide 1]; The CYP2J2[Cytochrome P450, family 2, subfamily J, polypeptide 2]; The CYP2R1[Cytochrome P450, family 2, subfamily R, polypeptide 1]; The CYP3A4[Cytochrome P450, family 3, subfamily A, polypeptide 4]; The CYP3A5[Cytochrome P450, family 3, subfamily A, polypeptide 5]; The CYP4F3[Cytochrome P450, family 4, subfamily F, polypeptide 3]; The CYP51A1[Cytochrome P450, family 51, subfamily A, polypeptide 1]; The CYP7A1[Cytochrome P450, family 7, subfamily A, polypeptide 1]; The rich cysteine of CYR61[, Angiogenesis inducer, 61]; CYSLTR1[cysteinyl-CysLT1R]; CYSLTR2[cysteinyl-leukotriene receptor 2]; DAO[D-amino acid oxidase]; DAOA[D-amino acid oxidase activity factor]; The dead related protein 3 of DAP3[]; DAPK1[death-associated protein kinase 1]; The DARC[duffy blood group, chemokine receptors]; Lack 1 in the DAZ1[azoospermatism]; DBH[dopamine β-hydroxylase (dopamine β-monooxygenase)]; DCK[desoxycytidine kinases]; DCLRE1C[DNA intersects in conjunction with repairing 1C (PSO2 homologue, saccharomyces cerevisiae)]; DCN[decorin]; DCT[dopachrome tautomerase (dopachrome δ-isomerase, tyrosine related protein 2)]; DCTN2[dynactin 2 (p50)]; DDB1[damage-specific DNA Binding Protein 1,127kDa]; DDB2[damage-specific DNA is in conjunction with albumen 2,48kDa]; DDC[DOP Adecarboxylase (aromatic l-amino acid decarboxylase)]; DDIT3[DNA-wound inducement transcript 3]; DDR1[vaginal areoles receptor tyrosine kinase 1]; DDX1[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 1]; DDX41[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 41]; DDX42[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 42]; DDX58[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 58]; The DEFA1[sozin, α 1]; The DEFA5[sozin, α 5, Paneth cell-specificity]; The DEFA6[sozin, α 6, Paneth cell-specificity]; The DEFB1[sozin, β 1]; The DEFB103B[sozin, β 103B]; The DEFB104A[sozin, β 104]; The DEFB4A[sozin, β 4]; DEK[DEK oncogene]; DENND1B[contains DENN/MADD territory 1B]; DES[desmin]; DGAT1[diglyceride O-acyltransferase homologue 1 (mouse)]; DGCR14[DiGeorge syndrome critical zone gene 14]; DGCR2[DiGeorge syndrome critical zone gene 2]; DGCR6[DiGeorge syndrome critical zone gene 6]; DGCR6L[DiGeorge syndrome critical zone gene 6-sample]; DGCR8[DiGeorge syndrome critical zone gene 8]; DGUOK[deoxyguanosine kinases]; DHFR[dihyrofolate reductase]; DHODH[dihydroorate dehydrogenase]; The auxiliary albumen synzyme of DHPS[deoxidation]; DHRS7B[dehydrogenase/reductase enzyme (SDR family) member 7B]; DHRS9[dehydrogenase/reductase enzyme (SDR family) member 9]; The transparent homologue 1 of DIAPH1[(fruit bat)]; DICER1[dicer 1, the ribalgilase type-iii]; DIO2[takes off iodine enzyme, iodothyronine, Type II]; DKC1[dyskeratosis is congenital 11, dyskeratosis albumen]; DKK1[dickkopf homologue 1 (Africa xenopus)]; DLAT[dihydrolipoamide S-transacetylase]; DLG2[discs, large homologue 2 (fruit bat)]; DLG5[discs, large homologue 5 (fruit bat)]; DMBT1[lacks in malignant brain tumor 1]; The DMC1 dosage inhibiting factor of DMC1[mck1 homologue, meiosis-specificity homologous recombination (yeast)]; DMD[dystrophin]; DMP1[dentine matrix acid phosphorus protein 1]; DMPK[myotonic dystrophy-protein kinase]; The two property of DMRT1[and mab-3 associated transcription factor 1]; DMXL2[Dmx-sample 2]; DNA2[DNA replicative helicase 2 homologues (yeast)]; The DNAH1[dynein, genonema, heavy chain 1]; The DNAH12[dynein, genonema, heavy chain 12]; The DNAI1[dynein, genonema, medium chain 1]; The DNAI2[dynein, genonema, medium chain 2]; DNASE1[deoxyribonuclease I]; DNM2[dynamin 2]; DNM3[dynamin 3]; DNMT1[DNA (cytimidine-5-)-transmethylase 1]; DNMT3B[DNA (cytimidine-5-)-transmethylase 3 β]; The DNTT[deoxynucleotidyl transferase, terminal]; DOCK1[cytokinesis acting factor 1]; DOCK3[cytokinesis acting factor 3]; DOCK8[cytokinesis acting factor 8]; DOK1[docking protein 1,62kDa (EGFR-TK downstream 1)]; DOLK[dolichol kinases]; DPAGT1[dolichol-phosphate (UDP-N-acetylglucosamine) 2-Acetamido-2-deoxy-D-glucose phosphotransferase 1 (GlcNAc-1-P transferase)]; DPEP1[dipeptidase 1 (kidney)]; DPH1[DPH1 homologue (saccharomyces cerevisiae)]; DPM1[dolichol-phosphate mannose transferase polypeptide 1, catalytic subunit]; DPP10[bis-peptidyls-peptase 10]; DPP4[bis-peptidyls-peptase 4]; DPYD[dihydropyrimidine dehydrogenase]; DRD2[dopamine receptor D2]; DRD3[dopamine receptor D3]; DRD4[dopamine receptor D4]; DSC2[desmocollin 2]; DSG1[desmoglein 1]; DSG2[desmoglein 2]; DSG3[desmoglein-3 (pemphigus vulgaris antigen)]; DSP[desmoplakin]; The little myotrophy albumen of DTNA[, α]; DTYMK[AZT acid kinase (thymidylate kinase)]; The dual oxidizing ferment 1 of DUOX1[]; The dual oxidizing ferment 2 of DUOX2[]; DUSP1[dual specificity phosphatase enzyme 1]; DUSP14[dual specificity phosphatase enzyme 14]; DUSP2[dual specificity phosphatase enzyme 2]; DUSP5[dual specificity phosphatase enzyme 5]; DUT[uracil deoxyriboside triphosphatase]; DVL1[is at random, dsh homologue 1 (fruit bat)]; The DYNC2H1[dynein, cytoplasm 2, heavy chain 1]; The DYNLL1[dynein, light chain, LC8-Class1]; DYRK1A[-specificity tyrosine-(Y)-phosphorylation kinases 1]; DYSF[dysferlin albumen, limb-girdle muscular dystrophy 2B (autosomal recessive)]; E2F 1[E2F transcription factor 1]; The early stage B cell factor 2 of EBF2[]; EBI3[Epstein-Barr virus induction 3]; ECE1[endothelin converting enzyme 1]; ECM1[extracellular matrix proteins 1]; The outer M-band of EDA[]; The outer M-band A acceptor of EDAR[]; EDN1[Endothelin 1]; EDNRA[endothelin receptor type A]; EDNRB[endothelin receptor type B]; EEF1A1[Translation elongation factor 1 alpha 1]; EEF1A2[eukaryotic translation elongation factor 1 alpha differential 2]; The fine albumen that EFEMP2[contains EGF-like cell extracellular matrix protein 2]; EFNA1[pterinophore-A1]; EFNB2[pterinophore-B2]; EFS[embryo Fyn related substrates]; EGF[EGF (β-anthelone)]; EGFR[EGF-R ELISA (EBL virus (v-erb-b) oncogene homologue, birds)]; The EGR1[early growth replys 1]; The EGR2[early growth replys 2]; The EHF[ets homology factor]; EHMT2[euchromatin histone-lysine N-transmethylase 2]; IF2AK2[eukaryotic translation initiation factor 2-alpha kinase 2]; EIF2S1[eukaryotic translation initiation factor 2,1 α of subunit, 35kDa]; EIF2S2[eukaryotic translation initiation factor 2,2 β of subunit, 38kDa]; EIF3A[eukaryotic translation initiation factor 3, subunit A]; EIF4B[eukaryotic translation initiation factor 4B]; EIF4E[eukaryotic translation initiation factor 4E]; EIF4EBP1[eukaryotic translation initiation factor 4E Binding Protein 1]; EIF4G1[eukaryotic translation initiation factor 4 γ, 1]; EIF6[eukaryotic translation initiation factor 6]; ELAC2[elaC homologue 2 (Escherichia coli)]; The ELANE[elastoser, neutrophil leucocyte is expressed]; ELAVL1[ELAV (embryonic death, paropsia, fruit bat)-sample 1 (Hu antigen R)]; ELF3[E74-like factor 3 (ets domain transcription factor, epithelium-specificity)]; ELF5[E74-like factor 5 (ets domain transcription factor)]; ELN[elastin laminin]; ELOVL4[extends very-long-chain fatty acid (FEN1/Elo2, SUR4/Elo3, yeast)-sample 4]; EMD[emerin]; The EMILIN1[elastin laminin microfibre interface factor 1]; EMR2[contains egf-original mold piece, mucoprotein-sample, hormone receptor-sample 2]; EN2[zigzag homology frame 2]; ENG[endothelium glycoprotein]; The ENO1[enolase1, (α)]; ENO2[enolase 2 (γ, neuron)]; ENO3[enolase 3 (β, muscle)]; Outer pyrophosphatase/the phosphodiesterase 2 of ENPP2[nucleotides]; Outer pyrophosphatase/the phosphodiesterase 3 of ENPP3[nucleotides]; The outer triphosphoric acid diphosphonic acid hydrolase 1 of ENTPD1[nucleosides]; EP300[E1A is in conjunction with albumen p300]; EPAS1[endothelium Hypoxia Inducible Factor-2 matter 1]; EPB42[erythrocyte membrane protein matter band 4.2]; EPCAM[epithelial cell adhesion molecule]; EPHA1[EPH acceptor A1]; EPHA2[EPH acceptor A2]; EPHB2[EPH acceptor B2]; EPHB4[EPH acceptor B4]; EPHB6[EPH acceptor B6]; EPHX1[EH 1, microsome (heteroplasia)]; EPHX2[EH 2, cytoplasm]; EPO[hematopoietin]; EPOR[EPO Receipter]; EPRS[glutamy-prolyl-tRNA synzyme]; EPX[eosinophil peroxidase]; ERBB2[v-erb-b2 EBL Viral Carcinogenesis gene homolog 2, nerve/spongioblastoma derives oncogene homologue (birds)]; ERBB2IP[erbb2 is in conjunction with albumen]; ERBB3[v-erb-b2 EBL Viral Carcinogenesis gene homolog 3 (birds)]; ERBB4[v-erb-a EBL Viral Carcinogenesis gene homolog 4 (birds)]; The ERCC1[excision repair cross complementing rodent repair deficiency, complementation organized for 1 (comprising overlapping antisense sequences)]; Mouse defect Cross-complementing Gene is repaired in the ERCC2[excision, complementary group 2]; Mouse defect Cross-complementing Gene is repaired in the ERCC3[excision, complementary group 3 (xeroderma pitmentosum group B supplements)]; Mouse defect Cross-complementing Gene is repaired in the ERCC4[excision, complementary group 4]; Mouse defect Cross-complementing Gene is repaired in the ERCC5[excision, complementary group 5]; Mouse defect Cross-complementing Gene is repaired in the ERCC6[excision, complementary group 6]; Mouse defect Cross-complementing Gene is repaired in the ERCC6L[excision, complementary group 6-sample]; Mouse defect Cross-complementing Gene is repaired in the ERCC8[excision, complementary group 8]; ERO1LB[ERO1-sample β (saccharomyces cerevisiae)]; ERVK6[endogenous retrovirus sequence K, 6]; The ERVWE1[endogenous retrovirus W of family, env (C7), the member 1]; ESD[esterase D/ formylglutation hydrolase]; ESR1[ERs 1]; ESR2[estrogen receptor 2 (ER β)]; ESRRA[estrogen-related receptor α]; ESRRB[estrogen-related receptor β]; ETS1[v-ets erythroblastosis virus E26 oncogene homologue 1 (birds)]; ETS2[v-ets erythroblastosis virus E26 oncogene homologue 2 (birds)]; The EWSR1[ewing's sarcoma turns breakpoint region 1]; EXO1[exonuclease 1]; EYA1[eyes disappearance homologue 1 (fruit bat)]; The enhancer 2 (fruit bat) of EZH2[zeste homologue 2]; EZR[ezrin]; F10[Stuart factor]; F11[plasma thromboplastin antecedent]; F12[Hageman factor (the Hageman factor)]; The F13A1[factor XIII, the A1 polypeptide]; The F13B[factor XIII, the B polypeptide]; F2[prothrombin (fibrin ferment)]; F2R[prothrombin (fibrin ferment) acceptor]; F2RL1[prothrombin (fibrin ferment) acceptor-sample 1]; F2RL3[prothrombin (fibrin ferment) acceptor-sample 3]; F3[thromboplastin (factor I, tissue factor)]; F5[labile factor (labile factor proaccelerin, instability factor)]; F7[proconvertin (serum prothrombin conversion accelerator)]; The F8[blood coagulation factor VIII, short blood coagulation component]; F9[plasma thromboplastin component]; FABP1[fatty acid binding protein 1, liver]; FABP2[fatty acid binding protein 2, intestines]; The FABP4[FABP4, adipocyte]; FADD[Fas (TNFRSF6)-relevant via Death Domain]; FADS1[fatty acid desaturase 1]; FADS2[FADS2]; FAF1[Fas (TNFRSF6) associated factor 1]; FAH[fumarylacetoacetate hydrolase (fumarylacetoacetase)]; FAM189B[sequence similarity family 189, member B]; FAM92B[sequence similarity family 92, member B]; The FANCA[Fanconi anaemia, complementary group A]; The FANCB[Fanconi anaemia, complementary group B]; The FANCC[Fanconi anaemia, complementary group C]; The FANCD2[Fanconi anaemia, complementary group D2]; The FANCE[Fanconi anaemia, complementary group E]; The FANCF[Fanconi anaemia, complementary group F]; The FANCG[Fanconi anaemia, complementary group G]; The FANCI[Fanconi anaemia, complementary group I]; The FANCL[Fanconi anaemia, complementary group L]; The FANCM[Fanconi anaemia, complementary group M]; FANK1[Fibronectins type III and ankyrin repeat territory 1]; FAS[Fas (TNF acceptor Superfamily, the member 6)]; FASLG[Fas part (TNF Superfamily, the member 6)]; FASN[fatty acid synthetase]; FASTK[Fas-activates serine/threonine kinase]; The fine albumen 5 of FBLN5[]; FBN1[fibrillin-1]; FBP1[ester of Harden Young esterase 1]; FBXO32[F-frame protein 32]; FBXW7[contains F-frame and WD duplicate domain 7]; FCAR[Fc fragment IgA, acceptor]; FCER1A[Fc fragment IGE, high-affinity I, acceptor; α polypeptide]; FCER1G[Fc fragment IGE, high-affinity I, acceptor; γ polypeptide]; The Fc fragment of FCER2[IgE, low-affinity II, acceptor (CD23)]; The Fc fragment of FCGR1A[IgG, high-affinity Ia, acceptor (CD64)]; The Fc fragment of FCGR2A[IgG, low-affinity IIa, acceptor (CD32)]; The Fc fragment of FCGR2B[IgG, low-affinity IIb, acceptor (CD32)]; The Fc fragment of FCGR3A[IgG, low-affinity IIIa, acceptor (CD16a)]; The Fc fragment of FCGR3B[IgG, low-affinity IIIb, acceptor (CD16b)]; FCN2[fiber gelatinized protein (agglutinin that contains collagen/fibrinogen territory) 2 (hucolin)]; FCN3[fiber gelatinized protein (containing collagen/fibrinogen territory) 3 (Hakata antigens)]; FCRL3[Fc acceptor-sample 3]; FCRL6[Fc acceptor-sample 6]; FDFT1[farnesyl-bisphosphate farnesyl transferase 1]; FDPS[farnesyl diphosphate synthase (farnesyl pyrophosphate synzyme, Dimethylallyltranstransferase, geraniol transferase)]; FDX1[ferredoxin 1]; FEN1[valve structure-specificity restriction endonuclease 1]; FERMT1[fermitin family homologue 1 (fruit bat)]; FERMT3[fermitin family homologue 3 (fruit bat)]; FES[feline sarcoma oncogene]; FFAR2[free-fat acid acceptor 2]; FGA[fibrinogen α chain]; FGB[fibrinogen β chain]; FGF1[desmocyte growth factor-21 (acidity)]; FGF2[FGF2 (alkalescence)]; FGF5[FGF5]; FGF7[fibroblast growth factor 7 (keratinocyte growth factor)]; FGF8[FGF8 (androgen-inducing)]; The FGFBP2[fibroblast growth factor is in conjunction with albumen 2]; FGFR1[fibroblast growth factor acceptor 1]; FGFR1OP[FGFR1 oncogene gametophyte]; FGFR2[fibroblast growth factor acceptor 2]; FGFR3[fibroblast growth factor receptor3]; FGFR4[fibroblast growth factor receptor 4]; FGG[fibrinogen γ chain]; FGR[Gardner-Rasheed cat sarcoma virus (v-fgr) oncogene homologue]; FHIT[Relationship between Fragile Histidine Triad Gene]; FHL1[4 half LIM domain 1]; FHL2[4 half LIM domain 2]; FIBP[fibroblast growth factor (acidity) ICBP]; FIGF[c-fos guides growth factor (vascular endothelial growth factor D)]; The FKBP1A[FK506 Binding Protein 1,12kDa]; The FKBP4[FK506 conjugated protein 4,59kDa]; FKBP5[FK506 is in conjunction with albumen 5]; FLCN[folliculin]; FLG[silk polyprotein]; FLG2[silk polyprotein family member 2]; The FLNA[tenuin, α]; FLNB[tenuin B, β]; The FLT1[fms EGFR-TK 1 (VEGF/vascular permeability factor acceptor) of being correlated with]; The FLT3[fms EGFR-TK 3 of being correlated with]; FLT3LG[fms EGFR-TK 3 parts of being correlated with]; The FLT4[fms EGFR-TK 4 of being correlated with]; FMN1[formin 1]; FMOD[fibromodulin]; FMR1[fragile X mental retardation 1]; FN1[fibronectin 1]; FOLH1[folic acid hydrolase (Prostato-specific membrane antigen) 1]; FOLR1[folacin receptor 1 (growing up)]; FOS[FBJ Muridae osteosarcoma virus oncogene homologue]; FOXL2[jaw frame L2]; FOXN1[jaw frame N1]; FOXN2[jaw frame N2]; FOXO3[jaw frame O3]; FOXP3[jaw frame P3]; FPGS[leaf acyl polyglutamic acid synzyme]; FPR1[formyl peptide receptor 1]; FPR2[formyl peptide receptor 2]; FRAS1[Fraser syndrome 1]; FREM2[FRAS1 relevant cell extracellular matrix protein 2]; FSCN1[flesh fasciclin homologue 1, actin-fasciclin matter (strongylocentrotus purpuratus)]; The FSHB[follicular stimulating hormone, beta polypeptides]; FSHR[follicle-stimulating hormone receptor]; FST[follistatin]; FTCD[FTCD]; The FTH1[ferritin, heavy polypeptide 1]; The FTL[ferritin, light polypeptide]; FURIN[furin (basic amino acid lyases in pairs)]; FUT1[fucosyltransferase 1 (galactoside 2-α-L-fucose based transferase, H blood group)]; FUT2[fucosyltransferase 2 (comprising secretor state)]; FUT3[FUT3 (galactoside 3 (4)-L-fucose based transferases, Lewis blood group)]; FUT4[fucosyltransferase 4 (α (1,3) fucosyltransferase, marrow-specificity)]; FUT7[fucosyltransferase 7 (α (1,3) fucosyltransferase)]; FUT8[fucosyltransferase 8 (α (1,6) fucosyltransferase)]; FXN[Fu Shi incoordination albumen]; FYN[FYN oncogene related SR C, FGR, YES]; The curling homologue 4 of FZD4[(fruit bat)]; G6PC3[glucose 6 phosphatases, catalysis, 3]; G6PD[G-6-P ester dehydrogenase]; The GAA[glucuroide, α; Acid]; GAB2[GRB2 Binding proteins 2]; GABBR1[GABA (GABA) B acceptor, 1]; GABRB3[GABA (GABA) acceptor, β 3]; GABRE[GABA (GABA) acceptor, ε]; GAD1[glutamate decarboxylase 1 (brain, 67kDa)]; GAD2[glutamate decarboxylase 2 (pancreas islet and brain, 65kDa)]; GADD45A[growth retardation and DNA-wound inducement, α]; GAL[galanin prepropeptide]; GALC[galactocerebroside β-galactosidase]; GALK1[galactokinase 1]; GALR1[galanin receptors 1]; GAP43[growth associated protein matter 43]; GAPDH[glyceraldehyde-3-phosphate dehydrogenase]; The GART[Phosphoribosylglycinamide formyltransferase, GAPS, Phosphoribosyl aminooimidazole synzyme]; GAST[gastrin]; GATA1[GATA Binding Protein 1 (globulin transcription factor 1)]; GATA2[GATA is in conjunction with albumen]; GATA3[GATA is in conjunction with albumen]; GATA4[GATA is in conjunction with albumen]; GATA6[GATA is in conjunction with albumen; The GBA[glucuroide, β, acid]; The GBA3[glucuroide, β, acid 3 (cytoplasm)]; GBE1[glucase (1[4-α-), branching enzyme 1]; GC[group-specificity component (DBP]; GCG[glucagons]; GCH1[GTP cyclohydrolase 1]; GCKR[glucokinase (hexokinase 4) regulatory factor]; The GCLC[Glutamate-cysteine ligase, catalytic subunit]; The GCLM[Glutamate-cysteine ligase, modifying factor subunit]; GCNT2[glucose amido (N-acetyl group) transferase 2, I-branching enzyme (I blood group)]; GDAP1[gangliosides-induce and break up related protein 1]; GDF15[growth and differentiation factor 15]; The glial cell derived neurotrophic factor of GDNF[]; GFAP[glial fibrillary acidic protein matter]; GGH[gamma-Glutamyl hydrolase (desmoenzyme, the leaf acyl gathers gamma-Glutamyl hydrolase)]; GGT1[gamma glutamyltransferase 1]; GGT2[gamma glutamyltransferase 2]; GH1[growth hormone 1]; GHR[growth hormone receptor]; GHRH[growth hormone releasing hormone]; GHRL[motilin/obestatin prepropeptide]; GHSR[secretagogue receptor]; GIF[stomach internal factor (Cobastab is synthetic)]; GIP[gastric inhibitory polypepitde]; The GJA1[gap junction protein, α Isosorbide-5-Nitrae 3kDa]; The GJA4[gap junction protein, α 4,37kDa]; The GJB2[gap junction protein, β 2,26kDa]; The GLA[galactosidase, α]; The GLB1[galactosidase, β 1]; GLI2[GLI family zinc refers to 2]; The GLMN[tamm-Horsfall protein, the FKBP related protein]; GLRX[glutaredoxin (thioltransferase)]; GLS[glutaminase]; GLT25D1[contains glycosyltransferase 25 territories 1]; GLUL[glutamic acid-ammonia ligase (glutamine synthelase)]; GLYAT[Gly-N-acyltransferase]; GM2A[GM2 gangliosides activity factor]; GMDS[GDP-mannose 4[6-dehydratase]; GNA12[guanine-nucleotide-binding protein (G albumen) α 12]; GNA13[guanine-nucleotide-binding protein (G albumen), α 13]; GNAI1[guanine-nucleotide-binding protein (G albumen), α suppresses active peptides 1]; GNAO1[guanine-nucleotide-binding protein (G albumen), α activating activities polypeptide O]; GNAQ[guanine-nucleotide-binding protein (G albumen), the q polypeptide]; GNAS[GNAS complex locus]; GNAZ[guanine-nucleotide-binding protein (G albumen), α z polypeptide]; GNB1[guanine-nucleotide-binding protein (G albumen), beta polypeptides 1]; GNB1L[guanine-nucleotide-binding protein (G albumen), beta polypeptides 1-sample]; GNB2L1[guanine-nucleotide-binding protein (G albumen), beta polypeptides 2-sample 1]; GNB3[guanine-nucleotide-binding protein (G albumen), beta polypeptides 3]; GNE[aminoglucose (UDP-N-acetyl group)-2-epimerase/ManNAc kinases]; GNG2[guanine-nucleotide-binding protein (G albumen), γ 2]; GNLY[granulysin]; GNPAT[phosphoglycerol O-acyltransferase]; GNPDA2[glucosamine-6-phosphate ester deaminase 2]; GNRH1[promoting sexual gland hormone-releasing hormone 1 (short corpus luteum-releasing hormone)]; GNRHR[promoting sexual gland hormone-releasing hormone receptor]; GOLGA8B[Golgi apparatus protein A8 family, member B]; GOLGB1[Golgi apparatus protein B1]; GOT1[glutamic-oxaloacetic transaminase 1, solvable (aspartate transaminase 1)]; GOT2[glutamic-oxaloacetic transaminase 2, mitochondria (aspartate transaminase 2)]; GP1BA[glycoprotein ibalpha (blood platelet), the α polypeptide]; GP2[glycoprotein 2 (zymogen granule film)]; GP6[Glycoprotein VI (blood platelet)]; GPBAR1[G albumen-coupling cholic acid acceptor 1]; GPC5[glypican 5]; GPI[glucosephosphate isomerase]; GPLD1[glycosyl-phosphatidyl inositol specificity Phospholipase D1]; GPN1[GPN-ring GTP enzyme 1]; GPR1[G albumen-coupled receptor 1]; GPR12[G albumen-coupled receptor 12]; GPR123[G albumen-coupled receptor 123]; GPR143[G albumen-coupled receptor 143]; GPR15[G albumen-coupled receptor 15]; GPR182[G albumen-coupled receptor 182]; GPR44[G albumen-coupled receptor 44]; GPR77[G albumen-coupled receptor 77]; GPRASP1[G albumen-coupled receptor sorting protein 1 of being correlated with]; GPRC6A[G albumen-coupled receptor, the C of family, organize 6, member A]; GPT[glutamic-pyruvic transaminase (alanine aminotransferase)]; GPX1[glutathione peroxidase 1]; GPX2[glutathione peroxidase 2 (stomach and intestine)]; GPX3[glutathione peroxidase 3 (blood plasma)]; The relevant factor protein matter 2 that is connected of GRAP2[GRB2]; The GRB2[growth factor receptors-in conjunction with albumen 2]; The GRIA2[glutamate receptor, ionic, AMPA2]; The GRIN1[glutamate receptor, ionic, N-methyl D-Asp 1]; The GRIN2A[glutamate receptor, ionic, N-methyl D-Asp 2]; The GRIN2B[glutamate receptor, ionic, N-methyl D-Asp 2B]; The GRIN2C[glutamate receptor, ionic, N-methyl D-Asp 2C]; The GRIN2D[glutamate receptor, ionic, N-methyl D-Asp 2D]; The GRIN3A[glutamate receptor, ionic, N-methyl-D-aspartate 3]; The GRIN3B[glutamate receptor, ionic, N-methyl-D-aspartate 3B]; GRK5[G albumen-coupled receptor kinase 5]; GRLF1[glucocorticoid receptor dna binding factor 1]; The GRM1[glutamate receptor, metabotropic 1]; GRP[gastrin-release peptide]; GRPR[gastrin-releasing peptide receptor]; GSC[goosecoid homology frame]; GSC2[goosecoid homology frame 2]; GSDMB[gasderminB]; GSK3B[glycogen synthase kinase 3 β]; GSN[gelsolin]; GSR[glutathione reductase]; GSS[glutathione synthetase]; GSTA1[glutathione S-transferase α 1]; GSTA2[glutathione S-transferase α 2]; GSTM1[glutathione S-transferase μ 1]; GSTM3[glutathione S-transferase μ 3 (brain)]; GSTO2[glutathione S-transferase Ω 2]; GSTP1[glutathione S-transferase π 1]; GSTT1[glutathione S-transferase θ 1]; The general transcription factor IIA of GTF2A1[, 1,19/37kDa]; The general transcription factor IIF of GTF2F1[, polypeptide 1,74kDa]; The general transcription factor IIH of GTF2H2[, polypeptide 2,44kDa]; The general transcription factor IIH of GTF2H4[, polypeptide 4,52kDa]; The general transcription factor IIH of GTF2H5[, polypeptide 5]; The general transcription factor IIi of GTF2I[]; The general transcription factor IIIA of GTF3A[]; GUCA2A[guanylate cyclase activity factor 2 (guanylin)]; GUCA2B[guanylate cyclase activity factor 2B (uroguanylin)]; GUCY2C[GUCY2C (thermally-stabilised enterotoxin receptor)]; GUK1[guanylate kinase-1]; GULP1[GULP, contain to swallow up be connected factor PTB territory 1]; The GUSB[glycuronidase, β]; GYPA[glycoprotein (MNS blood group)]; GYPB[Glycoprotein B (MNS blood group)]; GYPC[gC (Gerbich blood group)]; GYPE[glycoprotein E (MNS blood group)]; GYS1[glycogen synthetase 1 (muscle)]; GZMA[granzyme (granzyme 1, cytotoxin T-lymphocyte be correlated with serine easterase 3)]; GZMB[granzyme B (granzyme 2, cytotoxin T-lymphocyte be correlated with serine easterase 1)]; GZMK[granzyme K (granzyme 3; Trypsase II)]; The H1F0[H1 histone family, the member 0]; The H2AFX[H2A histone family, member X]; HABP2[HABP 2]; HACL1[2-hydroxyl acyl group-coacetylase lyases 1]; HADHA[hydroxyl acyl group-coa dehydrogenase/3-ketoacyl-coacetylase thiolase/alkene acyl-CoA hydratase (trifunctional protein), alpha subunit]; HAL[histidine ammonia-lyases]; HAMP[iron is adjusted plain antibacterial peptide]; The HAPLN1[hyaluronic acid is connected protein 1 with proteoglycan]; HAVCR1[hepatitis viruse cell receptor 1]; HAVCR2[hepatitis viruse cell receptor 2]; HAX1[HCLS1 related protein X-1]; The HBA1[hemoglobin, α 1]; The HBA2[hemoglobin, α 2]; The HBB[hemoglobin, β]; The HBE1[hemoglobin, ε 1]; The HBEGF[heparin-in conjunction with the EGF-like growth factor]; The HBG2[hemoglobin, γ G]; The full cytochrome c synzyme of HCCS[(cytochrome c heme-lyases)]; HCK[hematopoietic cell kinases]; HCRT[inferior colliculus secretin (orexin) neuropeptide precursor]; HCRTR1[inferior colliculus secretin (orexin) acceptor 1]; HCRTR2[inferior colliculus secretin (orexin) acceptor 2]; HCST[hematopoietic cell signal transduction]; HDAC1[histone deacetylase 1]; HDAC2[histone deacetylase 2]; HDAC6[histone deacetylase 6]; HDAC9[histone deacetylase 9]; HDC[histidine decarboxylase]; HERC2[hect territory and RLD2]; HES1[crinosity and enhancer, rupture 1, (fruit bat)]; HES6[crinosity and enhancer, 6 (fruit bats) of rupturing]; HESX1[HESX homology frame 1]; HEXA[hexosaminidase (α polypeptide)]; HEXB[hexosaminidase B (beta polypeptides)]; HFE[hemochromatosis]; HGF[HGF (hepatocyte growth factor A; Dispersion factor)]; HGS[HGF-regulation and control tyrosine kinase substrate]; HGSNAT[heparin-alpha-amido glucoside N-acetyl-transferase]; The HIF1A[oxygen deficient induction factor 1, alpha subunit (alkaline helix-loop-helix transcription factor)]; HINFP[histone H 4 transcription factor]; HINT1[histidine triplet nucleotide binding protein 1]; HIPK2[homeodomain interaction protein kinases 2]; HIRA[HIR histone cell cycle regulating defect homologue A (saccharomyces cerevisiae)]; HIST1H1B[histone 1, the H1b that troops]; HIST1H3E[histone 1, the H3e that troops]; HIST2H2AC[histone 2, the H2ac that troops]; HIST2H3C[histone 2, the H3c that troops]; HIST4H4[histone 4, the H4 that troops]; HJURP[Holliday linkage identification protein]; HK2[Hexokinase 2]; The HLA-A[major histocompatibility complex, class I, A]; The HLA-B[major histocompatibility complex, class I, B]; The HLA-C[major histocompatibility complex, class I, C]; The HLA-DMA[major histocompatibility complex, class II, DM α]; The HLA-DMB[major histocompatibility complex, class II, DM β]; The HLA-DOA[major histocompatibility complex, class II, DO α]; The HLA-DOB[major histocompatibility complex, class II, DO β]; The HLA-DPA1[major histocompatibility complex, class II, DP α 1]; The HLA-DPB1[major histocompatibility complex, class II, DP β 1]; The HLA-DQA1[major histocompatibility complex, class II, DQ α 1]; The HLA-DQA2[major histocompatibility complex, class II, DQ α 2]; The HLA-DQB1[major histocompatibility complex, class II, DQ β 1]; The HLA-DRA[major histocompatibility complex, class II, DR α]; The HLA-DRB1[major histocompatibility complex, class II, DR β 1]; The HLA-DRB3[major histocompatibility complex, class II, DR β 3]; The HLA-DRB4[major histocompatibility complex, class II, DR β 4]; The HLA-DRB5[major histocompatibility complex, class II, DR β 5]; The HLA-E[major histocompatibility complex, class I, E]; The HLA-F[major histocompatibility complex, class I, F]; The HLA-G[major histocompatibility complex, class I, G]; HLCS[holocarboxylase synthetase (biotin-(propiono-coacetylase-carboxylase (ATP-hydrolysis)) ligase)]; HLTF[unwindase-sample transcription factor]; HLX[H2.0-sample homology frame]; HMBS[methylol bilane synzyme]; HMGA1[high mobility group protein AT-hook 1]; HMGB1[high mobility group protein 1]; HMGCR[3-hydroxy-3-methyl glutaric acid radical-CoA-reductase]; HMOX1[Heme oxygenase (unlinking) 1]; HMOX2[Heme oxygenase (unlinking) 2]; HNF1A[HNF1 homology frame A]; The HNF4A[Hepatocyte nuclear factor 4, α]; HNMT[histamine N-methyl transferase]; HNRNPA1[hnRNP A1]; HNRNPA2B1[hnRNP A2/B1]; HNRNPH2[hnRNP H2 (H ')]; HNRNPUL1[hnRNP U-sample 1]; HOXA13[homology frame A13]; HOXA4[homology frame A4]; HOXA9[homology frame A9]; HOXB4[homology frame B4]; HP[hoptoglobin]; HPGDS[hematopoietic prostaglandin D synzyme]; HPR[hoptoglobin related protein]; HPRT1[hypoxanthine phosphoribosyltransferase 1]; HPS1[Hermansky-Pudlak syndrome 1]; HPS3[Hermansky-Pudlak comprehensive 3]; HPS4[Hermansky-Pudlak comprehensive 4]; HPSE[heparinase]; HPX[hemopexin]; HRAS[v-HA-ras Harvey rat sarcoma virus oncogene homologue]; The rich histidine glycoprotein of HRG[]; HRH1[histamine H_1 receptor]; HRH2[histamine receptor H2]; HRH3[histamine receptor H3]; HRH4[histamine receptor H4]; HSD11B1[hydroxy steroid (11-β) dehydrogenase 1]; HSD11B2[hydroxy steroid (11-β) dehydrogenase 2]; HSD17B1[hydroxy steroid (17-β) dehydrogenase 1]; HSD17B4[hydroxy steroid (17-β) dehydrogenase 4]; HSF1[Features of The Heat Shock Transcription Factor 1]; HSP90AA1[heat shock protein 90kDa α (cytoplasm), class A member 1]; HSP90AB1[heat shock protein 90kDa α (cytoplasm), class B member 1]; HSP90B1[heat shock protein 90kDa β (Grp94), the member 1]; HSPA14[heat shock 70kDa protein 14]; HSPA1A[heat shock 70kDa protein 1A]; HSPA1B[heat shock 70kDa protein 1B]; HSPA2[heat shock 70kDa protein 2]; HSPA4[heat shock 70kDa protein 4]; HSPA5[heat shock 70kDa protein 5 (glucose-regulation protein, 78kDa)]; HSPA8[heat shock 70kDa protein 8]; HSPB1[heat shock 27kDa protein 1]; HSPB2[heat shock 27kDa protein 2]; HSPD1[heat shock 60kDa protein 1 (chaperone)]; HSPE1[heat shock 10kDa protein 1 (cpn10)]; HSPG2[Heparan sulfate proteoglycan 2]; HTN3[histamine element 3]; HTR1A[5-hydroxytryptamine (thrombocytin) acceptor 1]; HTR2A[5-hydroxytryptamine (thrombocytin) acceptor 2]; HTR3A[5-hydroxytryptamine (thrombocytin) acceptor 3A]; HTRA1[HtrA serine peptase 1]; HTT[Huntington protein]; HUS1[HUS1 test point homologue (fission yeast)]; HUWE1[contains HECT, UBA and WWE territory 1]; HYAL1[hyaluronoglucosaminidase 1]; HYLS1[hydrogen lethal syndrome 1]; IAPP[IAPP]; The IBSP[integrin-in conjunction with sialoprotein]; ICAM1[ICAM-1]; ICAM2[ICAIU 2]; ICAM3[ICAIU 3]; ICAM4[ICAIU 4 (Landsteiner-Wiener blood group)]; ICOS[can induce T-cell costimulator]; ICOSLG[can induce T-cell costimulator part]; ID1[DNA is in conjunction with inhibiting factor 1, dominant negative helix-loop-helix protein matter]; ID2[DNA is in conjunction with inhibiting factor 2, dominant negative helix-loop-helix protein matter]; IDO1[indoleamine 2 [3-dioxygenase 1]; IDS[iduronate 2-sulfatase]; The IDUA[iduronidase, α-L-]; IFI27[interferon, but α-induced protein 27]; IFI30[interferon, but γ-induced protein 30]; IFITM1[interferon guiding transmembrane protein 1 (9-27)]; The IFNA1[interferon, α 1]; The IFNA2[interferon, α 2]; IFNAR1[interferon (α, β and Ω) acceptor 1]; IFNAR2[interferon (α, β and Ω) acceptor 2]; The IFNB1[interferon, β 1, fibroblast]; The IFNG[interferon, γ]; IFNGR1[interferon gamma receptor 1]; IFNGR2[interferon gamma receptor 2 (interferon gamma transformation factor 1)]; IGF1[type-1 insulin like growth factor (somatomedin C)]; IGF1R[type-1 insulin like growth factor acceptor]; IGF2[IMA-IGF2BP3-001 (SM-A)]; IGF2R[IMA-IGF2BP3-001 acceptor]; IGFBP1[IGFBP-1]; The IGFBP2[IGFBP2,36kDa]; IGFBP3[IBP3]; IGFBP4[IGFBP4]; IGFBP5[IGFBP5]; The constant α 1 of IGHA1[heavy chain immunoglobulin]; The constant ε of IGHE[heavy chain immunoglobulin]; The constant γ 1 of IGHG1[heavy chain immunoglobulin (G1m label)]; The constant γ 3 of IGHG3[heavy chain immunoglobulin (G3m label)]; The constant γ 4 of IGHG4[heavy chain immunoglobulin (G4m label)]; IGHM[heavy chain immunoglobulin constant-mu]; The IGHMBP2[immune globulin Mu is in conjunction with albumen 2]; κ is constant for the IGKC[immunoglobulin (Ig)]; The variable 2D-29 of IGKV2D-29[immunoglobulin (Ig) κ]; IGLL1[immunoglobulin (Ig) λ-sample polypeptide 1]; IGSF1[immunoglobulin (Ig) Superfamily, the member 1]; The inhibitor of κ light chain polypeptide genetic enhancer in the IKBKAP[B cell, the kinases complex protein of being correlated with]; The inhibitor of κ light chain polypeptide genetic enhancer in the IKBKB[B cell, kinase beta]; The inhibitor of IKBKE[B cell κ light chain polypeptide genetic enhancer, kinases ε]; The inhibitor of IKBKG[B cell κ light chain polypeptide genetic enhancer, kinases γ]; IKZF1[IKAROS family zinc refers to 1 (Ikaros)]; IKZF2[IKAROS family zinc refers to 2 (Helios)]; IL10[interleukin 10]; The IL10RA[Interleukin 10 receptor, α]; The IL10RB[Interleukin 10 receptor, β]; IL11[interleukin-11]; The IL12A[interleukin 12 (natural kill cell stimulating factor 1, cytotoxic lymphocytic maturation factor 1, p35)]; IL12B[interleukin 12 B (natural kill cell stimulating factor 2, cytotoxic lymphocytic maturation factor 2, p40)]; IL12RB1[interleukin 12 acceptor, β 1]; IL12RB2[interleukin 12 acceptor, β 2]; IL13[interleukin-13]; IL13RA1[interleukin-13 acceptor, α 1]; IL13RA2[interleukin-13 acceptor, α 2]; IL15[interleukin 15]; IL15RA[interleukin 15 acceptor, α]; IL16[interleukins 16 (the lymphocyte chemotactic factor (LCF) factor)]; IL17A[IL-17]; IL17F[IL-17 F]; IL17RA[IL-17 acceptor A]; IL17RB[IL-17 acceptor B]; IL17RC[IL-17 acceptor C]; IL18[interleukin-18 (interferon-γ-inducible factor)]; The IL18BP[interleukin-18 is in conjunction with albumen]; IL18R1[interleukin 18 receptor 1]; IL18RAP[interleukin 18 receptor auxiliary protein]; IL19[interleukin 1 9]; The IL1A[interleukin 1, α]; The IL1B[interleukin 1, β]; IL1F9[interleukin 1 family, the member 9]; The IL1R1[interleukin 1 receptor, type I]; IL1RAP[interleukin 1 receptor auxiliary protein]; IL1RL1[interleukin 1 receptor-sample 1]; IL1RN[interleukin 1 receptor antagonist]; IL2[interleukin 2]; IL20[interleukin 2 0]; IL21[IL-21]; IL21R[IL-21 acceptor]; IL22[interleukin 2 2]; The IL23A[interleukin 23, alpha subunit p19]; IL23R[interleukin 23 acceptor]; IL24[interleukin 24]; IL25[Interleukin-25]; IL26[Interleukin-26]; IL27[IL-27]; IL27RA[IL-27 acceptor, α]; IL29[interleukin 29 (interferon, λ 1)]; The IL2RA[Interleukin-2 Receptor, α]; The IL2RB[Interleukin-2 Receptor, β]; The IL2RG[Interleukin-2 Receptor, γ (Reconstruction in Sever Combined Immunodeciency)]; IL3[interleukin Ⅲ (colony-stimulating factor, various)]; IL31[interleukin Ⅲ 1]; IL32[interleukin Ⅲ 2]; IL33[interleukin Ⅲ 3]; IL3RA[interleukin Ⅲ acceptor, α (low-affinity)]; IL4[interleukin-4]; IL4R[interleukin-4 acceptor]; IL5[t cell growth factor (colony-stimulating factor, eosinophil)]; IL5RA[t cell growth factor acceptor, α]; IL6[interleukin-6 (interferon, β 2)]; IL6R[interleukin-6 receptor]; IL6ST[interleukin-6 signal transduction (gp130, oncostatinM receptor)]; IL7[interleukin-17]; IL7R[interleukin-17 receptor]; IL8[interleukin 8]; IL9[Interleukin-9]; IL9R[Interleukin-9 acceptor]; ILK[ILK]; IMP5[film endoproteinase 5]; The inner kinetochore proteantigen 135/155kDa of INCENP[]; ING1[growth inhibitor family, the member 1]; The INHA[inhibin, α]; The INHBA[inhibin, β A]; INPP4A[inositol polyphosphate-4-phosphatase, type I, 107kDa]; INPP5D[inositol polyphosphate-5-phosphatase, 145kDa]; INPP5E[inositol polyphosphate-5-phosphatase, 72kDa]; INPPL1[inositol polyphosphate phosphatase-sample 1]; INS[insulin]; INSL3[Insulin-Like 3 (Lay Schwann Cells)]; INSR[insulin receptor]; IPO13[inputs albumen 13]; IPO7[inputs albumen 7]; The GTP enzyme activation protein 1 that IQGAP1[contains the IQ motif]; IRAK1[interleukin 1 receptor associated kinase 1]; IRAK3[interleukin 1 receptor associated kinase 3]; IRAK4[interleukin 1 receptor associated kinase 4]; IRF1[interferon regulatory factor 1]; IRF2[interferon regulatory factor 2]; IRF3[interferon regulatory factor 3]; IRF4[interferon regulatory factor 4]; IRF5[interferon regulatory factor 5]; IRF7[interferon regulatory factor 7]; IRF8[interferon regulatory factor 8]; IRGM[Immune interrelation GTP enzyme family, M]; IRS1[substrate 1]; IRS2[IRS 2]; IRS4[IRS 4]; ISG15[ISG15 ubiquitin-sample modifying factor]; The ITCH[E3 ubiquitin protein matter ligase homologue (mouse) of itching]; ITFG1[contains beta 2 integrin alpha FG-GAP repetitive sequence 1]; The ITGA1[integrin, α 1]; The ITGA2[integrin, α 2 (CD49B, α 2 subunits of VLA-2 acceptor)]; The ITGA2B[integrin, α 2b (the platelet glycoprotein IIb of IIb/IIIa complex, antigen CD4 1)]; The ITGA3[integrin, α 3 (antigen CD4 9C, α 3 subunits of VLA-3 acceptor)]; The ITGA4[integrin, α 4 (antigen CD4 9D, the alpha-4 subunit of VLA-4 acceptor)]; The ITGA5[integrin, α 5 (fibronection receptor, α polypeptide)]; The ITGA6[integrin, α 6]; The ITGA8[integrin, α 8]; The ITGAE[integrin, α E (antigens c D103, people's mucous membrane lymphocyte antigen 1; The α polypeptide)]; The ITGAL[integrin, α L (antigens c D11A (p180), LFA 1; The α polypeptide)]; The ITGAM[integrin, α M (complement component 3 acceptor 3 subunits)]; The ITGAV[integrin, α V (Vitronectic receptor, α polypeptide, antigens c D51)]; The ITGAX[integrin, α X (complement component 3 acceptor 4 subunits)]; The ITGB1[integrin, β 1 (antigens c D29 comprises MDF2, MSK12 for fibronection receptor, beta polypeptides)]; The ITGB2[integrin, β 2 (complement component 3 acceptors 3 and 4 subunits)]; The ITGB3[integrin, β 3 (platelet glycoprotein IIIa, antigens c D61)]; ITGB3BP[integrin β 3 is in conjunction with albumen (β 3-endonexin)]; The ITGB4[integrin, β 4]; The ITGB6[integrin, β 6]; The ITGB7[integrin, β 7]; M-α (globulin) inhibiting factor H4 (kallikrein-responsive glycoprotein) in ITIH4[]; ITK[IL2-can induce the T-cell kinase]; Aggegation albumen 1 in ITLN1[(galactofuranose combination)]; Aggegation albumen 2 in ITLN2[]; ITPA[inosine triphosphatase (NTP pyrophosphatase)]; ITPR1[inositol Isosorbide-5-Nitrae, 5-triphosphate receptor, Class1]; ITPR3[inositol Isosorbide-5-Nitrae, 5-triguaiacyl phosphate acceptor, type 3]; IVD[isovaleryl-CoA dehydrogenase]; IVL[involurin]; IVNS1ABP[influenza virus NS1A is in conjunction with albumen]; JAG1[zigzag 1 (Alagille syndrome)]; JAK1[Janus kinases 1]; JAK2[Janus kinases 2]; JAK3[Janus kinases 3]; JAKMIP1[janus kinases and microtubule interaction protein 1]; JMJD6[contains jumonji territory 6]; JPH4[parent connection albumen 4]; JRKL[jerking movement homologue-sample (mouse)]; JUN[jun oncogene]; JUND[jun D is former-oncogene]; JUP[connects plakoglobin]; KARS[lysine-tRNA synzyme]; KAT5[K (lysine) transacetylase 5]; KCNA2[potassium voltage-gated channel, the blender subfamily of being correlated with, the member 2]; KCNA5[potassium voltage-gated channel, the composite dependency subfamily, the member 5]; KCND1[potassium voltage-gated channel, the Shal subfamily of being correlated with, the member 1]; KCNH2[potassium voltage-gated channel, subfamily H (eag is relevant), the member 2]; KCNIP4[Kv Channel Interaction albumen 4]; The large electricity of KCNMA1[potassium is led calcium-activated passage, subfamily M, α member 1]; The large electricity of KCNMB1[potassium is led calcium-activated passage, subfamily M, β member 1]; In KCNN3[potassium/and small-conductance calcium-active channel, subfamily N, the member 3]; KCNS3[potassium voltage-gated channel, delay-rectification, subfamily S, the member 3]; The KDR[kinases inserts domain receptor (a type-iii receptor tyrosine kinase)]; KHDRBS1[contains the KH territory, RNA combination, signal transduction relevant 1]; KHDRBS3[contains the KH territory, RNA combination, signal transduction relevant 3]; KIAA0101[KIAA0101]; KIF16B[kinesin family member 16B]; KIF20B[kinesin family member 20B]; KIF21B[kinesin family member 21B]; KIF22[kinesin family member 22]; KIF2B[kinesin family member 2B]; KIF2C[kinesin family member 2C]; KIR2DL1[killer cell immunoglobulin (Ig)-sample acceptor, two territories, long cytoplasmic tail, 1]; KIR2DL2[killer cell immunoglobulin (Ig)-sample acceptor, two territories, long cytoplasmic tail, 2]; KIR2DL3[killer cell immunoglobulin (Ig)-sample acceptor, two territories, long cytoplasmic tail, 3]; KIR2DL5A[killer cell immunoglobulin (Ig)-sample acceptor, two territories, long cytoplasmic tail, 5]; KIR2DS1[killer cell immunoglobulin (Ig)-sample acceptor, two territories, short cytoplasmic tail, 1]; KIR2DS2[killer cell immunoglobulin (Ig)-sample acceptor, two territories, short cytoplasmic tail, 2]; KIR2DS5[killer cell immunoglobulin (Ig)-sample acceptor, two territories, short cytoplasmic tail, 5]; KIR3DL1[killer cell immunoglobulin (Ig)-sample acceptor, three territories, long cytoplasmic tail, 1]; KIR3DS1[killer cell immunoglobulin (Ig)-sample acceptor, three territories, short cytoplasmic tail, 1]; KISS1[KiSS-1 transfer-inhibiting factor]; KISS1R[KISS 1 acceptor]; KIT[v-kitHardy-Zuckerman 4 cat sarcoma virus oncogene homologues]; KITLG[KIT part]; KLF2[Kruppel-like factor 2 (lung)]; KLF4[Kruppel-like factor 4 (intestines)]; KLK1[kallikrein 1]; The KLK11[kallikrein peptase 11 of being correlated with]; The KLK3[kallikrein peptase 3 of being correlated with]; KLKB1[kallikrein B, blood plasma (the Fletcher factor) 1]; KLRB1[killer cell agglutinin-sample acceptor subfamily B, the member 1]; KLRC1[killer cell agglutinin-sample acceptor subfamily C, the member 1]; KLRD1[killer cell agglutinin-sample acceptor subfamily D, the member 1]; KLRK1[killer cell agglutinin-sample acceptor subfamily K, the member 1]; KNG1[Prokineticin 1]; KPNA1[nucleoplasmin α 1 (input protein alpha 5)]; KPNA2[core peripheral proteins α 2 (RAG group's albumen 1, input protein alpha 1)]; KPNB1[nucleoplasmin (input albumen) β 1]; Kras[v-Ki-ras2 Kirsten rat sarcoma virus oncogene homologue]; KRT1[Keratin 1]; KRT10[Keratin 10]; KRT13[Keratin 13]; KRT14[Keratin 14]; KRT16[Keratin 16]; KRT18[Keratin 18]; KRT19[Keratin 19]; KRT20[Keratin 20]; KRT5[keratin 5]; KRT7[Keratin 7]; KRT8[CK8]; KRT9[Keratin 9]; KRTAP19-3[keratin related protein 19-3]; KRTAP2-1[keratin related protein 2-1]; L1CAM[L1 cell adhesion molecule]; The LACTB[lactamase, β]; LAG3[lymphocyte-activating gene 3]; The LALBA[lactoalbumin, α-]; The LAMA1[laminin, α 1]; The LAMA2[laminin, α 2]; The LAMA3[laminin, α 3]; The LAMA4[laminin, α 4]; The LAMB1[laminin, β 1]; The LAMB2[laminin, β 2 (laminin S)]; The LAMB3[laminin, β 3]; The LAMC1[laminin, γ 1 (LAMB2 in the past)]; The LAMC2[laminin, γ 2]; LAMP1[lysosome related membrane protein matter 1]; LAMP2[lysosome related membrane protein matter 2]; LAMP3[lysosome related membrane protein 3]; LAP3[leucine aminopeptidase 3]; LAPTM4A[lysosomal protein cross-film 4 α]; The LAT[T cell activation is connected the factor]; LBP[lipopolysaccharide binding protein]; LBR[lamin B acceptor]; LBXCOR1[Lbxcor1 homologue (mouse)]; LCAT[lecithin cholesterol acyltransferase]; LCK[lymphocyte-specific protein EGFR-TK]; LCN1[apolipoprotein 1 (lachrymal gland prealbumin)]; LCN2[apolipoprotein 2]; LCP1[lymphocyte cytoplasmic protein 1 (L-fimbrin)]; LCT[lactase]; LDLR[LDL receptor]; The LDLRAP1[LDL receptor is connected factor protein matter 1]; LECT2[leukocyte cell-derivative chemotaxin 2]; The rich proline 1 of LELP1[angling in late period shell-sample]; LEMD3[contains LEM territory 3]; LEP[leptin]; LEPR[leptin receptor]; The LGALS1[agglutinin, galactoside-combination, solvable, 1]; The LGALS3[agglutinin, galactoside-combination, solvable, 3]; The LGALS3BP[agglutinin, galactoside-combination, solvable, 3 in conjunction with albumen]; The LGALS4[agglutinin, galactoside-combination, solvable, 4]; The LGALS9[agglutinin, galactoside-combination, solvable, 9]; The LGALS9B[agglutinin, galactoside-combination, solvable, 9B]; G albumen-coupled receptor 4 that LGR4[contains leucine-rich repeat]; LHCGR[luteinizing hormone(LH/human chorionic gonadotropin receptor]; LIF[LIF ELISA (cholinergic differentiation factor)]; LIFR[leukemia inhibitory factor receptor α]; LIG1[ligase I, DNA, ATP-dependence]; LIG3[ligase III, DNA, ATP-dependence]; LIG4[ligase IV, DNA, ATP-dependence]; LILRA3[white blood cell immunoglobulin (Ig)-sample acceptor, subfamily A (there is no the TM territory), the member 3]; LILRB4[white blood cell immunoglobulin (Ig)-sample acceptor, subfamily B (TM and ITIM territory are arranged), the member 4]; LIMS 1[LIM and Senescent cell antigen-sample territory 1]; LIPA[lipase, lysosomal acid, cholesterol esterase]; LIPC[lipase, liver]; LIPE[lipase, hormone-sensitivity]; LIPG[lipase, endothelium]; The LMAN1[agglutinin, mannose-combination, 1]; Molten albumen-the sample of LMLN[Li Shiman (metallopeptidase M8 family)]; LMNA[Lamin A/C]; LMNB1[lamin B 1]; LMNB2[lamin B 2]; LOC646627[phosphatidase inhibiting factor]; LOX[lysyloxidase]; LOXHD1[lipoxygenase homeodomain 1]; LOXL1[lysyloxidase-sample 1]; LPA[lipoprotein, Lp (a)]; LPAR3[lpa receptor 3]; LPCAT2[lysophosphatidyl choline acyltransferase 2]; LPL[lipoprotein lipase]; LPO[lactoperoxidase]; LPP[contains the preferred transposition gametophyte of LIM territory lipoma]; LRBA[LPS-replys the vesica transportation, contains beach and grappling]; LRP1[LDH receptor related protein matter 1]; LRP6[LDH receptor related protein matter 6]; LRPAP1[LDH receptor related protein qualitative correlation protein 1]; LRRC32[contains leucine-rich repeat 32]; LRRC37B[contains leucine-rich repeat 37B]; LRRC8A[contains leucine-rich repeat 8 families, member A]; LRRK2[leucine-rich repeat kinases 2]; LRTOMT[contains rich leucine cross-film and 0-transmethylase territory]; The LSM1[LSM1 homologue, U6 small nuclear rna be correlated with (saccharomyces cerevisiae)]; The LSM2[LSM2 homologue, U6 small nuclear rna be correlated with (saccharomyces cerevisiae)]; LSP1[lymphocyte-specific protein 1]; LTA[lymphotoxin α (TNF Superfamily, the member 1)]; LTA4H[leukotriene A 4 hydrolase]; LTB[lymphotoxin-beta (TNF Superfamily, the member 3)]; LTB4R[leukotriene B42 receptor]; LTB4R2[leukotriene B42 receptor 2]; LTBR[lymphotoxin-beta-receptor (TNFR Superfamily, the member 3)]; LTC4S[leukotriene C synzyme]; LTF[lactotransferrin]; LY86[lymphocyte antigen 86]; LY9[lymphocyte antigen 9]; The LYN[v-yes-1 Yamaguchi sarcoma virus oncogene homologue of being correlated with]; LYRM4[contains LYR motif 4]; LYST[lysosome transportation regulatory factor]; LYZ[lysozyme (amyloidosis of kidney)]; LYZL6[lysozyme-sample 6]; LZTR1[leucine-slide fastener-sample transcription regulatory factor 1]; M6PR[Man-6-P ester acceptor (cation dependence)]; MADCAM1[mucosal vascular addressin cell adhesion molecule 1]; MAF[v-maf muscular aponeurotic fibrosarcoma oncogene homologue (birds)]; MAG[Myelin-associated glycoprotein]; The MAN2A1[mannosidase, α, class 2A, the member 1]; The MAN2B1[mannosidase, α, class 2B, the member 1]; The MANBA[mannosidase, β A, lysosome]; MANF[midbrain astroglia-derived neurotrophic factor]; MAOB[MAO-B]; MAP2[microtubule-associated proteins 2]; MAP2K1[mitogen activated protein kinase kinases 1]; MAP2K2[mitogen activated protein kinase kinases 2]; MAP2K3[mitogen activated protein kinase kinases 3]; MAP2K4[mitogen activated protein kinase kinases 4]; MAP3K1[mitogen activated protein kinase kinase kinase 1]; MAP3K11[mitogen activated protein kinase kinase kinase 11]; MAP3K14[mitogen activated protein kinase kinase kinase 14]; MAP3K5[mitogen activated protein kinase kinase kinase 5]; MAP3K7[mitogen activated protein kinase kinase kinase 7]; MAP3K9[mitogen activated protein kinase kinase kinase 9]; MAPK1[mitogen activated protein kinase 1]; MAPK10[mitogen activated protein kinase 10]; MAPK11[mitogen activated protein kinase 11]; MAPK12[mitogen activated protein kinase 12]; MAPK13[mitogen activated protein kinase 13]; MAPK14[mitogen activated protein kinase 14]; MAPK3[mitogen activated protein kinase 3]; MAPK8[mitogen activated protein kinase 8]; MAPK9[mitogen activated protein kinase 9]; MAPKAP1[mitogen activated protein kinase related protein 1]; MAPKAPK2[mitogen activated protein kinase-activated protein kinase 2]; MAPKAPK5[mitogen activated protein kinase-activated protein kinase 5]; MAPT[microtubule-associated proteins τ]; The rich myristoylation alanine of MARCKS[protein kinase C substrate]; MASP2[MBL serine peptase 2]; MATN1[stromatin 1, cartilage matrix protein matter]; The antiviral signal transducer matter of MAVS[mitochondria]; MB[myoglobins]; MBD2[methyl-CpG binding domain protein matter 2]; MBL2[mannan-binding lectin (protein C) 2, solvable (opsonin shortage)]; MBP[MBP ELISA]; The MBTPS2[film-in conjunction with the transcription factor peptase, site 2]; MC2R[melanocortin 2 acceptors (corticotropin)]; MC3R[melanocortin 3 acceptors]; MC4R[melanocortin 4 acceptors]; MCCC2[tiglyl-coacetylase carboxylase 2 (β)]; MCHR1[melanin-concentrated hormone receptor 1]; MCL1[bone marrow cell leukaemia sequence 1 (BCL2 is relevant)]; The MCM2[minichromosome maintains complex component 2]; The MCM4[minichromosome maintains complex component 4]; MCOLN1[glues lipoprotein 1]; MCPH1[cerebellum disease gene (microcephalin) 1]; MDC1[DNA-damage check point amboceptor 1]; MDH2[malic dehydrogenase 2, NAD (mitochondria)]; MDM2[Mdm2p53 is in conjunction with albumen homology thing (mouse)]; ME2[malate dehydrogenase 2, NAD (+)-dependence, mitochondria]; MECOM[MDS1 and EVI1 complex locus]; MED1[amboceptor complex subunit 1]; MED12[amboceptor complex subunit 12]; MED15[amboceptor complex subunit 15]; MED28[amboceptor complex subunit 28]; MEFV[Mediterranean fruit fly]; The multiple endocrine knurl of MEN1[I]; The outer phosphoglucoprotein of MEPE[matrix born of the same parents]; MERTK[c-mer is former-the oncogene EGFR-TK]; 2 homologues (mouse) after the MESP2[mesoderm]; MET[met is former-oncogene (hepatocyte growth factor receptor)]; MGAM[maltose-glucoamylase (alpha-glucosidase)]; The MGAT1[mannose group (α-1,3-)-glycoprotein β-1,2-N-acetyl glucosamine transferase]; The MGAT2[mannose group (α-1,6-)-glycoprotein β-1,2-N-acetyl glucosamine transferase]; MGLL[monoglyceride lipase]; MGMT[O-6-methyl D NA transmethylase]; MGST2[microsome glutathione S-transferase 2]; MICA[MHC class I polypeptide correlated series A]; MICB[MHC class I polypeptide correlated series B]; MIF[macrophage migration inhibitory factor (glycosylation-inhibiting factor)]; MKI67[is by the antigen of Monoclonal antibody Ki-67 identification]; MKS1[Meckel syndrome, 1]; MLH1[mutL homologue 1, colon cancer, without polyposis type 2 (Escherichia coli)]; MLL[marrow/lymph or mixing-pedigree leukaemia (three chest homologues, fruit bat)]; MLLT4[marrow/lymph or mixing-pedigree leukaemia (three pereonite homologues, fruit bat); Transposition, 4]; MLN[motilin]; MLXIPL[MLX interaction protein-sample]; MMAA[methylmalonic aciduria (Cobalamin shortage) cblA type]; MMAB[methylmalonic aciduria (Cobalamin shortage) cblB type]; MMACHC[methylmalonic aciduria (Cobalamin shortage) cblC type, homocystinuria]; MME[film metal-endopeptidase]; MMP1[matrix metal peptase 1 (interstitial collagenase)]; MMP10[matrix metal peptase 10 (Stromelysin 2)]; MMP12[matrix metal peptase 12 (MMP12)]; MMP13[matrix metal peptase 13 (clostridiopetidase A 3)]; MMP14[matrix metal peptase 14 (film-embedding)]; MMP15[matrix metal peptase 15 (film-embedding)]; MMP17[matrix metal peptase 17 (film-embedding)]; MMP2[matrix metal peptase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V clostridiopetidase A)]; MMP20[matrix metal peptase 20]; MMP21[matrix metal peptase 21]; MMP28[matrix metal peptase 28]; MMP3[matrix metal peptase 3 (Stromelysin-1, front gelatinase)]; MMP7[matrix metal peptase 7 (matrix crack protein, uterus)]; MMP8[matrix metal peptase 8 (neutrophil collagenase)]; MMP9[matrix metal peptase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V clostridiopetidase A)]; MMRN1[poly element 1]; MNAT1[menage a trois homologue 1, cyclin H assembly factor (Africa xenopus)]; MOG[myelin oligodendrocyte glycoprotein]; MOGS[mannose group-oligosaccharides glucuroide]; MPG[N-methyl purine-DNA glycosylase]; MPL[myelosis leukemia virus oncogene]; MPO[myeloperoxidase]; MPZ[myelin protein matter zero]; The MR1[major histocompatibility complex, class I is relevant]; The MRC1[mannose receptor, the C Class1]; The MRC2[mannose receptor, C type 2]; MRE11A[MRE11 meiotic recombination 11 homologue A (saccharomyces cerevisiae)]; The MRGPRX1[MAS GPR that is correlated with, member X1]; MRPL28[mitochondrial ribosomal protein L28]; MRPL40[mitoribosome protein L 4 0]; MRPS16[mitochondrial ribosomal protein S16]; MRPS22[mitochondrial ribosomal protein S22]; MS4A1[film-leap 4-territory, subfamily A, the member 1]; MS4A2[film-leap 4-territory, subfamily A, member 2 (Fc fragment IGE, high-affinity I, acceptor; Beta polypeptides)]; MS4A3[film-leap 4-territory, subfamily A, member 3 (hematopoietic cell-specificity)]; MSH2[mutS homologue 2, colon cancer, without polyposis Class1 (Escherichia coli)]; MSH5[mutS homologue 5 (Escherichia coli)]; MSH6[mutS homologue 6 (Escherichia coli)]; MSLN[mesothelin]; MSN[moesin]; MSR1[macrophage clearing factor acceptor 1]; MST1[macrophage-stimulating 1 (HGF-sample)]; MST1R[macrophage-stimulating 1 acceptor (c-met be correlated with EGFR-TK)]; MSTN[myostatin]; MSX2[msh homology frame 2]; MT2A[metallothionein 2]; MTCH2[mitochondrial carrier homologue 2 (Caenorhabditis elegans)]; MT-CO2[mitochondria Codocyte pigment c oxidizing ferment II]; MTCP1[mature T-cell proliferation 1]; MT-CYB[mitochondria Codocyte pigment b]; MTHFD1[methylenetetrahydrofolate dehydrogenase (NADP+ dependence) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase]; MTHFR[5[10-MTHFR (NADPH)]; MTMR14[flesh tubulin related protein 14]; MTMR2[flesh tubulin related protein 2]; MT-ND1[mitochondria coding nadh dehydrogenase 1]; MT-ND2[mitochondria coding nadh dehydrogenase 2]; The mechanism target (serine/threonine kinase) of MTOR[rapamycin]; MTR[5-methyl tetrahydrofolate-homocysteine methyl transferase]; MTRR[5-methyl tetrahydrofolate-homocysteine methyl transferase reductase]; MTTP[microsome triglyceride transferring protein]; MTX1[metaxin1]; The MUC1[MUC-1, cell surface is relevant]; MUC12[MUC-1 2, cell surface is relevant]; MUC16[MUC-1 6, cell surface is relevant]; MUC19[MUC-1 9, oligomerization]; The MUC2[MUC-2, oligomerization mucus/formation gel]; The MUC3A[MUC-3, cell surface is relevant]; MUC3B[MUC-3 B, cell surface is relevant]; The MUC4[MUC-4, cell surface is relevant]; MUC5AC[mucoprotein 5AC, oligomerization mucus/formation gel]; MUC5B[mucoprotein 5B, oligomerization mucus/formation gel]; MUC6[mucoprotein 6, oligomerization mucus/formation gel]; MUC7[mucoprotein 7, secretion]; MUS81[MUS81 restriction endonuclease homologue (saccharomyces cerevisiae)]; MUSK[muscle, bone, receptor tyrosine kinase]; MUT[methylmalonyl CoA mutarotase]; MVK[mevalonate kinase]; The main fornix protein of MVP[]; MX1[myxovirus (influenza virus) resistance 1, but interferon-induced protein p78 (mouse)]; MYB[v-myb medulloblastoma virus oncogene homologue (birds)]; MYBPH[myosin binding protein H]; MYC[v-myc myelocytomatosis Viral Carcinogenesis gene homolog (birds)]; The relevant oncogene of MYCN[v-myc myelocytomatosis virus, neuroblastoma derives (birds)]; MYD88[marrow differentiation primary response gene (88)]; The MYH1[myosin, heavy chain 1, skeletal muscle, grow up]; The MYH10[myosin, heavy chain 10, non-muscle]; The MYH11[myosin, heavy chain 11, smooth muscle]; The MYH14[myosin, heavy chain 14, non-muscle]; The MYH2[myosin, heavy chain 2, skeletal muscle, grow up]; The MYH3[myosin, heavy chain 3, skeletal muscle, embryo]; The MYH6[myosin, heavy chain 6, cardiac muscle, α]; The MYH7[myosin, heavy chain 7, cardiac muscle, β]; The MYH8[myosin, heavy chain 8, skeletal muscle, term]; The MYH9[myosin, heavy chain 9, non-muscle]; The MYL2[myosin, light chain 2, regulation and control, heart, slowly]; The MYL3[myosin, light chain 3, alkali; Ventricle, bone, slowly]; The MYL7[myosin, light chain 7, regulation and control]; The MYL9[myosin, light chain 9, regulation and control]; MYLK[MLCK]; MYO15A[myosin XVA]; MYO 1A[myoglobulin I A]; MYO1F[myoglobulin I F]; MYO3A[myoglobulin I IIA]; MYO5A[myosin VA (heavy chain 12, myosin)]; MYO6[myosin VI]; MYO7A[myosin VIIA]; MYO9B[myoglobulin I XB]; The MYOC[actin, trabecular network can induce glucocorticoid to reply]; MYOD1[myogenicity differentiation 1]; Albumen between MYOM2[flesh (M-protein) 2,165kDa]; MYST1[MYST histone acetyltransferase 1]; MYST2[MYST histone acetyltransferase 2]; MYST3[MYST histone acetyltransferase (monocytic leukemia) 3]; MYST4[MYST histone acetyltransferase (monocytic leukemia) 4]; NAGA[N-acetamino galactosidase enzyme, α-]; The NAGLU[N-acetylglucosaminidase, α-]; NAMPT[Nampt]; NANOG[Nanog homology frame]; NANOS1[nanos homologue 1 (fruit bat)]; NAPA[N-ethyl maleimide-sensitive factor connects protein, α]; NAT1[N-transacetylase 1 (arylamine N-acetyl-transferase)]; NAT2[N-transacetylase 2 (arylamine N-acetyl-transferase)]; NAT9[N-transacetylase 9 (GCN5 is relevant, supposes)]; The neural long-pending albumen of NBEA[]; NBN[nibrin]; NCAM1[N-CAM 1]; NCF1[neutrophil leucocyte cytoplasmic factor 1]; NCF2[neutrophil leucocyte cytoplasmic factor 2]; NCF4[neutrophil leucocyte cytoplasmic factor 4,40kDa]; NCK1[NCK is connected factor protein matter 1]; NCL[nucleolin]; NCOA1[nuclear receptor coactivator 1]; NCOA2[nuclear receptor coactivator 2]; NCOR1[nuclear receptor Corepressors 1]; The NCR3[natural cytotoxicity triggers acceptor 3]; NDUFA13[NADH dehydrogenase (ubiquinone) 1 α complex, 13]; NDUFAB1[NADH dehydrogenase (ubiquinone) 1, the sub-complex of α/β, 1,8kDa]; NDUFAF2[NADH dehydrogenase (ubiquinone) 1 α complex, assembly factor 2]; The NEDD4[neural precursor is expressed, and grows and lowers 4]; The NEFL[neurofilament, light polypeptide]; The NEFM[neurofilament, middle polypeptide]; NEGR1[neure growth regulatory factor 1]; NEK6[NIMA (forever from a) associated kinase 6 of mitotic gene]; The NELF[nose embryo LHRH factor]; NELL1[NEL-sample 1 (chicken)]; NES[nestin]; NEU1[sialidase 1 (lysosome sialidase)]; NEUROD1[neurogenicity differentiation 1]; NF1[neurofibromin 1]; NF2[neurofibromin 2 (merlin)]; The nuclear factor of NFAT5[activation T-cell 5, tonicity-replying]; The nuclear factor of NFATC1[activation T-cell, cytoplasm, calcineurin-dependence 1]; The nuclear factor of NFATC2[activation T-cell, cytoplasm, calcineurin-dependence 2]; The nuclear factor of NFATC4[activation T-cell, cytoplasm, calcineurin-dependence 4]; NFE2L2[nuclear factor (red blood cell-derivative 2)-sample 2]; The nuclear factor 1 of kappa light polypeptide gene enhancer in the NFKB1[B cell]; The nuclear factor 2 (p49/p100) of kappa light polypeptide gene enhancer in the NFKB2[B cell]; NFKBIA[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor, α]; NFKBIB[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor, β]; NFKBIL1[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor-sample 1]; The NFU1[NFU1 iron-sulfur cluster is in conjunction with homologue (saccharomyces cerevisiae)]; NGF[nerve growth factor (beta polypeptides)]; NGFR[trk C (TNFR Superfamily, the member 16)]; The non-homogeneous end of NHEJ1[-connection factor 1]; NID1[nestin 1]; NKAP[NFkB activation of protein]; NKX2-1, NK2[homology frame 1]; The NKX2-3[NK2 transcription factor is relevant, locus 3 (fruit bat)]; NLRP3[NLR family, contain pyrin territory 3]; NMB[Neuropeptide B]; NME1[non-metastatic cell 1, protein (NM23A) is expressed]; NME2[non-metastatic cell 2, protein (NM23B) is expressed]; NMU[neuromedin U]; NNAT[neuronatin]; NOD1[contains nucleotides-in conjunction with oligomerization territory 1]; NOD2[contains nucleotides-in conjunction with oligomerization territory 2]; NONO[contains non--POU territory, octamer-combination]; NOS1[nitric oxide synthase 1 (neuron)]; NOS2[nitric oxide synthase 2, can induce]; NOS3[nitric oxide synthase 3 (endothelial cell)]; NOTCH1[Notch homologue 1, transposition be correlated with (fruit bat)]; NOTCH2[Notch homologue 2 (fruit bat)]; NOTCH3[Notch homologue 3 (fruit bat)]; NOTCH4[Notch homologue 4 (fruit bat)]; NOX1[NADPH oxidizing ferment 1]; NOX3[NADPH oxidizing ferment 3]; NOX4[NADPH oxidizing ferment 4]; The NOX5[NADPH oxidizing ferment, EF chirality calcium binding domain 5]; The NPAT[nucleoprotein, the ataxia-telangiectasia locus]; The NPC1[niemann pick disease, Type C 1]; NPC1L1[NPC1 (niemann pick disease, Type C 1, gene)-sample 1]; The NPC2[niemann pick disease, Type C 2]; NPHP1[nephrophthisis 1 (childhood)]; NPHS1[nephrosis 1, congenital, Finland's type (ephrosis albumen)]; NPHS2[nephrosis 2, congenital, steroids-resistance (podocin)]; The NPLOC4[nucleoprotein is located 4 homologues (saccharomyces cerevisiae)]; NPM1[nuclear phosphoprotein (nucleolar phosphoprotein white matter B23, nuclear matrix protein)]; NPPA[natriuretic peptide precursor A]; NPPB[natriuretic peptide precursor B]; NPPC[natriuretic peptide precursor C]; NPR1[natriuratic peptide receptor A/ guanylate cyclase A (atrial natriuretic peptide acceptor A)]; NPR3[natriuratic peptide receptor C/ guanylate cyclase C (atrial natriuretic peptide acceptor C)]; NPS[neuropeptide S]; NPSR1[neuropeptide S acceptor 1]; NPY[neuropeptide tyrosine]; NPY2R[neuropeptide Y receptor Y2]; NQO1[NAD (P) H dehydrogenase, quinone 1]; NR0B1[nuclear receptor subunit family 0, group B, the member 1]; NR1H2[nuclear receptor subunit family 1, group H, the member 2]; NR1H3[nuclear receptor subunit family 1, group H, the member 3]; NR1H4[nuclear receptor subunit family 1, group H, the member 4]; NR1I2[nuclear receptor subunit family 1, group I, the member 2]; NR1I3[nuclear receptor subunit family 1, group I, the member 3]; NR2F2[nuclear receptor subunit family 2, group F, the member 2]; NR3C1[nuclear receptor subunit family 3, group C, member 1 (GCR)]; NR3C2[nuclear receptor subunit family 3, group C, the member 2]; NR4A1[nuclear receptor subunit family 4, group A, the member 1]; NR4A3[nuclear receptor subunit family 4, group A, the member 3]; NR5A1[nuclear receptor subunit family 5, group A, the member 1]; NRF1[core is breathed the factor 1]; NRG1[neuregulin 1]; NRIP1[nuclear receptor interaction albumen 1]; The NRIP2[nuclear receptor is in conjunction with albumen 2]; NRP1[neuropilin 1]; The NSD1[nuclear receptor is in conjunction with SET territory protein 1]; NSDHL[NAD (P) dependence steroid dehydrogenase-sample]; NSF[N-ethyl maleimide-sensitive factor]; NT5E[5 '-nucleotidase, outer (CD73)]; NTAN1[N-end asparagine acid amides enzyme]; NTF3[NT3]; NTF4[NT4]; NTN1[nerve growth factor 1]; NTRK1[neurotrophy EGFR-TK, acceptor, Class1]; NTRK2[neurotrophy EGFR-TK, acceptor, type 2]; NTRK3[neurotrophy EGFR-TK, acceptor, type 3]; NTS[neurotensin]; NUCB2[core is in conjunction with albumen 2]; NUDT1[nudix (nucleoside diphosphate coupling part X)-type motif 1]; NUDT2[nudix (nucleoside diphosphate coupling part X)-type motif 2]; NUDT6[nudix (nucleoside diphosphate coupling part X)-type motif 6]; NUFIP2[core fragile X mental retardation combined with protein albumen 2]; NUP98[nucleoporin 98kDa]; The NXF1[nRNA output factor 1]; OCA2[eyelid albinism II]; OCLN[Occludin]; ODC1[ornithine decarboxylase 1]; OFD1[OFD (toe) syndrome 11]; OGDH[ketoglutaric acid (KG) dehydrogenase (lipoamide)]; OGG1[8-oxo bridge guanine DNA glycosylase]; OGT[O-connection 2-Acetamido-2-deoxy-D-glucose (GlcNAc) transferase (UDP-N-acetylglucosamine: polypeptide-2-Acetamido-2-deoxy-D-glucose based transferase)]; OLR1[OxLDL ELISA (agglutinin-sample) acceptor 1]; OMP[sense of smell labelled protein]; The mono-homology frame 2 of cutting of ONECUT2[]; OPN3[opsin 3]; The OPRK1[Opioid Receptors, κ 1]; The OPRM1[Opioid Receptors, μ 1]; OPTN[optic nerve albumen]; The OR2B11[olfactory receptor, family 2, subfamily B, the member 11]; ORMDL3[ORM1-sample 3 (saccharomyces cerevisiae)]; OSBP[oxygen sterone is in conjunction with albumen]; OSGIN2[oxidative pressure induced growth inhibitor family member 2]; OSM[oncostatinM]; OTC[ornithine carbamyl transferase]; OTOP2[ear pterin 2]; OTOP3[ear pterin 3]; OTUD1[is containing OTU territory 1]; OXA1L[oxidizing ferment (cytochrome c) assembling 1-sample]; OXER1[oxo bridge eicosane class (OXE) acceptor 1]; The OXT[oxytocins, prepropeptide]; OXTR[ocytocin receptor]; P2RX7[purinoceptor P2X, ligand-gated ion channel, 7]; P2RY1[purinoceptor P2Y, G-albumen coupling, 1]; P2RY12[purinoceptor P2Y, G-albumen coupling, 12]; P2RY14[purinoceptor P2Y, G-albumen coupling, 14]; P2RY2[purinoceptor P2Y, G-albumen coupling, 2]; P4HA2[prolyl 4-hydroxylase, α polypeptide II]; P4HB[prolyl 4-hydroxylase, beta polypeptides]; P4HTM[prolyl 4-hydroxylase, cross-film (endoplasmic reticulum)]; PABPC1[gathers (A) in conjunction with albumen, cytoplasm 1]; PACSIN3[neuronal protein kinase c and casein kinase 2 zymolyte 3]; Pregnant albumen correlator Endometrium protein before PAEP[]; PAFAH1B1[blood platelet-activation factor PAF-AH 1b, regulation and control subunit 1 (45kDa)]; PAH[phenylalanine hydroxylase]; PAK1[p21 protein (Cdc42/RAC)-activated protein kinase 1]; PAK2[p21 protein (Cdc42/RAC)-activated protein kinase 2]; PAK3[p21 protein (Cdc42/RAC)-activated protein kinase 3]; PAM[peptide acyl glycine α-amidatioon monooxygenase]; PAPPA[PAPP matter A, pappus element 1]; PARG[gathers (ADP-ribose) glycerine hydrolase]; PARK2[Parkinson's (autosomal recessive, childhood) 2, Parkin]; PARP1[gathers (ADP-ribose) polymerase 1]; PAWR[PRKC, Apoptosis, WT1, regulatory factor]; The paired frame 2 of PAX2[]; The paired frame 3 of PAX3[]; The paired frame 5 of PAX5[]; The paired frame 6 of PAX6[]; PAXIP1[PAX (transcribing-activation domain) protein 1 that interacts]; PC[pyruvate carboxylase]; The PCCA[propionyl CoA carboxylase, the α polypeptide]; The PCCB[propionyl CoA carboxylase, beta polypeptides]; PCDH1[protocadherin 1]; PCK1[phosphoenolpy ruvate carboxy kinase 1 (solvable)]; PCM1[pericentriolar material 1]; PCNA[PCNA]; PCNT[centriole adjunct albumen]; PCSK1[proprotein convertases subtilopeptidase A/kexin Class1]; PCSK6[proprotein convertases subtilopeptidase A/kexin type 6]; PCSK7[proprotein convertases subtilopeptidase A/kexin type 7]; PCYT1A[cytidine phosphate acyltransferase 1, choline, α]; PCYT2[cytidine phosphate acyltransferase 2, monoethanolamine]; PDCD1[apoptosis 1]; PDCD1LG2[apoptosis 1 part 2]; PDCD6[apoptosis 6]; PDE3B[phosphodiesterase 3B, cGMP-suppresses]; The PDE4A[phosphodiesterase 4, cAMP-specificity (phosphodiesterase E2 fool homologue, fruit bat)]; The PDE4B[PDE4B, cAMP-specificity (phosphodiesterase E4 fool homologue, fruit bat)]; PDE4D[phosphodiesterase 4 D, cAMP-specificity (phosphodiesterase E3 fool homologue, fruit bat)]; PDE7A[phosphodiesterase 7]; PDGFA[blood platelet-derivative growth factor α polypeptide]; PDGFB[blood platelet-derivative growth factor beta polypeptides (ape sarcoma virus (v-sis) oncogene homologue)]; PDGFRA[blood platelet-derived growth factor receptor, the α polypeptide]; PDGFRB[blood platelet-derived growth factor receptor, beta polypeptides]; PDIA2[protein disulfide-isomerase family, the member 2]; PDIA3[protein disulfide-isomerase family, the member 3]; The PDK1[pyruvic dehydrogenase kinase, isoenzymes 1]; PDLIM1[PDZ and LIM territory 1]; PDLIM5[PDZ and LIM territory 5]; PDLIM7[PDZ and LIM territory 7 (enigma)]; PDP1[pyruvic dehydrogenase phosphatase catalytic subunit 1]; PDX1[pancreas and duodenum homology frame 1]; PDXK[pyridoxal (pyridoxol, vitamin B6) kinases]; PDYN[prodynorphin]; PECAM1[blood platelet/endothelial cell adhesion molecule]; PEMT[phosphatidyl-ethanolamine N-transmethylase]; PENK[proenkephalin]; PEPD[PEPD D]; PER1[cycle homologue 1 (fruit bat)]; PEX1[peroxisome occurrence factor 1]; PEX10[peroxisome occurrence factor 10]; PEX12[peroxisome occurrence factor 12]; PEX13[peroxisome occurrence factor 13]; PEX14[peroxisome occurrence factor 14]; PEX16[peroxisome occurrence factor 16]; PEX19[peroxisome occurrence factor 19]; PEX2[peroxisome occurrence factor 2]; PEX26[peroxisome occurrence factor 26]; PEX3[peroxisome occurrence factor 3]; PEX5[peroxisome occurrence factor 5]; PEX6[peroxisome occurrence factor 6]; PEX7[peroxisome occurrence factor 7]; PF4[platelet factor 4]; PFAS[Phosphoribosyl formylglycinamidine synzyme]; Folded protein subunit 4 before PFDN4[]; PFN1[profilin 1]; PGC[glandular stomach liquid eggs white (Pepsinogen C)]; PGD[phosphogluconate dehydrogenase]; PGF[placenta growth factor]; PGK1[phosphoglyceric kinase 1]; PGM1[glucophosphomutase 1]; PGR[PgR]; PHB[antiproliferative protein]; PHEX[phosphatase 1 controlling endopeptidase homologue, X-is chain]; PHF11[PHD finger protein matter 11]; PHOX2B[becomes p-sample homology frame 2b]; PHTF1[supposition homeodomain transcription factor 1]; PHYH[phytane acyl-coacetylase 2-hydroxylase]; PHYHIP[phytane acyl-coacetylase 2-hydroxylase interaction protein]; PI3[peptase initiator 3, skin-derivative]; PIGA[glypican grappling biosynthesis, class A]; PIGR[polymer immunoglobulin receptor]; PIK3C2A[phosphoinositide-3-kinases, class 2, α polypeptide]; PIK3C2B[phosphoinositide-3-kinases, class 2, beta polypeptides]; PIK3C2G[phosphoinositide-3-kinases, class 2, γ polypeptide]; PIK3C3[phosphoinositide-3-kinases, class 3]; PIK3CA[phosphoinositide-3-kinases, catalysis, α polypeptide]; PIK3CB[phosphoinositide-3-kinases, catalysis, beta polypeptides]; PIK3CD[phosphoinositide-3-kinases, catalysis, δ polypeptide]; PIK3CG[phosphoinositide-3-kinases, catalysis, γ polypeptide]; PIK3R1[phosphoinositide-3-kinases, regulation and control subunit 1 (α)]; PIK3R2[phosphoinositide-3-kinases, regulation and control subunit 2 (β)]; PIK3R3[phosphoinositide-3-kinases, regulation and control subunit 3 (γ)]; The PIKFYVE[Phosphoinoside kinase, contain FYVE and refer to]; PIN1[peptide acyl prolyl cis/trans isomerase, NIMA-interacts 1]; PINK1[PTEN induces supposition kinases 1]; PIP[lactogen-induced protein]; PIP5KL1[phosphatidylinositol-4-phosphate 5-kinase-sample 1]; PITPNM1[Phosphatidylinositol//Phosphatidylcholine Transfer Proteins matter, film relevant 1]; The molten pitressin metallopeptidase 1 of PITRM1[]; PITX2[becomes p-sample homeodomain 2]; PKD2[POLYCYSTIC KIDNEY DISEASE 2 (autosomal dominant)]; The PKLR[pyruvate kinase, liver and RBC]; The PKM2[pyruvate kinase, muscle]; PKN1[protein kinase N 1]; PL-5283[PL-5283 protein]; The PLA2G1B[phospholipase A2, group IB (pancreas)]; The PLA2G2A[phospholipase A2, group IIA (blood platelet, synovia)]; The PLA2G2D[phospholipase A2, group IID]; The PLA2G4A[phospholipase A2, group IVA (cytoplasm, calcium-dependence)]; The PLA2G6[phospholipase A2, group VI (cytoplasm, calcium-irrelevant)]; The PLA2G7[phospholipase A2, group VII (blood platelet-activation factor PAF-AH, blood plasma)]; PLA2R1[phospholipase A2 acceptor 1,180kDa]; The PLAT[plasminogen activating factors, tissue]; The PLAU[plasminogen activating factors, urokinase]; The PLAUR[plasminogen activating factors, urokinase receptor]; The PLCB1[phospholipase C, β 1 (phosphoinositide-specificity)]; The PLCB2[phospholipase C, β 2]; The PLCB4[phospholipase C, β 4]; The PLCD1[phospholipase C, δ 1]; The PLCG1[phospholipase C, γ 1]; The PLCG2[phospholipase C, γ 2 (phosphatidylinositols-specificity)]; The PLD1[Phospholipase D1, phosphatid ylcholine-specificity]; PLEC[plectin]; PLEK[pleckstrin]; PLG[plasminogen]; The other fat 1 of PLIN1[]; PLK1[polo-sample kinases 1 (fruit bat)]; PLK2[polo-sample kinases 2 (fruit bat)]; PLK3[polo-sample kinases 3 (fruit bat)]; PLP1[PLP 1]; PLTP[PLTP matter]; PMAIP1[phorbol-12-myristic acid-13-acetyl-induced protein 1]; Melanin before PMCH[-concentrated hormone]; PML[progranulocyte leukemia]; PMP22[peripheral myelin protein matter 22]; The postmeiotic separation of PMS2[PMS2 increases by 2 (saccharomyces cerevisiaes)]; PNLIP[pancreas lipase]; The other tumor antigen MA3 of PNMA3[]; PNMT[phenylethanol amine N-transmethylase]; PNP[purine nucleoside phosphorylase]; POLB[polymerase (DNA orientation), β]; POLD3[polymerase (DNA-orientation), δ 3, auxiliary subunit]; POLD4[polymerase (DNA-orientation), δ 4]; POLH[polymerase (DNA orientation), η]; POLL[polymerase (DNA orientation), λ]; POLR2A[polymerase (RNA) II (DNA orientation) polypeptide A, 220kDa]; POLR2B[polymerase (RNA) II (DNA orientation) polypeptide B, 140kDa]; POLR2C[polymerase (RNA) II (DNA orientation) peptide C, 33kDa]; POLR2D[polymerase (RNA) II (DNA orientation) polypeptide D]; POLR2E[polymerase (RNA) II (DNA orientation) polypeptide E, 25kDa]; POLR2F[polymerase (RNA) II (DNA orientation) polypeptide F]; POLR2G[polymerase (RNA) II (DNA orientation) polypeptide G]; POLR2H[polymerase (RNA) II (DNA orientation) polypeptide H]; POLR2I[polymerase (RNA) II (DNA orientation) polypeptide I, 14.5kDa]; POLR2J[polymerase (RNA) II (DNA orientation) polypeptide J, 13.3kDa]; POLR2K[polymerase (RNA) II (DNA orientation) polypeptide K, 7.0kDa]; POLR2L[polymerase (RNA) II (DNA orientation) polypeptide L, 7.6kDa]; POMC[POMC]; POMT1[protein-O-mannose transferase 1]; PON1[PON1]; PON2[paraoxonase 2]; PON3[PON3]; POSTN[periosteum albumen, POSTN]; POT1[POT1 protects telomere 1 homologue (fission yeast)]; POU2AF1[POU class 2 association factors 1]; POU2F1[POU class 2 homology frames 1]; POU2F2[POU class 2 homology frames 2]; POU5F1[POU class 5 homology frames 1]; PPA1[pyrophosphatase (inorganic) 1]; PPARA[Peroxisome proliferator activated receptors α]; PPARD[peroxisome proliferator-activated receptor δ]; PPARG[peroxisome proliferator-activated receptor γ]; PPARGC1A[peroxisome proliferator-activated receptor γ, coactivator 1 α]; PPAT[Phosphoribosyl pyrophosphoric acid aminopherase]; Before PPBP[-platelet basic protein (chemotactic factor (CF) (C-X-C motif) part 7)]; The PPFIA1[protein tyrosine phosphatase, acceptor type, f polypeptide (PTPRF), in conjunction with albumen (liprin), α 1]; PPIA[peptidyl prolyl isomerase A (Cyclophilin A)]; PPIB[peptidyl prolyl isomerase B (cyclophilin B)]; PPIG[peptidyl prolyl isomerase G (cyclophilin G)]; Protoporphyrin oxidizing ferment before PPOX[]; PPP1CB[protein phosphatase 1, catalytic subunit, β isoenzymes]; PPP1R12A[protein phosphatase 1, regulation and control (inhibiting factor) 12A of subunit]; PPP1R2[protein phosphatase 1, regulation and control (inhibiting factor) subunit 2]; PPP2R1B[protein phosphatase 2, regulation and control subunit A, β]; PPP2R2B[protein phosphatase 2, the regulation and control B of subunit, β]; PPP2R4[protein phosphatase 2 activity factors, regulation and control subunit 4]; PPP6C[protein phosphatase 6, catalytic subunit]; PPT1[palmityl-protein thioesterase 1]; PPY[pancreas polypeptide]; PRDM1[contains PR territory 1, has the ZNF territory]; PRDM2[contains PR territory 2, has the ZNF territory]; PRDX2[peroxidating reductase 2]; PRDX3[peroxidating reductase 3]; PRDX5[peroxidating reductase 5]; PRF1[perforin 1 (pore-forming protein)]; PRG2[proteoglycans 2, marrow (NK activity factor, eosinophil particle major basic protein)]; PRG4[proteoglycans 4]; The PRIM1[primase, DNA, polypeptide 1 (49kDa)]; The PRKAA1[protein kinase, AMP-activation, α 1 catalytic subunit]; The PRKAA2[protein kinase, AMP-activation, α 2 catalytic subunits]; The PRKAB1[protein kinase, AMP-activation, β 1 on-catalytic subunit]; The PRKACA[protein kinase, cAMP-dependence, catalysis, α]; The PRKACB[protein kinase, cAMP-dependence, catalysis, β]; The PRKACG[protein kinase, cAMP-dependence, catalysis, γ]; The PRKAR1A[protein kinase, cAMP-dependence, regulation and control, type I, α (tissue-specific extinguisher 1)]; The PRKAR2A[protein kinase, cAMP-dependence, regulation and control, Type II, α]; The PRKAR2B[protein kinase, cAMP-dependence, regulation and control, Type II, β]; The PRKCA[protein kinase C, α]; The PRKCB[protein kinase C, β]; The PRKCD[protein kinase C, δ]; The PRKCE[protein kinase C, ε]; The PRKCG[protein kinase C, γ]; The PRKCH[protein kinase C, η]; The PRKCI[protein kinase C, ι]; The PRKCQ[protein kinase C, θ]; The PRKCZ[protein kinase C, ζ]; PRKD1[protein kinase D1]; PRKD3[protein kinase D3]; The PRKDC[protein kinase, DNA-activation, catalytic polypeptide; Claim again DNAPK]; The PRKG1[protein kinase, cGMP-dependence, type I]; PRKRIR[protein-kinases, interferon-can induce double-stranded RNA dependence inhibiting factor, repressor (P58 repressor)]; PRL[lactogen]; PRLR[lactogen acceptor]; PRNP[prion protein]; PROC[protein C (clotting factor inhibiting factor Va and VIIIa)]; PRODH[proline dehydrogenase (oxidizing ferment) 1]; Dynein 1 before PROK1[]; Dynamin-2 before PROK2[]; PROM1[protruding plain 1]; PROS1[protein s (α)]; PRPH[peripheral protein]; PRSS1[protease, serine, 1 (trypsase 1)]; PRSS2[protease, serine, 2 (trypsase 2)]; PRSS21[protease, serine, 21 (testis albumen)]; PRSS3[protease, serine, 3]; PRTN3[protease 3]; PSAP[Prosaposin]; PSEN1[presenilin 1]; PSEN2[presenilin 2 (A Zihaimo disease 4)]; PSMA1[proteasome (precursor, huge protein factor) subunit, α type, 1]; PSMA2[proteasome (precursor, huge protein factor) subunit, α type, 2]; PSMA3[proteasome (precursor, huge protein factor) subunit, α type, 3]; PSMA5[proteasome (precursor, huge protein factor) subunit, α type, 5]; PSMA6[proteasome (precursor, huge protein factor) subunit, α type, 6]; PSMA7[proteasome (precursor, huge protein factor) subunit, α type, 7]; PSMB10[proteasome (precursor, huge protein factor) subunit, beta type, 10]; PSMB2[proteasome (precursor, huge protein factor) subunit, beta type, 2]; PSMB4[proteasome (precursor, huge protein factor) subunit, beta type, 4]; PSMB5[proteasome (precursor, huge protein factor) subunit, beta type, 5]; PSMB6[proteasome (precursor, huge protein factor) subunit, beta type, 6]; PSMB8[proteasome (precursor, huge protein factor) subunit, beta type, 8 (large multifunctional polypeptide enzymes 7)]; PSMB9[proteasome (precursor, huge protein factor) subunit, beta type, 9 (large multifunctional polypeptide enzymes 2)]; PSMC3[proteasome (precursor, huge protein factor) 26S subunit, ATP enzyme, 3]; PSMC4[proteasome (precursor, huge protein factor) 26S subunit, ATP enzyme, 4]; PSMC6[proteasome (precursor, huge protein factor) 26S subunit, ATP enzyme, 6]; PSMD4[proteasome (precursor, huge protein factor) 26S subunit, non ATP enzyne, 4]; PSMD9[proteasome (precursor, huge protein factor) 26S subunit, non ATP enzyne, 9]; PSME1[proteasome (proteasome, huge protein factor) activity factor subunit 1 (PA28 α)]; PSME3[proteasome (precursor, huge protein factor) (the PA28 γ of activity factor subunit 3; Ki)]; PSMG2[proteasome (proteasome, huge protein factor) assembling chaperone 2]; PSORS1C1[psoriasis neurological susceptibility 1 candidate gene 1]; PSTPIP1[proline-serine-threonine phosphatase interaction protein 1]; PTAFR[blood platelet-activation factor acceptor]; PTBP1[polypyrimidine tract Binding Protein 1]; PTCH1[speckle gene homolog 1 (fruit bat)]; PTEN[phosphatase and tensin homologue]; PTGDR[prostaglandin D 2 receptor (DP)]; PTGDS[PGD2 synzyme 21kDa (brain)]; PTGER1[prostaglandin E receptor 1 (hypotype EP1), 42kDa]; PTGER2[Prostaglin E Receptor 2 (hypotype EP2), 53kDa]; PTGER3[prostaglandin E receptor 3 (hypotype EP3)]; PTGER4[prostaglandin E receptor 4 (hypotype EP4)]; PTGES[Prostaglandin E Synthase]; PTGFR[PGF acceptor (FP)]; PTGIR[prostacyclin I2 (prostacyclin) acceptor (IP)]; PTGS 1[prostaglandin-endoperoxide synthetase 1 (prostaglandin G/H sythase and epoxidase)]; PTGS2[prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and epoxidase)]; PTH[parathormone]; PTHLH[parathormone-sample hormone]; PTK2[PTK2 protein tyrosine kinase 2]; PTK2B[PTK2B protein tyrosine kinase 2 β]; PTK7[PTK7 protein tyrosine kinase 7]; The other parathyrine of PTMS[thymus gland]; PTN[PTN]; The PTPN1[protein tyrosine phosphatase, non-acceptor type 1]; The PTPN11[protein tyrosine phosphatase, non-acceptor type 11]; The PTPN12[protein tyrosine phosphatase, non-acceptor type 12]; The PTPN2[protein tyrosine phosphatase, non-acceptor type 2]; The PTPN22[protein tyrosine phosphatase, non-acceptor type 22 (lymph)]; The PTPN6[protein tyrosine phosphatase, non-acceptor type 6]; The PTPRC[protein tyrosine phosphatase, acceptor type, C]; The PTPRD[protein tyrosine phosphatase, acceptor type, D]; The PTPRE[protein tyrosine phosphatase, acceptor type, E]; The PTPRJ[protein tyrosine phosphatase, acceptor type, J]; The PTPRN[protein tyrosine phosphatase, acceptor type, N]; The PTPRT[protein tyrosine phosphatase, acceptor type, T]; The PTPRU[protein tyrosine phosphatase, acceptor type, U]; PTRF[polymerase I and transcript releasing factor]; PTS[6-pyruvoyl tetrahydro pterin synzyme]; PTTG1[pituitary tumor-transform 1]; The PTX3[PTX3, long]; PUS10[pseudouridylic acid synthetase 1 0]; The serine/threonine kinase that PXK[contains the PX territory]; PXN[paxillin]; PYCR1[pyrroline-5-carboxylate reductase 1]; PYCR2[pyrroline-5-carboxylate reductase family, the member 2]; The PYGB[phosphorylase, glycogen; Brain]; The PYGM[phosphorylase, glycogen, muscle]; PYY[PYY]; PZP[pregnancy zone portein]; QDPR[quinoid dihydropteridine reductase]; RAB11A[RAB11A, member RAS Oncogene family]; RAB11FIP1[RAB11 family Binding Protein 1 (class I)]; RAB27A[RAB27A, member RAS Oncogene family]; RAB37[RAB37, member RAS oncogene family]; RAB39[RAB39, member RAS oncogene family]; RAB7A[RAB7A, member RAS oncogene family]; RAB9A[RAB9A, member RAS oncogene family]; The RAC1[ras C3 botulin substrate 1 (rho family, little gtp binding protein Rac1) of being correlated with]; The RAC2[ras C3 botulin substrate 2 (rho family, little gtp binding protein Rac2) of being correlated with]; RAD17[RAD17 homologue (fission yeast)]; RAD50[RAD50 homologue (saccharomyces cerevisiae)]; RAD51[RAD51 homologue (RecA homologue, Escherichia coli) (saccharomyces cerevisiae)]; RAD51C[RAD51 homologue C (saccharomyces cerevisiae)]; RAD51L1[RAD51-sample 1 (saccharomyces cerevisiae)]; RAD51L3[RAD51-sample 3 (saccharomyces cerevisiae)]; RAD54L[RAD54-sample (saccharomyces cerevisiae)]; RAD9A[RAD9 homologue A (fission yeast)]; RAF1[v-raf-1 Muridae leukemia virus oncogene homologue 1]; RAG1[recombination activating gene 1]; RAG2[recombination activating gene 2]; RAN[RAN, member RAS oncogene family]; RANBP1[RAN Binding Protein 1]; RAP1A[RAP1A, RAS oncogene family member]; RAPGEF4[Rap guanine nucleotide exchange factor (GEF) 4]; The RARA[retinoid receptor, α]; The RARB[retinoid receptor, β]; The RARG[retinoid receptor, γ]; RARRES2[retinoid receptor response factors (ungernine is induced) 2]; RARS[Arginyl-tRNA synthetase]; RASA1[RASp21 protein activity factor (GTP enzyme activation protein) 1]; The RASGRP1[RAS amidino groups discharges protein 1 (calcium and DAG-regulation and control)]; The RASGRP2[RAS amidino groups discharges protein 2 (calcium and DAG-regulation and control)]; The RASGRP4[RAS amidino groups discharges protein 4]; Associated (RalGDS/AF-6) territory family member 1 of RASSF1[RAS]; RB1[retinoblastoma 1]; RBBP4[retinoblastoma conjugated protein 4]; The RBBP8[retinoblastoma is in conjunction with albumen 8]; RBL1[retinoblastoma-sample 1 (p107)]; RBL2[retinoblastoma-sample 2 (p130)]; RBP4[RBP ELISA 4, blood plasma]; RBX1[encircles frame 1]; RCBTB1[is containing the regulatory factor 1 of chromosome concentrated (RCC1) and BTB (POZ) territory albumen 1]; RCN1[net calcium albumen 1, EF chirality calcium binding domain]; RCN2[net calcium albumen 2, EF chirality calcium binding domain]; RDX[radixin]; RECK[has the reverse inducible protein of the rich cysteine of kazal motif]; RECQL[RecQ protein-sample (DNA helicase Q1-sample)]; RECQL4[RecQ protein-sample 4]; RECQL5[RecQ protein-sample 5]; REG1A[regeneration pancreas islet-derivative 1 α]; REG3A[regeneration pancreas islet-derivative 3 α]; REG4[regeneration pancreas islet-derivative family, the member 4]; The too much syndrome virus oncogene of REL[v-rel reticuloendothelial cell homologue (birds)]; The too much syndrome virus oncogene of RELA[v-rel reticuloendothelial cell homologue A (birds)]; The too much syndrome virus oncogene of RELB[v-rel reticuloendothelial cell homologue B]; REN[feritin]; RET[ret is former-oncogene]; RETN[phylaxin]; RETNLB[resistance protein sample β]; RFC1[replication factor C (activity factor 1) 1,145kDa]; RFC2[replication factor C (activity factor 1) 2,40kDa]; RFC3[replication factor C (activity factor 1) 3,38kDa]; RFX1[regulatory factor X, 1 (affecting HLA class II expresses)]; RFX5[regulatory factor X, 5 (affecting HLA class II expresses)]; The protein that RFXANK[contains the relevant ankyrin of regulatory factor X]; RFXAP[regulatory factor X related protein]; RGS18[G protein signal transduction regulatory factor 18]; RHAG[Rh associated glycoprotein]; The RHD[Rh blood group, D antigen]; RHO[rhodopsin]; RHOA[ras homologue gene family, member A]; RHOD[ras homologue gene family, member D]; RIF1[RAP1 interaction factor homologue (yeast)]; RIPK1[acceptor (TNFRSF)-interaction serine-threonine kinase 1]; RIPK2[acceptor-interaction serine-threonine kinase 2]; RLBP1[retinaldehyde binding protein 1]; RLN1[relaxin 1]; RLN2[relaxin 2]; RMI1[RMI1, the genomic instability 1 of RecQ mediation, homologue (saccharomyces cerevisiae)]; The RNASE1[ribalgilase, RNaseA family, 1 (pancreas)]; RNA enzyme [ribalgilase, RNaseA family, 2 (liver, eosinophil-derivative neurotoxins)]; The RNASE3[ribalgilase, RNaseA family, 3 (eosinophil cationic proteins)]; RNASEH1[ribonuclease H 1]; RNASEH2A[ribonuclease H 2, subunit A]; The RNASEL[ribonuclease l (2 ' [5 '-few different adenylate synzyme-dependence)]; RNASEN[ribalgilase type-iii, core]; RNF123[ring finger protein 123]; RNF13[ring finger protein 13]; RNF135[ring finger protein 135]; RNF138[ring finger protein 138]; RNF4[ring finger protein 4]; RNH1[ribalgilase/angiogenic proteins inhibiting factor 1]; RNPC3[contains RNA-land (RNP1, RRM) 3]; RNPEP[arginyl aminopeptidase (aminopeptidase B)]; ROCK1[Rho is relevant, the protein kinase 1 that contains coiled coil]; ROM1[retina acromere memebrane protein 1]; ROR2[receptor tyrosine kinase-sample orphan receptor 2]; The RORA[RAR orphan receptor A that is correlated with]; RPA1[replication protein A1,70kDa]; RPA2[replication protein A2,32kDa]; RPGRIP1L[RPGRIP1-sample]; The RPLP1[ribosomal protein, large, P1]; RPS19[ribosomal protein S1 9]; RPS6KA3[ribosomal protein S6K, 90kDa, polypeptide 3]; RPS6KB1[ribosomal protein S6K, 70kDa, polypeptide 1]; RPSA[ribosomal protein SA]; RRBP1[ribophorin 1 homologue 180kDa (dog)]; RRM1[ribonucleotide reductase M1]; RRM2B[ribonucleotide reductase M2B (TP53 can induce)]; RUNX1[dwarf's associated transcription factor 1]; RUNX3[dwarf's associated transcription factor 3]; RXRA[retinoids X acceptor, α]; RXRB[retinoids X acceptor, β]; The blue Buddhist nun's alkali of RYR1[acceptor 1 (bone)]; RYR3[Arnold alkali acceptor 3]; S100A1[S100 calbindin A1]; S100A12[S100 calbindin A12]; S100A4[S100 calbindin A4]; S100A7[S100 calbindin A7]; S100A8[S100 calbindin A8]; S100A9[S100 calbindin A9]; S100B[S100 calbindin B]; S100G[S100 calbindin G]; S1PR1[sphingosine-1-phosphate receptor 1]; SAA1[Serum Amyloid A 1]; SAA4[Serum Amyloid A 4, composing type]; The SAFB[support connects factor B]; SAG[S-antigen; Retina and pineal body (CKIs)]; SAGE1[sarcoma antigen 1]; SARDH[sarcosine dehydrogenase]; The squamous cell carcinoma antigen 3 of SART3[T cell recognition]; SBDS[Shwachman-Bodian-Diamond syndrome]; SBNO2[strawberry notch homologue 2 (fruit bats)]; SCAMP3[secretion vector memebrane protein 3]; SCAP[SREBF chaperone]; SCARB1[clearing factor acceptor class B, the member 1]; SCD[stearoyl-coacetylase desaturase (δ-9-desaturase)]; SCG2[secretogranin II]; SCG3[secretogranin III]; SCG5[secretogranin V (7B2 protein)]; SCGB1A1[secretes globulin, the 1A of family, member 1 (uteroglobin)]; SCGB3A2[secretes globulin, the 3A of family, the member 2]; The SCN4A[sodium channel, valtage-gated, type I V, alpha subunit]; The SCNN1A[sodium channel, non-valtage-gated 1 α]; The SCNN1G[sodium channel, non-valtage-gated 1, γ]; The SCO1[SCO cytochrome oxidase lacks homologue 1 (yeast)]; The SCO2[SCO cytochrome oxidase lacks homologue 2 (yeast)]; SCP2[sterol carrier protein matter 2]; SCT[secretin]; SDC1[syndecan 1]; SDC2[syndecan 2]; SDC4[syndecan 4]; SDHB[succinate dehydrogenase complex, the B of subunit, iron sulphur (Ip)]; SDHD[succinate dehydrogenase complex, the D of subunit, AQP-CHIP]; SEC14L2[SEC14-sample 2 (saccharomyces cerevisiae)]; SEC16A[SEC16 homologue A (saccharomyces cerevisiae)]; SEC23B[Sec23 homologue B (saccharomyces cerevisiae)]; SELE[selects plain E]; SELL[selects plain L]; SELP[selects plain P (membrane granulosa protein 140kDa, antigens c D62)]; SELPLG[selects plain P part]; SEPT5[born of the same parents are split albumen 5]; The SEPP1[Selenoprotein P, blood plasma, 1]; SEPSECS[Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synzyme]; SERBP1[SERPINE1mRNA Binding Protein 1]; SERPINA1[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 1]; SERPINA2[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 2]; SERPINA3[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 3]; SERPINA5[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 5]; SERPINA6[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 6]; SERPINA7[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 7]; SERPINB1[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 1]; SERPINB2[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 2]; SERPINB3[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 3]; SERPINB4[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 4]; SERPINB5[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 5]; SERPINB6[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 6]; SERPINB9[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 9]; SERPINC1[serpin peptide enzyme inhibition factor, clade C (antithrombase), the member 1]; SERPIND1[serpin peptide enzyme inhibition factor, clade D (heparin cofactor), the member 1]; SERPINE1[serpin peptide enzyme inhibition factor, clade E (nexin, Plasminogen activator Class1), the member 1]; SERPINE2[serpin peptide enzyme inhibition factor, clade E (nexin, Plasminogen activator Class1), the member 2]; SERPINF2[serpin peptide enzyme inhibition factor, clade F (α-2 antiplasmin, pigment epidermal derived factors), the member 2]; SERPING1[serpin peptide enzyme inhibition factor, clade G (C1 inhibitor), the member 1]; SERPINH1[serpin peptide enzyme inhibition factor, clade H (heat shock protein 47), the member 1, (collagen binding protein 1)]; SET[SET core oncogene]; The SETDB2[SET territory, bifurcated 2]; SETX[senataxin]; Rich proline/the glutamine of SFPQ[splicing factor (polypyrimidine tract is relevant in conjunction with albumen)]; SFRP1[secretion frizzled related protein matter 1]; SFRP2[secretion frizzled related protein matter 2]; SFRP5[secretion frizzled related protein matter 5]; SFTPA1[surfactant albumin A 1]; SFTPB[SP-B]; SFTPC[surfactant PROTEIN C]; SFTPD[surfactant protein D]; The SGCA[inose, α (50kDa dystrophin associated glycoprotein)]; The SGCB[inose, β (43kDa dystrophin associated glycoprotein)]; SGK1[serum/glucocorticoid regulation and control kinases 1]; SGSH[N-sulfoamino-group glucose sulfo group hydrogenase]; SGTA[contain slightly rich glutamine-triangle tetrapeptide repetitive sequence (TPR)-, α]; SH2B1[SH2B is connected factor protein matter 1]; SH2B3[SH2B is connected factor protein matter 3]; SH2D1A[contains SH2 territory 1A]; SH2D4B[contains SH2 territory 4B]; SH3KBP1[SH3-territory kinase binding proteins 1]; SHBG[sex hormone-haptoglobin]; SHC1[SHC (containing Src homology 2 territories) transforming protein matter 1]; SHH[Sonic hedgehog homologue (fruit bat)]; SHMT2[serine hydroxymethylase 2 (mitochondria)]; SI[Sucrase-isomaltase (alpha-glucosidase)]; The single immunoglobulin (Ig) of SIGIRR[and toll-interleukin 1 receptor (TIR) territory]; SIP1[motor neuron survivin interaction protein 1]; SIPA1[signal-induce propagation to be correlated with 1]; SIRPA[signal-regulation protein α]; SIRPB2[signal-regulation protein β 2]; SIRT1[deacetylase (reticent mating type Information Regulating 2 homologues) 1 (saccharomyces cerevisiae)]; SKIV2L[superkiller antiviral activity 2-sample (saccharomyces cerevisiae)]; SKP2[S-phase kinase-associated protein matter 2 (p45)]; SLAMF1[signal transduction lymphocyte activator molecule family member 1]; SLAMF6[SLAM family member 6]; SLC11A1[solute carrier family 11 (proton-coupling bivalent metal ion transport protein), the member 1]; SLC11A2[solute carrier family 11 (proton-coupling bivalent metal ion transport protein), the member 2]; SLC12A1[solute carrier family 12 (sodium/potassium/chloride transport protein), the member 1]; SLC12A2[solute carrier family 12 (sodium/potassium/chloride transport protein), the member 2]; SLC14A1[solute carrier family 14 (urea transport protein), member 1 (Kidd blood group)]; SLC15A1[solute carrier family 15 (peptide transporters), the member 1]; SLC16A1[solute carrier family 16, member 1 (monocarboxylic acid transport protein 1)]; SLC17A5[solute carrier family 17 (anion/saccharide transporters), the member 5]; SLC17A6[solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter), the member 6]; SLC17A7[solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter), the member 7]; SLC19A1[solute carrier family 19 (folic acid transport protein), the member 1]; SLC1A1[solute carrier family 1 (neuron/epithelium high-affinity glutamate transporter, system Xag), the member 1]; SLC1A2[solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 2]; SLC1A4[solute carrier family 1 (glutamic acid/neutral amino acid transporter albumen), the member 4]; SLC22A12[solute carrier family 22 (organic anion/lithate transport protein), the member 12]; SLC22A2[solute carrier family 22 (organic cation transporters), the member 2]; SLC22A23[solute carrier family 22, the member 23]; SLC22A3[solute carrier family 22 (Extraneuronal monoamine transporters), the member 3]; SLC22A4[solute carrier family 22 (organic cation/erythrothioneine transport protein), the member 4]; SLC22A5[solute carrier family 22 (organic cation/organic cation transporters), the member 5]; SLC22A6[solute carrier family 22 (organic anion transport protein), the member 6]; SLC24A2[solute carrier family 24 (sodium/potassium/calcium exchanger), the member 2]; SLC25A1[solute carrier family 25 (mitochondrial carriers; Citrate transporter albumen), the member 1]; SLC25A20[solute carrier family 25 (carnitine/fatty acyl carnitine translocase), the member 20]; SLC25A3[solute carrier family 25 (mitochondrial carriers; Phosphate carrier), the member 3]; SLC25A32[solute carrier family 25, the member 32]; SLC25A33[solute carrier family 25, the member 33]; SLC25A4[solute carrier family 25 (mitochondrial carriers; The adenylic acid transposable element), the member 4]; SLC26A4[solute carrier family 26, the member 4]; SLC27A4[solute carrier family 27 (fatty acid transport proteins), the member 4]; SLC28A1[solute carrier family 28 (sodium-coupling nucleoside transporter), the member 1]; SLC2A1[solute carrier family 2 (facilitation GLUT), the member 1]; SLC2A13[solute carrier family 2 (facilitation GLUT), the member 13]; SLC2A3[solute carrier family 2 (facilitation GLUT), the member 3]; SLC2A4[solute carrier family 2 (facilitation GLUT), the member 4]; SLC30A1[solute carrier family 30 (Zinc transporters), the member 1]; SLC30A8[solute carrier family 30 (Zinc transporters), the member 8]; SLC31A1[solute carrier family 31 (copper transport protein is white), the member 1]; SLC35A1[solute carrier family 35 (cmp sialic acid transport protein), member A1]; SLC35A2[solute carrier family 35 (UDP-galactolipin transport protein), member A2]; SLC35C1[solute carrier family 35, member C1]; SLC35F2[solute carrier family 35, member F2]; SLC39A3[solute carrier family 39 (Zinc transporters), the member 3]; SLC3A2[solute carrier family 3 (two alkali and neutral amino acid transportation activity factor), the member 2]; SLC46A1[solute carrier family 46 (folic acid transport protein), the member 1]; SLC5A5[solute carrier family 5 (sodium iodide transporter), the member 5]; SLC6A11[solute carrier family 6 (neurotransmitter transport protein, GABA), the member 11]; SLC6A14[solute carrier family 6 (amino acid transporters), the member 14]; SLC6A19[solute carrier family 6 (neutral amino acid transporter albumen), the member 19]; SLC6A3[solute carrier family 6 (neurotransmitter transport protein, dopamine), the member 3]; SLC6A4[solute carrier family 6 (neurotransmitter transport protein, 5), the member 4]; SLC6A8[solute carrier family 6 (neurotransmitter transport protein, creatine), the member 8]; SLC7A1[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 1]; SLC7A2[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 2]; SLC7A4[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 4]; SLC7A5[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 5]; SLC8A1[solute carrier family 8 (sodium/calcium exchanger), the member 1]; SLC9A1[solute carrier family 9 (sodium/hydrogen exchanger), the member 1]; SLC9A3R1[solute carrier family 9 (sodium/hydrogen exchanger), member's 3 regulatory factors 1]; SLCO1A2[solute carrier organic anion transport protein family, member 1A2]; SLCO1B1[solute carrier organic anion transport protein family, member 1B1]; SLCO1B3[solute carrier organic anion transport protein family, member 1B3]; SLPI[secretion leucocyte peptide enzyme inhibition factor]; SMAD1[SMAD family member 1]; SMAD2[SMAD family member 2]; SMAD3[SMAD family member 3]; SMAD4[SMAD family member 4]; SMAD7[SMAD family member 7]; SMARCA4[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily A, the member 4]; SMARCAL1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, subfamily A-sample 1]; SMARCB1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily b, the member 1]; The SMC1A[chromosome structure maintains 1A]; The SMC3[chromosome structure maintains 3]; The SMG1[SMG1 homologue, phosphatidyl-inositol 3-kinase associated kinase (Caenorhabditis elegans)]; SMN1[survival of motor neurons protein 1, telomere]; SMPD1[sphingomyelin phosphodiesterase 1, sour lysosome]; SMPD2[sphingomyelin phosphodiesterase 2, neutral film (neutral sphingomyelinase)]; SMTN[smooth muscle albumen]; SNAI2[snail homologue 2 (fruit bat)]; SNAP25[synapse-related protein matter, 25kDa]; The SNCA[synapse nucleoprotein, α (the non-A4 component of amyloid precursor)]; The SNCG[synapse nucleoprotein, γ (breast cancer-specific protein 1)]; SNURF[SNRPN upstream reading frame]; SNW1[contains SNW territory 1]; SNX9[sorting nexin 9]; SOAT1[sterol O-acyltransferase 1]; SOCS1[Suppressor of Cytokine Signaling 1]; SOCS2[Suppressor of Cytokine Signaling 2]; SOCS3[Suppressor of cytokine signaling-3]; SOD1[superoxide dismutase 1, solvable]; SOD2[superoxide dismutase 2, mitochondria]; SORBS3[contains sorbose and SH3 territory 3]; SORD[SODH]; SOX2[SRY (sex-determining region Y)-frame 2]; SP1[Sp1 transcription factor]; SP110[SP110 nucleosome protein]; SP3[Sp3 transcription factor]; SPA17[sperm autoantigen protein 17]; The SPARC[secretory protein, acidity, rich cysteine-(osteonectin)]; SPHK1[sphingosine kinase 1]; SPI1[spleen focus-forming virus (SFFV) provirus is integrated oncogene spi1]; SPINK1[serine peptide enzyme inhibition factor, the Kazal Class1]; SPINK13[serine peptide enzyme inhibition factor, Kazal Class1 3 (supposition)]; SPINK5[serine peptide enzyme inhibition factor, Kazal type 5]; SPN[sialophorin]; SPON1[vertebra albumen 1, extracellular matrix proteins]; SPP1[secretes phosphoprotein 1]; The SPRED1[rudiment is relevant, contains EVH1 territory 1]; Slightly rich proline-the protein 2 of SPRR2A[]; The slightly rich proline of SPRR2B[-protein 2B]; The SPTB[spectrin, β, red blood cell]; SRC[v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (birds)]; SRD5A1[sterol-5-5 alpha-reductases, α polypeptide 1 (3-oxo-5 α-steroids δ 4-dehydrogenase α 1)]; SREBF1[sterol controlling element is in conjunction with transcription factor 1]; SREBF2[sterol controlling element is in conjunction with transcription factor 2]; The SRF[serum response factpr (c-fos serum sensing element-in conjunction with transcription factor)]; The sweet albumen of SRGN[silk]; SRP9[signal recognition particle 9kDa]; The protein that SRPX[contains sushi-repetitive sequence, X-is chain]; SRR[serine racemase enzyme]; SRY[sex-determining region Y]; SSB[Sjogren syndrome antigen B (autoantigen La)]; SST[amicine]; SSTR2[amicine acceptor 2]; SSTR4[amicine acceptor 4]; ST8SIA4[ST8 α-5-Acetamido-3,5-dideoxy-D-glycero-D-galactonulosonic acid glycosides α--2,8-sialyltransferase 4]; The acute regulation protein of STAR[steroids]; STAT1[signal transduction and transcriptional activators 1,91kDa]; STAT2[signal transduction and transcriptional activators 2,113kDa]; STAT3[signal transduction and transcriptional activators 3 (acute stage response factor)]; STAT4[signal transduction and transcriptional activators 4]; STAT5A[signal transduction and transcriptional activators 5]; STAT5B[signal transduction and transcriptional activators 5B]; STAT6[signal transduction and transcriptional activators 6, interleukin 4 is induced]; STELLAR[germ and embryonic stem cell enrichment protein STELLA]; STIM1[stromal interaction molecule 1]; STIP1[pressure-induce-phosphoprotein 1]; STK11[serine/threonine kinase 11]; STMN2[microtubule depolymerization albumen-sample 2]; STRAP[serine/threonine kinase receptor associated protein white matter]; STRC[stereocilia albumen]; STS[Steryl-sulfatase (microsome), isoenzymes S]; STX6[syntaxin 6]; STX8[syntaxin 8]; SULT1A1[sulfotransferase family, cytoplasm, 1A, phenol-preferably, the member 1]; SULT1A3[sulfotransferase family, cytoplasm, 1, phenol-preferably, the member 3]; SUMF1[sulfatase modifying factor 1]; SUMO1[mif 23 homologue SMT3 inhibiting factors 1 (saccharomyces cerevisiae)]; SUMO3[mif 23 homologue SMT3 initiator 3s (saccharomyces cerevisiae)]; SUOX[sulfite oxidase]; SUV39H1[piebald initiator 3-9 homologue 1 (fruit bat)]; SWAP70[SWAP exchange B cell conjugate 70kDa subunit]; SYCP3[synaptinemal complex protein 3]; SYK[spleen tyrosine kinase]; SYNM[joins silk-fibroin, median fiber albumen]; SYNPO[cynapse utmost point albumen]; SYNPO2[cynapse utmost point albumen 2]; SYP[synaptobrevin]; SYT3[Synaptotagmin I II]; SYTL1[synaptotagmin-sample 1]; T[T, short-tail class homologue (mouse)]; The TAC1[tachykinin, precursor 1]; TAC4[tachykinin 4 (ferroheme kassinin kinin)]; TACR1[tachykinin receptor 1]; TACR2[tachykinin receptor 2]; TACR3[tachykinin receptor 3]; TAGLN[glue turning egg(s) is white]; TAL1[T-cell Acute Lymphoblastic Leukemia 1]; TAOK3[TAO kinases 3]; TAP1[transport protein 1, ATP-binding cassette, subfamily B (MDR/TAP)]; The TAP2[transport protein 2, ATP-binding cassette, subfamily B (MDR/TAP)]; TARDBP[TAR DBP]; TARP[TCR γ replaces alternate reading frame protein matter]; TAT[TAT]; TBK1[TANK-is in conjunction with kinases 1]; The TBP[TATA frame is in conjunction with albumen]; TBX1[T-frame 1]; TBX2[T-frame 2]; TBX21[T-frame 21]; TBX3[T-frame 3]; TBX5[T-frame 5]; TBXA2R[thromboxane A2 acceptor]; TBXAS1[thromboxane A synthetase 1 (blood platelet)]; TCEA1[transcriptional elongation factor A (SII), 1]; TCEAL1[transcriptional elongation factor A (SII)-sample 1]; TCF4[transcription factor 4]; TCF7L2[transcription factor 7-sample 2 (T-cell-specific, HMG-frame)]; TCL1A[T-chronic myeloid leukemia/lymthoma 1A]; TCL1B[T-chronic myeloid leukemia/lymthoma 1B]; TCN1[transcobalamin I (Vitamin B12 binding protein, R binding factor family)]; TCN2[transcobalamin II; Macrocytic anemia]; TDP1[tyrosyl-DNA phosphodiesterase 1]; TEC[tec protein tyrosine kinase]; TECTA[overlay film protein alpha]; The TEK[TEK EGFR-TK, endothelium]; TERF1[telomeric repeat binding factor (NIMA-interaction) 1]; TERF2[telomeric repeat binding factor 2]; TERT[reverse transcriptase of telomere]; The TES[testis derives transcript (3LIM territory)]; TF[transferrin]; TFAM[transcription factor A, mitochondria]; TFAP2A[transcription factor AP-1-2 α (activating enhancer binding protein 2 α)]; TFF2[trefoil factor 2]; TFF3[trefoil factor 3 (intestines)]; TFPI[tissue factor approach inhibition factor (lipoprotein be correlated with coagulation inhibitor)]; TFPT[TCF3 (E2A) fusion partner (leukaemia childhood)]; TFR2[transferrin receptor 2]; TFRC[transferrin receptor (p90, CD71)]; TG[thyroglobulin]; The TGFA[TGF, α]; TGFB 1[TGF, β 1]; The TGFB2[TGF, β 2]; The TGFB3[TGF, β 3]; The TGFBR1[TGF, beta receptor 1]; The TGFBR2[TGF, beta receptor II (70/80kDa)]; TGIF1[TGFB-inducible factor homology frame 1]; TGM1[TGase 1 (K polypeptide epidermis type I, protein-glutamine-gamma glutamyltransferase)]; TGM2[TGase 2 (C polypeptide, protein-glutamine-gamma glutamyltransferase)]; TGM3[TGase 3 (E polypeptide, protein-glutamine-gamma glutamyltransferase)]; TH[tyrosine hydroxylase]; THAP1[contains the THAP territory, cell death related protein matter 1]; THBD[thrombomodulin]; THBS 1[thrombospondin 1]; THBS3[thrombospondin 3]; THPO[TPO]; THY1[Thy-1 cell surface antigen]; The TIA1[TIA1 cytotoxin particle rna binding protein of being correlated with]; TIE1[has the EGFR-TK 1 in immunoglobulin (Ig)-sample and EGF-sample territory]; TIMD4[contains T-cell immunoglobulin and mucoprotein territory 4]; TIMELESS[circadian rhythm gene homolog (fruit bat)]; TIMP1[TIMP TIMP metallopeptidase inhibitor 1]; TIMP2[TIMP metallopeptidase inhibiting factor 2]; TIMP3[TIMP metallopeptidase initiator 3]; The linking factor protein matter that TIRAP[contains toll-interleukin 1 receptor (TIR) territory]; TJP1[claudin-3 white matter 1 (zonuls occludens 1)]; TK1[thymidine kinase 1, solvable]; TK2[thymidine kinase 2, mitochondria]; TKT[transketolase]; TLE4[transducin sample division enhancer 4 (E (sp1) homologue, fruit bat)]; TLR1[toll sample acceptor 1]; TLR10[toll sample acceptor 10]; TLR2[toll sample acceptor 2]; TLR3[toll sample acceptor 3]; TLR4[toll sample acceptor 4]; TLR5[toll sample acceptor 5]; TLR6[toll sample acceptor 6]; TLR7[toll sample acceptor 7]; TLR8[toll sample acceptor 8]; TLR9[toll sample receptor 9]; TLX1[T-chronic myeloid leukemia homology frame 1]; TM7SF4[cross-film 7 Superfamily members 4]; TMED3[contains cross-film emp24 protein transport territory 3]; TMEFF2[has the transmembrane protein 2 in EGF-sample and two folliculus stabilize proteins-sample territories]; TMEM132E[transmembrane protein 132E]; TMEM18[transmembrane protein 18]; TMEM19[transmembrane protein 19]; TMEM216[transmembrane protein 216]; TMEM27[transmembrane protein 27]; TMEM67[transmembrane protein 67]; TMPO[thymopoietin]; TMPRSS15[transmembrane protein enzyme, serine 15]; The TMSB4X[extrasin beta 4, X-connects]; TNC[tenascin C]; TNF[TNF (TNF Superfamily, the member 2)]; The TNFAIP1[TNF, α-induced protein 1 (endothelium)]; The TNFAIP3[TNF, α-induced protein 3]; The TNFAIP6[TNF, α-induced protein 6]; TNFRSF10A[Tumor Necrosis Factor Receptors Superfamily, the member 10]; TNFRSF10B[Tumor Necrosis Factor Receptors Superfamily, member 10b]; TNFRSF10C[Tumor Necrosis Factor Receptors Superfamily, member 10c, do not have the bait of cell internal area]; TNFRSF10D[Tumor Necrosis Factor Receptors Superfamily, member 10d, have the bait of brachymemma Death Domain]; TNFRSF11A[Tumor Necrosis Factor Receptors Superfamily, the member 11, the NFKB activity factor]; TNFRSF11B[Tumor Necrosis Factor Receptors Superfamily, member 11b]; TNFRSF13B[Tumor Necrosis Factor Receptors Superfamily, member 13B]; TNFRSF13C[Tumor Necrosis Factor Receptors Superfamily, member 13C]; TNFRSF14[Tumor Necrosis Factor Receptors Superfamily, member 14 (herpesviral enters amboceptor)]; TNFRSF17[Tumor Necrosis Factor Receptors Superfamily, the member 17]; TNFRSF18[Tumor Necrosis Factor Receptors Superfamily, the member 18]; TNFRSF1A[Tumor Necrosis Factor Receptors Superfamily, member 1A]; TNFRSF1B[Tumor Necrosis Factor Receptors Superfamily, member 1B]; TNFRSF21[Tumor Necrosis Factor Receptors Superfamily, the member 21]; TNFRSF25[Tumor Necrosis Factor Receptors Superfamily, the member 25]; TNFRSF4[Tumor Necrosis Factor Receptors Superfamily, the member 4]; TNFRSF6B[Tumor Necrosis Factor Receptors Superfamily, member 6b, bait]; TNFRSF8[Tumor Necrosis Factor Receptors Superfamily, the member 8]; TNFRSF9[Tumor Necrosis Factor Receptors Superfamily, the member 9]; TNFSF10[TNF (part) Superfamily, the member 10]; TNFSF11[TNF (part) Superfamily, the member 11]; TNFSF12[TNF (part) Superfamily, the member 12]; TNFSF13[TNF (part) Superfamily, the member 13]; TNFSF13B[TNF (part) Superfamily, member 13b]; TNFSF14[TNF (part) Superfamily, the member 14]; TNFSF15[TNF (part) Superfamily, the member 15]; TNFSF18[TNF (part) Superfamily, the member 18]; TNFSF4[TNF (part) Superfamily, the member 4]; TNFSF8[TNF (part) Superfamily, the member 8]; TNFSF9[TNF (part) Superfamily, the member 9]; The TNKS[tankyrase, TRF1-is in conjunction with the relevant ADP-ribose polymerase of ankyrin]; TNNC1[TnC Class1 (slowly)]; TNNI2[Troponin I type 2 (bone, fast)]; TNNI3[Troponin I type 3 (heart)]; TNNT3[TnT type 3 (bone, fast)]; TNPO1[transport protein 1]; TNS1[tensin 1]; TNXB[tenascin XB]; TOM1L2[myb1-sample 2 targets (chicken)]; TOP1[topoisomerase (DNA) I]; TOP1MT[topoisomerase (DNA) I, mitochondria]; TOP2A[topoisomerase (DNA) II α 170kDa]; TOP2B[topoisomerase (DNA) II β 180kDa]; TOP3A[topoisomerase (DNA) III α]; TOPBP1[topoisomerase (DNA) II Binding Protein 1]; TP53[oncoprotein matter p53]; TP53BP1[oncoprotein matter p53 Binding Protein 1]; TP53RK[TP53 regulates and controls kinases]; TP63[oncoprotein matter p63]; TP73[oncoprotein matter p73]; TPD52[oncoprotein matter D52]; TPH1[TPH 1]; TPI1[triose-phosphate isomerase 1]; TPM1[tropomyosin 1 (α)]; TPM2[tropomyosin 2 (β)]; TPMT[thio-purine S-transmethylase]; TPO[thyroid peroxidase]; TPP1[tri-peptidyl peptase I]; TPP2[tri-peptidyl peptase II]; The TPPP[tubulin polymerization starts albumen]; The TPPP3[tubulin polymerization starts protein families member 3]; TPSAB1[trypsinlike enzyme α/β 1]; TPSB2[trypsinlike enzyme β 2 (gene/pseudogene)]; TPSD1[trypsinlike enzyme δ 1]; TPSG1[trypsinlike enzyme γ 1]; TPT1[oncoprotein matter, translate-control 1]; TRADD[TNFRSF1A-is relevant via Death Domain]; TRAF1[TNF receptor associated factor 1]; TRAF2[TNF receptor associated factor 2]; TRAF3IP2[TRAF3 interaction protein 2]; TRAF6[TNF receptor associated factor 6]; TRAIP[TRAF interaction protein]; TRAPPC10[transport protein matter particle composites 10]; TRDN[tri-hop proteins]; Tri-initial exonucleases 1 of repairing of TREX1[]; TRH[thyrotropic hormone-releasing hormone]; TRIB1[ball top family homologue 1 (fruit bat)]; TRIM21[contains three symbasis orders 21]; TRIM22[contains three symbasis orders 22]; TRIM26[contains three symbasis orders 26]; TRIM28[contains three symbasis orders 28]; TRIM29[contains three symbasis orders 29]; TRIM68[contains three symbasis orders 68]; TRPA1[transient receptor potential cationic channel protein, subfamily A, the member 1]; TRPC1[transient receptor potential cationic channel protein, subfamily C, the member 1]; TRPC3[transient receptor potential cationic channel protein, subfamily C, the member 3]; TRPC6[transient receptor potential cationic channel protein, subfamily C, the member 6]; TRPM1[transient receptor potential cationic channel protein, subfamily M, the member 1]; TRPM8[transient receptor potential cationic channel protein, subfamily M, the member 8]; TRPS1[nasopharynx hair follicle syndrome i]; TRPV1[transient receptor potential cationic channel protein, subfamily V, the member 1]; TRPV4[transient receptor potential cationic channel protein, subfamily V, the member 4]; TRPV5[transient receptor potential cationic channel protein, subfamily V, the member 5]; TRPV6[transient receptor potential cationic channel protein, subfamily V, the member 6]; TRRAP[transforms/transcribes the territory related protein]; TSC1[tuberous sclerosis 1]; TSC2[tuberous sclerosis 2]; TSC22D3[TSC22 territory family, the member 3]; TSG101[tumor susceptibility gene 101]; TSHR[thyrotropin receptor]; TSLP[thymic stromal lymphopoietin]; TSPAN7[tetra-revolves albumen 7]; TSPO[transposable element protein (18kDa)]; TSSK2[Testiculo-specific serine kinase enzyme 2]; TSTA3[tissue specificity transplantation antigen P35B]; The TTF2[transcription termination factor, rna plymerase ii]; TTN[titin]; TTPA[tocopherol (α) transferring protein]; TTR[thyroxine transport protein]; The TUBA1B[tubulin, α 1b]; The TUBA4A[tubulin, α 4]; The TUBB[tubulin, β]; The TUBB1[tubulin, β 1]; The TUBG1[tubulin, γ 1]; TWIST1[reverses homologue 1 (fruit bat)]; TWSG1[reverses primitive gut and forms homologue 1 (fruit bat)]; TXK[TXK EGFR-TK]; TXN[thioredoxin]; TXN2[thioredoxin 2]; TXNDC5[contains thioredoxin territory 5 (endoplasmic reticulum)]; TXNDC9[contains thioredoxin territory 9]; TXNIP[thioredoxin interaction protein]; TXNRD1[thioredoxin reductase 1]; TXNRD2[thioredoxin reductase 2]; TYK2[EGFR-TK 2]; TYMP[thymidine phosphorylase]; TYMS[thymidylate synthetase]; Tyr[tyrosinase (eyelid albinism IA)]; TYRO3[TYRO3 protein tyrosine kinase]; The TYROBP[TYRO protein tyrosine kinase is in conjunction with albumen]; TYRP1[tyrosinase-related protein matter 1]; UBB[ubiquitin B]; UBC[ubiquitin C]; UBE2C[ubiquitin-joinint enzyme E2C]; UBE2N[ubiquitin-joinint enzyme E2N (UBC13 homologue, yeast)]; UBE2U[ubiquitin-joinint enzyme E2U (supposition)]; UBE3A[ubiquitin protein matter ligase E3A]; UBE4A[ubiquitin factor E4A (UFD2 homologue, yeast)]; UCHL1[ubiquitin carboxyl-end esterase L1 (ubiquitin thiolesterase)]; UCN[Urocortin]; UCN2[Urocortin 2]; UCP1[Uncoupling Proteins 1 (mitochondria, proton carrier)]; UCP2[Uncoupling Proteins 2 (mitochondria, proton carrier)]; UCP3[Uncoupling Proteins 3 (mitochondria, proton carrier)]; The UFD1L[ubiquitin merges degraded 1 sample (yeast)]; UGCG[UDP-glucose ceramide glucose transferase]; UGP2[UDP-glucose pyrophosphatase 2]; UGT1A1[UDP glucuronyl transferase 1 family, polypeptide A 1]; UGT1A6[UDP glucuronyl transferase 1 family, polypeptide A 6]; UGT1A7[UDP glucuronyl transferase 1 family, polypeptide A 7]; UGT8[UDP glycosyl transferase 8]; UIMC1[contains ubiquitin interaction motif 1]; ULBP1[UL16 Binding Protein 1]; ULK2[unc-51-sample kinases 2 (Caenorhabditis elegans)]; UMOD[urine is adjusted albumen]; UMPS[uridine monophosphate synzyme]; UNC13D[unc-13 homologue D (Caenorhabditis elegans)]; UNC93B1[unc-93 homologue B1 (Caenorhabditis elegans)]; UNG[uracil-DNA glycosylase]; UQCRFS1[ubiquinone-Cytochrome c reductase, Rieske iron sulphur polypeptide 1]; UROD[uroporphyrinogen decarboxylase]; USF1[UBF 1]; USF2[UBF 2, c-fos interacts]; USP18[ubiquitin-specific peptase 18]; USP34[ubiquitin-specific peptase 34]; UTRN[myotrophy GAP-associated protein GAP]; UTS2[urotensin 2]; VAMP8[film bubble related membrane protein matter 8 (endosome small protein)]; VAPA[VAMP (film bubble related membrane protein matter) related protein, 33kDa]; VASP[vasodilator-stimulation phosphoprotein]; VAV1[vav1 guanine nucleotide exchange factor]; VAV3[vav3 guanine nucleotide exchange factor]; VCAM1[Vcam1]; VCAN[versican]; VCL[vinculin]; VDAC1[voltage-dependence anion channel 1]; VDR[vitamin D (1[25-dihydroxyvitamin D3) acceptor]; VEGFA[VEGF-A]; VEGFC[vascular endothelial growth factor C]; VHL[von Hippel-Lindau TIF]; VIL1[villin 1]; VIM[vimentin]; VIP[vasoactive intestinal peptide]; VIPR1[vip receptor 1]; VIPR2[vip receptor 2]; VLDLR[very low density lipoprotein receptor]; VMAC[vimentin-type intermediate filament curling coilin matter of being correlated with]; VPREB1[pre-B lymphocyte 1]; VPS39[film bubble protein sorting 39 homologues (saccharomyces cerevisiae)]; VTN[vitronectin]; VWF[vWF ELISA]; WARS[tryptophanyl-tRNA synthetase]; WAS[Wiskott-Aldrich syndrome (eczema-decrease of platelet)]; The WASF1[WAS protein families, the member 1]; The WASF2[WAS protein families, the member 2]; WASL[Wiskott-Aldrich syndrome-sample]; WDFY3[contains WD repetitive sequence and FYVE territory 3]; WDR36[WD duplicate domain 36]; WEE1[WEE1 homologue (fission yeast)]; WIF1[WNT inhibiting factor 1]; WIPF1[WAS/WASL is in conjunction with protein family, and the member 1]; WNK1[WNK lysine lacks protein kinase 1]; WNT5A[is aptery-type MMTV integration site family, the member 5]; WRN[Werner syndrome, RecQ unwindase-sample]; The WT1[nephroblastoma 1]; XBP1[X-frame Binding Protein 1]; XCL1[chemotactic factor (CF) (C motif) ligand 1]; XDH[xanthine dehydrogenase]; The chain inhibiting factor of the apoptotic X-of XIAP[]; The XPA[xeroderma pitmentosum, complementary group A]; The XPC[xeroderma pitmentosum, complementary group C]; XPO5[exports albumen 5]; The reparation of XRCC1[Chinese hamster cell X ray supplements defect repair 1]; The reparation of XRCC2[Chinese hamster cell X ray supplements defect repair 2]; The reparation of XRCC3[Chinese hamster cell X ray supplements defect repair 3]; The reparation of XRCC4[Chinese hamster cell X ray supplements defect repair 4]; The reparation of XRCC5[Chinese hamster cell X ray supplements defect repair 5 (double-stranded-fracture is re-engaged)]; The reparation of XRCC6[Chinese hamster cell X ray supplements defect repair 6]; YAP1[Yes related protein 1]; YARS[tyrosyl-tRNA synthetase]; YBX1[Y frame Binding Protein 1]; YES1[v-yes-1 Yamaguchi sarcoma virus oncogene homologue 1]; YPEL1[yippee-sample 1 (fruit bat)]; YPEL2[yippee-sample 2 (fruit bat)]; YWHAB[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, beta polypeptides]; YWHAQ[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the θ polypeptide]; YWHAZ[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the ζ polypeptide]; YY1[YY1 transcription factor]; ZAP70[ζ-chain (TCR) related protein kinase 70kDa]; ZBED1[zinc refers to, contains the BED-Class1]; ZC3H12A[contains zinc and refers to CCCH-Class1 2]; ZC3H12D[contains zinc and refers to CCCH-Class1 2D]; ZFR[zinc refers to rna binding protein]; ZNF148[zinc finger protein matter 148]; ZNF267[zinc finger protein matter 267]; ZNF287[zinc finger protein matter 287]; ZNF300[zinc finger protein matter 300]; ZNF365[zinc finger protein matter 365]; ZNF521[zinc finger protein matter 521]; ZNF74[zinc finger protein matter 74]; With ZPBP2[zona clear area in conjunction with albumen 2].

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in the research immune deficiency to study the effect of sudden change for animal and immune deficiency development and/or progress.

Should understand genetically modified animal, for example, knocking out with transgenic animal that method of the present invention produces can comprise with the gene that mode changes alone or in combination, comprises in Rag1, Rag2, FoxN1 and DNAPK the change of any one or more.Therefore, contain and for example comprise animals single, two or three gene knockouts.Any these can change therein in the whole bag of tricks that one or more immune deficiency genes can be useful and using.For example, genetically modified animal can be used for studying hematopoietic cell as described herein, such as identification progenitor cell (comprising lymph progenitor cell and multipotential stem cell); Be identified in the new cytokine worked in hematopoietic cell growth and differentiation; Analyze oneself and know the effect of cytokine; And the analysis medicine is for the effect of hematopoietic cell.This type of animal also can be used for studying the pathogenesis of the disease caused by virus infection, described virus is such as, but not limited to influenza, west Nile virus, simplexvirus, picornavirus, the neural coronavirus of parent, varicella-zoster (varicella), respiratory syncytial virus, cowpox, hepatitis B, rabies and dengue virus, and lymphotropic virus, comprise human immunodeficiency virus (HIV), human T-cell lymphotrophic virus (HTLV-1) and Epstein Barr virus (EBV), and the specific infection rat is still simulated the virus of human specific virus to its host's effect, for example rat adaptability influenza virus is (referring to for example H.Lebrec and G.R.Burleson (1994) Toxicology.Jul 1, 91 (2): 179-88).

In other embodiments, the genetically modified animal produced by method of the present invention is the defense mechanism for the microorganism that causes disease in immuuoeorapromised host applicable to research also, and wherein microorganism can be cytomegalovirus, pneumocystis carinii pneumonia (Pneumocystic carinii) or Candida kind.Genetically modified animal, such as the experimenter who for example knocks out rat and can be the clinical front assessment of specific " gene therapy ".For example, gene can be introduced in hemopoietic progenitor cell, preferably introduce in the multipotential stem cell with self-renewal capacity from the patient with genetic defect, or introduce in the multipotential stem cell with self-renewal capacity from the rat model with genetic defect, and cell is reintroduced back in the genetic modification rat with the treatment availability for definite modified cell.Genetically modified animal is also caused by the sudden change of the immune deficiency gene such as Rag1, Rag2, FoxN1 or DNAPK applicable to research or the potential source biomolecule mechanism of relative immune deficiency disorder and symptom.

In addition, the genetically modified animal produced by method of the present invention can be used for the diagnostic assay that exploitation includes but not limited to leukemic immune deficiency illness, wherein, with respect to unaffected control animal, assess animal unprocessed or that before process through therapeutical agent and whether have one or more biomarkers.This type of genetically modified animal can be used for the treatment of in the method such as the candidate therapy of leukemic immune deficiency illness or treatment compound and use in screening, use comprising but be not limited to Rag1, Rag2, one or more genetically modified animals that are knocked in the immune deficiency gene of FoxN1 or DNAPK, and untreated or before through can be medicine, microorganism, the animal of the another kind of therapeutical agent treatment of transplanted cells or other medicament is then through candidate therapy or candidate therapeutic agent treatment, obtain biological specimen from animal, and the sample with respect to unaffected wild-type check sample, or from the sample of the genetically modified animal that does not stand candidate therapy or therapeutical agent, biological specimen is assessed.

In other embodiments, the method for simulation autoimmune disease can relate to the adoptive transfer of the B cell that the antigen for autoimmune disease reacts, or for autoimmune disease activated T cell.Suitable non-human mammal immunity as follows with antigen target of autoimmune disease.

Immunocyte can, from through immune animal, preparing and can then be transplanted to genetically modified animal as described herein, knock out rat such as Rag1, Rag2, FoxN1 or DNAPK, or have the rat of any combination of these gene knockouts.Can then by the knock-out animal with without transplanting, compare, or by with transplanting, having the knock-out animal of the non-pathology immunocyte that lacks autoreactivity to compare, or by with transplanting, having the wild-type animal of immunocyte as above recently to assess mutually the development of the autoimmunization phenotype in the acceptor knock-out animal.

In some embodiments, the method that produces the CIDS model can comprise provides genetically modified animal, such as Rag1, Rag2, FoxN1 or the DNAPK rat through knocking out wherein as described herein, and can make knock-out animal further lack natural killer cell (NK) by any one in multiple possibility method.The unrestricted example that makes knock-out animal lack the method for NK comprises i) upset the Lyst gene; Or ii) with the compounds for treating FoxN1 saltant type animal that suppresses the NK cytoactive, described compound includes but not limited to NSAID (non-steroidal anti-inflammatory drug), statins, allosteric LFA-1 inhibitor, vinealeucoblastine(VLB), taxol, docetaxel (docetaxel), CldAdo (cladribine), Chlorambucil, Velcade or MG-132.

n. trinucleotide repeats sequence illness

The trinucleotide repeat expansion illness is divided into to two kinds of being determined by the tumor-necrosis factor glycoproteins type.Modal tumor-necrosis factor glycoproteins is triplet CAG, coded amino acid glutamine (Q) when it is present in gene coding region.Therefore, these illnesss are called as polyglutamyl amine (polyQ) illness and can comprise Heng Dingdun sick (HD); Spinal cord oblongata amyotrophy (SBMA); Spinocerebellar ataxia ( SCA type 1,2,3,6,7 and 17); With dentate nucleus rubrum pallidum lyys body atrophy (DRPLA).Other trinucleotide repeat expansion illness does not relate to the CAG triplet, or the CAG triplet is not in gene coding region and be called as non--polyglutamyl amine illness.Non--polyglutamyl amine illness can comprise fragile X mental retardation (FRAXA); Fragile X E backwardness (FRAXE); Friedreich disease (FRDA); Myotonic dystrophy (DM); And spinocerebellar ataxia (SCA type 8 and 12).

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to the trinucleotide repeats sequence illness is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences relevant to the trinucleotide repeats sequence illness.The protein relevant to the trinucleotide repeats sequence illness or the control sequence empirical correlation based on protein or sequence and trinucleotide repeat expansion illness are usually selected.Trinucleotide repeat expansion protein can comprise the protein relevant to the seriousness of the existence of the susceptibility of development trinucleotide repeat expansion illness, trinucleotide repeat expansion illness, trinucleotide repeat expansion illness or its any combination.For example, with respect to the colony that there is no the trinucleotide repeat expansion illness, in the colony of suffering from the trinucleotide repeat expansion illness, production rate or the circulation composition of trinucleotide repeat expansion illness related protein can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of the protein relevant to the trinucleotide repeat expansion illness comprises AR (androgen receptor), FMR1 (fragile X mental retardation 1), HTT (Huntington protein), DMPK (tonus muscular dystrophy-protein kinase), FXN (Fu Shi ataxia albumen), ATXN2 (ataxia albumen 2), ATN1 (Dystroglycan 1), FEN1 (valve structure-specificity endonuclease 1), TNRC6A (containing trinucleotide repeats sequence 6A), PABPN1 (gathering (A) in conjunction with albumen, core 1), JPH3 (parent's connection albumen 3), MED15 (amboceptor compound subunit 15), ATXN1 (ataxia albumen 1), ATXN3 (ataxia albumen 3), TBP (the TATA frame is in conjunction with albumen), CACNA1A (calcium channel, voltage-dependency, P/Q type, α 1A subunit), ATXN8OS (ATXN8 anti-chain (nonprotein coding)), PPP2R2B (protein phosphatase 2, regulation and control subunit B, β), ATXN7 (ataxia albumen 7), TNRC6B (containing trinucleotide repeats sequence 6B), TNRC6C (containing trinucleotide repeats sequence 6C), CELF3 (CUGBP, Elav-sample family member 3), MAB21L1 (mab-21-sample 1 (Caenorhabditis elegans)), MSH2 (mutS homologue 2, colorectal carcinoma, without polyposis Class1 (intestinal bacteria)), TMEM185A (transmembrane protein 185), SIX5 (SIX homology frame 5), CNPY3 (canopy 3 homologues (zebra fish)), FRAXE (rare, fra (X) is E (q28) for fragile site, folic acid type), GNB2 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 2), RPL14 (ribosomal protein L 14), ATXN8 (ataxia albumen 8), INSR (insulin receptor), TTR (thyroxine translocator), EP400 (E1A is in conjunction with albumen p400), GIGYF2 (GRB10 interaction GYF protein 2), OGG1 (8-oxo bridge guanine DNA glycosylase), STC1 (tin calsequestrin 1), CNDP1 (carnosine pepx 1 (metallopeptidase M20 family)), C10orf2 (karyomit(e) 10 open reading frame 2), MAML3mastermind-sample 3 (fruit bat), DKC1 (dyskeratosis congenital 11, dyskeratosis albumen), PAXIP1 (PAX interact (transcribing-activation domain) protein 1), CASK (calcium/calmodulin-dependency serineprotein kinase (MAGUK family)), MAPT (microtubule-associated proteins τ), SP1 (Sp1 transcription factor), POLG (polysaccharase (DNA orientation), γ), AFF2 (AF4/FMR2 family, the member 2), THBS1 (thrombospondin 1), TP53 (oncoprotein matter p53), ESR1 (estrogen receptor 1), CGGBP1 (CGG triplet repetitive sequence bindin 1), ABT1 (basic transcription incitant 1), KLK3 (kallikrein be correlated with peptase 3), PRNP (prion protein), JUN (jun oncogene), KCNN3 (in potassium/and small-conductance calcium-active channel, subfamily N, the member 3), BAX (BCL2 be correlated with X protein matter), FRAXA (rare, fra (X) is A (large testis disease, mental retardation) (q27.3) for fragile site, folic acid type), KBTBD10 (containing kelch tumor-necrosis factor glycoproteins and BTB (POZ) territory 10), MBNL1 (blind flesh-sample (fruit bat)), RAD51 (RAD51 homologue (RecA homologue, intestinal bacteria) (yeast saccharomyces cerevisiae)), NCOA3 (nuclear receptor co-activation albumen 3), ERDA1 (the expansion duplicate domain, CAG/CTG1), TSC1 (tuberous sclerosis 1), COMP (cartilage oligo-substrate protein matter), GCLC (Glutamate-cysteine ligase, catalytic subunit), RRAD (Ras be correlated with associated diabetes), MSH3 (mutS homologue 3 (intestinal bacteria)), DRD2 (Dopamine Receptors D2), CD44 (CD44 molecule (India's blood group)), CTCF (CCCTC-binding factor (zinc finger protein matter)), CCND1 (cyclin D1), CLSPN (button albumen homology thing (Africa xenopus)), MEF2A (myocyte enhancer factor 2), PTPRU (Protein Tyrosine Phosphatases, acceptor type, U), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), TRIM22 (containing three symbasis orders 22), WT1 (nephroblastoma 1), AHR (aromatic hydrocarbon receptor), GPX1 (Selenoperoxidase 1), TPMT (thio-purine S-methyltransgerase), NDP (fetal iritis syndrome sick (pseudoglioma)), ARX (without the relevant homology frame of awns), MUS81 (MUS81 endonuclease homologue (yeast saccharomyces cerevisiae)), TYR (tyrosine oxidase (eyelid albinism IA)), EGR1 (early growth replys 1), UNG (uracil-DNA glycosylase), NUMBL (numb homologue (fruit bat)-sample), FABP2 (fatty acid binding protein 2, intestines), EN2 (spination homology frame 2), CRYGC (crystallin, γ C), SRP14 (signal recognition particle 14kDa (homology AluRNA is in conjunction with albumen)), CRYGB (crystallin, γ B), PDCD1 (apoptosis 1), HOXA1 (homology frame A1), ATXN2L (ataxia albumen 2-sample), PMS2 (the PMS2 postmeiotic separates increases by 2 (yeast saccharomyces cerevisiaes)), GLA (tilactase, α), CBL (Cas-Br-M (mouse) ectropic retrovirus transforming sequence), FTH1 (ferritin, heavy polypeptide 1), IL12RB2 (interleukin 12 acceptor, β 2), OTX2 (just little tooth homology frame 2), HOXA5 (homology frame A5), POLG2 (polysaccharase (DNA orientation), γ 2, auxiliary subunit), DLX2 (tip is homology frame 2 still less), SIRPA (signals-modulating protein alpha), OTX1 (just little tooth homology frame 1), AHRR (aromatic hydrocarbon receptor supressor), MANF (midbrain astroglia cell-derived neurotrophic factor), TMEM158 (transmembrane protein 158 (gene/pseudogene)) and ENSG00000078687.

The exemplary protein relevant to the trinucleotide repeat expansion illness comprises HTT (Huntington protein), AR (androgen receptor), FXN (Fu Shi ataxia albumen), Atxn3 (ataxia albumen), Atxn1 (ataxia albumen), Atxn2 (ataxia albumen), Atxn7 (ataxia albumen), Atxn10 (ataxia albumen), DMPK (tonus muscular dystrophy-protein kinase), Atn1 (Dystroglycan 1), CBP (creb is in conjunction with albumen), VLDLR (extra-low density lipoprotein acceptor) and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research trinucleotide repeats sequence illness to study the effect of sudden change for animal and the development of trinucleotide repeats sequence illness and/or progress.

o. neurotransmission illness

The unrestricted example of neurotransmission illness comprises amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA) (comprising SCA2), the A Zihaimo disease, autism, , mental retardation, the special Cotard of thunder, fragile X mental retardation, dysthymia disorders, schizophrenia, bipolar illness, study, memory or behavior illness, anxiety, brain injury, ictal encephalopathic, Heng Dingdun disease (tarantism), mania, the antipsychotics malin syndrome, pain, Parkinson's disease, Parkinson's disease, tardive dyskinesia, myasthenia gravis, the fragment ataxia, kaliemia periodic paralysis, hypokalemia periodic paralysis, Lambert-Eaton syndrome, paramyotonia is congenital, the Rasmussen encephalitis, the disease that startles (hypermyotonia, stiff baby's syndrome) and poisonous effect, such as botulism, mycetism, organophosphate, snake venom (such as from coral snake (Taiwan bungarus fasciatus)).In one embodiment, method of the present invention can be used for producing wherein animal or the cell that the chromosome sequence of at least one and neurotransmission disease-related is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In each of above embodiment, can edit one or more chromosome sequences that are associated with the neurotransmission illness.The protein relevant to the neurotransmission illness or the control sequence empirical correlation based on protein or sequence and neurotransmission illness are usually selected.Neurotransmission illness related protein comprises the protein relevant to the seriousness of the existence of the susceptibility of development neurotransmission illness, neurotransmission illness, neurotransmission illness or its any combination.For example, with respect to the colony that there is no the neurotransmission illness, in the colony of suffering from the neurotransmission illness, production rate or the circulation composition of neurotransmission illness related protein can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of the protein relevant to the neurotransmission illness comprises SST (Somat), NOS1 (nitric oxide synthase 1 (neuron)), ADRA2A (adrenaline, α-2A-, acceptor), ADRA2C (adrenaline, α-2C-, acceptor), TACR1 (tachykinin receptor 1), HTR2C (serotonin (thrombocytin) acceptor 2C), SLC1A2 (solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 2), GRM5 (glutamate receptor, metabotropic 5), GRM2 (glutamate receptor, metabotropic 2), GABRG3 (GABA (GABA) A acceptor, γ 3), CACNA1B (calcium channel, voltage-dependence, N type, α 1B subunit), NOS2 (nitric oxide synthase 2 can be induced), SLC6A5 (solute carrier family 6 (neurotransmitter transport protein, Gly), the member 5), GABRG1 (GABA (GABA) A acceptor, γ 1), NOS3 (nitric oxide synthase 3 (endothelial cell)), GRM3 (glutamate receptor, metabotropic 3), HTR6 (serotonin (thrombocytin) acceptor 6), SLC1A3 (solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 3), GRM7 (glutamate receptor, metabotropic 7), HRH1 (histamine H_1 receptor), SLC1A1 (solute carrier family 1 (neuron/epithelium high-affinity glutamate transporter, system XAG), the member 1), GRM4 (glutamate receptor, metabotropic 4), GLUD2 (glutamte dehydrogenase 2), ADRA2B (adrenaline, α-2B-, acceptor), SLC1A6 (solute carrier family 1 (high-affinity aspartic acid/glutamate transporter), the member 6), GRM6 (glutamate receptor, metabotropic 6), SLC1A7 (solute carrier family 1 (glutamate transporter), the member 7), SLC6A11 (solute carrier family 6 (neurotransmitter transport protein, GABA), the member 11), CACNA1A (calcium channel, voltage-dependence, P/Q type, α 1A subunit), CACNA1G (calcium channel, voltage-dependence, T type, α 1G subunit), GRM1 (glutamate receptor, metabotropic 1), CACNA1H (calcium channel, voltage-dependence, T type, α 1H subunit), GRM8 (glutamate receptor, metabotropic 8), CHRNA3 (α 3 for cholinergic recepter, nicotine), P2RY2 (purinoceptor P2Y, G-albumen coupling, 2), TRPV6 (member 6 for transient receptor potential cationic channel protein, subfamily V), CACNA1E (calcium channel, voltage-dependence, R type, α 1E subunit), ACCN1 (amiloride-responsive cationic channel 1, neuron), CACNA1I (calcium channel, voltage-dependence, T type, α 1I subunit), GABARAP (GABA (A) receptor associated protein white matter), P2RY1 (purinoceptor P2Y, G-albumen coupling, 1), P2RY6 (pyrimidine energy acceptor P2Y, G-albumen coupling, 6), RPH3A (Rab rabphilin Rab 3A homologue (mouse)), HDC (histidine decarboxylase), P2RY14 (purinergic receptor P2Y, G-albumen coupling, 14), P2RY4 (pyrimidine energy acceptor P2Y, G-albumen coupling, 4), P2RY10 (purinergic receptor P2Y, G-albumen coupling, 10), SLC28A3 (solute carrier family 28 (sodium-coupling nucleoside transporter), the member 3), NOSTRIN (the nitric oxide synthase transportation factor), P2RY13 (purinergic receptor P2Y, G-albumen coupling, 13), P2RY8 (purinergic receptor P2Y, G-albumen coupling, 8), P2RY11 (purinergic receptor P2Y, G-albumen coupling, 11), SLC6A3 (solute carrier family 6 (neurotransmitter transport protein, dopamine), the member 3), HTR3A (serotonin (thrombocytin) acceptor 3A), DRD2 (dopamine receptor D2), HTR2A (serotonin (thrombocytin) acceptor 2A), TH (tyrosine hydroxylase), CNR1 (hemp component receptor 1 (brain)), VIP (vasoactive intestinal peptide), NPY (neuropeptide tyrosine), GAL (galanin prepropeptide), TAC1 (tachykinin, precursor 1), SYP (synaptobrevin), SLC6A4 (solute carrier family 6 (neurotransmitter transport protein, thrombocytin), the member 4), DBH (dopamine β-hydroxylase (dopamine β-monooxygenase)), DRD3 (dopamine receptor D3), NR3C1 (nuclear receptor subunit family 3, group C, member 1 (GCR)), HTR1B (serotonin (thrombocytin) acceptor 1B), GABBR1 (GABA (GABA) B acceptor, 1), CALCA (falling blood calcium albumen related polypeptide α), CRH (corticotropin releasing hormone), HTR1A (serotonin (thrombocytin) acceptor 1A), TACR2 (tachykinin receptor 2), COMT (catechol O-methyltransferase), GRIN2B (glutamate receptor, ionic, N-methyl D-Asp 2B), GRIN2A (glutamate receptor, ionic, N-methyl D-Asp 2), PRL (lactogen), ACHE (acetylcholinesterase (Yt blood group)), ADRB2 (adrenergic, β-2-, acceptor, surface), ACE (tonin (peptidyl-dipeptidase A) 1), SNAP25 (SNAP matter, 25kDa), GABRA5 (GABA (GABA) A acceptor, α 5), MECP2 (methyl CpG is in conjunction with albumen 2 (Rett syndrome)), BCHE (BuCh lipase), ADRB1 (adrenaline, β-1-, acceptor), GABRA1 (GABA (GABA) A acceptor, α 1), GCH1 (GTP cyclization hydrolase 1), DDC (DOP Adecarboxylase (aromatic l-amino acid decarboxylase)), MAOB (MAO-B), DRD5 (dopamine receptor D5), GABRE (GABA (GABA) A acceptor, ε), SLC6A2 (solute carrier family 6 (neurotransmitter transport protein, norepinephrine), the member 2), GABRR2 (GABA (GABA) acceptor, rho2), SV2A (synaptic membrane bubble gum albumen 2A), GABRR1 (GABA (GABA) acceptor, rho1), GHRH (growth hormone releasing hormone), CCK (CCK), PDYN (prodynorphin), SLC6A9 (solute carrier family 6 (neurotransmitter transport protein, Gly), the member 9), KCND1 (member 1 for potassium voltage-gated channel, the Shal subfamily of being correlated with), SRK (serine racemase enzyme), DYT10 (tension force abnormal 10), MAPT (microtubule-associated proteins τ), APP (amyloid (A4) precursor protein), CTSB (cathepsin B), ADA (adenosine deaminase), AKT1 (v-akt mouse thymoma viral oncogene homologue 1), GRIN1 (glutamate receptor, ionic, N-methyl D-Asp 1), BDNF (neurotrophic factor derived from brain), HMOX1 (Heme oxygenase (unlinking) 1), OPRM1 (Opioid Receptors, μ 1), GRIN2C (glutamate receptor, ionic, N-methyl D-Asp 2C), GRIA1 (glutamate receptor, ionic, AMPA1), GABRA6 (GABA (GABA) A acceptor, α 6), FOS (FBJ mouse osteosarcoma virus oncogene homologue), GABRG2 (GABA (GABA) A acceptor, γ 2), GABRB3 (GABA (GABA) A acceptor, β 3), OPRK1 (Opioid Receptors, κ 1), GABRB2 (GABA (GABA) A acceptor, β 2), GABRD (GABA (GABA) A acceptor, δ), ALDH5A1 (aldehyde dehydrogenase 5 families, member A1), GAD1 (glutamate decarboxylase 1 (brain, 67kDa)), NSF (N-second maleimide-sensitive factor), GRIN2D (glutamate receptor, ionic, N-methyl D-Asp 2D), ADORA1 (adenosine A 1 receptor), GABRA2 (GABA (GABA) A acceptor, α 2), GLRA1 (Gly acceptor, α 1), CHRM3 (cholinergic recepter, muscarine 3), CHAT (cholinacetyltranslase), KNG1 (Prokineticin 1), HMOX2 (Heme oxygenase (unlinking) 2), DRD4 (dopamine receptor D4), MAOA (MAOA), CHRM2 (cholinergic recepter, muscarine 2), ADORA2A (Adenosine A2a acceptor), STXBP1 (syntaxin Binding Protein 1), GABRA3 (GABA (GABA) A acceptor, α 3), TPH1 (TPH 1), HCRTR1 (low albumen (orexin) acceptor 1 of secreting), HCRTR2 (low albumen (orexin) acceptor 2 of secreting), CHRM1 (cholinergic recepter, muscarine 1), FOLH1 (folic acid hydrolase (Prostato-specific membrane antigen) 1), AANAT (aralkylamine N-acetyl-transferase), INS (insulin), NR3C2 (member 2 for nuclear receptor subunit family 3, group C), FAAH (fatty acid amide hydrolase), GALR2 (galanin receptors 2), ADCYAP1 (adenylate cyclase activating polypeptide 1 (hypophysis)), PPP1R1B (protein phosphatase 1, regulation and control (inhibiting factor) 1B of subunit), HOMER1 (homer homologue 1 (fruit bat)), ADCY10 (adenyl cyclase 10 (solvable)), PSEN2 (presenilin 2 (A Zihaimo disease 4)), UBE3A (ubiquitin protein matter ligase E3A), SOD1 (superoxide dismutase 1, solvable), LYN (v-yes-1 Yamaguchi sarcoma virus Related oncogene homologue), TSC2 (tuberous sclerosis 2), PRKCA (protein kinase C, α), PPARG (peroxisome proliferator-activated receptor γ), ESR1 (ERs 1), NTRK1 (neurotrophy EGFR-TK, acceptor, Class1), EGFR (EGF-R ELISA (EBL virus (v-erb-b) oncogene homologue, birds)), S100B (S100 calbindin B), NTRK3 (neurotrophy EGFR-TK, acceptor, type 3), PLCG2 (phospholipase C, γ 2 (phosphatidylinositols-specificity)), NTRK2 (neurotrophy EGFR-TK, acceptor, type 2), DNMT1 (DNA (cytimidine-5-)-transmethylase 1), EGF (EGF (β-anthelone)), GRIA3 (glutamate receptor, iodine nutrition, AMPA3), NCAM1 (N-CAM 1), CDKN1A (cyclin-dependent kinase enzyme inhibition factor 1A (p21, Cip1)), BCL2L1 (BCL2-sample 1), TP53 (oncoprotein matter p53), CASP9 (caspase 9, Apoptosis be correlated with cysteine peptase), CCKBR (CCK B acceptor), PARK2 (Parkinson's disease (autosomal recessive, childhood) 2, Parkin), ADRA1B (adrenaline, α-1B-, acceptor), CASP3 (Caspase-3, Apoptosis be correlated with cysteine peptase), PRNP (prion protein), CRHR1 (corticotropin releasing hormone acceptor 1), L1CAM (L1 cell adhesion molecule), NGFR (trk C (TNFR Superfamily, the member 16)), CREB1 (cAMP response element Binding Protein 1), PLCG1 (phospholipase C, γ 1), CAV1 (caveolin-1, caveolae protein, 22kDa), ABCC8 (member 8 for ATP-binding cassette, subfamily C (CFTR/MRP)), ACTN2 (actinine, α 2), GRIA2 (glutamate receptor, ionic, AMPA2), HPRT1 (hypoxanthine phosphoribosyltransferase 1), SYN1 (synapsin), CSNK2A1 (casein kinase 2, α 1 polypeptide), GRIK1 (glutamate receptor, ionic, kainic acid 1), ABCB1 (member 1 for ATP-binding cassette, subfamily B (MDR/TAP)), AVPR2 (arginine vasopressin acceptor 2), HTR4 (serotonin (thrombocytin) acceptor 4), C3 (complement component 3), AGT (hypertensinogen (member 8 for serpin peptide enzyme inhibition factor, clade A)), AGTR1 (angiotensin-ii receptor, Class1), CDK5 (cyclin-dependant kinase 5), LRP1 (low density lipoprotein receptor associated protein white matter 1), ARRB2 (CKIs, β 2), PLD2 (phospholipase D 2), OPRD1 (Opioid Receptors, δ 1), GNB3 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 3), PIK3CG (phosphoinositide-3-kinases, catalysis, γ polypeptide), APAF1 (apoptosis peptase activity factor 1), SSTR2 (amicine acceptor 2), IL2 (interleukin 2), ADORA3 (adenosine A 3 receptor), ADRA1A (adrenaline, α-1-, acceptor), HTR7 (7 (adenyl cyclase-couplings) of serotonin (thrombocytin) acceptor), ADRBK2 (adrenergic, β, receptor kinase 2), ALOX5 (arachidonic acid 5-LOX), NPR1 (natriuratic peptide receptor A/ guanylate cyclase A (atrial natriuretic peptide acceptor A)), AVPR1A (arginine vasopressin acceptor 1A), CHRNB1 (cholinergic recepter, nicotine, β 1 (muscle)), SET (SET core oncogene), PAH (PAH), POMC (POMC), LEPR (leptin receptor), SDC2 (syndecan 2), VIPR1 (vip receptor 1), DBI (stable in conjunction with inhibiting factor (GABA acceptor modulation factor, acyl group-coacetylase is in conjunction with albumen)), NPY1R (neuropeptide Y receptor Y1), NPR2 (natriuratic peptide receptor B/ guanylate cyclase B (atrial natriuretic peptide acceptor B)), CNR2 (hemp component receptor 2 (macrophage)), LEP (leptin), CCKAR (cholecystokinin receptor), GLRB (the Gly acceptor, β), KCNQ2 (member 2 for potassium voltage-gated channel, KQT-sample subfamily), CHRNA2 (cholinergic recepter, nicotine, α 2 (neuron)), BDKRB2 (bradykinin receptor B2), CHRNA1 (cholinergic recepter, nicotine, α 1 (muscle)), CHRND (cholinergic recepter, nicotine, δ), CHRNA7 (α 7 for cholinergic recepter, nicotine), PLD1 (Phospholipase D1, phosphatid ylcholine-specificity), NRXN1 (neuronin 1), NRP1 (neuropilin 1), DLG3 (discs, large homologue 3 (fruit bat)), GNAQ (guanine-nucleotide-binding protein (G albumen), q polypeptide), DRD1 (dopamine receptor D1), PRKG1 (protein kinase, cGMP-dependence, type I), CNTNAP2 (contactin related protein-sample 2), EDN3 (Endothelin 3), ABAT (4-Aminobutanoicacid transaminase), TDO2 (tryptophan 2,3-dioxygenase), NEUROD1 (neurogenicity differentiation 1), CHRNE (cholinergic recepter, nicotine, ε), CHRNB2 (cholinergic recepter, nicotine, β 2 (neuron)), CHRNB3 (β 3 for cholinergic recepter, nicotine), HTR1D (serotonin (thrombocytin) acceptor 1D), ADRA1D (adrenaline, α-1D-, acceptor), HTR2B (serotonin (thrombocytin) acceptor 2B), GRIK3 (glutamate receptor, ionic, kainic acid 3), NPY2R (neuropeptide Y receptor Y2), GRIK5 (glutamate receptor, ionic, kainic acid 5), GRIA4 (glutamate receptor, iodine nutrition, AMPA4), EDN1 (Endothelin 1), PRLR (lactogen acceptor), GABRB1 (GABA (GABA) A acceptor, β 1), GARS (Glycyl-tRNA synthetase), GRIK2 (glutamate receptor, ionic, kainic acid 2), ALOX12 (arachidonic acid 12-LOX), GAD2 (glutamate decarboxylase 2 (pancreas islet and brain, 65kDa)), LHCGR (luteinizing hormone(LH/chorionic gonadotropin acceptor), SHMT1 (serine hydroxymethylase 1 (solvable)), PDXK (pyridoxal (pyridoxol, vitamin B6) kinases), LIF (LIF ELISA (cholinergic differentiation factor)), PLCD1 (phospholipase C, δ 1), NTF3 (NT3), NFE2L2 (nuclear factor (granulophilocyte-derivative 2)-sample 2), PLCB4 (phospholipase C, β 4), GNRHR (gonadotropic hormone-releasing hormone receptor), NLGN1 (the neural albumen 1 that connects), PPP2R4 (protein phosphatase 2 activity factors, regulation and control subunit 4), SSTR3 (amicine acceptor 3), CRHR2 (corticotropin releasing hormone acceptor 2), NGF (nerve growth factor (beta polypeptides)), NRCAM (neuronal cell adhesion molecule), NRXN3 (neuronin 3), GNRH1 (gonadotropic hormone-releasing hormone 1 (leuteinization-releasing hormone)), TRHR (thyrotropic hormone-releasing hormone receptor), ARRB1 (CKIs, β 1), INPP1 (inositol polyphosphoric acids-1-phosphatase), PTN (PTN), PSMD10 (proteasome (precursor, huge protein factor) 26S subunit, non ATP enzyne, 10), DLG1 (discs, large homologue 1 (fruit bat)), PSMB8 (proteasome (precursor, huge protein factor) subunit, beta type, 8 (large multifunctional polypeptide enzymes 7)), CYCS (cytochrome c, body cell), ADORA2B (adenosine A 2b acceptor), ADRB3 (adrenaline, β-3-, acceptor), CHGA (Chromogranin A (parathyroid secretory protein 1)), ADM (adrenomedulin), GABRP (GABA (GABA) A acceptor, π), GLRA2 (Gly acceptor, α 2), PRKG2 (protein kinase, cGMP-dependence, Type II), GLS (glutaminase), TACR3 (tachykinin receptor 3), ALDH7A1 (aldehyde dehydrogenase 7 families, member A1), GABBR2 (GABA (GABA) B acceptor, 2), GDNF (glial cell derived neurotrophic factor), CNTFR (CNTF acceptor), CNTN2 (contactin 2 (aixs cylinder)), TOR1A (the anti-protein family 1 of turning round, member A (the anti-albumen of turning round)), CNTN1 (contactin 1), CAMK1 (calcium/calmodulin-deopendent protein kinase I), NPPB (natriuretic peptide precursor B), OXTR (ocytocin receptor), OSM (oncostatin M), VIPR2 (vip receptor 2), CHRNB4 (β 4 for cholinergic recepter, nicotine), CHRNA5 (α 5 for cholinergic recepter, nicotine), AVP (arginine vasopressin), RELN (reeling albumen), GRLF1 (glucocorticoid receptor dna binding factor 1), NPR3 (natriuratic peptide receptor C/ guanylate cyclase C (atrial natriuretic peptide acceptor C)), GRIK4 (glutamate receptor, ionic, kainic acid 4), KISS1 (KiSS-1 transfer-inhibiting factor), HTR5A (serotonin (thrombocytin) acceptor 5), ADCYAP1R1 (adenylate cyclase activating polypeptide 1 (hypophysis) acceptor type I), GABRA4 (GABA (GABA) A acceptor, α 4), GLRA3 (Gly acceptor, α 3), INHBA (inhibin, β A), DLG2 (discs, large homologue 2 (fruit bat)), PPYR1 (pancreas polypeptide receptor 1), SSTR4 (amicine acceptor 4), NPPA (natriuretic peptide precursor A), SNAP23 (SNAP matter, 23kDa), AKAP9 (kinases (PRKA) anchorin matter (yotiao) 9), NRXN2 (neuronin 2), FHL2 (4 half LIM domains 2), TJP1 (claudin-3 white matter 1 (zonuls occludens 1)), NRG1 (neuregulin 1), CAMK4 (calcium/calmodulin-deopendent protein kinase IV), CAV3 (caveolin 3), VAMP2 (film bubble related membrane protein matter 2 (synaptobrevin 2)), GALR1 (galanin receptors 1), GHRHR (ghrh receptor), HTR1E (serotonin (thrombocytin) acceptor 1E), PENK (proenkephalin), HTT (Huntington protein), HOXA1 (homology frame A1), NPY5R (neuropeptide Y receptor Y5), UNC119 (unc-119 homologue (Caenorhabditis elegans)), TAT (TAT), CNTF (CNTF), SHMT2 (serine hydroxymethylase 2 (mitochondria)), ENTPD1 (the outer triphosphoric acid diphosphonic acid hydrolase 1 of nucleosides), GRIP1 (glutamate receptor Binding Protein 1), GRP (gastrin-release peptide), NCAM2 (N-CAM 2), SSTR1 (amicine acceptor 1), CLTB (clathrin, light chain (Lcb)), DAO (D-AAO), QDPR (quinoid dihydropteridine reductase), PYY (PYY), PNMT (phenylethanol amine N-transmethylase), NTSR1 (neurotensin receptor 1 (high-affinity)), NTS (neurotensin), HCRT (low albumen (appetite albumen) the neuropeptide precursor of secreting), SNAP29 (SNAP matter, 29kDa), SNAP91 (SNAP matter, 91kDa homologue (mouse)), MADD (MAP-kinase activator Death Domain), IDO1 (IDO 1), TPH2 (TPH 2), TAC3 (tachykinin 3), GRIN3A (glutamate receptor, ionic, N-methyl-D-aspartate 3A), REN (feritin), GALR3 (galanin receptors 3), MAGI2 (film be correlated with guanylate kinase, contain WW and pdz domain 2), KCNJ9 (member 9 for potassium inward rectification passage, subfamily J), BDKRB1 (bradykinin receptor B1), CHRNA6 (α 6 for cholinergic recepter, nicotine), CHRM5 (cholinergic recepter, muscarine 5), CHRNG (cholinergic recepter, nicotine, γ), SLC6A1 (solute carrier family 6 (neurotransmitter transport protein, GABA), the member 1), ENTPD2 (the outer triphosphoric acid diphosphonic acid hydrolase 2 of nucleosides), CALCB (falling blood calcium albumen related polypeptide β), SHBG (sex hormone-haptoglobin), SERPINA6 (member 6 for serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin)), NRG2 (neuregulin 2), PNOC (front former pain albumen), (N-second maleimide-sensitive factor connects protein to NAPA, α), PICK1 (with the interactional protein of PRKCA1), PLCD4 (phospholipase C, δ 4), GCDH (glutaryl-CoA dehydrogenase), NLGN2 (the neural albumen 2 that connects), NBEA (neural long-pending albumen), ATP10A (ATP enzyme, class V, Class1 0), RAPGEF4 (Rap guanine nucleotide exchange factor (GEF) 4), UCN (Urocortin), PCSK6 (proteinogen invertase subtilopeptidase A/kexin type 6), HTR1F (serotonin (thrombocytin) acceptor 1F), SGCB (inose, β (43kDa dystrophin associated glycoprotein)), GABRQ (GABA (GABA) acceptor, θ), GHRL (Leptin/obestatin prepropeptide), NCALD (neurocalcin δ), NEUROD2 (neurogenicity differentiation 2), DPEP1 (dipeptidase 1 (kidney)), SLC1A4 (solute carrier family 1 (glutamic acid/neutral amino acid transporter albumen), the member 4), DNM3 (dynamin 3), SLC6A12 (solute carrier family 6 (neurotransmitter transport protein, betaine/GABA), the member 12), SLC6A6 (solute carrier family 6 (neurotransmitter transport protein, taurine), the member 6), YME1L1 (YME1-sample 1 (saccharomyces cerevisiae)), VSNL1 (visinin-sample 1), SLC17A7 (solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter), the member 7), HOMER2 (homer homologue 2 (fruit bat)), SYT7 (synaptotagmin VII), TFIP11 (cluster protein interactive protein 11), GMFB (glial maturation factor, β), PREB (combination of lactogen controlling element), NTSR2 (neurotensin acceptor 2), NTF4 (NT4), PPP1R9B (protein phosphatase 1, regulation and control (inhibiting factor) subunit 9 B), DISC1 (schizophrenia damaged 1), NRG3 (neuregulin 3), OXT (oxytocins, prepropeptide), TRH (thyrotropic hormone-releasing hormone), NISCH (nischarin), CRHBP (corticotropin releasing hormone is in conjunction with albumen), SLC6A13 (solute carrier family 6 (neurotransmitter transport protein, GABA), the member 13), NPPC (natriuretic peptide precursor C), CNTN3 (contactin 3 (plasmacytoma is relevant)), KAT5 (K (lysine) transacetylase 5), CNTN6 (contactin 6), KIAA0101 (KIAA0101), PANX1 (pannexin 1), CTSL1 (cathepsin L 1), EARS2 (Glutamyl-tRNA synthetase 2, mitochondria (supposition)), CRIPT (rich cysteine-PDZ-is in conjunction with albumen), CORT (cortisol stabilize proteins), DLGAP4 (discs, large (fruit bat) homologue related protein 4), ASTN2 (star actin 2), HTR3B (serotonin (thrombocytin) acceptor 3B), PMCH (front melanin-concentrated hormone), TSPO (transposable element protein (18kDa)), GDF2 (growth and differentiation factor 2), CNTNAP1 (contactin related protein 1), GNRH2 (gonadotropic hormone-releasing hormone 2), AUTS2 (self-closing disease neurological susceptibility candidate 2), SV2C (synaptic membrane bubble gum albumen 2C), CARTPT (cart prepropeptide), NSUN4 (NOP2/ sun territory family, the member 4), CNTN5 (contactin 5), NEUROD4 (neurogenicity differentiation 4), NEUROG1 (neural element 1), SLTM (SAFB-sample, transcription regulaton factor), GNRHR2 (gonadotropic hormone-releasing hormone (type 2) acceptor 2), ASTN1 (star actin 1), SLC22A18 (solute carrier family 22, the member 18), SLC17A6 (solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter), the member 6), GABRR3 (GABA (GABA) acceptor, rho3), DAOA (D-AAO activity factor), ENSG00000123384 and NOS2P1 (nitric oxide synthase 2 pseudogenes 1).

Exemplary neurotransmission related protein comprises 5-HTT (serotonin transporter), SLC6A4 (solute carrier family 6, the member 4), COMT (catechol-O-methyltransferase), DRD1A (Dopamine Receptors D1A), SLC6A3 (solute carrier family 6, the member 3), DAO1 (D-AAO), DTNBP1 (the different protein-binding protein 1 that connects) and its any combination.

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in research neurotransmission illness to study the effect of sudden change for animal and the development of neurotransmission illness and/or progress.

ii. pharmacology model

Method of the present invention can be used for producing animal or the cell that can be used as pharmacology model.This type of pharmacology model can be pharmacokinetic model or pharmacodynamics model.For example, in one embodiment, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in one or more nucleotide sequences relevant to the pharmaceutically active compound metabolism.This type of animal or cell can be used for studying the effect of nucleotide sequence for medical compounds.

In addition, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in the disease-related sequence.This type of animal or cell can be used for assessing the effect of therapeutical agent in disease progression or progress.For example, the effect of therapeutical agent can be measured in " humanization " animal, so that the Information Availability therefrom obtained is in the effect of prediction medicament in human body.Usually, described method comprises that making to comprise at least one coding contacts with therapeutical agent with the genetically modified animal through editor's chromosome sequence of disease-associated protein, and the result that will select parameter result of acquisition when the wild-type animal is contacted with identical medicament compares.The unrestricted example of suitable disease is included in those diseases of listing in part II (a) i.

Also provide the assessment medicament comprising the method for effect through the isolated cell of editor chromosome sequence in of at least one coding with disease-associated protein, and use the lysate of this type of cell cell of genetically modified animal disclosed herein (or derive from) to assess the method for pharmacy effect.For example, can determine the effect of specified protein in the metabolism of particular agent with disease-related by these class methods.Similarly, can easily determine substrate specificity and pharmacokinetic parameter by these class methods.Those skilled in the art are familiar with suitable test and/or program.

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to toxicology is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).Relate to absorption, distribution, metabolism and excretion (ADME) and toxicologic any chromosome sequence or protein and can be used for purpose of the present invention.ADME and toxicology the related protein empirical correlation based on protein and ADME and toxicology associated conditions are usually selected.For example, with respect to the colony that there is no ADME and toxicology illness, in the colony of suffering from ADME and toxicology illness, production rate or the circulation composition of ADME and toxicology related protein can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The exemplary unrestricted example that relates to ADME and toxicologic chromosome sequence or protein can be selected from Oct 1, Oct 2, Hfe2, Ppar (α) MDR1a (abc transport albumin A BCB1a), MDR1b (ABCB1b), BCRP (ABCC1), MRP1 (ABCG2), MRP2 (ABCC2, cMOAT) and combination thereof.

Another aspect of the present disclosure comprises the method for assessing pharmacy effect.Suitable medicament includes, without being limited to pharmacy activity component, medicine, foodstuff additive, agricultural chemicals, weedicide, toxin, industrial chemicals, household chemicals and other environmental chemicals.For example, the effect of medicament can be measured in " humanization " genetically modified animal, so that the Information Availability therefrom obtained is in the effect of prediction medicament in human body.Usually, described method comprise make to comprise relate to ADME with toxicologic at least one through the inactivation chromosome sequence, with the genetically modified animal of at least one chromosomal integration sequence that coding relates to ADME and toxicologic ortholog human protein, with medicament, contact, and the result that will select parameter result of acquisition when the wild-type animal is contacted with identical medicament compares.Selected parameter includes but not limited to the elimination factor of (a) medicament or its meta-bolites; (b) cyclical level of medicament or its meta-bolites; (c) bioavailability of medicament or its meta-bolites; (d) metabolic rate of medicament or its meta-bolites; (e) clearance rate of medicament or its meta-bolites; (f) toxicity of medicament or its meta-bolites; (g) effect of medicament or its meta-bolites; (h) disposal of medicament or its meta-bolites; (i) medicament or its meta-bolites act on outward the liver of metabolic rate and removing.

Also provide the assessment medicament to relate to ADME and the toxicologic method of effect in the isolated cell of editor's chromosome sequence comprising at least one, and use the lysate of this type of cell cell of genetically modified animal disclosed herein (or derive from) to assess the method for pharmacy effect.For example, can determine ADME and the effect of toxicologic specified protein in the particular agent metabolism of relating to by these class methods.Similarly, can easily determine substrate specificity and pharmacokinetic parameter by these class methods.Those skilled in the art are familiar with suitable test and/or program.

In relating to medicine ADME and toxicologic target protein, abc transport albumen is arranged, claim again to flow out translocator matter.Therefore, for example, the genetically modified animal through editor's chromosome sequence that contains as described herein coding abc transport albumen comprises bioactive agent and its distribution of research, effect, metabolism and/or the toxicity of medicine applicable to screening.Predictability that these screening methods are particularly useful for improving assessment medicine is as described herein for example, as the behavior in the genetically modified animal (genetic modification rat) of human model.Therefore, the disclosure also provides the method for the ADME overview of assessment medicine in genetically modified animal, as the part of drug screening or evaluation process.Candidate therapeutic agent, drug candidate can be administered to and have that target gene knocks out and/or expressed genetically modified genetically modified animal, and this measure can realize by using ZFN.Knock out or knock in gene relevant at least one aspect of medicine ADME overview or toxicology and/or metabolism, and can derive from mouse, rat or human genome.

For example, the method of the target of filler test compound can be utilized wherein such as any one or more in the abc transport albumen of Mdr1a, Mdr1b, PXR, BCRP, MRP1 or MRP2 and be knocked out, thereby suppresses or eliminate the genetically modified animal of the cross-film transportation that knocks out protein mediation.This type of animal can be exposed to the test compounds that doubtful inhibition knocks out the translocator activity of protein.Compound suppresses transportation in genetically modified animal can be with any mensuration the in the test of many Routine Test Labs and technology, and suppresses to transport and can compare with the observations in wild-type animal by the same test compound treatment.The difference of the effect of test compounds in two animals can be indicated the target of test compounds.In addition, suppress some ADME characteristic that one or more albumen of abc transport such as Mdr1a, Mdr1b, PXR, BCRP, MRP1 or MRP2 can improve candidate therapeutic agent.For example, the absorption of candidate therapeutic compound or effect can be improved by knocking out one or more albumen of abc transport such as Mdr1a, Mdr1b, PXR, BCRP, MRP1 or MRP2 expression in particular organization.Therefore, should understand genetically modified animal and cell as described herein, the genetically modified animal and the cell that for example comprise the genetic modification of one or more abc transport albumen can advantageously be used in many methods of the ADME that assesses the candidate therapeutic compound and toxicology characteristics, with the target of characterization test compound, or identify ADME characteristics and the toxicologic method that wherein can improve candidate compound.

Can be easy to recognize that need urgently to calculate to a nicety medicine and environmental chemicals can affect larger crowd.Genetically modified animal as herein described, embryo, cell and clone can be used for analyzing various compounds and can how to interact with biosystem.Genetically modified cell and clone can be for example for control biosystem many oneself know complicacy in order to improve the mensuration system based on cell, measure the predictive ability of systems such as those of the molecular entity for assessment of new and possible drug-drug interactions.More particularly, generally acknowledged that biosystem comprises the various ingredients reacted for being exposed to new potential hazardous compound usually.

" ADMET system " has been described to comprise five components.But the first component is those biosystems that signaling drug metabolism system starts when multilated, and can comprise that stress reaction and DNA repair approach.Once the drug metabolism system is activated, " foreign matter sensor " just monitors needs the exogenous molecule of removing.The foreign matter sensor detects the exogenous molecule cascade that then activated gene is induced, and this enzyme that makes to be responsible for the exogenous molecules metabolism is more easily removed form is raised.The enzyme of the 3rd ADMET component comprises the Phase I enzyme, and it comprises at least three class oxydase, and wherein a most on record class is the Cytochrome P450s class.Cytopigment 450 enzymes partly are added into potential toxin in order to make the toxin inactivation by reactive hydroxyl usually, and make toxin have more polarity (solubility).The 4th component of ADMET system comprises at least seven fermentoids, and it further changes the product of Phase I enzyme modification.Generally, these enzymes are desmoenzymes, and it adds hydrophilic parts so that have now water-solublely more greatly in the ADMET system through the xenobiontics of oxidation, and can be collected easily, and excrete by urine or bile.Last component relates to the translocator system of translocator (as abc transport albumen), and it serves as the molecular pump of promotion xenobiontics from a movement of tissue to another tissue.Translocator is responsible for medicine is moved into to cell, emigrated cells or through cell.

Every kind of component of ADMET system has its oneself a set of substrate structure specificity, and this must be considered by any mensuration.Make predictability become one more the situation of hang-up be that there is the series of genes polymorphism in the key members for each class in five class components in colony, and these situations can greatly affect the activity to specific heteroplasia chemical structure.The pharmacogenomics field of development has solved the challenge brought by this heritable variation.In addition, the gender difference that how different components of known heteroplasia system reacts also work in the variation of drug metabolism.

Therefore, about the toxicology problem of clinical effectiveness or the chemical of medicine, genetically modified animal as herein described, cell and particularly clone will can be used as having the basis of the mensuration based on cell of the predictive ability through improving.Clearly expect that one group of clone can be used for such purpose.For example, can produce the mensuration based on cell, the metabolism of medical compounds or the target tissue of toxicity wherein may occur in its representative.At present, usually in the transformation cell lines from target tissue, carry out standard test, and it have some consistent functional performances.In order to produce the better mensuration based on cell that even more can represent state of nature, the multipotential stem cell of genetic modification and differentiation can be used for replacing the immortality cell component.In other words, genetically modified cell system can be used in being applicable to the mensuration based on cell with higher predictive power of format high throughput, high-content screening compound.

Therefore, the disclosure contains the genetic modification by the ZFN mediation of the gene relevant to each part of heteroplasia metabolic mechanism.What these modifications comprised the reporter gene label knocks out, knocks in, introduces specific sudden change that oneself knows that impact is active or the combination of these modifications.For example, genetically modified cell and clone can be for generation of the some groups of translocators with tissue specificity, sex-specific and/or reflection colony; The some groups of foreign matter sensor determinations based on cell that there is tissue specificity and reflect colony on function; The mensuration of inducing with the gene activation of measuring the different pharmaceutical metabolic components and obvious toxicology reaction (as genetoxic, cardiac toxic and apoptosis).

According to the disclosure, can set up tissue specificity clone, it is modified to separate the reaction for indivedual chemical entities of specific translocator activity and prediction colony.For example, ZFN can be used for for example in Intestine Epithelial Cell Lines, producing transporter gene and knock out, in order to important common polymorphisms is introduced in Intestine Epithelial Cell Lines, and represent in the clone of liver, hemato encephalic barrier (brain microvasculature endotheliocyte), kidney and any relevant tissue specificity clone.Some groups of clone can comprise (as MDR-1, MRP1,2,3,4,6, the BCRP) intestinal epithelial cells (Caco2 or BBe1) that knocks out that has indivedual translocators, the intestinal epithelial cells that knocks out combination (for example BCRP and MRP2, MDR-1 and MRP2, MRP-3 and MRP1) with the impact for isolating indivedual translocators, and idle running fortune albuminous cell system (all 7 kinds of translocators are knocked).Some groups of intestinal epithelial cellss may comprise that OATP-2B1, PEPT-1 and OCT-N2 knock out.Can produce some groups of intestinal epithelial cellss, it comprises the general polymorphism of the main transporter gene that affects medicament transport and paid close attention to by the pharmaceuticals researcher.

Oneself knows that the three kinds of foreign matter sensors (PXR, AHR and CAR) in human body have the overlapping specificity that xenobiontics is reacted.Know that what degree which foreign matter sensor is activated and be activated to by any specific chemical compound is also to understand a significant consideration of drug reaction and drug interaction.The some groups of cells of inducing that produce report foreign matter sensor can be described these specificitys.Further modified cells will allow Prediction with important polymorphism on the function that solves the foreign matter sensor.ZFN can be used for producing and knock out clone with translocator as above and similarly knock out clone, and is created in the reporter gene clone that different foreign matter sensors are induced the different fluorescence proteins of rear expression.For example, can set up clone, if wherein induce PXR just to express green FP, if induce the CAR activity just to express red FP, if induce AhR just to express blue FP.All cells system can, in the clone of related organization's type, build in intestines, liver, kidney, brain and heart.Can produce the tissue that representative relates to drug toxicity and extent of metabolism maximum, and the some groups of cells that wherein each foreign matter sensor (CAR, PXR, AhR) all is knocked.Also can be created in each the rear clone that produces fluorescence protein activated in three kinds of foreign matter sensors.

The mensuration of inducing that also contains ADME bio-transformation and toxicology response gene.Although the activity of each of many Phase I and Phase enzyme now simply biochemical measurement analyzed, available mensuration can't be measured in the format high throughput mode xenobiontics the inducing any certain enzyme of exogenous interpolation.ZFN can be used for producing as described herein genetically modified cell system, and it can raise and the mensuration of with toxicology, reacting relevant gene provides basis for the lower mediation of measuring critical stage I and Phase/enzyme.For example, ZFN can be used for setting up for example, clone with reporter gene (coding fluorescence albumen or luciferase), and described gene is inserted in the promotor near-end of measured gene.These gene target can be any in critical stage I, Phase, translocator, genotox or apoptosis/downright bad pathway component.Can also produce some groups of organizing specific sexual cells, its for example, activation to the gene of coding stage I or Phase enzyme, translocator or toxic reaction approach (genetoxic or apoptosis) is reported.

iii. research and develop model

Method of the present invention can be used for producing animal or the cell that can be used as researching and developing model.This class model can be used for studying fetal development, allelotaxis, tract growth etc.For example, in one embodiment, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in the nucleotide sequence of one or more and organ or tract related to development.The unrestricted example of organ comprises brain, eye, nose, ear, throat, oral cavity (comprising tooth, tongue, lip, gum), spinal cord, bone, heart, blood vessel, lung, liver, pancreas, gall-bladder, spleen, esophagus, stomach, small intestine, large intestine, appendix, rectum, bladder, the organ of reproductive system, immune organ (comprising Tiroidina, lymphoglandula, lymphatic vessel) and endocrine system organ.The unrestricted example of tract comprises neural system, the recycle system, Digestive tract, respiratory system, Skeletal system, lymphsystem, reproductive system, musculature, integumentary system, Excretory system and endocrine system.

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to neurodevelopment is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).The chromosome sequence relevant with neurodevelopment can be protein coding sequence or control sequence.In certain embodiments, the neurodevelopment sequence can be relevant with following each person: neurodevelopment illness, relevant with the neurodevelopment illness, or the biochemical route relevant to the closely related illness in the neurodevelopment illness (as pku).

The unrestricted example of the sequence relevant to neurodevelopment comprises A2BP1[incoordination albumen 2 Binding Protein 1s], The amino ethanedioic acid transaminase of AADAT[], AANAT[aralkylamine N-acetyl-transferase], ABAT[4-aminobutyric acid transaminase], ABCA1[ATP is in conjunction with box, subfamily A (ABC1), the member 1], ABCA13[ATP is in conjunction with box, subfamily (ABC1), the member 13], ABCA2[ATP is in conjunction with box, subfamily A (ABC1), the member 2], ABCB1[ATP is in conjunction with box, subfamily B (MDR/TAP), the member 1], ABCB11[ATP is in conjunction with box, subfamily B (MDR/TAP), the member 11], ABCB4[ATP is in conjunction with box, subfamily B (MDR/TAP), the member 4], ABCB6[ATP is in conjunction with box, subfamily B (MDR/TAP), the member 6], ABCB7[ATP is in conjunction with box, subfamily B (MDR/TAP), the member 7], ABCC1[ATP is in conjunction with box, subfamily C (CFTR/MRP), the member 1], ABCC2[ATP is in conjunction with box, subfamily C (CFTR/MRP), the member 2], ABCC3[ATP is in conjunction with box, subfamily C (CFTR/MRP), the member 3], ABCC4[ATP is in conjunction with box, subfamily C (CFTR/MRP), the member 4], ABCD1[ATP is in conjunction with box, subfamily D (ALD), the member 1], ABCD3[ATP is in conjunction with box, subfamily D (ALD), the member 3], ABCG1[ATP is in conjunction with box, subfamily G (WHITE), the member 1], ABCG2[ATP is in conjunction with box, subfamily G (WHITE), the member 2], ABCG4[ATP is in conjunction with box, subfamily G (WHITE), the member 4], ABHD11[contains from hydrolase territory 11], ABI1[abl interaction factor 1], ABL1[c-abl oncogene 1, receptor tyrosine kinase], ABL2[v-abl Abelson murine leukemia virus oncogene homologue 2 (arg, Abelson related gene)], The ABLIM1[actin is in conjunction with LIM protein 1], The ABLIM2[actin is in conjunction with the LIM protein families, and the member 2], The ABLIM3[actin is in conjunction with the LIM protein families, and the member 3], ABO[ABO blood group (transferase A, α 1-3-N-acetyl-galactosaminyl transferase; Transferase B, α 1-3-galactosyltransferase)], ACAA1[acetyl-coacetylase acyltransferase 1], ACACA[EC 6.4.1.2 α], ACACB[EC 6.4.1.2 β], ACADL[acyl group-coa dehydrogenase, long-chain], ACADM[acyl group-coa dehydrogenase, C-4 to C-12 straight chain], ACADS[acyl group-coa dehydrogenase, C-2 to C-3 short chain], ACADSB[acyl group-coa dehydrogenase, short/side chain], The ACAN[aggrecan], ACAT2[acetyl-coacetylase transacetylase 2], ACCN1[amiloride-responsive cationic channel 1, neuron], ACE[tonin (peptidyl-dipeptidase A) 1], ACE2[tonin (peptidyl-dipeptidase A) 2], ACHE[acetylcholinesterase (Yt blood group)], The ACLY[ATP citric acid lyase], ACO1[aconitase 1, solvable], The ACTA1[actin, α 1, skeletal muscle], The ACTB[actin, β], The ACTC1[actin, α, cardiac muscle 1], The ACTG1[actin, γ 1], ACTL6A[actin sample 6], ACTL6B[actin sample 6B], The ACTN1[actinine, α 1], ACTR1A[ARP1 actinrelated proteins 1 homologue A, centractin α (yeast)], ACTR2[ARP2 actinrelated proteins 2 homologues (yeast)], ACTR3[ARP3 actinrelated proteins 3 homologues (yeast)], ACTR3B[ARP3 actinrelated proteins 3 homologue B (yeast)], ACVR1[activin A acceptor, type I], ACVR2A[activin A acceptor, Type II A], The ADA[adenosine deaminase], ADAM10[ADAM metallopeptidase territory 10], ADAM11[ADAM metallopeptidase territory 11], ADAM12[ADAM metallopeptidase territory 12], ADAM15[ADAM metallopeptidase territory 15], ADAM17[ADAM metallopeptidase territory 17], ADAM18[ADAM metallopeptidase territory 18], ADAM19[ADAM metallopeptidase territory 19 (unwinding protein enzyme β)], ADAM2[ADAM metallopeptidase territory 2], ADAM20[ADAM metallopeptidase territory 20], ADAM21[ADAM metallopeptidase territory 21], ADAM22[ADAM metallopeptidase territory 22], ADAM23[ADAM metallopeptidase territory 23], ADAM28[ADAM metallopeptidase territory 28], ADAM29[ADAM metallopeptidase territory 29], ADAM30[ADAM metallopeptidase territory 30], ADAM8[ADAM metallopeptidase territory 8], ADAM9[ADAM metallopeptidase territory 9 (unwinding protein enzyme γ)], ADAMTS1[has the ADAM metallopeptidase of thrombospondin Class1 motif, 1], ADAMTS13[has the ADAM metallopeptidase of thrombospondin Class1 motif, 13], ADAMTS4[has the ADAM metallopeptidase of thrombospondin Class1 motif, 4], ADAMTS5[has the ADAM metallopeptidase of thrombospondin Class1 motif, 5], That ADAP2[has is two, The ArfGAP 2 in PH territory], The ADAR[adenosine deaminase, the RNA-specificity], The ADARB1[adenosine deaminase, RNA-specificity, B1 (RED1 homology rat)], ADCY1[adenyl cyclase 1 (brain)], ADCY10[adenyl cyclase 10 (solvable)], ADCYAP1[adenylate cyclase activating polypeptide 1 (hypophysis)], ADD1[adducin 1 (α)], ADD2[adducin 2 (β)], ADH1A[alcohol dehydrogenase 1A (class I), the α polypeptide], ADIPOQ[fat connects albumen, contains C1Q and collagen domain], The ADK[adenosine kinase], The ADM[adrenomedulin], ADNP[activity-dependence neuroprotective factor homology frame], The ADORA1[adenosine A 1 receptor], ADORA2A[Adenosine A2a acceptor], ADORA2B[adenosine A 2b acceptor], The ADORA3[adenosine A 3 receptor], ADRA1B[adrenaline, α-1B-, acceptor], ADRA2A[adrenaline, α-2A-, acceptor], ADRA2B[adrenaline, α-2B-, acceptor], ADRA2C[adrenaline, α-2C-, acceptor], ADRB1[adrenaline, β-1-, acceptor], ADRB2[adrenaline, β-2-, acceptor, surface], ADRB3[adrenaline, β-3-, acceptor], ADRBK2[adrenaline, β, receptor kinase 2], ADSL[adenosine butanedioic acid lyase], AFF2[AF4/FMR2 family, the member 2], AFM[afamin], AFP[α-fetoprotein], AGAP1[have GTP enzyme territory, The ArfGAP 1 in ankyrin repeat and PH territory], AGER[terminal glycosylation end product-specific receptor], AGFG1[has the ArfGAP 1 that FG repeats], AGPS[alkanisation glycerosone phosphate synthase], The AGRN[agrin], AGRP[agouti related protein homologue (mouse)], AGT[hypertensinogen (member 8 for serpin peptide enzyme inhibition factor, clade A)], The AGTR1[angiotensin-ii receptor, Class1], The AGTR2[angiotensin-ii receptor, type 2], The AHCY[adenosyl homocysteinase], AHI1[Abelson assists integration site 1], The AHR[aromatic hydrocarbon receptor], AHSG[α-2-HS-glycoprotein], AICDA[activates-induces cytidine deaminase], AIFM 1[Apoptosis-inducible factor, mitochondria is relevant, and 1], AIRE[autoimmunity regulatory factor], AKAP12[A kinases (PRKA) anchorin matter 12], AKAP9[A kinases (PRKA) anchorin matter (yotiao) 9], AKR1A1[aldehyde-one reductase family 1, member A1 (aldehyde reductase)], AKR1B1[aldehyde-one reductase family 1, member B1 (aldose reductase)], AKR1C3[aldehyde-one reductase family 1, member C3 (3-α hydroxysteroid dehydrogenase, Type II)], AKT1[v-akt mouse thymoma Viral Carcinogenesis gene homolog 1], AKT2[v-akt mouse thymoma Viral Carcinogenesis gene homolog 2], AKT3[v-akt mouse thymoma Viral Carcinogenesis gene homolog 3 (protein kinase B, γ)], ALAD[ammonia levulic acid, δ-, dehydratase], The ALB[albumin], The ALB[albumin], ALCAM[activated leukocyte cell adhesion molecule], ALDH1A1[aldehyde dehydrogenase 1 family, member A1], ALDH3A1[aldehyde dehydrogenase 3 families, member A1], ALDH5A1[aldehyde dehydrogenase 5 families, member A1], ALDH7A1[aldehyde dehydrogenase 7 families, member A1], ALDH9A1[aldehyde dehydrogenase 9 families, member A1], The ALDOA[ALD-A, fructose-diphosphonic acid], The ALDOB[ALD-B, fructose-diphosphonic acid], The ALDOC[ALD-C, fructose-diphosphonic acid], ALK[anaplasia lymthoma receptor tyrosine kinase], ALOX12[arachidonic acid 12-LOX], ALOX5[arachidonic acid 5-LOX], ALOX5AP[arachidonic acid 5-LOX-activator protein matter], The ALPI[alkaline phosphatase, intestines], The ALPL[alkaline phosphatase, liver/bone/kidney], The ALPP[alkaline phosphatase, placenta (Regan isoenzymes)], ALS2[amyotrophic lateral sclerosis 2 (childhood)], AMACR[Alpha-Methyl acyl group-coacetylase racemase], AMBP[α-1-microglobulin/bikunin precursor], The AMPH[Amphiphilic proteins], The ANG[angiogenic proteins, ribalgilase, RNaseA family, 5], The ANGPT1[Ang-1], The ANGPT2[ANG2], ANGPTL3[angiopoietin-like 3], ANK1[ankyrin 1, red blood cell], ANK3[ankyrin 3, node of Ranvier (ankyrin G)], ANKRD1[ankyrin duplicate domain 1 (cardiac muscle)], Acid (rich leucine) nuclear phosphoprotein of ANP32E[32 families, member E], The ANPEP[Anpep], ANXA1[annexin A1], The ANXA2[ANX2L4], ANXA5[annexin A5], AP1S1[is connected factor relative protein matter complex 1, σ 1 subunit], AP1S2[is connected factor relative protein matter complex 1, σ 2 subunits], AP2A1[is connected factor relative protein matter complex 2, α 1 subunit], AP2B1[is connected factor relative protein matter complex 2, β 1 subunit], APAF1[apoptosis peptase activity factor 1], The combination of APBA1[amyloid (A4) precursor protein, family, the member 1], The combination of APBA2[amyloid (A4) precursor protein, family, the member 2], The combination of APBB1[amyloid (A4) precursor protein, the B of family, member 1 (Fe65)], The combination of APBB2[amyloid (A4) precursor protein, the B of family, the member 2], APC[adenoma polyposis Escherichia coli], APCS[amyloid P component, serum], APEX1[APEX nuclease (multifunctional dna repairase) 1], APH1B[anterior pharynx defect 1 homologue B (Caenorhabditis elegans)], APLP1[amyloid (A4) precursor sample protein 1], The APOA1[apolipoprotein A-1], APOA5[aPoA-V], APOB[apolipoprotein B (comprising Ag (x) antigen)], APOC2[apoC-II], The APOD[Apolipoprotein D], The APOE[apo E], The APOM[Apoliprotein M], APP[amyloid (A4) precursor protein], APPL1[is connected factor protein matter, and phosphotyrosine interacts, and contains PH territory and leucine zipper 1], The APRT[adenine phosphoribosyl transferase], APTX[aprataxin], AQP1[aquaporin 1 (Colton blood group)], AQP2[aquaporin 2 (collecting pipe)], AQP3[aquaporin 3 (Gill blood group)], The AQP4[aquaporin 4], The AR[androgen receptor], ARC[activity-regulating cell skeleton related protein], The AREG[amphiregulin], ARFGEF2[ADP-ribosylation factor guanylic acid-exchange factor 2 (brefeldin A-inhibition)], The ARG1[arginase, liver], ARHGAP1[Rho GTP enzyme activation protein 1], ARHGAP32[Rho GTP enzyme activation protein 32], ARHGAP4[Rho GTP enzyme activation protein 4], ARHGAP5[Rho GTP enzyme activation protein 5], ARHGDIA[Rho GDP inhibiting factor (GDI) α that dissociates], ARHGEF1[Rho guanine nucleotide exchange factor (GEF) 1], ARHGEF10[Rho guanine nucleotide exchange factor (GEF) 10], ARHGEF11[Rho guanine nucleotide exchange factor (GEF) 11], ARHGEF12[Rho guanine nucleotide exchange factor (GEF) 12], ARHGEF15[Rho guanine nucleotide exchange factor (GEF) 15], ARHGEF16[Rho guanine nucleotide exchange factor (GEF) 16], ARHGEF2[Rho/RAC guanine nucleotide exchange factor (GEF) 2], ARHGEF3[Rho guanine nucleotide exchange factor (GEF) 3], ARHGEF4[Rho guanine nucleotide exchange factor (GEF) 4], ARHGEF5[Rho guanine nucleotide exchange factor (GEF) 5], ARHGEF6[RAC/Cdc42 guanine nucleotide exchange factor (GEF) 6], ARHGEF7[Rho guanine nucleotide exchange factor (GEF) 7], ARHGEF9[Cdc42 guanine nucleotide exchange factor (GEF) 9], The rich AT of ARID1A[is in conjunction with territory 1A (SWI sample)], The rich AT interaction territory 1B (SWI1 sample) of ARID1B[], ARL13B[ADP-ribosylation factor sample 13B], ARPC1A[actinrelated proteins 2/3 complex, the 1A of subunit, 41kDa], ARPC1B[actinrelated proteins 2/3 complex, the 1B of subunit, 41kDa], ARPC2[actinrelated proteins 2/3 complex, subunit 2,34kDa], ARPC3[actinrelated proteins 2/3 complex, subunit 3,21kDa], ARPC4[actinrelated proteins 2/3 complex, subunit 4,20kDa], ARPC5[actinrelated proteins 2/3 complex, subunit 5,16kDa], ARPC5L[actinrelated proteins 2/3 complex, subunit's 5 samples], ARPP19[cAMP-regulates and controls phosphoprotein, 19kDa], ARR3[CKIs 3, retina (X-CKIs)], The ARRB2[CKIs, β 2], ARSA[virtue sulfatase A], The ARTN[Artesunate], ARX[is without the relevant homology frame of awns], ASCL1[is without bristle scale and shell complex homologue 1 (fruit bat)], ASMT[acetyl varies O-transmethylase], ASPA[asparagus fern acyltransferase (sword bean disease)], ASPG[asparaginase homologue (saccharomyces cerevisiae)], ASPH[aspartic acid B-hydroxylase], ASPM[asp (abnormal spindle) homologue, microcephaly be correlated with (fruit bat)], ASRGL1[asparaginase sample 1], ASS1[argininosuccinate synthetase 1], ASTN1[star actin 1], The ATAD5[ATP enzyme family, contain AAA territory 5], ATF2[transcriptional factors 2], ATF4[transcriptional factors 4 (tax-replys enhancer element B67)], ATF6[transcriptional factors 6], ATM[ataxia-telangiectasia sudden change], ATOH1[is without adjusting homologue 1 (fruit bat)], Anti-oxidant protein 1 homologue of ATOX1[ATX1 (yeast)], The ATP10A[ATP enzyme, class V, Class1 0], The ATP2A2[ATP enzyme, Ca++ transhipment, cardiac muscle, slowly spasm 2], The ATP2B2[ATP enzyme, Ca++ transhipment, plasma membrane 2], The ATP2B4[ATP enzyme, Ca++ transhipment, plasma membrane 4], The ATP5O[ATP synzyme, H+ transhipment, mitochondria F1 complex, O subunit], The ATP6AP1[ATP enzyme, H+ transhipment, lysosome auxiliary protein 1], The ATP6V0C[ATP enzyme, H+ transhipment, lysosome 16kDa, the c of V0 subunit], The ATP7A[ATP enzyme, Cu++ transhipment, α polypeptide], The ATP8A1[ATP enzyme, ammonia phosphatide transport protein (APLT), class I, type 8, the member 1], The ATR[ataxia-telangiectasia is relevant with Rad3], The ATRN[nest egg is white], ATRX[alpha Thalassemia/feeblemindedness syndrome X-chain (RAD54 homologue, saccharomyces cerevisiae)], ATXN1[incoordination albumen 1], ATXN2[incoordination albumen 2], ATXN3[incoordination albumen 3], AURKA[aurora kinases A], AUTS2[self-closing disease neurological susceptibility candidate gene 2], The AVP[arginine vasopressin], AVPR1A[arginine vasopressin acceptor 1A], AXIN2[axin2], The AXL[AXL receptor tyrosine kinase], The blue pyridine 1 of AZU 1[], The B2M[beta-2-microglobulin], B3GNT2[UDP-GlcNAc: β Gal β-1[3-N-acetylglucosaminyl transferase 2], B9D1[B9 protein territory 1], BACE1[β-site APP-lyases 1], BACE2[β-site APP-lyases 2], BACH1[BTB and CNC homology 1, alkaline leucine zipper transcription factor 1], The BAD[cell death BCL2 antagonism factor of being correlated with], BAGE2[B melanoma antigen family, the member 2], BAIAP2[BAI1 related protein 2], BAIAP2L1[BAI1 related protein 2 samples 1], BAK1[BCL2-antagonist/kill and wound 1], The relevant RING of BARD1[BRCA1 territory 1], BARHL1[BarH sample homology frame 1], BARHL2[BarH sample homology frame 2], The BASP1[brain is abundant, and film connects signal-proteins 1], The BAX[BCL2 X protein matter of being correlated with], The contiguous zinc in the calm territory of BAZ1A[refers to territory, 1], The contiguous zinc in the calm territory of BAZ1B[refers to territory, 1B], BBS9[Bardet-Biedl syndrome 9], BCAR1[breast cancer anti-estrogen resistance 1], BCHE[BuCh lipase], BCL10[B cell CLL/ lymthoma 10], BCL2[B cell CLL/ lymthoma 2], BCL2A1[BCL2 related protein A1], BCL2L1[BCL2 sample 1], BCL2L11[BCL2 sample 11 (Apoptosis helper factor)], BCL3[B cell CLL/ lymthoma 3], BCL6[B cell CLL/ lymthoma 6], BCL7A[B cell CLL/ lymthoma 7], BCL7B[B cell CLL/ lymthoma 7B], BCL7C[B cell CLL/ lymthoma 7C], BCR[breakaway poing Cu Ji district], BDKRB1[bradykinin receptor B1], The large neurotrophic factor derived from brain of BDNF[], BECN1[benzyl chlorine element 1, autophagy is relevant], The BEST1[spot albumen 1 that withers], The BEX1[brain is expressed, and X-chain 1], The BEX2[brain is expressed X-chain 2], BGLAP[bone γ-carboxylic glutamic acid (gla) protein], The BGN[biglycan], The dead antagonism factor in BID[BH3 interaction territory], BIN1[bridging integration factor 1], BIRC2[contains baculoviral IAP repetitive sequence 2], BIRC3[contains baculoviral IAP repetitive sequence 3], BIRC5[contains baculoviral IAP repetitive sequence 5], BIRC7[contains baculoviral IAP repetitive sequence 7], BLK[B lymphocyte EGFR-TK], BLVRB[biliverdin reductase B (flavin reductase (NADPH))], BMI1[BMI1 combs albumen fourth finger oncogene more], BMP1[skeletal form generation protein 1], BMP10[skeletal form generation protein 10], BMP15[skeletal form generation protein 15], BMP2[skeletal form generation protein 2], BMP3[skeletal form generation protein 3], BMP4[skeletal form generation protein 4], BMP5[skeletal form generation protein 5], BMP6[skeletal form generation protein 6], BMP7[skeletal form generation protein 7], BMP8A[skeletal form generation protein 8], BMP8B[skeletal form generation protein 8b], BMPR1A[skeletal form generation protein acceptor, type I A], BMPR1B[skeletal form generation protein acceptor, type I B], BMPR2[skeletal form generation protein acceptor, Type II (serine/threonine kinase)], BOC[Boc homologue (mouse)], The relevant ovary of BOK[BCL2 kills and wounds], BPI[sterilization/permeability-increase protein], BRAF[v-raf Muridae sarcoma virus oncogene homologue B1], The BRCA1[mammary cancer 1, early send out], BRCA2[breast cancer 2, early send out], BRWD1[contains calm territory and WD duplicate domain 1], BSND[Bartter syndrome, infancy, sensorineural deafness (Barttin)], BST2[marrow stromal cell antigen 2], BTBD10[contains BTB (POZ) territory 10], BTC[second born of the same parents element], The BTD[biotin enzyme], BTG3[BTG family, the member 3], BTK[Bruton agamaglobulinemia EGFR-TK], The BTN1A1[butyrophilin, subfamily 1, member A1], The budding 1 homologue β (yeast) that BUB1B[is not suppressed by benzimidazole], C15orf2[chromosome 15 ORFs 2], C16orf75[chromosome 16 ORFs 75], C17orf42[chromosome 17 ORFs 42], C1orf187[chromosome 1 ORFs 187], C1R[complement component 1, the r subfraction], C1S[complement component 1, the s subfraction], C21orf2[chromosome 21 ORFs 2], C21orf33[chromosome 21 ORFs 33], C21orf45[chromosome 21 ORFs 45], C21orf62[chromosome 21 ORFs 62], C21orf74[chromosome 21 ORFs 74], C3[complement component 3], C3orf58[chromosome 3 ORFs 58], C4A[complement component 4 (Rodgers blood group)], C4B[complement component 4B (Chido blood group)], C5AR1[complement component 5 acceptors 1], C6orf106[chromosome 6 ORFs 106], C6orf25[chromosome 6 ORFs 25], CA1[carbonic anhydrase I], CA2[carbonic anhydrase II], CA3[carbonic anhydrase III, muscle specific], CA6[carbonic anhydrase VI], CA9[carbonic anhydrase IX], CABIN1[calcineurin Binding Protein 1], CABLES 1[Cdk5 and Ab1 zymolyte 1], The CACNA1B[calcium channel, voltage-dependence, N type, α 1B subunit], The CACNA1C[calcium channel, voltage-dependence, L type, α 1C subunit], The CACNA1G[calcium channel, voltage-dependence, T type, α 1G subunit], The CACNA1H[calcium channel, voltage-dependence, T type, α 1H subunit], The CACNA2D1[calcium channel, voltage-dependence, α 2/ delta-subunit 1], CADM1[cell adhesion molecule 1], CADPS2[Ca++-dependent release activity factor 2], CALB2[calbindin 2], Blood calcium albumen related polypeptide α falls in CALCA[], The blood calcium protein receptor falls in CALCR[], CALM3[calmodulin 3 (phosphorylase kinase, δ)], The CALR[calprotectin], CAMK1[calcium/calmodulin-deopendent protein kinase I], CAMK2A[calcium/calmodulin-dependent protein kinase ii-alpha], CAMK2B[calcium/calmodulin-dependent protein kinase ii β], CAMK2G[calcium/calmodulin-dependent protein kinase ii γ], CAMK4[calcium/calmodulin-deopendent protein kinase IV], CAMKK2[calcium/calmodulin-deopendent protein kinase kinases 2, β], CAMP[Ka Telanshi peptide antibacterial peptide], CANT1[calcium activated oligonucleotide enzyme 1], The CANX[calnexin], CAPN1[calpain 1, (μ/I) large subunit], CAPN2[calpain 2, (m/II) large subunit], CAPN5[calpain 5], CAPZA1[capping protein (actin fiber) muscle Z axis, α 1], The CARD16[caspase is raised territory family, and the member 16], The CARM1[coactivator arginine methyltransferase 1 of being correlated with], The CARTPT[CART prepropeptide], CASK[calcium/calmodulin-dependence serineprotein kinase (MAGUK family)], CASP1[caspase 1, the Apoptosis cysteine peptase (interleukin 1, β, invertase) of being correlated with], CASP10[caspase 10, the Apoptosis cysteine peptase of being correlated with], CASP2[caspase 2, the Apoptosis cysteine peptase of being correlated with], The CASP3[Caspase-3, the Apoptosis cysteine peptase of being correlated with], CASP6[caspase 6, the Apoptosis cysteine peptase of being correlated with], CASP7[caspase 7, the Apoptosis cysteine peptase of being correlated with], CASP8[caspase 8, the Apoptosis cysteine peptase of being correlated with], CASP8AP2[caspase 8 related proteins 2], CASP9[caspase 9, the Apoptosis cysteine peptase of being correlated with], The CASR[calcium-sensing receptor], The CAST[calpastatin], The CAT[catalase], The CAV1[caveolin-1, caveolae protein, 22kDa], CAV2[caveolin 2], CAV3[caveolin 3], CBL[Cas-Br-M (mouse) ectropic retrovirus transforming sequence], CBLB[Cas-Br-M (mouse) ectropic retrovirus transforming sequence b], CBR1[carbonyl reductase 1], CBR3[carbonyl reductase 3], CBS[cystathionie-beta-synthetase], CBX1[colouration box homologue 1 (HP1 β homologue fruit bat)], CBX5[colouration box homologue 5 (HP1 α homologue, fruit bat)], CC2D2A[contains coiled coil and C2 territory 2A], CCBE1[collagen and calcium are in conjunction with EGF territory 1], CCBL1[cysteine bond-β lyase, cytoplasm], CCDC50[contains coiled coil territory 50], The CCK[CCK], The CCKAR[cholecyctokinin a receptor], CCL1[chemotactic factor (CF) (C-C motif) ligand 1], CCL11[chemotactic factor (CF) (C-C motif) ligand 1 1], CCL13[chemotactic factor (CF) (C-C motif) ligand 1 3], The CCL17[CCL17], CCL19[chemotactic factor (CF) (C-C motif) ligand 1 9], CCL2[chemotactic factor (CF) (C-C motif) part 2], CCL20[chemotactic factor (CF) (C-C motif) part 20], CCL21[chemotactic factor (CF) (C-C motif) part 21], CCL22[chemotactic factor (CF) (C-C motif) part 22], CCL26[chemotactic factor (CF) (C-C motif) part 26], CCL27[chemotactic factor (CF) (C-C motif) part 27], CCL3[chemotactic factor (CF) (C-C motif) part 3], CCL4[chemotactic factor (CF) (C-C motif) part 4], CCL5[chemotactic factor (CF) (C-C motif) part 5], CCL7[chemotactic factor (CF) (C-C motif) part 7], CCL8[chemotactic factor (CF) (C-C motif) part 8], CCNA1[Cyclin A 1], CCNA2[Cyclin A 2], The CCNB1[Cyclin B1], CCND1[cyclin D1], CCND2[cyclin D2], The CCND3[cyclin D 3], CCNG1[cyclin G1], CCNH[cyclin H], CCNT1[cyclin T1], CCR1[chemotactic factor (CF) (C-C motif) acceptor 1], CCR3[chemotactic factor (CF) (C-C motif) acceptor 3], CCR4[chemotactic factor (CF) (C-C motif) acceptor 4], CCR5[chemotactic factor (CF) (C-C motif) acceptor 5], CCR6[chemotactic factor (CF) (C-C motif) acceptor 6], CCR7[chemotactic factor (CF) (C-C motif) acceptor 7], CCT5[contains chaperone TCP1, subunit 5 (ε)], The CD14[CD14 molecule], The CD19[CD19 molecule], The CD1A[CD1a molecule], The CD1B[CD1b molecule], The CD1D[CD1d molecule], The CD2[CD2 molecule], The CD209[CD209 molecule], The CD22[CD22 molecule], The CD244[CD244 molecule, Natural Killer Cell Receptors 2B4], The CD247[CD247 molecule], The CD27[CD27 molecule], The CD274[CD274 molecule], The CD28[CD28 molecule], The CD2AP[CD2 related protein], The CD33[CD33 molecule], The CD34[CD34 molecule], CD36[CD36 molecule (thrombospondin acceptor)], The CD3E[CD3e molecule, ε (CD3-TCR complex)], The CD3G[CD3g molecule, γ (CD3-TCR complex)], The CD4[CD4 molecule], The CD40[CD40 molecule, TNF receptor superfamily member 5], The CD40LG[CD40 part], CD44[CD44 molecule (India's blood group)], The CD46[CD46 molecule, CCP matter], The CD47[CD47 molecule], The CD5[CD5 molecule], The CD55[CD55 molecule, Decay accelerating factor (Cromer blood group)], The CD58[CD58 molecule], The CD59[CD59 molecule, CCP matter], The CD63[CD63 molecule], The CD69[CD69 molecule], The CD7[CD7 molecule], The CD72[CD72 molecule], The CD74[CD74 molecule, major histocompatibility complex, class II invariant chain], The CD79A[CD79a molecule, the immunoglobulin (Ig) α that is correlated with], The CD79B[CD79b molecule, the immunoglobulin (Ig) β that is correlated with], The CD80[CD80 molecule], The CD81[CD81 molecule], The CD86[CD86 molecule], The CD8A[CD8a molecule], The CD9[CD9 molecule], The CD99[CD99 molecule], The CDA[cytidine deaminase], CDC25A[CDC 25 homologue A (fission yeast)], CDC25C[CDC 25 homologue C (fission yeast)], CDC37[CDC 37 homologues (saccharomyces cerevisiae)], CDC42[CDC 42 (gtp binding protein, 25kDa)], CDC5L[CDC5 CDC 5 samples (fission yeast)], CDH1[cadherin 1, Class1, E-cadherin (epithelium)], CDH10[cadherin 10, type 2 (T2-cadherin)], CDH12[cadherin 12, type 2 (N-cadherin 2)], CDH15[cadherin 15, Class1, M-cadherin (flesh tubulin)], CDH2[cadherin 2, Class1, N-cadherin (neuron)], CDH4[cadherin 4, Class1, R-cadherin (retina)], CDH5[cadherin 5, type 2 (blood vessel endothelium)], CDH9[cadherin 9, type 2 (T1-cadherin)], CDIPT[CDP-diacylglycerol--inositol 3-phosphatidyl transferring enzyme (phosphatidylinositols synzyme)], CDK1[cyclin-dependant kinase 1], CDK14[cyclin-dependant kinase 14], CDK2[cyclin-dependant kinase 2], CDK4[cyclin-dependant kinase 4], CDK5[cyclin-dependant kinase 5], CDK5R1[cyclin-dependant kinase 5, regulation and control subunit 1 (p35)], CDK5RAP2[CDK5 regulation and control subunit related protein 2], CDK6[cyclin-dependant kinase 6], CDK7[cyclin-dependant kinase 7], CDK9[cyclin-dependant kinase 9], CDKL5[cyclin-dependant kinase sample 5], CDKN1A[cyclin-dependent kinase enzyme inhibition factor 1A (p21, Cip1)], CDKN1B[cyclin-dependent kinase enzyme inhibition factor 1B (p27, Kip1)], CDKN1C[cyclin-dependent kinase enzyme inhibition factor 1C (p57, Kip2)], CDKN2A[cyclin-dependent kinase enzyme inhibition factor 2 (melanoma, p16 suppress CDK4)], CDKN2B[cyclin-dependent kinase enzyme inhibition factor 2B (p15 suppresses CDK4)], CDKN2C[cyclin-dependent kinase enzyme inhibition factor 2C (p18 suppresses CDK4)], CDKN2D[cyclin-dependent kinase enzyme inhibition factor 2D (p19 suppresses CDK4)], CDNF[brain dopamine neurotrophic factor], The CDO1[cysteine dioxygenase, type I], CDR2[cerebellum degeneration related protein 2,62kDa], The license of CDT1[chromatin and the DNA replication dna factor 1], CDX1[tail type is with source capsule 1], CDX2[tail type is with source capsule 2], CEACAM1[carcinomebryonic antigen relevant cell adhesion molecule 1 (biliary glycoprotein)], CEACAM3[carcinomebryonic antigen relevant cell adhesion molecule 3], The CEACAM5[CEA-006], CEACAM7[carcinomebryonic antigen relevant cell adhesion molecule 7], CEBPB[CCAAT/ enhancer binding protein (C/EBP), β], CEBPD[CCAAT/ enhancer binding protein (C/EBP), δ], CECR2[cat's eye syndrome chromosomal region, candidate gene 2], CEL[carboxyl ester lipase (cholate-stimulation lipase)], CENPC1[centromere protein matter C1], CENPJ[centromere protein matter J], CEP290[centrosome protein 290kDa], CER1[cerberus 1, cysteine knot superfamily, homologue (Africa xenopus)], CETP[cholesteryl transesterify protein, blood plasma], CFC1[cripto, FRL-1, secret family 1], The CFH[complement factor H], CFHR1[complement factor H relevant 1], CFHR3[complement factor H relevant 3], CFHR4[complement factor H relevant 4], The CFI[CFI], CFL1[Cofilin 1 (non-muscle)], CFL2[Cofilin 2 (muscle)], CFLAR[CASP8 and FADD like cell apoptotic effector], CFTR[cystic fibrosis transmembrane conductance regulatory factor (ATP is in conjunction with box subfamily C, and the member 7)], The CGA[glycoprotein hormones, the α polypeptide], The CGB[HCG, beta polypeptides], The CGB5[HCG, beta polypeptides 5], CGGBP1[CGG triplet repetitive sequence bindin 1], The CHAF1A[Chromatin assembly factor 1, subunit A (p150)], The CHAF1B[Chromatin assembly factor 1, the B of subunit (p60)], The CHAT[cholinacetyltranslase], CHEK1[CHK1 test point homologue (fission yeast)], CHEK2[CHK2 test point homologue (fission yeast)], CHGA[Chromogranin A (parathyroid secretory protein 1)], CHKA[choline kinase α], CHL1[has the cell adhesion molecule with L1CAM (the nearly homologue of L1) homology], CHN1[chimeric protein (chimericin) 1], CHP[calbindin P22], CHP2[calcineurin B homologous protein 2], CHRD[tendon albumen], The CHRM1[cholinergic recepter, muscarine 1], The CHRM2[cholinergic recepter, muscarine 2], The CHRM3[cholinergic recepter, muscarine 3], The CHRM5[cholinergic recepter, muscarine 5], The CHRNA3[cholinergic recepter, nicotine, α 3], The CHRNA4[cholinergic recepter, nicotine, α 4], The CHRNA7[cholinergic recepter, nicotine, α 7], The CHRNB2[cholinergic recepter, nicotine, β 2 (neuron)], CHST1[carbohydrate (keratan sulfate GAL-6) sulfotransferase 1], CHST10[carbohydrate sulfotransferase 10], CHST3[carbohydrate (chondroitin 6) sulfotransferase 3], The conservative helix-loop-helix of CHUK[is all at kinases], CHURC1[contains churchill territory 1], CIB1[calcium and integrin are in conjunction with 1 (calcium and integrin)], CIITA[class II, major histocompatibility complex, transform activity factor], The cold rna binding protein of inducing of CIRBP[], CISD1[CDGSH iron sulphur territory 1], The CISH[cell factor can be induced the protein that contains SH2], CIT citizen's [citron (rho combination, serine/threonine kinase 21)], CLASP2[cytoplasm attachment related protein 2], The CLCF1[myocardial nutrition albumen like cell factor 1], CLCN2[chloride channel 2], CLDN1[sealing element 1], CLDN14[sealing element 14], CLDN16[sealing element 16], CLDN3[sealing element 3], CLDN4[sealing element 4], CLDN5[sealing element 5], CLDN8[sealing element 8], CLEC12A[C-type lectin domain family 12, member A], CLEC16A[C-type lectin domain family 16, member A], CLEC5A[C-type lectin domain family 5, member A], CLEC7A[C-type lectin domain family 7, member A], The connection albumen 2 that CLIP2[contains the CAP-GLY territory], CLSTN1[calcium is with linear protein 1], The CLTC[clathrin, heavy chain (Hc)], The CLU[clusterin], The CMIP[c-Maf-induced protein], CNBP[CCHC-type zinc refers to, nucleic acid binding protein], CNGA3[cyclic nucleotide gate passage α 3], CNGB3[cyclic nucleotide gate passage β 3], CNN1[Calponin 1, alkalescence, smooth muscle], CNN2[Calponin 2], CNN3[Calponin 3, acidity], The CNOT8[CCR4-NOT transcription complex, subunit 8], CNP[2 ' [3 '-cyclic nucleotide 3 ' phosphodiesterase], CNR1[hemp component receptor 1 (brain)], CNR2[hemp component receptor 2 (macrophage)], The CNTF[CNTF], CNTFR[CNTF acceptor], CNTFR[CNTF acceptor], CNTFR[CNTF acceptor], CNTLN[centlein, centrosome protein], CNTN1[contactin 1], CNTN2[contactin 2 (aixs cylinder)], CNTN4[contactin 4], CNTNAP1[contactin related protein 1], CNTNAP2[contactin related protein sample 2], The blue mould homologue (mouse) of COBL[lace], COG2[oligomerization Golgi complex component 2], COL18A1[collagen, type XVIII, α 1], COL1A1[collagen, type I, α 1], COL1A2[collagen, type I, α 2], COL2A1[collagen, Type II, α 1], COL3A1[collagen, type-iii, α 1], COL4A3[collagen, type I V, α 3 (Goodpasture antigen)], COL4A3BP[collagen, type I V, α 3 (Goodpasture antigen) is in conjunction with albumen], COL5A1[collagen, type V, α 1], COL5A2[collagen, type V, α 2], COL6A1[collagen, type VI, α 1], COL6A2[collagen, type VI, α 2], COL6A3[collagen, type VI, α 3], The COMT[catechol O-methyltransferase], COPG2[capside protein matter complex, the γ of subunit 2], The photosensitive form generation of COPS4[COP9 structure homologue subunit 4 (arabidopsis)], The CORO1A[coronin, actin binding protein, 1], The COX5A[cytochrome c oxidase Va of subunit], The COX7B[cytochrome c oxidase VIIb of subunit], CP[ceruloplasmin (Ferroxidase)], CPA1[Carboxypeptidase A 1 (pancreas)], CPA2[Carboxypeptidase A 2 (pancreas)], CPA5[Carboxypeptidase A 5], CPB2[protaminase 2 (blood plasma)], The auxiliary front protoporphyrinogen oxidase of CPOX[], CPS 1[carbamyl-phosphate synthetase 1, mitochondria], CPT1A[carnitine palmitoyltransferase 1 A (liver)], CR1[complement component (3b/4b) acceptor 1 (Knops blood group)], CR2[complement component (3d/Epstein Barr virus) acceptor 2], CRABP1[cell vitamin A acid Binding Protein 1], CRABP2[cell vitamin A acid is in conjunction with albumen 2], CRAT[carnitine O-transacetylase], CRB1[crumbs homologue 1 (fruit bat)], CREB 1[cAMP response element binding protein 1], CREBBP[CREB is in conjunction with albumen], The rich cysteine of CRELD1[-EGF sample territory 1], The CRH[corticotropin releasing hormone], Rich cysteine-the protein 1 (intestines) of CRIP1[], CRK[v-crk sarcoma virus CT10 oncogene homologue (birds)], CRKL[v-crk sarcoma virus CT10 oncogene homologue (birds) sample], The CRLF1[CRLF1], The CRLF2[cell factor receptor sample factor 2], The CRLF3[cell factor receptor sample factor 3], The CRMP1[collapsin is replied amboceptor protein 1], The CRP[C-reactive protein, PTX-3 is relevant], CRTC1[CREB regulatory transcription co-activation albumen 1], The CRX[cone-retinal rod homology frame], The CRYAA[crystallin, α], The CRYAB[crystallin, α B], The CS[citrate synthase], The CSAD[cysteine-sulfinate decarboxylase], CSF1[colony-stimulating factor 1 (macrophage)], CSF1R[colony-stimulating factor 1 acceptor], CSF2[colony stimulating factor 2 (GM)], CSF2RA[colony stimulating factor 2 acceptors, α, low-affinity (GM)], CSF3[colony stimulating factor 3 (granulocyte)], CSF3R[colony stimulating factor 3 acceptors (granulocyte)], CSH2[chorion somatomammotropin hormone 2], The CSK[c-src EGFR-TK], The various territory 1 of CSMD1[CUB and sushi], The various territory 3 of CSMD3[CUB and sushi], The CSNK1D[Casein kinase 1, δ], The CSNK1E[Casein kinase 1, ε], CSNK2A1[casein kinase 2, α 1 polypeptide], CSPG4[chondroitin sulfate proteoglycan 4], CSPG5[chondroitin sulfate proteoglycan 5 (neural polysaccharide C)], CST3[cysteine proteinase inhibiting factor C], CST7[cysteine proteinase inhibiting factor F (leucocyte albumen)], CSTB[cysteine proteinase inhibiting factor B (stefinB)], CTAG1B[cancer/testis antigen 1B], CTBP1[C-end Binding Protein 1], CTCF[CCCTC binding factor (zinc finger protein matter)], The little phosphatase 1 of CTDSP1[CTD (carboxyl-end territory, rna plymerase ii, polypeptide A)], CTF1[myocardial nutrition albumen 1], The CTGF[CTGF], CTLA4[cytotoxin T-lymphocyte related protein 4], CTNNA1[catenin (cadherin related protein), α 1,102kDa], CTNNAL1[catenin (cadherin related protein), α sample 1], CTNNB1[catenin (cadherin related protein), β 1,88kDa], CTNND1[catenin (cadherin related protein), δ 1], CTNND2[catenin (cadherin related protein), δ 2 (neural blood platelet rabphilin Rab associated arm-repeat sequence protein)], The CTNS[cystinosis, ephrosis], The CTRL[chymotrypsin-like], CTSB[cathepsin B], CTSC[cathepsin C], CTSD[cathepsin D], CTSG[cathepsin G], CTSH[Cathepsin H], The CTSL1[cathepsin L 1], The CTSS[cathepsin S], CTTN[musculus cutaneus filamentous actin], CTTNBP2[skin actin binding protein 2], CUL4B[hysteresis protein 4B], CUL5[hysteresis protein 5], CUX2[cutting sample homology frame 2], CX3CL1[chemotactic factor (CF) (C-X3-C motif) ligand 1], CX3CR1[chemotactic factor (CF) (C-X3-C motif) acceptor 1], CXADR[Coxsackie virus and adenovirus receptor], CXCL1[chemotactic factor (CF) (C-X-C motif) ligand 1 (melanoma growth-stimulating activity, α)], The CXCL10[IP10], CXCL12[chemotactic factor (CF) (C-X-C motif) ligand 12 (stroma cell-derived factor-1)], CXCL16[chemotactic factor (CF) (C-X-C motif) ligand 1 6], CXCL2[chemotactic factor (CF) (C-X-C motif) part 2], CXCL5[chemotactic factor (CF) (C-X-C motif) part 5], CXCR1[chemotactic factor (CF) (C-X-C motif) acceptor 1], CXCR2[chemotactic factor (CF) (C-X-C motif) acceptor 2], CXCR3[chemotactic factor (CF) (C-X-C motif) acceptor 3], CXCR4[chemotactic factor (CF) (C-X-C motif) acceptor 4], CXCR5[chemotactic factor (CF) (C-X-C motif) acceptor 5], CYB5A[cytochrome b5 type A (microsome)], CYBA[cytochrome b-245, the α polypeptide], CYBB[cytochrome b-245, beta polypeptides], The CYCS[cytochrome c, body cell], CYFIP1[cytoplasm FMR1 Binding Protein 1], CYLD[cylindroma (turban neoplastic syndrome)], The CYP11A1[Cytochrome P450, family 11, subfamily A, polypeptide 1], The CYP11B1[Cytochrome P450, family 11, subfamily B, polypeptide 1], The CYP11B2[Cytochrome P450, family 11, subfamily B, polypeptide 2], The CYP17A1[Cytochrome P450, family 17, subfamily A, polypeptide 1], The CYP19A1[Cytochrome P450, family 19, subfamily A, polypeptide 1], The CYP1A1[Cytochrome P450, family 1, subfamily A, polypeptide 1], The CYP1A2[Cytochrome P450, family 1, subfamily A, polypeptide 2], The CYP1B1[Cytochrome P450, family 1, subfamily B, polypeptide 1], The CYP21A2[Cytochrome P450, family 21, subfamily A, polypeptide 2], The CYP2A6[Cytochrome P450, family 2, subfamily A, polypeptide 6], The CYP2B6[Cytochrome P450, family 2, subfamily B, polypeptide 6], The CYP2C9[Cytochrome P450, family 2, subfamily C, polypeptide 9], The CYP2D6[Cytochrome P450, family 2, subfamily D, polypeptide 6], The CYP2E1[Cytochrome P450, family 2, subfamily E, polypeptide 1], The CYP3A4[Cytochrome P450, family 3, subfamily A, polypeptide 4], The CYP7A1[Cytochrome P450, family 7, subfamily A, polypeptide 1], , the rich cysteine of CYR61[, Angiogenesis inducer, 61], CYSLTR1[cysteinyl-CysLT1R], CYSLTR2[cysteinyl-leukotriene receptor 2], DAB1[inefficacy homologue 1 (fruit bat)], DAGLA[diacylglycerol lipase, α], DAGLB[diacylglycerol lipase, β], The DAO[D-amino acid oxidase], DAOA[D-amino acid oxidase activity factor], DAPK1[death-associated protein kinase 1], DAPK3[death-associated protein kinase 3], DAXX[death-territory related protein], DBH[dopamine β-hydroxylase (dopamine β-monooxygenase)], DBI[is stable in conjunction with inhibiting factor (the GABA regulation factor, acyl group-coacetylase is in conjunction with albumen)], DBN1[flesh connection brain albumen 1], DCAF6[DDB1 and CUL4 correlation factor 6], In the DCC[colorectal cancer, lack], DCDC2[contains both adrenal glands cortical hormone prime field 2], The DCK[deoxycytidine kinase], DCLK1[both adrenal glands cortin sample kinases 1], The DCN[decorin], DCTN1[dynactin 1 (p150, gummed homologue, fruit bat)], DCTN2[dynactin 2 (p50)], DCTN4[dynactin 4 (p62)], DCUN1D1[DCN1, hysteresis protein neddylation defect 1, contain territory 1 (saccharomyces cerevisiae)], DCX[both adrenal glands cortin], DDB1[damage-specific DNA Binding Protein 1,127kDa], DDC[DOP Adecarboxylase (aromatic l-amino acid decarboxylase)], DDIT3[DNA-wound inducement transcript 3], DDIT4[DNA-wound inducement transcript 4], DDIT4L[DNA-wound inducement transcript 4 samples], DDR1[vaginal areoles receptor tyrosine kinase 1], DDX10[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 10], DDX17[DEAD (Asp-Glu-Ala-Asp) frame polypeptide 17], The DEFB4A[sozin, β 4], The DEK[DEK oncogene], The DES[desmin], DEXI[Dexi homologue (mouse)], The DFFA[DNA splitting factor, 45kDa, α polypeptide], The DFNB31[deafness, autosomal recessive 31], DGCR6[DiGeorge syndrome crisis district gene 6], DGUOK[deoxyguanosine kinases], DHCR7[7-dehydrocholesterol reductase], The DHFR[dihyrofolate reductase], The transparent homologue 1 of DIAPH1[(fruit bat)], DICER1[dicer1, the ribalgilase type-iii], DIO1[takes off iodine enzyme, iodine thyronine, type I], DIO2[takes off iodine enzyme, iodine thyronine, Type II], DIP2A[DIP2 plate-like interaction protein 2 homologue A (fruit bat)], DIRAS3[DIRAS family, GTP is in conjunction with RAS sample 3], DISC1[schizophrenia damaged 1], Damaged 2 (the nonprotein codings) of DISC2[schizophrenia], DKC1[dyskeratosis is congenital 11, dyskeratosis albumen], DLG1[discs, large homologue 1 (fruit bat)], DLG2[discs, large homologue 2 (fruit bat)], DLG3[discs, large homologue 3 (fruit bat)], DLG4[discs, large homologue 4 (fruit bat)], DLGAP1[discs, large (fruit bat) homologue related protein 1], DLGAP2[discs, large (fruit bat) homologue related protein 2], DLK1[δ sample 1 homologue (fruit bat)], DLL1[δ sample 1 (fruit bat)], The DLX1[tip is homology frame 1 still less], The DLX2[tip is homology frame 2 still less], the DLX3[tip is homology frame 3 still less], The DLX4[tip is homology frame 4 still less], The DLX5[tip is homology frame 5 still less], The DLX6[tip is homology frame 6 still less], DMBT1[lacks in malignant brain tumor 1], The DMC1 dosage inhibiting factor of DMC1[mck1 homologue, meiosis-specificity homologous recombination (yeast)], The DMD[dystrophin], DMPK[tonicity muscular dystrophy-protein kinase], The DNAI2[dynein, genonema, medium chain 2], DNAJC28[DnaJ (Hsp40) homologue, subfamily C, the member 28], DNAJC30[DnaJ (Hsp40) homologue, subfamily C, the member 30], The DNASE1[deoxyribonuclease I], DNER[contains δ/notch sample EGF repetitive sequence], DNLZ[DNL-type zinc refers to], DNM1[dynamin 1], DNM3[dynamin 3], DNMT1[DNA (cytimidine-5-)-transmethylase 1], DNMT3A[DNA (cytimidine-5-)-transmethylase 3 α], DNMT3B[DNA (cytimidine-5-)-transmethylase 3 β], The DNTT[deoxynucleotidyl transferase, end], The dual C2 sample of DOC2A[territory, α], DOCK1[cytokinesis acting factor 1], DOCK3[cytokinesis acting factor 3], DOCK4[cytokinesis acting factor 4], DOCK7[cytokinesis acting factor 7], DOK7[docking protein 7], The DONSON[SON downstream is contiguous], DOPEY1[anaesthetizes family member 1], DOPEY2[anaesthetizes family member 2], DPF1[D4, zinc and dual PHD finger family 1], DPF3[D4, zinc and dual PHD finger, family 3], DPH1[DPH1 homologue (saccharomyces cerevisiae)], DPP10[bis-peptidyls-peptase 10], DPP4[bis-peptidyls-peptase 4], DPRXP4[difference-homology frame the pseudogene 4 of being correlated with in pairs], The DPT[skin connects albumen], The DPYD[dihydropyrimidine dehydrogenase], DPYSL2[dihydropyrimidinase sample 2], DPYSL3[dihydropyrimidinase sample 3], DPYSL4[dihydropyrimidinase sample 4], DPYSL5[dihydropyrimidinase sample 5], DRD1[dopamine receptor D1], DRD2[dopamine receptor D2], DRD3[dopamine receptor D3], DRD4[dopamine receptor D4], DRD5[dopamine receptor D5], DRG1[developmental regulation gtp binding protein 1], DRGX[Dorsal root nerve center homology frame], DSC2[desmocollin 2], DSCAM[Down syndrome cell adhesion molecule], DSCAML1[Down syndrome cell adhesion molecule sample 1], DSCR3[Down syndrome crisis district gene 3], DSCR4[Down syndrome crisis district gene 4], DSCR6[Down syndrome crisis district gene 6], DSERG1[Down syndrome cerebral lesion related protein 1], DSG1[desmoglein 1], DSG2[desmoglein 2], The DSP[desmoplakin], DST[dystonia albumen], DSTN[cracks albumen (actin factor lytic)], The little myotrophy protein-binding protein 1 of DTNBP1[], Fool's [fool's homologue (Africa xenopus)], DUSP1[dual specificity phosphatase 1], DUSP13[dual specificity phosphatase 13], DUSP6[dual specificity phosphatase 6], The DUT[uracil deoxyriboside triphosphatase], The DVL1[disheveled protein, dsh homologue 1 (fruit bat)], DYRK1A[is dual-specificity tyrosine-(Y)-phosphorylation kinases 1A], DYRK3[is dual-specificity tyrosine-(Y)-phosphorylation kinases 3], DYSF[dysferlin albumen, limb-girdle muscular dystrophy 2B (autosomal recessive)], DYX1C1[dysphrasia neurological susceptibility 1 candidate gene 1], E2F1[E2F transcription factor 1], EARS2[Glutamyl-tRNA synthetase 2, mitochondria (supposition)], The early stage B cell factor 4 of EBF4[], ECE1[endothelin converting enzyme 1], The ECHS1[enoyl-CoA hydratase, short chain, 1, mitochondria], EDN1[Endothelin 1], EDN2[Endothelin 2], EDN3[Endothelin 3], EDNRA[endothelin receptor type A], EDNRB[endothelin receptor type B], The EEF1A1[Translation elongation factor 1 alpha 1], EEF2[eukaryotic translation elongation factor 2], EEF2K[eucaryon elongation factor-2 kinases], EFHA1[EF-chirality territory family, member A1], EFNA1[pterinophore-A1], EFNA2[pterinophore-A2], EFNA3[pterinophore-A3], EFNA4[pterinophore-A4], EFNA5[pterinophore-A5], EFNB2[pterinophore-B2], EFNB3[pterinophore-B3], EFS[embryo Fyn related substrates], EGF[EGF (β-anthelone)], EGFR[EGF-R ELISA (EBL virus (v-erb-b) oncogene homologue, birds)], EGLN1[egl nine homologues 1 (Caenorhabditis elegans)], The EGR1[early growth replys 1], The EGR2[early growth replys 2], The EGR3[early growth replys 3], EHHADH[alkene acyl-coacetylase, hydrase/3-hydroxyalkyl coa dehydrogenase], EHMT2[euchromatin histone-lysine N-transmethylase 2], EID1[differentiation EP300 interaction inhibiting factor 1], EIF1AY[eukaryotic translation initiation factor 1A, Y-is chain], EIF2AK2[eukaryotic translation initiation factor 2-alpha kinase 2], EIF2AK3[eukaryotic translation initiation factor 2-alpha kinase 3], EIF2B2[eukaryotic translation initiation factor 2B, 2 β of subunit, 39kDa], EIF2B5[eukaryotic translation initiation factor 2B, 5 ε of subunit, 82kDa], EIF2S1[eukaryotic translation initiation factor 2,1 α of subunit, 35kDa], EIF2S2[eukaryotic translation initiation factor 2,2 β of subunit, 38kDa], EIF3M[eukaryotic translation initiation factor 3, the M of subunit], EIF4E[eukaryotic translation initiation factor 4E], EIF4EBP1[eukaryotic translation initiation factor 4E Binding Protein 1], EIF4G1[eukaryotic translation initiation factor 4 γ, 1], EIF4H[eukaryotic translation initiation factor 4H], The ELANE[elastoser, neutrophil leucocyte is expressed], ELAVL1[ELAV (embryonic death, abnormal vision, fruit bat) sample 1 (Hu antigen R)], ELAVL3[ELAV (embryonic death, abnormal vision, fruit bat) sample 3 (Hu antigens c)], ELAVL4[ELAV (embryonic death, abnormal vision, fruit bat) sample 4 (Hu antigen D)], ELF5[E74 like factor 5 (ets domain transcription factor)], ELK1[ELK1, member ETS Oncogene family], ELMO1[engulfs and cell mobility 1], The ELN[elastin laminin], ELP4[extended proteins matter 4 homologues (saccharomyces cerevisiae)], EMP2[epithelia membrane protein white matter 2], EMP3[epithelia membrane protein white matter 3], The empty passage homology of EMX1[frame 1], The empty passage homology of EMX2[frame 2], EN1[zigzag homology frame 1], EN2[zigzag homology frame 2], ENAH[enables homologue (fruit bat)], ENDOG[endonuclease G], The ENG[endothelial factor], The ENO1[enolase1, (α)], ENO2[enolase 2 (γ, neuron)], ENPEP[glutamyl aminopeptidase (Aminopeptidase A)], Outer pyrophosphatase/the phosphodiesterase 1 of ENPP1[nucleotides], Outer pyrophosphatase/the phosphodiesterase 2 of ENPP2[nucleotides], ENSA[endosulfine α], ENSG00000174496[], ENSG00000183653[], ENSG00000215557[], The outer triphosphoric acid diphosphonic acid hydrolase 1 of ENTPD1[nucleosides], EP300[E1A is in conjunction with albumen p300], The EPCAM[epithelial cell adhesion molecule], EPHA1[EPH acceptor A1], EPHA10[EPH acceptor A10], EPHA2[EPH acceptor A2], EPHA3[EPH acceptor A3], EPHA4[EPH acceptor A4], EPHA5[EPH acceptor A5], EPHA6[EPH acceptor A6], EPHA7[EPH acceptor A7], EPHA8[EPH acceptor A8], EPHB1[EPH acceptor B1], EPHB2[EPH acceptor B2], EPHB3[EPH acceptor B3], EPHB4[EPH acceptor B4], EPHB6[EPH acceptor B6], EPHX2[EH 2, cytoplasm], The EPM2A[epilepsy, carrying out property myoclonia type 2A, Lafora disease (laforin)], The EPO[hematopoietin], The EPOR[EPO Receipter], EPRS[glutamy-prolyl-tRNA synzyme], EPS15[EGF-R ELISA approach substrate 15], ERBB2[v-erb-b2 EBL viral oncogene homologue 2, nerve/spongioblastoma derives oncogene homologue (birds)], ERBB3[v-erb-b2 EBL viral oncogene homologue 3 (birds)], ERBB4[v-erb-a EBL viral oncogene homologue 4 (birds)], ERC2[ELKS/RAB6 combination/CAST family member 2], The ERCC2[excision repair cross complementing rodent repair deficiency, complementary group 2], The ERCC3[excision repair cross complementing rodent repair deficiency, complementary group 3 (xeroderma pitmentosum group B supplements)], The ERCC5[excision repair cross complementing rodent repair deficiency, complementary group 5], The ERCC6[excision repair cross complementing rodent repair deficiency, complementary group 6], The ERCC8[excision repair cross complementing rodent repair deficiency, complementary group 8], EREG[investigation mission outside the city or town albumen], ERG[v-ets marrow erythroblastosis virus E26 oncogene homologue (birds)], The ERVWE1[endogenous retrovirus W of family, env (C7), the member 1], ESD[esterase D/ formylglutation hydrolase], ESR1[ERs 1], ESR2[estrogen receptor 2 (ER β)], ESRRA[estrogen-related receptor α], ESRRB[estrogen-related receptor β], ETS1[v-ets marrow erythroblastosis virus E26 oncogene homologue 1 (birds)], ETS2[v-ets marrow erythroblastosis virus E26 oncogene homologue 2 (birds)], ETV1[ets variant 1], ETV4[ets variant 4], ETV5[ets variant 5], ETV6[ets variant 6], The EVL[Enah/Vasp sample], EXOC4[steeps outer complex component 4], EXOC8[steeps outer complex component 8], EXT1[exostosis (various) 1], EXT2[exostosis (various) 2], The enhancer 2 (fruit bat) of EZH2[zeste homologue 2], The EZR[ezrin], F12[Hageman factor (the Hageman factor)], F2[prothrombin (fibrin ferment)], F2R[prothrombin (fibrin ferment) acceptor], F2RL1[prothrombin (fibrin ferment) acceptor sample 1], F3[thromboplastin (factor I, tissue factor)], F7[proconvertin (serum haemoglutinin transform promote because of)], The F8[blood coagulation factor VIII, short blood coagulation component], The F9[plasma thromboplastin component], The FAAH[fatty acid amide hydrolase], FABP3[fatty acid binding protein 3, muscle and the heart (mammary gland-derivative GIF)], The FABP4[FABP4, adipocyte], FABP5[FABP 5 (psoriasis is relevant)], FABP7[fatty acid binding protein 7, brain], FADD[Fas (TNFRSF6)-relevant via dead district], FADS2[fatty acid desaturase 2], The FAM120C[sequence similarity 120C of family], FAM165B[sequence similarity family 165, member B], FAM3C[sequence similarity family 3, member C], FAM53A[sequence similarity family 53, member A], FARP2[FERM, RhoGEF and pleckstrin territory protein 2], The FARSA[Phenylalanyl-tRNA synthetase, alpha subunit], FAS[Fas (TNF receptor superfamily, the member 6)], FASLG[Fas part (TNF superfamily, the member 6)], The FASN[fatty acid synthetase], FASTK[Fas-activates serine/threonine kinase], FBLN1[fibula albumen 1], The FBN1[fibrillin-1], FBP1[fructose-1[6-bisphosphate 1], FBXO45[F-frame protein 45], FBXW5[contains F-frame and WD duplicate domain 5], FBXW7[contains F-frame and WD duplicate domain 7], FCER2[Fc fragment IGE, low-affinity II, acceptor (CD23)], The Fc fragment of FCGR1A[IgG, high-affinity Ia, acceptor (CD64)], The Fc fragment of FCGR2A[IgG, low-affinity IIa, acceptor (CD32)], The Fc fragment of FCGR2B[IgG, low-affinity IIb, acceptor (CD32)], The Fc fragment of FCGR3A[IgG, low-affinity IIIa, acceptor (CD16a)], FCRL3[Fc acceptor sample 3], FDFT1[farnesyl-diphosphonic acid method acyltransferase 1], FDX1[ferredoxin 1], The FDXR[ferredoxin reductase], FECH[ferrochelatase (protoporphyria)], FEM1A[fem-1 homologue A (Caenorhabditis elegans)], FER[fer (fps/fes is relevant) EGFR-TK], FES[feline sarcoma oncogene], FEZ1[bunchy and extended proteins matter ζ 1 (vertebra protein I)], FEZ2[bunchy and extended proteins matter ζ 2 (vertebra protein I I)], FEZF 1[FEZ family zinc refers to 1], FEZF2[FEZ family zinc refers to 2], FGF1[desmocyte growth factor-21 (acidity)], FGF19[desmocyte growth factor-21 9], FGF2[FGF2 (alkalescence)], FGF20[FGF2 0], FGF3[fibroblast growth factor 3 (mouse mammary tumor virus integration site (v-int-2) oncogene homologue)], FGF4[fibroblast growth factor 4], The FGF5[FGF5], FGF7[fibroblast growth factor 7 (keratinocyte growth factor)], FGF8[FGF8 (androgen-guiding)], FGF9[FGF9 (Deiter's cells-activation factor)], FGFBP1[fibroblast growth factor Binding Protein 1], FGFR1[fibroblast growth factor acceptor 1], The FGFR2[fibroblast growth factor acceptor 2], The FGFR3[fibroblast growth factor receptor3], The FGFR4[fibroblast growth factor receptor 4], The FHIT[Relationship between Fragile Histidine Triad Gene], FHL1[4 half LIM domain 1], FHL2[4 half LIM domain 2], FIBP[fibroblast growth factor (acidity) ICBP], FIGF[c-fos guides growth factor (vascular endothelial growth factor D)], The dry albumen sample 1 of FIGNL1[], FKBP15[FK506 Binding Protein 15,133kDa], FKBP1B[FK506 Binding Protein 1 B, 12.6kDa], FKBP5[FK506 is in conjunction with albumen 5], FKBP6[FK506 is in conjunction with albumen 6,36kDa], FKBP8[FK506 is in conjunction with albumen 8,38kDa], FKTN[fukutin], The FLCN[folliculin], FLG[silk polyprotein], The FLI1[Friend leukemia virus integrates 1], FLNA[tenuin A, α], FLNB[tenuin B, β], FLNC[tenuin C, γ], The FLT1[fms EGFR-TK 1 (VEGF/vascular permeability factor acceptor) of being correlated with], The FLT3[fms EGFR-TK 3 of being correlated with], FMN1[formin 1], FMNL2[formin sample 2], FMR1[fragile X mental retardation 1], FN1[fibronectin 1], FOLH1[folic acid hydrolase (Prostato-specific membrane antigen) 1], FOLR1[folacin receptor 1 (growing up)], FOS[FBJ mouse osteosarcoma virus oncogene homologue], FOSB[FBJ mouse osteosarcoma virus oncogene homologue B], FOXC2[jaw frame C2 (MFH-1, mesenchymal cell jaw 1)], FOXG1[jaw frame G1], FOXL2[jaw frame L2], FOXM1[jaw frame M1], FOXO1[jaw frame O1], FOXO3[jaw frame O3], FOXP2[jaw frame P2], FOXP3[jaw frame P3], FPR1[formyl peptide acceptor 1], FPR2[formyl peptide acceptor 2], FRMD7[contains FERM territory 7], FRS2[fibroblast growth factor acceptor substrate 2], FRS3[fibroblast growth factor acceptor substrate 3], The FRYL[FRY sample], FSCN1[flesh fasciclin homologue 1, actin-fasciclin matter (strongylocentrotus purpuratus)], The FSHB[follicular stimulating hormone, beta polypeptides], The FSHR[follicle-stimulating hormone receptor], FST[folliculus stabilize proteins], FSTL1[folliculus stabilize proteins sample 1], FSTL3[folliculus stabilize proteins sample 3 (glycoprotein secretions)], FTCD[formimino transferase ring desaminase], The FTH1[ferritin, heavy chain polypeptide 1], The FTL[ferritin, light chain polypeptide], FTMT[ferritin mitochondria], FTSJ1[FtsJ homologue 1 (Escherichia coli)], The FUCA1[fucosidase, α-L-1, tissue], FURIN[furin (basic amino acid lyases in pairs)], FUT 1[fucosyltransferase 1 (galactoside 2-α-L-fucose based transferase, H blood group)], FUT4[fucosyltransferase 4 (α (1[3) fucosyltransferase, marrow-specificity)], FXN[Fu Shi incoordination albumen], The FXR1[fragile X mental retardation, autosome homologue 1], The FXR2[fragile X mental retardation, autosome homologue 2], The ion transfer regulatory factor 1 that FXYD1[contains the FXYD territory], FYB[FYN is in conjunction with albumen (FYB-120/130)], FYN[FYN oncogene related SR C, FGR, YES], The curling homologue 1 of FZD1[(fruit bat)], The curling homologue 10 of FZD10[(fruit bat)], The curling homologue 2 of FZD2[(fruit bat)], The curling homologue 3 of FZD3[(fruit bat)], The curling homologue 4 of FZD4[(fruit bat)], The curling homologue 5 of FZD5[(fruit bat)], The curling homologue 6 of FZD6[(fruit bat)], The curling homologue 7 of FZD7[(fruit bat)], The curling homologue 8 of FZD8[(fruit bat)], The curling homologue 9 of FZD9[(fruit bat)], Relevant 1 (fruit bat) of FZR1[fizzy/ CDC 20], The G6PD[glucose-6-phosphate dehydrogenase (G6PD)], The GAA[glucuroide, α; Acid], GAB 1[GRB2 Binding proteins 1], GABARAP[GABA (A) receptor associated protein white matter], GABBR1[GABA (GABA) B acceptor, 1], GABBR2[GABA (GABA) B acceptor, 2], The GABPA[GA conjugated protein transcription factor, alpha subunit 60kDa], GABRA1[GABA (GABA) A acceptor, α 1], GABRA2[GABA (GABA) A acceptor, α 2], GABRA3[GABA (GABA) A acceptor, α 3], GABRA4[GABA (GABA) A acceptor, α 4], GABRA5[GABA (GABA) A acceptor, α 5], GABRA6[GABA (GABA) A acceptor, α 6], GABRB1[GABA (GABA) A acceptor, β 1], GABRB2[GABA (GABA) A acceptor, β 2], GABRB3[GABA (GABA) A acceptor, β 3], GABRD[GABA (GABA) A acceptor, δ], GABRE[GABA (GABA) A acceptor, ε], GABRG1[GABA (GABA) A acceptor, γ 1], GABRG2[GABA (GABA) A acceptor, γ 2], GABRG3[GABA (GABA) A acceptor, γ 3], GABRP[GABA (GABA) A acceptor, π], GAD1[glutamate decarboxylase 1 (brain, 67kDa)], GAD2[glutamate decarboxylase 2 (pancreas islet and brain, 65kDa)], GAL[galanin prepropeptide], GALE[UDP-galactolipin-4-epimerase], GALK1[galactokinase 1], GALT[galactose-1-phosphate uridyl transferase], GAP43[growth associated protein matter 43], The GAPDH[glyceraldehyde-3-phosphate dehydrogenase], The GARS[Glycyl-tRNA synthetase], GART[phosphoribosyl glycinamide formyl transferase, Phosphoribosylglycinamide synthetase, Phosphoribosyl aminooimidazole synzyme], GAS1[growth retardation-specificity 1], GAS6[growth retardation-specificity 6], The GAST[gastrin], GATA1[GATA Binding Protein 1 (globin transcription factor 1)], GATA2[GATA is in conjunction with albumen 2], GATA3[GATA is in conjunction with albumen 3], The GATA4[GATA conjugated protein 4], GATA6[GATA is in conjunction with albumen 6], The GBA[glucuroide, β, acid], GBE1[glucan (1[4-α-), branching enzyme 1], The GBX2[primitive gut forms brain homology frame 2], GC[group-specificity component (DBP)], The GCG[hyperglycemic factor], GCH1[GTP cyclization hydrolase 1], GCNT1[glucose amido (N-acetyl) transferase 1, core 2], GDAP1[gangliosides-induce and break up related protein 1], GDF1[growth and differentiation factor 1], GDF11[growth and differentiation factor 11], The GDF15[growth and differentiation factor 15], GDF7[growth and differentiation factor 7], The GDI1[GDP inhibiting factor 1 of dissociating], The GDI2[GDP inhibiting factor 2 of dissociating], The glial cell derived neurotrophic factor of GDNF[], GDPD5[contains phosphoglycerol diester phosphodiesterase territory 5], In GEM[skeletal muscle, gtp binding protein is crossed expression], GFAP[glial fibrillary acidic protein matter], The GFER[growth factor, the liver regeneration spreading factor], GFI1B[growth factor 1B transcription inhibition factor that has nothing to do], GFRA1[GDNF family receptors α 1], GFRA2[GDNF family receptors α 2], GFRA3[GDNF family receptors α 3], GFRA4[GDNF family receptors α 4], GGCX[gamma-glutamyl carboxylase], The GGNBP2[gamete is grown protein-binding protein 2], GGT1[gamma glutamyltransferase 1], GGT2[gamma glutamyltransferase 2], The GH1[growth hormone 1], The GHR[growth hormone receptor], The GHRH[growth hormone releasing hormone], The GHRHR[ghrh receptor], GHRL[motilin/obestatin prepropeptide], the GHSR[secretagogue receptor], GIPR[gastric inhibitory polypepitde acceptor], GIT1[G protein-coupled receptor kinase is in conjunction with ArfGAP1], The GJA1[gap junction protein, α Isosorbide-5-Nitrae 3kDa], The GJA4[gap junction protein, α 4,37kDa], The GJA5[gap junction protein, α 5,40kDa], The GJB1[gap junction protein, β 1,32kDa], The GJB2[gap junction protein, β 2,26kDa], The GJB6[gap junction protein, β 6,30kDa], The GLA[galactosidase, α], The GLB1[galactosidase, β 1], GLDC[Gly dehydrogenase (decarboxylation)], GLI1[GLI family zinc refers to 1], GLI2[GLI family zinc refers to 2], GLI3[GLI family zinc refers to 3], GLIS1[GLIS family zinc refers to 1], GLIS2[GLIS family zinc refers to 2], The GLO1[GLO-I], GLRA2[Gly acceptor, α 2], GLRB[Gly acceptor, β], The GLS[glutaminase], GLUD1[glutamte dehydrogenase 1], GLUD2[glutamte dehydrogenase 2], GLUL[glutamic acid-ammonia ligase (glutamine synthelase)], GLYAT[Gly-N-acyltransferase], GMFB[Deiter's cells maturation factor, β], GMNN[joint conference albumen, the DNA replication dna inhibiting factor], GMPS[guanine one phosphate synthase], GNA11[guanine-nucleotide-binding protein (G protein), α 11 (Gq class)], GNA12[guanine-nucleotide-binding protein (G protein) α 12], GNA13[guanine-nucleotide-binding protein (G protein), α 13], GNA14[guanine-nucleotide-binding protein (G protein), α 14], GNA15[guanine-nucleotide-binding protein (G protein), α 15 (Gq class)], GNAI1[guanine-nucleotide-binding protein (G protein), α suppresses active peptides 1], GNAI2[guanine-nucleotide-binding protein (G protein), α suppresses active peptides 2], GNAI3[guanine-nucleotide-binding protein (G protein), α suppresses active peptides 3], GNAL[guanine-nucleotide-binding protein (G protein), α activating activities polypeptide, sense of smell type], GNAO1[guanine-nucleotide-binding protein (G protein), α activating activities polypeptide O], GNAQ[guanine-nucleotide-binding protein (G protein), the q polypeptide], The GNAS[GNAS complex locus], GNAT1[guanine-nucleotide-binding protein (G protein), α transduction activity polypeptide 1], GNAT2[guanine-nucleotide-binding protein (G protein), α transduction activity polypeptide 2], GNAZ[guanine-nucleotide-binding protein (G protein), α z polypeptide], GNB1[guanine-nucleotide-binding protein (G protein), beta polypeptides 1], GNB1L[guanine-nucleotide-binding protein (G protein), beta polypeptides 1 sample], GNB2[guanine-nucleotide-binding protein (G protein), beta polypeptides 2], GNB2L1[guanine-nucleotide-binding protein (G protein), beta polypeptides 2 samples 1], GNB3[guanine-nucleotide-binding protein (G protein), beta polypeptides 3], GNB4[guanine-nucleotide-binding protein (G protein), beta polypeptides 4], GNB5[guanine-nucleotide-binding protein (G protein), β 5], GNG10[guanine-nucleotide-binding protein (G protein), γ 10], GNG11[guanine-nucleotide-binding protein (G protein), γ 11], GNG12[guanine-nucleotide-binding protein (G protein), γ 12], GNG13[guanine-nucleotide-binding protein (G protein), γ 13], GNG2[guanine-nucleotide-binding protein (G protein), γ 2], GNG3[guanine-nucleotide-binding protein (G protein), γ 3], GNG4[guanine-nucleotide-binding protein (G protein), γ 4], GNG5[guanine-nucleotide-binding protein (G protein), γ 5], GNG7[guanine-nucleotide-binding protein (G protein), γ 7], The molten albumen of GNLY[grain], GNRH1[gonadotropic hormone-releasing hormone 1 (leuteinization-releasing hormone)], GNRHR[gonadotropic hormone-releasing hormone receptor], GOLGA2[Golgi apparatus protein A2], GOLGA4[Golgi apparatus protein A4], GOT2[glutamic-oxaloacetic transaminase 2, mitochondria (aspartate transaminase 2)], GP1BA[glycoprotein ibalpha (blood platelet), the α polypeptide], GP5[glycoprotein V (blood platelet)], GP6[Glycoprotein VI (blood platelet)], GP9[glycoprotein I X (blood platelet)], GPC1[glypican 1], GPC3[glypican 3], GPD1[glycerol-3-phosphate dehydrogenase 1 (solvable)], GPHN[bridge tail albumen], The GPI[glucosephosphate isomerase], GPM6A[glycoprotein M6A], GPM6B[glycoprotein M6B], GPR161[G protein-coupled receptor 161], GPR182[G protein-coupled receptor 182], GPR56[G protein-coupled receptor 56], GPRC6A[G protein-coupled receptor, the C of family, organize 6, member A], The G protein regulation inducible factor 1 of GPRIN1[axon elongation], GPT[glutamic-pyruvic transaminase (alanine aminotransferase)], GPT2[glutamic-pyruvic transaminase (GPT) (alanine aminotransferase) 2], GPX1[glutathione peroxidase 1], GPX3[glutathione peroxidase 3 (blood plasma)], GPX4[glutathione peroxidase 4 (phosphatide hydroperoxidase)], The relevant factor protein matter that is connected of GRAP[GRB2], GRB10[growth factor receptors bindin 10], The GRB2[growth factor receptors is in conjunction with albumen 2], The GRB7[growth factor receptors is in conjunction with albumen 7], GREM1[gremlin1, cysteine knot superfamily, homologue (Africa xenopus)], The GRIA1[glutamate receptor, ionic, AMPA1], The GRIA2[glutamate receptor, ionic, AMPA2], The GRIA3[glutamate receptor, iodine nutrition, AMPA3], The GRID2[glutamate receptor, ionic, δ 2], The GRID2IP[glutamate receptor, ionic, δ 2 (Grid2) is in conjunction with albumen], The GRIK1[glutamate receptor, ionic, kainic acid 1], The GRIK2[glutamate receptor, ionic, kainic acid 2], The GRIN1[glutamate receptor, ionic, N-methyl D-Asp 1], The GRIN2A[glutamate receptor, ionic, N-methyl D-Asp 2A], GRIP1[glutamate receptor Binding Protein 1], GRLF1[glucocorticoid receptor dna binding factor 1], The GRM1[glutamate receptor, metabotropic 1], The GRM2[glutamate receptor, metabotropic 2], The GRM5[glutamate receptor, metabotropic 5], The GRM7[glutamate receptor, metabotropic 7], The GRM8[glutamate receptor, metabotropic 8], The GRN[granulin], GRP[gastrin-release peptide], GRPR[gastrin-releasing peptide receptor], GSK3B[glycogen synthase kinase 3 β], The GSN[gelsolin], The GSR[glutathione reductase], The GSS[glutathione synthetase], GSTA1[glutathione S-transferase α 1], GSTM1[glutathione S-transferase μ 1], GSTP1[glutathione S-transferase π 1], GSTT1[glutathione S-transferase θ 1], GSTZ1[glutathione transferase ζ 1], The general transcription factor IIB of GTF2B[], The general transcription factor IIE of GTF2E2[, polypeptide 2, β 34kDa], The general transcription factor IIH of GTF2H1[, polypeptide 1,62kDa], The general transcription factor IIH of GTF2H2[, polypeptide 2,44kDa], The general transcription factor IIH of GTF2H3[, polypeptide 3,34kDa], The general transcription factor IIH of GTF2H4[, polypeptide 4,52kDa], The general transcription factor IIi of GTF2I[], GTF2IRD1[contains GTF2I duplicate domain 1], GTF2IRD2[contains GTF2I duplicate domain 2], GUCA2A[guanylate cyclase activity factor 2A (amidine albumen)], GUCY1A3[guanylate cyclase 1, solvable, α 3], The GUSB[glycuronidase, β], GYPA[glycophorin A (MNS blood group)], GYPC[glycophorin C (Gerbich blood group)], GZF1[GDNF-can induce zinc finger protein matter 1], GZMA[granzyme A (granzyme 1, cytotoxin T-lymphocyte be correlated with serine easterase 3)], GZMB[granzyme B (granzyme 2, cytotoxin T-lymphocyte be correlated with serine easterase 1)], H19[H19, the maternal expression transcript of trace (nonprotein coding)], The H1F0[H1 histone family, the member 0], The H2AFX[H2A histone family, member X], The H2AFY[H2A histone family, member Y], H6PD[hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)], HADHA[hydroxyalkyl-coa dehydrogenase/3-ketone ethyl-coacetylase thiolase/alkene acyl-CoA hydratase (trifunctional protein), alpha subunit], HAMP[iron is adjusted plain antibacterial peptide], The HAND1[heart and neural crest derivative express 1], The HAND2[heart and neural crest derivative express 2], HAP1[Huntington protein related protein 1], The HAPLN1[hyaluronic acid is connected protein 1 with proteoglycans], The HARS[Histidyl-tRNA synthetase], HAS1[hyaluronic acid synthetase 1], HAS2[hyaluronic acid synthetase 2], The HAS3[hyaluronic acid synthase 3], HAX1[HCLS1 related protein X-1], The HBA2[hemoglobin, α 2], The HBB[hemoglobin, β], HBEGF[Heparin-binding EGF like growth factor], The HBG1[hemoglobin, γ], The HBG2[hemoglobin, γ G], The full cytochrome c synzyme of HCCS[(cytochrome c ferroheme-lyase)], HCK[hemopoietic cell kinases], HCLS1[hematopoietic cell-specificity Lyn substrate 1], The HCN4[hyperpolarization activates cyclic nucleotide-gate potassium channel 4], Low albumen (appetite albumen) the neuropeptide precursor of secreting of HCRT[], Low albumen (appetite albumen) acceptor 1 of secreting of HCRTR1[], Low albumen (appetite albumen) acceptor 2 of secreting of HCRTR2[], HDAC1[histone deacetylase 1], HDAC2[histone deacetylase 2], HDAC4[histone deacetylase 4], HDAC9[histone deacetylase 9], The HDC[histidine decarboxylase], The HDLBP[HDL is in conjunction with albumen], HEPACAM[liver cell adhesion molecule], HES1[crinosity and enhancer, rupture 1, (fruit bat)], HES3[crinosity and enhancer, 3 (fruit bats) of rupturing], HES5[crinosity and enhancer, 5 (fruit bats) of rupturing], HES6[crinosity and enhancer, 6 (fruit bats) of rupturing], HEXA[hexosaminidase A (α polypeptide)], HFE[hemochromatosis disease], 2 (childhood) of HFE2[hemochromatosis disease type], HGF[HGF (hepatocyte growth factor A; Dispersion factor)], HGS[HGF-regulation and control tyrosine kinase substrate], The homology frame is expressed in HHEX[hematopoiesis], The HHIP[hedgehog is in conjunction with albumen], The HIF1A[oxygen deficient induction factor 1, alpha subunit (alkaline helix-loop-helix transcription factor)], HINT1[histidine triplet nucleotide binding protein 1], HIPK2[homeodomain interaction protein kinases 2], HIRA[HIR histone cell cycle regulating defect homologue A (saccharomyces cerevisiae)], HIRIP3[HIRA interaction protein 3], HIST1H2AB[histone 1, the H2ab that troops], HIST1H2AC[histone 1, the H2ac that troops], HIST1H2AD[histone 1, the H2ad that troops], HIST1H2AE[histone 1, the H2ae that troops], HIST1H2AG[histone 1, the H2ag that troops], HIST1H2AI[histone 1, the H2ai that troops], HIST1H2AJ[histone 1, the H2aj that troops], HIST1H2AK[histone 1, the H2ak that troops], HIST1H2AL[histone 1, the H2al that troops], HIST1H2AM[histone 1, the H2am that troops], HIST1H3E[histone 1, the H3e that troops], HIST2H2AA3[histone 2, the H2aa3 that troops], HIST2H2AA4[histone 2, the H2aa4 that troops], HIST2H2AC[histone 2, the H2ac that troops], HKR1[GLI-Kruppel family member HKR1], The HLA-A[major histocompatibility complex, class I,], The HLA-B[major histocompatibility complex, class I, B], The HLA-C[major histocompatibility complex, class I, C], The HLA-DMA[major histocompatibility complex, class II, DM α], The HLA-DOB[major histocompatibility complex, class II, DO β], The HLA-DQA1[major histocompatibility complex, class II, DQ α 1], The HLA-DQB1[major histocompatibility complex, class II, DQ β 1], The HLA-DRA[major histocompatibility complex, class II, DR α], The HLA-DRB1[major histocompatibility complex, class II, DR β 1], The HLA-DRB4[major histocompatibility complex, class II, DR β 4], The HLA-DRB5[major histocompatibility complex, class II, DR β 5], The HLA-E[major histocompatibility complex, class I, E], The HLA-F[major histocompatibility complex, class I, F], The HLA-G[major histocompatibility complex, class I, G], HLCS[holocarboxylase synthetase (biotin-(propiono-coacetylase-carboxylase (ATP-hydrolysis)) ligase)], HMBS[methylol Choline synzyme], HMGA1[high mobility group AT-hook 1], HMGA2[high mobility group AT-hook 2], HMGB1[is high-mobility group frame 1], HMGCR[3-hydroxy-3-methyl glutaryl-CoA-reductase], HMGN1[is high-and mobility group nucleosome is in conjunction with territory 1], HMOX1[Heme oxygenase (unlinking) 1], HMOX2[Heme oxygenase (unlinking) 2], HNF1A[HNF1 is with source capsule A], The HNF4A[Hepatocyte nuclear factor 4, α], The HNMT[histamine N-methyl transferase], HNRNPA2B1[hnRNP A2/B1], HNRNPK[hnRNP K], HNRNPL[hnRNP L], HNRNPU[hnRNP U (support connection factors A)], HNRPDL[hnRNP D sample], HOMER1[homer homologue 1 (fruit bat)], HOXA1[homology frame A1], HOXA10[homology frame A10], HOXA2[homology frame A2], HOXA5[homology frame A5], HOXA9[homology frame A9], HOXB1[homology frame B1], HOXB4[homology frame B4], HOXB9[homology frame B9], HOXD11[homology frame D11], HOXD12[homology frame D12], HOXD13[homology frame D13], The HP[haptoglobin], HPD[4-HPPA dioxygenase], HPRT1[hypoxanthine phosphoribosyltransferase 1], HPS4[Albinism with hemorrhagic diathesis and reticuloendothelial cell pigmentation 4], The HPX[hemopexin], HRAS[v-HA-ras Harvey rat sarcoma virus oncogene homologue], The rich histidine glycoprotein of HRG[], The HRH1[histamine H_1 receptor], HRH2[histamine receptor H2], HRH3[histamine receptor H3], HSD11B1[hydroxy steroid (11-β) dehydrogenase 1], HSD11B2[hydroxy steroid (11-β) dehydrogenase 2], HSD17B10[hydroxy steroid (17-β) dehydrogenase 10], HSD3B2[hydroxyl-δ-5-steroid dehydrogenase, 3 β-and steroids δ-isomerase 2], HSF1[Features of The Heat Shock Transcription Factor 1], HSP90AA1[heat shock protein 90kDa α (cytoplasm), class A member 1], HSP90B1[heat shock protein 90kDa β (Grp94), the member 1], HSPA1A[heat shock 70kDa protein 1A], HSPA4[heat shock 70kDa protein 4], HSPA5[heat shock 70kDa protein 5 (glucose-regulation protein, 78kDa)], HSPA8[heat shock 70kDa protein 8], HSPA9[heat shock 70kDa protein 9 (lethal albumen)], HSPB1[heat shock 27kDa protein 1], HSPD1[heat shock 60kDa protein 1 (chaperone)], HSPE1[heat shock 10kDa protein 1 (cpn10)], HSPG2[heparan sulfate proteoglycan 2], HTN1[histamine element 1], HTR1A[5-hydroxytryptamine (thrombocytin) acceptor 1A], HTR1B[5-hydroxytryptamine (thrombocytin) acceptor 1B], HTR1D[5-hydroxytryptamine (thrombocytin) acceptor 1D], HTR1E[5-hydroxytryptamine (thrombocytin) acceptor 1E], HTR1F[5-hydroxytryptamine (thrombocytin) acceptor 1F], HTR2A[5-hydroxytryptamine (thrombocytin) acceptor 2A], HTR2B[5-hydroxytryptamine (thrombocytin) acceptor 2B], HTR2C[5-hydroxytryptamine (thrombocytin) acceptor 2C], HTR3A[5-hydroxytryptamine (thrombocytin) acceptor 3A], HTR3B[5-hydroxytryptamine (thrombocytin) acceptor 3B], HTR5A[5-hydroxytryptamine (thrombocytin) acceptor 5A], HTR6[5-hydroxytryptamine (thrombocytin) acceptor 6], 7 (adenyl cyclase-couplings) of HTR7[5-hydroxytryptamine (thrombocytin) acceptor], The HTT[Huntington protein], HYAL1[Hyaluronoglucosaminidase 1], The HYOU1[anoxic raises 1], The IAPP[IAPP], IBSP[integrin bound sialic acid protein], The ICAM1[ICAM-1], ICAM2[ICAIU 2], ICAM3[ICAIU 3], ICAM5[ICAIU 5, akrencephalon albumen], ICOS[can induce T-cell costimulator], ID1[suppresses DNA in conjunction with 1, dominant negative helix-loop-helix protein matter], ID2[suppresses DNA in conjunction with 2, dominant negative helix-loop-helix protein matter], ID3[suppresses DNA in conjunction with 3, dominant negative helix-loop-helix protein matter], ID4[suppresses DNA in conjunction with 4, dominant negative helix-loop-helix protein matter], IDE[insulin-digestive enzyme], IDI1[iso-amylene-diphosphonic acid δ isomerase 1], IDO1[indoleamine 2 [3-dioxygenase 1], IDS[sweat acid 2-sulfatase], IDUA[sweat acid enzyme, α-L-], IER3[replys 3 immediately in early days], IFI27[interferon, but α-induced protein 27], The IFNA1[interferon, α 1], The IFNA2[interferon, α 2], IFNAR1[interferon (α, β and Ω) acceptor 1], IFNAR2[interferon (α, β and Ω) acceptor 2], The IFNB1[interferon, β 1, fibroblast], The IFNG[interferon, γ], IFNGR1[interferon gamma receptor 1], IFNGR2[interferon gamma receptor 2 (interferon gamma transduced element 1)], IGF1[type-1 insulin like growth factor (somatomedin C)], IGF1R[type-1 insulin like growth factor acceptor], IGF2[IMA-IGF2BP3-001 (SM-A)], IGF2R[IMA-IGF2BP3-001 acceptor], The IGFBP1[IGFBP-1], The IGFBP2[IGFBP2,36kDa], The IGFBP3[IBP3], The IGFBP4[IGFBP4], The IGFBP5[IGFBP5], The IGFBP6[IGFBP6], The IGFBP7[PSF], The constant α 1 of IGHA1[heavy chain immunoglobulin], The constant ε of IGHE[heavy chain immunoglobulin], The constant γ 1 of IGHG1[heavy chain immunoglobulin (G1m label)], The IGHJ1[heavy chain immunoglobulin connects 1], IGHM[heavy chain immunoglobulin constant-mu], The IGHMBP2[immune globulin Mu is in conjunction with albumen 2], κ is constant for the IGKC[immunoglobulin (Ig)], The inhibitor of IKBKAP[B cell κ light chain polypeptide gene promoter, the kinases complex protein of being correlated with], The inhibitor of IKBKB[B cell κ light chain polypeptide gene promoter, kinase beta], IKZF1[IKAROS family zinc refers to 1 (IKAROS)], The IL10[interleukin 10], The IL10RA[Interleukin 10 receptor, α], The IL10RB[Interleukin 10 receptor, β], The IL11[interleukin-11], IL11RA[interleukin-11 acceptor, α], The IL12A[interleukin 12 (natural kill cell stimulating factor 1, cytotoxic lymphocytic maturation factor 1, p35)], IL12B[interleukin 12 B (natural kill cell stimulating factor 2, cytotoxic lymphocytic maturation factor 2, p40)], IL12RB1[interleukin 12 acceptor, β 1], The IL13[interleukin-13], The IL15[interleukin 15], IL15RA[interleukin 15 acceptor, α], IL16[interleukins 16 (IL-16)], The IL17A[IL-17], IL18[interleukin-18 (interferon-γ-Guiding factor)], The IL18BP[interleukin-18 is in conjunction with albumen], The IL1A[interleukin 1, α], The IL1B[interleukin 1, β], IL1F7[interleukin 1 family, member 7 (ζ)], The IL1R1[interleukin 1 receptor, type I], The IL1R2[interleukin 1 receptor, Type II], IL1RAPL1[interleukin 1 receptor auxiliary protein sample 1], IL1RL1[interleukin 1 receptor sample 1], IL1RN[interleukin 1 receptor antagonist], The IL2[interleukin 2], The IL21[IL-21], IL22[interleukin 2 2], The IL23A[interleukin 23, alpha subunit p19], IL23R[interleukin 23 acceptor], IL29[interleukin 29 (interferon, λ 1)], The IL2RA[Interleukin-2 Receptor, α], The IL2RB[Interleukin-2 Receptor, β], IL3[interleukin Ⅲ (colony-stimulating factor, various)], IL3RA[interleukin Ⅲ acceptor, α (low-affinity)], The IL4[interleukin-4], IL4R[interleukin-4 acceptor], IL5[t cell growth factor (colony-stimulating factor, eosinophil)], IL6[interleukin-6 (interferon, β 2)], The IL6R[interleukin-6 receptor], IL6ST[interleukin-6 signal transduction (gp130, oncostatin M receptor)], The IL7[interleukin-17], The IL7R[interleukin-17 receptor], The IL8[interleukin 8], The IL9[Interleukin-9], ILK[integrin-chain kinases], IMMP2L[IMP2 inner wire Mitochondria Membrane peptase sample (saccharomyces cerevisiae)], IMMT[internal membrane protein, mitochondria (mitofilin)], IMPA1[inositol (muscle)-1 (or 4)-monophosphate enzyme 1], IMPDH2[IMP (inosine monophosphate) dehydrogenase 2], INADL[InaD sample (fruit bat)], The inner centromere protein matter of INCENP[antigen 1 35/155kDa], ING1[suppresses growth family, and the member 1], ING3[suppresses growth family, and the member 3], INHA[suppresses, α], INHBA[suppresses, β A], INPP1[inositol polyphosphoric acids-1-phosphatase], INPP5D[inositol polyphosphoric acids-5-phosphatase, 145kDa], INPP5E[inositol polyphosphoric acids-5-phosphatase, 72kDa], INPP5J[inositol polyphosphoric acids-5-phosphatase J], INPPL1[inositol polyphosphoric acids phosphatase sample 1], INS[insulin], INSIG2[insulin guiding gene 2], INS-IGF2[INS-IGF2 read-through transcription thing], INSL3[Insulin-Like 3 (interstitial glands)], The INSR[insulin receptor], INVS[inversion albumen], IQCB1[contains IQ motif B1], The GTP enzyme activation protein 1 that IQGAP1[contains the IQ motif], IRAK1[interleukin 1 receptor associated kinase 1], IRAK4[interleukin 1 receptor associated kinase 4], IREB2[iron-reacted constituent is in conjunction with albumen 2], IRF1[interferon regulatory factor 1], IRF4[interferon regulatory factor 4], IRF8[interferon regulatory factor 8], The IRS1[substrate 1], IRS2[IRS 2], IRS4[IRS 4], The easy Lip river of IRX3[chief family homology frame 3], The ISG15[ISG15 Ubiquitin like modifier], ISL1[ISLLIM homology frame 1], ISL2[ISLLIM homology frame 2], The ISLR2[immunoglobulin superfamily contains leucine-rich repeat 2], The ITGA2[integrin, α 2 (CD49B, α 2 VLA-2 of subunit acceptors)], The ITGA2B[integrin, α 2b (platelet glycoprotein IIbIIb/IIIa complex, antigen CD4 1)], The ITGA3[integrin, α 3 (antigen CD4 9C, α 3 VLA-3 of subunit acceptors)], The ITGA4[integrin, α 4 (antigen CD4 9D, alpha-4 subunit VLA-4 acceptor)], The ITGA5[integrin, α 5 (fibronectin receptor, α polypeptide)], The ITGA6[integrin, α 6], The ITGA9[integrin, α 9], The ITGAL[integrin, (α L (antigens c D11A (p180), LFA 1; The α polypeptide)], The ITGAM[integrin, α M (complement component 3 acceptor 3 subunits)], The ITGAV[integrin, α V (Vitronectic receptor, α polypeptide, antigens c D51)], The ITGAX[integrin, α X (complement component 3 acceptor 4 subunits)], The ITGB1[integrin, β 1 (antigens c D29 comprises MDF2, MSK12 for fibronectin receptor, beta polypeptides)], The ITGB2[integrin, β 2 (complement component 3 acceptors 3 and 4 subunits)], The ITGB3[integrin, β 3 (platelet glycoprotein IIIa, antigens c D61)], The ITGB4[integrin, β 4], The ITGB6[integrin, β 6], The ITGB7[integrin, β 7], M-α (globulin) inhibiting factor H4 (plasma kallikrein-responsive glycoprotein) in ITIH4[], ITM2B[integral protein 2B], ITPR1[inositol 1[4[5-triphosphate receptor, Class1], ITPR2[inositol 1[4[5-triphosphate receptor, type 2], ITPR3[inositol 1[4[5-triphosphate receptor, type 3], ITSN1[intersects albumen 1 (SH3 territory protein)], ITSN2[intersects albumen 2], IVL[bud albumen], JAG1[zigzag 1 (Alagille syndrome)], JAK1[Janus kinases 1], JAK2[Janus kinases 2], JAK3[Janus kinases 3], JAM2[connects adhesion molecule 2], JARID2[jumonji, rich AT is in conjunction with territory 2], JMJD1C[contains jumonji territory 1C], JMY[connects mediation and regulation protein, p53 co-factor], JRKL[jerking movement homologue sample (mouse)], The JUN[jun oncogene], JUNB[junB is former-oncogene], JUND[junD is former-oncogene], JUP[connects plakoglobin], KAL1[promoting sexual gland hormone is not enough and anosmia syndrome 1 sequence], KALRN[potassium albumen, the RhoGEF kinases], KARS[lysine-tRNA synzyme], KAT2B[K (lysine) transacetylase 2B], KATNA1[katanin p60 (containing the ATP enzyme) subunit A 1], KATNB1[katanin p80 (the containing the WD repetitive sequence) B1 of subunit], KCNA4[potassium voltage-gated channel, the vibrator subfamily of being correlated with, the member 4], KCND1[potassium voltage-gated channel, the Shal subfamily of being correlated with, the member 1], KCND2[potassium voltage-gated channel, the Shal subfamily of being correlated with, the member 2], KCNE1[potassium voltage-gated channel, the Isk family that is correlated with, the member 1], KCNE2[potassium voltage-gated channel, the Isk family that is correlated with, the member 2], KCNH2[potassium voltage-gated channel, subfamily H (eag is relevant), the member 2], KCNH4[potassium voltage-gated channel, subfamily H (eag is relevant), the member 4], KCNJ15[potassium inward rectification passage, subfamily J, the member 15], KCNJ3[potassium inward rectification passage, subfamily J, the member 3], KCNJ4[potassium inward rectification passage, subfamily J, the member 4], KCNJ5[potassium inward rectification passage, subfamily J, the member 5], KCNJ6[potassium inward rectification passage, subfamily J, the member 6], The large electricity of KCNMA1[potassium is led calcium-activate channel, subfamily M, α member 1], In KCNN1[potassium/and small-conductance calcium-activate channel, subfamily N, the member 1], In KCNN2[potassium/and small-conductance calcium-activate channel, subfamily N, the member 2], In KCNN3[potassium/and small-conductance calcium-activate channel, subfamily N, the member 3], KCNQ1[potassium voltage-gated channel, KQT sample subfamily, the member 1], KCNQ2[potassium voltage-gated channel, KQT sample subfamily, the member 2], KDM5C[lysine (K)-specificity demethylase 5C], The KDR[kinases inserts domain receptor (a type-iii receptor tyrosine kinase)], KIAA0101[KIAA0101], KIAA0319[KIAA0319], KIAA1715[KIAA1715], KIDINS220[kinases D bound substrates, 220kDa], KIF15[filamentous actin family member 15], KIF16B[filamentous actin family member 16B], KIF1A[filamentous actin family member 1A], KIF2A[filamentous actin heavy chain member 2A], KIF2B[filamentous actin family member 2B], KIF3A[filamentous actin family member 3A], KIF5C[filamentous actin family member 5C], KIF7[filamentous actin family member 7], The KIR2DL1[killer cell immunoglobulin-like receptors, two territories, long cytoplasmic tail, 1], The KIR2DL3[killer cell immunoglobulin-like receptors, two territories, long cytoplasmic tail, 3], The KIR2DS2[killer cell immunoglobulin-like receptors, two territories, short cytoplasmic tail, 2], The KIR3DL1[killer cell immunoglobulin-like receptors, three territories, long cytoplasmic tail, 1], The KIR3DL2[killer cell immunoglobulin-like receptors, three territories, long cytoplasmic tail, 2], KIRREL3[IRRE sample 3 (fruit bats) of the same clan], KISS1[KiSS-1 transfer-inhibiting factor], The KISS1R[KISS1 acceptor], KIT[v-kitHardy-Zuckerman4 cat sarcoma virus oncogene homologue], The KITLG[KIT part], KL[klotho], KLF7[Kruppel like factor 7 (ubiquity)], KLK1[kallikrein 1], The KLK10[kallikrein peptase 10 of being correlated with], The KLK11[kallikrein peptase 11 of being correlated with], The KLK2[kallikrein peptase 2 of being correlated with], The KLK3[kallikrein peptase 3 of being correlated with], The KLK5[kallikrein peptase 5 of being correlated with], KLRD1[killer cell agglutinin receptor subfamily D, the member 1], KLRK1[killer cell agglutinin receptor subfamily K, the member 1], KMO[Kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)], The KNG1[Prokineticin 1], KPNA2[nucleoplasmin α 2 (RAG group's albumen 1, input protein alpha 1)], KPNB1[nucleoplasmin (input albumen) β 1], KPTN[kaptin (actin binding protein)], Kras[v-Ki-ras2Kirsten rat sarcoma virus oncogene homologue], KRIT1[KRIT1, ankyrin repeat contains], The KRT1[Keratin 1], The KRT10[Keratin 10], The KRT14[Keratin 14], The KRT18[Keratin 18], The KRT19[Keratin 19], KRT3[keratin 3], The KRT5[keratin 5], The KRT7[Keratin 7], The KRT8[CK8], KRTAP19-3[keratin related protein 19-3], KRTAP2-1[keratin related protein 2-1], The L1CAM[L1 cell adhesion molecule], The LACTB[lactamase, β], The LALBA[lactoalbumin, α-], The LAMA1[laminin, α 1], The LAMB1[laminin, β 1], The LAMB2[laminin, β 2 (laminin S)], The LAMB4[laminin, β 4], LAMP1[lysosome related membrane protein matter 1], LAMP2[lysosome related membrane protein matter 2], LAP3[leucine aminopeptidase 3], LAPTM4A[lysosomal protein cross-film 4 α], LARGE[sample-glycosyl transferase], The LARS[Leucyl-tRNA synthetase], LASP1[LIM and SH3 protein 1], The LAT2[T cell activation is connected factor family, and the member 2], The LBP[lipopolysaccharide binding protein], LBR[lamin B acceptor], LCA10[lung cancer associated proteins matter 10], The congenital blindness 5 of LCA5[Leber], The LCAT[lecithin cholesterol acyltransferase], LCK[lymphocyte-specific protein EGFR-TK], LCN1[fat calcium albumen 1 (lachrymal gland prealbumin)], LCN2[fat calcium albumen 2], LCP1[lymphocyte cytoplasmic protein 1 (L-fimbrin)], LCP2[lymphocyte cytoplasmic protein 2 (the 76kDa leucocyte protein that contains the SH2 territory)], The LCT[lactase], The LDB1[LIM territory is in conjunction with 1], The LDB2[LIM territory is in conjunction with 2], The LDHA[lactic dehydrogenase], LDLR[low density lipoprotein acceptor], LDLRAP1[low density lipoprotein acceptor is connected factor protein matter 1], LEF1[lymph enhancer binding factor 1], LEO1[Leo1, Paf1/RNA polymerase II complex component, homologue (saccharomyces cerevisiae)], The LEP[leptin], The LEPR[leptin receptor], The LGALS13[agglutinin, the galactoside combination, solvable, 13], The LGALS3[agglutinin, the galactoside combination, solvable, 3], The LGMN[legumain], The G protein coupled receptor 4 that LGR4[contains leucine-rich repeat], LGTN[connects albumen], LHCGR[luteinizing hormone(LH/chorionic gonadotropin acceptor], LHFPL3[lipoma HMGIC merges collocation thing sample 3], LHX1[LIM homology frame 1], LHX2[LIM homology frame 2], LHX3[LIM homology frame 3], LHX4[LIM homology frame 4], LHX9[LIM homology frame 9], LIF[LIF ELISA (cholinergic differentiation factor)], LIFR[leukemia inhibitory factor receptor α], LIG1[ligase I, DNA, ATP-dependence], LIG3[ligase III, DNA, ATP-dependence], LIG4[ligase IV, DNA, ATP-dependence], LILRA3[leukocytic immunity globulin sample acceptor, subfamily A (there is no the TM territory), the member 3], LILRB1[leukocytic immunity globulin sample acceptor, subfamily B (TM and ITIM territory), the member 1], LIMK1[LIM territory kinases 1], LIMK2[LIM territory kinases 2], LIN7A[lin-7 homologue A (Caenorhabditis elegans)], LIN7B[lin-7 homologue B (Caenorhabditis elegans)], LIN7C[lin-7 homologue C (Caenorhabditis elegans)], LINGO1[contains leucine-rich repeat and Ig territory 1], LIPC[lipase, liver], LIPE[lipase, hormone-sensitivity], The lethal gigantism young of LLGL1[homologue 1 (fruit bat)], The LMAN1[agglutinin, mannose combination, 1], The LMNA[Lamin A/C], LMO2[is LIM territory 2 (oblique side's albumen sample 1) only], LMX1A[LIM homeobox transcription factor 1, α], LMX1B[LIM homeobox transcription factor 1, β], LNPEP[leucyl/cysteine aminopeptidase], LOC400590[supposes LOC400590], The similar hCG1774990 of LOC646021[], The similar hCG1991475 of LOC646030[], LOC646627[phosphatidase inhibiting factor], The LOR[loricrin], The LOX[lysyl oxidase], LOXL1[lysyl oxidase sample 1], LPA[lipoprotein, Lp (a)], The LPL[lipoprotein lipase], The LPO[lactoperoxidase], LPP[contains the preferred transposition collocation of LIM territory lipoma thing], LPPR1[lipophosphatidic acid acid phosphatase GAP-associated protein GAP Class1], LPPR3[lipophosphatidic acid acid phosphatase GAP-associated protein GAP type 3], LPPR4[lipophosphatidic acid acid phosphatase GAP-associated protein GAP type 4], LPXN[leupaxin], LRP1[low density lipoprotein receptor associated protein white matter 1], LRP6[low density lipoprotein receptor associated protein white matter 6], LRP8[low density lipoprotein receptor associated protein white matter 8, the apo e acceptor], LRPAP1[low density lipoprotein RAP qualitative correlation protein 1], LRPPRC[contains rich leucine PPR motif], LRRC37B[contains rich leucic repetitive sequence 37B], LRRC4C[contains rich leucic repetitive sequence 4C], LRRTM1[leucine-rich repeat cross-film neuron 1], LSAMP[limbic system associated membrane protein matter], The LSM2[LSM2 homologue, U6 small nuclear rna be correlated with (saccharomyces cerevisiae)], LSS[lanosterol synzyme (2[3-oxygen MF59-lanosterol cyclase)], LTA[lymphotoxin α (TNF superfamily, the member 1)], The LTA4H[leukotriene A 4 hydrolase], LTBP1[latent transforming growth factor-beta Binding Protein 1], LTBP4[latent transforming growth factor-beta conjugated protein 4], LTBR[lymphotoxin-beta-receptor (TNFR superfamily, the member 3)], LTC4S[leukotriene C synzyme], The LTF[lactotransferrin], LY96[lymphocyte antigen 96], LYN[v-yes-1Yamaguchi sarcoma virus Related oncogene homologue], LYVE1[lymphatic endothelial hyaluronic acid receptor 1], M6PR[Man-6-P acceptor (cation dependence)], MAB21L1[mab-21 sample 1 (Caenorhabditis elegans)], MAB21L2[mab-21 sample 2 (Caenorhabditis elegans)], MAF[v-maf aponeurosis fibrosarcoma oncogene homologue (birds)], The MAG[Myelin-associated glycoprotein], The MAGEA1[melanoma antigen A of family, 1 (antigen MZ2-E is expressed in indication)], MAGEL2[MAGE sample 2], MAL[mal, T-Cell Differentiation protein], MAML2[mastermind sample 2 (fruit bat)], The MAN2A1[mannosidase, α, class 2A, the member 1], The MANBA[mannosidase, β A, lysosome], MANF[midbrain astroglia-derived neurotrophic factor], The MAOA[MAOA], The MAOB[MAO-B], MAP1B[microtubule-associated proteins 1B], MAP2[microtubule-associated proteins 2], MAP2K1[mitogen activated protein kinase kinases 1], MAP2K2[mitogen activated protein kinase kinases 2], MAP2K3[mitogen activated protein kinase kinases 3], MAP2K4[mitogen activated protein kinase kinases 4], MAP3K1[mitogen activated protein kinase kinase kinase 1], MAP3K12[mitogen activated protein kinase kinase kinase 12], MAP3K13[mitogen activated protein kinase kinase kinase 13], MAP3K14[mitogen activated protein kinase kinase kinase 14], MAP3K4[mitogen activated protein kinase kinase kinase 4], MAP3K7[mitogen activated protein kinase kinase kinase 7], MAPK1[mitogen activated protein kinase 1], MAPK10[mitogen activated protein kinase 10], MAPK14[mitogen activated protein kinase 14], MAPK3[mitogen activated protein kinase 3], MAPK8[mitogen activated protein kinase 8], MAPK8IP2[mitogen activated protein kinase 8 is in conjunction with albumen 2], MAPK8IP3[mitogen activated protein kinase 8 is in conjunction with albumen 3], MAPK9[mitogen activated protein kinase 9], MAPKAPK2[mitogen activated protein kinase-activated protein kinase 2], MAPKSP1[MAPK scaffold protein 1], The MAPRE3[microtubule-associated proteins, RP/EB family, the member 3], MAPT[microtubule-associated proteins τ], The rich myristoylation alanine of MARCKS[protein kinase C substrate], MARK1[MAP/ microtubule affinity-regulation and control kinases 1], MARK2[MAP/ microtubule affinity-regulation and control kinases 2], MAT2A[methionine adenosyltransferase II, α], MATR3[stromatin 3], MAX[MYC correlation factor X], MAZ[MYC associated zinc finger matter (purine is in conjunction with transcription factor)], The MB[myoglobins], MBD1[methyl-CpG binding domain protein matter 1], MBD2[methyl-CpG binding domain protein matter 2], MBD3[methyl-CpG binding domain protein matter 3], MBD4[methyl-CpG binding domain protein matter 4], MBL2[mannose binding lectin (protein C) 2, solvable (opsonin defect)], The MBP[MBP ELISA], The MBTPS1[film is in conjunction with the transcription factor peptase, position 1], MC1R[melanocyte cortex hormone of aadrenaline 1 acceptor (α msh receptor)], MC3R[melanocyte cortex hormone of aadrenaline 3 acceptors], MC4R[melanocyte cortex hormone of aadrenaline 4 acceptors], MCCC2[methyl butene acyl-coacetylase carboxylase 2 (β)], MCF2L[MCF.2 clone derives the transforming sequence sample], MCHR1[melanocyte-concentrated hormone receptor 1], MCL1[bone marrow cell leukaemia sequence 1 (BCL2 is relevant)], The MCM7[minichromosome maintains complex component 7], MCPH1[cerebellum disease gene 1], MDC1[amboceptor DNA-damages prosecution point 1], MDFIC[contains MyoD family inhibiting factor territory], The phosphoglycerol inositol grappling 1 that MDGA1[contains the MAM territory], MDK[Midkine (axon growth-startup factor 2)], MDM2[Mdm2p53 is in conjunction with albumen homology thing (mouse)], ME2[malate dehydrogenase 2, NAD (+)-dependence, mitochondria], MECP2[methyl CpG in conjunction with albumen 2 (the Rett autism, Dementia and ataxia syndrome)], MED1[amboceptor complex subunit 1], MED12[amboceptor complex subunit 12], MED24[amboceptor complex subunit 24], MEF2A[myocyte enhancer factor 2A], MEF2C[myocyte enhancer factor 2C], MEIS1[MEIS homology frame 1], The multiple endocrine knurl of MEN1[I], MERTK[c-mer is former-the oncogene EGFR-TK], 2 homologues (mouse) after the MESP2[mesoderm], MEST[mesoderm specific transcriptional thing homologue (mouse)], MET[met is former-oncogene (hepatocyte growth factor receptor)], The METAP2[human methionine aminopeptidase 2], METRN[nickel line albumen, spongiocyte differentiation regulatory factor], MFSD6[contains main helper factor superfamily territory 6], MGAT2[mannose group (α-1[6-)-glycoprotein β-1[2-N-acetylglucosaminyl transferase], MGMT[O-6-methyl guanine-dnmt rna], MGP[matrix GLA protein], MGST1[microsome glutathione S-transferase 1], MICA[MHC class I polypeptide correlated series A], MICAL1[contains the relevant monoxygenase of microtubule, Calponin and LIM territory 1], MICB[MHC class I polypeptide correlated series B], MIF[macrophage migration inhibitory factor (glycosylation-inhibiting factor)], MITF[ommatidium associated transcription factor], The antigen of MKI67[Monoclonal antibody Ki-67 identification], MKKS[McKusick-Kaufman syndrome], The MKNK1[MAP kinases is in conjunction with serine/threonine kinase 1], MKRN3[makorin ring finger protein 3], MKS1[Meckel syndrome, 1], MLH1[mutL homologue 1, colon cancer, without polyposis type 2 (Escherichia coli)], MLL[marrow/lymph or mixing-be leukaemia (three chest homologues, fruit bat)], MLLT4[marrow/lymph or mixing-be leukaemia (three chest homologues, fruit bat); Transposition, 4], MLPH[melanocyte Avidin], MLX[MAX sample protein X], MLXIPL[MLX is in conjunction with the albumen sample], MME[film metal-endopeptidase], MMP1[matrix metal peptase 1 (interstitial collagenase)], MMP10[matrix metal peptase 10 (molten stromatin 2)], MMP12[matrix metal peptase 12 (MMP12)], MMP13[matrix metal peptase 13 (clostridiopetidase A 3)], MMP14[matrix metal peptase 14 (film-embedding)], MMP2[matrix metal peptase 2 (gelatinase A, 72kDa gelatinase, 72kDa type I V clostridiopetidase A)], MMP24[matrix metal peptase 24 (film-embedding)], MMP26[matrix metal peptase 26], MMP3[matrix metal peptase 3 (molten stromatin 1, front gelatinase)], MMP7[matrix metal peptase 7 (mating GAP-associated protein GAP, uterus)], MMP8[matrix metal peptase 8 (neutrophil collagenase)], MMP9[matrix metal peptase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V clostridiopetidase A)], MN1[meningioma (upset balanced translocation) 1], MNAT1[menage a trois homologue 1, cyclin H assembly factor (Africa xenopus)], MNX1[motor neuron and pancreas homology frame 1], The MOG[myelin oligodendrocyte glycoprotein], MPL[myelosis leukemia virus oncogene], The MPO[myeloperoxidase], The MPP1[memebrane protein, palmitoylation 1,55kDa], MPZL1[myelin protein matter zero sample 1], The MR1[major histocompatibility complex, class I is relevant], MRAP[melanocyte cortex hormone of aadrenaline 2 acceptor auxiliary proteins], MRAS[muscle RAS oncogene homologue], The MRC1[mannose receptor, the C Class1], The MRGPRX1[MAS GPR that is correlated with, member X1], MS4A1[film-leap 4-territory, subfamily A, the member 1], MSH2[mutS homologue 2, colon cancer, without polyposis Class1 (Escherichia coli)], MSH3[mutS homologue 3 (Escherichia coli)], MSI1[Musashi homologue 1 (fruit bat)], The MSN[moesin], MSR1[macrophage clearing factor acceptor 1], The MSTN[myostatin], MSX1[msh homology frame 1], MSX2[msh homology frame 2], The MT2A[metallothionein 2A], MT3[metallothionein 3], MT-ATP6[mitochondria coding ATP synzyme 6], MT-CO1[mitochondria Codocyte pigment c oxidizing ferment I], MT-CO2[mitochondria Codocyte pigment c oxidizing ferment II], MT-carbon dioxide [mitochondria Codocyte pigment c oxidizing ferment III], MTF1[metal-regulative transcription factor 1], MTHFD1[methylenetetrahydrofolate dehydrogenase (NADP+ dependence) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase], MTHFD1L[methylenetetrahydrofolate dehydrogenase (NADP+ dependence) 1 sample], MTHFR[5[10-MTHFR (NADPH)], MTL5[metallothionein sample 5, Testiculo-specificity (tesmin)], MTMR14[flesh tubulin related protein 14], MT-ND6[mitochondria coding nadh dehydrogenase 6], MTNR1A[melatonin receptors 1A], The MTNR1B[Melatonin receptor 1B], The mechanism target (serine/threonine kinase) of MTOR[rapamycin], MTR[5-methyl tetrahydrofolate-homocysteine methyl transferase], MTRR[5-methyl tetrahydrofolate-homocysteine methyl transferase reductase], MTTP[microsome triglyceride transferring protein], The MUC1[MUC-1, cell surface is relevant], MUC16[MUC-1 6, cell surface is relevant], MUC19[MUC-1 9, oligomeric], The MUC2[MUC-2, oligomeric mucus/formation gel], MUC3A[MUC-3 A, cell surface is relevant], MUC5AC[mucoprotein 5AC, oligomeric mucus/formation gel], MUSK[muscle, bone, receptor tyrosine kinase], MUT[methylmalonyl CoA mutarotase], The MVK[mevalonate kinase], The main fornix protein of MVP[], MX1[myxovirus (influenza virus) resistance 1, but interferon-induced protein p78 (mouse)], MXD1[MAX dimerization protein 1], MXI1[MAX binding factor 1], MYB[v-myb medulloblastoma virus oncogene homologue (birds)], MYC[v-myc myelocytomatosis viral oncogene homologue (birds)], MYCBP2[MYC is in conjunction with albumen 2], MYCN[v-myc myelocytomatosis virus Related oncogene, neuroblastoma derives (birds)], MYD88[marrow differentiation primary response gene (88)], The MYF5[myogenicity factor 5], The MYH10[myosin, heavy chain 10, non-muscle], The MYH14[myosin, heavy chain 14, non-muscle], The MYH7[myosin, heavy chain 7, cardiac muscle, β], The MYL1[myosin, light chain 1, alkali; Bone, fast], The MYL10[myosin, light chain 10, regulation and control], The MYL12A[myosin, light chain 12, regulation and control, non-striated muscle], The MYL12B[myosin, light chain 12B, regulation and control], The MYL2[myosin, light chain 2, regulation and control, heart, slowly], The MYL3[myosin, light chain 3, alkali; Ventricle, bone, slowly], The MYL4[myosin, light chain 4, alkali; Atrium, the embryo], The MYL5[myosin, light chain 5, regulation and control], The MYL6[myosin, light chain 6, alkali, smooth muscle and non-muscle], The MYL6B[myosin, light chain 6B, alkali, smooth muscle and non-muscle], The MYL7[myosin, light chain 7, regulation and control], The MYL9[myosin, light chain 9, regulation and control], The MYLK[MLCK], MYLPF[myosin light chain, but phosphorylation, quick skeletal muscle], MYO1D[myoglobulin I D], MYO5A[myosin VA (heavy chain 12, myoxin)], The MYOC[actin, trabecular network can induce glucocorticoid to reply], MYOD1[myogenicity differentiation 1], MYOG[myogenin (the myogenicity factor 4)], Albumen between MYOM2[flesh (M-protein) 2,165kDa], MYST3[MYST histone acetyltransferase (monocytic leukemia) 3], The newborn polypeptide related complexes of NACA[alpha subunit], The NAGLU[N-acetylglucosaminidase, α-], NAIP[NLR family, iap protein matter], The NAMPT[Nampt], NANOG[Nanog homology frame], NANS[N-acetyl acid synzyme], NAP1L2[nucleosome assembly protein 1 sample 2], NAPA[N-second maleimide-sensitive factor connects protein, α], NAPG[N-second maleimide-sensitive factor connects protein, γ], NAT2[N-transacetylase 2 (arylamine N-acetyl-transferase)], The NAV1[neuron guiding factor 1], The NAV3[neuron guiding factor 3], The neural long-pending albumen of NBEA[], NCALD[neurocalcin δ], NCAM1[N-CAM 1], NCAM2[N-CAM 2], NCF1[neutrophil leucocyte cytoplasmic factor 1], NCF2[neutrophil leucocyte cytoplasmic factor 2], NCK1[NCK is connected factor protein matter 1], NCK2[NCK is connected factor protein matter 2], NCKAP1[NCK related protein 1], The NCL[nucleolin], NCOA2[nuclear receptor coactivator 2], NCOA3[nuclear receptor coactivator 3], NCOR1[nuclear receptor Corepressors 1], NCOR2[nuclear receptor Corepressors 2], NDE1[nudE core distribution gene E homologue 1 (aspergillus nidulans)], NDEL1[nudE core distribution gene E homologue (aspergillus nidulans) sample 1], NDN[necdin homologue (mouse)], NDNL2[necdin sample 2], NDP[fetal iritis syndrome sick (pseudoglioma)], NDUFA1[NADH dehydrogenase (ubiquinone) 1 α complex, 1,7.5kDa], NDUAB1[NADH dehydrogenase (ubiquinone) 1, the sub-complex of α/β, 1,8kDa], NDUFS3[NADH dehydrogenase (ubiquinone) Fe-S protein 3,30kDa (NADH-ubiquinone reductase)], NDUFV3[NADH dehydrogenase (ubiquinone) flavoprotein 3,10kDa], The NEDD4[neural precursor is expressed, and grows and lowers 4], The NEDD4L[neural precursor is expressed, and grows and lowers 4 samples], The NEFH[neurofilament, heavy chain polypeptide], The NEFL[neurofilament, light chain polypeptide], The NEFM[neurofilament, the medium polypeptide], The NENF[NDNF], NEO1[regenerated protein homologue 1 (chicken)], The nested albumen of NES[], The NET1[epithelial cell transforms 1], NEU1[sialidase 1 (lysosome sialidase)], NEU3[sialidase 3 (film sialidase)], NEUROD1[neurogenicity differentiation 1], NEUROD4[neurogenicity differentiation 4], The neural element 1 of NEUROG1[], The neural element 2 of NEUROG2[], NF1[neurofibromin 1], NF2[neurofibromin 2 (merlin)], NFASC[neurofascin homologue (chicken)], NFAT5[activation T-nuclear factor 5, the elasticity of muscle-replying], NFATC1[activation T-nuclear factor, cytoplasm, calcineurin-dependence 1], NFATC2[activation T-nuclear factor, cytoplasm, calcineurin-dependence 2], NFATC3[activation T-nuclear factor, cytoplasm, calcineurin-dependence 3], NFATC4[activation T-nuclear factor, cytoplasm, calcineurin-dependence 4], NFE2L2[nuclear factor (granulophilocyte-derivative 2) sample 2], NFIC[nuclear factor I/C (CCAAT is in conjunction with transcription factor)], The NFIL3[nuclear factor, the interleukin Ⅲ regulation and control], NFKB1[B cell kappa light polypeptide gene enhancer nuclear factor 1], NFKB2[B cell kappa light polypeptide gene enhancer nuclear factor 2 (p49/p100)], NFKBIA[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor, α], NFKBIB[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor, β], NFKBIL1[B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor sample 1], NFYA[nuclear factor Y, α], NFYB[nuclear factor Y, β], NGEF[neuron guanine nucleotide exchange factor], NGF[nerve growth factor (beta polypeptides)], NGFR[trk C (TNFR superfamily, the member 16)], NGFRAP1[trk C (TNFRSF16) related protein 1], NHLRC1[contains NHL repetitive sequence 1], NINJ1[ninjurin1], NINJ2[ninjurin2], NIP7[core is inputted 7 homologues (saccharomyces cerevisiae)], The non-marking 1 of the happy puppet syndrome of NIPA1[Prader-Willi/], The non-marking 2 of the happy puppet syndrome of NIPA2[Prader-Willi/], NIPAL1[contains NIPA sample territory 1], NIPAL4[contains NIPA sample territory 4], NIPSNAP1[nipsnap homologue 1 (Caenorhabditis elegans)], NISCH[nischarin], NIT2[nitrilase family, the member 2], NKX2-1[NK2 homology frame 1], NKX2-2[NK2 homology frame 2], The neural albumen 1 that connects of NLGN1[], The neural albumen 2 that connects of NLGN2[], The neural albumen 3 that connects of NLGN3[], The neural albumen 4 that connects of NLGN4X[, X-is chain], The neural albumen 4 that connects of NLGN4Y[, Y-is chain], NLRP3[NLR family, contain hot albumen territory 3], The NMB[Neuropeptide B], NME1[non-metastatic cell 1, protein (NM23A) is expressed], NME2[non-metastatic cell 2, protein (NM23B) is expressed], NME4[non-metastatic cell 4, protein expression], NNAT[neuronatin], NOD1[contains nucleotides in conjunction with oligomerization territory 1], NOD2[contains nucleotides in conjunction with oligomerization territory 2], The NOG[noggin], NOL6[nucleolus protein family 6 (RNA is relevant)], NOS1[nitric oxide synthase 1 (neuron)], NOS2[nitric oxide synthase 2, can induce], NOS3[nitric oxide synthase 3 (endothelial cell)], The NOSTRIN[nitric oxide synthase transportation factor], NOTCH1[Notch homologue 1, transposition be correlated with (fruit bat)], NOTCH2[Notch homologue 2 (fruit bat)], NOTCH3[Notch homologue 3 (fruit bat)], November [wilm tumor is crossed expressing gene], NOVA1[nerve-tumour abdomen antigen 1], NOVA2[nerve-tumour abdomen antigen 2], NOX4[NADPH oxidizing ferment 4], NPAS4[neuron Hypoxia Inducible Factor-2 matter 4], NPFF[neuropeptide FF-amidated peptide precursor], NPHP1[nephrophthisis 1 (childhood)], NPHP4[nephrophthisis 4], NPHS1[nephrosis 1, congenital, Finland's type (ephrosis albumen)], NPM1[nuclear phosphoprotein (nucleolar phosphoprotein B23, nuclear matrix protein)], NPPA[natriuretic peptide precursor A], NPPB[natriuretic peptide precursor B], NPPC[natriuretic peptide precursor C], NPR1[natriuratic peptide receptor A/ guanylate cyclase A (atrial natriuretic peptide acceptor A)], NPR3[natriuratic peptide receptor C/ guanylate cyclase C (atrial natriuretic peptide acceptor C)], NPRL2[nitrogen permease regulatory factor sample 2 (saccharomyces cerevisiaes)], NPTX1[neuron PTX-3 I], NPTX2[neuron PTX-3 II], The NPY[neuropeptide tyrosine], NPY1R[neuropeptide Y receptor Y1], NPY2R[neuropeptide Y receptor Y2], NPY5R[neuropeptide Y receptor Y5], NQO1[NAD (P) H dehydrogenase, quinone 1], NQO2[NAD (P) H dehydrogenase, quinone 2], NR0B1[nuclear receptor subunit family 0, group B, the member 1], NR0B2[nuclear receptor subunit family 0, group B, the member 2], NR1H3[nuclear receptor subunit family 1, group H, the member 3], NR1H4[nuclear receptor subunit family 1, group H, the member 4], NR1I2[nuclear receptor subunit family 1, group I, the member 2], NR1I3[nuclear receptor subunit family 1, group I, the member 3], NR2C1[nuclear receptor subunit family 2, group C, the member 1], NR2C2[nuclear receptor subunit family 2, group C, the member 2], NR2E1[nuclear receptor subunit family 2, group E, the member 1], NR2F1[nuclear receptor subunit family 2, group F, the member 1], NR2F2[nuclear receptor subunit family 2, group F, the member 2], NR3C1[nuclear receptor subunit family 3, group C, member 1 (GCR)], NR3C2[nuclear receptor subunit family 3, group C, the member 2], NR4A2[nuclear receptor subunit family 4, group A, the member 2], NR4A3[nuclear receptor subunit family 4, group A, the member 3], NR5A1[nuclear receptor subunit family 5, group A, the member 1], NR6A1[nuclear receptor subunit family 6, group A, the member 1], NRAS[neuroblastoma RAS virus (v-ras) oncogene homologue], NRCAM[neuronal cell adhesion molecule], NRD1[nardil lyases (N-arginine two alkali invertases)], NRF1[core is breathed the factor 1], The NRG1[neuregulin 1], NRIP1[nuclear receptor Binding Protein 1], NRN1[neural process albumen 1], NRP1[neuropilin 1], NRP2[neuropilin 2], NRSN1[neurensin1], The neural order albumen of NRTN[], NRXN1[neuronin 1], NRXN3[neuronin 3], The NSD1[nuclear receptor is in conjunction with SET territory protein 1], NSF[N-second maleimide-sensitive factor], NSUN5[NOP2/ sun territory family, the member 5], NT5E[5 '-nucleotidase, outer (CD73)], The NTF3[NT3], The NTF4[NT4], NTHL1[nth endonuclease III sample 1 (Escherichia coli)], NTN1[spindle albumen 1], NTN3[spindle albumen 3], NTN4[spindle albumen 4], NTNG1[spindle Protein G 1], NTRK1[neurotrophy EGFR-TK, acceptor, Class1], NTRK2[neurotrophy EGFR-TK, acceptor, type 2], NTRK3[neurotrophy EGFR-TK, acceptor, type 3], The NTS[neurotensin], NTSR1[neurotensin acceptor 1 (high-affinity)], NUCB2[core connects albumen 2], NUDC[core distribution gene C homologue (aspergillus nidulans)], NUDT6[nudix (the chain part X of nucleoside diphosphate)-type motif 6], NUDT7[nudix (the chain part X of nucleoside diphosphate)-type motif 7], Numb [numb homologue (fruit bat)], NUP98[nucleoporin 98kDa], The NUPR1[nucleoprotein, transcription regulatory factor, 1], The NXF1[nRNA output factor 1], NXNL1[core redox protein sample 1], The OAT[OAT], OCA2[eyelid albinism II], OCLN[shading albumen], The OCM[oncomodulin], The ODC1[ornithine decarboxylase 1], OFD1[actinal surface section digital synthesis levies 11], OGDH[oxoglutarate (KG) dehydrogenase (lipoamide)], OLA1[Obg sample ATP enzyme 1], OLIG1[oligodendroglia transcription factor 1], The OLIG2[oligodendroglia is transcription factor 2], OLR1[oxidized low density lipoprotein (agglutinin) acceptor 1], The OMG[oligodendrocyte myelin glycoprotein], The few diaphragm albumen 1 of OPHN1[], OPN1SW[opsin 1 (cone pigment), short-Bo-sensitivity], The OPRD1[Opioid Receptors, δ 1], The OPRK1[Opioid Receptors, κ 1], OPRL1[opiate receptor sample 1], The OPRM1[Opioid Receptors, μ 1], OPTN[optic nerve albumen], OSBP[oxygen sterone is in conjunction with albumen], OSBPL10[oxygen sterone is in conjunction with albumen sample 10], OSBPL6[oxygen sterone is in conjunction with albumen sample 6], OSM[oncostatin M], The OTC[OCT], The just little tooth homology of OTX2[frame 2], OXA1L[oxidizing ferment (cytochrome c) assembles 1 sample], The OXT[oxytocins, prepropeptide], The OXTR[ocytocin receptor], P2RX7[purinergic receptor P2X, part-gated ion channel, 7], P2RY1[purinergic receptor P2Y, the coupling of G-protein, 1], P2RY12[purinergic receptor P2Y, the coupling of G-protein, 12], P2RY2[purinergic receptor P2Y, the coupling of G-protein, 2], P4HB[prolyl 4-hydroxylase, beta polypeptides], PABPC 1[gathers (A) in conjunction with albumen, cytoplasm 1], The PAD14[Peptidylarginine deiminase, type I V], Pregnant albumen correlator Endometrium protein before PAEP[], PAFAH1B1[blood platelet-activation factor PAF-AH 1b, regulation and control subunit 1 (45kDa)], PAFAH1B2[blood platelet-activation factor PAF-AH 1b, catalytic subunit 2 (30kDa)], The PAG1[phosphoprotein glycosyl sphingolipid microcell 1 of being correlated with], The PAH[PAH], PAK1[p21 protein (Cdc42/RAC)-activation kinases 1], PAK2[p21 protein (Cdc42/RAC)-activation kinases 2], PAK3[p21 protein (Cdc42/RAC)-activation kinases 3], PAK4[p21 protein (Cdc42/RAC)-activation kinases 4], PAK6[p21 protein (Cdc42/RAC)-activation kinases 6], PAK7[p21 protein (Cdc42/RAC)-activation kinases 7], PAPPA[PAPP matter A, pappus element 1], PAPPA2[pappus element 2], PARD6A[par-6 branch defect 6 homologue α (Caenorhabditis elegans)], PARG[gathers (ADP-ribose) glycerine hydrolase], PARK2[Parkinson's (autosomal recessive, childhood) 2, Parkin], PARK7[Parkinson's (autosomal recessive is early sent out) 7], PARN[gathers (A)-specific ribonucleic acid enzyme (deadenylation nuclease)], PARP 1[gathers (ADP-ribose) polymerase 1], PAWR[PRKC, Apoptosis, WT1, regulatory factor], The paired frame 2 of PAX2[], The paired frame 3 of PAX3[], The paired frame 5 of PAX5[], The paired frame 6 of PAX6[], The paired frame 7 of PAX7[], PBX1[pre B cell leukaemia homology frame 1], The PC[pyruvate carboxylase], PCDH10[protocadherin 10], PCDH19[protocadherin 19], PCDHA12[protocadherin α 12], PCK2[phosphoenolpy ruvate carboxy kinase 2 (mitochondria)], PCLO[piccolo (presynaptic cell matter stroma protein)], PCM1[pericentriolar material 1], The different aspartic acid of PCMT1[protein-L-(D-Asp) O-transmethylase], The PCNA[PCNA], PCNT[centriole adjunct albumen], PCP4[Purkinje cell protein 4], PCSK7[proteinogen invertase subtilopeptidase A/kexin type 7], PDCD1[apoptosis 1], PDE11A[phosphodiesterase 11], PDE3B[phosphodiesterase 3B, cGMP-suppresses], The PDE4A[phosphodiesterase 4, cAMP-specificity (phosphodiesterase E2 fool homologue, fruit bat)], The PDE4B[PDE4B, cAMP-specificity (phosphodiesterase E4 fool homologue, fruit bat)], PDE4D[phosphodiesterase 4 D, cAMP-specificity (phosphodiesterase E3 fool homologue, fruit bat)], PDE5A[PDE5 A, the cGMP-specificity], PDE8A[phosphodiesterase 8], PDGFA[blood platelet-derivative growth factor α polypeptide], PDGFB[blood platelet-derivative growth factor beta polypeptides (ape sarcoma virus (v-sis) oncogene homologue)], The PDGFC[platelet-derived growth factor C], The PDGFD[platelet-derived growth factor D], PDGFRA[blood platelet-derived growth factor receptor, the α polypeptide], PDGFRB[blood platelet-derived growth factor receptor, beta polypeptides], PDHA1[pyruvic dehydrogenase (lipoamide) α 1], The PDIA2[protein disulfide-isomerase A of family, the member 2], The PDIA3[protein disulfide-isomerase A of family, the member 3], PDLIM1[PDZ and LIM territory 1], PDLIM7[PDZ and LIM territory 7 (mystery type)], PDP1[pyruvic dehydrogenase phosphatase catalytic subunit 1], PDPN[flatfoot albumen], PDXK[pyridoxal (pyridoxol, vitamin B6) kinases], PDXP[pyridoxal (pyridoxol, vitamin B6) phosphatase], The PDYN[prodynorphin], PDZK1[contains pdz domain 1], PEBP1[phosphotidylethanolabinding binding protein 1], PECAM1[blood platelet/endothelial cell adhesion molecule], The PENK[proenkephalin], PER1[cycle homologue 1 (fruit bat)], PER2[cycle homologue 2 (fruit bat)], PEX13[peroxisome occurrence factor 13], PEX2[peroxisome occurrence factor 2], PEX5[peroxisome occurrence factor 5], PEX7[peroxisome occurrence factor 7], The PF4[platelet factor 4], PFAS[Phosphoribosyl formylglycinamidine synzyme], The PFKL[phosphofructokinase, liver], The PFKM[phosphofructokinase, muscle], PFN1[profilin 1], PFN2[profilin 2], PFN3[profilin 3], PFN4[profilin family, the member 4], PGAM2[phosphoglyceric acid mutarotase 2 (muscle)], The PGD[phosphogluconate dehydrogenase], The PGF[placenta growth factor], PGK1[phosphoglyceric kinase 1], PGM1[glucophosphomutase 1], The PGR[PgR], The PHB[antiproliferative protein], PHEX[phosphatase 1 controlling endopeptidase homologue, X-is chain], PHF10[PHD finger protein matter 10], PHF8[PHD finger protein matter 8], The PHGDH[phosphoglycerate dehydrogenase], The PHKA2[phosphorylase kinase, α 2 (liver)], PHLDA2[pleckstrin homology sample territory, the A of family, the member 2], The paired sample homology of PHOX2B[frame 2b], PHYH[phytane acyl-coacetylase 2-hydroxylase], PHYHIP[phytane acyl-coacetylase 2-hydroxylase is in conjunction with albumen], PIAS 1[protein inhibiting factor activates STAT, 1], The PICALM[phosphatidylinositols is in conjunction with clathrin assembly protein], PIGF[glypican grappling biosynthesis, class F], PIGP[glypican grappling biosynthesis, class P], PIK3C2A[phosphoinositide-3-kinases, class 2, α polypeptide], PIK3C2B[phosphoinositide-3-kinases, class 2, beta polypeptides], PIK3C2G[phosphoinositide-3-kinases, class 2, γ polypeptide], PIK3C3[phosphoinositide-3-kinases, class 3], PIK3CA[phosphoinositide-3-kinases, catalysis, α polypeptide], PIK3CB[phosphoinositide-3-kinases, catalysis, beta polypeptides], PIK3CD[phosphoinositide-3-kinases, catalysis, δ polypeptide], PIK3CG[phosphoinositide-3-kinases, catalysis, γ polypeptide], PIK3R1[phosphoinositide-3-kinases, regulation and control subunit 1 (α)], PIK3R2[phosphoinositide-3-kinases, regulation and control subunit 2 (β)], PIK3R3[phosphoinositide-3-kinases, regulation and control subunit 3 (γ)], PIK3R4[phosphoinositide-3-kinases, regulation and control subunit 4], PIK3R5[phosphoinositide-3-kinases, regulation and control subunit 5], PINK1[PTEN guiding supposition kinases 1], The paired sample homeodomain 1 of PITX1[], The paired sample homeodomain 2 of PITX2[], The paired sample homeodomain 3 of PITX3[], PKD1[POLYCYSTIC KIDNEY DISEASE 1 (autosomal dominant)], PKD2[POLYCYSTIC KIDNEY DISEASE 2 (autosomal dominant)], PKHD1[polycystic kindey and hepatopathy 1 (autosomal recessive)], The PKLR[pyruvate kinase, liver and RBC], PKN2[protein kinase N 2], PKNOX1[PBX/ has joint 1 homology frame 1], PL-5283[PL-5283 protein], The PLA2G10[phospholipase A2, group X], The PLA2G2A[phospholipase A2, group IIA (blood platelet, synovia)], The PLA2G4A[phospholipase A2, group IVA (cytoplasm, calcium-dependence)], The PLA2G6[phospholipase A2, group VI (cytoplasm, calcium-irrelevant)], The PLA2G7[phospholipase A2, group VII (blood platelet-activation factor PAF-AH, blood plasma)], PLAC4[Placento-specificity 4], The PLAG1[pleomorphic adenoma gene 1], PLAGL1[pleomorphic adenoma gene sample 1], The PLAT[plasminogen activating factors, tissue], The PLAU[plasminogen activating factors, urokinase], The PLAUR[plasminogen activating factors, urokinase receptor], The PLCB1[phospholipase C, β 1 (phosphoinositide-specificity)], The PLCB2[phospholipase C, β 2], The PLCB3[phospholipase C, β 3 (phosphatidylinositols-specificity)], The PLCB4[phospholipase C, β 4], The PLCG1[phospholipase C, γ 1], The PLCG2[phospholipase C, γ 2 (phosphatidylinositols-specificity)], PLCL1[phospholipase C sample 1], The PLD1[Phospholipase D1, phosphatid ylcholine-specificity], The PLD2[phospholipase D 2], The PLEK[pleckstrin], PLEKHH1[contains pleckstrin homology territory, the H of family (MyTH4 territory) member 1], The PLG[plasminogen], The other fat 1 of PLIN1[], PLK1[polo sample kinases 1 (fruit bat)], PLOD1[precollagen-lysine 1,2-oxoglutarate 5-dioxygenase 1], PLP1[PLP 1], PLTP[PLTP matter], PLXNA1[clump albumin A 1], PLXNA2[clump albumin A 2], PLXNA3[clump albumin A 3], PLXNA4[clump albumin A 4], PLXNB1[clump protein B 1], PLXNB2[clump protein B 2], PLXNB3[clump protein B 3], PLXNC1[clump PROTEIN C 1], The PLXND1[plexin D 1], The PML[progranulocyte leukemia], PMP2[peripheral myelin protein matter 2], PMP22[peripheral myelin protein matter 22], The PMS2[PMS2 postmeiotic separates increases by 2 (saccharomyces cerevisiaes)], The PMVK[phosphomevalonate kinase], Former pain albumen before PNOC[], The PNP[purine nucleoside phosphorylase], PNPLA6[contains patatin sample phosphatidase territory 6], PNPO[pyridoxamine 5 '-the phosphoric acid oxidizing ferment], POFUT2[protein O-fucosyltransferase 2], POLB[polymerase (DNA orientation), β], POLR1C[polymerase (RNA) I peptide C, 30kDa], POLR2A[polymerase (RNA) II (DNA orientation) polypeptide A, 220kDa], POLR3K[polymerase (RNA) III (DNA orientation) polypeptide K, 12.3kDa], POM121C[POM121 membrane glycoprotein C], The POMC[POMC], The chain mannose β of POMGNT1[protein O-[2-N-acetylglucosaminyl transferase], POMT1[protein-O-mannose transferase 1], The PON1[PON1], PON2[paraoxonase 2], POR[P450 (cytochromes) oxidoreducing enzyme], POSTN[periosteum albumen, POSTN], POU1F1[POU class 1 homology frame 1], POU2F1[POU class 2 homology frames 1], POU3F4[POU class 3 homology frames 4], POU4F1[POU class 4 homology frames 1], POU4F2[POU class 4 homology frames 2], POU4F3[POU class 4 homology frames 3], POU5F1[POU class 5 homology frames 1], PPA1[pyrophosphatase (inorganic) 1], The PPARA[Peroxisome proliferator activated receptors α], PPARD[peroxisome proliferator-activated receptor δ], PPARG[peroxisome proliferator-activated receptor γ], PPARGC1A[peroxisome proliferator-activated receptor γ, coactivator 1 α], PPAT[Phosphoribosyl pyrophosphoric acid aminopherase], Before PPBP[-platelet basic protein (chemotactic factor (CF) (C-X-C motif) part 7)], The PPFIA1[protein tyrosine phosphatase, acceptor type, f polypeptide (PTPRF), in conjunction with albumen (liprin), α 1], The PPFIA2[protein tyrosine phosphatase, acceptor type, f polypeptide (PTPRF), in conjunction with albumen (liprin), α 2], The PPFIA3[protein tyrosine phosphatase, acceptor type, f polypeptide (PTPRF), in conjunction with albumen (liprin), α 3], PPFIBP1[PTPRF is in conjunction with albumen, Binding Protein 1 (liprin β 1)], PPIC[peptide acyl prolyl isomerase C (cyclophilin C)], PPIG[peptide acyl prolyl isomerase G (cyclophilin G)], PPP1R15A[protein phosphatase 1, regulation and control (inhibiting factor) subunit 15], PPP1R1B[protein phosphatase 1, regulation and control (inhibiting factor) 1B of subunit], PPP1R9A[protein phosphatase 1, regulation and control (inhibiting factor) subunit 9], PPP1R9B[protein phosphatase 1, regulation and control (inhibiting factor) subunit 9 B], PPP2CA[protein phosphatase 2, catalytic subunit, α isoenzymes], PPP2R4[protein phosphatase 2A activity factor, regulation and control subunit 4], PPP3CA[protein phosphatase 3, catalytic subunit, α isoenzymes], PPP3CB[protein phosphatase 3, catalytic subunit, β isoenzymes], PPP3CC[protein phosphatase 3, catalytic subunit, γ isoenzymes], PPP3R1[protein phosphatase 3, the regulation and control B of subunit, α], PPP3R2[protein phosphatase 3, the regulation and control B of subunit, β], PPP4C[protein phosphatase 4, catalytic subunit], PPY[pancreas polypeptide], PQBP1[polyglutamyl amine Binding Protein 1], PRAM1[PML-RARA regulates and controls adapter molecule 1], The PRAME[melanoma is preferentially expressed antigen], PRDM1[contains PR territory 1, the ZNF territory], PRDM15[contains PR territory 15], PRDM2[contains PR territory 2, the ZNF territory], PRDX1[peroxidating reductase 1], PRDX2[peroxidating reductase 2], PRDX3[peroxidating reductase 3], PRDX4[peroxidating reductase 4], PRDX6[peroxidating reductase 6], PRF1[perforin 1 (pore-forming protein)], The PRKAA1[protein kinase, AMP-activates, α 1 catalytic subunit], The PRKAA2[protein kinase, AMP-activates, α 2 catalytic subunits], The PRKAB1[protein kinase, AMP-activates, β 1 on-catalytic subunit], The PRKACA[protein kinase, cAMP-dependence, catalysis, α], The PRKACB[protein kinase, cAMP-dependence, catalysis, β], The PRKACG[protein kinase, cAMP-dependence, catalysis, γ], The PRKAG1[protein kinase, AMP-activates, γ 1 on-catalytic subunit], The PRKAG2[protein kinase, AMP-activates, γ 2 on-catalytic subunits], The PRKAR1A[protein kinase, cAMP-dependence, regulation and control, type I, α (tissue-specific extinguisher 1)], The PRKAR1B[protein kinase, cAMP-dependence, regulation and control, type I, β], The PRKAR2A[protein kinase, cAMP-dependence, regulation and control, Type II, α], The PRKAR2B[protein kinase, cAMP-dependence, regulation and control, Type II, β], The PRKCA[protein kinase C, α], The PRKCB[protein kinase C, β], The PRKCD[protein kinase C, δ], The PRKCE[protein kinase C, ε], The PRKCG[protein kinase C, γ], The PRKCH[protein kinase C, η], The PRKCI[protein kinase C, ι], The PRKCQ[protein kinase C, θ], The PRKCZ[protein kinase C, ζ], PRKD1[protein kinase D1], The PRKDC[protein kinase, DNA-activates, catalytic polypeptide], The PRKG1[protein kinase, cGMP-dependence, type I], The PRL[lactogen], PRLR[lactogen acceptor], PRMT1[protein arginine transmethylase 1], The PRNP[prion protein], PROC[protein C (clotting factor inhibiting factor Va and VIIIa)], PROCR[protein C acceptor, endothelium (EPCR)], PRODH[proline dehydrogenase (oxidizing ferment) 1], Dynein 1 before PROK1[], Dynamin-2 before PROK2[], PROM1[protruding plain 1], PROS1[protein s (α)], Before PRPF40A[PRP40-the mRNA processing factor 40 homologue A (saccharomyces cerevisiae)], Before PRPF40B[PRP40-the mRNA processing factor 40 homologue B (saccharomyces cerevisiae)], The PRPH[periphery], PRPH2[periphery 2 (retinal degeneration, slowly)], PRPS 1[Phosphoribosyl pyrophosphate synthetase 1], Rich proline (G-carboxyglutamic acid) 4 (cross-films) of PRRG4[], PRSS8[protease, serine, 8], The PRTN3[protease 3], PRX[shows colloid albumen], The PSAP[Prosaposin], PSEN1[presenilin 1], PSEN2[presenilin 2 (A Zihaimo disease 4)], PSG1[pregnancy specific β-1-glycoprotein 1], PSIP1[PC4 and SFRS1 Binding Protein 1], PSMA5[proteasome (proteasome, huge protein factor) subunit, α type, 5], PSMA6[proteasome (proteasome, huge protein factor) subunit, α type, 6], PSMB8[proteasome (proteasome, huge protein factor) subunit, beta type, 8 (large multifunctional polypeptide enzymes 7)], PSMB9[proteasome (proteasome, huge protein factor) subunit, beta type, 9 (large multifunctional polypeptide enzymes 2)], PSMC1[proteasome (proteasome, huge protein factor) 26S subunit, ATP enzyme, 1], PSMC4[proteasome (proteasome, huge protein factor) 26S subunit, ATP enzyme, 4], PSMD9[proteasome (proteasome, huge protein factor) 26S subunit, non ATP enzyne, 9], PSME1[proteasome (proteasome, huge protein factor) activity factor subunit 1 (PA28 α)], PSME2[proteasome (proteasome, huge protein factor) activity factor subunit 2 (PA28 β)], PSMG1[proteasome (proteasome, huge protein factor) assembling chaperone 1], The PSPH[phosphoserine phosphatase], PSPN[persephin], PSTPIP1[proline-serine-threonine phosphatase Binding Protein 1], PTAFR[blood platelet-activation factor acceptor], PTCH1[speckle gene homolog 1 (fruit bat)], PTCH2[speckle gene homolog 2 (fruit bat)], PTEN[phosphatase and tensin homologue], PTF1A[pancreas idiosyncratic transcription factor, 1], PTGER1[prostaglandin E receptor 1 (hypotype EP1), 42kDa], PTGER2[Prostaglin E Receptor 2 (hypotype EP2), 53kDa], PTGER3[prostaglandin E receptor 3 (hypotype EP3)], PTGER4[prostaglandin E receptor 4 (hypotype EP4)], The PTGES[Prostaglandin E Synthase], PTGES2[Prostaglandin E Synthase 2], PTGIR[prostacyclin I2 (prostatitis cyclase protein) acceptor (IP)], PTGS1[prostaglandin-endoperoxide synthetase 1 (prostaglandin G/H sythase and epoxidase)], PTGS2[prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and epoxidase)], The PTH[parathormone], PTH1R[parathormone 1 acceptor], PTHLH[parathormone sample hormone], PTK2[PTK2 protein tyrosine kinase 2], PTK2B[PTK2B protein tyrosine kinase 2 β], PTK7[PTK7 protein tyrosine kinase 7], The PTN[PTN], The PTPN1[protein tyrosine phosphatase, non-acceptor type 1], The PTPN11[protein tyrosine phosphatase, non-acceptor type 11], The PTPN13[protein tyrosine phosphatase, non-acceptor type 13 (APO-1/CD95 (Fas) be correlated with phosphatase)], The PTPN18[protein tyrosine phosphatase, non-acceptor type 18 (brain derived greatly)], The PTPN2[protein tyrosine phosphatase, non-acceptor type 2], The PTPN22[protein tyrosine phosphatase, non-acceptor type 22 (lymph)], The PTPN6[protein tyrosine phosphatase, non-acceptor type 6], The PTPN7[protein tyrosine phosphatase, non-acceptor type 7], The PTPRA[protein tyrosine phosphatase, acceptor type,], The PTPRB[protein tyrosine phosphatase, acceptor type, B], The PTPRC[protein tyrosine phosphatase, acceptor type, C], The PTPRD[protein tyrosine phosphatase, acceptor type, D], The PTPRE[protein tyrosine phosphatase, acceptor type, E], The PTPRF[protein tyrosine phosphatase, acceptor type, F], The PTPRJ[protein tyrosine phosphatase, acceptor type, J], The PTPRK[protein tyrosine phosphatase, acceptor type, K], The PTPRM[protein tyrosine phosphatase, acceptor type, M], The PTPRO[protein tyrosine phosphatase, acceptor type, O], The PTPRS[protein tyrosine phosphatase, acceptor type, S], The PTPRT[protein tyrosine phosphatase, acceptor type, T], The PTPRU[protein tyrosine phosphatase, acceptor type, U], The PTPRZ1[protein tyrosine phosphatase, acceptor-type, Z polypeptide 1], PTS[6-pyruvoyl tetrahydro pterin synzyme], PTTG1[pituitary tumor-transform 1], The PVR[poliovirus receptor], PVRL1[poliovirus receptor 1 (herpesviral enters amboceptor C) of being correlated with], PWP2[PWP2 is tryptophan protein homology thing (yeast) periodically], The PXN[paxillin], PYCARD[contains PYD and CARD territory], The PYGB[phosphorylase, glycogen; Brain], The PYGM[phosphorylase, glycogen, muscle], The PYY[PYY], QDPR[quinoid dihydropteridine reductase], QKI[shakes homologue, and KH territory RNA is in conjunction with (mouse)], RAB11A[RAB11A, member RAS Oncogene family], RAB11FIP5[RAB11 family is in conjunction with albumen 5 (class I)], RAB39B[RAB39B, member RAS Oncogene family], RAB3A[RAB3A, member RAS Oncogene family], RAB4A[RAB4A, member RAS Oncogene family], RAB5A[RAB5A, member RAS Oncogene family], RAB8A[RAB8A, member RAS Oncogene family], RAB9A[RAB9A, member RAS Oncogene family], RABEP1[rabaptin, the RABGTP enzyme is in conjunction with effector protein 1], RABGEF1[RAB guanine nucleotide exchange factor (GEF) 1], The RAC1[ras C3 botulin substrate 1 (rho family, little gtp binding protein Rac1) of being correlated with], The RAC2[ras C3 botulin substrate 2 (rho family, little gtp binding protein Rac2) of being correlated with], The RAC3[ras C3 botulin substrate 3 (rho family, little gtp binding protein Rac3) of being correlated with], RAD51[RAD51 homologue (RecA homologue, Escherichia coli) (saccharomyces cerevisiae)], RAF1[v-raf-1 Muridae leukemia virus oncogene homologue 1], RAG1[recombination activating gene 1], RAG2[recombination activating gene 2], RAGE[nephroncus antigen], RALA[v-RAL ape leukemia virus oncogene homologue A (ras is relevant)], The RALBP1[ralA Binding Protein 1], RALGAPA2[Ral GTP enzyme activation protein, alpha subunit 2 (catalysis)], RALGAPB[Ral GTP enzyme activation protein, β subunit (on-catalytic)], The RALGDS[ral guanine nucleotide dissociation stimulator factor], RAN[RAN, member RAS Oncogene family], RAP1A[RAP1A, RAS Oncogene family member], RAP1B[RAP1B, RAS Oncogene family member], RAP1GAP[RAP1GTP enzyme activation protein], RAPGEF3[Rap guanine nucleotide exchange factor (GEF) 3], RAPGEF4[Rap guanine nucleotide exchange factor (GEF) 4], RAPH1[Ras associated (RalGDS/AF-6) and pleckstrin homology territory 1], RAPSN[cynapse acceptor Rapsyn], The RARA[retinoid receptor, α], The RARB[retinoid receptor, β], The RARG[retinoid receptor, γ], The RARS[Arginyl-tRNA synthetase], RASA1[RAS p21 protein activity factor (gtpase activating protein matter) 1], RASA2[RAS p21 protein activity factor 2], RASGRF1[Ras protein-specific guanine nucleotides-releasing factor 1], The RASGRP1[RAS amidino groups discharges protein 1 (calcium and DAG-regulation and control)], Associated (RalGDS/AF-6) the territory family member 1 of RASSF1[Ras], Associated (RalGDS/AF-6) the territory family member 5 of RASSF5[Ras], RB1[retinoblastoma 1], RBBP4[retinoblastoma conjugated protein 4], RBM11[RNA binding motif protein 11], RBM4[RNA binding motif protein 4], RBM45[RNA binding motif protein 45], RBP4[RBP ELISA 4, blood plasma], The recombination signal in RBPJ[immunoglobulin (Ig) κ J zone is in conjunction with albumen], RCAN1[calcineurin regulatory factor 1], RCAN2[calcineurin regulatory factor 2], RCAN3[RCAN family member 3], RCOR1[REST assists suppressor 1], The RDX[radixin], REEP3[acceptor auxiliary protein 3], REG1A[regeneration pancreas islet-derivative 1 α], The too much syndrome virus oncogene of RELA[v-rel reticuloendothelial cell homologue A (birds)], RELN[reeling albumen], The REN[feritin], REPIN1[copies and starts the factor 1], The reticent transcription factor of REST[RE1-], RET[ret is former-oncogene], The RETN[resistance protein], RFC1[replication factor C (activity factor 1) 1,145kDa], RFC2[replication factor C (activity factor 1) 2,40kDa], RFX1[regulatory factor X, 1 (affecting HLA class II expresses)], RGMA[RGM territory family, member A], RGMB[RGM territory family, member B], RGS3[G protein signal transduction regulatory factor 3], The RHD[Rh blood group, D antigen], The RHEB[Ras homologue is enriched in brain], The RHO[rhodopsin], RHOA[ras homologue gene family, member A], RHOB[ras homologue gene family, member B], RHOC[ras homologue gene family, member C], RHOD[ras homologue gene family, member D], RHOG[ras homologue gene family, member G (rhoG)], RHOH[ras homologue gene family, member H], The RPTOR of the RICTOR[MTOR companion that has nothing to do, complex 2], RIMS3[regulation and control synaptic membrane exocytosis 3], RIPK1[acceptor (TNFRSF) is in conjunction with serine-threonine kinase 1], RIPK2[receptors bind serine-threonine kinase 2], The RNASE1[ribalgilase, RNaseA family, 1 (pancreas)], The RNASE3[ribalgilase, RNaseA family, 3 (eosinophil cationic proteins)], The RNASEL[ribonuclease l (2 ' [5 '-few different adenylate synzyme-dependence)], The GTP of RND1[Rho family enzyme 1], The GTP of RND2[Rho family enzyme 2], The GTP of RND3[Rho family enzyme 3], RNF123[ring finger protein 123], RNF128[ring finger protein 128], RNF13[ring finger protein 13], RNF135[ring finger protein 135], RNF2[ring finger protein 2], RNF6[ring finger protein (C3H2C3 type) 6], RNH1[ribalgilase/angiogenic proteins inhibiting factor 1], RNPC3[contains RNA calmodulin binding domain CaM (RNP1, RRM) 3], The roundabout albumen of ROBO1[, aixs cylinder guiding acceptor, homologue 1 (fruit bat)], The roundabout albumen of ROBO2[, aixs cylinder guiding acceptor, homologue 2 (fruit bat)], The roundabout albumen of ROBO3[, aixs cylinder guiding acceptor, homologue 3 (fruit bat)], The roundabout albumen homology thing 4 of ROBO4[, magical roundabout albumen (fruit bat)], ROCK1[Rho is relevant, the protein kinase 1 that contains coiled coil], ROCK2[Rho is relevant, the protein kinase 2 that contains coiled coil], RPGR[retinal pigment degeneration GTP enzyme regulatory factor], RPGRIP1[retinal pigment degeneration GTP enzyme regulatory factor Binding Protein 1], The RPGRIP1L[RPGRIP1 sample], RPL10[ribosomal protein L 10], RPL24[ribosomal protein L 2 4], RPL5[ribosomal protein L 5], RPL7A[ribosome protein L 7/L a], The RPLP0[ribosomal protein, large, P0], RPS17[ribosomal protein S1 7], RPS17P3[ribosomal protein S1 7 pseudogenes 3], RPS19[ribosomal protein S1 9], The RPS27A[Ribosomal protein S27a], RPS6[ribosomal protein S6], RPS6KA1[ribosomal protein S6K, 90kDa, polypeptide 1], RPS6KA3[ribosomal protein S6K, 90kDa, polypeptide 3], RPS6KA6[ribosomal protein S6K, 90kDa, polypeptide 6], RPS6KB1[ribosomal protein S6K, 70kDa, polypeptide 1], The relevant RAS virus of RRAS[(r-ras) oncogene homologue], The relevant RAS virus of RRAS2[(r-ras) oncogene homologue 2], RRBP1[ribophorin 1 homologue 180kDa (dog)], RRM1[ribonucleotide reductase M1], RRM2[ribonucleotide reductase M2], RRM2B[ribonucleotide reductase M2B (TP53 can induce)], RTN4[reticuloprotein 4], RTN4R[reticuloprotein 4 acceptors], RUFY3[contains RUN and FYVE territory 3], RUNX1[dwarf's associated transcription factor 1], RUNX1T1[dwarf's associated transcription factor 1; Transposition, 1 (cyclin D is relevant)], RUNX2[dwarf's associated transcription factor 2], RUNX3[dwarf's associated transcription factor 3], RUVBL2[RuvB sample 2 (Escherichia coli)], RXRA[retinoids X acceptor, α], RYK[RYK acceptor sample EGFR-TK], The blue Buddhist nun's alkali of RYR2[acceptor 2 (hearts)], The blue Buddhist nun's alkali of RYR3[acceptor 3], S100A1[S100 calbindin A1], S100A10[S100 calbindin A10], S100A12[S100 calbindin A12], S100A2[S100 calbindin A2], S100A4[S100 calbindin A4], S100A6[S100 calbindin A6], S100A7[S100 calbindin A7], S100A8[S100 calbindin A8], S100A9[S100 calbindin A9], S100B[S100 calbindin B], SAA4[Serum Amyloid A 4, structure], SACS[spasm incoordination Charlevoix-Saguenay (sacsin)], The SAFB[support connects factor B], SAG[S-antigen; Retina and pineal body (CKIs)], SAMHD1[SAM territory and HD territory 1], SATB2[SATB homology frame 2], SBDS[Shwachman-Bodian-Diamond syndrome], SCARB1[clearing factor acceptor class B, the member 1], SCD[stearoyl-coacetylase desaturase (δ-9-desaturase)], SCD5[stearoyl-coacetylase desaturase 5], SCG2[secretogranin II], SCG5[secretogranin V (7B2 protein)], SCGB1A1[secretes globulin, the 1A of family, member 1 (uteroglobin)], The SCN11A[sodium channel, valtage-gated, type XI, alpha subunit], The SCN1A[sodium channel, valtage-gated, type I, alpha subunit], The SCN2A[sodium channel, valtage-gated, Type II, alpha subunit], The SCN3A[sodium channel, valtage-gated, type-iii, alpha subunit], The SCN5A[sodium channel, valtage-gated, type V, alpha subunit], The SCN7A[sodium channel, valtage-gated, type VII, α], The SCNN1B[sodium channel, non-voltage-gated 1, β], The SCNN1G[sodium channel, non-voltage-gated 1, γ], SCP2[sterol carrier protein matter 2], The SCT[secretin], The SCTR[secretin receptor], The SCUBE1[signal peptide, CUB territory, EGF sample 1], SDC2[syndecan 2], SDC3[syndecan 3], The SDCBP[syndecan is in conjunction with albumen (same linear protein)], The SDHB[dehydrogenase, the B of subunit, iron sulphur (Ip)], The SDHD[dehydrogenase, the D of subunit, integral protein], The SDS[serine dehydrase], SEC14L2[SEC14-2 (saccharomyces cerevisiae)], SELE[selects plain E], [selecting plain L], SELP[selects plain P (140kDa, antigens c D62)], SELPLG[selects plain P part], The SEMA3A[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3A], The SEMA3B[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3B], The SEMA3C[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3C], The SEMA3D[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3D], The SEMA3E[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3E], The SEMA3F[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3F], The SEMA3G[sema territory, immunoglobulin (Ig) territory (Ig), short alkaline territory, secretion, (arm plate albumen) 3G], The SEMA4A[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4A], The SEMA4B[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4B], The SEMA4C[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4C], The SEMA4D[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4D], The SEMA4F[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4F], The SEMA4G[sema territory, immunoglobulin (Ig) territory (Ig), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 4G], The SEMA5A[sema territory, seven thrombospondins repeat (Class1 and Class1 sample), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 5A], The SEMA5B[sema territory, seven thrombospondins repeat (Class1 and Class1 sample), membrane-spanning domain (TM) and short cell matter territory, (arm plate albumen) 5B], The SEMA6A[sema territory, membrane-spanning domain (TM), and cytoplasm territory, (arm plate albumen) 6A], The SEMA6B[sema territory, membrane-spanning domain (TM), and cytoplasm territory, (arm plate albumen) 6B], The SEMA6C[sema territory, membrane-spanning domain (TM), and cytoplasm territory, (arm plate albumen) 6C], The SEMA6D[sema territory, membrane-spanning domain (TM), and cytoplasm territory, (arm plate albumen) 6D], SEMA7A[arm plate albumen 7A, GPI film grappling (John Milton Hagen blood group)], The SEPP1[Selenoprotein P, blood plasma, 1], SEPT2[born of the same parents are split albumen 2], SEPT4[born of the same parents are split albumen 4], SEPT5[born of the same parents are split albumen 5], SEPT6[born of the same parents are split albumen 6], SEPT7[born of the same parents are split albumen 7], SEPT9[born of the same parents are split albumen 9], SERPINA1[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 1], SERPINA3[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 3], SERPINA7[serpin peptide enzyme inhibition factor, clade A (α-1 antiprotease, antitrypsin), the member 7], SERPINB1[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 1], SERPINB2[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 2], SERPINB6[serpin peptide enzyme inhibition factor, clade B (ovalbumin), the member 6], SERPINC1[serpin peptide enzyme inhibition factor, clade C (antithrombase), the member 1], SERPINE1[serpin peptide enzyme inhibition factor, clade E (nexin, Plasminogen activator Class1), the member 1], SERPINE2[serpin peptide enzyme inhibition factor, clade E (nexin, Plasminogen activator Class1), the member 2], SERPINF1[serpin peptide enzyme inhibition factor, clade F (α-2 antiplasmin, pigment epidermal derived factors), the member 1], SERPINH1[serpin peptide enzyme inhibition factor, clade H (heat shock protein 47), the member 1, (collagen binding protein 1)], SERPINI1[serpin peptide enzyme inhibition factor, clade I (neurofilament presses down albumen), the member 1], SET[SET core oncogene], SETX[senataxin], The ictal encephalopathic of SEZ6L2[6 homologues (mouse) sample 2 of being correlated with], Rich proline/the glutamine of SFPQ[splicing factor-(polypyrimidine tract is relevant in conjunction with albumen)], SFRP1[secretion frizzled related protein matter 1], SFRP4[secretion frizzled related protein matter 4], The SFRS15[splicing factor, rich arginine/serine-15], SFTPA1[surfactant albumin A 1], The SFTPB[SP-B], SFTPC[surfactant PROTEIN C], The SGCB[inose, β (43kDa dystrophin associated glycoprotein)], The SGCE[inose, ε], SGK1[serum/glucocorticoid regulation and control kinases 1], SH2B1[SH2B is connected factor protein matter 1], SH2B3[SH2B is connected factor protein matter 3], SH2D1A[contains SH2 territory 1A], The SH3BGR[SH3 territory is in conjunction with rich GLU-protein], The SH3BGRL[SH3 territory is in conjunction with rich GLU-protein sample], SH3BP1[SH3-territory Binding Protein 1], SH3GL1P2[SH3-territory GRB2 sample 1 pseudogene 2], SH3GL3[SH3-territory GRB2 sample 3], SH3KBP1[SH3-territory kinase binding proteins 1], SH3PXD2A[SH3 and PX territory 2A], SHANK1[SH3 and various ankyrin duplicate domain 1], SHANK2[SH3 and various ankyrin duplicate domain 2], SHANK3[SH3 and various ankyrin duplicate domain 3], The SHBG[sex hormone binding globulin], SHC1[SHC (Src homology 2 territories are contained) transforming protein matter 1], SHC3[SHC (containing Src homology 2 territories) transforming protein matter 3], SHH[Sonic hedgehog homologue (fruit bat)], The soc-2 inhibiting factor (Caenorhabditis elegans) of the transparent homologue of SHOC2[], SI[Sucrase-isomaltase (alpha-glucosidase)], The inattentive homologue 1 of SIAH1[seven (fruit bat)], The inattentive homologue 2 of SIAH2[seven (fruit bat)], SIGMAR1[σ is non--opioid intracellular receptor 1], SILV[silver color homologue (mouse)], The mono-meaning of SIM1[homologue 1 (fruit bat)], The mono-meaning of SIM2[homologue 2 (fruit bats)], SIP1[motor neuron survivin Binding Protein 1], SIRPA[signals-modulating protein alpha], Reticent albumen (reticent mating type Information Regulating 2 homologues) 1 (saccharomyces cerevisiae) of regulating of SIRT1[], Reticent albumen (reticent mating type Information Regulating 2 homologues) 4 (saccharomyces cerevisiaes) of regulating of SIRT4[], Reticent albumen (reticent mating type Information Regulating 2 homologues) 6 (saccharomyces cerevisiaes) of regulating of SIRT6[], SIX5[SIX homology frame 5], SKI[v-ski sarcoma virus oncogene homologue (birds)], SKP2[S-phase kinase-associated protein matter 2 (p45)], SLAMF6[SLAM family member 6], SLC10A1[solute carrier family 10 (sodium/cholic acid cotransporter family), the member 1], SLC11A2[solute carrier family 11 (proton-coupling bivalent metal ion transport protein), the member 2], SLC12A1[solute carrier family 12 (sodium/potassium/chloride transport protein), the member 1], SLC12A2[solute carrier family 12 (sodium/potassium/chloride transport protein), the member 2], SLC12A3[solute carrier family 12 (sodium/chloride transport protein), the member 3], SLC12A5[solute carrier family 12 (potassium/chloride transport protein), the member 5], SLC12A6[solute carrier family 12 (potassium/chloride transport protein), the member 6], SLC13A1[solute carrier family 13 (sodium/sulfuric acid is worked in coordination with transport protein), the member 1], SLC15A1[solute carrier family 15 (peptide transporters), the member 1], SLC16A2[solute carrier family 16, member 2 (monocarboxylic acid transport protein 8)], SLC17A5[solute carrier family 17 (anion/saccharide transporters), the member 5], SLC17A7[solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter), the member 7], SLC18A2[solute carrier family 18 (vesicle monoamine), the member 2], SLC18A3[solute carrier family 18 (vesicle acetylcholine), the member 3], SLC19A1[solute carrier family 19 (folic acid transport protein), the member 1], SLC19A2[solute carrier family 19 (thiamines transport protein), the member 2], SLC1A1[solute carrier family 1 (neuron/epithelium high-affinity glutamate transporter, system XAG), the member 1], SLC1A2[solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 2], SLC1A3[solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 3], SLC22A2[solute carrier family 22 (organic cation transporters), the member 2], SLC25A12[solute carrier family 25 (mitochondrial carrier, Aralar), the member 12], SLC25A13[solute carrier family 25, member 13 (citrin)], SLC25A20[solute carrier family 25 (carnitine/fatty acyl carnitine translocase), the member 20], SLC25A3[solute carrier family 25 (mitochondrial carriers; Phosphate carrier), the member 3], SLC26A3[solute carrier family 26, the member 3], SLC27A1[solute carrier family 27 (fatty acid transport proteins), the member 1], SLC29A1[solute carrier family 29 (nucleoside transporters), the member 1], SLC2A1[solute carrier family 2 (facilitation GLUT), the member 1], SLC2A13[solute carrier family 2 (facilitation GLUT), the member 13], SLC2A2[solute carrier family 2 (facilitation GLUT), the member 2], SLC2A3[solute carrier family 2 (facilitation GLUT), the member 3], SLC2A4[solute carrier family 2 (facilitation GLUT), the member 4], SLC30A3[solute carrier family 30 (Zinc transporters), the member 3], SLC30A4[solute carrier family 30 (Zinc transporters), the member 4], SLC30A8[solute carrier family 30 (Zinc transporters), the member 8], SLC31A1[solute carrier family 31 (copper transport protein is white), the member 1], SLC32A1[solute carrier family 32 (GABA vesicle transport protein), the member 1], SLC34A1[solute carrier family 34 (sodium phosphates), the member 1], SLC38A3[solute carrier family 38, the member 3], SLC39A2[solute carrier family 39 (Zinc transporters), the member 2], SLC39A3[solute carrier family 39 (Zinc transporters), the member 3], SLC40A1[solute carrier family 40 (iron-regulation and control transport protein), the member 1], SLC4A11[solute carrier family 4, the Boratex transport protein, the member 11], SLC5A3[solute carrier family 5 (sodium/muscle-inositol cotransporter albumen), the member 3], SLC5A8[solute carrier family 5 (iodide transport protein), the member 8], SLC6A1[solute carrier family 6 (neurotransmitter transport protein, GABA), the member 1], SLC6A14[solute carrier family 6 (amino acid transporters), the member 14], SLC6A2[solute carrier family 6 (neurotransmitter transport protein, norepinephrine), the member 2], SLC6A3[solute carrier family 6 (neurotransmitter transport protein, dopamine), the member 3], SLC6A4[solute carrier family 6 (neurotransmitter transport protein, 5), the member 4], SLC6A8[solute carrier family 6 (neurotransmitter transport protein, creatine), the member 8], SLC7A14[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 14], SLC7A5[solute carrier family 7 (cationic amino acid transporter albumen, y+ system), the member 5], SLC9A2[solute carrier family 9 (sodium/hydrogen exchanger), the member 2], SLC9A3[solute carrier family 9 (sodium/hydrogen exchanger), the member 3], SLC9A3R1[solute carrier family 9 (sodium/hydrogen exchanger), member's 3 regulatory factors 1], SLC9A3R2[solute carrier family 9 (sodium/hydrogen exchanger), member's 3 regulatory factors 2], SLC9A6[solute carrier family 9 (sodium/hydrogen exchanger), the member 6], SLIT1[slit homologue 1 (fruit bat)], SLIT2[slit homologue 2 (fruit bat)], SLIT3[slit homologue 3 (fruit bat)], SLITRK1[SLIT and NTRK sample family, the member 1], SLN[flesh lipoprotein], SLPI[secretion leucocyte peptide enzyme inhibition factor], SMAD1[SMAD family member 1], SMAD2[SMAD family member 2], SMAD3[SMAD family member 3], SMAD4[SMAD family member 4], SMAD6[SMAD family member 6], SMAD7[SMAD family member 7], SMARCA1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily a, the member 1], SMARCA2[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily a, the member 2], SMARCA4[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily a, the member 4], SMARCA5[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily a, the member 5], SMARCB1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily b, the member 1], SMARCC1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily c, the member 1], SMARCC2[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily c, the member 2], SMARCD1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily d, the member 1], SMARCD3[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily d, the member 3], SMARCE1[SWI/SNF is relevant, and matrix is relevant, chromatinic actin dependence regulatory factor, and subfamily e, the member 1], The SMG1[SMG1 homologue, phosphatidyl-inositol 3-kinase associated kinase (Caenorhabditis elegans)], SMN1[survival of motor neurons protein 1, telomere], The level and smooth homologue of SMO[(fruit bat)], SMPD1[sphingomyelin phosphodiesterase 1, sour lysosome], The SMS[spermine synthase], SNAI2[snail homologue 2 (fruit bat)], SNAP25[SNAP matter, 25kDa], The SNCA[synapse nucleoprotein, α (non-A4 component amyloid precursor)], The SNCAIP[synapse nucleoprotein, α is in conjunction with albumen], The SNCB[synapse nucleoprotein, β], The SNCG[synapse nucleoprotein, γ (breast cancer-specific protein 1)], SNRPA[small nuclear ribonucleoprotein polypeptide A], SNRPN[small nuclear ribonucleoprotein polypeptide N], SNTG2[alternate albumen, γ 2], SNURF[SNRPN upstream reading frame], SOAT1[sterol O-acyltransferase 1], SOCS 1[Suppressor of Cytokine Signaling 1], The SOCS3[Suppressor of cytokine signaling-3], SOD1[superoxide dismutase 1, solvable], SOD2[superoxide dismutase 2, mitochondria], SORBS3[contains sorbose and SH3 territory 3], SORL1[chooses the albumen associated receptor, and L (DLR class) contains A to be repeated], SORT1[chooses albumen 1], The non-seven sub-homologues 1 of kinases (fruit bat) of SOS1[], The non-seven sub-homologues 2 of kinases (fruit bat) of SOS2[], SOSTDC1[contains sclerosis albumen territory 1], SOX1[SRY (sex-determining region Y)-frame 1], SOX10[SRY (sex-determining region Y)-frame 10], SOX18[SRY (sex-determining region Y)-frame 18], SOX2[SRY (sex-determining region Y)-frame 2], SOX3[SRY (sex-determining region Y)-frame 3], SOX9[SRY (sex-determining region Y)-frame 9], The SP1[Sp1 transcription factor], The SP3[Sp3 transcription factor], SPANXB1[SPANX family, member B1], SPANXC[SPANX family, member C], The SPARC[secretory protein, acidity, rich cysteine (osteonectin)], SPARCL1[SPARC sample 1 (glue protein)], SPAST[spasm albumen], SPHK1[sphingosine kinase 1], SPINK1[serine peptide enzyme inhibition factor, the Kazal Class1], SPINT2[serine peptide enzyme inhibition factor, Kunitz type, 2], The SPN[sialophorin], SPNS2[spinster homologue 2 (fruit bat)], The SPON2[SPON2, extracellular matrix proteins], SPP1[secretes phosphoprotein 1], The SPRED2[rudiment is relevant, contains EVH1 territory 2], SPRY2[rudiment homologue 2 (fruit bat)], The SPTA1[spectrin, α, red blood cell 1 (elliptocytosis 2)], The SPTAN1[spectrin, α, non--red blood cell 1 (α-fodrin)], The SPTB[spectrin, β, red blood cell], The SPTBN1[spectrin, β, non--red blood cell 1], SRC[v-src sarcoma (Schmidt-Ruppin-2) viral oncogene homologue (birds)], SRCRB4D[contains the rich domain cysteine of clearing factor acceptor, group B (4 territory)], SRD5A1[steroids-5-5 alpha-reductases, α polypeptide 1 (3-oxo-5 α-steroids δ 4-dehydrogenase α 1)], SREBF1[sterol controlling element is in conjunction with transcription factor 1], SREBF2[sterol controlling element is in conjunction with transcription factor 2], SRF[serum response factpr (c-fos serum sensing element is in conjunction with transcription factor)], SRGAP1[SLIT-ROBORho gtpase activating protein matter 1], SRGAP2[SLIT-ROBO Rho gtpase activating protein matter 2], SRGAP3[SLIT-ROBO Rho gtpase activating protein matter 3], SRPX[contains sushi-repeat sequence protein, and X-is chain], The SRY[sex-determining region Y], SSB[Sjogren syndrome antigen B (autoantigen La)], SSH1[slingshot homologue 1 (fruit bat)], SSRP1[structure specific recognition protein 1], The SST[amicine], SSTR1[amicine acceptor 1], SSTR2[amicine acceptor 2], SSTR3[amicine acceptor 3], SSTR4[amicine acceptor 4], SSTR5[amicine acceptor 5], ST13[suppresses oncogenicity 13 (colon cancer) (Hsp70 is in conjunction with albumen)], ST14[suppresses oncogenicity 14 (colon cancer)], ST6GAL1[ST6 beta galactose amine α-2[6-sialyltransferase 1], ST7[suppresses oncogenicity 7], STAG2[matrix antigen 2], The STAG3[matrix antigen 3], The acute regulation protein of STAR[steroids], STAT1[signal transduction and transcriptional activators 1,91kDa], STAT2[signal transduction and transcriptional activators 2,113kDa], STAT3[signal transduction and transcriptional activators 3 (acute stage response factor)], STAT4[signal transduction and transcriptional activators 4], STAT5A[signal transduction and transcriptional activators 5A], STAT5B[signal transduction and transcriptional activators 5B], STAT6[signal transduction and transcriptional activators 6, the interleukin 4 guiding], The STATH[Statherin], STC1[tin calcium albumen 1], STIL[SCL/TAL1 disturbs locus], STIM1[stromal interaction molecule 1], STK11[serine/threonine kinase 11], STK24[serine/threonine kinase 24 (STE20 homologue, yeast)], STK36[serine/threonine kinase 36, merge homologue (fruit bat)], STK38[serine/threonine kinase 38], STK38L[serine/threonine kinase 38 samples], STK39[serine threonine kinases 39 (STE20/SPS1 homologue, yeast)], STMN1[microtubule depolymerization albumen 1], STMN2[microtubule depolymerization albumen sample 2], STMN3[microtubule depolymerization albumen sample 3], STMN4[microtubule depolymerization albumen sample 4], STOML1[oral cavity albumen (EPB72) sample 1], STS[steoid sulfatase (microsome), isoenzymes S], The protein 1 that STUB1[contains STIP1 homology and U-frame], STX1A[syntaxin 1A (brain)], STX3[syntaxin 3], STYX[serine/threonine/tyrosine is in conjunction with albumen], SUFU[merges homologue inhibiting factor (fruit bat)], SULT2A1[sulfotransferase family, cytoplasm, 2A, dehydrobenzene (DHEA)-preferably, the member 1], SUMO1[mif 23 homologue SMT3 inhibiting factors 1 (saccharomyces cerevisiae)], SUMO3[mif 23 homologue SMT3 initiator 3s (saccharomyces cerevisiae)], SUN1[contains Sad1 and UNC84 territory 1], SUN2[contains Sad1 and UNC84 territory 2], SUPT16H[Ty16 homologue inhibiting factor (saccharomyces cerevisiae)], SUZ12P[zeste12 homologue pseudogene inhibiting factor], SV2A[synaptic membrane bubble gum albumen 2A], The SYK[spleen tyrosine kinase], The SYN1[synapsin], SYN2[synapsin I], SYN3[synapsin II], SYNGAP1[cynapse Ras gtpase activating protein matter 1 homologue (rat)], Albumen 1 is stretched in the SYNJ1[cynapse], SYNPO2[cynapse utmost point albumen 2], The SYP[synaptobrevin], The SYT1[Synaptotagmin I], The TAC1[tachykinin, precursor 1], TAC3[tachykinin 3], TACR1[tachykinin receptor 1], The TAF1[TAF1RNA polymerase II, the TATA frame is in conjunction with albumen (TBP) correlation factor, 250kDa], The TAF6[TAF6RNA polymerase II, the TATA frame is in conjunction with albumen (TBP) correlation factor, 80kDa], TAGAP[T-cell-stimulating RhoGTP enzyme activated protein white matter], TAGLN[glue turning egg(s) is white], TAGLN3[glue turning egg(s) white 3], TAOK2[TAO kinases 2], TAP1[transport protein 1, ATP is in conjunction with box, subfamily B (MDR/TAP)], The TAP2[transport protein 2, ATP is in conjunction with box, subfamily B (MDR/TAP)], TAPBP[TAP is in conjunction with albumen (first mercapto albumen)], The TARDBP[TAR DBP], TARP[TCR γ replaces alternate reading frame protein matter], The TAS2R1[taste receptors, type 2, the member 1], The TAT[TAT], TBC1D4[TBC1 territory family, the member 4], TBCB[microtubulin fold co-factor B], TBCD[microtubulin fold co-factor D], TBCE[microtubulin fold co-factor E], TBL1Y[transducin (β) sample 1, Y-is chain], TBL2[transducin (β) sample 2], The TBP[TATA frame is in conjunction with albumen], The TBPL2[TATA frame is in conjunction with albumen sample 2], The TBR1[T-frame, brain, 1], TBX1[T frame 1], TBX21[T-frame 21], TBXA2R[thromboxane A2 acceptor], TBXAS1[thromboxane A synthetase 1 (blood platelet)], TCEB3[transcriptional elongation factor B (SIII), polypeptide 3 (110kDa, elongation factors A)], TCF12[transcription factor 12], TCF19[transcription factor 19], TCF4[transcription factor 4], TCF7[transcription factor 7 (T-cell-specific, HMG-frame)], TCF7L2[transcription factor 7 samples 2 (T-cell-specific, HMG-frame)], The TCHH[trichohyalin], TCN1[transcobalamin I (vitamin b12 in conjunction with albumen, R binding factor family)], TCN2[transcobalamin II; Macrocytic anemia], TCP1[t-complex 1], TDO2[tryptophan 2[3-dioxygenase], TDRD3[contains tudor territory 3], TEAD2[TEA territory family member 2], TEAD4[TEA territory family member 4], The TEK[TEK EGFR-TK, endothelium], TERF1[telomeric repeat binding factor (NIMA combination) 1], TERF2[telomeric repeat binding factor 2], The TERT[reverse transcriptase of telomere], TET2[tet Oncogene family member 2], The TF[transferrin], TFAM[transcription factor A, mitochondria], TFAP2A[transcription factor AP-1-2 α (activating enhancer binding protein 2 α)], TFCP2[transcription factor CP2], TFF1[trefoil factor 1], The TFF2[trefoil factor 2], TFF3[trefoil factor 3 (intestines)], TFPI[tissue factor approach inhibition factor (lipoprotein be correlated with coagulation inhibitor)], TFPI2[tissue factor approach inhibition factor 2], TFRC[transferrin receptor (p90, CD71)], The TG[thyroglobulin], The TGFA[TGF, α], The TGFB1[TGF, β 1], TGFB1I1[transforminggrowthfactor-β1 guiding transcript 1], The TGFB2[TGF, β 2], The TGFB3[TGF, β 3], The TGFBR1[TGF, beta receptor 1], The TGFBR2[TGF, beta receptor II (70/80kDa)], The TGFBR3[TGF, beta receptor III], TGIF1[TGFB-Guiding factor homology frame 1], TGM2[TGase 2 (C polypeptide, protein-glutamine-gamma glutamyltransferase)], The TH[tyrosine hydroxylase], THAP1[contains the THAP territory, cell death related protein matter 1], The THBD[thrombomodulin], THBS1[thrombospondin 1], The THBS2[TSP-2], THBS4[thrombospondin 4], THEM4[thioesterase superfamily member 4], The THPO[TPO], The THRA[Thyroid Hormone Receptors, α (EBL virus (v-erb-a) oncogene homologue, birds)], The THY1[Thy-1 cell surface antigen], The TIAM1[T-cell lymphoma is invaded and is shifted 1], The TIAM2[T-cell lymphoma is invaded and transferase 12], The TIMP1[TIMP TIMP metallopeptidase inhibitor 1], TIMP2[TIMP metallopeptidase inhibiting factor 2], TIMP3[TIMP metallopeptidase initiator 3], TINF2[TERF1 (TRF1) the syncaryon factor 2], TJP1[claudin-3 white matter 1 (zonuls occludens 1)], TJP2[claudin-3 white matter 2 (zonuls occludens 2)], TK1[thymidine kinase 1, solvable], The TKT[transketolase], TLE1[transducin sample division enhancer 1 (E (sp1) homologue, fruit bat)], TLR1[toll sample acceptor 1], TLR2[toll sample acceptor 2], TLR3[toll sample acceptor 3], TLR4[toll sample acceptor 4], TLR5[toll sample acceptor 5], TLR7[toll sample acceptor 7], TLR8[toll sample acceptor 8], TLR9[toll sample receptor 9], TLX3[T-chronic myeloid leukemia homology frame 3], TMEFF1[has the transmembrane protein 1 in EGF sample and two folliculus stabilize proteins sample territories], TMEM100[transmembrane protein 100], TMEM216[transmembrane protein 216], TMEM50B[transmembrane protein 50B], TMEM67[transmembrane protein 67], TMEM70[transmembrane protein 70], TMEM87A[transmembrane protein 87], TMOD2[tropomodulin 2 (neuron)], TMOD4[tropomodulin 4 (muscle)], TMPRSS11A[transmembrane protein enzyme, serine 11], TMPRSS15[transmembrane protein enzyme, serine 15], TMPRSS2[transmembrane protein enzyme, serine 2], TNC[tenascin C], TNF[TNF (TNF superfamily, the member 2)], The TNFAIP3[TNF, α-pilot protein matter 3], The TNFRSF10A[tumor necrosis factor receptor super family, the member 10], The TNFRSF10B[tumor necrosis factor receptor super family, member 10b], The TNFRSF10C[tumor necrosis factor receptor super family, member 10c, do not have the bait of cell internal area], The TNFRSF10D[tumor necrosis factor receptor super family, member 10d, have the bait of brachymemma Death Domain], The TNFRSF11B[tumor necrosis factor receptor super family, member 11b], The TNFRSF18[tumor necrosis factor receptor super family, the member 18], The TNFRSF19[tumor necrosis factor receptor super family, the member 19], The TNFRSF1A[tumor necrosis factor receptor super family, member 1A], The TNFRSF1B[tumor necrosis factor receptor super family, member 1B], The TNFRSF25[tumor necrosis factor receptor super family, the member 25], The TNFRSF8[tumor necrosis factor receptor super family, the member 8], TNFSF10[TNF (part) superfamily, the member 10], TNFSF11[TNF (part) superfamily, the member 11], TNFSF13[TNF (part) superfamily, the member 13], TNFSF13B[TNF (part) superfamily, member 13b], TNFSF4[TNF (part) superfamily, the member 4], The TNK2[EGFR-TK, non-acceptor, 2], TNNI3[Troponin I type 3 (heart)], TNNT1[TnT Class1 (bone, slowly)], TNNT2[TnT type 2 (heart)], TNR[tenascin R (restraining albumen, janusin)], TNS1[tensin 1], TNS3[tensin 3], TNXB[tenascin XB], TOLLIP[toll is in conjunction with albumen], TOP1[topoisomerase (DNA) I], TOP2A[topoisomerase (DNA) II α 170kDa], TOP2B[topoisomerase (DNA) II β 180kDa], The anti-protein family 1 of turning round of TOR1A[, member A (the anti-albumin A of turning round)], TP53[oncoprotein matter p53], TP53BP1[oncoprotein matter p53 Binding Protein 1], TP63[oncoprotein matter p63], TP73[oncoprotein matter p73], TPH1[TPH 1], TPH2[TPH 2], TPI1[triose-phosphate isomerase 1], The TPO[thyroid peroxidase], TPT1[oncoprotein matter, translate-control 1], TPTE[cross-film phosphatase has the tensin homology], TRADD[TNFRSF1A-has dead district], TRAF2[TNF receptor associated factor 2], TRAF3[TNF receptor associated factor 3], TRAF6[TNF receptor associated factor 6], TRAP1[TNF receptor associated protein white matter 1], TREM1[triggers marrow sexual cell expression of receptor 1], TRH[thyrotropic hormone-releasing hormone], TRIM21[contains three symbasis orders 21], TRIM22[contains three symbasis orders 22], TRIM26[contains three symbasis orders 26], TRIM27[contains three symbasis orders 27], TRIM50[contains three symbasis orders 50], TRIO[triple functions territory (PTPRF combination)], TRPA1[transient receptor potential cationic channel protein, subfamily A, the member 1], TRPC1[transient receptor potential cationic channel protein, subfamily C, the member 1], TRPC5[transient receptor potential cationic channel protein, subfamily C, the member 5], TRPC6[transient receptor potential cationic channel protein, subfamily C, the member 6], TRPM1[transient receptor potential cationic channel protein, subfamily M, the member 1], TRPV1[transient receptor potential cationic channel protein, subfamily V, the member 1], TRPV2[transient receptor potential cationic channel protein, subfamily V, the member 2], TRRAP[transforms/transcribes the territory related protein], TSC1[tuberous sclerosis 1], TSC2[tuberous sclerosis 2], TSC22D3[TSC22 territory family, the member 3], TSG101[tumor susceptibility gene 101], The TSHR[thyrotropin receptor], The TSN[transfer protein], TSPAN12[tetra-revolves protein 12], TSPAN7[tetra-revolves albumen 7], TSPO[transposable element protein (18kDa)], TTC3[triangle tetrapeptide duplicate domain 3], The TTF1[transcription termination factor, rna plymerase i], The TTF2[transcription termination factor, rna plymerase ii], The TTN[titin], TTPA[tocopherol (α) transferring protein], TTR[thyroxine transport protein], TUB[tubbiness homologue (mouse)], The TUBA1A[tubulin, α 1a], The TUBA1B[tubulin, α 1b], The TUBA1C[tubulin, α 1c], The TUBA3C[tubulin, α 3c], The TUBA3D[tubulin, α 3d], The TUBA4A[tubulin, α 4a], The TUBA8[tubulin, α 8], The TUBB[tubulin, β], The TUBB1[tubulin, β 1], The TUBB2A[tubulin, β 2A], The TUBB2B[tubulin, β 2B], The TUBB2C[tubulin, β 2C], The TUBB3[tubulin, β 3], The TUBB4[tubulin, β 4], The TUBB4Q[tubulin, beta polypeptides 4, member Q], The TUBB6[tubulin, β 6], The TUBGCP5[tubulin, the γ complex protein 5 of being correlated with], The TUFM[Tu translation elongation factor, mitochondria], TUSC3[TIF candidate gene 3], TWIST1[reverses homologue 1 (fruit bat)], The TXN[thioredoxin], The TXNIP[thioredoxin is in conjunction with albumen], TXNRD1[thioredoxin reductase 1], TXNRD2[thioredoxin reductase 2], TYK2[EGFR-TK 2], The TYMP[thymidine phosphorylase], The TYMS[thymidylate synthetase], TYR[tyrosinase (eyelid albinism IA)], The TYRO3[TYRO3 protein tyrosine kinase], The TYROBP[TYRO protein tyrosine kinase is in conjunction with albumen], TYRP1[tyrosinase-related protein matter 1], U2AF1[U2 small nuclear rna confactor 1], UBA1[Ubiquitin like modifier activating enzymes 1], UBA52[ubiquitin A-52 residue ribosomal protein fusion products 1], UBB[ubiquitin B], UBC[ubiquitin C], UBE2A[ubiquitin binding enzyme E2A (RAD6 homologue)], UBE2C[ubiquitin binding enzyme E2C], UBE2D2[ubiquitin binding enzyme E2D2 (UBC4/5 homologue, yeast)], UBE2H[ubiquitin binding enzyme E2H (UBC8 homologue, yeast)], UBE2I[ubiquitin binding enzyme E2I (UBC9 homologue, yeast)], UBE3A[ubiquitin protein matter ligase E3A], UBL5[ubiquitin sample 5], UCHL1[ubiquitin carboxyl-end esterase L1 (ubiquitin thiolesterase)], The UCN[Urocortin], UCP1[Uncoupling Proteins 1 (mitochondria, proton carrier)], UCP2[Uncoupling Proteins 2 (mitochondria, proton carrier)], UCP3[Uncoupling Proteins 3 (mitochondria, proton carrier)], UGT1A1[UDP glucuronyl transferase 1 family, polypeptide A 1], UGT1A3[UDP glucuronyl transferase 1 family, polypeptide A 3], ULK1[unc-51 sample kinases 1 (Caenorhabditis elegans)], UNC5A[unc-5 homologue A (Caenorhabditis elegans)], UNC5B[unc-5 homologue B (Caenorhabditis elegans)], UNC5C[unc-5 homologue C (Caenorhabditis elegans)], UNC5D[unc-5 homologue D (Caenorhabditis elegans)], The UNG[uracil-DNA glycosylase], The UPF3 regulatory factor homologue B (yeast) of UPF3B[nonsense transcript], UPK3B[urinates molten albumen 3B], UPP2[UP 2], UQCRC1[ubiquinone-Cytochrome c reductase core protein I], USF1[UBF 1], USF2[UBF 2, the c-fos combination], USH2A[Usher syndrome 2A (autosomal recessive, slight)], USP1[ubiquitin-specific peptase 1], USP15[ubiquitin-specific peptase 15], USP25[ubiquitin-specific peptase 25], USP29[ubiquitin-specific peptase 29], USP33[ubiquitin-specific peptase 33], USP4[ubiquitin-specific peptase 4 (former-oncogene)], USP5[ubiquitin-specific peptase 5 (isopeptidase T)], USP9X[ubiquitin-specific peptase 9, X-is chain], USP9Y[ubiquitin-specific peptase 9, Y-is chain], The UTRN[dystrophin], UXT[extensively-express transcript], VAMP7[film bubble related membrane protein matter 7], VASP[vasodilator-stimulation phosphoprotein], The VAV1[vav1 guanine nucleotide exchange factor], The VAV2[vav2 guanine nucleotide exchange factor], Homology frame 1 before the VAX1[abdomen], The VCAM1[Vcam1], The VCL[vinculin], VDAC1[voltage-dependence anion channel 1], VDAC2[voltage-dependence anion channel 2], VDR[vitamin D (1[25-dihydroxyvitamin D3) acceptor], The VEGFA[VEGF-A], The VEGFB[vascular endothelial growth factor B], The VEGFC[vascular endothelial growth factor C], The VGF[VGF nerve growth factor can be induced], VHL[von Hippe1-Lindau TIF], The VIM[vimentin], The VIP[vasoactive intestinal peptide], VIPR1[vip receptor 1], VIPR2[vip receptor 2], VKORC1[vitamin K epoxide reductase complex, subunit 1], VLDLR[extra-low density lipoprotein acceptor], VPS29[film bubble protein sorting 29 homologues (saccharomyces cerevisiae)], VSIG4[contains V-group and immunoglobulin (Ig) territory 4], VSX1[vision system homology frame 1], The VTN[vitronectin], VWC2[contains vWF ELISA C territory 2], The VWF[vWF ELISA], WAS[Wiskott-Aldrich syndrome (eczema-decrease of platelet)], The WASF1[WAS protein families, the member 1], The WASF2[WAS protein families, the member 2], WASL[Wiskott-Aldrich syndrome sample], Aortic stenosis syndrome chromosomal region 16 on the WBSCR16[Williams valve], Aortic stenosis syndrome chromosomal region 17 on the WBSCR17[Williams valve], WBSCR22[Williams Beuren syndrome chromosomal region 22], WBSCR27[Williams Beuren syndrome chromosomal region 27], Aortic stenosis syndrome chromosomal region 28 on the WBSCR28[Williams valve], WDR4[WD duplicate domain 4], WEE1[WEE1 homologue (fission yeast)], The WAS protein homology thing that WHAMM[is relevant to actin, golgi's membrane and microtubule], WIPF1[WAS/WASL is in conjunction with protein family, and the member 1], WIPF3[WAS/WASL is in conjunction with protein family, and the member 3], WNK3[WNK lysine defect protein kinase 3], WNT1[is aptery-type MMTV integration site family, the member 1], WNT10A[is aptery-type MMTV integration site family, and member 10A], WNT10B[is aptery-type MMTV integration site family, and member 10B], WNT11[is aptery-type MMTV integration site family, the member 11], WNT16[is aptery-type MMTV integration site family, the member 16], WNT2[is aptery-type MMTV integration site family member 2], WNT2B[is aptery-type MMTV integration site family, and member 2B], WNT3[is aptery-type MMTV integration site family, the member 3], WNT3A[is aptery-type MMTV integration site family, and member 3A], WNT4[is aptery-type MMTV integration site family, the member 4], WNT5A[is aptery-type MMTV integration site family, and member 5A], WNT5B[is aptery-type MMTV integration site family, and member 5B], WNT6[is aptery-type MMTV integration site family, the member 6], WNT7A[is aptery-type MMTV integration site family, and member 7A], WNT7B[is aptery-type MMTV integration site family, and member 7B], WNT8A[is aptery-type MMTV integration site family, and member 8A], WNT8B[is aptery-type MMTV integration site family, and member 8B], WNT9A[is aptery-type MMTV integration site family, and member 9A], WNT9B[is aptery-type MMTV integration site family, and member 9B], The rich tryptophan basic protein of WRB[], WRN[Werner syndrome, RecQ unwindase sample], WT 1[embryonal adenomyosarcoma 1], XBP1[X-frame Binding Protein 1], XCL1[chemotactic factor (CF) (C motif) ligand 1], The XDH[xanthine dehydrogenase], The chain inhibiting factor of the apoptotic X-of XIAP[], XIRP2[contains the xin actin in conjunction with repetitive sequence 2], The XPC[xeroderma pitmentosum, complementary group C], The reparation of XRCC1[Chinese hamster cell X ray supplements defect repair 1], The reparation of XRCC5[Chinese hamster cell X ray supplements defect repair 5 (double-stranded-fracture is re-engaged)], The reparation of XRCC6[Chinese hamster cell X ray supplements defect repair 6], XRN1[5 '-3 ' RNA excision enzyme 1], YBX1[Y frame Binding Protein 1], YWHAB[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, beta polypeptides], YWHAE[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the ε polypeptide], YWHAG[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the γ polypeptide], YWHAQ[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the θ polypeptide], YWHAZ[tyrosine 3-monooxygenase/Tryptophan 5-monooxygenase activator protein matter, the ζ polypeptide], ZAP70[ζ-chain (TCR) related protein kinase 70kDa], ZBTB 16[contains zinc and refers to and BTB territory 16], ZBTB33[contains zinc and refers to and BTB territory 33], ZC3H12A[contains zinc and refers to CCCH-Class1 2A], ZEB 1[zinc refers to that the E-frame is in conjunction with homology frame 1], ZEB2[zinc refers to that the E-frame is in conjunction with homology frame 2], ZFP161[zinc finger protein matter 161 homologues (mouse)], ZFP36[zinc finger protein matter 36, C3H type, homologue (mouse)], ZFP42[zinc finger protein matter 42 homologues (mouse)], ZFP57[zinc finger protein matter 57 homologues (mouse)], ZFPM1[zinc finger protein matter, many types of 1], ZFPM2[zinc finger protein matter, many types of 2], ZFY[zinc finger protein matter, Y-is chain], ZFYVE9[zinc refers to, contains FYVE territory 9], ZIC1[Zic family member 1 (odd number-paired homologue, fruit bat)], ZIC2[Zic family member 2 (odd number-paired homologue, fruit bat)], ZIC3[Zic family member 3 (odd number-paired homologue, fruit bat)], ZMPSTE24[zinc metallopetidase (STE24 homologue, saccharomyces cerevisiae)], ZNF148[zinc finger protein matter 148], ZNF184[zinc finger protein matter 184], ZNF225[zinc finger protein matter 225], ZNF256[zinc finger protein matter 256], ZNF333[zinc finger protein matter 333], ZNF385B[zinc finger protein matter 385B], ZNF44[zinc finger protein matter 44], ZNF521[zinc finger protein matter 521], ZNF673[zinc refers to family member 673], ZNF79[zinc finger protein matter 79], ZNF84[zinc finger protein matter 84], ZW10[ZW10, kinetochore is relevant, homologue (fruit bat)] and the ZYX[zyxin].

Preferred neurodevelopment gene can comprise BMP4 (skeletal form generation protein 4); CHRD (tendon albumen); NOG (noggin); WNT2 (aptery-type MMTV integration site family member 2); WNT2B (aptery-type MMTV integration site family, member 2B); WNT3A (aptery-type MMTV integration site family, member 3A); WNT4 (aptery-type MMTV integration site family, the member 4); WNT5A (aptery-type MMTV integration site family, member 5A); WNT6 (aptery-type MMTV integration site family, the member 6); WNT7B (aptery-type MMTV integration site family, member 7B); WNT8B (aptery-type MMTV integration site family, member 8B); WNT9A (aptery-type MMTV integration site family, member 9A); WNT9B (aptery-type MMTV integration site family, member 9B); WNT10A (aptery-type MMTV integration site family, member 10A); WNT10B (aptery-type MMTV integration site family, member 10B); WNT16 (aptery-type MMTV integration site family, the member 16); OTX2 (just little tooth homology frame 2); GBX2 (gastrula forms brain homology frame 2); FGF8 (FGF8 (male sex hormone-inducing)); RELN (reeling albumen); DAB1 (inefficacy homologue 1 (fruit bat)); POU4F1 (POU class 4 homology frames 1); And numb (numb homologue (fruit bat).

In certain embodiments, the animal produced by method of the present invention can be used for by using normally used tolerance in the research neurodevelopment to study sudden change for animal and neurodevelopmental effect.

iv. cell function model

Method of the present invention can be used for producing animal or the cell that can be used as the cell function model.This type of model can be used for the impact for the target cell function of chromosome sequence that institute edits.For example, the cell function model can be used for the impact for intracellular signal transduction or extracellular signal transduction of chromosome sequence that institute edits.Perhaps, the cell function model can be used for institute and edits the impact of karyomit(e) nucleotide sequence for sensory perception.

For example, in one embodiment, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in one or more nucleotide sequences relevant to the signal transduction bio-chemical pathway.The unrestricted example of suitable approach and relevant nucleotide sequence is listed in table C.

In addition, method of the present invention can be used for being created in animal or the cell that comprises the karyomit(e) editor in one or more nucleotide sequences relevant to cell function.As limiting examples, can in the sequence relevant with the AB translocator to cognition, the pain sensation, the sense of taste, carry out the karyomit(e) editor, details are as follows respectively for it.

a. cognitive

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to cognition is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

In the above-described embodiment, the cognitive relevant protein of the chromosome sequence codified relevant to cognition, may be maybe control sequence.Cognitive related protein be one group can be relevant to susceptibility, the seriousness that cognitive illness, cognitive illness occur or its any combination of the cognitive illness of development different proteins.The limiting examples of cognitive illness comprises the A Zihaimo disease; Mental retardation; The Rett Cotard; Fragile X mental retardation; Emotional conditions, as severe depression, one pole disease, mania, anxiety disorder, bipolarity illness, dysthymia, and manic depressions; Mental illness, as schizophrenia, Split feeling illness, Schizophreniform illness, paranoea, of short duration mental illness, the mental illness that material causes, the property shared mental illness; The personality illness, as borderline personality's illness and separation property identity illness; Anxiety disorder, as generalized anxiety disorder and obsession; Young illness; Dementia, as HIV related dementia (HAD) and multi-infarct dementia; Autism; Regulate disorderly; Delirium; Coprolalia; Stress illness after attention deficit disorder and wound.

Cognitive relevant protein or the control sequence empirical correlation based on cognitive correlated series and cognitive illness are usually selected.For example, with respect to the colony that there is no cognitive illness, in suffering from the colony of cognitive illness, the production rate of cognitive related protein or circulation composition can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The limiting examples of cognitive related protein comprises A2M (α-2-macroglobulin), AATF (Apoptosis antagonism transcription factor), ACPP (PAP), ACTA2 (actin α 2 smooth muscle sustainers), ADAM22 (ADAM metallopeptidase territory), ADORA3 (adenosine A 3 receptor), ADRA1D (α-1D adrenocepter, α-1D adrenocepter), AHSG (α-2-HS-glycoprotein), AIF1 (allograft inflammatory factor 1), ALAS2 (δ-ammonia levulic acid synzyme 2), AMBP (α-1-microglobulin/bikunin precursor), ANK3 (Ankryn3), ANXA3 (annexin A 3), APCS (amyloid P component serum), APOA1 (Apolipoprotein A1), APOA12 (ApoA2), APOB (apolipoprotein B), APOC1 (ApoC1), APOE (apo E), APOH (Apolipoprotein H), APP (amyloid precusor protein), ARC (activity-regulating cell skeleton related protein), ARF6 (ADP-ribosylation factor 6), ARHGAP5 (Rho gtpase activating protein matter 5), ASCL1 (without bristle scale and shell homologue 1), B2M (beta-2 microglobulin), B4GALNT1 (β-Isosorbide-5-Nitrae-N-acetyl-amine-galactose transferase 1), BAX (Bcl-2-be correlated with X protein matter), BCAT (branched-chain amino acid transaminase 1 cytoplasm), BCKDHA (BCKA dehydrogenase E1 α), BCKDK (branched-chain alpha-keto acid dehydrogenase kinases), BCL2 (B cell lymphoma 2), BCL2L1 (BCL2 sample 1), BDNF (neurotrophic factor derived from brain), BHLHE40 (kind E bHLH protein matter 40), BHLHE41 (kind E bHLH protein matter 41), BMP2 (bone morphogenetic protein-2 A), BMP3 (bone morphogenetic protein 3), BMP5 (bone morphogenetic protein 5), BRD1 (containing calm territory 1), BTC (second born of the same parents' element), BTNL8 (butyrophilin sample protein 8), CALB1 (calbindin 1), CALM1 (calmodulin 1), CAMK1 (calcium/calmodulin-deopendent protein kinase type I), CAMK4 (calcium/calmodulin-deopendent protein kinase type I V), CAMKIIB (calcium/calmodulin-deopendent protein kinase Type II B), CAMKIIG (calcium/calmodulin-deopendent protein kinase Type II G), CASP11 (caspase-1 0), CASP8 (caspase 8 Apoptosis be correlated with cysteine peptase), CBLN1 (cerebellin 1 precursor), CCL2 (chemotactic factor (CF) (C-C motif) part 2), CCL22 (chemotactic factor (CF) (C-C motif) part 22), CCL3 (chemotactic factor (CF) (C-C motif) part 3), CCL8 (chemotactic factor (CF) (C-C motif) part 8), CCNG1 (cyclin-G1), CCNT2 (cyclin T2), CCR4 (C-C chemokine receptors type 4 (CD194)), CD58 (CD58), CD59 (protection element), CD5L (CD5 antigen sample), CD93 (CD93), CDKN2AIP (CDKN2A interaction protein), CDKN2B (cyclin-dependent kinase enzyme inhibition factor 2B), CDX1 (homology frame protein C DX-1), CEA (carcinomebryonic antigen), CEBPA (CCAAT/ enhancer binding protein α), CEBPB (CCAAT/ enhancer binding protein C/EBP β), CEBPB (CCAAT/ enhancer binding protein β), CEBPD (CCAAT/ enhancer binding protein δ), CEBPG (CCAAT/ enhancer binding protein γ), CENPB (kinetochore PROTEIN B), CGA (glycoprotein hormones α chain), CGGBP1 (CGG triplet repetitive sequence bindin 1), CHGA (Chromogranin A), CHGB (secretoneurin), CHN2 (β-chimericin), CHRD (tendon albumen), CHRM1 (cholinergic recepter muscarine 1), CITED2 (Cbp/p300 is in conjunction with transforming activity factor 2), CLEC4E (the 4 member E of C-type lectin domain family), CMTM2 (protein 2 that the CKLF sample contains the MARVEL membrane-spanning domain), CNTN1 (contactin 1), CNTNAP1 (contactin related protein sample 1), CR1 (red blood cell complement receptor 1), CREM (cAMP-response element regulatory factor), CRH (cortin-releasing hormone), CRHR1 (cortin releasing hormone receptor 1), CRKRS (CDC 2 related protein kinases 7), CSDA (DBP A), CSF3 (granulocyte colony stimulating factor 3), CSF3R (G-CSF 3 acceptors), CSP (chemical co-ordination protein), CSPG4 (chondroitin sulfate proteoglycan 4), CTCF (CCCTC binding factor zinc finger protein matter), CTGF (CTGF), CXCL12 (Chemokines CC-X-C motif ligand 1 2), DAD1 (the dead factor 1 of anti-cell), DAXX (dead related protein 6), DBN1 (Drebrin1), DBP (albumin promoter-protein-bonded D of albumin D-frame site), DDR1 (containing dish albumen domain receptor family member 1), DDX14 (DEAD/DEAH frame unwindase), DEFA3 (sozin α 3 neutrophil leucocytes-specificity), DVL3 (dsh homologue 3 at random), EDN1 (Endothelin 1), EDNRA (endothelin receptor type A), EGF (EGF), EGFR (EGF-R ELISA), EGR1 (early growth response protein matter 1), EGR2 (early growth response protein matter 2), EGR3 (early growth response protein matter 3), EIF2AK2 (eukaryotic translation initiation factor 2-alpha kinase 2), ELANE (expression of elastoser neutrophil leucocyte), ELK1 (the ELK1 member of ETS oncogene family), ELK3 (ELK3ETS-territory protein (SRF auxiliary protein 2)), EML2 (Echinodermata microtubule-associated proteins sample 2), EPHA4 (EPH acceptor A4), ERBB2 (V-erb-b2 EBL Viral Carcinogenesis gene homolog 2), ERBB3 (receptor tyrosine-protein kinase erbB-3), ESR2 (estrogen receptor 2), ESR2 (estrogen receptor 2), ETS1 (V-ets marrow erythroblastosis virus E26 oncogene homologue 1), ETV6 (Ets variant 6), FASLG (FasL TNF superfamily member 6), FCAR (the Fc fragment of IgA acceptor), FCER1G (the Fc fragment of the IgE high-affinity I acceptor of γ polypeptide), FCGR2A (the Fc fragment of IgG low-affinity IIa acceptor CD32), FCGR3B (the Fc fragment of IgG low-affinity IIIb acceptor CD16b), FCGRT (the Fc fragment of IgG acceptor transport protein α), FGA (alkaline fibrinogen), FGF1 (acid fibroblast growth factor 1), FGF14 (fibroblast growth factor 14), FGF16 (desmocyte growth factor-21 6), FGF18 (FGF-18), FGF2 (HBGH-2), FIBP (acid fibroblast growth factor ICBP), FIGF (C-fos inductive factor), FMR1 (fragile X mental retardation 1), FOSB (FBJ Muridae osteosarcoma virus oncogene homologue B), FOXO1 (jaw frame O1), FSHB (follicle-stimulating hormone (FSH) beta polypeptides), FTH1 (ferritin heavy chain polypeptide 1), FTL (ferritin light chain polypeptide), G1P3 (but interferon-' alpha '-induced protein 6), G6S (2-Acetamido-2-deoxy-D-glucose-6-sulfatase), GABRA2 (GABA A receptor alpha 2), GABRA3 (GABA A receptor alpha 3), GABRA4 (GABA A receptor alpha 4), GABRB1 (GABA A receptor β 1), GABRG1 (GABA A receptor y 1), GADD45A (growth retardation and DNA-wound inducement α), GCLC (Glutamate-cysteine ligase catalytic subunit), GDF15 (growth and differentiation factor 15), GDF9 (growth differentiation factor 9), GFRA1 (GDNF family receptors α 1), GIT1 (G albumen-coupled receptor kinase binding factor 1), GNA13 (guanine-nucleotide-binding protein/G protein alpha 13), GNAQ (guanine-nucleotide-binding protein/G albumen q polypeptide), GPR12 (G albumen-coupled receptor 12), GPR18 (G albumen-coupled receptor 18), GPR22 (G albumen-coupled receptor 22), GPR26 (G albumen-coupled receptor 26), GPR27 (G albumen-coupled receptor 27), GPR77 (G albumen-coupled receptor 77), GPR85 (G albumen-coupled receptor 85), GRB2 (growth factor receptors is in conjunction with albumen 2), GRLF1 (glucocorticoid receptor dna binding factor 1), GST (glutathione S-transferase), GTF2B (general transcription factor IIB), GZMB (granzyme B), HAND1 (heart and neural crest derivative express 1), HAVCR1 (hepatitis a virus cell receptor 1), HES1 (crinosity and enhancer rupture 1), HES5 (crinosity and enhancer rupture 5), HLA-DQA1 (major histocompatibility complex class II DQ α), HOXA2 (homology frame A2), HOXA4 (homology frame A4), HP (hoptoglobin), HPGDS (prostaglandin-D synzyme), HSPA8 (heat shock 70kDa protein 8), HTR1A (5-hydroxytryptamine receptor 1A), HTR2A (5-hydroxytryptamine receptor 2A), HTR3A (5-hydroxytryptamine receptor 3A), ICAM1 (ICAM-1 (CD54)), IFIT2 (interferon-induced protein triangle tetrapeptide repeats 2), IFNAR2 (interferon α/β/Ω acceptor 2), IGF1 (type-1 insulin like growth factor), IGF2 (IMA-IGF2BP3-001), IGFBP2 (IGFBP2,36kDa), IGFBP7 (PSF), IL10 (interleukin 10), IL10RA (Interleukin 10 receptor α), IL11 (interleukin-11), IL11RA (interleukin-11 receptor alpha), IL11RB (interleukin-11 receptor β), IL13 (interleukin-13), IL15 (interleukin 15), IL17A (IL-17 A), IL17RB (IL-17 acceptor B), IL18 (interleukin-18), IL18RAP (interleukin 18 receptor auxiliary protein), IL1R2 (interleukin 1 receptor Type II), IL1RN (interleukin 1 receptor antagonist), IL2RA (interleukin 2 receptor α), IL4R (interleukin-4 acceptor), IL6 (interleukin-6), IL6R (interleukin-6 receptor), IL7 (interleukin-17), IL8 (interleukin 8), IL8RA (interleukin 8 receptor alpha), IL8RB (interleukin 8 receptor β), ILK (integrin-chain kinases), INPP4A (inositol polyphosphoric acids-4-phosphatase type I, 107kDa), INPP4B (inositol polyphosphoric acids-4-phosphatase type I β), INS (insulin), IRF2 (interferon regulatory factor 2), IRF3 (interferon regulatory factor 3), IRF9 (interferon regulatory factor 9), IRS1 (substrate 1), ITGA4 (integrin alpha-4), ITGA6 (beta 2 integrin alpha-6), ITGAE (beta 2 integrin alpha E), ITGAV (beta 2 integrin alpha-V), JAG1 (zigzag 1), JAK1 (Janus kinases 1), JDP2 (Jun dimerization protein 2), JUN (Jun oncogene), JUNB (JunB proto-oncogene), KCNJ15 (potassium inward rectification passage subfamily J member 15), KIF5B (kinesin family member 5B), KLRC4 (killer cell agglutinin receptor subfamily C member 4), KRT8 (CK8), LAMP2 (lysosome related membrane protein matter 2), LEP (leptin), LHB (luteinizing hormone(LH beta polypeptides), LRRN3 (leucine-rich repeat neuron 3), MAL (Mal T-Cell Differentiation protein), MAN1A1 (mannosidase α class 1A member 1), MAOB (MAO-B), MAP3K1 (mitogen activated protein kinase kinase kinase 1), MAPK1 (mitogen activated protein kinase 1), MAPK3 (mitogen activated protein kinase 3), MAPRE2 (microtubule-associated proteins RP/EB family member 2), MARCKS (rich myristoylation alanine protein kinase C substrate), MAS1 (MAS1 oncogene), MASL1 (MAS1 oncogene sample), MBP (MBP ELISA), MCL1 (bone marrow cell leukaemia sequence 1), MDMX (MDM2 sample p53 is in conjunction with albumen), MECP2 (methyl CpG is in conjunction with albumen 2), MFGE8 (milk globules-EGF factor 8 protein), MIF (macrophage migration inhibitory factor), MMP2 (matrix metal peptase 2), MOBP (myelin be correlated with oligodendroglia basic protein), MUC16 (cancer antigen 125), MX2 (myxovirus (influenza virus) resistance 2), (the MYB Binding Protein 1 a) for MYBBP1A, NBN (disconnected albumen), NCAM1 (N-CAM 1), NCF4 (neutrophil leucocyte cytoplasmic factor 440kDa), NCOA1 (nuclear receptor coactivator 1), NCOA2 (nuclear receptor coactivator 2), NEDD9 (neural precursor is expressed to grow and lowered 9), NEUR (neuraminidase), NFATC1 (activation T-nuclear factor cytoplasm calcineurin-dependence 1), NFE2L2 (nuclear factor granulophilocyte-derivative 2 samples 2), NFIC (nuclear factor I/C), NFKBIA (B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor α), NGFR (trk C), NIACR2 (niacin receptor 2), NLGN3 (the neural albumen 3 that connects), NPFFR2 (neuropeptide FF receptor 2), NPY (neuropeptide tyrosine), NR3C2 (3 groups of C members 2 of nuclear receptor subunit family), NRAS (neuroblastoma RAS virus (v-ras) oncogene homologue), NRCAM (neuronal cell adhesion molecule), NRG1 (neuregulin 1), NRTN (neural order albumen), NRXN1 (neuronin 1), NSMAF (neutral sphingomyelinase activation correlation factor), NTF3 (NT-3), NTF5 (neurotrophin 4/5), ODC1 (ornithine decarboxylase 1), OR10A1 (olfactory receptor 10A1), OR1A1 (the 1 subfamily A member 1 of olfactory receptor family), OR1N1 (the 1 subfamily N member 1 of olfactory receptor family), OR3A2 (the 3 subfamily A members 2 of olfactory receptor family), OR7A17 (the 7 subfamily A members 17 of olfactory receptor family), ORM1 (AGP1), OXTR (ocytocin receptor), P2RY13 (purinoceptor P2YG-albumen coupling 13), P2Y12 (purinoceptor P2Y G-albumen coupling 12), P70S6K (P70S6 kinases), PAK1 (P21/Cdc42/Rac1-activates kinases 1), PAR1 (Prader-Willi/Angelman zone-1), PBEF1 (PBEF 1), PCAF (P300/CBP correlation factor), PDE4A (cAMP-specificity 3 ', 5 '-cPDE 4A), PDE4B (PDE4B cAMP-specificity), PDE4B (PDE4B cAMP-specificity), PDE4D (phosphodiesterase 4 D cAMP-specificity), PDGFA (blood platelet-derivative growth factor α polypeptide), PDGFB (blood platelet-derivative growth factor beta polypeptides), PDGFC (platelet-derived growth factor C), PDGFRB (β-type blood platelet-derived growth factor receptor), PDPN (flatfoot albumen), PENK (enkephalins), PER1 (cycle homologue 1), PLA2 (phospholipase A2), PLAU (plasminogen activating factors urokinase), PLXNC1 (clump shape PROTEIN C 1), PMVK (phosphomevalonate kinase), PNOC (front former pain albumen), POLH (polymerase (DNA orientation) η), POMC (POMC (corticotropin/β-short lipoprotein/α-melanocyte-stimulatinghormone/β-melanocyte stimulating hormone/beta-endorphin)), POU2AF1 (POU territory class 2 association factors 1), PRKAA1 (5 '-the AMP-activated protein kinase α of catalytic subunit-1), PRL (prolactin), PSCDBP (CAP 1 is in conjunction with albumen), PSPN (Persephin albumen), PTAFR (blood platelet-activity factor acceptor), PTGS2 (prostaglandin-endoperoxide synzyme 2), PTN (PTN), PTPN11 (the non-acceptor type 11 of protein tyrosine phosphatase), PYY (PYY), RAB11B (RAB11B member RAS Oncogene family), RAB6A (RAB6A member RAS Oncogene family), RAD17 (RAD17 homologue), RAF1 (RAF proto-oncogene serine/threonine-protein kinase), RANBP2 (RAN is in conjunction with albumen 2), RAP1A (the RAS oncogene RAP1A member of family), RB1 (retinoblastoma 1), RBL2 (retinoblastoma sample 2 (p130)), RCVRN (recoverin), REM2 (RAS/RAD/GEM sample GTP is in conjunction with 2), RFRP (RF acid amides related peptide), RPS6KA3 (ribosomal protein S6K 90kDa polypeptide 3), RTN4 (reticuloprotein 4), RUNX1 (dwarf's associated transcription factor 1), S100A4 (S100A4), S1PR1 (sphingosine-1-phosphate receptor 1), SCG2 (secretogranin II), SCYE1 (I inducing cell factor subfamily E member 1), SELENBP1 (selenium Binding Protein 1), SGK (serum/glucocorticoid regulation and control kinases), SKD1 (K+ transportation growth defect inhibiting factor 1), SLC14A1 (member 1 of solute carrier family 14 (urea transport protein) (Kidd blood group)), SLC25A37 (25 members 37 of solute carrier family), SMAD2 (SMAD family member 2), SMAD5 (SMAD family member 5), SNAP23 (synapse-related protein matter 23kDa), SNCB (homotype nucleoprotein β), SNF1LK (SNF1 sample kinases), SORT1 (sorting protein 1), SSB (Sjogren syndrome antigen B), STAT1 (signal transduction and transcriptional activators 1,91kDa), STAT5A (signal transduction and transcriptional activators 5A), STAT5B (signal transduction and transcriptional activators 5B), STX16 (syntaxin 16), TAC1 (tachykinin precursor 1), TBX1 (T-frame 1), TEF (TH embryo factor), TF (transferrins), TGFA (transforming growth factor α), TGFB1 (transforminggrowthfactor-β1), TGFB2 (transforming grouth factor beta 2), TGFB3 (transforming growth factor β 3), TGFBR1 (transforming growth factor β receptor I), TGM2 (turning glutamy enzyme 2), THPO (TPO), TIMP1 (TIMP TIMP metallopeptidase inhibitor 1), TIMP3 (TIMP metallopeptidase initiator 3), TMEM129 (transmembrane protein 129), TNFRC6 (the rich cysteine of TNFR/NGFR district), TNFRSF 10A (A member of the TNF receptor family 10a), TNFRSF10C (A member of the TNF receptor family 10c does not have the bait of cell internal area), TNFRSF1A (A member of the TNF receptor family 1A), TOB2 (ERBB2 conduction 2), TOP1 (topoisomerase (DNA) I), TOPOII (topoisomerase 2), TRAK2 (transport protein matter kinesin is in conjunction with 2), TRH (thyroid-stimulating hormone-releasing hormone), TSH (thyroid gland-stimulation hormone α), TUBA1A (tubulin α 1a), TXK (TXK EGFR-TK), TYK2 (EGFR-TK 2), UCP1 (Uncoupling Proteins 1), UCP2 (Uncoupling Proteins 2), ULIP (Unc-33 sample phosphoprotein), UTRN (dystrophin related protein), VEGF (VEGF), VGF (the VGF nerve growth factor can be induced), VIP (vasoactive intestinal peptide), VNN1 (blood vessel non-inflammatory albumen 1), VTN (vitronectin), WNT2 (aptery-type MMTV integration site family member 2), XRCC6 (the staggered complementary gene 6 of repairing of x-ray), ZEB2 (zinc refers to that the E-frame is in conjunction with homology frame 2) and ZNF461 (zinc finger protein matter 461).

Exemplary cognitive related protein comprises ANK3 (Ankryn3), APP (amyloid precursor protein), B2M (beta-2 microglobulin), BRD1 (containing calm territory 1), FMR1 (fragile X mental retardation 1), MECP2 (methyl CpG is in conjunction with albumen 2), NGFR (trk C), NLGN3 (the neural albumen 3 that connects), NRXN1 (neuronin 1) and its any combination.

In certain embodiments, the animal that method of the present invention produces can be used for the research sudden change for animal and cognitive impact.

b. nociception and the sense of taste

Feel that relevant chromosome sequence can include but not limited to the gene relevant with nociception, the gene relevant with pain and the relevant gene with the sense of taste.In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to sense process is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

Feel that relevant chromosome sequence can be relevant to the process of nociception or reception and response destructive stimulus.The unrestricted example of the relevant chromosome sequence of nociception comprises CALCA (falling blood calcium albumen related polypeptide α); FOS (FBJ mouse osteosarcoma virus oncogene homologue); NPY (neuropeptide tyrosine); TACR1 (tachykinin receptor 1); OPRM1 (Opioid Receptors μ 1); OPRD1 (Opioid Receptors δ 1); OPRK1 (Opioid Receptors κ 1); TH (tyrosine hydroxylase); DRD2 (dopamine receptor D2); PTGS2 (prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and epoxidase)); TNF (TNF (TNF superfamily member 2)); PDYN (prodynorphin); KNG1 (Prokineticin 1); CCK (CCK); NOS1 (nitric oxide synthase 1 (neuron)); IL1B (interleukin-1 beta); SST (Somat); HTR3A (serotonin (thrombocytin) acceptor 3A); MAPK1 (mitogen activated protein kinase 1); GAL (galanin prepropeptide); DYT10 (tension force abnormal 10); TRPV1 (transient receptor potential cationic channel protein subfamily V member 1); IL6 (interleukin-6 (interferon beta2)); HTR2A (serotonin (thrombocytin) acceptor 2A); CNR1 (hemp component receptor 1 (brain)); NOS2 (nitric oxide synthase 2 can be induced); PNOC (front former pain albumen); NTS (neurotensin); PTGS1 (prostaglandin-endoperoxide synthetase 1 (prostaglandin G/H sythase and epoxidase)); ACHE (acetylcholinesterase (Yt blood group)); NGF (nerve growth factor (beta polypeptides)); CCKBR (CCK B acceptor); HTR1A (serotonin (thrombocytin) acceptor 1A); NPFF (neuropeptide FF-amidated peptide precursor); CCL2 (chemotactic factor (CF) (C-C motif) part 2); CAT (catalase); BDNF (neurotrophic factor derived from brain); ADORA1 (adenosine A 1 receptor); NPR1 (natriuratic peptide receptor A/ guanylate cyclase A (atrial natriuretic peptide acceptor A)); GRP (gastrin-release peptide); MME (film metal-endopeptidase); ABCB1 (ATP is in conjunction with box subfamily B (MDR/TAP) member 1); PENK (proenkephalin); TAC1 (tachykinin precursor 1); INS (insulin); NTRK1 (neurotrophy tyrosine kinase receptor Class1); SCN9A (the valtage-gated type I X alpha subunit in sodium channel); BCHE (BuCh lipase); GALR2 (galanin receptors 2); ADCYAP1 (adenylate cyclase activating polypeptide 1 (hypophysis)); HRH2 (histamine receptor H2); OXT (oxytocins prepropeptide); POMC (POMC); ADORA2A (Adenosine A2a acceptor); CPOX (auxiliary front protoporphyrinogen oxidase); NTSR2 (neurotensin acceptor 2); SLC1A2 (member 2 of solute carrier family 1 (neuroglia high-affinity glutamate transporter)); OPRL1 (opiate receptor sample 1); GALR1 (galanin receptors 1); DDC (DOP Adecarboxylase (aromatic l-amino acid decarboxylase)); P2RX2 (purinergic receptor P2X part-gated ion channel 2); HMOX1 (Heme oxygenase (unlinking) 1); CNR2 (hemp component receptor 2 (macrophage)); HTR1B (serotonin (thrombocytin) acceptor 1B); HRH1 (histamine H_1 receptor); ADRA2A (adrenergic α-2A-acceptor); GALR3 (galanin receptors 3); KCND1 (potassium voltage-gated channel Shal be correlated with subfamily member 1); PRL (lactogen); IFNG (interferon gamma); GABBR1 (GABA (GABA) B acceptor 1); IL10 (interleukin 10); VWF (vWF ELISA); GPT (glutamic-pyruvic transaminase (alanine aminotransferase)); CSF3 (colony stimulating factor 3 (granulocyte)); IL2 (interleukin 2); IFNA1 (Interferon α1); PROK1 (front dynein 1); HMGCR (3-hydroxy-3-methyl glutaryl-CoA-reductase); JUN (jun oncogene); NPPA (natriuretic peptide precursor A); ADCY10 (adenyl cyclase 10 (solvable)); IL4 (interleukin-4); MAPK14 (mitogen activated protein kinase 14); ADA (adenosine deaminase); TGFB1 (transforminggrowthfactor-β1); MAPK8 (mitogen activated protein kinase 8); EDNRB (endothelin receptor type B); AKR1B1 (the 1 member B 1 (aldose reductase) of aldehyde-one reductase family); NOS3 (nitric oxide synthase 3 (endothelial cell)); GABRE (GABA (GABA) A acceptor ε); KCNJ5 (potassium inward rectification passage subfamily J member 5); EPHX2 (EH 2 cytoplasm); EDNRA (endothelin receptor type A); NTSR1 (neurotensin acceptor 1 (high-affinity)); IL13 (interleukin-13); EDN3 (Endothelin 3); CRH (corticotropin releasing hormone); PPARA (Peroxisome proliferator activated receptors α); CCKAR (cholecyctokinin a receptor); FAAH (fatty acid amide hydrolase); EDN1 (Endothelin 1); CABIN1 (calcineurin Binding Protein 1); NTRK3 (neurotrophy tyrosine kinase receptor type 3); NTF3 (NT3); PL-5283 (PL-5283 protein); APC (adenoma polyposis Escherichia coli); DBH (dopamine β-hydroxylase (dopamine β-monooxygenase)); SYP (synaptobrevin); SLC8A1 (member 1 of solute carrier family 8 (sodium/calcium exchanger)); CHRNA4 (cholinergic recepter nicotine α 4); TRPA1 (transient receptor potential cationic channel protein subfamily A member 1); CYBB (cytochrome b-245 beta polypeptides); RAC1 (ras be correlated with C3 botulin substrate 1 (the little gtp binding protein Rac1 of rho family)); IDS (sweat acid 2-sulfatase); LTF (lactotransferrin); TRPM8 (transient receptor potential cationic channel protein subfamily M member 8); MRGPRX3 (MAS be correlated with GPR member X3); CCR5 (chemotactic factor (CF) (C-C motif) acceptor 5); CCL5 (chemotactic factor (CF) (C-C motif) part 5); MBL2 (mannose binding lectin (protein C) 2 solvable (opsonin shortage)); P2RX3 (purinergic receptor P2X part-gated ion channel 3); MRGPRX2 (MAS be correlated with GPR member X2); FAM134B (the 134 member B of family with sequence similarity); IL8 (interleukin 8); NTRK2 (neurotrophy tyrosine kinase receptor type 2); GJA1 (gap junction protein α 143kDa); CACNA1H (calcium channel voltage-dependent T type α 1H subunit); HDC (histidine decarboxylase); IFT88 (transportation 88 homologues (chlamydomonas) in flagellum); POU4F3 (POU class 4 homology frames 3); ATOH1 (without adjusting homologue 1 (fruit bat)); GRM3 (glutamate receptor metabotropic 3); ADK (adenosine kinase); RIPK2 (acceptor interaction serine-threonine kinase 2); ANPEP (Anpep); DRD1 (dopamine receptor D1); NFE2L2 (nuclear factor (granulophilocyte-derivative 2) sample 2); RET (ret proto-oncogene); AHSP (hemoglobin alpha stable protein); ESR2 (estrogen receptor 2 (ER β)); HLA-A (major histocompatibility complex class IA); CHRM2 (cholinergic recepter muscarine 2); ALAD (ammonia levulic acid δ-dehydratase); CXCL2 (chemotactic factor (CF) (C-X-C motif) part 2); HSPG2 (heparan sulfate proteoglycan 2); F2R (prothrombin (fibrin ferment) acceptor); KCNIP3 (Kv Channel Interaction albumen 3 calcium decline albumen); GRIN1 (glutamate receptor ionic N-methyl D-Asp 1); GRIK1 (glutamate receptor ionic kainic acid 1); P2RX7 (purinergic receptor P2X part-gated ion channel 7); CACNA1B (calcium channel voltage-dependence N type α 1B subunit); TACR2 (tachykinin receptor 2); NPFFR2 (neuropeptide FF receptor 2); MRGPRX1 (MAS be correlated with GPR member X1); MRGPRX4 (MAS be correlated with GPR member X4); PTH2 (parathormone 2); DRGX (DRGs homology frame); CCR3 (chemotactic factor (CF) (C-C motif) acceptor 3); CYBA (cytochrome b-245 α polypeptide); CCL7 (chemotactic factor (CF) (C-C motif) part 7); S100A6 (S100 calbindin A6); CHGA (Chromogranin A (parathyroid secretory protein 1)); CCL4 (chemotactic factor (CF) (C-C motif) part 4); HTR5A (serotonin (thrombocytin) acceptor 5A); KCNC3 (potassium voltage-gated channel ShaW be correlated with subfamily member 3); PNMT (phenylethanol amine N-transmethylase); CCL8 (chemotactic factor (CF) (C-C motif) part 8); LTB4R (leukotriene B42 receptor); NOXA1 (nadph oxidase activity factor 1); PHOX2B (sample homology frame 2b in pairs); NOX1 (nadph oxidase 1); NOX4 (nadph oxidase 4); TAS1R3 (taste receptors Class1 member 3); NEUROG1 (neural element 1); NOXO1 (nadph oxidase organizer 1); TRIM26 (containing three symbasis orders 26); OMP (sense of smell labelled protein); ZC3H12A (contain zinc and refer to CCCH-Class1 2A); CXCR4 (chemotactic factor (CF) (C-X-C motif) acceptor 4); PLA2G2A (phospholipase A2 group IIA (blood platelet synovia)); PLA2G1B (phospholipase A2 group IB (pancreas)); GNRH1 (gonadotropic hormone-releasing hormone 1 (leuteinization-releasing hormone)); TJP1 (claudin-3 white matter 1 (zonuls occludens 1)); NRG1 (neuregulin 1); GRIN2B (glutamate receptor ionic N-methyl D-Asp 2B); COL18A1 (collagen-type XVIII α 1); HTR6 (serotonin (thrombocytin) acceptor 6); HTR7 (7 (adenyl cyclase-couplings) of serotonin (thrombocytin) acceptor); SLC1A3 (member 3 of solute carrier family 1 (neuroglia high-affinity glutamate transporter)); CACNA1D (calcium channel voltage-dependence L type α 1D subunit); GRM2 (glutamate receptor metabotropic 2); HNMT (histamine N-methyl transferase); ADORA2B (adenosine A 2b acceptor); SLC1A1 (member 1 of solute carrier family 1 (neuron/epithelium high-affinity glutamate transporter system Xag)); GABBR2 (GABA (GABA) B acceptor 2); PCSK2 (proteinogen invertase subtilopeptidase A/kexin type 2); CD160 (CD160 molecule); TSPO (transposable element protein (18kDa)); NPSR1 (neuropeptide S acceptor 1); PROL1 (rich proline lachrymal gland 1); NPVF (neuropeptide VF precursor); NPS (neuropeptide S); PRNP (prion protein); GRIA2 (glutamate receptor ionic AMPA2); GRIA1 (glutamate receptor parent ionic AMPA1); PRKCE (protein kinase C ε); ITPR1 (inositol 1 (4 (5-triphosphate receptor Class1); CBR1 (carbonyl reductase 1); ADORA3 (adenosine A 3 receptor); FMR1 (fragile X mental retardation 1); ALOX5 (arachidonic acid 5-LOX); GRM7 (glutamate receptor metabotropic 7); PRKG1 (protein kinase cGMP-dependence type I); IL7 (interleukin-17); GRIK5 (glutamate receptor ionic kainic acid 5); HCRTR1 (low albumen (orexin) acceptor 1 of secreting); CCL21 (chemotactic factor (CF) (C-C motif) part 21); IL1RN (interleukin 1 receptor antagonist); CX3CR1 (chemotactic factor (CF) (C-X3-C motif) acceptor 1); P2RX4 (purinergic receptor P2X part-gated ion channel 4); AVP (arginine vasopressin); PRPH (peripheral protein); MTOR (the mechanism target (serine/threonine kinase) of rapamycin); NFATC4 (activation T-nuclear factor cytoplasm calcineurin-dependence 4); F2RL1 (prothrombin (fibrin ferment) acceptor sample 1); EDN2 (Endothelin 2); ACCN2 (amiloride-responsive cationic channel 2 neurons); P2RX1 (purinergic receptor P2X part-gated ion channel 1); ENPEP (glutamyl aminopeptidase (Aminopeptidase A)); CLDN5 (sealing element 5); GFRA3 (GDNF family receptors α 3); PTGER1 (prostaglandin E receptor 1 (hypotype EP1) 42kDa); OCLN (shading albumen); P2RX5 (purinergic receptor P2X part-gated ion channel 5); CALB1 (calbindin 128kDa); CXCL1 (chemotactic factor (CF) (C-X-C motif) ligand 1 (melanoma growth-stimulating activity α)); BDKRB1 (bradykinin receptor B1); TRPV4 (transient receptor potential cationic channel protein subfamily V member 4); PRLHR (prolactin releasing hormone (PRH) acceptor); P2RX6 (purinergic receptor P2X part-gated ion channel 6); LALBA (lactoalbumin α-); IL17A (IL-17 A); NPFFR1 (neuropeptide FF receptor 1); ARTN (Artesunate); PTH2R (parathormone 2 acceptors); PROK2 (front Dynamin-2); PROKR2 (front dynein receptor 2); MAS1L (MAS1 oncogene sample); PROKR1 (front dynein receptor 1); MRGPRD (MAS be correlated with GPR member D); MRGPRE (MAS be correlated with GPR member E); MRGPRF (MAS be correlated with GPR member F); And PRLH (prolactin releasing hormone (PRH)).

In addition, the relevant chromosome sequence of sensation can with the pain sense correlation.The unrestricted example of the relevant chromosome sequence of pain comprises PTGS2 (prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and epoxidase)); SCN9A (the valtage-gated type I X alpha subunit in sodium channel); TRPV1 (transient receptor potential cationic channel protein subfamily V member 1); KNG1 (Prokineticin 1); IL1B (interleukin-1 beta); NTRK1 (neurotrophy tyrosine kinase receptor Class1); BDKRB 1 (bradykinin receptor B 1); BDKRB2 (bradykinin receptor B2); P2RX3 (purinergic receptor P2X part-gated ion channel 3); POMC (POMC); GAL (galanin prepropeptide); SCN10A (the valtage-gated type X alpha subunit in sodium channel); PRKCG (protein kinase C gamma); PTGS1 (prostaglandin-endoperoxide synthetase 1 (prostaglandin G/H sythase and epoxidase)); GRIN1 (glutamate receptor parent ionic N-methyl D-Asp 1); NGF (nerve growth factor (beta polypeptides)); CALCA (falling blood calcium albumen related polypeptide α); TNF (TNF (TNF superfamily member 2)); IL6 (interleukin-6 (interferon beta2)); CRP (the C reactive protein PTX-3 is relevant); INS (insulin); OPRM1 (Opioid Receptors μ 1); COMT (catechol O-methyltransferase); CNR1 (hemp component receptor 1 (brain)); IL10 (interleukin 10); CCK (CCK); TACR1 (tachykinin receptor 1); OPRD1 (Opioid Receptors δ 1); NPFFR2 (neuropeptide FF receptor 2); TGFB1 (transforminggrowthfactor-β1); NOS1 (nitric oxide synthase 1 (neuron)); CRH (corticotropin releasing hormone); GALR3 (galanin receptors 3); MSD (microcephaly companion spasm diplegia (Paine's syndrome)); IL8 (interleukin 8); MB (myoglobins); DYT10 (tension force abnormal 10); PRL (lactogen); MAPK1 (mitogen activated protein kinase 1); TAC1 (tachykinin precursor 1); PDYN (prodynorphin); GCH1 (GTP cyclization hydrolase 1); SOD1 (superoxide dismutase 1 is solvable); SLC6A4 (member 4 of solute carrier family 6 (neurotransmitter transport protein thrombocytin)); GRIN2B (glutamate receptor ionic N-methyl D-Asp 2B); NPY (neuropeptide tyrosine); OPRK1 (Opioid Receptors κ 1); PENK (proenkephalin); TRPA1 (transient receptor potential cationic channel protein subfamily A member 1); IL2 (interleukin 2); CABIN1 (calcineurin Binding Protein 1); NOS2 (nitric oxide synthase 2 can be induced); PNOC (front former pain albumen); GRIN2A (glutamate receptor ionic N-methyl D-Asp 2A); CHKA (choline kinase α); FOS (FBJ mouse osteosarcoma virus oncogene homologue); GRIN2D (glutamate receptor ionic N-methyl D-Asp 2D); CCL2 (chemotactic factor (CF) (C-C motif) part 2); HTR2A (serotonin (thrombocytin) acceptor 2A); CYP19A1 (Cytochrome P450 family 19 subfamily A polypeptide 1); GRIN2C (glutamate receptor ionic N-methyl D-Asp 2C); PTGES (Prostaglandin E Synthase); HTR3A (serotonin (thrombocytin) acceptor 3A); FAAH (fatty acid amide hydrolase); NTRK2 (neurotrophy tyrosine kinase receptor type 2); ACE (tonin (peptidyl-dipeptidase A) 1); GRM1 (glutamate receptor metabotropic 1); GDNF (glial cell derived neurotrophic factor); TLR4 (toll sample acceptor 4); DRD2 (dopamine receptor D2); GRM5 (glutamate receptor metabotropic 5); VIP (vasoactive intestinal peptide); PROK1 (front dynein 1); GALR2 (galanin receptors 2); ESR1 (ERs 1); NR3C1 (3 groups of C members 1 of nuclear receptor subunit family (GCR)); MME (film metal-endopeptidase); EDN1 (Endothelin 1); NPY1R (neuropeptide Y receptor Y1); ADK (adenosine kinase); NPY2R (neuropeptide Y receptor Y2); GALR1 (galanin receptors 1); TRPC1 (transient receptor potential cationic channel protein subfamily C member 1); TRPC5 (transient receptor potential cationic channel protein subfamily C member 5); TRPC6 (transient receptor potential cationic channel protein subfamily C member 6); HBS 1L (HBS 1 sample (saccharomyces cerevisiae)); GRIN3A (glutamate receptor ionic N-methyl-D-aspartate 3A); GRIN3B (glutamate receptor ionic N-methyl-D-aspartate 3B); GPR55 (G albumen-coupled receptor 55); MRGPRX3 (MAS be correlated with GPR member X3); HSN2 (hereditary sensory sacred disease Type II); AKR1B1 (the 1 member B1 (aldose reductase) of aldehyde-one reductase family); NGFR (trk C (TNFR superfamily member 16)); PRKCE (protein kinase C ε); TRPM8 (transient receptor potential cationic channel protein subfamily M member 8); SST (amicine); IL1RN (interleukin 1 receptor antagonist); CD40LG (CD40L); BCHE (BuCh lipase); ACPP (PAP); NPPC (natriuretic peptide precursor C); SCN11A (the valtage-gated type XI alpha subunit in sodium channel); KLK3 (kallikrein be correlated with peptase 3); PTGIR (prostacyclin I2 (prostatitis cyclase protein) acceptor (IP)); PPYR1 (pancreas polypeptide receptor 1); NPY5R (neuropeptide Y receptor Y5); NPFFR1 (neuropeptide FF receptor 1); ACCN4 (amiloride-responsive cationic channel 4 hypophysis); MMEL1 (film metal-endopeptidase sample 1); UCN (Urocortin); IFNG (interferon gamma); CYP2D6 (Cytochrome P450 family 2 subfamily D polypeptide 6); CACNA1B (calcium channel voltage-dependence N type α 1B subunit); ACCN3 (amiloride-responsive cationic channel 3); BDNF (large neurotrophic factor derived from brain); MAPK14 (mitogen activated protein kinase 14); CNR2 (hemp component receptor 2 (macrophage)); MMP9 (matrix metal peptase 9 (gelatinase B92kDa gelatinase 92kDa type I V clostridiopetidase A)); IL4 (interleukin-4); ADRB2 (alpha 1 beta-adrenergic-2-receptor surface); GFAP (glial fibrillary acidic protein matter); KCNIP3 (Kv Channel Interaction albumen 3 calcium decline albumen); IL1R1 (interleukin 1 receptor type I); ABCB1 (ATP is in conjunction with box subfamily B (MDR/TAP) member 1); MAPK8 (mitogen activated protein kinase 8); MC1R (melanocyte cortex hormone of aadrenaline 1 acceptor (α msh receptor)); ALB (albumin); CAMK2G (calcium/calmodulin-dependent protein kinase ii γ); PLAT (plasminogen activating factors tissue); P2RX4 (purinergic receptor P2X part-gated ion channel 4); MAPK3 (mitogen activated protein kinase 3); TNFRSF1A (A member of the TNF receptor family 1A); TTF2 (transcription termination factor rna plymerase ii); ITIH4 (in m-α (globulin) inhibiting factor H4 (plasma kallikrein-responsive glycoprotein)); CXCR4 (chemotactic factor (CF) (C-X-C motif) acceptor 4); SOD2 (superoxide dismutase 2 mitochondrias); SRC (v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homologue (birds)); PPARA (Peroxisome proliferator activated receptors α); CREB1 (cAMP reacted constituent Binding Protein 1); F2 (prothrombin (fibrin ferment)); GAD1 (glutamate decarboxylase 1 (brain 67kDa)); P2RX7 (purinergic receptor P2X part-gated ion channel 7); F3 (thromboplastin (factor I tissue factor)); MIF (macrophage migration inhibitory factor (glycosylation-inhibiting factor)); LEP (leptin); GNRH1 (gonadotropic hormone-releasing hormone 1 (leuteinization-releasing hormone)); OPRL1 (ORL 1); CCL3 (chemotactic factor (CF) (C-C motif) part 3); UCP1 (Uncoupling Proteins 1 (mitochondria proton carrier)); NTS (neurotensin); SLC12A5 (member 5 of solute carrier family 12 (potassium/chloride transport protein)); CD160 (CD160 molecule); NPFF (neuropeptide FF-amidated peptide precursor); ANPEP (Anpep); VDR (vitamin D (1 (25-dihydroxyvitamin D3) acceptor); JUN (jun oncogene); ADIPOQ (contain fat and connect PROTEIN C 1Q and collagen domain); ELK1 (ELK1 member ETS Oncogene family); FGF2 (FGF2 (alkalescence)); GABBR1 (GABA (GABA) B acceptor 1); COMP (cartilage oligomeric matrix protein matter); SERPINE1 (serpin peptide enzyme inhibition factor clade E (nexin Plasminogen activator Class1) member 1); GRM2 (glutamate receptor metabotropic 2); GAD2 (glutamate decarboxylase 2 (pancreas islet and brain 65kDa)); EPO (hematopoietin); NTF3 (NT3); IL1R2 (interleukin 1 receptor Type II); ADCY1 (adenyl cyclase 1 (brain)); PEPD (PEPD D); HBEGF (Heparin-binding EGF like growth factor); GAST (gastrin); KCND1 (potassium voltage-gated channel Shal be correlated with subfamily member 1); OXT (oxytocins prepropeptide); SLC17A5 (17 (anion/saccharide transporter) members 5 of solute carrier family); PL-5283 (PL-5283 protein); STN (set albumen); EGF (EGF (β-anthelone)); CACNA1A (calcium channel voltage-dependence P/Q type α 1A subunit); VWF (vWF ELISA); ANXA5 (annexin A5); MMP2 (matrix metal peptase 2 (gelatinase A72kDa gelatinase 72kDa type I V clostridiopetidase A)); HMGCR (3-hydroxy-3-methyl glutaryl-CoA-reductase); SPP1 (secretion phosphoprotein 1); SCN5A (the valtage-gated type V alpha subunit in sodium channel); GLA (galactosidase α); CHRNA4 (cholinergic recepter nicotine α 4); PITX2 (sample homeodomain 2 in pairs); DLG4 (the large homologue 4 of discs (fruit bat)); GNB3 (guanine-nucleotide-binding protein (G albumen) beta polypeptides 3); ADORA1 (adenosine A 1 receptor); MYH7 (the myocardium β of myoglobulin heavy chain 7); TXN (thioredoxin); CP (ceruloplasmin (Ferroxidase)); CSF3 (colony stimulating factor 3 (granulocyte)); SLC1A1 (member 1 of solute carrier family 1 (neuron/epithelium high-affinity glutamate transporter system XAG)); IAPP (IAPP); GUK1 (guanylate kinase-1); NPPA (natriuretic peptide precursor A); ADCYAP1 (adenylate cyclase activating polypeptide 1 (hypophysis)); XDH (xanthine dehydrogenase); SRD5A1 (steroids-5-5 alpha-reductases α polypeptide 1 (3-oxo-5 α-steroids δ 4-dehydrogenase α 1)); IDO1 (indoleamine 2 (3-dioxygenase 1); REN (feritin); CX3CL1 (chemotactic factor (CF) (C-X3-C motif) ligand 1); NEK3 (NIMA (forever from mitotic gene a) associated kinase 3); KIAA0101 (KIAA0101); ARTN (Artesunate); SLC17A6 (member 6 of solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter)); GPR172B (G albumen-coupled receptor 172B); BCL2 (B cell CLL/ lymthoma 2); CREBBP (CREB is in conjunction with albumen); NCAM1 (N-CAM 1); EPOR (EPO Receipter); ATP2A2 (ATP enzyme Ca++ transhipment cardiac muscle is spasm 2 slowly); HTR7 (7 (adenyl cyclase-couplings) of serotonin (thrombocytin) acceptor); MYH11 (myoglobulin heavy chain 11 smooth muscle); AGTR2 (angiotensin-ii receptor type 2); ENO2 (enolase 2 (γ neuron)); VIM (vimentin); MAP2K3 (mitogen activated protein kinase kinases 3); ADAM17 (ADAM metallopeptidase territory 17); IL6ST (interleukin-6 signal transduction (gp130 oncostatin M receptor)); PSMA2 (proteasome (the huge protein factor of the proteasome) α of subunit type 2); MAP2K6 (mitogen activated protein kinase kinases 6); S100A9 (S100 calbindin A9); S100A8 (S100 calbindin A8); CCL21 (chemotactic factor (CF) (C-C motif) part 21); EPHA4 (EPH acceptor A4); ADCYAP1R1 (adenylate cyclase activating polypeptide 1 (hypophysis) acceptor type I); CGB (HCG beta polypeptides); IBSP (integrin bound sialic acid protein); SORT1 (sorting protein 1); CNTF (CNTF); DAO (D-AAO); NRTN (neural order albumen); HCRT (low albumen (orexin) the neuropeptide precursor of secreting); MAP1B (microtubule-associated proteins 1B); ADAMTS13 (the ADAM metallopeptidase 13 with thrombospondin Class1 motif); ABP1 (amiloride Binding Protein 1 (amine oxidase (cupric))); SLC17A7 (member 7 of solute carrier family 17 (sodium-dependence inorganic phosphate cotransporter)); CADM1 (cell adhesion molecule 1); AIF1 (allograft inflammatory factor 1); ADCY10 (adenyl cyclase 10 (solvable)); TRIM26 (containing three symbasis orders 26); GGT2 (gamma glutamyltransferase 2); IL1A (interleukin 1 α); C1S (complement component 1s subgroup is divided); MPO (myeloperoxidase); NPPB (natriuretic peptide precursor B); F2RL1 (prothrombin (fibrin ferment) acceptor sample 1); TNNI3 (Troponin I type 3 (heart)); SELP (selecting plain P (membrane granulosa protein matter 140kDa antigens c D62)); TNFRSF11B (A member of the TNF receptor family 11b); FABP3 (fatty acid binding protein 3 muscle and heart (mammary gland-derivative GIF)); ADRA2A (adrenergic α-2A-acceptor); HTR1A (serotonin (thrombocytin) acceptor 1A); CASP3 (Caspase-3 Apoptosis be correlated with cysteine peptase); CPOX (auxiliary front protoporphyrinogen oxidase); SCN7A (the valtage-gated type VII α in sodium channel); PPARG (peroxisome proliferator-activated receptor γ); MYL3 (myosin light chain 3 alkali; The ventricle bone is slow); CRHR1 (corticotropin releasing hormone acceptor 1); ICAM1 (ICAM-1); MAPK10 (mitogen activated protein kinase 10); CAMK2A (calcium/calmodulin-dependent protein kinase ii-alpha); EDNRB (endothelin receptor type B); CSF2 (colony stimulating factor 2 (GM)); SCN4A (the valtage-gated type I V alpha subunit in sodium channel); EPRS (glutamy-prolyl-tRNA synzyme); HBB (hemoglobin β); IL5 (t cell growth factor (colony-stimulating factor eosinophil)); EDNRA (endothelin receptor type A); MEFV (Mediterranean fruit fly); PAPPA (PAPP matter A pappus element 1); PTGER4 (prostaglandin E receptor 4 (hypotype EP4)); PIK3C2A (phosphoinositide-3-kinases 2 α polypeptide); BGLAP (bone γ-carboxylic glutamic acid (gla) protein); POR (P450 (cytochromes) oxidoreducing enzyme); NOS3 (nitric oxide synthase 3 (endothelial cell)); PRKACA (protein kinase cAMP-dependence catalysis α); TP53 (oncoprotein matter p53); RPS6KB1 (ribosomal protein S6K 70kDa polypeptide 1); PRKAR1A (protein kinase cAMP-dependence regulation and control type I α (tissue-specific extinguisher 1)); IGF1 (type-1 insulin like growth factor (somatomedin C)); GRIA2 (glutamate receptor parent ionic AMPA2); GRIA1 (glutamate receptor ionic AMPA1); IL13 (interleukin-13); HSP90AA1 (heat shock protein 90kDa α (cytoplasm) class A member 1); PIK3CG (the kinase catalytic γ polypeptide of phosphoinositide-3-); IL12B (interleukin 12 B (natural kill cell stimulating factor 2 cytotoxic lymphocytic maturation factor 2p40)); CYP3A4 (Cytochrome P450 family 3 subfamily A polypeptide 4); PRKACB (protein kinase cAMP-dependence catalysis β); PRKAR2A (protein kinase cAMP-dependence regulation and control Type II α); GRM8 (glutamate receptor metabotropic 8); CAMK2D (calcium/calmodulin-dependent protein kinase ii δ); GRM7 (glutamate receptor metabotropic 7); GH1 (growth hormone 1); TNNT2 (TnT type 2 (heart)); MAOA (MAOA); CAMK2B (calcium/calmodulin-dependent protein kinase ii β); SERPINC1 (serpin peptide enzyme inhibition factor clade C (antithrombase) member 1); SLC12A2 (member 2 of solute carrier family 12 (sodium/potassium/chloride transport protein)); COL2A1 (collagen-type II α 1); PRKAR1B (protein kinase cAMP-dependence regulation and control type I β); CX3CR1 (chemotactic factor (CF) (C-X3-C motif) acceptor 1); PRKACG (protein kinase cAMP-dependence catalysis γ); SLC6A2 (member 2 of solute carrier family 6 (neurotransmitter transport protein norepinephrine)); MTOR (the mechanism target (serine/threonine kinase) of rapamycin); DLG2 (the large homologue 2 of discs (fruit bat)); MGLL (monoglyceride lipase); ATF3 (activating transcription factor 3); ALPP (alkaline phosphatase placenta (Regan isoenzymes)); COL9A2 (collagen-type IX α 2); HBG2 (hemoglobin γ G); MRGPRX1 (MAS be correlated with GPR member X1); FGFR1 (fibroblast growth factor acceptor 1); NFKB1 (B cell kappa light polypeptide gene enhancer nuclear factor 1); EIF4E (eukaryotic translation initiation factor 4E); PRKCA (protein kinase C α); EGFR (EGF-R ELISA (EBL virus (v-erb-b) oncogene homologue birds)); PIK3R1 (phosphoinositide-3-kinase regulatory subunit 1 (α)); PTPN6 (the non-acceptor type 6 of protein tyrosine phosphatase); PLCG2 (phospholipase C γ 2 (phosphatidylinositols-specificity)); PRKCQ (protein kinase C theta); PLG (plasminogen); GRIA3 (glutamate receptor iodine nutrition AMPA3); IL6R (interleukin-6 receptor); HIF1A (hypoxia-inducible factor-1 alpha subunit (alkaline helix-loop-helix transcription factor)); ALPL (alkaline phosphatase liver/bone/kidney); ADCY6 (adenyl cyclase 6); PRKCZ (protein kinase C ζ); GRM3 (glutamate receptor metabotropic 3); IL2RA (interleukin 2 receptor α); PIK3CD (the kinase catalytic δ polypeptide of phosphoinositide-3-); SNCA (synapse nucleoprotein α (non-A4 component amyloid precursor)); CYP1A1 (Cytochrome P450 family 1 subfamily A polypeptide 1); PLCG1 (phospholipase C γ 1); DBH (dopamine β-hydroxylase (dopamine β-monooxygenase)); GRIK1 (glutamate receptor ionic kainic acid 1); PRKCH (Protein kinase Cη); PRKCD (protein kinase C δ); CAT (catalase); ITPR1 (inositol 1 (4 (5-triphosphate receptor Class1); PLCB3 (phospholipase Cβ 3 (phosphatidylinositols-specificity)); PLCB2 (phospholipase Cβ 2); PIK3CB (the kinase catalytic beta polypeptides of phosphoinositide-3-); PLA2G2A (phospholipase A2 group IIA (blood platelet synovia)); PIK3CA (the kinase catalytic α polypeptide of phosphoinositide-3-); DRD3 (dopamine receptor D3); DMD (dystrophin); MAPK7 (mitogen activated protein kinase 7); PIK3C3 (phosphoinositide-3-kinases type 3); LPL (lipoprotein lipase); ADCY8 (adenyl cyclase 8 (brain)); HSPG2 (heparan sulfate proteoglycan 2); CCL5 (chemotactic factor (CF) (C-C motif) part 5); ALOX5 (arachidonic acid 5-LOX); PRKCI (protein kinase C ι); PRKAR2B (protein kinase cAMP-dependence regulation and control Type II β); GLRA1 (Gly receptor alpha 1); MMP12 (matrix metal peptase 12 (MMP12)); CHAT (cholinacetyltranslase); LRP5 (low density lipoprotein receptor associated protein white matter 5); TIMP1 (TIMP TIMP metallopeptidase inhibitor 1); PLCB1 (phospholipase Cβ 1 (phosphoinositide-specificity)); F2R (prothrombin (fibrin ferment) acceptor); EIF2S1 (the eukaryotic translation initiation factor 21 α 35kDa of subunit); SELL (selecting plain L); THBS2 (TSP-2); ADRA2C (adrenergic α-2C-acceptor); HTR2B (serotonin (thrombocytin) acceptor 2B); TF (transferrin); CST3 (cysteine proteinase inhibiting factor C); PIK3C2B (phosphoinositide-3-kinases 2 beta polypeptides); PLCD1 (phospholipase C δ 1); PLCB4 (phospholipase Cβ 4); NR1I2 (1 group of I member 2 of nuclear receptor subunit family); PIK3R2 (phosphoinositide-3-kinase regulatory subunit 2 (β)); PYGM (phosphorylase glycogen muscle); KCNQ3 (potassium voltage-gated channel KQT sample subfamily member 3); PECAM1 (blood platelet/endothelial cell adhesion molecule); CCL4 (chemotactic factor (CF) (C-C motif) part 4); TACR3 (tachykinin receptor 3); GRM4 (glutamate receptor metabotropic 4); 9-Sep (born of the same parents are split albumen 9); LBP (lipopolysaccharide binding protein); CAMK1 (calcium/calmodulin-deopendent protein kinase I); SCN1A (the valtage-gated type I alpha subunit in sodium channel); OSM (oncostatin M); SQSTM1 (sequestrum 1); AVP (arginine vasopressin); PRPH (peripheral protein); GLRA3 (Gly receptor alpha 3); PIK3R3 (phosphoinositide-3-kinase regulatory subunit 3 (γ)); PTGER3 (prostaglandin E receptor 3 (hypotype EP3)); SPTLC1 (serine palmitoyltransferase long-chain alkali subunit 1); PIK3C2G (phosphoinositide-3-kinases 2 γ polypeptide); PTH (parathormone); TJP1 (claudin-3 white matter 1 (zonuls occludens 1)); SCN2B (the valtage-gated Type II β in sodium channel); EIF2AK2 (eukaryotic translation initiation factor 2-alpha kinase 2); CACNA2D2 (calcium channel voltage-dependence α 2/ delta-subunit 2); ADCY5 (adenyl cyclase 5); PRKCB (protein kinase C β); TAT (TAT); CLDN5 (sealing element 5); HYAL1 (Hyaluronoglucosaminidase 1); PLCD3 (phospholipase C δ 3); PTGER1 (prostaglandin E receptor 1 (hypotype EP1) 42kDa); KRT7 (Keratin 7); PPIG (peptide acyl prolyl isomerase G (cyclophilin G)); OCLN (shading albumen); CACNA2D1 (calcium channel voltage-dependence α 2/ delta-subunit 1); CXCL1 (chemotactic factor (CF) (C-X-C motif) ligand 1 (melanoma growth-stimulating activity α)); SLC6A1 (member 1 of solute carrier family 6 (neurotransmitter transport protein GABA)); SERPINA6 (serpin peptide enzyme inhibition factor clade A (α-1 antiprotease antitrypsin) member 6); TRPV4 (transient receptor potential cationic channel protein subfamily V member 4); NNT (Nicotinamide Nucleotide Transhydrogenase); GRM6 (glutamate receptor metabotropic 6); DPP3 (two peptidyls-peptase 3); SLC18A3 (member 3 of solute carrier family 18 (vesicle acetylcholine)); GPT (glutamic-pyruvic transaminase (alanine aminotransferase)); TFIP11 (cluster protein interactive protein 11); KCNK2 (potassium channel subfamily K member 2); CYB5A (cytochrome b5 type A (microsome)); PLCZ1 (phospholipase C ζ 1); ANK3 (ankyrin 3 node of Ranviers (ankyrin G)); BLVRB (biliverdin reductase B (flavin reductase (NADPH))); FGF23 (fibroblast growth factor 23); CAMK1G (calcium/calmodulin-deopendent protein kinase IG); TRPV2 (transient receptor potential cationic channel protein subfamily V member 2); PIK3R5 (phosphoinositide-3-kinase regulatory subunit 5); GRINA (glutamate receptor ionic N-methyl D-Asp related protein 1 (glutamic acid combination)); PROK2 (front Dynamin-2); ENAM (enamel); NPBWR1 (Neuropeptide B/W acceptor 1); LXN (latex element); MRGPRX2 (MAS be correlated with GPR member X2); AMBN (ameloblast albumen (enamel stroma protein)); UCN2 (Urocortin 2); TUFT1 (becoming CLU 1); FAM134B (the 134 member B of sequence similarity family); TAC4 (tachykinin 4 (ferroheme kassinin kinin)); NPB (Neuropeptide B); PDGFRB (blood platelet-derived growth factor receptor beta polypeptides); ITGB2 (integrin β 2 (complement component 3 acceptors 3 and 4 subunits)); FGFR2 (fibroblast growth factor acceptor 2); TSC1 (tuberous sclerosis 1); RUNX1 (dwarf's associated transcription factor 1); PTPRC (protein tyrosine phosphatase acceptor type C); FYN (FYN oncogene related SR CFGRYES); APP (amyloid (A4) precursor protein); PGR (PgR); ERBB2 (v-erb-b2 EBL viral oncogene homologue 2 nerves/spongioblastoma derives oncogene homologue (birds)); ERBB3 (v-erb-b2 EBL viral oncogene homologue 3 (birds)); CSTB (cysteine proteinase inhibiting factor B (stefinB)); CASP8 (caspase 8 Apoptosis be correlated with cysteine peptase); ADA (adenosine deaminase); WT1 (embryonal adenomyosarcoma 1); CD44 (CD44 molecule (India's blood group)); NFKBIA (B cell kappa light polypeptide gene enhancer nuclear factor inhibiting factor α); RB1 (retinoblastoma 1); S100B (S100 calbindin B); MYL2 (myosin light chain 2 regulation and control hearts are slow); PSEN1 (presenilin 1); EGR1 (early growth replys 1); GJA1 (gap junction protein α 143kDa); SLC6A3 (member 3 of solute carrier family 6 (neurotransmitter transport protein dopamine)); JAK2 (Janus kinases 2); RYR1 (blue Buddhist nun's alkali acceptor 1 (bone)); CCKBR (CCK B acceptor); RELA (the too much syndrome virus oncogene of v-rel reticuloendothelial cell homologue A (birds)); RET (ret former-oncogene); ANXA2 (ANX2L4); CCR5 (chemotactic factor (CF) (C-C motif) acceptor 5); TGFBR1 (transforming growth factor β receptor 1); PARK2 (Parkinson's (autosomal recessive childhood) 2Parkin); ITGA6 (beta 2 integrin alpha 6); DPYD (dihydropyrimidine dehydrogenase); TH (tyrosine hydroxylase); GNAS (GNAS complex locus); TNFRSF1B (p75TNFR); COL1A1 (collagen-type I α 1); HMOX1 (Heme oxygenase (unlinking) 1); LDHA (lactate dehydrogenase A); MBP (MBP ELISA); SERPINA1 (serpin peptide enzyme inhibition factor clade A (α-1 antiprotease antitrypsin) member 1); SCNN1A (non-voltage-gated 1 α in sodium channel); ACTN2 (actinine α 2); ACHE (acetylcholinesterase (Yt blood group)); TTN (titin); CCNH (cyclin H); SLC1A2 (member 2 of solute carrier family 1 (neuroglia high-affinity glutamate transporter)); ESR2 (estrogen receptor 2 (ER β)); HTR4 (serotonin (thrombocytin) acceptor 4); KCNH2 (potassium voltage-gated channel subfamily H (eag is relevant) member 2); ADRBK1 (adrenergic β receptor kinases 1); IRS1 (substrate 1); C3 (complement component 3); LTA4H (leukotriene A 4 hydrolase); GSR (glutathione reductase); NF2 (neurofibromin 2 (merlin)); ATF2 (activating transcription factor 2); IGFBP3 (IBP3); BMP4 (skeletal form generation protein 4); CDK5 (cyclin-dependant kinase 5); CDC25C (CDC 25 homologue C (fission yeast)); CD36 (CD36 molecule (thrombospondin acceptor)); TPM1 (tropomyosin 1 (α)); CD40 (CD40 molecule TNF receptor superfamily member 5); CYP1A2 (Cytochrome P450 family 1 subfamily A polypeptide 2); FN1 (fibronectin 1); PKM2 (pyruvate kinase muscle); G6PD (glucose-6-phosphate dehydrogenase (G6PD)); CGA (glycoprotein hormones α polypeptide); HSF1 (Features of The Heat Shock Transcription Factor 1); CD3E (CD3e molecule ε (CD3-TCR complex)); CYP3A5 (Cytochrome P450 family 3 subfamily A polypeptide 5); CYP2C9 (Cytochrome P450 family 2 subfamily C polypeptide 9); ADRA1A (adrenergic α-1A-acceptor); CD14 (CD14 molecule); IL4R (interleukin-4 acceptor); ITPR3 (inositol 1 (4 (5-triphosphate receptor types 3); IL15 (interleukin 15); MECP2 (methyl CpG is in conjunction with albumen 2 (Rett syndrome)); ANXA1 (annexin A1); PRKAG1 (PKA MP-activates γ 1 on-catalytic subunit); DCN (decorin); MYB (v-myb medulloblastoma virus oncogene homologue (birds)); AVPR1A (arginine vasopressin acceptor 1A); HLA-DQB1 (major histocompatibility complex class IIDQ β 1); NEFL (neurofilament light chain polypeptide); SCNN1B (non-voltage-gated 1 β in sodium channel); CACNA1H (calcium channel voltage-dependent T type α 1H subunit); IFNAR1 (interferon (α β and Ω) acceptor 1); PDE4D (phosphodiesterase 4 DcAMP-specificity (phosphodiesterase E3 fool homologue fruit bat)); HDAC9 (histone deacetylase 9); ABCC 1 (ATP is in conjunction with box subfamily C (CFTR/MRP) member 1); PRDX5 (peroxidating reductase 5); EPHX2 (EH 2 cytoplasm); VCAM1 (Vcam1); PRKAG2 (PKA MP-activates γ 2 on-catalytic subunits); ADCY2 (adenyl cyclase 2 (brain)); HTR1B (serotonin (thrombocytin) acceptor 1B); ADCY9 (adenyl cyclase 9); HLA-A (major histocompatibility complex class IA); SLC1A3 (member 3 of solute carrier family 1 (neuroglia high-affinity glutamate transporter)); HLA-B (major histocompatibility complex type I B); ITGA2 (beta 2 integrin alpha 2 (CD49B α 2 VLA-2 of subunit acceptors)); GABRA2 (GABA (GABA) A receptor alpha 2); IL2RB (Interleukin-2 Receptor β); GLRB (Gly receptor β); SOCS3 (Suppressor of cytokine signaling-3); CSNK2B (casein kinase 2 beta polypeptides); KCNK3 (potassium channel subfamily K member 3); KCNQ2 (potassium voltage-gated channel KQT sample subfamily member 2); DPYSL2 (dihydropyrimidinase sample 2); CYP2J2 (Cytochrome P450 family 2 subfamily J polypeptide 2); DRD4 (dopamine receptor D4); PRKG1 (protein kinase cGMP-dependence type I); TNFSF11 (TNF (part) superfamily member 11); IFNAR2 (interferon (α β and Ω) acceptor 2); EIF4EBP1 (eukaryotic translation initiation factor 4E Binding Protein 1); EIF4G1 (eukaryotic translation initiation factor 4 γ 1); EIF4G3 (eukaryotic translation initiation factor 4 γ 3); SCNN1G (non-voltage-gated 1 γ in sodium channel); SERPING1 (serpin peptide enzyme inhibition factor clade G (C1 inhibitor) member 1); PABPN1 (poly-(A) is in conjunction with pyrenoids 1); CAST (calpastatin); CTSC (cathepsin C); CTGF (CTGF); CHRNB2 (cholinergic recepter nicotine β 2 (neuron)); ADCY3 (adenyl cyclase 3); ADCY7 (adenyl cyclase 7); ADRA1D (adrenergic α-1D-acceptor); CHRM2 (cholinergic recepter muscarine 2); DHFR (dihyrofolate reductase); MC2R (melanocyte cortex hormone of aadrenaline 2 acceptors (corticotropin)); THBD (thrombomodulin); IL7 (interleukin-17); IL18 (interleukin-18 (interferon-γ-inducible factor)); SIRT1 (deacetylase (reticent mating type Information Regulating 2 homologues) 1 (saccharomyces cerevisiae)); GRIA4 (glutamate receptor iodine nutrition AMPA4); CSNK1E (Casein kinase 1 ε); CPE (CPE); PRSS1 (protease serine 1 (trypsase 1)); GOT2 (glutamic-oxaloacetic transaminase 2 mitochondrias (aspartate transaminase 2)); GABRB1 (GABA (GABA) A receptor β 1); ALOX12 (arachidonic acid 12-LOX); CCL11 (chemotactic factor (CF) (C-C motif) ligand 1 1); HLA-DRB1 (major histocompatibility complex class IIDR β 1); RBL2 (retinoblastoma sample 2 (p130)); AGER (terminal glycosylation end product-specific receptor); LAMP1 (lysosome related membrane protein matter 1); MAPKAPK2 (mitogen activated protein kinase-activated protein kinase 2); LTA (lymphotoxin α (TNF superfamily member 1)); CYP4A11 (Cytochrome P450 family 4 subfamily A polypeptide 11); MAOB (MAO-B); TPH1 (TPH 1); SPARC (secretory protein rich acidic cysteine (osteonectin)); PIK3R4 (phosphoinositide-3-kinase regulatory subunit 4); CYP17A1 (Cytochrome P450 family 17 subfamily A polypeptide 1); CD63 (CD63 molecule); CLCN1 (chloride channel 1 skeletal muscle); NFE2L2 (nuclear factor (granulophilocyte-derivative 2) sample 2); TNFRSF11A (A member of the TNF receptor family 11a NFKB activity factor); CRHR2 (corticotropin releasing hormone acceptor 2); COPE (the capside protein matter complex ε of subunit); CYP4F2 (Cytochrome P450 family 4 subfamily F polypeptide 2); APOB (apolipoprotein B (comprising Ag (x) antigen)); GFRA1 (GDNF family receptors α 1); HMBS (methylol Choline synzyme); F5 (labile factor (labile factor proaccelerin instability factor)); TPO (thyroid peroxidase); AMPH (Amphiphilic proteins); PTGER2 (Prostaglin E Receptor 2 (hypotype EP2) 53kDa); PKLR (pyruvate kinase liver and RBC); SMPD1 (the sour lysosome of sphingomyelin phosphodiesterase 1); PLA2G4A (phospholipase A2 group IVA (cytoplasm calcium-dependence)); JUNB (junB proto-oncogene); GSN (gelsolin); PLCE1 (phospholipase C-epsilon 1); PSMB8 (proteasome (the huge protein factor of proteasome) subunit's beta type 8 (large multifunctional polypeptide enzyme 7)); CYCS (cytochrome c body cell); KCNK1 (potassium channel subfamily K member 1); PGF (placenta growth factor); IL10RA (Interleukin 10 receptor α); CHRM1 (cholinergic recepter muscarine 1); IL12RB1 (interleukin 12 receptor β 1); CHGA (Chromogranin A (parathyroid secretory protein 1)); GABRE (GABA (GABA) A acceptor ε); GJA4 (gap junction protein α 437kDa); ALAD (ammonia levulic acid δ-dehydratase); GLRA2 (Glycine Receptors α 2); ITPR2 (inositol 1 (4 (5-triphosphate receptor types 2); MPZ (myelin protein matter zero); AQP1 (aquaporin 1 (Colton blood group)); MYBPC3 (cardiac myosin binding protein-C heart); CPT2 (Carnitine palmitoyltransferase 2); STAR (the acute regulation protein of steroids); GLB1 (galactosidase β 1); SCN8A (the valtage-gated type VIII alpha subunit in sodium channel); LGALS1 (the agglutinin galactoside is in conjunction with solvable 1); PCSK1 (proteinogen invertase subtilopeptidase A/kexin Class1); IKBKAP (the inhibitor kinases complex of B cell κ light chain polypeptide gene promoter be correlated with protein); REST (the reticent transcription factor of RE1-); OXTR (ocytocin receptor); UGT2B7 (UDP glucuronyl transferase 2 family polypeptides B7); LTF (lactotransferrin); TYRP1 (tyrosinase-related protein matter 1); RBL1 (retinoblastoma sample 1 (p107)); TCAP (titin-CAP (albumen continuously)); KCNJ1 (potassium inward rectification passage subfamily J member 1); KCNN3 (in potassium/small-conductance calcium-activate channel subfamily N member 3); PSMC1 (proteasome (the huge protein factor of proteasome) 26S subunit A TP enzyme 1); RELN (reeling albumen); MYH14 (the non-muscle of myoglobulin heavy chain 14); ADCY4 (adenyl cyclase 4); MMP10 (matrix metal peptase 10 (molten stromatin 2)); FXN (Fu Shi incoordination albumen); ATF4 (activating transcription factor 4 (tax-replys enhancer element B67)); NOG (noggin); PPOX (front protoporphyrin oxidizing ferment); TNNC1 (TnC Class1 (slowly)); HRH2 (histamine receptor H2); PLA2G4C (phospholipase A2 group IVC (cytoplasm calcium-irrelevant)); NR3C2 (3 groups of C members 2 of nuclear receptor subunit family); AMPD1 (adenylic acid deaminase 1); FKBP4 (FKBPL 459kDa); MBD2 (methyl-CpG binding domain protein matter 2); NRG1 (neuregulin 1); MBL2 (mannose binding lectin (protein C) 2 solvable (opsonin shortage)); AGA (aspartoyl aminoglucose enzyme); SP1 (Sp1 transcription factor); SCN3A (the valtage-gated type-iii alpha subunit in sodium channel); FABP2 (fatty acid binding protein 2 intestines); PABPC1 (poly-(A) is in conjunction with albuminous cell matter 1); ACCN2 (amiloride-responsive cationic channel 2 neurons); ACTC1 (actin α cardiac muscle 1); ACP5 (acid phosphatase 5 tartaric acid resistances); EIF4B (eukaryotic translation initiation factor 4B); EIF4EBP2 (eukaryotic translation initiation factor 4E is in conjunction with albumen 2); EIF4A1 (eukaryotic translation initiation factor 4A1); CAMK4 (calcium/calmodulin-deopendent protein kinase IV); CACNB3 (calcium channel voltage-dependence β 3 subunits); CAV3 (caveolin 3); CA6 (carbonic anhydrase VI); ALOX12B (arachidonic acid 12-LOX 12R type); CCL17 (CCL17); CCL22 (chemotactic factor (CF) (C-C motif) part 22); MMP20 (matrix metal peptase 20); GAP43 (growth associated protein matter 43); ALOX5AP (arachidonic acid 5-LOX-activator protein matter); ANTXR2 (anthrax toxoreceptor 2); HGD (alcapton 1 (2-dioxygenase); SELE (selecting plain E); MYLK2 (MLCK 2); VEGFA (VEGF-A); PRX (table colloid albumen); IL10RB (Interleukin 10 receptor β); HAS1 (hyaluronic acid synthetase 1); GTF2IRD1 (containing GTF2I duplicate domain 1); IL16 (interleukins 16 (IL-16)); GRIP1 (glutamate receptor interaction protein 1); PHKA1 (phosphorylase kinase α 1 (muscle)); FOXP3 (jaw frame P3); SFTPC (surfactant PROTEIN C); PDIA3 (the A member of protein disulfide-isomerase family 3); SRM (spermidine synthase); MARCKS (rich myristoylation alanine protein kinase C substrate); RAPGEF3 (Rap guanine nucleotide exchange factor (GEF) 3); RAGE (nephroncus antigen); MRC1 (mannose receptor C Class1); SPINK1 (serine peptide enzyme inhibition factor Kazal Class1); CYP4F3 (Cytochrome P450 family 4 subfamily F polypeptide 3); LPIN1 (grease 1); TREX1 (three initial exonucleases 1 of repairing); CYSLTR2 (cysteinyl-leukotriene receptor 2); PTX3 (PTX3 is long); PTGES2 (Prostaglandin E Synthase 2); ASAH1 (ASAH1 (sour ceramidase) 1); H2AFZ (H2A histone family member Z); HFE (hemochromatosis disease); PYGB (phosphorylase glycogen; Brain); NR2F6 (2 groups of F members 6 of nuclear receptor subunit family); CYP3A7 (Cytochrome P450 family 3 subfamily A polypeptide 7); RAB6A (RAB6A member RAS Oncogene family); F2RL3 (prothrombin (fibrin ferment) acceptor sample 3); RGS4 (G protein signal transduction regulatory factor 4); SCNN1D (non-voltage-gated 1 δ in sodium channel); SCN1B (the valtage-gated type I β in sodium channel); SCN2A (the valtage-gated Type II alpha subunit in sodium channel); CALCRL (falling blood calcium protein receptor sample); CALB1 (calbindin 128kDa); CACNG2 (calcium channel voltage-dependence γ subunit 2); TACR2 (tachykinin receptor 2); GPC3 (glypican 3); GALNT3 (UDP-N-acetyl-α-D-galactosamine: polypeptide N-acetyl-galactosaminyl transferase 3 (GalNAc-T3)); CXCL10 (IP10); ANKH (carrying out property of anchylosis homologue (mouse)); PRKD1 (protein kinase D1); KCNN4 (in potassium/small-conductance calcium-activate channel subfamily N member 4); TGM1 (TGase 1 (K polypeptide epidermis type I protein-glutamine-gamma glutamyltransferase)); SLC26A2 (member 2 of solute carrier family 26 (sulfuric acid transport protein)); MTNR1A (melatonin receptors 1A); MIPEP (peptase in the middle of mitochondria); SI (Sucrase-isomaltase (alpha-glucosidase)); RHAG (Rh associated glycoprotein); SLC12A3 (member 3 of solute carrier family 12 (sodium/chloride transport protein)); RNASE1 (ribalgilase RNaseA family 1 (pancreas)); ELANE (expression of elastoser neutrophil leucocyte); GPC6 (glypican 6); ENPP2 (the outer pyrophosphatase/phosphodiesterase 2 of nucleotides); SCN3B (the valtage-gated type-iii β in sodium channel); CALB2 (calbindin 2); CTSA (cathepsin A); EIF2AK1 (eukaryotic translation initiation factor 2-alpha kinase 1); TMSB4X (extrasin beta 4 X-is chain); LPO (lactoperoxidase); NDN (necdin homologue (mouse)); PICK1 (combined with protein PRKCA1); PLCD4 (phospholipase C δ 4); CLDN3 (sealing element 3); HCN1 (hyperpolarization activates cyclic nucleotide-gate potassium channel 1); MATN3 (maternal albumen 3); COL9A3 (collagen-type IX α 3); BTG1 (B cell transposition gene 1 anti-hyperplasia); LCN1 (fat calcium albumen 1 (lachrymal gland prealbumin)); FDX1 (ferredoxin 1); UTRN (dystrophin); FMOD (fibromodulin); PDE4A (phosphodiesterase 4 AcAMP-specificity (phosphodiesterase E2 fool homologue fruit bat)); RRBP1 (ribophorin 1 homologue 180kDa (dog)); MLYCD (malonyl-coa decarboxylase); ANXA3 (annexin A 3); PRKD3 (protein kinase D3); GHRL (motilin/obestatin prepropeptide); GDF15 (growth and differentiation factor 15); BCL11A (B cell CLL/ lymthoma 11A (zinc finger protein matter)); CSRP3 (rich cysteine and Gly protein 3 (heart LIM protein)); CXCL2 (chemotactic factor (CF) (C-X-C motif) part 2); TOMM40 (mitochondrial outer membrane 40 homologues (yeast) translocase); KCNK6 (potassium channel subfamily K member 6); KCNN2 (in potassium/small-conductance calcium-activate channel subfamily N member 2); SLC6A12 (member 12 of solute carrier family 6 (neurotransmitter transport protein betaine/GABA)); ALOXE3 (arachidonic acid LOX 3); SOST (sclera solidifies); PRLHR (prolactin releasing hormone (PRH) acceptor); TIMM44 (mitochondrial inner membrane 44 homologues (yeast) translocase)); KCNN1 (in potassium/small-conductance calcium-activate channel subfamily N member 1); CHRNA9 (cholinergic recepter nicotine α 9); GPC5 (glypican 5); GPR37 (G albumen-coupled receptor 37 (endothelin receptor type B sample)); NKX2-1 (NK2 homology frame 1); HMMR (hyaluronic acid-mediation motility acceptor (RHAMM)); PKHD1 (polycystic kindey and hepatopathy 1 (autosomal recessive)); AOC2 (amine oxidase cupric 2 (retina-specificity)); KRT20 (Keratin 20); CORIN (corin serine peptase); AZU1 (blue pyridine 1); MAPK6 (mitogen activated protein kinase 6); PAEP (front pregnant albumen correlator Endometrium protein); CACNA2D4 (calcium channel voltage-dependence α 2/ delta-subunit 4); EIF3A (eukaryotic translation initiation factor 3 subunit A); BTG2 (BTG family member 2); P2RY14 (purinergic receptor P2YG-protein coupling 14); PDLIM7 (PDZ and LIM territory 7 (mystery type)); CACNA2D3 (calcium channel voltage-dependence α 2/ delta-subunit 3); LAMP3 (lysosome related membrane protein matter 3); PLCL2 (phospholipase C sample 2); NOSIP (nitric oxide synthase interaction protein); CRHBP (corticotropin releasing hormone is in conjunction with albumen); KLK5 (kallikrein be correlated with peptase 5); ADAM2 (ADAM metallopeptidase territory 2); SIRPA (signals-modulating protein alpha); PMPCB (peptase (mitochondria processing) β); GPC4 (glypican 4); MYH6 (the myocardium α of myoglobulin heavy chain 6); CXCL9 (CXCL9); KCNK5 (potassium channel subfamily K member 5); KCNK10 (potassium channel subfamily K member 10); NMU (neuromedin U); SCN4B (the valtage-gated type I V β in sodium channel); CAMK1D (calcium/calmodulin-deopendent protein kinase ID); COL8A2 (collagen-type VIII α 2); RAB11FIP1 (RAB11 family Binding Protein 1 (class I)); NDOR1 (NADPH dependence diflavin oxidoreducing enzyme 1); ZNF318 (zinc finger protein matter 318); P2RX2 (purinergic receptor P2X part-gated ion channel 2); UGT1A6 (UDP glucuronyl transferase 1 family polypeptides A6); LEMD3 (containing LEM territory 3); UGT1A1 (UDP glucuronyl transferase 1 family polypeptides A1); PDLIM3 (PDZ and LIM territory 3); KCTD12 (containing potassium channel four dimerization territories 12); KCNK9 (potassium channel subfamily K member 9); DSE (sulfuric acid cortin epimerase); DSPP (dentine saliva phosphoric acid albumen); KCNT2 (potassium channel subfamily T member 2); NMUR2 (neuromedin U acceptor 2); CHST6 (carbohydrate (N-acetyl-glucosamine 6-O) sulfotransferase 6); CCL28 (chemotactic factor (CF) (C-C motif) part 28); SLPI (secretion leucocyte peptide enzyme inhibition factor); CCL1 (chemotactic factor (CF) (C-C motif) ligand 1); KCNK15 (potassium channel subfamily K member 15); KCTD15 (containing potassium channel four dimerization territories 15); ANKRD1 (ankyrin duplicate domain 1 (cardiac muscle)); SIGMAR1 (σ non--opioid intracellular receptor 1); SLCO2A1 (solute carrier organic anion transport protein family member 2A1); MUC16 (MUC-1 6 cell surfaces are relevant); CNTNAP1 (contactin related protein 1); LGR6 (g protein coupled receptor 6 that contains leucine-rich repeat); ASPN (ASPN); PLCH2 (phospholipase C η 2); PLCL1 (phospholipase C sample 1); AGFG1 (ArfGAP companion FG repeats 1); HOXB8 (homology frame B8); KCNK12 (potassium channel subfamily K member 12); KCNK4 (potassium channel subfamily K member 4); KCNRG (potassium channel regulatory factor); KCTD13 (containing potassium channel four dimerization territories 13); KCNT1 (potassium channel subfamily T member 1); RNF19A (ring finger protein 19A); CIAPIN1 (cytokine induction apoptosis inhibiting factor 1); TNS3 (tensin 3); AMELX (ameloblastin X-is chain); CRBN (cerebellum); MLN (short stomach filamentous actin); CXCR1 (chemotactic factor (CF) (C-X-C motif) acceptor 1); NPBWR2 (Neuropeptide B/W acceptor 2); KCMF1 (potassium channel regulatory factor 1); KCNK7 (potassium channel subfamily K member 7); KCNV1 (potassium channel subfamily V member 1); KCTD5 (containing potassium channel four dimerization territories 5); KCNV2 (potassium channel subfamily V member 2); KCNK13 (potassium channel subfamily K member 13); ERAP2 (endoplasmic reticulum aminopeptidase 2); KCTD2 (containing potassium channel four dimerization territories 2); KCTD3 (containing potassium channel four dimerization territories 3); KCNK17 (potassium channel subfamily K member 17); KCTD10 (containing potassium channel four dimerization territories 10); KCTD7 (containing potassium channel four dimerization territories 7); SCT (secretin); NGDN (neuroguidin EIF4E is in conjunction with albumen); MLNR (short stomach filamentous actin acceptor); MPZL2 (myelin protein matter zero sample 2); PROL1 (rich proline lachrymal gland 1); KCNK16 (potassium channel subfamily K member 16); KCTD9 (containing potassium channel four dimerization territories 9); KCTD11 (containing potassium channel four dimerization territories 11); KCTD8 (containing potassium channel four dimerization territories 8); KCTD4 (containing potassium channel four dimerization territories 4); KCTD6 (containing potassium channel four dimerization territories 6); KCTD1 (containing potassium channel four dimerization territories 1); NPVF (neuropeptide VF precursor); MAGIX (MAGI family member X-is chain); MRGPRX4 (MAS be correlated with GPR member X4); MRGPRD (MAS be correlated with GPR member D); TET2 (tet Oncogene family member 2); KCTD14 (containing potassium channel four dimerization territories 14); GLYATL1 (Gly-N-acyltransferase sample 1); ZNF493 (zinc finger protein matter 493); ZNF429 (zinc finger protein matter 429); MRGPRE (MAS be correlated with GPR member E); SUN2 (containing Sad1 and UNC84 territory 2); AMTN (glaze maturation protein); MRGPRF (MAS be correlated with GPR member F); CDK20 (cyclin-dependant kinase 20); KCNU1 (potassium channel subfamily U member 1); GATS (GATS matrix antigen 3 opposite strand); GLRA4 (Gly receptor alpha 4); IGHE (the constant ε of heavy chain immunoglobulin); DRGX (Dorsal root nerve center homology frame); MRGPRG (MAS be correlated with GPR member G); LOC729977 (supposing LOC729977); MT-TK (mitochondria coding tRNA lysine); LOC400680 (the gene of being supported by the AK097381 hypothesis; BC040866); COP (clathrin-orderly protein); IGES (immunoglobulin E concentration serum); MGS (Mungen syndrome); TRNAS-AGA (transfer ribonucleic acid serine (anticodon AGA)); And LOC100132258 (being similar to secretion vector memebrane protein 2).

The unrestricted example of sense of taste related gene comprises TAS2R38 (member 38 for taste receptors, type 2); TAS1R1 (member 1 for taste receptors, Class1); TAS2R3 (member 3 for taste receptors, type 2); TAS2R5 (member 5 for taste receptors, type 2); TAS2R1 (member 1 for taste receptors, type 2); TAS2R16 (member 16 for taste receptors, type 2); TAS2R4 (member 4 for taste receptors, type 2); TAS2R14 (member 14 for taste receptors, type 2); TAS2R10 (member 10 for taste receptors, type 2); TAS2R7 (member 7 for taste receptors, type 2); TAS2R13 (member 13 for taste receptors, type 2); TAS2R9 (member 9 for taste receptors, type 2); TAS2R8 (member 8 for taste receptors, type 2); TAS1R3 (member 3 for taste receptors, Class1); TAS2R31 (member 31 for taste receptors, type 2); TAS1R2 (member 2 for taste receptors, Class1); TAS2R43 (member 43 for taste receptors, type 2); TAS2R50 (member 50 for taste receptors, type 2); TAS2R46 (member 46 for taste receptors, type 2); TAS2R30 (member 30 for taste receptors, type 2); TAS2R42 (member 42 for taste receptors, type 2); PLCB2 (phospholipase C, β 2); TAS2R20 (member 20 for taste receptors, type 2); TAS2R19 (member 19 for taste receptors, type 2); GNG13 ((guanine-nucleotide-binding protein (G albumen)), γ 13); TAS2R12 (taste receptors, type 2, member's 12 pseudogenes); GNAT1 (guanine-nucleotide-binding protein (G albumen), α transduction activity polypeptide 1); TAS2R41 (member 41 for taste receptors, type 2); TAS2R60 (member 60 for taste receptors, type 2); TAS2R40 (member 40 for taste receptors, type 2); TAS2R39 (member 39 for taste receptors, type 2); GCG (hyperglycemic factor); TAS2R18 (taste receptors, type 2, member's 18 pseudogenes); GRM4 (glutamate receptor, metabotropic 4); LCN1 (fat calcium albumen 1 (lachrymal gland prealbumin)); TRPV1 (member 1 for transient receptor potential cationic channel protein, subfamily V); ACCN1 (amiloride-responsive cationic channel 1, neuron); TAS2R45 (member 45 for taste receptors, type 2); TAS2R15 (taste receptors, type 2, member's 15 pseudogenes); FOS (mouse osteosarcoma virus oncogene homologue); SLC9A1 (solute carrier family 9 (sodium/hydrogen exchanger), the member 1); INS (insulin); ACCN5 (amiloride-responsive cationic channel 5, intestines); TAS2R2 (taste receptors, type 2, member's 2 pseudogenes); GRM7 (glutamate receptor, metabotropic 7); NPY (neuropeptide tyrosine); LEP (leptin); CASR (calcium-sensing receptor); GNAZ (guanine-nucleotide-binding protein (G albumen), α z polypeptide); CIB1 (calcium and integrin are in conjunction with 1 (calcium and integrin)); ADCY10 (adenyl cyclase 10 (solvable)); LEPR (leptin receptor); DRD1 (dopamine receptor D1); LGR6 (g protein coupled receptor 6 that contains leucine-rich repeat); GRM8 (glutamate receptor, metabotropic 8); GRM6 (glutamate receptor, metabotropic 6); GLP1R (glucogan-like peptide 1 receptor); AGER (terminal glycosylation end product-specific receptor); SLC2A2 (solute carrier family 2 (facilitation GLUT), the member 2); GIP (gastric inhibitory polypepitde); REN (rennin); PDYN (prodynorphin); RRBP1 (ribophorin 1 homologue 180kDa (dog)); SLC15A1 (solute carrier family 15 (peptide transporter), the member 1); OXT (oxytocins, prepropeptide); IL4I1 (interleukin-4 guiding 1); VN1R17P (plough nose 1 acceptor 17 pseudogenes); TAS2R62P (member 62, pseudogene for taste receptors, type 2); TAS2R64P (taste receptors, type 2, member's 64 pseudogenes); TAS2R63P (taste receptors, type 2, member's 63 pseudogenes); PS5 (bitterness receptors pseudogene PS5); PS3 (bitterness receptors PS3); PS7 (bitterness receptors Ps7 pseudogene); C6orf15 (chromosome 6 ORFs 15); TAS2R6 (member 6 for taste receptors, type 2); TAS2R22 (member 22 for taste receptors, type 2); TAS2R33 (member 33 for taste receptors, type 2); TAS2R37 (member 37 for taste receptors, type 2); TAS2R36 (member 36 for taste receptors, type 2); GNAT3 (guanine-nucleotide-binding protein, α transduction 3); TRPM5 (member 5 for transient receptor potential cationic channel protein, subfamily M); TRPM7 (member 7 for transient receptor potential cationic channel protein, subfamily M); GNB1 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 1); ITPR3 (inositol Isosorbide-5-Nitrae, 5-triphosphate receptor, type 3); ACE (tonin (peptidyl-dipeptidase A) 1); ENO2 (enolase 2 (γ, neuron)); CALCA (falling blood calcium albumen related polypeptide α); CCK (CCK); RTP3 (acceptor (chemical co-ordination) transport protein 3); PL-5283 (PL-5283 protein); PRKCG (protein kinase C, γ); KCNQ1 (member 1 for potassium voltage-gated channel, KQT-sample subfamily); BDNF (neurotrophic factor derived from brain); SCNN1A (sodium channel, non-voltage-gated 1 α); GNB3 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 3); SCNN1B (sodium channel, non-voltage-gated 1, β); SCNN1G (sodium channel, non-voltage-gated 1, γ); GNB4 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 4); PDE1A (phosphodiesterase 1A, calmodulin-dependence); DMBT1 (lacking in malignant brain tumor 1); PDE3B (phosphodiesterase 3B, cGMP-suppresses); PDE1C (phosphodiesterase 1C, calmodulin-dependence 70kDa); PRKCA (protein kinase C, α); NTRK3 (neurotrophy EGFR-TK, acceptor, type 3); NTRK2 (neurotrophy EGFR-TK, acceptor, type 2); PRKCQ (protein kinase C, θ); PRKACA (protein kinase, the cAMP-dependence, catalysis, α); CCKBR (CCK B acceptor); PRKCZ (protein kinase C, ζ); TH (tyrosine hydroxylase); NGFR (trk C (TNFR superfamily, the member 16)); DRD2 (dopamine receptor D2); NOS1 (nitric oxide synthase 1 (neuron)); PRKCE (protein kinase C, ε); PRKCH (protein kinase C, η); PRKCD (protein kinase C, δ); ABCB1 (member 1 for ATP-binding cassette, subfamily B (MDR/TAP)); MAPK1 (mitogen activated protein kinase 1); PLCB3 (phospholipase C, β 3 (phosphatidylinositols-specificity)); ADCY8 (adenyl cyclase 8 (brain)); ADRBK2 (adrenergic, β, receptor kinase 2); PRKACB (protein kinase, the cAMP-dependence, catalysis, β); PRKCI (protein kinase C, ι); CCKAR (cholecyctokinin a receptor); KCNK3 (member 3 for potassium channel, subfamily K); PLCB1 (phospholipase C, β 1 (phosphoinositide-specificity)); ADCY3 (adenyl cyclase 3); NTF3 (NT3); PLCB4 (phospholipase C, β 4); GNB5 (guanine-nucleotide-binding protein (G albumen), β 5); GNAL (guanine-nucleotide-binding protein (G albumen), α Activation Activity polypeptide, sense of smell type); GNB2 (guanine-nucleotide-binding protein (G albumen), beta polypeptides 2); KCNK1 (member 1 for potassium channel, subfamily K); HTR1A (serotonin (thrombocytin) acceptor 1A); CNGA3 (cyclic nucleotide gate passage α 3); PRKACG (protein kinase, the cAMP-dependence, catalysis, γ); PRKCB (protein kinase C, β); RBP4 (RBP ELISA 4, blood plasma); GRP (gastrin-release peptide); PDE3A (phosphodiesterase 3A, cGMP-suppresses); KRT14 (Keratin 14); SCNN1D (sodium channel, non-voltage-gated 1, δ); PRKD1 (protein kinase D1); PDE1B (phosphodiesterase 1B, calmodulin-dependence); PDE2A (phosphodiesterase 2A, cGMP-stimulates); PRKD3 (protein kinase D3); SST (amicine); KCNK6 (member 6 for potassium channel, subfamily K); KCNK2 (member 2 for potassium channel, subfamily K); NTF4 (NT4); GNG3 (guanine-nucleotide-binding protein (G albumen), γ 3); RNH1 (ribalgilase/angiogenic proteins inhibiting factor 1); KCNK5 (member 5 for potassium channel, subfamily K); KCNK10 (member 10 for potassium channel, subfamily K); P2RX2 (purinergic receptor P2X, part-gated ion channel, 2); KCTD12 (containing potassium channel four dimerization territories 12); KCNK9 (member 9 for potassium channel, subfamily K); KCNT2 (member 2 for potassium channel, subfamily T); KCNK15 (member 15 for potassium channel, subfamily K); KCTD15 (containing potassium channel four dimerization territories 15); KCNK12 (member 12 for potassium channel, subfamily K); KCNK4 (member 4 for potassium channel, subfamily K); KCNRG (potassium channel regulatory factor); KCTD13 (containing potassium channel four dimerization territories 13); KCNT1 (member 1 for potassium channel, subfamily T); KCMF1 (potassium channel regulatory factor 1); KCNK7 (member 7 for potassium channel, subfamily K); KCNV1 (member 1 for potassium channel, subfamily V); KCTD5 (containing potassium channel four dimerization territories 5); KCNV2 (member 2 for potassium channel, subfamily V); KCNK13 (member 13 for potassium channel, subfamily K); KCTD2 (containing potassium channel four dimerization territories 2); KCTD3 (containing potassium channel four dimerization territories 3); KCNK17 (member 17 for potassium channel, subfamily K); KCTD10 (containing potassium channel four dimerization territories 10); KCTD7 (containing potassium channel four dimerization territories 7); KCNK16 (member 16 for potassium channel, subfamily K); KCTD9 (containing potassium channel four dimerization territories 9); KCTD11 (containing potassium channel four dimerization territories 11); KCTD8 (containing potassium channel four dimerization territories 8); KCTD4 (containing potassium channel four dimerization territories 4); KCTD6 (containing potassium channel four dimerization territories 6); KCTD1 (containing potassium channel four dimerization territories 1); KCTD14 (containing potassium channel four dimerization territories 14); RTP4 (acceptor (chemical co-ordination) transport protein 4); KCNU1 (member 1 for potassium channel, subfamily U); LOC730036 (supposing LOC730036); RPS6KA3 (ribosomal protein S6K, 90kDa, polypeptide 3); MAPT (microtubule-related protein τ); CHEK2 (CHK2 test point homologue (fission yeast)); FYN (FYN oncogene related SR C, FGR, YES); APP (amyloid (A4) precursor protein); PTEN (phosphatase and tensin homologue); SOD1 (superoxide dismutase 1, solvable); CSTB (cysteine proteinase inhibiting factor B (stefin B)); SHH (Sonic hedgehog homologue (fruit bat)); AKR1B1 (aldehyde-one reductase family 1, member B1 (aldose reductase)); COMT (catechol O-methyltransferase); S100B (S100 calbindin B); PTK2B (PTK2B protein tyrosine kinase 2 β); PLCG2 (phospholipase C, γ 2 (phosphatidylinositols-specificity)); PSEN1 (presenilin 1); SLC6A3 (solute carrier family 6 (neurotransmitter transport protein, dopamine), the member 3); PAX6 (frame 6 in pairs); MMP1 (matrix metal peptase 1 (interstitial collagenase)); CACNA1A (calcium channel, voltage-dependence, P/Q type, α 1A subunit); CASP9 (Guang winter enzyme 9, Apoptosis-relevant cysteine peptase); PRKAR1A (protein kinase, cAMP-dependence, regulation and control, type I, α (tissue-specific extinguisher 1)); MMP3 (matrix metal peptase 3 (molten stromatin 1, front gelatinase)); ADCY6 (adenyl cyclase 6); CASP3 (Guang winter enzyme 3, Apoptosis-relevant cysteine peptase); GNAS (GNAS complex locus); MMP9 (matrix metal peptase 9 (gelatinase B, 92kDa gelatinase, 92kDa type I V clostridiopetidase A)); NOTCH2 (Notch homologue 2 (fruit bat)); CREB 1 (cAMP reacted constituent Binding Protein 1); SNCA (synapse nucleoprotein, α (non-A4 component amyloid precursor)); OPRM1 (Opioid Receptors, μ 1); CALM1 (calmodulin 1 (phosphorylase kinase, δ)); PLCG1 (phospholipase C, γ 1); BRCA1 (mammary cancer 1 is early sent out); APOE (apo E); DBH (dopamine β-hydroxylase (dopamine β-monooxygenase)); PTGS2 (prostaglandin-endoperoxide synzyme 2 (prostaglandin G/H sythase and epoxidase)); ADRBK1 (adrenergic, β, receptor kinase 1); ITGB4 (integrin, β 4); NLGN3 (the neural albumen 3 that connects); CD36 (CD36 molecule (thrombospondin acceptor)); EEF2 (eukaryotic translation elongation factor 2); OPRD1 (Opioid Receptors, δ 1); HSPG2 (heparan sulfate proteoglycan 2); GAD1 (glutamate decarboxylase 1 (brain, 67kDa)); ANXA1 (annexin A1); PRKAR2A (protein kinase, the cAMP-dependence, regulation and control, Type II, α); HHEX (the homology frame is expressed in hematopoiesis); GRM1 (glutamate receptor, metabotropic 1); NPR1 (natriuratic peptide receptor A/ guanylate cyclase A (atrial natriuretic), peptide acceptor A); SYP (synaptobrevin); CALM3 (calmodulin 3 (phosphorylase kinase, δ)); PRKAR2B (protein kinase, the cAMP-dependence, regulation and control, Type II, β); ADCY2 (adenyl cyclase 2 (brain)); SLC1A3 (solute carrier family 1 (neuroglia high-affinity glutamate transporter), the member 3); GABBR1 (GABA (GABA) B acceptor, 1); PTPRS (protein tyrosine phosphatase, acceptor type, S); KNG1 (Prokineticin 1); DDC (DOP Adecarboxylase (aromatic l-amino acid decarboxylase)); GNAQ (guanine-nucleotide-binding protein (G albumen), q polypeptide); E2F4 (E2F transcription factor 4, p107/p130-combination); DRD4 (dopamine receptor D4); MAOA (MAOA); CALM2 (calmodulin 2 (phosphorylase kinase, δ)); CHRNB2 (cholinergic recepter, nicotine, β 2 (neuron)); GRK5 (G albumen-coupled receptor kinase 5); PRLR (lactogen acceptor); ID2 (suppressing DNA in conjunction with 2, dominant negative helix-loop-helix protein matter); TPH1 (TPH 1); PLCD1 (phospholipase C, δ 1); GNA11 (guanine-nucleotide-binding protein (G albumen), α 11 (Gq class)); GNA12 (guanine-nucleotide-binding protein (G albumen) α 12); CRH (corticotropin releasing hormone); GNRH1 (gonadotropic hormone-releasing hormone 1 (leuteinization-releasing hormone)); S100A8 (S100 calbindin A8); CYCS (cytochrome c, body cell); KCNB1 (member 1 for potassium voltage-gated channel, the Shab-subfamily of being correlated with); DST (dystonia albumen); ADCY1 (adenyl cyclase 1 (brain)); CHGA (Chromogranin A (parathyroid secretory protein 1)); HTR3A (serotonin (thrombocytin) acceptor 3A); GAL (galanin prepropeptide); TACR3 (tachykinin receptor 3); ALDH7A1 (aldehyde dehydrogenase 7 families, member A1); PRKAR1B (protein kinase, the cAMP-dependence, regulation and control, type I, β); AQP5 (aquaporin 5); AQP2 (aquaporin 2 (collecting pipe)); AQP1 (aquaporin 1 (Colton blood group)); GLI3 (GLI family zinc refers to 3); POU2F1 (POU class 2 homology frames 1); OTX2 (just little tooth homology frame 2); TTR (thyroxine transport protein); CACNA1B (calcium channel, voltage-dependence, N type, α 1B subunit); IKBKAP (inhibitor of B cell κ light chain polypeptide gene promoter, kinases complex-related protein); RHO (rhodopsin); UGT2B7 (UDP glucuronyl transferase 2 families, polypeptide B7); LCT (lactase); TCOF1 (Treacher Collins-Franceschetti syndrome 1); KCNJ1 (member 1 for potassium inward rectification passage, subfamily J); VIP (vasoactive intestinal peptide); AQP3 (aquaporin 3 (Gill blood group)); TAC1 (tachykinin, precursor 1); ADCY4 (adenyl cyclase 4); HP (haptoglobin); ALDH4A1 (aldehyde dehydrogenase 4 families, member A1); GDI1 (GDP dissociate inhibiting factor 1); SOX2 (SRY (sex-determining region Y)-frame 2); NOG (noggin); FST (folliculus stabilize proteins); NDST1 (N-deacetylase/N-sulfotransferase (heparan glucose amido) 1); ABLIM1 (actin is in conjunction with LIM protein 1); NOS2 (nitric oxide synthase 2 can be induced); EIF2B1 (eukaryotic translation initiation factor 2B, 1 α, the 26kDa of subunit); CA6 (carbonic anhydrase VI); DKK1 (dickkopf homologue 1 (Africa xenopus)); SIX3 (SIX homology frame 3); SIX1 (SIX homology frame 1); HTT (Huntington protein); AGRP (agouti related protein homologue (mouse)); NCAM2 (N-CAM 2); BBS4 (Bardet-Biedl syndrome 4); GNA15 (guanine-nucleotide-binding protein (G albumen), α 15 (Gq class)); GNA13 (guanine-nucleotide-binding protein (G albumen), α 13); ASCL1 (without bristle scale and shell complex homologue 1 (fruit bat)); MGLL (monoglyceride lipase); PLCD3 (phospholipase C, δ 3); CEBPB (CCAAT/ enhancer binding protein (C/EBP), β); BBS1 (Bardet-Biedl syndrome 1); HES1 (crinosity and enhancer, rupture 1, (fruit bat)); GNG2 (guanine-nucleotide-binding protein (G albumen), γ 2); TPH2 (TPH 2); P2RX3 (purinergic receptor P2X, part-gated ion channel, 3); AQP7 (aquaporin 7); CNGB1 (cyclic nucleotide gate passage β 1); GABRR1 (GABA (GABA) acceptor, rho1); GBX2 (primitive gut forms brain homology frame 2); SLC6A1 (solute carrier family 6 (neurotransmitter transport protein, GABA), the member 1); PEBP1 (phosphotidylethanolabinding binding protein 1); KRT13 (Keratin 13); NAV2 (the neuron guiding factor 2); BBS2 (Bardet-Biedl syndrome 2); PLCD4 (phospholipase C, δ 4); CLDN8 (sealing element 8); CLDN7 (sealing element 7); CISH (containing the protein that cell factor can be induced SH2); GNGT2 (guanine-nucleotide-binding protein (G albumen), γ transduction activity polypeptide 2); GNG4 (guanine-nucleotide-binding protein (G albumen), γ 4); GNA14 (guanine-nucleotide-binding protein (G albumen), α 14); UCN (Urocortin); PDE4A (phosphodiesterase 4 A, cAMP-specificity (phosphodiesterase E2 fool homologue, fruit bat)); MKKS (McKusick-Kaufman syndrome); GAST (gastrin); PRKX (protein kinase, X-is chain); CHRD (tendon albumen); PRSS2 (protease, serine, 2 (trypsase 2)); KRT20 (Keratin 20); CLDN6 (sealing element 6); CLCN4 (chloride channel 4); DLX5 (tip is homology frame 5 still less); TRPA1 (member 1 for transient receptor potential cationic channel protein, subfamily A); TRPM8 (member 8 for transient receptor potential cationic channel protein, subfamily M); PLCZ1 (phospholipase C, ζ 1); SLC5A2 (solute carrier family 5 (sodium/glucose cotransporter), the member 2); GDF11 (growth and differentiation factor 11); BLVRB (biliverdin reductase B (flavin reductase (NADPH))); SCN7A (sodium channel, valtage-gated, type VII, α); PANX1 (pannexin 1); IFI35 (interferon-induced protein 35); NRAP (nebulin-relevant anchorin); HES5 (crinosity and enhancer, 5 (fruit bats) of rupturing); GSC (goosecoid homology frame); REEP1 (acceptor auxiliary protein 1); CCL28 (chemotactic factor (CF) (C-C motif) part 28); GJB4 (gap junction protein, β 4,30.3kDa); B3GNT2 (UDP-GlcNAc: β Gal β-1,3-N-acetylglucosaminyl transferase 2); CNGA2 (cyclic nucleotide gate passage α 2); ZNF423 (zinc finger protein matter 423); HESX1 (HESX homology frame 1); CNGA4 (cyclic nucleotide gate passage α 4); GPR158 (G albumen-coupled receptor 158); MAGEL2 (MAGE-sample 2); UBR3 (ubiquitin protein matter ligase E3 component n-identifies albumen 3 (supposition)); NPTXR (neuron PTX-3 acceptor); SLC24A6 (solute carrier family 24 (sodium/potassium/calcium exchanger), the member 6); GPRC6A (G albumen-coupled receptor, the C of family organize 6, member A); SLC24A3 (solute carrier family 24 (sodium/potassium/calcium exchanger), the member 3); BEST2 (spot wither albumen 2); OR8D2 (olfactory receptor, family 8, subfamily D, the member 2); OR5P2 (olfactory receptor, family 5, subfamily P, the member 2); FOXG1 (jaw frame G1); OR8B8 (olfactory receptor, family 8, subfamily B, the member 8); OR8D1 (olfactory receptor, family 8, subfamily D, the member 1); OR10A5 (olfactory receptor, family 10, subfamily A, the member 5); OMP (sense of smell labelled protein); (transcription factor AP-1-2 ε (activates enhancer binding protein 2, ε) to TFAP2E; OR5P3 (olfactory receptor, family 5, subfamily P, the member 3); OR10A4 (olfactory receptor, family 10, subfamily A, the member 4); DMRTA1 (the DMRT sample A1 of family); TMEM147 (transmembrane protein 147); OR8A1 (olfactory receptor, family 8, subfamily A, the member 1); EBF2 (early stage B cell factor 2); PKD1L3 (POLYCYSTIC KIDNEY DISEASE 1-sample 3); GPR179 (G albumen-coupled receptor 179); RTP1 (acceptor (chemical co-ordination) transport protein 1); KLHL35 (kelch-sample 35 (fruit bat)); RGS21 (G protein signal transduction regulatory factor 21); RTP2 (acceptor (chemical co-ordination) transport protein 2); ACSM4 (acyl group-coacetylase synzyme medium chain family member 4); GUCY2E (guanylate cyclase 2E); CYP2G1P (Cytochrome P450, family 2, subfamily G, polypeptide 1 pseudogene); OR7E35P (olfactory receptor, family 7, subfamily E, member's 35 pseudogenes); And NUDT16P1 (nudix (the chain part X-shape of nucleoside diphosphate motif 16, pseudogene 1).

Exemplary sensation-relevant chromosome sequence comprises TRPM7 (member 7 for transient receptor potential cationic channel protein, subfamily M); TRPM5 (member 5 for transient receptor potential cationic channel protein, subfamily M); TRPC5 (transient receptor potential cationic channel protein subfamily C member 5); TRPC6 (transient receptor potential cationic channel protein subfamily C member 6); TRPC1 (transient receptor potential cationic channel protein subfamily C member 1); CNR1 (hemp component receptor 1 (brain)); CNR2 (hemp component receptor 2 (scavenger cell)); ADRBK1 (adrenergic β receptor kinases 1); TRPA1 (transient receptor potential cationic channel protein subfamily A member 1); POMC (proopiomelanocortin); CALCA (blood calcium albumen-related polypeptide α falls in CGRP); Corticotropin releasing factor (CRF) (CRH, corticotropin releasing factor (CRF)); PKA such as PRKACA (protein kinase cAMP-dependency catalysis α), PRKACB (protein kinase cAMP-dependency catalysis β), PRKAR1A (protein kinase cAMP-dependency regulation and control type I α (tissue-specific extinguisher 1)), and PRKAR2A (protein kinase cAMP-dependency regulation and control Type II α); ERAL1 (Era G-protein-sample 1 (intestinal bacteria)); NR2B (GRIN2B, glutamate receptor ionic N-methyl D-Asp 2B); LGALS1 (the lectin galactoside-in conjunction with solvable 1); TRPV1 (transient receptor potential cationic channel protein subfamily V member 1); SCN9A (the valtage-gated type I X alpha subunit in sodium channel); OPRD1 (Opioid Receptors δ 1); OPRK1 (Opioid Receptors κ 1); And OPRM1 (Opioid Receptors μ 1).

In certain embodiments, the animal that method of the present invention produces can be used for the impact of research sudden change for animal and sensation illness.

Another aspect of the present disclosure comprises the method for the indication of the sensation illness of assessing animal model, and wherein animal model comprises genetically modified animal, its comprise at least one coding sensation related protein through editor's chromosome sequence.This method comprises that the selected parameter will obtained from animal model and the selected parameter obtained from the wild-type animal compare.The unrestricted example of selected parameter for assessment of at least one indication of sensation illness comprises: a) spontaneous behavior; B) performance in the behavior test; C) physically different; D) tissue or cellular abnormality; E) biochemical function; F) molecular structure; And combination.

Can comprise any or multiple in the nociception illness relevant with said gene and sense of taste illness by the sensation illness of described method assessment.The unrestricted example of nociception illness comprises allodynia; Neurodynia; HSAN-1, as Denny-Brown neuropathy, ulcer damage property neuropathy, thevenard syndrome, family's trophoneurosis, mal perforant du pied, familial syringomyelia and peroneal muscular atrophy type 2B syndrome; HSAN-2, as congenital sensory neuropathy or Morvan disease; HSAN-3, as familial vegetative dystonie (FD) or Riley-Day syndrome; HSAN-4, as congenital insensitive with anhidrosis (CIPA) to pain; And HSAN-5, as congenital insensitive with local anhidrosis to pain.The unrestricted example of sense of taste illness comprises parageusia, hypogeusia and ageustia.

The indication of sensation illness can spontaneous appearance in animal model, or can facilitate by being exposed to exogenous material, described exogenous material includes but not limited to nociception stimulation, taste stimulation, protein that sensation is relevant, feels relevant agonist and feel relevant antagonist.

the C.ABC translocator

Abc transport albumen is the larger and important family at the ubiquitous protein called membrane transporters of animal kingdom.These transmembrane proteins are by ATP hydrolysis and provide power with this energy to other various functions, described function comprises crosses in cell and extracellular film the molecule displacement, and this carries out under finite concentration gradient having often.(about comment, referring to Higgins, C.F., ABC transporters:from microorganisms to man, Annu.Rev.Cell Biol.8 67-113 (1992); And M.Dean, Human ABC Transporter Superfamily, Bethesda (MD): National Center for Biotechnology Information (US); On November 18th, 2002, is it found in following network address www.ncbi.nlm.nih.gov/bookshelf/br.fcgi? book=mono_001).

In one embodiment, method of the present invention can be used for producing animal or the cell that wherein at least one chromosome sequence relevant to abc transport albumen is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

The abc transport protein staining body sequence abc transport albumen of may encoding may be maybe abc transport albumen control sequence.Abc transport protein sequence for example, empirical correlation based on abc transport protein sequence and Animal diseases or symptom, especially Mammals (people) disease or symptom is usually selected.For example, with respect to the colony that there is no disease or symptom, in the colony of suffering from abc transport protein related diseases or symptom, the expression of the abc transport albumen in particular organization can raise or reduce.The difference of protein level can be assessed by proteomics as known in the art or genome analysis technology.

The unrestricted example of human ABC transfer protein gene comprises: ABCA1 (ABC1), ABCA2 (ABC2), ABCA3 (ABC3), ABCC, ABCA4 (ABCR), ABCA5, ABCA6, ABCA7, ABCA8, ABCA9, ABCA10, ABCA12, ABCA13, ABCB1 (PGY1, MDR), ABCB2 (TAP1), ABCB3 (TAP2), ABCB4 (PGY3), ABCB5, ABCB6 (MTABC), ABCB7 (ABC7), ABCB8 (MABC1), ABCB9, ABCB10 (MTABC2), ABCB11 (SPGP), ABCC1 (MRP1), ABCC2 (MRP2), ABCC3 (MRP3), ABCC4 (MRP4), ABCC5 (MRP5), ABCC6 (MRP6), CFTR (ABCC7), ABCC8 (SUR), ABCC9 (SUR2), ABCC10 (MRP7), ABCC11 (ABCC12), ABCD1 (ALD), ABCD2 (ALDL1, ALDR), ABCD3 (PXMP1, PMP70), ABCD4 (PMP69, P70R), ABCE1 (OABP, RNS4I), ABCF1 (ABC50), ABCF2 (ABCF3), ABCG1 (ABC8, White), ABCG2 (ABCP, MXR, BCRP), ABCG4 (White2), ABCG5 (White3) and ABCG8.

The unrestricted example of mouse ABC transporter gene comprises Abca1, Abca2, Abca3, Abca4, Abca5, Abca6, Abca7, Abca8a, Abca8b, Abca9, Abca12, Abca13, Abcb1a, Abcb1b, Abcb2 (Tap1), Abcb3 (Tap2), Abcb4, Abcb5, Abcb6, Abcb7, Abcb8, Abcb9, Abcb10, Abcb11, Abcc1, Abcc2, Abcc3, Abcc4, Abcc5, Abcc6, Abcc7 (Cftr), Abcc8, Abcc9, Abcc10, Abcc11, Abcd1, Abcd2, Abcd3, Abcd4, Abce1, Abcf1, Abcf2, Abcf3, Abcg1, Abcg2, Abcg3, Abcg4, Abcg5 and Abcg8.

The drosophila gene group comprises 56 ABC transporter gene, wherein has a Mammals subfamily that represents that each is known at least.The unrestricted example of fruit bat ABC transporter gene comprises: G3156 (AAF45509, AE003417); CG2759 (w; AAF45826; AE003425); CG1703 (AAF48069; AE003486); CG1824 (AAF48177; AE003489); CG9281 (AAF48493; AE003500); CG8473 (AAF48511; AE003500); CG12703 (AE003513; AE003513); CG1819 (AAF50847; AE003569); CG1718 (AAF50837; AE003568); CG1801 (AAF50836; AE003568); CG1494AAF50838; AE003568); CG3164 (AAF51548; AE003590); CG4822 (AAF51551; AE003590); CG17646 (AAF51341; AE003585); CG9892 (AAF51223; AE003582); CG9664 (AAF51131; AE003580); CG9663 (AAF51130; AE00358); CG3327 (AAF51122; AE003580); CG2969 (Atet; AAF51027; AE003576); CG11147 (AAF52284; AE003611); CG7806 (AAF52639; AE003620); CG7627 (AAF52648; AE003620); CG5853 (AAF52835; AE003626); CG5772 (Sur; AAF52866; AE003627); CG6214 (AAF53223; AE003637); CG7491 (AAF53328; AE003641); CG17338 (AAF53736; AE003661); CG10441 (AAF53737; AE003661); CG9270 (AAF53950; AE003668); CG8799 (AAF58947; AE003833); CG3879 (Mdr49AAF58437; AE003820); CG8523 (Mdr50; AAF58271; AE003815); CG8908 (AAF57490; AE003792); CG10505 (AAF46706; AE003453); CG 17632 (bw; AAF47020; AE003461); CG7955 (AAF47526; AE003472); CG10226 (AAF50670; AE003563); Mdr65 (AAF50669; AE003563); CG5651 (AAF50342; AE003553); CG7346 (AAF50035; AE003544); CCG4314 (st; AAF49455; AE003527); CG5944 (AAF49305; AE003522); CG6052 (AAF49312; AE003523); CG9330 (AAF49142; AE003516); CG14709 (AAF54656; AE003692); CG4225 (AAF55241; AE003710); CG4562 (AAF55707; AE003728); CG4794 (AAF55726; AE003728); CG5789 (AAF56312; AE003748); CG18633 (AAF56360; AE003749); CG11069 (AAF56361; AE003749); CG6162 (AAF56584; AE003756); CG9990 (AAF56807; AE003766); CG11898 (AAF56870; AE003768); CG11897 (AAF56869; AE003768); And CG2316 (AAF59367; AE003844).

Exemplary abc transport albumen comprises MDR1, BCRP (ABCG2), MRP1 (ABCC2) and MRP2 (ABCC2), and its mouse homologue Mdr1a (Abcb1a), Mdr1b (Abcb1b), BCRP (ABCG2), MRP1 (ABCC1), MRP2 (ABCC2) and its any combination.Although should be appreciated that unnamed gene used herein relates to the genome of people and mouse, but be included in the close homologue of fixed any these genes in other animal, described other animal comprises invertebrates, as Caenorhabditis elegans (C.elegans) and drosophila melanogaster (D.melanogaster), and Mammals, include but not limited to rat, hamster, cat and dog.Can determine close homologue by sequential analysis, evolutionary analysis, functional analysis or its any combination.

In certain embodiments, the animal that method of the present invention produces can be used for the impact of research sudden change for animal and abc transport albumen.

v. humanized model

The animal produced by method of the present invention also may be used as humanized model.As described in detail above, humanized model is expressed people's nucleotide sequence in inhuman animal.In one embodiment, can be through humanization at research application or model described in part II (a).In another embodiment, described livestock animals or companion animals can be through humanizations hereinafter.

(b) domestic animal application

In one embodiment, method of the present invention can be used for producing the livestock animals with the one or more chromosomal editors that produce one or more ideal characters." livestock animals " used herein refers to the animal that can hatch to make a profit.The unrestricted example of livestock animals is listed in this section, and is described in detail as follows.

The unrestricted example of the ideal character of livestock animals comprises specific hair color or quality, disease resistance, raising reproductivity, increases meat production, increases the muscle fat ratio, increases breast production, reduces fecal pollution etc.In another embodiment, method of the present invention can be used for being created in the livestock animals that has the karyomit(e) editor in the gene of listing in table D.

In addition, in exemplary embodiment, livestock animals may be sheep, horse, ox or pig animal, and details see below.

i. the application of sheep

In one embodiment, method of the present invention can be used for producing sheep or the sheep cell that wherein has at least a chromosome sequence to be edited.The unrestricted example of sheep chromosome sequence to be edited may comprise the structure of those codings and hair color, decorative pattern, wool fiber and the sequence of disease-resistant relevant protein.For example, the unrestricted example of the protein relevant to hair color, decorative pattern and/or wool fiber structure comprises MSH receptor protein, Agouti albumen, tyrosinase-related protein and Keratin sulfate associated protein.The unrestricted example that is applicable to hair color albumen comprises tyrosine oxidase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signal transducer (ASIP) and melanocyte avidin (MLPH).The other oroteins that those skilled in the art's understanding is relevant to the structure of hair color, coat pattern and wool fiber exists, but not yet determines the locus of these other oroteins of coding.The unrestricted example that participates in the sequence of disease resistance comprises PRPN, and it is relevant to Transmissible spongiform encephalopathy (TSE).

In one embodiment, method of the present invention can be used for producing the sheep of genetic modification, wherein comprises at least one editor's chromosome sequence, and it shows the needed phenotype of people.For example, the inactivation of the chromosome sequence of coding Agouti may produce the sheep with striped color.In other embodiments, the sheep animal that comprises at least one editor's chromosome sequence can be as the genetic model of research hair color, coat pattern and/or hair growth.In addition, comprise at least one sheep animal of upsetting chromosome sequence and can be used as disease model for studying disease or the symptom that affects people or other animal.The unrestricted example that is applicable to disease or symptom comprises albinism, hair follicle disease and alopecia.In addition, the lysate of disclosed sheep cell and described cell can be used for similar research purpose.

ii. the application of horse

In one embodiment, method of the present invention can be used for producing horse or the horse cell that wherein at least one chromosome sequence has been edited.The unrestricted example of the chromosome sequence of horse to be edited comprises the sequence of those coding hair color, decorative pattern and disease resistances.

The unrestricted example of the suitable coat color gene of coding hair color and decorative pattern protein comprises extension (black/red factor), Agouti, MC1R, grey colour correction (Gray Modifier), the dilution of champagne wine and women-sensual pursuits (Champagne Dilution), Tobiano, silver color dilution (Silver Dilution), MATP (cream-colored dilution (Cream Dilution)), pearl dilution (Pearl Dilution) and Sabino1.Those skilled in the art understand other gene may be relevant to hair color and coat pattern with protein, but not yet determine locus.

In another embodiment, method of the present invention can be used for producing the horse of genetic modification, its comprise the coding HERDA through editor chromosome sequence, wherein chromosome sequence through inactivation so that do not produce some allelotrope of HERDA albumen.In addition, there is the horse of genetic modification of the inactivation HERDA variant of chromosome sequence described herein, may manifest that HERDA occurs and HERDA propagates carrier's minimizing.In unrestriced embodiment, the Marko of genetic modification can comprise the chromosome sequence through editor of coding HERDA.In another unrestriced embodiment, the genetic modification Marko can comprise the chromosome sequence through editor, and it only makes the HERDA inactivation in oneself knows gene carrier's variant form.

In another embodiment, method of the present invention can be used for producing the horse of genetic modification, the chromosome sequence through editor that it comprises coding HYPP, wherein chromosome sequence through inactivation so that the HYPP dominant gene through inactivation and do not produce HYPP albumen.In addition, the Marko who has a genetic modification of the HYPP dominant allele of inactivation and chromosome sequence described herein can show HYPP and propagate and the perpetuity minimizing in Malaysia and China.In unrestriced example, the Marko of genetic modification can comprise the chromosome sequence through editor of coding HYPP.

In another embodiment, method of the present invention can be used for producing the genetic modification horse, the chromosome sequence through editor that it comprises coding Overo protein, wherein chromosome sequence so that do not produce some allelotrope of Overo albumen and/or some allelotrope of Overo albumen is not fatal, but still can produce framework overo phenotype through inactivation.In unrestriced example, genetic modification horse animal may comprise the chromosome sequence through editor of coding Overo, and wherein dominant allele is by inactivation.In another unrestriced embodiment, the genetic modification Marko can comprise the chromosome sequence through editor, and it is only known in the variant form of expressing lethal or harmful phenotype and make the Overo inactivation at oneself.In another embodiment, described modification is changed into the AG sudden change so that sudden change returns to the Isoleucine in EDNRB protein by dinucleotides TC.

In another embodiment, method of the present invention can be used for producing the horse of genetic modification, the chromosome sequence through editor that it comprises coding GBE, wherein chromosome sequence through inactivation so that the GBE Recessive alleles through inactivation and do not produce the respective egg white matter.In addition, the horse that has a genetic modification of inactivation GBE variant may show that minimizing and GBE gene carrier that GBE occurs reduce.In unrestriced example, the Marko of genetic modification can comprise the chromosome sequence through editor of coding GBE.In another unrestriced embodiment, the genetic modification Marko can comprise the chromosome sequence through editor, and it is only known in the variant form of expressing lethal or harmful phenotype and make the GBE inactivation at oneself.

In an alternative embodiment, method of the present invention can be used for producing the horse of genetic modification, the chromosome sequence through editor that it comprises coding JEB, wherein chromosome sequence through inactivation so that the JEB Recessive alleles through inactivation and do not produce JEB protein.In addition, the horse of genetic modification that has a JEB variant of inactivation may show the minimizing that JEB occurs and propagates.In unrestriced example, the Marko of genetic modification can comprise the chromosome sequence through editor of coding JEB.In another unrestriced embodiment, the genetic modification Marko can comprise the chromosome sequence through editor, and it only makes the JEB inactivation in oneself knows gene carrier's variant form.

In another embodiment, method of the present invention can be used for producing the horse of genetic modification, its comprise the coding PSSM through editor chromosome sequence, wherein chromosome sequence through inactivation so that do not produce PSSM dominant gene and albumen.In addition, the genetic modification Marko who has inactivation PSSM dominant allele and a chromosome sequence described herein can there will be in the propagation of Malaysia and China PSSM and perpetuity and reduces.In unrestriced embodiment, the Marko of genetic modification can comprise the chromosome sequence through editor of coding PSSM.

In another replacement scheme, method of the present invention can be used for producing the genetic modification horse comprised through editor's chromosome sequence, described sequence comprises C/C, C/T or the T/T variant of the myostatin of speed and sports achievement, and this depends on the character of required phenotypic character.

Method of the present invention also can be used for producing the genetic modification horse of any combination that comprises above-described chromosomal change.For example, the Agouti gene that the Marko of genetic modification comprises inactivation and/or the PSSM chromosome sequence through editing, modified MATP chromosome sequence, and/or the JEB chromosome sequence of modification or inactivation.

Horse detailed in this article or horse cell may have multiple application.In one embodiment, comprise at least one horse through the genetic modification of editor's chromosome sequence and may show the needed phenotype of people.For example, the inactivation of the chromosome sequence of coding Agouti may produce the horse with striped color fur.In other embodiments, the Marko who comprises at least one editor's chromosome sequence is with the genetic model as research hair color, coat pattern and/or hair growth.In addition, comprising at least one Marko who upsets chromosome sequence usings as model for studying disease or the symptom (referring to above part II (a)) that affects people or other animal.Except dermatosis, as epidermis spandex propagation, or muscle disease, outside high potassium periodic paralysis disease, fatal white Overo syndrome, glycogen branching enzyme deficiency disease, polysaccharide deposition myopathy, recurrent exertional rhabdomyolysis (RER), severe combined immunodeficiency (SCID), the unrestricted example that is applicable to disease or symptom comprises albinism, hair follicle disease and alopecia.In addition, the lysate of disclosed horse cell and described cell can be used for similar research purpose.

iii. the application of pig

In one embodiment, method of the present invention can be used for producing pig or the pig cell that wherein has at least a chromosome sequence to be edited.The unrestricted example of waiting the pig chromosome sequence editing and/or insert may comprise the sequence of those coding hair colors, decorative pattern, disease resistance, meat, increase litter size, meat/fat ratio and reduce the sequence that phosphorus pollutes, as phytase.

In some embodiments, method of the present invention can be used for being created in the pig that comprises the karyomit(e) editor in the nucleotide sequence relevant to hair color or decorative pattern.The unrestricted example that affects the pig chromosome sequence of hair color or decorative pattern comprises MC1R.Play central role during the eumelanin (black/palm fibre) of novel melanocortin receptor 1 (MC1R) in regulation and control Mammals melanophore and phaeomelanin (red/Huang) synthesize, and encoded by classical Extension (E) coat color gene seat.

In another unrestriced embodiment, method of the present invention can be used for being created in the pig that comprises the karyomit(e) editor in the nucleic acid relevant to disease resistance.This genetic modification pig may comprise the chromosome sequence through editor as CD163 or sialic acid attachment proteins.

In another embodiment, method of the present invention can be used for being created in the pig that comprises the karyomit(e) editor in the nucleic acid relevant to meat, meat amount and/or meat fat ratio.For example, the unrestricted example of waiting to lack or edit to increase the pig chromosome sequence of muscle growth in pig comprises those coded proteins, as the sequence of myostatin/GDF8.The unrestriced example that relates to the chromosome sequence of meat comprises HAL, RN or PSS.In yet another embodiment, the genetic modification pig may comprise the chromosome sequence through editor that coding relates to the sequence of meat/fat ratio, as IGF2, GHRH, H-FABP, GH, IGF1, PIT1, GHRHR, GHR or its combination.

In another unrestriced embodiment, method of the present invention can be used for being created in the pig that comprises the karyomit(e) editor in the nucleic acid relevant to the farrowing amount.For example, the genetic modification pig may comprise the chromosome sequence through editor or modification that coding increases the ESR of farrowing amount.

In further embodiment, method of the present invention can be used for being created in and reduces phosphorus phosphoric acid salt and pollute the pig that comprises the karyomit(e) editor in relevant nucleic acid.For example, the genetic modification pig may comprise the chromosome sequence through editor that the coding phytase pollutes to reduce phosphoric acid salt.

Pig animal disclosed herein and cell may have multiple application.In one embodiment, comprise at least one pig through the genetic modification of editor's chromosome sequence and may show the needed phenotype of people.For example, the encode modification of the allelic chromosome sequence of a kind of MC1R may cause pig to produce having required hair color or the hair of decorative pattern.In other embodiments, the pig that comprises at least one editor's chromosome sequence can be as the genetic model of research hair color, coat pattern and/or hair growth.In addition, comprise at least one pig of upsetting chromosome sequence and can be used as model for studying the disease that affects people or other animal or (referring to above part II (a)) of symptom.The unrestricted example that is applicable to disease or symptom comprises albinism, hair follicle disease and alopecia.In addition, the lysate of disclosed pig cell and described cell can be used for similar research purpose, as described in detail in above part II (a).

iv. the application of ox

In one embodiment, method of the present invention can be used for producing ox or the ox cell that wherein has at least a chromosome sequence to be edited.The unrestricted example of waiting the ox chromosome sequence editing and/or insert comprises those codings and milk yield, quality and processing, meat production and quality, hair color and quality, on the impact of environment with cultivate the sequence of relevant protein.

In certain embodiments, method of the present invention can be used for being created in the ox that has the karyomit(e) editor in the sequence relevant to milk yield, quality and processing.For example, chromosome sequence to be edited can comprise that casein, lactose and lactose-related protein (for example tilactase, Sumylact L, semi-lactosi, beta lactoglobulin, alpha-lactalbumin, lactoferrin), osteopontin, acetyl-CoA carboxylase, tyrosine oxidase and related protein, tissue and cell regeneration induces peptide (RIPTAC) and other tethelin, rich proline(Pro) polypeptide (PRP), alph-opalescin (LA), lactoperoxidase and N,O-Diacetylmuramidase.

In another embodiment, method of the present invention can be used for being created in the sequence relevant to meat product and quality, for example in FGFR3, EVC2, MC1R and myostatin (mh), has karyomit(e) editor's ox.

In other embodiments, method of the present invention can be used for being created in the ox that has the karyomit(e) editor in the sequence relevant with cultivation to BSE-resistance (such as PRPN), hair color and quality (such as MC1R, TYRP1, MGF or KITLG), environmental influence.In certain embodiments, locus may not be determined, but can determine by method generally known in the art.

Ox animal disclosed herein and cell may have multiple application.In one embodiment, comprise at least one ox through the genetic modification of editor's chromosome sequence and may show the needed phenotype of people.For example, the inactivation of the chromosome sequence of coding Agouti may produce the ox with striped color.In other embodiments, the ox that comprises at least one editor's chromosome sequence can be as the genetic model of research hair color, coat pattern and/or hair growth.In addition, comprise at least one ox of upsetting chromosome sequence and can be used as model for studying disease or the symptom that affects people or other animal.The unrestricted example that is applicable to disease or symptom comprises albinism, hair follicle disease and alopecia.In addition, the lysate of disclosed ox cell and described cell can be used for similar research purpose.

(c) companion animals application

In another embodiment, method of the present invention can be used for producing one or more companion animals that cause the karyomit(e) editor of one or more ideal characters.Here " companion animals " used refers to traditionally and do not accomplish the object of profit making and domesticated animal.But note, in some cases, companion animals can cultivate to make a profit.The unrestricted example of companion animals describes in detail at this paper and following part III.The unrestricted example of the suitable ideal character of companion animals comprises hypoallergenic, specific hair color or quality, disease resistance, minimizing urine or Fecal odor etc.

In certain embodiments, method of the present invention can be used for being created in the companion animals that has the karyomit(e) editor in the gene of listing in above table D.

In exemplary, method of the present invention can be used for producing the companion animals that comprises one or more karyomit(e) editors, as cat, dog or rabbit.Each discusses in more detail below.

i. cat

In one embodiment, method of the present invention can be used for producing cat or the cat cell that wherein has at least a chromosome sequence to be edited.The unrestricted example of cat chromosome sequence to be edited can comprise those coded proteins, such as the transformation reactions crude protein, relate to the protein that urine odor produces and the sequence that relates to the protein of hair color, coat pattern and/or hair length.

In certain embodiments, method of the present invention can be used for being created in the cat that has the karyomit(e) editor in the nucleotide sequence relevant to hypoallergenic.Preferably allergenic protein comprises domestic cat 1 (Fel d1), and it is the main allergen be present on cat, and is the chain 1 of peptide of the independent genes encoding in the cat gene group and the heterodimer of chain 2.

In another embodiment, method of the present invention can be used for being created in the cat that has the karyomit(e) editor in the nucleotide sequence relevant to the generation of urine odor.For example, the protein that produces urine odor can related to, such as in the Procaine esterase 5A that produces main urine pheromone felinine, carrying out the karyomit(e) editor.

In another embodiment, method of the present invention can be used for being created in the cat that the nucleotide sequence relevant to hair color, length or decorative pattern has the karyomit(e) editor.The unrestricted example of suitable hair color protein comprises tyrosine oxidase (TYR), tyrosine oxidase-related protein 1 (TYRP1), augoti signal transducer matter (ASIP) and melanocyte avidin (MLPH).The unrestricted example of the protein relevant with hair length is FGF5 (FGF5).Those skilled in the art understand the length that many other oroteins relate to hair color, coat pattern, hair, but not yet determine its locus.

Animal disclosed herein and cell may have a plurality of application.In one embodiment, comprise at least one cat through the genetic modification of editor's chromosome sequence and may show the needed phenotype of people.For example, the inactivation of the chromosome sequence of coding Fel d1 can produce the cat of hypoallergenic or non-allergy.In other embodiments, the cat that comprises at least one editor's chromosome sequence can be as the genetic model of research hair color, coat pattern and/or hair growth.In addition, comprise at least one cat of upsetting chromosome sequence and can be used as model for studying disease or the symptom (referring to above part II (a)) that affects people or other animal.The unrestricted example that is applicable to disease or symptom comprises albinism, deafness, skin disorder, hair disorders and alopecia.In addition, the lysate of disclosed cat cell and described cell can be used for similar research purpose.

ii. rabbit

In one embodiment, method of the present invention can be used for producing rabbit or the rabbit cell that wherein has at least a chromosome sequence to be edited.The unrestricted example of waiting the rabbit chromosome sequence editing and/or insert can comprise the sequence that those are relevant to cardiovascular disorder, immune deficiency and hair color, decorative pattern and/or length.

In one embodiment, method of the present invention can be used for being created in the rabbit that comprises one or more karyomit(e) editors in the sequence relevant to cardiovascular disorder.The unrestricted example of the rabbit chromosome sequence relevant to cardiovascular disorder can comprise apo A, apoA-I, apoB, apoE2, apoE3 and lecithin cholesterol acyltransferase (LCAT), and rabbit apolipoprotein B, the catalysis of mRNA-editing enzymes poly--peptide 1 (APOBEC-1).The further unrestricted example of rabbit chromosome sequence to be edited comprises the sequence of the protein that those codings are relevant with autosomal dominant disorder-familial hypertrophic cardiomyopathy (FHC).FHC can be caused by the various mutations of the gene of coding various contractions, structure, passage and kinase protein.

In another embodiment, method of the present invention can be used for being created in the rabbit that comprises the karyomit(e) editor in the nucleotide sequence relevant to immune deficiency.The unrestricted example of rabbit chromosome sequence to be edited can comprise fumarylacetoacetate hydrolase (FAH), restructuring-activating gene-1 (Rag1), restructuring-activating gene-1 (Rag2), jaw frame O1 (Foxo1), DNAPK (dsDNA-deopendent protein kinase), IL2 γ acceptor.

Method of the present invention also can be used for producing the genetic modification rabbit of any combination that comprises above-described chromosomal change.For example, the genetic modification rabbit can comprise modifies or inactivation FAH, and/or modification or inactivation RAG1 chromosome sequence, and/or modifies the RAG2 chromosome sequence, and/or modification or inactivation Foxo1, DNAPK and/or IL2 γ acceptor.All and any combination of above-described chromosomal change can be used for expanding from the liver cell in people or other source, and this further allows the research, chronic hepatopathy, acute hepatopathy, hepatocellular carcinoma, hepatitis of drug metabolism study, toxicologic study, safety evaluation research, infectious diseases and any other liver to infect or disease.

In yet another embodiment, method of the present invention can be used for producing the genetic modification rabbit, and it comprises the editor chromosome sequence of coding without hair homologous protein (hr).Normal hair follicle (HF) may appear seeming in the rabbit of carrying sudden change at the hr locus, but will be after birth soon hair will come off fully.Comprise genetic modification rabbit through editor's hr chromosome sequence can be used as wound healing test, skin irritation test, treatment virus infection, bacterium infect, with the model animals of other rabbit model mating and for any application that wherein normal rabbit can be shaved light.

In addition, method of the present invention also can be used for producing the genetic modification rabbit of any combination that comprises above-described chromosomal change.For example, the genetic modification rabbit can comprise inactivation ApoE, and/or FAH, and/or the RAG1 chromosome sequence, and/or modifies the RAG2 chromosome sequence, and/or modification or inactivation Foxo1DNAPK and/or IL2 γ acceptor, and/or without hair homologue protein staining body sequence.

Genetic modification rabbit disclosed herein and cell may have multiple application.In one embodiment, comprise at least one genetic modification rabbit through editor's chromosome sequence and may show the needed phenotype of people.For example, after the inactivation of the chromosome sequence of coding nothing hair homologue gene can be created in and be born, the rabbit of very fast nothing hair, make rabbit not need as usually requiring in various experiments uses, shaving light.In other embodiments, comprising at least one rabbit through editor's chromosome sequence can be as research hair color, coat pattern and/or hair growth, body size, the growth of bone and the genetic model of muscle development and structure.In addition, comprise at least one rabbit of upsetting chromosome sequence and can be used as model for studying disease or the symptom (referring to above part II (a)) that affects people, rabbit or other animal.The unrestricted example of applicable disease or symptom comprises cardiovascular disorder, eye disease, thyroid disease, autoimmune disorder and immune deficiency.In addition, the lysate of disclosed rabbit cell and described cell can be used for similar research purpose.

iii. dog

In one embodiment, method of the present invention can be used for producing dog or the canine cells that wherein has at least a chromosome sequence to be edited.The unrestricted example of waiting the dog chromosome sequence editing and/or insert comprises the sequence of protein, limbs length, body size, hair color, decorative pattern and/or quality and diseases etc. that those coding anaphylaxis are relevant.

In certain embodiments, method of the present invention can be used for being created in the dog that has one or more karyomit(e) editors in the nucleotide sequence relevant to hypoallergenic.The unrestricted example of this dog chromosome sequence comprises Can f 1.There is the dog that Can f 1 " knocks out " or modify and may there is hypoallergenic, or nonallergic, and/or without excessively barking.

In other embodiments, method of the present invention can be used for being created in the dog that has one or more karyomit(e) editors in the nucleotide sequence relevant to limbs length or body size.For instance, suitable nucleotide sequence may comprise fibroblast growth factor 4 (FGF4) and type-1 insulin like growth factor (IGF-1).

In another embodiment, method of the present invention can be used for being created in the dog that has one or more karyomit(e) editors in the nucleotide sequence relevant to hair color, decorative pattern, length and/or quality.For example, suitable nucleotide sequence may with level and smooth and thread texture fur (T-vertebra albumen-2, the thread hair of PSPO2), long and short fur (ZFGF-5, FGF5), volume and straight fur (Keratin 71, KRT71), without hair (jaw frame transcription factor family FOX13), hair color (melanocyte adrenocortical hormone 1 acceptor, Mclr; Agouti; And beta-defensin, CBD103) with there not being wholly or in part pigmentation, (transcription factor that ommatidium is relevant MITF) is correlated with.Those skilled in the art understand the length that other oroteins relates to hair color, coat pattern, hair, but not yet determine its locus.

In further embodiment, method of the present invention can be used for being created in the dog that has one or more karyomit(e) editors in the nucleotide sequence relevant to the human disease.The unrestricted example of this type of disease comprises eyesight illness, kidney, lethargy, rheumatoid arthritis, SCID, Keratin sulfate relative disease, cystinuria, hemorrhagic diseases, wax sample lipofuscin deposition and copper poisoning.In one embodiment, the dog of genetic modification may comprise the low chromosome sequence through editor of secreting albumen-2-acceptor gene HCRTR2 of coding.In another embodiment, chromosomal editor may be at the RCND locus.In yet another embodiment, the dog of genetic modification may comprise the coded protein folliculin through editor chromosome sequence.In another embodiment, the dog of genetic modification may comprise the karyomit(e) editor in the RPE65 gene.

Method of the present invention also can be used for producing the genetic modification dog of any combination that comprises above-described chromosomal change.For example, the dog of genetic modification may comprise Can f1 and/or the Agouti chromosome sequence of inactivation, modifies the FGF4 chromosome sequence, and/or the HCRTR2 of modification or inactivation, RCND and/or RPE65 chromosome sequence.

Dog animal and cell that method of the present invention produces may have multiple application.In one embodiment, comprise at least one genetic modification dog through editor's chromosome sequence and may show the needed phenotype of people.For example, the dog that the inactivation of the chromosome sequence of coding Can f 1 may produce hypoallergenic or non-allergy and/or excessively not bark.In other embodiments, comprise the genetic model that at least one dog through editor's chromosome sequence may be used as research hair color, coat pattern and/or hair growth, body size, leg length and width and skull shape.In addition, comprise at least one dog of upsetting chromosome sequence and can be used as model for studying disease or the symptom (referring to above part II (a)) that affects people, dog or other animal.The unrestricted example of applicable disease or symptom comprises cancer, deafness, heart disease, cataract, hip dysplasia, thyroid disease, flatulence, autoimmune disorder, gradual neurodeatrophia and epilepsy.In addition, the lysate of disclosed canine cells and described cell can be used for similar research purpose.

(d) biomolecules produces application

In some embodiments, method of the present invention can be used for producing animal or the cell that can produce biomolecules.For example, in one embodiment, method of the present invention can be used for producing animal or cell, and its one or more karyomit(e) editors that comprise make animal or cell be created in the biomolecules that animal in the situation that does not have the karyomit(e) editor or cell do not produce usually.For example, method of the present invention can be used for producing and can produce antibiotic cell.Perhaps, method of the present invention can be used to produce and can in its milk, produce the ox of required biomolecules, as described in detail in above part II (b).

Another aspect of the present invention comprises by the genetically modified cell through editor's chromosome sequence that comprises coded protein or the method that animal produces the purifying biological component.The unrestricted example of this type of biological components comprises antibody, cytokine, signal-proteins, enzyme, receptor stimulant and receptor antagonist.

In another embodiment, method of the present invention can be used for producing following animal or cell, and it comprises one or more karyomit(e) editors, so that the biomolecules that will usually produce with animal or cell is compared, animal or cell produce modified biomolecules.For example, method of the present invention can be used for producing the silkworm that comprises the karyomit(e) editor, makes the silk produced by silkworm more cater to the need.The unrestricted example of silkworm chromosome sequence to be edited comprises that those are coded in the sequence of the protein of specifically expressing in sericterium.Sericterium is the synthetic position of silk-protein, and can be divided into three interval that morphology and function is different: ASG, MSG and PSG.In one embodiment, the genetic modification silkworm that comprises the fibroin (comprising fibroin heavy chain (FibH), fibroin light chain (FibL) and fibrohexamerin P25) of modification in PSG can have and have not isophenic silky fibre aspect the ability of color, quality, slickness, length, intensity, weight or absorbing dye.In other embodiments, the modifying factor that the genetic modification silkworm comprises the Juvenile hormone binding protein of encoding, described Juvenile hormone binding protein relates to the neotonin signal transduction in PSG and mediates the g and D of sericterium.In another embodiment, the genetic modification silkworm comprises in MSG modifies the ser1 gene, and its generation has viscosity and covers the glue protein sericin in the sericterium outside, fibroin core top.Sericin forms the approximately 10-25% of silk, and must come unstuck in the silk course of processing.Comprise the genetic modification silkworm of modifying the ser1 gene and can produce the silky fibre that does not need the process of extensively coming unstuck.Therefore, in Textile Manufacturing Industry, the genetic modification silky fibre does not need by add the way of metal " increasing the weight of " in silk goods.

One group of limiting examples that relates to the protein of silk generation is the translocator that participation transhipment and silk form relevant material, the member (the 35 member B3 of family, member E1, and 39 members 9 of family) and the cross-film transport protein isotype 2 that such as solute carrier family, become.Those skilled in the art understand the ability that other oroteins relates to a color, quality, slickness, uniformity coefficient, length, intensity, weight and absorbing dye, but locus also is not determined.

Protease inhibitor in A/MSG can be in protection sericterium inner chamber fibroin in order to avoid play a significant role in the proteolytic enzyme in being expressed in A/MSG (such as feeler esterase and serine protease) digestion.In another embodiment, the genetic modification silkworm can comprise the chromosome sequence through editor of the protease inhibitor in coding A/MSG.The protease inhibitor coding region of modifying may produce the silk-protein with different physical properties.In one embodiment, the genetic modification silkworm that comprises modified protein enzyme inhibition factor chromosomal region can have a kind of phenotype, and produce and there is no a high proportion of sericin, but still constant on shape and other physical properties.

In another embodiment, the genetic modification silkworm can comprise the chromosome sequence through editor of coding fibroin, sericin, solute carrier, protease inhibitor or its combination.Chromosome sequence through editor can comprise at least one modification so that produce silk-protein, sericin or other silky fibre formation associated protein that changes pattern.Chromosomal sequence may be modified to comprise the variation of at least one Nucleotide, so that the protein of expressing comprises at least one amino acid described in detail above, changes.In addition, can comprise a sudden change through editor's chromosome sequence, so that sequence inactivation and do not produce protein or defective protein.Just as detailed above, sudden change may comprise disappearance, insertion or point mutation.Compare with the silkworm that wherein said chromosomal region is not edited, comprise through editor's FibH, ser1 and/or the genetic modification silkworm of protease inhibitor chromosome sequence and can there is different fiber colors, quality and weight.

Silk is the nature hypoallergenic.Yet some can be because of various former thereby generation silk allergy.Generally, allergy can be traced back to the food of silkworm, as mulberry tree or oak leaf, and the protein chain in the silk that its impact is produced by silkworm.Silk allergy can cause asthma or allergic rhinitis.In one embodiment, the genetic modification silkworm can comprise the α that all participates in glucose hydrolysis and transportation in the digestion be coded in as the mulberry leaf of the unique food source of silkworm and the chromosome sequence through editor of β glucuroide, glycoside hydrolase and glucose transporter.These protein are expressed in the middle intestines of silkworm, and relevant to the function of digestion, transportation and absorption as nutritive substance.In another embodiment, the genetic modification silkworm can comprise the chromosome sequence through editor of coding lipase protein family, feeler esterase, Procaine esterase and clearing factor acceptor SR-B1, and these materials are mainly relevant to lipid metabolism in middle intestines (such as the degraded of triglyceride hydrolysis, smell acetic acid compound and the combination of modified low density lipoprotein).The above-described genetic modification silkworm that comprises the chromosome sequence through editing generally can not contain the anaphylactoid anaphylactogen of the silk that causes silk manufacturing operator and human consumer.

Middle intestines also represent resistance and the immunoreactive the first line of defence of silkworm.In one embodiment, the genetic modification silkworm can comprise the chromosome sequence through editor of coding in conjunction with the aminopeptidase of all kinds of Cry toxin.For example, be expressed in cadherin in silkworm-sample protein B tR175 and serve as the Cry toxoreceptor in signal transduction.In another embodiment, the genetic modification silkworm can comprise 17 members' of the cytochrome P450 gene family in middle intestines the chromosome sequence through editor, and described member comprises CYP4, CYP6 and CYP9.Cytochrome P450 gene family involved in plant toxin and Metabolism of pesticides in middle intestines.

Intestines specific gene coding peptidoglycan recognition protein in another, its can be consumingly in conjunction with the whole cell peptidoglycan of gram-positive microorganism and trigger immune response.In addition, the two kind lymphocyte receptor genes encodings of specifically expressing in middle intestines in identification, work in pathogenic agent in conjunction with albumen.In another group embodiment, the genetic modification silkworm can comprise peptidoglycan recognition protein or lymphocyte in conjunction with the chromosome sequence through editor in albumen, wherein makes described chromosome sequence raise, so that silkworm has more disease resistance.Suitable sudden change from what has been discussed above, the genetic modification silkworm generally all can have immunity system preferably, is not subject to the impact of disease and pathogenic agent, and insensitive to the plant poison in its food source and sterilant.

Be similar to the silkworm fiber, spider silk is another kind of natural fiber, and it is than the material Kevlar of the current ballistic protection vest for army hard three times.The remarkable ability that spider silk elongates allows it to absorb more energy when breaking, and more effectively slows down bullet.Yet strong, the pliable and tough silk that obtains the spider generation is unpractiaca.Clone the gene of manufacturing from the spider silk of spider (N.clavipes), also existed synthetic basic mode to imitate spider dragline silk.In one embodiment, the genetic modification silkworm may comprise the chromosome sequence through editor, and it comprises integration sequence, as whiplike gene.The genetic modification silkworm will make it possible to system and produce in large quantity spider silk to meet the demand of the novel material with special performance.

The genetic modification silkworm is also contained in the present invention, any combination that it comprises above-described chromosomal change.For example, the genetic modification silkworm may comprise modified FibH and/or FibL chromosome sequence, modify the ser1 chromosome sequence, and/or modifies BtR175, and/or the CYP4 chromosome sequence, and/or from other species or biological integration sequence.

Silkworm disclosed herein and cell may have multiple application.In one embodiment, comprise at least one genetic modification silkworm through editor's chromosome sequence and may show the needed phenotype of people.For example, the modification of the chromosome sequence of coding fibroin may produce the silky fibre with unique color, quality, weight or intensity.In other embodiments, comprising at least one silkworm through editor's chromosome sequence can be as the genetic model of research silk composition, generation and/or transportation.In addition, comprise at least one silkworm of upsetting chromosome sequence and can be used as model for studying disease or the symptom that affects people or other animal.The unrestricted example of applicable disease or symptom comprises mulberry tree allergy.In addition, the lysate of disclosed silkworm cell and described cell can be used for similar research purpose.

III. the animal that comprises the karyomit(e) editor

An aspect of the present disclosure provides the genetically modified animal that wherein at least one chromosome sequence is edited.Suitable karyomit(e) editor can include but not limited to the editing type described in detail in above part I (f).

As used herein term " animal " refers to the non-human animal.But animal embryo, childhood or adult.Suitable animal can comprise vertebrates such as Mammals, birds, Reptilia, Amphibians and fish.Be applicable to mammiferous example and can include but not limited to rodent, companion animals, domestic animal and primate.Rodentine unrestricted example comprises mouse, rat, hamster, gerbil jird and cavy.Suitable companion animals can include but not limited to cat, dog, rabbit, hedgehog and ferret.The unrestriced example of domestic animal comprises horse, goat, sheep, pig, ox, camel and alpaca.Suitable primate can include but not limited to New World monkey, old world monkey and man like ape, for example capuchin monkey, chimpanzee, mongoose lemur, macaque, marmoset monkey, thin,tough silk hair monkey, Ateles, Squirrel monkey and vervet.The unrestricted example of birds comprises chicken, turkey, duck and goose.In addition, but the animal invertebrates, as insect, nematode etc.The unrestricted example of insect comprises silkworm, fruit bat and mosquito.

In one embodiment, exemplary animal is rat.The unrestricted example of suitable rat strain comprises Dahl Salt-Sensitive, Fischer 344, Lewis, Long Evans Hooded, Sprague-Dawley and Wistar.

In each above-mentioned repetition of suitable animal of the present invention, animal does not comprise the transposon sequence of the random integration of external source introducing.

Animal of the present invention can comprise in above part II, or the genome editor of the gene of listing in above Table A, B, C and D.In other embodiments, animal of the present invention can comprise the genome editor as described in embodiment.

In exemplary embodiment, method of the present invention can be used for the animal that exploitation derives from the embryo, wherein at least one karyomit(e) in each cell of animal, comprises the karyomit(e) editor.In some embodiments, method can be used for the animal that comprises the karyomit(e) editor on the karyomit(e) of exploitation in each cell of animal.In some embodiments, chromosomal editor is at least one euchromosome.In other embodiments, chromosomal editor is at least one sex chromosome.

Two animals of the present invention can hybridize to produce karyomit(e) editor's animal homozygote.In addition, animal can hybridize that karyomit(e) editor and other genetic background are combined.As unrestricted example, other genetic background comprises genetic background, the genetic background with non-targeted integration with another karyomit(e) editor, has the genetic background of deletion mutantion and the genetic background of wild-type.In one embodiment, for example, animal A can comprise the first chromosome editor, and animal B may comprise the second karyomit(e) editor.In the F1 that comprises the first and second karyomit(e) editors generation, can be by obtaining A and B mating.This or similar breeding system is one of the method for more than one karyomit(e) of combination editor in identical animal.

In certain embodiments, the animal that comprises the karyomit(e) editor can be used for producing primary cell line, as described in detail in following part IV.Gained clone will comprise the karyomit(e) editor who is incorporated at first the embryo.In any application that animal of the present invention can describe in detail in above part II, use.

IV. the cell of genetic modification

Another aspect of the present invention contains the cell produced by method of the present invention, comprises at least one karyomit(e) editor's cell.Suitable editor can include but not limited to the editing type described in detail in above part I (f).

The type of the cell that comprises at least one karyomit(e) editor may and will change.In the ordinary course of things, cell will be eukaryotic cell.In some cases, cell may be primary cell, cultured cells or immortal cell line cell.Suitable cell can comprise fungi or yeast, as pichia spp, yeast saccharomyces cerevisiae or fission yeast; Insect cell, as the SF9 cell from fall army worm (Spodoptera frugiperda) or from the S2 cell of drosophila melanogaster (Drosophila melanogaster); And zooblast, as mouse, rat, hamster, non-human primate or people's cell.Exemplary cell is Mammals.But mammalian cell primary cell.In the ordinary course of things, can use any primary cell to the double-strand break sensitivity.Cell may be polytype cell, as inoblast, sarcoplast, T or B cell, scavenger cell, epithelial cell etc.

When using mammal cell line, clone is the clone of any establishment or the primary cell line of not yet describing.Clone may adhere to or is NA, or clone can be used oneself standard technique of knowing of those skilled in the art to grow promoting to adhere to, under non-adhesion or organotypic growth's condition.The unrestricted example of suitable mammal cell line comprises Chinese hamster ovary (CHO) cell, the monkey kidney CVI clone transformed by SV40 (COS7), the human embryonic kidney cell is 293, baby hamster kidney cell (BHK), Properties of Sertoli Cells Isolated from Mice Testis (TM4), monkey-kidney cells (CVI-76), African green monkey kidney cell (VERO), human cervical carcinoma cell (HeLa), Madin-Darby canine kidney(cell line) (MDCK), Buffalo rats liver (BRL3A), human pneumonocyte (W138), human liver cell (HepG2), mouse mammary tumor cell (MMT), rat hepatoma cell (HTC), the HIH/3T3 cell, people U2-OS osteosarcoma cell line, people A549 clone, people K562 clone, people HEK293 clone, people HEK293T clone and TRI cell.About the full list of mammal cell line, those of ordinary skills can be with reference to the catalogue (ATCC of American Type Culture Collecti

, Mamassas, VA).

In exemplary embodiment, cell of the present invention is the embryo.The embryo is unicellular embryo or many cells embryo.Applicable embryo can, from several different invertebrate species, comprise Mammals, birds, Reptilia, Amphibians and fish.In general, suitable embryo be can collect, inject and cultivation so that the embryo that Zinc finger nuclease is expressed.In some embodiments, suitable embryo can comprise the embryo from rodent, companion animals, domestic animal and primate.Rodentine unrestricted example comprises mouse, rat, hamster, gerbil jird and cavy.The unrestricted example of companion animals comprises cat, dog, rabbit, hedgehog and ferret.The unrestricted example of domestic animal comprises horse, goat, sheep, pig, camel, alpaca and ox.The unrestricted example of primate comprises capuchin monkey, chimpanzee, mongoose lemur, macaque, marmoset monkey, thin,tough silk hair monkey, Ateles, Squirrel monkey and vervet.In other embodiments, suitable embryo can comprise the embryo from fish, Reptilia, Amphibians or birds.In addition, but suitable embryo insect embryo, for example drosophila embryos, mosquito embryo or silkworm embryo.The method that it will be appreciated by those skilled in the art that collection, injection and cultivate the embryo is well known in the art, and will depend on embryo's species and different.In all cases, can be identified for by the conventional best approach best technique of specific embryo's species.

In other embodiments, but the cell stem cell.Suitable stem cell includes, without being limited to embryonic stem cell, ES sample stem cell, fetal stem cell, adult stem cell, multipotential stem cell, induced multi-potent stem cells, multipotential stem cell, few energy stem cell and unipotency stem cell.

In addition, cell of the present invention can be modified to comprise label or reporter gene.Reporter gene comprises the gene of those codings as the selective marker of E.C. 2.3.1.28 (CAT) and neomycin phosphotransferase (neo), the gene of the fluorescin of coding as the fluorescin of green fluorescent protein (GFP), red fluorescent protein, or it improves any genetically engineered variant of reporting performance.The unrestricted example of this type of known FP variant comprises EGFP, blue fluorescent protein (EBFP, EBFP2, azurite, mKalama1), cyan fluorescent protein (ECFP, Xi Lulin, CyPet) and yellow fluorescence protein derivative (YFP, citrine, Venus, YPet).For example, in containing the genetic construction of reporter gene, the reporter gene sequence can directly merge to produce gene fusion with target gene.The reporter gene sequence can be incorporated in the target gene in the target mode, but for example reporter gene sequence specificity is incorporated into 5 of target gene ' or 3 ' end.Therefore, these two genes are under the control of same promoter element, and are transcribed into single messenger RNA(mRNA) molecule.In addition, reporter gene can be used for monitoring the activity of the promotor in genetic construction, for example the reporter gene sequence is placed in to target promotor downstream so that under the control of the expression of reporter gene in the target promotor, and viewed specific activity, can be directly and the activity of quantitative assay reporter gene usually and under the strongly consistent promotor.Should be understood that to do like this may or may not can cause target gene to destroy.

Definition

Unless otherwise defined, otherwise all technology used herein and scientific terminology have the implication of usually understanding with those skilled in the art.Below with reference to the General Definition of the many terms that use in the present invention: Singleton etc. are provided for those skilled in the art, Dictionary of Microbiology and Molecular Biology (the 2nd edition 1994); The Cambridge Dictionary of Science and Technology (Walker compiles, 1988); The Glossary of Genetics, the 5th edition, R.Rieger etc. (volume), Springer Verlag (1991); With Hale & Marham, The Harper Collins Dictionary of Biology (1991).Unless otherwise, otherwise following term used herein has the implication of giving it.

When introducing the key element of the disclosure or its preferred embodiment, article " ", " a kind of ", " being somebody's turn to do " and " described " wish refer to exist one or more key elements.Term " comprises ", " comprising " and " having " wish is comprising property, and means to exist other key element except listing key element.

As used herein " gene " refers to the DNA district (comprising exon and intron) of encoding gene product, and all DNA district of regulatory gene product generation, no matter whether this type of regulating and controlling sequence is close to coding and/or transcription sequence.Therefore, gene including but not limited to promoter sequence, terminator, translational control sequence such as ribosome bind site and internal ribosome entry site, enhanser, silencer, insulator, boundary element, replication orgin, matrix attachment site and region.

Term " nucleic acid " and " polynucleotide " refer to linearity or annular form and are strand or the deoxynucleotide of double chain form or nucleotide polymer.For the purpose of this disclosure, these terms should not be interpreted as the length of limit polymerization thing.Term can comprise the known analogue of natural nucleotide, and at base, sugar and/or phosphoric acid part (as phosphorothioate backbone) modified Nucleotide.Usually, the analogue of specific nucleotide has identical base-pairing specificity; Be analogue and the T base pairing of A.

Term " polypeptide " and " protein " are used alternatingly to refer to the polymkeric substance of amino-acid residue.

Term " restructuring " refers to the process of the genetic information exchange of two polynucleotide.For the purpose of this disclosure, " homologous recombination " refers to, the special shape of this exchange for example occurred during the reparation of the double-strand break in cell.Sequence similarity between two nucleotide sequences of this process need, adopt " donor " or " exchange " molecule to provide template for the reparation of " target " molecule (experiencing the molecule of double-strand break), and differently be called " non-intersection gene conversion " or " short-track gene conversion " because it can cause genetic information to transfer to target from donor.Be not bound by any particular theory, this transfer can relate to the mismatch repair of the heteroduplex DNA formed between the target that breaks and donor, and/or " synthetic dependency chain annealing ", wherein donor will become the genetic information of the part of target for resynthesis, and/or relevant process.This special homologous recombination usually causes the change in the target molecule sequence, so that donor or exchange partly or entirely being incorporated in target polynucleotide of nucleotide sequence.

As used herein, term " target site " or " target sequence " refer to a kind of nucleotide sequence, and it limits the part of chromosome sequence to be edited, and Zinc finger nuclease through through engineering approaches with identification and be bonded thereto, as long as there are enough conditions of combination.

The technology of determining nucleic acid and amino acid sequence identity is well known in the art.Generally, these technology comprise the nucleotide sequence of the mRNA that determines gene and/or determine the aminoacid sequence by its coding, and by these sequences and second Nucleotide or aminoacid sequence relatively.Also can determine by this way and icp gene group sequence.In the ordinary course of things, consistence refers to that the definite nucleotide pair Nucleotide of two polynucleotide or peptide sequence or amino acid are to amino acid whose correspondence.Two or more sequences (polynucleotide or amino acid) can be by determining that its identity percentage recently compares.The identity per-cent of two sequences (no matter nucleic acid or aminoacid sequence) is the length of the number of two exact matchings between aligned sequences divided by shorter sequence, and is multiplied by 100.The approximation ratio of nucleotide sequence is to by Smith and Waterman, and local homology's algorithm of Advances in Applied Mathematics 2:482-489 (1981) provides.This algorithm can be by being used by Dayhoff, Atlas of Protein Sequences and Structure, M.O.Dayhoff compiles, 5 supplementary issue 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA exploitation by Gribskov, the normalized marking matrix of Nucl.Acids Res.14 (6): 6745-6763 (1986) and be applied to aminoacid sequence.The exemplary tool of determining this algorithm of sequence identity per-cent is provided in " BestFit " utility routine by Genetics Computer Group (Madison, Wis.).Identity per-cent between the sequence of calculation or other suitable scheme of similarity are generally known in the art, and for example, another comparison scheme is BLAST, and it uses default parameters.For example, BLASTN and BLASTP can be used by the default parameters with following: genetic code=standard; Strainer=nothing; Chain=both; Cut-off=60; Expectation=10; Matrix=BLOSUM62;=50 sequences are described; Sequence=high score; Database=nonredundancy sequence, GenBank+EMBL+DDBJ+PDB+GenBank CDS translation+Swiss albumen+Spupdate+PIR.The details of these schemes is found in the GenBank website.About sequence as herein described, the expected degree scope of sequence identity be approximately 80% to 100% with and between any round values.Usually, the identity per-cent between sequence for 70-75% at least, preferably 80-82%, more preferably 85-90%, even more preferably 92%, more preferably 95% and most preferably 98% sequence identity still.

In addition, sequence similarity degree between Nucleotide can be determined by following steps: form to stablize under double-stranded condition between the zone that allows total sequence identity to a certain degree and make multi-nucleotide hybrid, with the enzymic digestion of strand specific nucleic acid, and carry out the size measurement of digestion fragment.As adopt aforesaid method to determine, when sequence molecule really show on measured length at least about 70%-75%, preferably 80%-82%, more preferably 85%-90%, even more preferably 92%, still more preferably during 95% and most preferably 98% sequence identity, two kinds of nucleic acid, or two peptide sequences are basically similar each other.Used hereinly basically similarly also refer to show with specifying DNA or peptide sequence to there is the sequence of complete identity.Basically similar DNA sequence dna can, in the Southern hybrid experiment, be determined under the stringent condition for example limited for this particular system.Limit suitable hybridization conditions in the skill of this area.Referring to such as Sambrook etc., above-mentioned; Nucleic Acid Hybridization:A Practical Approach, B.D.Hames and S.J.Higgins compile, (1985) Oxford; Washington, D.C.; IRL Press).

The selective cross of two nucleic acid fragments can be determined as follows.Sequence identity degree between two nucleic acid molecule affects efficiency and the intensity of the hybridisation events between these molecules.The nucleotide sequence that part is consistent will suppress the hybridization of on all four sequence and target molecule at least in part.The restraining effect of the hybridization of on all four sequence can utilize hybridization assays as known in the art (for example to assess, Southern (DNA) trace, Northern (RNA) trace, solution hybridization etc., referring to Sambrook etc., Molecular Cloning:A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.).This type of mensuration can be used selectivity in various degree, for example, uses the different condition of severity from low to high to carry out.If use low stringency, can assess with assist probes the shortage of non-specific binding, the identity that described probe even lacks the part degree (for example, probe have be less than sequence identity approximately 30% and target molecule), so that in the situation that there is not the non-specific binding event, assist probes can not with target hybridization.

When the detection system utilized based on hybridization, select the nucleic acid probe with the reference nucleic acid sequence complementation, then, by selecting suitable condition, probe and reference sequences selectivity are hybridized each other, or combination, with the formation duplex molecule.Usually have under the condition of target nucleic acid sequence that length at least about 70% sequence identity is at least an about 10-14 Nucleotide and hybridize allowing to detect to have with selected nucleic acid probe sequence with the nucleic acid molecule of reference sequences selective cross under can the hybridization conditions strict in appropriateness.Strict hybridization conditions allows to detect to have with selected nucleic acid probe sequence to have the target nucleic acid sequence that the length that is greater than about 90-95% sequence identity is at least about 10-14 Nucleotide usually.The hybridization conditions that is applicable to probe/reference sequences hybridization (its middle probe and reference sequences have the sequence identity of specific degrees) can be determined (referring to for example Nucleic Acid Hybridization:A Practical Approach according to method as known in the art, B.D.Hames and S.J.Higgins compile, (1985) Oxford; Washington, D.C.; IRL Press).Hybridization conditions is well known to those skilled in the art.

The severity of hybridization refers to that hybridization conditions is unfavorable for forming the degree of the hybrid that contains mismatched nucleotide acid, and higher severity is relevant to the low tolerance range of not mating hybrid.The factor of impact hybridization severity is well known to those skilled in the art, and includes but not limited to the concentration of temperature, pH value, ionic strength and organic solvent (as methane amide and dimethyl sulfoxide (DMSO)).As known to the person skilled in the art, the hybridization severity increases along with higher temperature, lower ionic strength and lower solvent strength.Stringent condition about hybridization, known in this area, can set up specific severity by Change Example as following factor by many condition of equivalences: exist in the based composition of the length of sequence and character, various sequences, salt concn and other hybridization solution composition, hybridization solution or do not have blocker (as T 500 and polyoxyethylene glycol), hybridization temperature and time parameter, and different wash conditions.Can follow standard method in this area selects one group of specific hybridization conditions (referring to such as Sambrook etc., Molecular Cloning:A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.).

Following examples are included the preferred embodiments of the invention of demonstrating.Those skilled in the art should understand disclosed technology in the following embodiments and represent the technology that plays in practice better effect that the present inventor finds.But, in view of the disclosure, those skilled in the art recognize and can be changed in disclosed specific embodiments, and still obtain same or similar result, and do not deviate from the spirit and scope of the present invention, therefore, all items that propose in accompanying drawing or illustrate are interpreted as exemplary, and do not have limited significance.

Embodiment

Following examples first-selected embodiment of the present invention that included to demonstrate.Those skilled in the art should understand disclosed technology in the following embodiments and represent the technology that plays in practice better effect that the present inventor finds.But, in view of the disclosure, those skilled in the art recognize can carry out many variations in disclosed specific embodiments, and still obtain same or similar result, and do not deviate from the spirit and scope of the present invention, therefore, all items that propose in accompanying drawing or illustrate are interpreted as exemplary, and do not have limited significance.

Following examples explanation various repetitions of the present invention.

Embodiment 1: the construction for targeted integration to restriction fragment length polymorphism (RFLP) the donor nucleic acid in rat gene group PXR nucleic acid district.

After the double-strand break of inducing at the ZFN of target, there are two kinds of possible DNA to repair result (Fig. 1).Fracture can be repaired by non-homologous end joining (NHEJ), cause the sudden change that contains base deletion or increase, or, under the existence of donor dna, donor dna can be used as the template for by homologous recombination (HR), repairing double-strand break.The specific sequence variation if donor dna is encoded, these deliberate sudden changes will be included in biological genome at target site.

In order to test the targeted integration of rat gene group with procaryotic injection, design and prepare construct with the PXR gene regions to the rat gene group for targeted integration.Construct is assembled to NotI or Pmei restriction fragment length polymorphism (RFLP) site are introduced in the PXR gene regions (Fig. 2).Construct has the sequence homology that has 200,800 or 2000 base pairs with the PXR gene target site of both sides, RFLP site to be introduced through design.Determine effective targeted and the required same Source size of homologous recombination with the homology region of three sizes.

Utilize pcr amplification to assemble the clone to introduce the restriction site easily for the clone, and the end (Fig. 1) of RFLP site in the PXR homology region.PCR primer for the PXR homology region that increases is described in table 1.Accuprime HF archaeal dna polymerase is for PCR reaction amplification.30s extends for the 200bp fragment, and 1.5min extends for the 800bp fragment, and 4min extends for the 2Kbp fragment.Then use suitable digestion with restriction enzyme PCR fragment, and use the ternary connection to be cloned into 6 plasmids to list in generation table 2 in pBluescript.

Embodiment 2: the structure for targeted integration to restriction fragment length polymorphism (RFLP) the donor nucleic acid in rat gene group rRosa26 nucleic acid district.

Also the construction plasmid with by NotI and Pmei RFLP site targeted integration in the rRosa26 nucleic acid district of rat gene group.The design of plasmid and construction are as described in above-mentioned embodiment 1.PCR primer pair for the rRosa26 homologous region that increases is described in table 3.

Embodiment 3: the construction for targeted integration to restriction fragment length polymorphism (RFLP) the donor nucleic acid in mouse or rat gene group Mdr1a nucleic acid district.

The construction plasmid with by NotI and Pmei RFLP site targeted integration to the mMdr1a nucleic acid district of mouse genome or the rMdr1a nucleic acid district of rat gene group.The design of plasmid and construction are as described in above embodiment 1.PCR primer pair for the Mdr1a homologous region that increases is described in table 4." m " represents that mouse and " r " represent rat.

Embodiment 4:GFP expresses the structure of integrating box.

In order to test the targeted integration of the nucleic acid fragment that is greater than RFLP, design and prepare construct with by GFP expression cassette targeted integration in the PXR of rat and rRosa26 Viral RNA genome district and in the mMdr1a Viral RNA genome district of mouse.In brief, increase the GFP expression cassette that contains people PGK promotor, GFP open reading frame and polyadenylic acid signal so that with following primer, the NotI restriction site is introduced to end (Fig. 3): PGKGFP-F NotI (5 '-aaagcggccgcttggggttgcgccttttcc) (SEQ ID NO:49) and PGKGFP-R NotI (5 '-aaaagcggccgccatagagcccaccgcatc) (SEQ ID NO:50) with PCR.Then the PCR fragment is cloned into construction in embodiment 1-3 containing in the NotI plasmid.

Embodiment 5: refer to the preparation of mRNA for the zinc of targeted integration.

For designing a pair of zinc, each target integration site refers to nucleic acid, and as described to clone in the Sigma website.About more information, refer to Science (2009) 325:433, it is incorporated to this paper by reference.Then by first under 37 ℃, containing 10 μ l damping fluid 2 (NEB, #B7002S), 10 μ l10xBSA (are diluted by 100x BSA, NEB, the ZFN expression plasmid DNA 2h that #B9001S), in the 100 μ l reactants of 8 μ l XbaI (NEB, #R0145S) prepared respectively by digestion 20 μ g in a large number come external generation to express the mRNA of ZFN.With 100 μ l phenol/trichloromethane (Sigma, P2069) abstraction reaction things, surpassing centrifugal 10min under 20,000x g.By 10 μ l 3M NaOAc (Sigma, S7899) and 250 μ l100% ethanol precipitation and centrifugal 25min at full throttle at room temperature for the water-based supernatant liquor.Consequent precipitation is cleaned by adding 300 μ l 70% ethanol that filter via 0.02 μ M strainer.Precipitation is carried out to air-dry and Eddy diffusion in the filtered 0.1xTE of 20 μ l 0.02 μ M.

Then as described by using the MessageMax T7 Capped Message Transcription Kit (#MMA60710) from Epicentre Biotechnologies to carry out in-vitro transcription, thereby produce the ZFN transcript with purified DNA digestion.In brief, reagent constituents is preheated to room temperature, and order below the reactive component of 20 μ l reactants is at room temperature combined: 5 μ l 0.02um filter the water without the RNA enzyme, template, 2 μ l lox prepared by 1 μ l transcribe damping fluid, the 8 μ l 2-Cap/NTP of unit premixs, 2 μ l 100mM DTT and 2 μ l MessageMax T7 enzyme solution.Then incubation reaction thing 30min in 37 ℃ of brooders.

Then use as described A-Plus Poly (A) Polymerase tailing test kit (Epicentre, #PAP5 104H) will add cap RNA with the polyadenylic acid tailing.With following given order, reactive component is at room temperature combined: 55.5 μ l 0.02um filter water, 10 μ l 10x A-Plus reaction buffers, 10 μ l 10mM ATP, 2.5 μ l ScriptGuard RNA enzyme inhibitorss (40 units/microlitre), 20 μ l in-vitro transcription capping things, the 2 μ l A-plus poly A polymerases without the RNA enzyme.Then at 37 ℃ of lower incubation reaction thing 30min.Cap polyadenylic acid-tailing the mRNA that adds of gained is passed through to the 5M NH by equal volume ₄the Oac precipitation is carried out purifying twice.Then mRNA precipitation is carried out air-dryly, and Eddy diffusion filters in injection damping fluids (1mM Tris, pH7.4,0.25mM EDTA) in 30 μ l, and uses Nanodrop spectrophotometer measurement RNA concentration.

Embodiment 6: targeted integration is in the embryo.

For nucleic acid being incorporated in rat or mouse genome, Zinc finger nuclease mRNA is mixed with the target DNA filtered with the 0.02um strainer of a large amount of preparations.Nucleic acid mixture is comprised of a part of ZFN mRNA and a part of donor dna.Then use currently known methods by the nucleic acid mixture microinjection in unicellular embryo's protokaryon.By the embryo's incubated in vitro through injecting, or transfer in pseudo-parent.By the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section results are with for DNA extraction and analysis.

In order to extract DNA, will be organized under 50 ℃ cracking 30min in 100 μ l Epicentre ' s QuickExtract, hatch 10min at 65 ℃ subsequently, and hatch 3min under 98 ℃.In order to determine whether to have occurred targeted integration, use suitable primer to use the pcr amplification target area.For wherein RFLP being incorporated into to the experiment in Animal genome, the PCR product is digested to detect integration (Fig. 4 A) with the RFLP enzyme of introducing.In addition, use and to utilize wild-type PCR fragment and to measure from the Cel-I restriction endonuclease of the PCR fragment of embryonal vaccination, to prove that ZFN mRNA has in the embryo functional by detecting the NHEJ irrelevant with targeted integration.For wherein GFP being incorporated into to the experiment of Animal genome, the size variation of PCR fragment shows to integrate (Fig. 4 B).In addition, the amplification that wherein only primer resides at the integration juncture on the GFP box is used to assess the integration of donor nucleic acid.

Embodiment 7: the DNA extraction of the mMdr1a target site in mouse genome and the test of pcr amplification.

With as the embryo who extracts 1-64 cell described in embodiment 6 test will extraction from tissue the PCR condition that increased of target nucleic acid., in 50 μ l reactants, contain in the reactant up to 5 μ l Epicentre ' s QuickExtract solution, use the 900bp fragment amplification (Fig. 5) that will contain mouse mMdr1a target area in 36 amplification cycles of 60 ℃ of downward-extension 4min.These results show, QuickExtract can not disturb pcr amplification, and DNA can be from the sample amplification of only extracting from the 1-10 cell.In order to improve susceptibility, can increase the PCR cycle index, maybe can carry out nido CR reaction.

Embodiment 8:NotI donor RFLP is incorporated into P of Rats XR genome district-experiment A.

Be expelled to for the donor plasmid (arm with 800bp) that NotI RFLP site is incorporated into to rat gene Zu PXR district the rat embryo that there is as mentioned above ZFN mRNA.The DNA that use is extracted from many embryos carries out PCR, carries out NotI restriction enzyme analysis and CEL-I endonuclease analysis subsequently.Pcr amplification is successfully (Fig. 6 A) for many embryos, and the Cel-I endonuclease analysis shows, most of fragments have the variation (Fig. 6 B) of nucleotide sequence at required target place.

Embodiment 9:NotI donor RFLP is incorporated into mouse mMdr1a genome district-experiment B.

Repeat as described in Example 8 NotI RFLP targeted integration in mouse mMdr1a district.The mMdr1a district digests with pcr amplification and with NotI.Pcr amplification is successfully (Fig. 7) for many embryos, and shows with NotI digestion, and many embryos comprise integrated RFLP site (referring to for example swimming lane 13,17,19,20 and 23).Always have 7 and produce targeted integration in 32 embryos of all generation data.

These results (Fig. 8) have been confirmed by after further cleaning the PCR reaction product, repeating the NotI digestion reaction.

Embodiment 10: DNA extraction and the pcr amplification of the PXR target site in test rat gene group.

Test is from the pcr amplification in the PXR zone of blastocyst, to determine sensitivity level.The PCR reactant comprises 5 μ l templates, 5 μ l PCR damping fluids, 5 μ l primer, 0.5 μ l Taq polysaccharase and for 33.5 μ l water of 50 μ l reactants separately.Template forms (Fig. 9) by the undiluted DNA extracted from the rat blastocyst or with the DNA of the dilution proportion of 1: 2,1: 6,1: 10 and 1: 30.

Embodiment 11:NotI donor RFLP is incorporated into P of Rats XR genome district.

Be expelled to for the donor plasmid (homology arm with 800bp) that NotI RFLP site is incorporated into to rat gene group PXR district the rat embryo that there is as mentioned above ZFN mRNA.Have 123 embryos and be injected, and 106 survivals.Inject the nucleic acid of the concentration of successively decreasing with test toxicity.In 51 embryos of injection 5ng nucleic acid, survive and be divided into two cell stages at second day for 17.In 23 embryos of injection 2ng nucleic acid, survive and be divided into two cell stages at second day for 14.In 29 embryos of injection 10ng nucleic acid, survive and be divided into two cell stages at second day for 12.10 of injection contrast embryos are not all survived, and are divided into two cell stages at second day.

The DNA that use is extracted from many embryos carries out the pcr amplification in PXR district, carries out subsequently with NotI and the analysis of Cel-I endonuclease.Pcr amplification is successfully for many embryos, and NotI and the demonstration of Cel-I endonuclease analysis, and 18 variations (Figure 10) that have nucleotide sequence at required target place are arranged in 47 embryos.

Embodiment 12:RFLP targeted integration is in the genomic mMdr1a of mouse fetal target area.

Be expelled to for the donor plasmid (homology arm with 800bp) of NotI being introduced to mouse genome mMdr1a district the mice embryonic that there is as mentioned above ZFN mRNA.12.5dpc grow in better fetus and have one to be positive for the NotI site for four that locate.All four deciduas are all negative.(Figure 11).

Embodiment 13:GFP targeted integration is to fetus mMdr1a locus.

Be expelled to for the donor plasmid (homology arm with 800bp) of the GFP box being introduced to mouse genome mMdr1a district the mice embryonic that there is as mentioned above ZFN mRNA.In 40 fetuses, have two at the 12.5dpc place for GFP box be positive (Figure 12).

Embodiment 14:RFLP targeted integration is in the genomic PXR of rat fetal target area.

Be expelled to for the donor plasmid (thering is the same source arm of 800bp) of NotI being introduced to rat gene group PXR district the mice embryonic that there is as mentioned above ZFN mRNA.In eight fetuses, have one at the 13dpc place for NotI site be positive (Figure 13).

Embodiment 15: the genome editor of SMAD4 in the cat cell

Use the ZFN of being combined with people SMAD4 chromosome sequence to test the genome editor of Zinc finger nuclease (ZFN) mediation in the cat cell, this is because the DNA binding site in cat and people is identical.SMAD4ZFN is provided in table 5 aminoacid sequence and the corresponding DNA binding site of (19160/19159).That uses known Protocols in Molecular Biology to produce coding SMAD4ZFN (19160/19159) adds cap, polyadenylation mRNA.MRNA is transfected in people K562, cat AKD (lung) and cat CRFK (kidney) cell.MRNA injection compared with control cells with coding GFP.

Table 5.SMAD4 ZFN

Test to measure the frequency of the double-stranded rhexis that ZFN induces with the Cel-1 nuclease.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool of processing from ZFN produces the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.As shown in figure 14, the SMAD4 locus in SMAD4ZFN (19160/19159) cracking people and cat cell.

Embodiment 16: the genome editor of the SMAD4 in the cat embryo

Application standard program results cat embryo and use with the Science such as Geurts (2009) 325:433 all be incorporated herein by reference in the technology described similar technology roughly, with the SMAD4ZFN (19160/19159) that encodes add cap, polyadenylation mRNA injects.During microinjection, the embryo of cat is in 2-4 cell stage.With 0.1mM EDTA injection contrast embryo.Test to estimate cutting frequency with the Cel-1 described in embodiment 15.As illustrated in fig. 15, cutting efficiency is estimated as about 6-9%.

Table 6 provides the growth of embryo after microinjection.Approximately the fetal development of 19% (3/16) injection small volume SMAD4ZFN mRNA is to the blastocyst stage, and the contrast fetal development of 50% (8/16) injection EDTA is to the blastocyst stage.

Table 6 fetal development

Embodiment 17: the genome editor of Fel d1 in the cat cell

ZFN is the not same district (above-mentioned referring to (2009) such as Geurts) with the Fel d1 chromosome sequence of target cat through design.The chain 1-exons 1 of ZFN target Fel d1, chain 1-exon 2 or chain 2-exon 2.The aminoacid sequence of each ZFN and DNA binding site are shown in Table 7.

Table 7 Fel d1 ZFN

Fel d1 ZFN (17/18) with the exons 1 of coding target chain 1; The mRNA of the Fel d1ZFN (12/13) of the Fel d1 ZFN (7/9) of the exon 2 of target mark chain 1 or the exon 2 of target chain 2 carrys out transfection cat AKD cell.Test to assess the cutting efficiency of ZFN mediation with Cel-1 as above.The cutting efficiency that 17/18Fel d1 ZFN is right is estimated as approximately 17% (referring to Figure 16).7/9 Fel d1 ZFN is to about 16% efficiency cracking chain 1 exon 2 (referring to Figure 17).Figure 18 illustrate chain 2 exon 2s by 12/13 Fel d1 ZFN to cracking.

Embodiment 18: the genome editor of Fel d1 in the cat embryo

In order to promote the inactivation of Fel d1 locus, process the embryo of cat with two couples of Fel d1 ZFN.A pair of (17/18) target chain 1-exons 1, and another is to (12/13) target chain 2-exon 2.Because the genomic organization of Fel d1 locus, the coding region of chain 2 (transcribing from the D score chain) be positioned at chain 1 (from " and " chain transcribes) the about 4000bp of upstream of coding region.Therefore, infer that editor's event of two different positionss can mediate the larger disappearance of Fel d1 locus.Basically as described in above embodiment 16, rightly with coding ZFN add cap, polyadenylation mRNA injects jointly by the cat embryo.Table 8 provides the growth of embryo after microinjection.Compare with those embryos with the low concentration injection, with the embryo of higher concentration Fel d1 ZFN injection, there is higher surviving rate.

Table 8: fetal development.

At the 8th day, results contrast and experiment embryo were to be analyzed.The contrast blastocyst comprises an about 150-300 cell, and the experiment blastocyst comprises an about 70-100 cell, and the experiment morula comprises an about 16-30 cell.The single embryo's of Application standard Program extraction DNA, and stand Cel-1 and analyze (referring to Figure 19 ).Swimming lane 1,3 and 7 sample show expection Cel-1 digestion product.Sequential analysis shows, the extra band in other swimming lane (comprising the contrast swimming lane, 6) is due near SNP.

In order further to analyze editor's Fel d1 locus, pcr amplification the order-checking of Application standard method are carried out in target area.The sequential analysis confirmation, sample #5 has the disappearance (Figure 20) of 4541bp between the coding region of chain 2 and chain 1.Especially the binding site of ZFN 13 is by brachymemma 2BP, and ZFN 12 in conjunction with the disappearance of the downstream sequence together with other.Surprisingly, the binding site of 17/18 pair is intact, shows that disappearance produces (referring to Figure 21) by 12/13ZFN to cracking.

Embodiment 19: the genome editor of Cauxin in the cat cell

The ZFN in target Cauxin locus district, to through design, and tests as described in detail above in the cat cell.The aminoacid sequence that table 9 provides zinc to refer to spiral and the DNA binding site of each active ZFN.

Table 9 Cauxi ZFN

Figure 22 provides the result of Cel-1 test, and wherein 1/2 couple, 9/10 couple and 17/18ZFN are proved cracking Cauxi locus.Figure 23 illustrates that 29/30ZFN is to cracking Cauxi locus.

Embodiment 20: the genome editor of Agouti in the model animals cell

Can use the ZFN of being combined with the chromosome sequence of the hair color genes involved of sheep cell, test the genome editor of Zinc finger nuclease (ZFN) mediation in the cell of model animals (as sheep), described gene such as MSH receptor protein, tyrosine oxidase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signal protein (ASIP), melanocyte avidin (MLPH).Specific hair color-genes involved to be edited can be the gene with DNA binding site identical with the DNA binding site of the corresponding sheep homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in the sheep cell.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency of the double-stranded rhexis that ZFN induces.The test of this method detects the allelotrope of the target locus that departs from wild-type (WT) that the incomplete reparation by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break causes.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification in the target zone of the cell pool processed from ZFN.This mixture unwind and again annealing unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use the selected hair color genes involved seat of ZFN cracking sheep cell.

Embodiment 21: the genome editor of Agouti in the model animals embryo

The embryo of usable criterion program results model animalss (such as sheep), and use with embodiment 20 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, the sheep embryo can be in the 2-4 cell stage.With 0.1mM EDTA injection contrast embryo.The frequency of the double-stranded rhexis of testing with the Cel-1 described in embodiment 20 to estimate that ZFN induces.Estimate cutting efficiency by the Cel-1 test-results.

Can assess the growth of the embryo after microinjection.Can arrive the effect in blastocyst stage for embryo survival to determine ZFN mRNA with the embryo's comparison with the EDTA injection with the embryo of smaller size smaller ZFN mRNA injection.

Embodiment 22: the genome editor of FibH in the model animals cell

Can use the ZFN of being combined with the chromosome sequence of the silkworm fiber genes involved of silkworm cell, model animals (such as silkworm, silkworm) in cell, the genome editor of test Zinc finger nuclease (ZFN) mediation, described gene is as fibroin heavy chain (FibH), fibroin light chain (FibL), fibrohexamerin P25, sericin (Ser1), Cry toxoreceptor (BtR175), Cytochrome P450 (CYP4, CYP6, CYP9).Specific silky fibre genes involved to be edited can be the gene with DNA binding site identical with the DNA binding site of corresponding insect, such as the spider homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in silkworm (silkworm) cell.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency of inducing double-stranded rhexis of ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use cognitive genes involved seat selected in ZFN cracking silkworm (silkworm) cell.

Embodiment 23: the genome editor of FibH in the model animals embryo

The embryo of usable criterion program results model animals (such as silkworm, silkworm) ovum embryo, and use with embodiment 22 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, silkworm (silkworm) ovum embryo may be in the 2-4 cell stage.With 0.1mMEDTA injection contrast embryo.The frequency of the double-stranded rhexis of testing with the Cel-1 described in embodiment 22 to estimate that ZFN induces.Useful CEl-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.Can be with embryo's comparison of injecting with EDTA to determine ZFN mRNA effect to the later stage for embryo survival with the embryo of smaller size smaller ZFN mRNA injection.

Embodiment 24:TUBA1B promotor

The following examples describe the expression of using tubulin promoter regulation and control heterologous protein in detail.The TUBA1B of coding tubulin α-1B is selected as the target chromosome sequence.Design a pair of Zinc finger nuclease (ZFN) with Zhong position, target TUBA1B coding region.About more out of Memory, refer to Science (2009) 325:433, its full content is incorporated herein by reference.Design a kind of ZFN with binding sequence 5 ' CTTCGCCTCCTAATC3 ' (SEQ ID NO:86), and design another kind of ZFN with binding sequence 5 ' CACTATGGTGAGTAA3 ' (SEQ ID NO:87) (Figure 24 A).In conjunction with after, ZFN is to introducing double-strand break in the sequence 5 ' CCTAGC3 ' between two ZFN recognition sequences.Use known Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.

The sequence (seeing Figure 24 B) that target gene (that is, SH2 biosensor) comprises the coding GFP be connected with a 2A peptide territory with two SH2 territories.Construction plasmid (Figure 25) using as by SH2 biosensor sequence targeted integration to the donor nuclei thuja acid in human cell line's TUBA1B locus.Described plasmid comprise SH2 biosensor encoding sequence with and both sides be positioned at 1Kb and the 700bp TUBA1B locus sequence to the cleavage site upstream and downstream introduced by ZFN.Plasmid through design so that SH2 biosensor encoding sequence with the endogenous sequence that just in time is positioned at tubulin initiator codon downstream, with frame, integrate.After activating the TUBA1B locus, produce two kinds of independent protein, as Figure 24 B is described.

The paired rna of donor plasmid and coding ZFN is transfected in U2OS, A549, K562, HEK293 or HEK293T cell.Nucleic acid mixture comprises a part of donor dna and a part of ZFN RNA.Then cultivate the cell through transfection under standard conditions.The analysis of indivedual cell clones shows GFP fluorescence, shows to have expressed the allos biosensor.Western analyzes confirmation, and the expression of alpha-tubulin is not incorporated to by target affects (Figure 24 C).

The biosensor that the another kind of donor plasmid of construction contains Grb2 with the permission insertion (that is, GFP-2xSH2-Grb2-2A).The sensor that contains Grb2 is activated by EGF, and the transposition of experience core.With nucleic acid transfection A549 cell, and cultivate to allow integration and the expression of TUBA1B locus.Cell is exposed to EGF the imaging of 100ng/ml.Figure 26 provides the time course of SH2 sensor transposition.

Embodiment 25:ACTB promotor

The design the following examples are used stronger promotor with test.Well-known strong promoter is in the ACTB locus of coding beta-actin.Design a pair of ZFN with target ACTB locus.Design a kind of ZFN with binding sequence 5 ' GTCGTCGACAACGGCTCC3 ' (SEQ ID NO:88), and design another kind of ZFN with binding sequence 5 ' TGCAAGGCCGGCTTCGCGG3 ' (SEQ ID NO:89).In conjunction with after, ZFN is to introducing double-strand break in the sequence 5 ' GGCATG3 ' between two ZFN recognition sequences.

The design donor plasmid to be so that SH2 biosensor sequence to be provided, and to the beta-actin (being GFP-2x-SH2-2-RFP) that endogenous produces tag (Figure 27).Nucleic acid is introduced to cell, and produce two kinds of fluorescins (that is, GFP biosensor and RFP mark Actin muscle).Monitor the fluorescence of every kind of protein with fluorescent microscope.

In order to monitor better different fluorescins, another donor plasmid of construction is to contain the biosensor that comprises Grb2.Therefore, donor plasmid comprises: GFP-2xSH2-Grb2-2A-RFP.With nucleic acid transfection A549 cell, and cultivate to allow integration and the expression of ACTB locus.Cell is exposed to EGF the imaging of 100ng/ml.Figure 28 provides the time course of GFP-Grb2 biosensor transposition and the position of RFP-Actin muscle.The amount of institute's generation sensor is so high so that exist in a large number not in conjunction with or " dissociating " biosensor, thereby significantly increase the background fluorescence amount.

Embodiment 26:LMNB1 promotor

LMNB1 locus for target coding lamin B 1 albumen, prepare another to ZFN.Design a kind of ZFN with binding sequence 5 ' CCTCGCCGCCCCGCT3 ' (SEQ ID NO:90), and design another kind of ZFN with binding sequence 5 ' GCCGCCCGCCATGGCG3 ' (SEQ ID NO:91).In conjunction with after, ZFN is to introducing double-strand break in the sequence 5 ' GTCTCC3 ' between two recognition sequences.

Can build the sequence of donor plasmid to comprise the encoding human sensor protein, described sequence is positioned at the both sides of the LMNB1 sequence of ZFN cracking site upstream and downstream.Nucleic acid and the donor plasmid of coding ZFN can be incorporated in cell, and can monitor as described in detail above cell.

Embodiment 27: the evaluation of the ZFN of editor LRRK2 locus

LRRK2 gene in selected rat is for the genome editor of Zinc finger nuclease (ZFN) mediation.Design, assemble and verify ZFN (seeing the Science such as Geurts (2009) 325:433) with foregoing strategy and program.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning LRRK2 gene regions (XM_235581) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

That with oneself, knows that Protocols in Molecular Biology produces the every a pair of ZFN of coding adds cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by test to detect the double-stranded rhexis that ZFN induces with the Cel-1 nuclease.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test show ZFN to target in conjunction with 5 '-tgGGTCATGAAGTGGGGGTGagtgctgt-3 ' (SEQ ID NO:94; The contact site means with capitalization) and 5 '-gaGCCCTGTACCTGGCTGTCtacgacct-3 ' (SEQ ID NO:95), its in the LRRK2 locus through cracking.

Embodiment 28: the LRRK2 locus in editor's rat embryo

The Application standard program will encode active ZFN right add cap, polyadenylation mRNA microinjection to (such as above-mentioned referring to (2009) such as Geurts) in the rat embryo of fertilization.To carry out incubated in vitro through the embryo of injection, or transfer to the false pregnancy female rats until childbirth.By the embryo/fetus of gained, or the toe of results birth alive animal/cauda section is also to analyze for DNA extraction.Application standard program DNA isolation.Use the target area of suitable primer pair LRRK2 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 29 illustrates the LRRK2 locus through editor in two source kind animals.An animal has the 10bp disappearance in the target sequence of exon 30, and second animal has the 8bp disappearance in the target sequence of exon 30.These disappearances upset the reading frame of LRRK2 coding region.

Embodiment 29: the evaluation of the ZFN of editor SNCA locus

Supposition zinc by scanning rat SNCA locus (NM_019169) refers to that binding site design can edit the ZFN of SNCA (alpha-synapse nucleoprotein) locus.Basically as Integration Assembly And Checkout ZFN as described in embodiment 27.This analyzes demonstration, ZFN to target in conjunction with 5 '-agTCAGCACAGGCATGTccatgttgagt-3 ' (SEQ ID NO:96) and 5 '-ccTCTGGGGTAGTGAACAGGtctcccac-3 ' (SEQ ID NO:97), its cracking in the SNCA gene.

Embodiment 30: the evaluation of the ZFN of editor DJ-1 locus

Identify as mentioned above the ZFN of the activity had at the DJ-1 locus.That is to say, the zinc of supposition of scanning rat DJ-1 gene (NM_019169) refers to binding site, and basically as Integration Assembly And Checkout ZFN described in embodiment 27.It is found that ZFN to target in conjunction with 5 '-aaGCCGACTAGAGAGAGaacccaaacgc-3 ' (SEQ ID NO:98) and 5 '-gtGAAGGAGATcCTCAAGgagcaggaga-3 ' (SEQ ID NO:99), its editor's DJ-1 locus.

Embodiment 31: the evaluation of the ZFN of editor Parkin protein gene seat

In order to identify the ZFN of target cracking Parkin protein gene seat, the supposition zinc of scanning P of Rats arkin protein gene (NM_020093) refers to binding site.Basically as Integration Assembly And Checkout ZFN couple as described in embodiment 27.This analyzes demonstration, ZFN to target in conjunction with 5 '-gaACTCGGaGTTTCCCAGgctggacctt-3 ' (SEQ ID NO:100) and 5 '-gtGCGGCACCTGCAGACaagcaaccctc-3 ' (SEQ ID NO:101), its cracking in the Parkin protein gene.

Embodiment 32: the evaluation of the ZFN of editor PINK1 locus

Basically identify as mentioned above the ZFN of the activity had at the PINK1 locus.The supposition zinc of scanning P of Rats INK1 gene (NM_020093) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 27.This analyzes demonstration, ZFN is to target in conjunction with 5 '-ggGTAGTAGTGTGGGGGtagcatgtcag-3 ' (SEQ ID NO:102) and 5 '-aaGGCCTGgGCCACGGCCGCAcactctt-3 ' (SEQ ID NO:103), and it edits PINK1 gene.

Following table provides the aminoacid sequence of the spiral of active ZFN.

The genome editor of embodiment 33:ApoE locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rabbit ApoE locus.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module that can scan rabbit ApoE gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rabbit cell.The mRNA injection compared with control cells of available code GFP.Can carry out identified activity ZFN couple by test to detect the double-stranded rhexis that ZFN induces with the Cel-1 nuclease.This test can detect by the non-homologous end joining of ZFN inducing DNA double-strand break (NHEJ) mediation and not exclusively repair the allelotrope of the target gene seat that departs from wild-type caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation can carry out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This detection can be identified a pair of active ZFN of editor ApoE locus.

In order to mediate the editor of ApoE locus in animal, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the unicellular embryo of the rabbit that is fertilized.By the embryo's incubated in vitro through injecting, or transfer to the female rabbit of false pregnancy until childbirth.Embryo/the fetus of gained, maybe can gather in the crops the toe of the birth animal that lives/cauda section with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target district of suitable primer pair ApoE locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

Embodiment 34: FAH genome editor in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in rabbit or human disease-relevant chromosome sequence, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding fumarylacetoacetate hydrolase (FAH) in the cell of described animal.This type of model animal can be rabbit.Usually, can be used for introducing disappearance or insertion so that the upset of the coding region of FAH gene in conjunction with coding and the ZFN of the rabbit chromosome sequence of the relevant fumarylacetoacetate hydrolase of rabbit immune deficiency, so that can not produce functional FAH albumen.

Basically as above embodiment 33 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.Fumarylacetoacetate hydrolase be can in genetic modification rabbit or its filial generation, assess and the immune deficiency symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that FAH " knocks out ", carry out the analysis of molecules of immune deficiency-relational approach.

Embodiment 35: express the generation of the humanization rabbit of mutant human cTnl

Familial hypertrophic cardiomyopathy (FHC) shows hereditary autosomal dominant form and different inherited pathogenic factor.FHC or phenocopy can be caused by the various mutations of the gene of coding various contractions, structure, passage and kinase protein.Usually, irregular pulse, especially the ventricular tachycardia relevant to FHC and fibrillation will cause sudden death.The single base of cTnl locus changes the change that causes disease-associated protein (cardiac troponin).ZFN-mediated gene group editor can be used for producing the humanization rabbit, and wherein rabbit cTnl locus replaces with the mutant form of the people cTnl locus that comprises one or more sudden changes.This type of humanization rabbit can be used for the advancing of disease that research is relevant to people FHC.In addition, the humanization rabbit can be used for being evaluated at the approach of the FHC that causes comprising cTnl by the effect of the potential healing potion of target.

Use the method described in above embodiment, can produce the genetic modification rabbit.Yet, in order to produce the humanization rabbit, the human chromosome sequence of ZFN mRNA and encoding mutant type cardiac troponin can be co-injected in rabbit embryonic.Then, the rabbit chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rabbit of the cardiac troponin of expressing mutant form.

Embodiment 36: the genome editor of PRPN in the model animals cell

Can use with the ZFN of chromosome sequence (such as the PRPN) combination of the prion protein gene of ox cell and test Zinc finger nuclease (ZFN)-mediated gene group editor in the cell of model animals (such as ox).Specific gene to be edited can be the gene with DNA binding site identical with the DNA binding site of the corresponding ox homologue of described gene.End-blocking, the polyadenylation mRNA of coding ZFN can be used known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content is similar technology roughly) to produce.MRNA can be transfected in the ox cell.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use the selected PRPN locus of ZFN cracking ox cell.

Embodiment 37: the genome editor of PRPN in the model animals embryo

The embryo of the model animals (such as ox) of usable criterion program results, and use with embodiment 36 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, the ox embryo can be in the unicellular stage.Available 0.1mM EDTA injection contrast embryo.Cel-1 described in useful embodiment 36 tests to estimate that ZFN induces the frequency of double-stranded rhexis.Useful Cel-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.Can arrive the effect in blastocyst stage for embryo survival to determine ZFN mRNA with the embryo's comparison with the EDTA injection with the embryo of smaller size smaller ZFN mRNA injection.

Embodiment 38: the evaluation of the ZFN of editor ApoE locus

Selected ApoE gene is for the genome editor of Zinc finger nuclease (ZFN) mediation.Use foregoing strategy and program (seeing the Science such as Geurts (2009) 325:433) to design, assemble and verify ZFN.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat ApoE gene regions (NM_138828) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

That with oneself, knows that Protocols in Molecular Biology produces the every a pair of ZFN of coding adds cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test show ZFN to target in conjunction with 5 ' aaGCGGTTCAGGGCCTGctcccagggtt-3 ' (SEQ ID NO:117; The contact site means with capitalization) and 5 ' ggGATTACCTGcGCTGGGtgcagacgct-3 ' (SEQ ID NO:118), its cracking in the ApoE locus.

Embodiment 39: the ApoE locus in editor's rat embryo

The Application standard program will encode active ZFN right add cap, polyadenylation mRNA microinjection to (such as above-mentioned referring to (2009) such as Geurts) in the rat embryo of fertilization.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair ApoE locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 30 provides two ApoE locus through editor.An animal has the 16bp disappearance in the target sequence of exon 2, and second animal has the 1bp disappearance in the target sequence of exon 2.These disappearances upset the reading frame of ApoE coding region.

Embodiment 40: the evaluation of the ZFN of editor's leptin gene seat

Basically identify as mentioned above the ZFN of target cracking rat leptin gene.The supposition zinc of scanning rat leptin gene (NM_013076) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 38.This detection display ZFN to target in conjunction with 5 '-gtGGATAGGCACAGcttgaacataggac-3 ' (SEQ ID NO:119; The contact site means with capitalization) and 5 ' aaGTCCAGGATGACACCaaaaccctcat-3 ' (SEQ ID NO:120), its cracking in the leptin gene seat.

Embodiment 41: the leptin gene seat in editor's rat embryo

Basically as described in embodiment 39, with the right mRNA microinjection rat embryo of the active leptin ZFN of coding.Embryonal vaccination is through hatching, and extracts DNA from the animal of gained.Use the target area of suitable primer pair leptin gene seat to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 31 provides the leptin gene seat through editor, wherein from the district of 5 ' end disappearance 151bp of 3 ' end of exons 1 and introne 1.

Embodiment 42: the Pten locus in editor's rat embryo

Basically as described in above embodiment 38, the ZFN of design target and cracking P of Rats ten locus also tests its activity.Identified activity ZFN couple.The DNA binding site is 5 '-CCCCAGTTTGTGGTCtgcca-3 ' SEQ ID NO:121) and 5 '-gcTAAAGGTGAAGATCTA-3 ' (SEQ ID NO:122).Can right add cap, polyadenylation mRNA microinjection to rat embryo by coding is active, and can analyze as described in Example 39 the embryo of gained.Therefore, can edit the Pten locus to contain disappearance or to insert, so that coding region is upset and do not produce the functioning gene product.

Embodiment 43: the genome editor of the Canca1C in the model animals cell

Can use the ZFN with chromosome sequence (such as Canca1C, Sod1, Pten, Ppar (α) and the combination thereof) combination of the cardiovascular genes involved of rat cell, test Zinc finger nuclease (ZFN)-mediated gene group editor in the cell of model animals (such as rat).The to be edited specific chromosome sequence that relates to cardiovascular disorder can be the gene with DNA binding site identical with the DNA binding site of the corresponding human homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (include but not limited to the Science all be incorporated herein by reference (2009) 325:433 in the technology described similar technology roughly) to produce.MRNA can be transfected in rat cell and people K562 cell, suppose that the K562 cell has identical DNA binding site.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use the selected cognitive genes involved seat of ZFN cracking people and rat cell.

Embodiment 44: the genome editor of the Canca1C in the model animals embryo

The embryo of usable criterion program results model animalss (such as rat), and use with embodiment 43 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, rat embryo can be in the unicellular stage.Available 0.1mM EDTA injection contrast embryo.Cel-1 described in useful embodiment 43 tests to estimate that ZFN induces the frequency of double-stranded rhexis.Useful Cel-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.Can arrive the effect in blastocyst stage for embryo survival to determine ZFN mRNA with the embryo's comparison with the EDTA injection with the embryonal vaccination of smaller size smaller ZFN mRNA.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Embodiment 45: the genome editor of myostatin/GDF8, CD163 or sialic acid attachment proteins in the model animals cell

Can use the ZF of being combined with the chromosome sequence of the hair color genes involved of pig cell, the genome editor of N test Zinc finger nuclease (ZFN) mediation in the cell of model animals (as pig), described gene such as MC1R, MSH receptor protein, tyrosine oxidase (TYR), tyrosinase-related protein 1 (TYRP1), agouti signal protein (ASIP), melanocyte avidin (MLPH).Specific hair color-genes involved to be edited can be the gene with DNA binding site identical with the DNA binding site of the corresponding pig homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (include but not limited to the Science all be incorporated herein by reference (2009) 325:433 in the technology described similar technology roughly) to produce.MRNA can be transfected in pig cell.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use selected myostatin/GDF8, CD163 or the sialic acid attachment proteins locus of ZFN cracking pig cell.

Embodiment 46: the genome editor of HAL, RN, ESR, IGF2, GHRH, H-FABP, GH, IGF1, PIT1, GHRHR or GHR in the model animals embryo

The embryo of usable criterion program results model animalss (such as pig), and use with embodiment 45 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, the pig embryo can be in the 2-4 cell stage.With 0.1mM EDTA injection contrast embryo.Test to estimate that with the Cel-1 described in embodiment 45 ZFN induces the frequency of double-stranded rhexis.Useful Cel-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.Can arrive the effect in blastocyst stage for embryo survival to determine ZFN mRNA with the embryo's comparison with the EDTA injection with the embryo of smaller size smaller ZFN mRNA injection.

The genome editor of embodiment 47:Can f1 locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking dog Can f 1 locus.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that merges to produce a pair of 4,5 or 6 finger proteins with existing module of scanning dog Can f1 gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in canine cells.The mRNA injection compared with control cells of available code GFP.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test can detect by the non-homologous end joining of ZFN inducing DNA double-strand break (NHEJ) mediation and not exclusively repair the allelotrope of the target gene seat that departs from wild-type caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation can carry out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test can be identified a pair of active ZFN of editor Can f 1 locus.

In order to mediate the editor of animal Can f 1 locus, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (1) such as Geurts) the active ZFN that will encode is to the dog embryo that is fertilized.By the embryo's incubated in vitro through injecting, or transfer to the female dog of false pregnancy until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target area of suitable primer pair Can f 1 locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

Embodiment 48: HCRTR2 genome editor in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in dog or human disease-relevant chromosome sequence, and described sequence such as genetic modification model animal hangs down with the coding in the cell that derives from described animal the chromosome sequence of secreting protein receptor albumen.This type of model animal may be dog.Usually, can be used for introducing disappearance or insertion so that the upset of the coding region of HCRTR2 gene is secreted protein receptor albumen so that can not produce functional hanging down in conjunction with the coding low ZFN that secretes the dog chromosome sequence of protein receptor relevant to the dog narcolepsy.

Basically as above embodiment 47 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.Can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease as described in detail above.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.The low protein receptor of secreting be can in genetic modification dog or its filial generation, assess and the hypnolepsy symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that HCRTR2 " knocks out ", carry out the analysis of molecules of narcolepsy-relational approach.

Embodiment 49: produce the humanization dog of expressing mutant human BHD

BHD has people's multisystem illness of strong similarity with RCND (abiogenous heredity dog carcinoma syndrome).Genome relatively in, RCND locus and people BHD locus are overlapping.The single base of RCND locus changes the change that causes disease-associated protein folliculin.ZFN-mediated gene group editor can be used for producing the humanization dog, and wherein dog RCND locus replaces with the mutant form of the people BHD locus that comprises one or more sudden changes.This type of humanization dog can be used for the advancing of disease that research is relevant to mutant human FHC albumen.In addition, the humanization dog can be used for assessing the effect of potential healing potion that target causes the approach of the kidney that comprises BHD.

Use the method described in above embodiment can produce the genetic modification dog.Yet, in order to produce the humanization dog, ZFN mRNA can be expelled in the dog embryo jointly with the human chromosome sequence of encoding mutant type BHD albumen.Then, the dog chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization dog of the BHD albumen of expressing mutant form.

For example 50: the genome editor of habituation associated protein in the model animals cell

Can use the ZFN of being combined with the chromosome sequence of the habituation genes involved of rat cell, test the genome editor of Zinc finger nuclease (ZFN) mediation in the cell of model animals (as rat), described gene such as ABAT (4-Aminobutanoicacid transaminase), DRD2 (Dopamine Receptors D2), DRD3 (Dopamine Receptors D3), DRD4 (Dopamine Receptors D4), GRIA1 (glutamate receptor, ionic, AMPA 1), GRIA2 (glutamate receptor, ionic, AMPA 2), GRIN1 (glutamate receptor, ionic, N-methyl D-Asp 1), GRIN2A (glutamate receptor, ionic, N-methyl D-Asp 2A), GRM5 (metabotropic glutamate receptor 5), HTR1B (serotonin (thrombotonin) acceptor 1B), PDYN (dynorphin) or PRKCE (protein kinase C, ε).Specific habituation genes involved to be edited can be the gene with DNA binding site identical with the DNA binding site of the corresponding human homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in rat cell and people K562 cell, suppose that the K562 cell has identical DNA binding site.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use the selected habituation genes involved seat of ZFN cracking people and rat cell.

For example 51: the genome editor of habituation associated protein in the model animals embryo

The embryo of usable criterion program results model animalss (such as rat), and use with embodiment 50 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, rat embryo can be in the unicellular stage.With 0.1mM EDTA injection contrast embryo.Test to estimate that with the Cel-1 described in embodiment 50 ZFN induces the frequency of double-stranded rhexis.Useful Cel-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.Can arrive the effect in blastocyst stage for embryo survival to determine ZFN mRNA with the embryo's comparison with the EDTA injection with the embryo of smaller size smaller ZFN mRNA injection.

The genome editor of embodiment 52:APP locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat app gene seat.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that merges to produce a pair of 4,5 or 6 finger proteins with existing module in scanning rat app gene district refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Know with oneself that Protocols in Molecular Biology produces to be encoded into ZFN added to cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The a pair of active ZFN of this test for identification editor app gene seat.Zinc refers to that binding site is 5 '-GCCAGCACCCCTGACgcag ' 3-(SEQ ID NO:129) and 5 '-tcGACAAGTACCTGGAG ' 3 ' (SEQ ID NO:130).

In order to mediate the editor of app gene seat in animal, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained or the toe of Live Animals/cauda section with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair app gene seat to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 32 provides the app gene seat through editor in two source kind animals; One has 292bp disappearance (Figure 32 A) in exon 9, and another has 309bp disappearance (Figure 32 B) in exon 9.

For example 53: the genome editor of cognitive genes involved in the model animals cell

Use is in conjunction with the ZFN of the chromosome sequence of cognitive genes involved, the genome editor of test ZFN-mediation in the cell of model animals (such as rat), described cognitive genes involved such as ANK3 (Ankryn 3), APP (amyloid precursor protein), B2M (beta-2 microglobulin), BRD1 (containing calm territory 1), FMR1 (fragile X mental retardation 1), MECP2 (methyl CpG is in conjunction with albumen 2), NGFR (trk C), NLGN3 (the neural albumen 3 that connects) or NRXN1 (neuronin 1).Can be basically as ZFN that embodiment 52 is described to design and test.Can use the ZFN of target specific knowledge-genes involved to introduce disappearance or insertion so that the coding region inactivation of target gene.

For example 54: the genome editor of cognitive genes involved in model animals

But the embryo of Application standard program results model animalss (such as rat), and as above embodiment 52 in describe in detail, the ZFN of the cognitive genes involved of injection coding target adds cap, polyadenylation mRNA.Comprise for donor or the exchange polynucleotide of the sequence of integrating or exchanging and can jointly inject with ZFN.Can analyze as mentioned above in the animal of gained the chromosomal region through editor.But the variation of the aspects such as the behavior of the modified animal of phenotype analytical, study.In addition, genetically modified animal can be used for assessing the effect that potential therapeutical agent is used for the treatment of cognitive associated conditions.

Embodiment 55: the genome editor of CCR2 in model animals

The genome editor of Zinc finger nuclease (ZFN) mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of inflammation, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding CCR2 albumen in the cell of described animal.This type of model animal may be rat.Usually, can use ZFN in conjunction with the rat chromosome sequence of coding inflammation associated protein CCR2 nonsense mutation is introduced to the coding region of CCR2 gene, so that can not produce active CCR2 albumen.

Adding cap, polyadenylation mRNA can use known Protocols in Molecular Biology (technology of describing in Science (0470) 2009:325 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in rat embryo.During microinjection, rat embryo can be in the unicellular stage.Available 0.1mM EDTA injection contrast embryo.Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

Can in the genetic modification rat, assess the growth of embryo after microinjection, and CCR2 " knocks out " the inflammation related symptoms that causes and the development of illness.For CCR2, the symptom relevant to inflammation and illness can comprise the development of rheumatoid arthritis and the inflammatory reaction to tumour of change.Result can compare with the control rats with 0.1mm EDTA injection, and the chromosomal region of the CCR2 albumen of wherein encoding does not change.In addition, can in deriving from the cell that comprises the genetically modified animal that CCR2 " knocks out ", carry out the analysis of molecules of inflammation relational approach.

Embodiment 56: express the generation of the humanization rat of mutant human perforin-1

The missense mutation of perforin-1 (the crucial effector of lymphocytic cytotoxic effect) causes a series of diseases, comprises that familial Hemophagocytic lymphohistocysis disease increases to swollen neoplastic risk.The α-amino-isovaleric acid amino acid of the position 50 that a kind of this type of sudden change is perforin-1 is replaced by the V50M missense mutation of methionine(Met).Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein P of Rats RF1 gene is replaced by the mutant human PRF1 gene that comprises the V50M sudden change.This type of humanization rat can be used for the advancing of disease that research is relevant to mutant human perforin-1.In addition, the humanization rat can be used for assessing the effect of the potential therapeutical agent of the pathways of inflammation that target comprises perforin-1.

Use the method described in above embodiment 55, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type perforin-1 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of perforin-1 albumen of expressing mutant form.

Embodiment 57: editor Pten locus

Basically as described in above embodiment 55, the ZFN of design target and cracking P of Rats ten locus also tests its activity.Identified activity ZFN couple.The DNA binding site is 5 '-CCCCAGTTTGTGGTCtgcca-3 ' (SEQ ID NO:135) and 5 '-gcTAAAGGTGAAGATCTA-3 ' (SEQ ID NO:136).But what the coding activity was right adds cap, polyadenylation mRNA microinjection to rat embryo, and can be as the embryo of gained that embodiment 55 is described to analyze.Therefore, can edit the Pten locus to contain disappearance or to insert, so that coding region is upset and do not produce the functioning gene product.

Embodiment 58: the evaluation of the ZFN of editor Rag1 locus

Selected Rag1 gene is for the genome editor of Zinc finger nuclease (ZFN) mediation.Design, assemble and verify ZFN with the strategy of describing in above embodiment and program.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat Rag1 gene regions (XM_001079242) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.Produce adding cap, polyadenylation mRNA and being transfected in rat cell of every couple of ZFN of coding.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test show ZFN to target in conjunction with 5 '-ttCCTTGGGCAGTAGACctgactgtgag-3 ' (SEQ ID NO:137; The contact site means with capitalization) and 5 '-gtGACCGTGGAGTGGCAcccccacacac-3 ' (SEQ ID NO:138), its cracking in the Rag1 gene.

Embodiment 59: editor Rag1 locus

As above embodiment is described, the active ZFN of coding is right add cap, polyadenylation mRNA microinjection in the fertilization rat embryo.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Embryo/the fetus of results gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair Rag1 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 33 provides the DNA sequence dna (SEQ ID NO:131 and 132) through editor Rag1 locus in two animals.An animal has the 808bp disappearance in exon 2, and second animal has the 29bp disappearance in the target sequence of exon 2.These disappearances upset the reading frame of Rag1 coding region.

Embodiment 60: the evaluation of the ZFN of editor Rag2 locus

Basically identify as mentioned above the ZFN of target cracking Rag2 gene.The supposition zinc of scanning rat Rag2 gene (XM 001079235) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 55.This test show ZFN to target in conjunction with 5 '-acGTGGTATATaGCCGAGgaaaaagtgt-3 ' (SEQ ID NO:139; The contact site means with capitalization) and 5 '-atACCACGTCAATGGAAtggccatatct-' 3 ' (SEQ ID NO:140), its cracking in the Rag2 locus.

Embodiment 61: editor Rag2 locus

Basically as described in embodiment 56, with the right mRNA microinjection rat embryo of the active Rag2ZFN of coding.Hatch through embryonal vaccination, and extract DNA from the animal of gained.Use the target area of suitable primer pair Rag2 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 34 provides the DNA sequence dna through editor Rag2 locus in two animals.An animal has the 13bp disappearance in the target sequence of exon 3, and second animal has the 2bp disappearance in the target sequence of exon 3.These disappearances upset the reading frame of Rag2 coding region.

Embodiment 62: the evaluation of the ZFN of editor FoxN1 locus

Basically as identified the ZFN of target cracking FoxN1 gene as described in above embodiment 55.The supposition zinc of scanning rat FoxN1 gene (XM_220632) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 55.This test shows two pairs of active ZFN cracking in the FoxN1 locus: first pair of target is in conjunction with 5 '-ttAAGGGCCATGAAGATgaggatgctac-3 ' (SEQ ID NO:141; The contact site means with capitalization) and 5 '-caGCAAGACCGGAAGCCttccagtcagt-3 ' (SEQ ID NO:142); And second pair of target is in conjunction with 5 '-ttGTCGATTTTGGAAGGattgagggccc-3 ' (SEQ ID NO:143) and 5 '-atGCAGGAAGAGCTGCAgaagtggaaga-' 3 ' (SEQ ID NO:144).

Embodiment 63: the evaluation of the ZFN of editor DNAPK locus

Basically as identified the ZFN of target crack DNA PK gene as described in above embodiment 55.The supposition zinc of scanning rat DNAPK gene (NM_001108327) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 55.This test show ZFN to target in conjunction with 5 '-taCACAAGTCCtTCTCCAggagctagaa-3 ' (SEQ ID NO:145; The contact site means with capitalization) and 5 '-acAAAGCTTATGAAGGTcttagtgaaaa-' 3 ' (SEQ ID NO:146), its cracking in the DNAPK locus.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Embodiment 64: the genome editor of Oct 1 in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of AD, described sequence such as genetic modification model animal and derive from the chromosome sequence of coding Oct 1 albumen in the cell of described animal.This type of model animal may be rat.Usually, can be used for introducing disappearance or insertion so that the upset of the coding region of Oct 1 gene in conjunction with the ZFN of rat chromosome sequence of coding Oct 1 albumen relevant to AD, so that can not produce functional Oct 1 albumen.

Available code ZFN adds the suitable fertilization embryo that cap, polyadenylation mRNA microinjection may be in the unicellular stages.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.Can in genetic modification rat or its filial generation, assess by Oct 1 and " knock out " the AD symptom that causes and the development of illness.In addition, can in deriving from the cell that comprises the genetically modified animal that ErbB4 " knocks out ", carry out the analysis of molecules of AD relational approach.

Embodiment 65: express the generation of the humanization rat that relates to ADME and toxicologic people's gene of mutant form

In the generation of the humanization rat of expressing the mutant form gene, can use the sudden change that relates to ADME and toxicologic any chromosome sequence.Gene can be Oct 1, Oct 2, Hfe2, Ppar (α) and combination thereof.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein rat gene replaces with the mutant human gene that comprises sudden change.This humanization rat can be used for the advancing of disease that research is relevant to the mutant human albumen of target gene coding.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the AD that comprises target gene.

Use the method described in above embodiment, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing mutein.

Embodiment 66: the evaluation of the ZFN of editor Mdr1a locus

Selected Mdr1a gene is for the genome editor of Zinc finger nuclease (ZFN) mediation.Use foregoing strategy and program (seeing the Science such as Geurts (2009) 325:433) to design, assemble and verify ZFN.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat Mdr1a gene regions (NM_133401) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

That with oneself, knows that Protocols in Molecular Biology produces the every a pair of ZFN of coding adds cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test show ZFN to target in conjunction with 5 '-acAGGGCTGATGGCcaaaatcacaagag-3 ' (SEQ ID NO:164; The contact site means with capitalization) and 5 '-ttGGACTGTCAGCTGGTatttgggcaaa-' 3 ' SEQ ID NO:165), its cracking in the Mdr1a locus.

Embodiment 67: editor Mdr1a locus

The Application standard program will encode active ZFN right add cap, polyadenylation mRNA microinjection to (such as above-mentioned referring to (2009) such as Geurts) in the rat embryo of fertilization.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section results are with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair Mdr1a locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 35 provides the DNA sequence dna through editor Mdr1a locus in two animals.An animal has the 20bp disappearance in the target sequence of exon 7, and second animal has 15bp disappearance and 3bp insertion in the target sequence of exon 7.Locus through editor has phase shift mutation and a plurality of translation stop codon.

Carry out the Western analysis to confirm that Mdr1a locus inactivation is not so that produce Mdr1a albumen.The PC that knocks out rat from Mdr1a prepares cell lysates.Prepare the compared with control cells lysate from people's neuroblastoma clone.As shown in figure 36, in Mdr1a (/-) animal, Mdr1a albumen do not detected, show Mdr1a locus inactivation.

Embodiment 68: the evaluation of the ZFN of editor Mdr1b locus

Basically identify as mentioned above the ZFN of target cracking Mdr1b gene.The supposition zinc of scanning rat Mdr1b gene (NM_012623) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 64.This test show ZFN to target in conjunction with 5 '-agGAGGGGAAGCAGGGTtccgtggatga-3 ' (SEQ ID NO:166; The contact site means with capitalization) and 5 '-atGCTGGTGTTCGGatacatgacagata-3 ' (SEQ ID NO:167), its cracking in the Mdr1b locus.

Embodiment 69: the evaluation of the ZFN of editor Mrp1 locus

Basically as identified the ZFN of target cracking Mrp1 gene as described in above embodiment 64.The supposition zinc of scanning rat Mrp1 gene (NM_022281) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 64.This detection display ZFN to target in conjunction with 5 '-gaAGGGCCCAGGTTCTAagaaaaagcca-3 ' (SEQ ID NO:168; The contact site means with capitalization) and 5 '-tgCTGGCTGGGGTGGCTgttatgatcct-' 3 ' (SEQ ID NO:169), its cracking in the Mrp1 locus.

Embodiment 70: editor Mrp1 locus

Basically as described in embodiment 65, with the right mRNA microinjection rat embryo of the active Mrp1 ZFN of coding.Embryonal vaccination is through hatching, and extracts DNA from the animal of gained.Use the target area of suitable primer pair Mrp1 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 37 provides the DNA sequence dna through editor Mrp1 locus in two animals.An animal has the 43bp disappearance in exon 11, and second animal has the 14bp disappearance in exon 11.These disappearances upset the reading frame of Mrp1 coding region.

Embodiment 71: the evaluation of the ZFN of editor Mrp2 locus

Basically as identified the ZFN of target cracking Mrp2 gene as described in above embodiment 64.The supposition zinc of scanning rat Mrp2 gene (NM_012833) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 64.This test show ZFN to target in conjunction with 5 '-ttGCTGGTGACtGACCTTgttttaaacc-3 ' (SEQ ID NO:170; The contact site means with capitalization) and 5 '-ttGAGGCGGCCATGACAAAGgacctgCa-' 3 ' (SEQ ID NO:171), its cracking in the Mrp2 locus.

Embodiment 72: editor Mrp2 locus

Basically as described in embodiment 65, with the right mRNA microinjection rat embryo of the active Mrp2ZFN of coding.Embryonal vaccination is through hatching, and extracts DNA from the animal of gained.Use the target area of suitable primer pair Mrp2 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 38 provides the DNA sequence dna through editor Mrp2 locus, and wherein exon 7 lacks 726bp, thereby upsets the reading frame of Mrp2 coding region.

Embodiment 73: the evaluation of the ZFN of editor BCRP locus

Basically as identified the ZFN of target cracking BCRP gene as described in above embodiment 64.The supposition zinc of scanning rat BCRP gene (NM_181381) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 64.This test show ZFN to target in conjunction with 5 '-atGACGTCAAGGAAGAAgtctgcagggt-3 ' (SEQ ID NO:172; The contact site means with capitalization) and 5 '-acGGAGATTCTTCGGCTgtaatgttaaa-' 3 ' (SEQ ID NO:173), its cracking in the BCRP locus.

Embodiment 74: editor BCRP locus

Basically as described in embodiment 65, with the right mRNA microinjection rat embryo of the active BCRP ZFN of coding.Embryonal vaccination is through hatching, and extracts DNA from the animal of gained.Use the target area of suitable primer pair BCRP gene to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 39 provides the DNA sequence dna through editor BCRP locus in two source kind animals.An animal has the 588bp disappearance in exon 7, and second animal has the 696bp disappearance in exon 7.These disappearances upset the reading frame of BCRP coding region.

The upset of embodiment 75:Mdr1a

The external preparation of ZFN mRNA: from Sigma CompoZr production line, obtain the ZFN expression plasmid.Each plasmid is in the XbaI site linearizing of the 3 ' end that is positioned at FokI ORF.Use MessageMax T7 to add cap transcript reagent box and poly-(A) polysaccharase tailing test kit (Epicentre Biotechnology, Madison, WI) or mMessage Machine T7 test kit and poly-(A) tailing test kit (Ambion, Austin, TX) prepare 5 ' and add cap and 3 ' polyadenylic acid tailing messenger RNA(mRNA).5M NH4OAc precipitation twice by polyadenylic acid tailing reactant with equal volume, then be dissolved in injection damping fluid (1mM Tris-HCl, PH7.4,0.25mM EDTA).Use NanoDrop 2000 spectrometers (Thermo Scientific, Wilmington, DE) to estimate mRNA concentration.

ZFN checking in culturing cell: in brief, as ZFN, when target site produces the double-strand break of repairing by the non-homologous end joining approach, introduce disappearance or insert.The allelotrope of amplification wild-type and sudden change in identical PCR reaction.When the mixture sex change and while allowing it to anneal again, not pairing region around the allelotrope of wild-type and sudden change and cracking site forms two strands, it can be by strand specificity restriction endonuclease identification cracking, thereby produces except parent PCR product two than small molecules.The existence of cracking PCR band shows the activity of ZFN in transfectional cell.

Under 37 ℃, in the situation that 5%CO2 is arranged, cultivate NIH 3T3 cell in thering is 10%FBS and antibiotic DMEM.ZFN mRNA is matched with 1: 1 ratio, and be transfected in NIH 3T3 cell to use Nucleofector (Lonza, Basel, Switzerland) to confirm the ZFN activity, its 3T3 cell 96 holes of following manufacturers scheme of shuttling back and forth.Transfection 24 hours afterwards, remove substratum, and under 37 ℃, cell and every hole 15 μ l trypsinase hatched to 5min.Then cell suspending liquid transferred to 100 μ l QuickExtract (Epicentre) and hatched 10min under 68 ℃, under 98 ℃, hatching 3min.Then using the DNA that extracts in the PCR reaction as template, with following primer pair, around target site, increase:

Mdr1a Cel-I F:ctgtttcttgacaaaacaacactaggctc (SEQ ID NO:174)

Mdr1a Cel-I R:gggtcatgggaaagagtttaaaatc (SEQ ID NO:175)

Each 50 μ l PCR reactant comprises 1 μ l template, 5 μ l damping fluid II, 5 each primer of μ l 10uM, 0.5 μ l AccuPrime High Fidelity (InVitrogen, Carsbad, CA) and 38.5 μ l water.Use following PCR program: 95 ℃, 5min; 95 ℃, 30 seconds, 60 ℃, 30 seconds and 68 ℃, 35 circulations of 45 seconds, then 68 ℃, 5min, 4 ℃.The above-mentioned PCR reactant of three microlitres is mixed and hatches according to following program with 7 μ l 1x damping fluid II: 95 ℃, 10min, drop to 85 ℃ with-2 ℃/s speed from 95 ℃, drop to 25 ℃ with-0.1 ℃/s speed from 85 ℃, continue to be held under 4 ℃ and add respectively a microlitre nuclease S and toughener (Transgenomic, Omaha, NE) in order to digest above-mentioned reactant 20min under 42 ℃.Mixture is above analyzed at 10% polyacrylamide TBE gel (Bio-Rad, Hercules, CA).

Microinjection and mouse are raised: FVB/NTac and C57BL/6NTac mouse are fed in static cage and be held under 14h/10h illumination/dark cycle, freely take food and water.Injecting hCG (5I.U./mouse) 48h before, with PMS (5I.U./mouse), inject three to surrounding female mice in age.After hCG injection, 10-12h gathers in the crops unicellular zygote with for microinjection.The ZFN mRNA of injection 2ng/ μ l.The ovum of injection is transferred to false pregnancy female (from the Swiss Webster (SW) of Taconic Labs, itself and the male mating of vasectomized SW) with 0.5dpc.

Detect test with sudden change and identify source kind animal: under 50 ℃, the toe fragment is hatched to 30min in 100-200 μ l QuickExtract (Epicentre Biotechnology), hatch 10min under 65 ℃, and hatch 3min under 98 ℃.Verify under identical condition at the ZFN with in culturing cell, use one group of identical primer to carry out PCR and sudden change detection test.

TA Cloning and sequencing: in order to identify the modification in the kind animal of source, by the JumpStart Taq ReadyMix PCR test kit amplification for DNA of extracting.Each PCR reactant comprises 25 μ l2x ReadyMix, 5 μ l primers, 1 μ l template and 19 μ l water.Use and verify identical PCR program with the ZFN in culturing cell.Use TOPO TA clone test kit (Invitrogen), according to the explanation of manufacturers, clone each PCR reactant.Gather at least 8 colonies from each transforms, with T3 and T7 primer, carry out pcr amplification, and check order with T3 or T7 primer.At Elim Biopharmaceuticals (Hayward, CA), checked order.

PCR for detection of large disappearance: in order to detect larger disappearance, another group primer is used for to each target:

Mdr1a 800F:catgctgtgaagcagatacc (SEQ ID NO:176)

Mdr1a 800R:ctgaaaactgaatgagacatttgc (SEQ ID NO:177)

Each 50 μ l PCR comprises: 1 μ l template, 5 μ l 10x damping fluid II, 5 each 800F/R primer of μ l 10uM, 0.5 μ l AccuPrime Taq Polymerase High Fidelity (Invitrogen) and 38.5 μ l water.Use follow procedure: 95 ℃, 5min; 95 ℃, 30 seconds, 62 ℃, 30 seconds and 68 ℃, 35 circulations of 45 seconds, then 68 ℃, 5min, continue to be held under 4 ℃.Sample is analyzed on 1% sepharose.The different bands that will have the molecular weight lower than wt are checked order.

Organize RNA preparation and RT-PCR: by Mdr1a-/-or Mdr1a+ /+littermate puts to death to gather in the crops tissue during age in week at 5-9.Large intestine, kidney and liver organization are dissected, and existing side by side to use or seal up for safekeeping is provided with aftertreatment, biopsy is placed in RNAlater solution (Ambion), and-20 ℃ of storages.Use GenElute Mammalian Total RNA Miniprep test kit (Sigma), according to the explanation of manufacturers, prepare total RNA.In order to eliminate any DNA pollutent, DNAseI for RNA (New England Biolabs, Ipswich, MA) is processed, then loading is to purification column.With the total RNA of 1 μ l, primer RT-F (5 '-GCCGATAAAAGAGCCATGTTTG) (SEQ ID NO:178) and RT-R (5 '-GATAAGGAGAAAAGCTGCACC) (SEQ ID NO:179), use SuperScript ^tMiII One-Step RT-PCR system and Platinum

taq High Fidelity test kit (Invitrogen) carries out the RT-PCR reaction.Reverse transcription and PCR subsequently loop with synthetic for cDNA with 55 ℃ of 30min and 94 ℃ of 2min one; And 9415sec, 56 ℃ of 30see, and 68 ℃ of 1min are to be increased.The PCR product is splined on 1.2% sepharose and with ethidium bromide and observes.

Disappearance in table 10:Mdr1a gathers

-10-5-2+2+5+10

gCCATCAGCCCTGTTICTTGGACTGTCAGCTGGT

What is interesting is, find respectively three less disappearances in two source kind animals: the 19bp disappearance in source kind animal 7 and 36, the 21bp disappearance in source kind animal 17 and 27 and the 6bp disappearance (Figure 43) in source kind animal 34 and 44.

Observe the reproductive tract transport by Mdr1a source kind animal high.Select the wild-type FVB/N mouse in nine source kind animals and F1 generation to backcross, it all transmits at least one mutation allele to its offspring.Seven source kind animals are transmitted a plurality of mutation alleles.What is interesting is, in some cases, in the kind animal of source, Unidentified neomorph is also transmitted reproductive tract, such as source kind animal 6,8,13,21 and 44 (table 11).

Table 11: the allelotrope transmission in reproductive tract

In order to confirm that disappearance in the Mdr1a gene cancels it and express, we use the forward that lays respectively in exon 5 and 9 and reverse primer to the Mdr1a-with 396bp disappearance that set up by source kind animal 23/-total RNA of liver, kidney and the intestines of mouse carries out RT-PCR (Figure 44).Mdr1a albumen differential expression in tissue.Liver and large intestine are mainly expressed Mdr1a, and renal expression Mdr1a and Mdr1b.With corresponding wild-type sample, compare, from all Mdr1a-/-sample of tissue is to produce less product than low yield, wherein the sequence hopping associated with exon 7, introduce a plurality of too early terminator codons in its exon in mutant animals 8.

The RT-PCR result show Mdr1a-/-sample produces the transcript of disappearance 172bp exon 7 with the level lower than wild-type, this may be that the too early terminator codon of being introduced by the exon skipping that causes the nonsense mediated decay is produced (Figure 44 B).Mdr1a-/-sample in, with wild-type transcript equal and opposite in direction place or on have faint band, it is likely the PCR artifact, because those amplifications from the bands of gel excision mainly produce the exon skipping product.In second takes turns PCR, with the equal-sized band of wild-type be the mixture (not shown) that does not produce readable sequences.Mouse Mdr1a gene has 28 exons, and proteins encoded is comprised of six membrane-spanning domains (TM 1-6 and TM 7-12) of two units and ATP-binding site and interjacent joining region.All 12 TM territories and two ATP-binding motifs are absolutely necessary for the Mdr1a function.Mdr1a ZFN target coding TM 3 and 4 exon 7.Partial Protein by exon skipping and translation termination generation too early will not have functional.Therefore, derive from the Mdr1a-of source kind animal 23/-mouse represents functional knocking out.

In order to verify the potential site of missing the target of Mdr1a ZFN, we have identified 20 sites the most similar to the Mdr1a target site in the mouse genome, and it all has the 5bp mispairing compared to the ZFN binding sequence.A site is in the Mdr1b gene identical with Mdr1a gene 88%.In order to verify the specificity of Mdr1a ZFN, we use the sudden change detection method to test the Mdr1b site in all 44 Mdr1a F0 cubs.In 44 cubs, neither one has NHEJ event (Figure 45) in the Mdr1b site.In 44 life birth, any one Mdr1b site does not detect the specificity of the result indication Mdr1a ZFN of modification.In addition, and the unexpected modification at the irrelevant locus place of target site will between nursery stage, lose subsequently.

Table 12 is listed the some sites among 20 the active sites of missing the target of the Mdr1a ZFN checked in mouse genome, its most similar to the Mdr1a target site (having five does not mate).Chromosomal numbering and the gene title (if oneself knows) at its place have been listed.All unmatched bases mean with lowercase.Intervening sequence between binding site means with bold-type letter.

The potential site of missing the target of table 12:Mdr1a ZFN

Following table 13 provides the aminoacid sequence of active ZFN spiral.

table 13: the aminoacid sequence of active ZFN spiral

The genome editor of embodiment 76:APP locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat app gene seat.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module in scanning rat app gene district refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Know with oneself that Protocols in Molecular Biology produces to be encoded into ZFN added to cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The a pair of active ZFN of this test for identification editor app gene seat.Zinc refers to that binding site is 5 '-GCCAGCACCCCTGACgcag-3 ' (SEQ ID NO:213) and 5 '-tcGACAAGTACCTGGAG-3 ' (SEQ ID NO:214).

In order to mediate the editor of animal app gene seat, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair app gene seat to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 32 provide in two source kind animals through editor's app gene seat; One has 292bp disappearance (Figure 32 A) in exon 9, and another has 309bp disappearance (Figure 32 B) in exon 9.

The genome editor of embodiment 77:ApoE locus

Identify as mentioned above at the activated ZFN of ApoE locus tool.That is to say, scanning rat ApoE gene (NM_138828) refer to binding site at supposition zinc, and basically as Integration Assembly And Checkout ZFN couple described in embodiment 76.Find ZFN to target in conjunction with 5 '-aaGCGGTTCAGGGCCTGctcccagggtt-3 ' (SEQ ID NO:215; The contact site means with capitalization) and 5 '-ggGATTACCTGcGCTGGGtgcagacgct-3 ' (SEQ ID NO:216), its cracking ApoE locus.

As described in above embodiment 76, the mRNA right with the active ZFN of coding injects the unicellular embryo of zygote.As the animal of analyzing gained is described in detail in detail in embodiment 76.Figure 30 provides two ApoE locus through editor.An animal has the 16bp disappearance in the target sequence of exon 2, and second animal has the 1bp disappearance in the target sequence of exon 2.These disappearances upset the reading frame of ApoE coding region.

The genome editor of embodiment 78:BDNF locus

In order to identify the ZFN of target cracking BDNF locus, the supposition zinc of scanning rat BDNF gene (NM_012513) refers to binding site.Basically as Integration Assembly And Checkout ZFN couple as described in embodiment 76.This analyzes demonstration, ZFN is to target in conjunction with 5 '-cgGGGTCGGAGtGGCGCCgaaccctcat-3 ' (SEQ ID NO:217) and 5 '-cgGGGTCGGAGtGGCGCCgaaccctcat-3 ' (SEQ ID NO:218), and it edits in the BDNF locus.

With the active ZNF of coding, the rat embryo of right mRNA microinjection fertilization is also analyzed basically as described in above embodiment 76.Figure 46 provide in two source kind animals through editor's BDNF locus; One has the 14bp disappearance in the target sequence of exon 2, and another has the 7bp disappearance in the target sequence of exon 2.

Observe the change of the phenotype of genetic modification rat.The homozygote animal is dead within birth 2 weeks.With corresponding control animal (that is, the embryo of the GFP mRNA microinjection of using by oneself), compare, the size of heterozygote and homozygote animal is less.

Embodiment 79: the genome editor of PSEN1 in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of AD, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding PSEN1 albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the upset of the coding region of PSEN1 gene in conjunction with the ZFN of rat chromosome sequence of coding PSEN1 albumen relevant to AD, so that can not produce functional PSEN1 albumen.

Basically as above embodiment 76 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.PSEN1 be can in genetic modification rat or its filial generation, assess and the AD symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that PSEN1 " knocks out ", carry out the analysis of molecules of AD relational approach.

Embodiment 80: express the generation of the humanization rat of mutant human PSEN2

The missense mutation of PSEN2 (from the enzyme complex part of APP cracking amyloid beta) can cause type 4 familial AD.A kind of this type of sudden change is the M239V missense mutation that the methionine residues acid of the wherein position 239 in PSEN2 replaces with the α-amino-isovaleric acid residue.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein P of Rats SEN2 Gene Replacement is the mutant human PSEN2 gene that comprises the M239V sudden change.This type of humanization rat can be used for the advancing of disease that research is relevant to mutant human PSEN2 albumen.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the AD that comprises PSEN2.

Use the method described in above embodiment can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type PSEN2 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing saltant type PSEN2 albumen.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Embodiment 81: the genome editor of BZRAP1 in model animals

The genome editor of Zinc finger nuclease (ZFN) mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of ASD, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding BZRAP1 albumen in the cell of described animal.This type of model animal can be rat.Usually, can use the ZFN of rat chromosome sequence in conjunction with coding BZRAP1 protein relevant to ASD nonsense mutation is introduced to the coding region of BZRAP1 gene, so that can not produce active BZRAP1 albumen.

Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in rat embryo.During microinjection, rat embryo can be in the unicellular stage.Can contrast the embryo with 0.1mM EDTA injection.Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The growth of embryo after microinjection be can in the genetic modification rat, assess, and the ASD related symptoms that causes and the development of illness " knocked out " by BZRAP1.For BZRAP1, the symptom relevant with ASD and illness may comprise the development of rheumatoid arthritis and the inflammatory reaction to tumour of change.Result can compare with the control rats with 0.1mm EDTA injection, and the chromosomal region of the BZRAP1 albumen of wherein encoding does not change.In addition, can in deriving from the cell that comprises the genetically modified animal that BZRAP1 " knocks out ", carry out the analysis of molecules of ASD relational approach.

Embodiment 82: express the generation of the humanization rat of mutant human neuronin-1

The missense mutation of neuronin-1 (contributing to the presynaptic albumen that the neurone of cynapse place is bonded together) is relevant with autism.The amino acid of the leucine of the position 18 that a kind of this type of sudden change is wherein neuronin-1 replaces with the L18Q missense mutation of glutamine.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein rat NRXN1 Gene Replacement is the mutant human NRXN1 gene that comprises the L18Q sudden change.This humanization rat can be used for studying the development of autism.In addition, the humanization rat can be used for assessing the effect of the potential autism therapeutical agent of target perforin-1.

Use the method described in above embodiment 81, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant neuronin-1 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of neuronin-1 albumen of expressing mutant form.

The genome editor of embodiment 83:NOG locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat NOG locus.The ZFN design can be used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat NOG gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rat cell.The mRNA injection compared with control cells of available code GFP.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test can be used for identifying a pair of active ZFN of editor's app gene seat.

In order to mediate the editor of animal NOG locus, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Embryo/the fetus of results gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target area of suitable primer pair NOG locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

Embodiment 84: the genome editor of BMP4 in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the neurodevelopment chromosome sequence, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding PSEN4 albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance in conjunction with the ZFN of the rat chromosome sequence of the coding BMP4 albumen relevant to the neurodevelopment approach or insertion can not be produced functional BMP4 albumen so that the coding region of BMP4 gene upsets.

Basically as above embodiment 83 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.BMP4 be can in genetic modification rat or its filial generation, assess and the neurodevelopment symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that BMP4 " knocks out ", carry out the analysis of molecules of neurodevelopment approach phase.

Embodiment 85: express the generation of the humanization rat of mutant human BMP4

Four missense mutation of BMP4 detected in people's spinal bifida aperta patient colony.The genome editor of ZFN-mediation can be used for producing the humanization rat, the people BMP4 gene relevant to spinal bifida aperta that wherein rat BMP4 Gene Replacement is mutant form, or any combination of described four sudden changes.This type of humanization rat can be used for the development of the spinal bifida aperta that research is relevant to mutant human BMP4 albumen.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the spinal bifida aperta that comprises BMP4.

Method described in use embodiment 83, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type BMP4 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing saltant type BMP4 albumen.

Embodiment 86: express the generation of the A source rat of mutant human perforin-1

The missense mutation of perforin-1 (the crucial effector of lymphocytic cytotoxic effect) causes a series of diseases, comprises that familial Hemophagocytic lymphohistocysis is sick to swollen neoplastic risk increase.The V50M missense mutation that the α-amino-isovaleric acid amino acid substitution of the position 50 that a kind of this type of sudden change is wherein perforin-1 is methionine(Met).Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein P of Rats RF1 Gene Replacement is the mutant human PRF1 gene that comprises the V50M sudden change.This type of humanization rat can be used for the advancing of disease that research is relevant to mutant human perforin-1.In addition, the humanization rat can be used for assessing the effect of the potential therapeutical agent of the pathways of inflammation that target comprises perforin-1.

Use the method described in above embodiment 38, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type perforin-1 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of perforin-1 albumen of expressing mutant form.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Title zinc refers to the sequence SEQ ID of spiral

NO:

ApoE RSDALSV DSSHRTR RSDNLSE TSGSLTR RSDDLTR 223

ApoE RSDHLSR QSSDLRR RSDVLSA DRSNRIK TSSNLSR 224

The genome editor of embodiment 87:TRPM5 locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat TRPM5 locus.The ZFN design can be used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat TRPM5 gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rat cell.The mRNA injection compared with control cells of available code GFP.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test can be used for identifying a pair of active ZFN of editor TRPM5 locus.

In order to mediate the editor of animal TRPM5 locus, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target area of suitable primer pair TRPM5 locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

Embodiment 88: the genome editor of ERAL1 in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of nociception, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding ERAL1 albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the coding region of ERAL1 gene is upset in conjunction with the ZFN of rat chromosome sequence of coding ERAL1 albumen relevant to the nociception approach, so that can not produce functional ERAL1 albumen.

Basically as above embodiment 87 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.ERAL1 be can in genetic modification rat or its filial generation, assess and the AD symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that ERAL1 " knocks out ", carry out the analysis of molecules of nociception relational approach.

Embodiment 89: express the generation of the humanization rat of mutant human SCN9A

The missense mutation of the SCN9A sodium-ion channel of high level expression (in nociception dorsal root ganglion (DRG) neurone with) is to take the erythromelalgia (a kind of hereditary illness) that the symmetrical cusalgia of pin, shank and hand is feature relevant.In SCN9A, characterize three sudden change: W897X, be arranged in the P ring in territory 2; I767X, be arranged in the S2 fragment in territory 2; And S459X, in the joining region between territory 1 and 2, wherein any one can produce the non-functional albumen of brachymemma.The genome editor of ZFN-mediation can be used for producing the humanization rat, the people SCN9A gene that wherein rat SCN9A Gene Replacement is mutant form, and it comprises W897X sudden change, I767X sudden change, S459X sudden change or three any combinations of sudden change.This type of humanization rat can be used for the development of the erythromelalgia that research is relevant to mutant human SCN9A albumen.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the erythromelalgia that comprises SCN9A.

Use the method described in above embodiment 87, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type SCN9A albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing saltant type SCN9A albumen.

Embodiment 90: the evaluation of the ZFN of editor DISC1 locus

DISC1 gene in selected rat is for the genome editor of Zinc finger nuclease (ZFN) mediation.Use foregoing strategy and program (seeing the Science such as Geurts (2009) 325:433) to design, assemble and verify ZFN.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning DISC1 gene regions (NM_175596) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

That with oneself, knows that Protocols in Molecular Biology produces the every a pair of ZFN of coding adds cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA injection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test show ZFN to target in conjunction with 5 '-taGTCCCGGCAGGCTATcctgggcggtg-3 ' (SEQ ID NO:226; The contact site means with capitalization) and 5 '-ccGTCACCAGGCGGGACtggctgatgcg-3 ' (SEQ ID NO:227), its cracking in the DISC1 locus.

Embodiment 91: the DISC1 locus in editor's rat embryo

What Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode was right adds cap, polyadenylation mRNA microinjection in the rat embryo of fertilization.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Embryo/the fetus of results gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.Application standard program DNA isolation.Use the target area of suitable primer pair DISC1 locus to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 47 provides the DISC1 locus through editor, and wherein the target sequence in exon 5 has the 20bp disappearance.This disappearance upsets the reading frame of DISC1 coding region.

Embodiment 92: the evaluation of the ZFN of editor BDNF locus

In order to identify the ZFN of target cracking BDNF locus, the supposition zinc of scanning rat BDNF gene (NM_012513) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 90.This analyzes demonstration, ZFN to target in conjunction with 5 '-cgGGGTCGGAGtGGCGCCgaaccctcat-3 ' (SEQ ID NO:228) and 5 '-ccGCCGTGGGGaGCTGAGcgtgtgtgac-3 ' (SEQ ID NO:229), its cracking in the BDNF gene.

With the active ZNF of coding, the rat embryo of right mRNA microinjection fertilization is also analyzed basically as described in above embodiment 91.Figure 46 provides the BDNF locus through editor in two source kind animals; One has the 14bp disappearance in the target sequence of exon 2, and another has the 7bp disappearance in the target sequence of exon 2.

Observe the phenotypic alternation of genetic modification rat.The homozygote animal is dead within birth 2 weeks.With corresponding control animal (that is, the embryo of the GFP mRNA microinjection of using by oneself), compare, the size of heterozygote and homozygote animal is less.

Embodiment 93: the genome editor of ErbB4 in model animals

The genome editor of ZFN-mediation can be used for the effect of " knocking out " sudden change in chromosome sequence that research is relevant to schizophrenia, the chromosome sequence of the coding ErbB4 albumen in described sequence such as genetic modification model animal and the cell that derives from described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the coding region of ErbB4 gene is upset in conjunction with the ZFN of the rat chromosome sequence of the coding ErbB4 albumen relevant to schizophrenia, so that can not produce functional ErbB4 albumen.

Can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.Can in genetic modification rat or its filial generation, assess by ErbB4 and " knock out " the symptoms of schizophrenia that causes and the generation of illness.In addition, can in deriving from the cell that comprises the genetically modified animal that ErbB4 " knocks out ", carry out the analysis of molecules of schizophrenia relational approach.

Embodiment 94: express the generation of the humanization rat of mutant human TPH1

Comprise in order to develop " humanization " animal model for assessment of the symptoms of schizophrenia and treatment, can to produce the genomic rat that contains people's mutant form TPH1.People's mutant form can be the A218C in the intron 7 that is found in TPH1; A218C is considered to and the schizophrenia height correlation.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein rat gene replaces with the people TPH1 of A218C mutant form.This humanization rat can be used for the schizoid development that research is relevant to the mutant human albumen of mutation T PH1 coding.In addition, the humanization rat can be used for assessing the effect of the potential therapeutical agent of target and TPH1 relational approach.

Use the method described in above embodiment 91, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type TPH1 albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing mutein.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Embodiment 95: evaluation can be edited the ZFN of p53 locus

Selected p53 gene is for the genome editor of Zinc finger nuclease (ZFN) mediation.Use foregoing strategy and program (seeing the Science such as Geurts (2009) 325:433) to design, assemble and verify ZFN.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat p53 gene regions (NM_030989) refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

That with oneself, knows that Protocols in Molecular Biology produces the every a pair of ZFN of coding adds cap, polyadenylation mRNA.MRNA is transfected in rat cell.MRNA transfection compared with control cells with coding GFP.Carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This detection display ZFN to target in conjunction with 5 '-atCTGGAGGAAGACtGGAGAAcaagagc-3 ' (SEQ ID NO:234; The contact site shows with capitalization) and 5 '-atATTCTGGTAAGGAGCCGGgcaagagg-3 ' (SEQ ID NO:235), its editor p53 gene.

Embodiment 96: the editor of p53 locus in rat embryo

What Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode was right adds cap, polyadenylation mRNA microinjection in the rat embryo of fertilization.MRNA microinjection contrast embryo with salt solution or coding GFP.To transfer to the false pregnancy female rats through the embryo of injection until childbirth.Gather in the crops the toe of each birth animal that lives/cauda section with for DNA extraction with use the Cel-1 test to be analyzed.As shown in figure 48, approximately 25% laboratory animal has the p53 locus through editor.

Embodiment 97: the inactivation of the p53 locus of rat

In order to determine the p53 locus inactivation through editor, carry out the Western analysis to confirm not produce p53 albumen.Prepare cell lysates from kidney and the liver of wild-type animal and p53 knock-out animal.As shown in figure 49, the tenuigenin of p53 knock-out animal and karyolysis product all do not have p53 albumen.Yet Actin muscle matter level is invariable in wild-type and saltant type sample.Therefore, to edit rat be that p53 knocks out rat to p53.

Embodiment 98: the evaluation of the ZFN of BCRP locus in the editor rat

Basically as identified the ZFN of target cracking BCRP gene as described in above embodiment 95.The supposition zinc of scanning rat BCRP gene (NM_1811381) refers to binding site.Basically as Integration Assembly And Checkout ZFN as described in embodiment 95.Discovery ZFN is to target in conjunction with 5 '-atGACGTCAAGGAAGAAgtctgcagggt-3 ' (SEQ ID NO:236) and 5 '-acGGAGATTCTTCGGCTgtaatgttaaa-3 ' (SEQ ID NO:237), and it edits BCRP locus.

Embodiment 99: editor BCRP locus

Basically as described in embodiment 95 and 96, with the right mRNA microinjection rat embryo of the active BCRP ZFN of coding.Hatch the embryo through injection, and extract DNA from the animal of gained.Use the target area of suitable primer pair BCRP gene to carry out pcr amplification.The DNA of amplification is subcloned in suitable carrier, and the order-checking of Application standard method.Figure 39 provides the BCRP locus through editor in two source kind animals.An animal has the 588bp disappearance in exon 7, and second animal has the 696bp disappearance in exon 7.These disappearances upset the reading frame of BCRP coding region.

Embodiment 100: editor Pten locus

Basically as described in above embodiment 95, the ZFN of design target and cracking P of Rats ten locus also tests its activity.Identified activity ZFN couple.The DNA binding site is 5 '-CCCCAGTTTGTGGTCtgcca-3 ' (SEQ ID NO:238) and 5 '-gcTAAAGGTGAAGATCTA-3 ' (SEQ ID NO:239).Can right add cap, polyadenylation mRNA microinjection to rat embryo by coding is active, and can be as the embryo of gained that embodiment 95 and 96 are described to analyze.Therefore, the Pten locus can be through editor to contain disappearance or to insert, so that coding region is upset and do not produce functional protein.

Following table provides the aminoacid sequence of the spiral of active ZFN.

Embodiment 101: the genome editor of HTT in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of trinucleotide repeat expansion, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding HTT albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the coding region of HTT gene is upset in conjunction with the ZFN of the rat chromosome sequence of the coding HTT albumen relevant to the trinucleotide repeat expansion illness, so that can not produce functional HTT albumen.

Can know that Protocols in Molecular Biology adds cap, the suitable fertilization embryo of polyadenylation mRNA microinjection with coding ZFN according to oneself.Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.The pcr amplification of the target area of the cell pool processed from ZFN is produced to the mixture of wild-type and saltant type amplicon.This mixture unwind and again annealing cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.Can be analyzed the sequence of edited chromosome sequence.Can in genetic modification rat or its filial generation, assess the development that " is knocked out " the trinucleotide repeat expansion illness caused by HTT.In addition, can in deriving from the cell that comprises the genetically modified animal that HTT " knocks out ", carry out the analysis of molecules of trinucleotide repeat expansion relational approach.

Embodiment 102: express the generation of the humanization rat of the mutant human gene that relates to the trinucleotide repeat expansion illness

The sudden change that relates to any chromosome sequence of trinucleotide repeat expansion illness can be used for producing the humanization rat of expressing mutated genes.Gene can be htt, ar, fxn, atxn1, atxn2, atxn3, atxn7, atxn10, dmpk, atn1, cbp, vldlr and combination thereof.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein rat gene replaces with the mutant human gene that comprises sudden change.This humanization rat can be used for the advancing of disease that research is relevant to the mutant human albumen of target gene coding.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the trinucleotide repeat expansion illness that comprises target gene.

Use the method described in above embodiment, can produce the genetic modification rat.Yet, in order to produce the humanization rat, ZFN mRNA can be expelled in rat embryo jointly with the human chromosome sequence of encoding mutant type albumen.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing mutein.

Embodiment 103: the genome editor of 5-HTT in model animals

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of neurotransmission, described sequence such as genetic modification model animal and derive from the chromosome sequence of the coding 5-HTT albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the coding region of 5-HTT gene is upset in conjunction with the ZFN of the rat chromosome sequence of the coding 5-HTT albumen associated with the neurotransmission associated conditions, so that can not produce functional 5-HTT albumen.

Can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.5-HTT be can in genetic modification rat or its filial generation, assess and the neurotransmission symptom that causes and the development of illness " knocked out ".In addition, can in deriving from the cell that comprises the genetically modified animal that ErbB4 " knocks out ", carry out the analysis of molecules of neurotransmission relational approach.

Embodiment 104: express the generation of the humanization rat of the mutant human gene that relates to neurotransmission

The sudden change that relates to any chromosome sequence of neurotransmission illness can be used for producing the humanization rat of expressing mutated genes.Gene can be 5-HTT, COMT, DRD, SLC6A3, DAO, DTNBP1, GABAa, NMDA, NMDAR, NR1, NR2a, NR2b, mGLUR1, mGLUR2, mGLUR3, mGLUR5, GLUR1, GLUR2, GAD67, GAT1, TCF4, NPAS3, GR1K4, COMT, MAO, DBH, TyrH, CB1, CB2, FAAH, MAGL and combination thereof.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein rat gene replaces with the mutant human gene that comprises sudden change.This humanization rat can be used for the advancing of disease that research is relevant to the mutant human albumen of target gene coding.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the neurotransmission illness that comprises target gene.

Use the method described in above embodiment can produce the genetic modification rat.Yet, in order to produce the humanization rat, the human chromosome sequence of ZFN mRNA and encoding mutant type albumen can be expelled in rat embryo jointly.Then, the rat chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization rat of expressing mutein.

The genome editor of embodiment 105:APH-1 locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat APH-1 locus.The ZFN design can be used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat APH-1 gene regions refers to binding site, described albumen can be in conjunction with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rat cell.Then the mRNA of available code GFP injects compared with control cells.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test can detect by the non-homologous end joining of ZFN inducing DNA double-strand break (NHEJ) mediation and not exclusively repair the allelotrope of the target gene seat that departs from wild-type caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation can carry out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This detection can be identified a pair of active ZFN of editor APH-1 locus.

In order to mediate the editor of APH-1 locus in animal, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Use the target area of suitable primer pair APH-1 locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

For example 106: the genome editor of Secretases genes involved in the model animals cell

Can use the ZFN in conjunction with the chromosome sequence of Secretases-genes involved, the genome editor of test ZFN-mediation in the cell of model animals (such as rat), described sequence such as APH-1A, APH-1B, PSEN1, NCSTN or PEN-2.Can basically as describing, embodiment 105 design and test ZFN.Can use the ZFN of the specific Secretases genes involved of target to introduce disappearance or insertion so that the coding region inactivation of target gene.

For example 107: the genome editor of Secretases genes involved in model animals

But the embryo of Application standard program results model animalss (such as rat), and as above embodiment 105 in describe in detail, the ZFN of injection coding target Secretases genes involved adds cap, polyadenylation mRNA.Comprise for donor or the exchange polynucleotide of the sequence of integrating or exchanging and can jointly inject with ZFN.Can analyze as mentioned above the chromosomal region through editor in the animal of gained.But the variation of the behavior of the modified animal of phenotype analytical, study etc.In addition, genetically modified animal can be used for assessing the effect that potential therapeutical agent is used for the treatment of the Secretases illness.

The genome editor of embodiment 108:SOD1 locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat SOD1 locus.The ZFN design can be used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat SOD1 gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rat cell.Then the mRNA of available code GFP injects compared with control cells.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.Not mating the DNA " microvesicle " that site can form can carry out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This detection can be used for identifying a pair of active ZFN of editor SOD1 locus.

In order to mediate the editor of SOD1 locus in animal, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target area of suitable primer pair SOD1 locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

For example 109: the genome editor of ALS genes involved in the model animals cell

Can use the ZFN in conjunction with the chromosome sequence of ALS genes involved, the genome editor of test ZFN-mediation in the cell of model animals (such as rat), described sequence such as SOD1, ALS2, FUS, TARDBP or VEGF (A, B or C).Can basically as describing, embodiment 108 design and test ZFN.Can use the ZFN of the specific ALS genes involved of target to introduce disappearance or insertion so that the coding region inactivation of target gene.

For example 110: pattern give birth in the genome editor of thing ALS genes involved

But the embryo of Application standard program results model animalss (such as rat), and as above embodiment 108 in describe in detail, the ZFN of injection coding target ALS genes involved adds cap, polyadenylation mRNA.Comprise for donor or the exchange polynucleotide of the sequence of integrating or exchanging and can jointly inject with ZFN.Can analyze as mentioned above in the animal of gained the chromosomal region through editor.The variation of the behavior of the modified animal of phenotype analytical, study etc.In addition, genetically modified animal can be used for assessing the effect that potential therapeutical agent is used for the treatment of ALS.

The genome editor of embodiment 111:prnd locus

Can use previously described strategy and program (referring to the Science such as Geurts (2009) 325:433) to design, assemble and verify the Zinc finger nuclease (ZFN) of target cracking rat prdn locus.The ZFN design is used through 1 finger of checking in advance and the archives of 2 finger print pieces.The supposition zinc that can merge to produce a pair of 4,5 or 6 finger proteins with existing module of scanning rat prdn gene regions refers to binding site, described albumen is in connection with the 12-18bp sequence on the 12-18bp sequence on a chain and another chain, and 5-6bp wherein has an appointment between two binding sites.

Can use oneself know Protocols in Molecular Biology produce coding ZFN right add cap, polyadenylation mRNA.MRNA can be transfected in rat cell.The mRNA injection compared with control cells of available code GFP.Can carry out identified activity ZFN couple by the double-stranded rhexis of inducing with Cel-1 nuclease test detection ZFN.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation carrys out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.This test can be identified a pair of active ZFN of editor prnd locus.

In order to mediate the editor of prnd locus in animal, but the right mRNA microinjection of Application standard program (such as above-mentioned referring to (2009) such as Geurts) the active ZFN that will encode is to the rat embryo of being fertilized.By the embryo's incubated in vitro through injecting, or transfer to the false pregnancy female rats until childbirth.Can gather in the crops the embryo/fetus of gained, or the toe of the birth animal that lives/cauda section is with for DNA extraction and analysis.But Application standard program DNA isolation.Can use the target area of suitable primer pair prnd locus to carry out pcr amplification.The DNA of amplification can be subcloned in suitable carrier, and the order-checking of Application standard method.

For example 112: the genome editor of Dpl gene in the model animals cell

The genome editor of ZFN-mediation can be used for studying the effect of " knocking out " sudden change in the relevant chromosome sequence of AD, described sequence such as genetic modification model animal and derive from the chromosome sequence of the encoding D pl albumen in the cell of described animal.This type of model animal can be rat.Usually, can be used for introducing disappearance or insertion so that the coding region of Dpl gene (Prnd) is upset in conjunction with the ZFN of rat chromosome sequence of coding Dpl albumen relevant to AD, so that can not produce functional Dpl albumen.

Basically as above embodiment 111 describe in detail, can be with coding ZFN add cap, the suitable fertilization embryo of polyadenylation mRNA microinjection.As described in detail above, can test to measure the frequency that ZFN induces double-stranded rhexis with the Cel-1 nuclease.Can to the sequence of edited chromosome sequence, be analyzed as mentioned above.Can in genetic modification rat or its filial generation, assess by Dpl and " knock out " the AD symptom that causes and the development of illness.In addition, can in deriving from the cell that comprises the genetically modified animal that Dpl " knocks out ", carry out the analysis of molecules of AD relational approach.

For example 113: model animals refers to the genome editor of that Prp gene

The coding polymorphism at Prp codon 129 places and disease susceptibility and phenotype modify effect have strong associated, especially when the amino acid at codon 129 places is methionine(Met) or α-amino-isovaleric acid.Can use the genome editor of ZFN-mediation to produce the humanization rat, wherein P of Rats rp Gene Replacement is to comprise the mutant human Prpn gene with 129M or 129V.This type of humanization rat can be used for the advancing of disease that research is relevant to mutant human PSEN2 albumen.In addition, the humanization rat can be used for assessing the effect of potential healing potion that target causes the approach of the Protein virus illness that comprises neurotoxic Prp isotype.

Embodiment 114: the genome editor of the Agouti in the model animals cell

Can use the ZFN of being combined with the chromosome sequence of the hair color genes involved of horse cell, test the genome editor of Zinc finger nuclease (ZFN) mediation in the cell of model animals (such as horse), described sequence such as MSH receptor protein, agouti signal protein (ASIP) and melanocyte avidin (MLPH).Specific hair color-genes involved to be edited can be the gene with DNA binding site identical with the DNA binding site of the corresponding horse homologue of described gene.Coding ZFN adds cap, polyadenylation mRNA and can use known Protocols in Molecular Biology (technology of describing in Science (2009) 325:433 that includes but not limited to be incorporated herein by reference with full content roughly similarly technology) to produce.MRNA can be transfected in the horse cell.The mRNA injection compared with control cells of available code GFP.

Useful Cel-1 nuclease tests to measure the frequency that ZFN induces double-stranded rhexis.This test detects by non-homologous end joining (NHEJ) mediation of ZFN inducing DNA double-strand break and not exclusively repairs the allelotrope of the target gene seat that departs from wild-type (WT) caused.Can produce the mixture of wild-type and saltant type amplicon to the pcr amplification of the target area of the cell pool processed from ZFN.This mixture unwind and again annealing can cause forming and not mating between the heteroduplex of wild-type and mutant allele.The DNA " microvesicle " that does not mate site formation can carry out cracking by surveyor nuclease Cel-1, and split product can be analyzed by gel electrophoresis.The relative intensity that split product is compared with parent's band is the tolerance of the Cel-1 cracking level of heteroduplex.This so reflected the frequency of the ZFN mediation cracking of experiencing subsequently the endogenous target gene seat that NHEJ not exclusively repairs.

The result of this experiment can show to use the selected hair color genes involved seat of ZFN cracking horse cell.

Embodiment 115: the genome editor of Agouti in the model animals embryo

The embryo of usable criterion program results model animalss (such as horse), and use with embodiment 114 in similar coding ZFN described add cap, polyadenylation mRNA injection.During microinjection, the horse embryo can be usually in the unicellular stage.Can contrast the embryo with 0.1mM EDTA injection.Cel-1 described in useful embodiment 114 tests to estimate that ZFN induces the frequency of double-stranded rhexis.Useful Cel-1 test-results is estimated cutting efficiency.

Can assess the growth of the embryo after microinjection.With the embryo of smaller size smaller ZFN mRNA injection, can compare with the embryo with the EDTA injection, to determine ZFN mRNA effect to the blastocyst stage for embryo survival.

Embodiment 116: express the generation of the humanization horse of mutant human SCID

In radiosensitive T-B-SCID patient, identified the first man sudden change in the gene of coding DNA-PKcs (DNA-deopendent protein kinase catalytic subunit).The sudden change of DNA-PKcs gene has been predicted for a long time, but only identified spontaneous mutation in mouse, horse and canine model.The single base of DNA-PKcs changes the change that can cause disease-associated kinase subunit protein.The genome editor of ZFN-mediation can be used for producing the humanization horse, and wherein horse dna-PKcs replaces with the mutant form of the human DNA-PK cs that comprises one or more sudden changes.The advancing of disease that this type of humanization Marko is relevant to mutant human DNA-PKcs albumen for research.In addition, the humanization Marko causes the effect of potential healing potion of the approach of the immune deficiency that comprises DNA-PKcs for assessment of target.

Use the method described in above embodiment can produce the genetic modification horse.Yet, in order to produce the humanization horse, ZFN mRNA can be expelled in the horse embryo jointly with the human chromosome sequence of encoding mutant type DNA-PKcs albumen.Then, the horse chromosome sequence can replace with the mutant human sequence by homologous recombination, and can produce the humanization horse of the DNA-PKcs albumen of expressing mutant form.

Claims (20)

1. a method of editing chromosome sequence, described method comprises:

(a) to introduce in the cell that comprises described chromosome sequence target sequence in the described chromosome sequence of at least one code identification and can the described chromosome sequence of cracking in the nucleic acid of Zinc finger nuclease of cracking site, and optional

(i) at least one comprises the donor polynucleotide for donor sequences, upstream sequence and the downstream sequence integrated, the both sides of wherein said donor sequences are described upstream sequence and described downstream sequence, and the either side of wherein said upstream sequence and described downstream sequence and described cracking site has significant sequence identity, or

(ii) at least one exchange polynucleotide, it comprises with the part that is positioned at described cracking site of described chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes; With

(b) cultivate described cell allow to express described Zinc finger nuclease, so that described Zinc finger nuclease is introduced described chromosome sequence by double-strand break at described cracking site, and wherein said double-strand break is by following process reparation:

(i) non-homologous end joining repair process, introduce described chromosome sequence so that will suddenly change, or optional

(ii) homology mediation repair process, so that be incorporated in described chromosome sequence by described donor sequences or the part of described turnaround sequence and described chromosome sequence exchanged.

2. method according to claim 1, wherein said cell is the embryo.

3. method according to claim 2, wherein said embryo is unicellular embryo.

4. method according to claim 1, wherein introduce described cell by the nucleic acid of more than one coding Zinc finger nucleases.

5. method according to claim 1, the nucleic acid of wherein said coding Zinc finger nuclease is RNA.

6. method according to claim 5, wherein added cap to described RNA.

7. method according to claim 5, wherein carry out polyadenylation to described RNA.

8. method according to claim 1, more than one polynucleotide that wherein will be selected from described donor polynucleotide, described exchange polynucleotide or its any combination are introduced described cell.

9. method according to claim 1, wherein said cell is culturing cell, primary cell or stem cell.

10. method according to claim 1, wherein said cell is people's cell, mammalian cell, vertebrate cells, invertebral zooblast or fungal cell.

11. a non-human animal, described animal is produced by method according to claim 1.

12. non-human animal according to claim 11, wherein said animal is rodent.

13. non-human animal according to claim 11, wherein said animal is livestock animals.

14. non-human animal according to claim 11, wherein said animal is companion animals.

15. a cell, described cell is by using method according to claim 1 to produce.

16. cell according to claim 15, wherein said cell is the embryo.

17. cell according to claim 16, wherein said embryo is unicellular embryo.

18. cell according to claim 15, wherein said cell is culturing cell, primary cell or stem cell.

19. an embryo, described embryo comprise target sequence in the described chromosome sequence of at least one code identification and can the described chromosome sequence of cracking in the nucleic acid of Zinc finger nuclease of cracking site, and optional

(i) at least one comprises the donor polynucleotide for donor sequences, upstream sequence and the downstream sequence integrated, the both sides of wherein said donor sequences are described upstream sequence and described downstream sequence, and the either side of wherein said upstream sequence and described downstream sequence and described cracking site has significant sequence identity, or

(ii) at least one exchange polynucleotide, it comprises with the part that is positioned at described cracking site of described chromosome sequence basically same and further comprise the turnaround sequence that at least one Nucleotide changes.

20. embryo according to claim 19, wherein said embryo is unicellular embryo.

Images