CN102732520A - Preparation method for serum miRNAs specific to active pulmonary tuberculosis - Google Patents
Preparation method for serum miRNAs specific to active pulmonary tuberculosis Download PDFInfo
- Publication number
- CN102732520A CN102732520A CN2012101719198A CN201210171919A CN102732520A CN 102732520 A CN102732520 A CN 102732520A CN 2012101719198 A CN2012101719198 A CN 2012101719198A CN 201210171919 A CN201210171919 A CN 201210171919A CN 102732520 A CN102732520 A CN 102732520A
- Authority
- CN
- China
- Prior art keywords
- mirnas
- mir
- serum
- hsa
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method for serum miRNAs specific to active pulmonary tuberculosis. The method comprises the following steps: A1, collection and clinical detection of serum samples of patients with active pulmonary tuberculosis and healthy controls; A2, extraction of total RNAs from the serum samples; A3, high flux sequencing and screening of serum miRNAs specific to active pulmonary tuberculosis; and A4, designing of stem-loop reverse transcription primers, upstream primers and downstream primers of miRNAs, wherein the stem-loop reverse transcription primers are SEQ ID No. 10 to SEQ ID No. 18, a commonly-used upstream primer is SEQ ID No. 19 and a commonly-used downstream primer is SEQ ID No. 28. According to the invention, to prepare serum miRNAs specific to active pulmonary tuberculosis, high flux sequencing is used for preliminary screening of differentially expressed serum miRNAs, specific reverse transcription primers are designed by using a stem-loop method, and verification is carried out by using a fluorescence quantitative method so as to obtain the differentially expressed serum miRNAs; the serum miRNAs have remarkable significance to research on control of propagation of pulmonary tuberculosis and to reduction of the incidence rate of pulmonary tuberculosis.
Description
Technical field
The present invention relates to technical field of molecular biology, in particular prepare the method for the serum miRNAs of active tuberculosis disease special (significant).
Background technology
The whole world has 2,000,000,000 people to infect mycobacterium tuberculosis; 2,000 ten thousand people's hectics are sick; Wherein sick 1,200 ten thousand examples of active tuberculosis increase pulmonary tuberculosis (pulmonary tuberculosis, TB) patient 850～9,200,000 examples every year newly; Mortality ratio reaches 120～1,500,000 examples, is that single infective agent causes the disease that death toll is maximum.In the most serious country of 22 pulmonary tuberculosis, the 2nd is ranked in China in the world, and popular situation is very severe.China has consumptive 4,510,000 people now, about 1,300,000 people of active tuberculosis patient wherein, and in 1,450,000 example/years of new cases, mortality ratio reached for 130,000 example/years, had surpassed the summation of other transmissible disease death tolls.The sick research difficult point of active tuberculosis is to lack special mark.Research data shows, has the miRNAs of stability in serum and the blood plasma, and the variation of miRNAs express spectra has tissue and cell-specific, is suitable as candidate's biological marker of pulmonary tuberculosis.
But because the miRNAs molecular weight is little, content is few in the serum, but enormous amount, traditional PCR sequencing PCR complicated operation, expense is expensive, and the order-checking degree of depth is limited, and efficient is lower, is inappropriate for the detection of miRNAs.So the detection of miRNAs has just become key issue with analyzing.Along with the development of high-flux sequence examination technology, the research of miRNAs is greatly improved.This sequencing technologies can detect any RNA in 17-35 the Nucleotide, based on the sequence label and the frequency of occurrences of survey target miRNAs, can be used to the minor alteration of finding new miRNAs and detecting known miRNAs length and sequence.And can adjust the extraction scope according to demand; Have advantages such as speed is fast, cost is low, coverage is dark, be fit to very much the order-checking of the miRNAs of 21-25 Nucleotide composition, can obtain known miRNAs in the DB; Can also find new miRNAs, accuracy and highly sensitive.Simultaneously, being used to excavate, identify and the quantitative miRNAs collection of illustrative plates of the full genomic level of all species, is the better method of deciphering miRNAs collection of illustrative plates.Still the report that does not have at present the serum miRNAs that uses high-flux sequence examination pulmonary tuberculosis differential expression.Through the differential expression miRNAs of high-flux sequence examination, also need the quantitative fluorescent PCR checking.Owing to sophisticated miRNAs length is too short, can not pass through the real-time fluorescence quantitative PCR detection, but pass through the reverse transcription primer of the loop-stem structure of particular design, cooperate real-time quantitative PCR primer and probe, can accurately detect miRNAs expression in the micro-example.The miRNAs fluorescent quantitative PCR technique is a kind of new detection technique; Can carry out quantitatively ripe miRNAs, service area divides the homolgous molecule of ripe miRNAs molecule and precursor molecule and other ripe miRNAs, have fast, simple, save time, detection sensitivity is high; Sample consumption few (only needing the total RNA of 1-10ng or the miRNAs about 50pg); Ultra wide linearity range can be crossed over 7 one magnitude, is the miRNAs of fit closely preparation differential expression.
Summary of the invention
The technical problem of all solutions of the present invention provides the method for the sick special serum miRNAs of preparation active tuberculosis.
Technical scheme of the present invention is following:
The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special may further comprise the steps: A1: the collection and the clinical detection of active tuberculosis patient and normal healthy controls person's serum sample; A2: the total RNA that extracts serum sample; A3: the high-flux sequence examination of the serum miRNAs that active tuberculosis is sick special; A4: the design miRNAs stem ring reverse transcription primer and the upper reaches, downstream primer; Stem ring reverse transcription primer is SEQ ID NO:10-SEQ ID NO:18; General upstream primer is SEQ ID NO:19, and downstream primer is SEQ ID NO:20-SEQ ID NO:28; A5: the sick special serum miRNAs of quantitative fluorescent PCR checking active tuberculosis.
Described method, operation below the concrete execution of said A1: collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons.All participator's blood samples are to rise morning on an empty stomach to extract, and adopt not anticoagulant blood-collecting pipe of disposal vacuum, gather peripheral blood 3.0mL, and 4 hours with interior centrifugal (3000x g, 10min, 4 ℃), are distributed into each 200 μ L after sucting clearly, are stored in-80 ℃ of refrigerators.
Described method, operation below the concrete execution of said A2: active tuberculosis patient and normal healthy controls person's serum are taken out in-80 ℃, treat 4 ℃ of dissolvings naturally; Draw 200 μ L with pipettor, joining 1.5ml does not have in the RNase EP pipe, adds 700 μ L Qiagen Lysis solution, places the violent vortex mixing of vortex appearance to fully cracking, up to can't see the white suspension thing; Room temperature leaves standstill 5min; Add 140 μ L chloroforms; Violent 15s, the standing demix 3min of mixing; See 12000g when demixing phenomenon is arranged, 15min, 4 ℃; Get supernatant liquid (general 500 μ L) with pipettor and transfer in the new 1.5mL collection tube, add the absolute ethyl alcohol of 1.5 times of supernatant volumes, mixing turns upside down; Get 700 μ L and contain the alcoholic acid lysate and be added in the pillar, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube is on post; Add 700 μ LRWTsolution, the centrifugal 18s of 8000g abandons lower floor, and post is placed on the new collection tube; Add 500 μ L RPE, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube is on post; Add 500 μ L RPE, the centrifugal 2min of 8000g abandons collection tube.Put into new 2ml collection tube to pillar, at full speed centrifugal 1min; Put into 1.5mL Elution pipe to pillar; Add 30 μ L RNase-Free Water, leave standstill 1min, solution is fully combined, then the centrifugal 1min of 8000g with post.
Get the total RNA sample 1.0 μ L of active tuberculosis patient and normal healthy controls person's serum, detect the OD value, on ultraviolet spectrophotometer, measure A260/A280 numerical value, represent between 1.8～2.0 that when its numerical value the purity of total RNA is better through nanodrop-2000; Less than albumen in the 1.8 explanation solution or the time other organic pollutions apparent in view, then possibly degrade by total RNA greater than 2.0; And A260/A230, then ratio should be between 2～2.5, and then explanation less than normal has the residual salt residue.
Described method, operation below the concrete execution of said A3: with high-flux sequence examination technology, the serum miRNAs of differential expression between preliminary screening active tuberculosis patient and the normal healthy controls person.20 routine consumptives and 20 routine normal healthy controls persons respectively provide the serum of 5mL; Serum requires: concentration >=5ng/ul after Agilent Bioanalyzer detects, total amount >=100ng; Impurity such as albumen, salt ion is few, and the PAGE gel electrophoresis separates more normal; According to result and information biology software analysis, select differential expression miRNAs like normalization method and variance analysis method of calculation; Comprise hierarchical clustering through clustering method, Kmeans cluster and SOM etc. classify to different samples, and difference miRNAs is carried out similarity analysis, obtain the serum miRNAs of differential expression.
Described method; Operation below the concrete execution of said A3: according to the PRELIMINARY RESULTS that high-flux sequence examination technology obtains, the miRNAs that chooses satisfies three conditions: 1. in active tuberculosis patient or normal healthy controls person, detect the miRNAs expression amount and reach 20copies at least; 2. differential expression is more than 2 times; 3. there were significant differences (P＜0.01) for the P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
Described method, operation below the concrete execution of said A4: in the miRBase DB, find the mature sequence of corresponding miRNAs, with general stem ring method design.3 ' end at general stem ring adds 6 and ripe miRNAs 3 ' end reverse complemental paired base, is stem ring primer, can carry out rt to miRNAs, uses the special upstream primer of general downstream primer and miRNAs to increase at last.The each rt of stem ring primer can only be to a kind of miRNAs or 6 miRNAs that base is identical of 3 ' end.And fluorescent quantitation upstream and downstream design of primers, downstream primer is the part on the stem ring, and upstream primer can be through primer 5.0 designs; About upstream and downstream primer length 20bp; Annealing temperature Tm value about 60 ℃, the about 40%-60% of GC content, amplified production is about 60bp.Design of primers is estimated through 7.0 pairs of primers of lesegene after accomplishing.Increasing in active tuberculosis patient serum sample with confidential reference items miR-16 is example; Observe the amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has tangible logarithmic phase; And blank does not have the continuous curve generation, explains that amplification is all right.MiR-16 product to amplification is done solubility curve, have and have only one tangible unimodal, occur and there is the no obvious crest of template contrast, explain that the warp after product that increases is special miR-16.Be that this is quantitatively pollution-free, accurately, reliable.
Described method, operation below the concrete execution of said A5: carry out reverse transcription with Fermentas reverse transcription test kit.Reverse transcription reaction system: total RNA 2.5 μ L, RNase suppressor factor RRI 0.25 μ L, dNTP (10mM each) 0.5 μ L, 5 * M-MuLV buffer, 1.0 μ L, stem ring primer SLP (2 μ M) 0.5 μ L, M-MuLV ThermoScript II 0.25 μ L, TV 5 μ L.Method is carried out in two steps, the first step: 65 ℃, and 5min; On ice, 10min.Second step: 42 ℃, 60min; 70 ℃, 15min; After reaction finishes, be stored in-80 ℃ of refrigerators.
Described method, operation below the concrete execution of said A5: the serum miRNAs that carries out quantitative fluorescent PCR checking differential expression with the SYBR method.Quantitative fluorescent PCR system: ddH2O 7 μ L, SYBR system Mix 10 μ L, 50*ROX refenence dye 0.4 μ L, FP (10 μ M)/RP (10 μ M) 0.8 μ L, Template (cDNA) 1 μ L, TV 20 μ L.Centrifugal slightly behind the mixing, in ABI 7500, carry out quantitative fluorescent PCR reaction, reaction parameter is set to: 95 ℃ of 30s, 95 ℃ of 5s then, 60 ℃ of 31s, totally 40 circulations.
Described method, said A5 is concrete carry out below operation: the data analysis of miRNAs fluorescent quantitation is internal control gene with miR-16, target gene is carried out normalization method handle, and has guaranteed the amount of comparison object gene in the sample of equal amount.The variation formula that miRNA expresses multiple is RQ=2
-Δ Δ CT, Δ Δ CT=(CT miRNA-CT miR-16) OC-(CT miRNA-CT miR-16) Mean ON wherein.RQ represents relative expression's variable quantity; CT miRNA and CTmiR-16 represent the Ct value with target miRNA and internal control gene miR-16 in the sample respectively; OC deputy activity property consumptive, ON represents normal healthy controls person, and Mean ON represents the MV in all normal control groups.It is not add the cDNA template in the reaction system that negative control and repeated experiments, negative control are set up in experiment, with ddH
2O replaces, and all quantitative fluorescent PCRs are all done 3 repetitions.
Described method, operation below said A5 specifically carries out: GraphPad Prism 5 softwares are adopted in miRNA relative expression component analysis, single sample T check and independent sample T check in the employing software.P＜0.05 o'clock thinks that the result has significant difference on statistics, and P＜0.01 o'clock thinks that the result has utmost point significant difference on statistics.The miRNA data processed result of differential expression is represented with mean+/-standard error, draws the scatter diagram that contains error line.
The present invention prepares the sick special serum miRNAs of active tuberculosis; Utilize the serum miRNAs of the preliminary examination differential expression of high-flux sequence; Use the reverse transcription primer of stem ring method designs specificity; Carry out fluorescence quantifying PCR method and verify the serum miRNAs that obtains differential expression, research control pulmonary tuberculosis is propagated, the incidence that reduces pulmonary tuberculosis has great importance.
Description of drawings
Fig. 1 is the hsa-miR-378 (P＜0.05) that detects expression amount rise in active tuberculosis patient serum with the method for quantitative fluorescent PCR;
Fig. 2 is the hsa-miR-483-5p (P＜0.01) that detects expression amount rise in active tuberculosis patient serum with the method for quantitative fluorescent PCR.
Embodiment
Below in conjunction with specific embodiment, the present invention is elaborated.
Material: the total RNA extraction reagent box is available from Qiagen company; Quantitative fluorescent PCR reverse transcription test kit is available from Fermentas company; SYBR system Mix is available from the precious biotechnology (Dalian) of TaKaRa ltd; 96 orifice plates and film are available from Axygen company.
Embodiment 1
The collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection:
Collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons.All participator's blood samples are to rise morning on an empty stomach to extract, and adopt not anticoagulant blood-collecting pipe of disposal vacuum, gather peripheral blood 3.0mL, and 4 hours with interior centrifugal (3000x g, 10min, 4 ℃), are distributed into each 200 μ L serum sample after sucting clearly, are stored in-80 ℃ of refrigerators.
Embodiment 2
Extract the total RNA in all serum samples:
Active tuberculosis patient and normal healthy controls person's serum are taken out in-80 ℃, treat 4 ℃ of dissolvings naturally; Draw 200 μ L with pipettor, joining 1.5mL does not have in the RNase EP pipe, adds 700 μ L Qiagen Lysis solution, places the violent vortex mixing of vortex appearance to fully cracking, up to can't see the white suspension thing; Room temperature leaves standstill 5min; Add 140 μ L chloroforms; Violent 15s, the standing demix 3min of mixing; See 12000g when demixing phenomenon is arranged, 15min, 4 ℃; Get supernatant liquid (general 500 μ L) with pipettor and transfer in the new 1.5mL collection tube, add the absolute ethyl alcohol of 1.5 times of supernatant volumes, mixing turns upside down; Get 700 μ L and contain the alcoholic acid lysate and be added in the pillar, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube (repeats 2 times) on post; Add 700 μ LRWT solution, the centrifugal 18s of 8000g abandons lower floor, and post is placed on the new collection tube; Add 500 μ L RPE, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube is on post; Add 500 μ L RPE, the centrifugal 2min of 8000g abandons collection tube.Put into new 2mL collection tube to pillar, at full speed centrifugal 1min; Put into 1.5mL Elution pipe to pillar; Add 30 μ L RNase-Free Water, leave standstill 1min, solution is fully combined, then the centrifugal 1min of 8000g with post.
Get the total RNA sample 1.0 μ L of active tuberculosis patient and normal healthy controls person's serum; Detect the OD value through nanodrop-2000; On ultraviolet spectrophotometer, measure A260/A280 numerical value, total rna concentration is between 5～10ng/ μ L as a result for mensuration, and A260/A280 numerical value is between 1.2～1.9.
Embodiment 3: with high-flux sequence examination technology, the miRNAs of preliminary screening active tuberculosis patient and normal healthy controls person's serum differential expression.
20 routine consumptives and 20 routine normal healthy controls persons respectively provide the serum of 20mL; Serum requires: concentration >=5ng/ul after Agilent Bioanalyzer detects, total amount >=100ng; Impurity such as albumen, salt ion is few, and the PAGE gel electrophoresis separates more normal; According to result and information biology software analysis, select differential expression miRNAs like normalization method and variance analysis method of calculation; Comprise hierarchical clustering through clustering method, Kmeans cluster and SOM etc. classify to different samples, and difference miRNAs is carried out similarity analysis, obtain the serum miRNAs of differential expression.
Described method, the PRELIMINARY RESULTS that high-flux sequence examination technology obtains detects 236 miRNAs in active tuberculosis patient serum, detect 254 miRNAs among the normal healthy controls person; Active tuberculosis patient and normal healthy controls person have the serum miRNAs of 91 differential expressions, in the consumptive, have 44 miRNAs expression amounts to raise, 47 miRNAs expression amount downward modulations.The miRNAs that chooses satisfies three conditions: 1. in active tuberculosis patient or normal healthy controls person, detect the miRNAs expression amount and reach 20copies at least; 2. differential expression is more than 2 times; 3. there were significant differences (P＜0.01) for the P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
Embodiment 4: the design miRNAs stem ring reverse transcription primer and the upper reaches, downstream primer.
In the miRBase DB, find the mature sequence of corresponding miRNAs; Hsa-let-7i (MIMAT0000415UGAGGUAGUAGUUUGUGCUGUU); Hsa-miR-122 (MIMAT0000421UGGAGUGUGACAAUGGUGUUUG); Hsa-miR-146a (MIMAT0000449UGAGAACUGAAUUCCAUGGGUU), hsa-miR-146b-5p (MIMAT0002809UGAGAACUGAAUUCCAUAGGCU), hsa-miR-181a-2* (MIMAT0004558ACCACUGACCGUUGACUGUACC); Hsa-miR-320c (MIMAT0005793AAAAGCUGGGUUGAGAGGGU); Hsa-miR-378 (MIMAT0000732ACUGGACUUGGAGUCAGAAGG), hsa-miR-483-5p (MIMAT0004761AAGACGGGAGGAAAGAAGGGAG), hsa-miR-93 (MIMAT0000093CAAAGUGCUGUUCGUGCAGGUAG).
With general stem ring method design.3 ' end at general stem ring adds 6 and ripe miRNAs 3 ' end reverse complemental paired base, is stem ring primer, that is:
hsa-let-7i：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGC，
hsa-miR-122：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAACA，
hsa-miR-146a：
GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACCCA，
hsa-miR-146b-5p：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCTA，
hsa-miR-181a-2*：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGTACA，
hsa-miR-320c：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCTC，
hsa-miR-378：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTTCT，
hsa-miR-483-5p：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCCCT，
hsa-miR-93：
GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT；
Can carry out rt to miRNAs.
The each rt of stem ring primer can only be to a kind of miRNAs or 6 miRNAs that base is identical of 3 ' end.And fluorescent quantitation upstream and downstream design of primers, downstream primer is the part on the stem ring, and upstream primer can pass through the primer5.0 software design; About upstream and downstream primer length 20bp; Annealing temperature Tm value about 60 ℃, the about 40%-60% of GC content, amplified production is about 60bp.Design of primers is estimated through 7.0 pairs of primers of lesegene after accomplishing.Use general downstream primer and the special upstream primer of miRNAs to increase.
General downstream primer is: 5 '-AGTGCAGGGTCCGAGGTATT-3 ',
Upstream primer: hsa-let-7i (5 '-CTCGGCCTGAGGTAGTAGTTTG-3 '),
hsa-miR-122(5’-CGCGGTGGAGTGTGACAATG-3’)，
hsa-miR-146a(5’-GGGTGAGAACTGAATTCCA-3’)，
hsa-miR-146b-5p(5’-ATGGCCTGAGAACTGAATTCC-3’)，
hsa-miR-181a-2*(5’-ATCTGTCACCACTGACCGTTG-3’)，
hsa-miR-320c(5’-ATGCCAAAAGCTGGGTTGA-3’)，
hsa-miR-378(5’-GATAATACTGGACTTGGAGTC-3’)，
hsa-miR-483-5p(5’-TCTCGGAAGACGGGAGGA-3’)，
hsa-miR-93(5’-CGCGGCAAAGTGCTGTTC-3’)，
Increasing in active tuberculosis patient serum sample with confidential reference items miR-16 is example; Observe the amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has tangible logarithmic phase; And blank does not have the continuous curve generation, explains that amplification is all right.MiR-16 product to amplification is done solubility curve, have and have only one tangible unimodal, occur and there is the no obvious crest of template (NTC) contrast, explain that the warp after product that increases is special miR-16.Be that this is quantitatively pollution-free, accurately, reliable.
The sick relevant serum miRNAs of quantitative fluorescent PCR checking active tuberculosis.
Carry out reverse transcription with Fermentas reverse transcription test kit.Reverse transcription reaction system: total RNA 2.5 μ L, RNase suppressor factor RRI 0.25 μ L, dNTP (10mM each) 0.5 μ L, 5 * M-MuLV buffer, 1.0 μ L, stem ring primer SLP (2 μ M) 0.5 μ L, M-MuLV ThermoScript II 0.25 μ L, TV 5 μ L.Method is carried out in two steps, the first step: 65 ℃, and 5min; On ice, 10min.Second step: 42 ℃, 60min; 70 ℃, 15min; After reaction finishes, be stored in-80 ℃ of refrigerators.
Quantitative fluorescent PCR system: ddH
2O 7 μ L, SYBR system Mix 10 μ L, 50*ROX refenence dye0.4 μ L, FP (10 μ M)/RP (10 μ M) 0.8 μ L, Template (cDNA) 1 μ L, TV 20 μ L.Centrifugal slightly behind the mixing, in ABI 7500, carry out quantitative fluorescent PCR reaction, reaction parameter is set to: 95 ℃ of 30s, 95 ℃ of 5s then, 60 ℃ of 31s, totally 40 circulations.
The data analysis of miRNAs fluorescent quantitation is internal control gene with miR-16, target gene is carried out normalization method handle, and has guaranteed the amount of comparison object gene in the sample of equal amount.The variation formula that miRNA expresses multiple is RQ=2
-Δ Δ CT, Δ Δ CT=(CT miRNA-CT miR-16) OC-(CT miRNA-CT miR-16) Mean ON wherein.RQ represents relative expression's variable quantity; CT miRNA and CT miR-16 represent the Ct value with target miRNA and internal control gene miR-16 in the sample respectively; OC deputy activity property consumptive, ON represents normal healthy controls person, and MeanON represents the MV in all normal control groups.It is not add the cDNA template in the reaction system that negative control and repeated experiments, negative control are set up in experiment, with ddH
2O replaces, and all quantitative fluorescent PCRs are all done 3 repetitions.
Qualification result:
The collection of active tuberculosis patient and normal healthy controls person's serum sample and clinical detection
Collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons altogether.Tuberculosis sufferer blood sample is to rise morning on an empty stomach to extract, and adopts not anticoagulant blood-collecting pipe of disposal vacuum, gathers peripheral blood 3.0mL, and is centrifugal.Be distributed into each 200 μ L serum sample after sucting clearly, be stored in-80 ℃ of refrigerators.It is similar in normal healthy controls person and active tuberculosis sufferer that final selected sample guarantees that men and women's sex ratio, age, active tuberculosis cause of disease expose history, vaccine inoculation and skin PPD test.The case essential information is seen table 1.
aThe P value representation is done the T check between two groups,
bThe P value representation is χ between two groups
2Check.
Ill example of table 1 active tuberculosis and normal healthy controls clinical pathology information
Extract total RNA of serum sample
Because total RNA enrichment is lower in the serum sample, the serum that extracts 200 μ L through the Qiagen test kit can obtain between concentration 5～10ng/ μ L of total RNA, and A260/A280 numerical value is between 1.2～1.9.Because content is lower, so we generally do not carry out detected through gel electrophoresis, and mainly become cDNA to be used for quantitative fluorescent PCR total RNA reverse transcription.Total RNA in serum sample has unusual stability, can tolerate multigelation, acid-alkali treatment, DNase processing etc.The NanoDrop-2000 of total RNA mensuration result sees table 2 in the serum sample.
The NanoDrop-2000 of total RNA measures the result in table 2 serum sample
The high-flux sequence examination of the serum miRNAs that active tuberculosis is sick special
With high-flux sequence examination technical Analysis 20 routine consumptives and 20 routine normal healthy controls person's serum miRNAs.The PRELIMINARY RESULTS that high-flux sequence examination technology obtains detects 236 miRNAs in active tuberculosis patient serum, detect 254 miRNAs among the normal healthy controls person; The kind of active tuberculosis patient and the medium and small RNAs of normal healthy controls person's serum is seen table 3; The quantity of miRNAs is seen table 4 in active tuberculosis patient and the normal healthy controls person's serum.Active tuberculosis patient and normal healthy controls person have the serum miRNAs of 91 differential expressions, in the consumptive, have 44 miRNAs expression amounts to raise and see table 5, and table 6 is seen in 47 miRNAs expression amount downward modulations.
Table 3 is used the kind of high-flux sequence examination technical Analysis active tuberculosis patient and the medium and small RNAs of normal healthy controls person's serum
Table 4 is used the quantity of miRNAs in high-flux sequence examination technical Analysis active tuberculosis patient and the normal healthy controls person's serum
Expression amount raises table 5 application high-flux sequence examination technical Analysis in active tuberculosis patient serum
Reduce by expression amount in active tuberculosis patient serum for table 6 application high-flux sequence examination technical Analysis
The miRNAs that chooses satisfies three conditions: 1. in active tuberculosis patient or normal healthy controls person, detect the miRNAs expression amount and reach 20copies at least; 2. differential expression is more than 2 times; 3. there were significant differences (P＜0.01) for the P value.Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a, hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c, hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
The design miRNAs stem ring reverse transcription primer and the upper reaches, downstream primer:
In general stem is around-France, have 14 pairs of bases to form stem structure, 16 bases form ring structure, and this stem ring has very high stability.3 ' end at general stem ring adds 6 and ripe miRNAs 3 ' end reverse complemental paired base, is stem ring primer, can carry out rt to miRNAs, uses the special upstream primer of general downstream primer and miRNAs to increase at last.The each rt of stem ring primer can only be to a kind of miRNAs or 6 miRNAs that base is identical of 3 ' end.And fluorescent quantitation upstream and downstream design of primers, reverse primer is the last branch of stem ring, and upstream primer can be through primer 5.0 designs; About upstream and downstream primer length 20bp; Annealing temperature Tm value about 60 ℃, the about 40%-60% of GC content, amplified production is about 60bp.Design of primers can be estimated through 7.0 pairs of primers of lesegene after accomplishing.To expression of results and the analysis of 9 serum miRNAs behind quantitative fluorescent PCR; Increasing in active tuberculosis patient serum sample with confidential reference items miR-16 is example; Observe the amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has tangible logarithmic phase; And blank does not have the continuous curve generation, explains that amplification is all right.MiR-16 product to amplification is done solubility curve, have and have only one tangible unimodal, occur and there is the no obvious crest of template (NTC) contrast, explain that the warp after product that increases is special miR-16.Be that this is quantitatively pollution-free, accurately, reliable.
The sick special serum miRNAs of quantitative fluorescent PCR checking active tuberculosis
Data to the quantitative fluorescent PCR gained are analyzed; Draw the serum miRNAs relative expression difference multiple between active tuberculosis patient and the normal healthy controls person; Test with the Mann-Whitney method in GraphPad Prism 5 statistical analysis softwares, whether the differential expression of serum analysis miRNAs in two groups of sample serum has significant difference (P＜0.05) on statistics again.9 miRNAs in 60 routine active tuberculosis patients and the 60 routine normal healthy controls group serum are verified; The result finds that hsa-miR-378 and hsa-miR-483-5p have significant difference (being respectively P＜0.05 and P＜0.01) between pulmonary tuberculosis group and normal healthy controls group; Difference is more than 2 times; Ct value＜35, verification and measurement ratio＞75% (Fig. 1 and Fig. 2).
The preparation method of the serum miRNAs that a kind of active tuberculosis of the present invention is sick special is used for the serum miRNAs of differential expression between detected activity property consumptive and the normal healthy controls person, has higher specificity and accuracy.
Should be understood that, concerning those of ordinary skills, can improve or conversion, and all these improvement and conversion all should belong to the protection domain of accompanying claims of the present invention according to above explanation.
Claims (10)
1. the preparation method of the sick special serum miRNAs of an active tuberculosis is characterized in that, may further comprise the steps: A1: the collection and the clinical detection of active tuberculosis patient and normal healthy controls person's serum sample; A2: the total RNA that extracts serum sample; A3: the high-flux sequence examination of the serum miRNAs that active tuberculosis is sick special; A4: the design miRNAs stem ring reverse transcription primer and the upper reaches, downstream primer; Stem ring reverse transcription primer is SEQ ID NO:10-SEQ ID NO:18; General upstream primer is SEQ ID NO:19, and downstream primer is SEQ ID NO:20-SEQ ID NO:28; A5: the sick special serum miRNAs of quantitative fluorescent PCR checking active tuberculosis.
2. method according to claim 1 is characterized in that, operation below the concrete execution of said A1: collect 80 routine active tuberculosis patients and 80 routine normal healthy controls persons.All participator's blood samples are to rise morning on an empty stomach to extract, and adopt not anticoagulant blood-collecting pipe of disposal vacuum, gather peripheral blood 3.0mL, and 4 hours with interior centrifugal: 3000x g, 10min, 4 ℃; Be distributed into each 200 μ L after sucting clearly, be stored in-80 ℃ of refrigerators.
3. method according to claim 2 is characterized in that, operation below the concrete execution of said A2: active tuberculosis patient and normal healthy controls person's serum are taken out in-80 ℃, treat 4 ℃ of dissolvings naturally; Draw 200 μ L with pipettor, joining 1.5ml does not have in the RNase EP pipe, adds 700 μ L Qiagen Lysis solution, places the violent vortex mixing of vortex appearance to fully cracking, up to can't see the white suspension thing; Room temperature leaves standstill 5min; Add 140 μ L chloroforms; Violent 15s, the standing demix 3min of mixing; See 12000g when demixing phenomenon is arranged, 15min, 4 ℃; Get supernatant liquid with pipettor and transfer in the new 1.5mL collection tube, add the absolute ethyl alcohol of 1.5 times of supernatant volumes, mixing turns upside down; Get 700 μ L and contain the alcoholic acid lysate and be added in the pillar, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube repeats 2 times on post; Add 700 μ LRWT solution, the centrifugal 18s of 8000g abandons lower floor, and post is placed on the new collection tube; Add 500 μ L RPE, the centrifugal 18s of 8000g abandons lower floor, and the replacement collection tube is on post; Add 500 μ L RPE, the centrifugal 2min of 8000g abandons collection tube.Put into new 2ml collection tube to pillar, at full speed centrifugal 1min; Put into 1.5mL Elution pipe to pillar; Add 30 μ L RNase-Free Water, leave standstill 1min, solution is fully combined with post, the centrifugal 1min of 8000g repeats 2 times then.
Get the total RNA sample 1.0 μ L of active tuberculosis patient and normal healthy controls person's serum, detect the OD value, on ultraviolet spectrophotometer, measure A260/A280 numerical value, represent between 1.8～2.0 that when its numerical value the purity of total RNA is better through nanodrop-2000; Less than albumen in the 1.8 explanation solution or the time other organic pollutions apparent in view, then possibly degrade by total RNA greater than 2.0; And A260/A230, then ratio should be between 2～2.5, and then explanation less than normal has the residual salt residue.
4. method according to claim 3 is characterized in that, operation below the concrete execution of said A3: with high-flux sequence examination technology, the serum miRNAs of differential expression between preliminary screening active tuberculosis patient and the normal healthy controls person; 20 routine consumptives and 20 routine normal healthy controls persons respectively provide the serum of 5mL; Serum requires: concentration >=5ng/ul after Agilent Bioanalyzer detects, total amount >=100ng; Impurity such as albumen, salt ion is few, and the PAGE gel electrophoresis separates more normal; According to result and information biology software analysis, select differential expression miRNAs like normalization method and variance analysis method of calculation; Comprise hierarchical clustering through clustering method, Kmeans cluster and SOM etc. classify to different samples, and difference miRNAs is carried out similarity analysis, obtain the serum miRNAs of differential expression.
5. method according to claim 3 is characterized in that, said A3 is concrete carry out below operation: the PRELIMINARY RESULTS that obtains according to high-flux sequence examination technology; Filter out 9 miRNAs:hsa-let-7i, hsa-miR-122, hsa-miR-146a; Hsa-miR-146b-5p, hsa-miR-181a-2*, hsa-miR-320c; Hsa-miR-378, hsa-miR-483-5p, hsa-miR-93.
6. method according to claim 4 is characterized in that, operation below the concrete execution of said A4: in the miRBase DB, find the mature sequence of corresponding miRNAs, with general stem ring method design; 3 ' end at general stem ring adds 6 and ripe miRNAs 3 ' end reverse complemental paired base, is stem ring primer, can carry out rt to miRNAs, uses the special upstream primer of general downstream primer and miRNAs to increase at last; The each rt of stem ring primer can only be to a kind of miRNAs or 6 miRNAs that base is identical of 3 ' end; And fluorescent quantitation upstream and downstream design of primers, downstream primer is the part on the stem ring, and upstream primer can be through primer 5.0 designs; About upstream and downstream primer length 20bp; Annealing temperature Tm value about 60 ℃, the about 40%-60% of GC content, amplified production is about 60bp; Design of primers is estimated through 7.0 pairs of primers of lesegene after accomplishing; Increasing in active tuberculosis patient serum sample with confidential reference items miR-16 is example; Observe the amplification situation, amplification curve is level and smooth and along with the increase of cycle number, fluorescent signal has tangible logarithmic phase; And blank does not have the continuous curve generation, explains that amplification is all right; MiR-16 product to amplification is done solubility curve, have and have only one tangible unimodal, occur and there is the no obvious crest of template contrast, explain that the warp after product that increases is special miR-16; Be that this is quantitatively pollution-free, accurately, reliable.
7. method according to claim 5 is characterized in that, operation below the concrete execution of said A5: carry out reverse transcription with Fermentas reverse transcription test kit; Reverse transcription reaction system: total RNA 2.5 μ L, RNase suppressor factor RRI 0.25 μ L, dNTP (10mM each) 0.5 μ L, 5 * M-MuLV buffer, 1.0 μ L, stem ring primer SLP (2 μ M) 0.5 μ L, M-MuLV ThermoScript II 0.25 μ L, TV 5 μ L.Method is carried out in two steps, the first step: 65 ℃, and 5min; On ice, 10min.Second step: 42 ℃, 60min; 70 ℃, 15min; After reaction finishes, be stored in-80 ℃ of refrigerators.
8. method according to claim 5 is characterized in that, operation below the concrete execution of said A5: the serum miRNAs that carries out quantitative fluorescent PCR checking differential expression with the SYBR method; Quantitative fluorescent PCR system: ddH
2O7 μ L, SYBR system Mix 10 μ L, 50*ROX refenence dye 0.4 μ L, FP (10 μ M)/RP (10 μ M) 0.8 μ L, Template (cDNA) 1 μ L, TV 20 μ L; Centrifugal slightly behind the mixing, in ABI 7500, carry out quantitative fluorescent PCR reaction, reaction parameter is set to: 95 ℃ of 30s, 95 ℃ of 5s then, 60 ℃ of 31s, totally 40 circulations.
9. method according to claim 5; It is characterized in that; Said A5 is concrete carry out below operation: the data analysis of miRNAs fluorescent quantitation is internal control gene with miR-16, target gene is carried out normalization method handle, and has guaranteed the amount of comparison object gene in the sample of equal amount; The variation formula that miRNA expresses multiple is RQ=2
-Δ Δ CT, Δ Δ CT=(CT miRNA-CT miR-16) OC-(CT miRNA-CT miR-16) Mean ON wherein.RQ represents relative expression's variable quantity; CT miRNA and CT miR-16 represent the Ct value with target miRNA and internal control gene miR-16 in the sample respectively; OC deputy activity property consumptive, ON represents normal healthy controls person, and Mean ON represents the MV in all normal control groups; It is not add the cDNA template in the reaction system that negative control and repeated experiments, negative control are set up in experiment, with ddH
2O replaces, and all quantitative fluorescent PCRs are all done 3 repetitions.
10. method according to claim 5 is characterized in that, operation below said A5 specifically carries out: GraphPad Prism 5 softwares are adopted in miRNA relative expression component analysis, single sample T check and independent sample T check in the employing software; P＜0.05 o'clock thinks that the result has significant difference on statistics, and P＜0.01 o'clock thinks that the result has utmost point significant difference on statistics; The miRNA data processed result of differential expression is represented with mean+/-standard error, draws the scatter diagram that contains error line.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210171919.8A CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210171919.8A CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102732520A true CN102732520A (en) | 2012-10-17 |
| CN102732520B CN102732520B (en) | 2016-01-20 |
Family
ID=46988822
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210171919.8A Active CN102732520B (en) | 2012-05-30 | 2012-05-30 | The preparation method of the serum miRNAs that a kind of active tuberculosis is sick special |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102732520B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571938A (en) * | 2013-02-25 | 2014-02-12 | 哈尔滨医科大学 | Reverse transcription polymerase chain reaction (PCR) method for detecting tubercle bacillus infection from clinical specimen |
| CN104017806A (en) * | 2014-05-08 | 2014-09-03 | 复旦大学 | MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent |
| EP3026121A1 (en) * | 2014-11-27 | 2016-06-01 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Micro-RNA-based diagnosis of tuberculosis |
| CN109593845A (en) * | 2019-01-25 | 2019-04-09 | 河北仁博科技有限公司 | Purposes of the miRNA as the marker of diagnosis of endometriosis |
| CN109852686A (en) * | 2019-02-26 | 2019-06-07 | 浙江大学医学院附属妇产科医院 | The internal reference collection of excretion body miRNA a kind of and more internal reference combination with standard sizing techniques |
| CN110018302A (en) * | 2019-03-27 | 2019-07-16 | 南京大学 | It is a kind of new to cause pulmonary inflammatory diagnosing and treating reagent by liver diseases |
| CN114231612A (en) * | 2021-12-27 | 2022-03-25 | 深圳大学 | MiRNA marker related to active tuberculosis and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106884052A (en) * | 2017-03-23 | 2017-06-23 | 李继承 | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307361A (en) * | 2008-07-15 | 2008-11-19 | 南京大学 | Method for identifying miRNA in blood serum of patient with lung cancer by Solexa technology |
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
-
2012
- 2012-05-30 CN CN201210171919.8A patent/CN102732520B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101307361A (en) * | 2008-07-15 | 2008-11-19 | 南京大学 | Method for identifying miRNA in blood serum of patient with lung cancer by Solexa technology |
| WO2011109440A1 (en) * | 2010-03-01 | 2011-09-09 | Caris Life Sciences Luxembourg Holdings | Biomarkers for theranostics |
Non-Patent Citations (3)
| Title |
|---|
| FU Y. 等: "Circulating MicroRNAs in Patients with Active Pulmonary Tuberculosis", 《JOURNAL OF CLINICAL MICROBIOLOGY》, vol. 49, no. 12, 31 December 2011 (2011-12-31), pages 4246 - 4251 * |
| MAERTZDORF J.等: "Common patterns and disease-related signatures in tuberculosis and sarcoidosis", 《PNAS》, 30 April 2012 (2012-04-30) * |
| 张立群 等: "肺结核患者外周血单核细胞中差异表达miRNA的筛选", 《中国防痨杂志》, vol. 33, no. 11, 30 November 2011 (2011-11-30), pages 729 - 733 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103571938A (en) * | 2013-02-25 | 2014-02-12 | 哈尔滨医科大学 | Reverse transcription polymerase chain reaction (PCR) method for detecting tubercle bacillus infection from clinical specimen |
| CN104017806A (en) * | 2014-05-08 | 2014-09-03 | 复旦大学 | MicroRNA (Ribose Nucleic Acid) and application thereof in preparation of active tuberculosis detection reagent |
| EP3026121A1 (en) * | 2014-11-27 | 2016-06-01 | Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V. | Micro-RNA-based diagnosis of tuberculosis |
| CN109593845A (en) * | 2019-01-25 | 2019-04-09 | 河北仁博科技有限公司 | Purposes of the miRNA as the marker of diagnosis of endometriosis |
| CN109852686A (en) * | 2019-02-26 | 2019-06-07 | 浙江大学医学院附属妇产科医院 | The internal reference collection of excretion body miRNA a kind of and more internal reference combination with standard sizing techniques |
| CN110018302A (en) * | 2019-03-27 | 2019-07-16 | 南京大学 | It is a kind of new to cause pulmonary inflammatory diagnosing and treating reagent by liver diseases |
| CN114231612A (en) * | 2021-12-27 | 2022-03-25 | 深圳大学 | MiRNA marker related to active tuberculosis and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102732520B (en) | 2016-01-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102732520A (en) | Preparation method for serum miRNAs specific to active pulmonary tuberculosis | |
| Wu et al. | Analysis of microRNA expression profiling identifies miR-155 and miR-155* as potential diagnostic markers for active tuberculosis: a preliminary study | |
| Woo et al. | Clinical spectrum of Exophiala infections and a novel Exophiala species, Exophiala hongkongensis | |
| EP2406402B1 (en) | Method to assess human allograft status from microrna expression levels | |
| CN106939333B (en) | Application of the miRNA marker in the Cervical intraepitheliaI neoplasia reagent for preparing screening folic acid deficiency group | |
| US20170283883A1 (en) | Methods for lung cancer detection | |
| CN105177132A (en) | RT-PCR method for quantitatively detecting miRNA | |
| CN106811529A (en) | The fluorescent quantificationally PCR detecting kit and primer of mycobacterium tuberculosis, probe | |
| KR20130029079A (en) | Marker consisting of plasma microrna and a new method for diagnosis of hepatocellular carcinoma | |
| CN107653315A (en) | Applications of the lncRNAs active tuberculosis disease-specific mark | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN112195244B (en) | Application of GMFB (GMFB) as hepatocyte liver cancer biomarker | |
| Li et al. | The Molecular Heterogeneity of Natural Cordyceps sinensis with Multiple Ophiocordyceps sinensis Fungi Challenges the Anamorph-Teleomorph Connection Hypotheses. | |
| CN101555520A (en) | Has-mir-122 kit for early prediction of hepatocirrhosis developed from chronic hepatitis B and detection method thereof | |
| CN104059994B (en) | A kind of test kit based on serum miRNA and using method thereof and application | |
| CN110184353B (en) | SNP marker related to esophagus cancer patient prognosis and application thereof | |
| Li et al. | Screening and validating the immune-related gene expression signatures in peripheral blood mononuclear cells of nonischaemic cardiomyopathy | |
| CN109266751B (en) | Biomarker combination for nasopharyngeal carcinoma diagnosis and application | |
| CN102021169A (en) | Serum/plasma miRNA composition and use thereof | |
| CN101363064B (en) | Standard substance for detecting influenza a virus load and detection method thereof | |
| CN109722491A (en) | The real-time fluorescence quantitative PCR primer and probe and its application of HIV-1 RNA quantitative detection | |
| CN107557441A (en) | Diagnosis of glioma mark Circ2:23823258 | 23823569 and application | |
| CN107604076A (en) | Diagnosis of glioma mark Circ6:4891713 | 4892379 and application | |
| CN106554991A (en) | Can be used for the blood miR-134 detection kits of coronary artery calcification diagnosis | |
| CN116218979A (en) | Hepatitis B microRNA molecular marker combination and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |