CN102260667B - Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS - Google Patents
Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS Download PDFInfo
- Publication number
- CN102260667B CN102260667B CN201010601506.XA CN201010601506A CN102260667B CN 102260667 B CN102260667 B CN 102260667B CN 201010601506 A CN201010601506 A CN 201010601506A CN 102260667 B CN102260667 B CN 102260667B
- Authority
- CN
- China
- Prior art keywords
- cell
- sirna
- hiv
- mixture
- cell particles
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a medicine for treating AIDS, wherein, the cell microparticles of the medicine carry siRNA with the singularity of anti-HIV. The invention further relates to a preparation method of the medicine.
Description
Technical field
The invention belongs to treating AIDS pharmaceutical field, the method that specifically adopts RNA to disturb is carried out the treatment of acquired immune deficiency syndrome (AIDS).Provide efficient, specific siRNA and conduct to transport the cell particles of carrier.Both mixtures can be used as the treatment that medicine carries out acquired immune deficiency syndrome (AIDS) and HIV the infected.
Prior art
Acquired immune deficiency syndrome (AIDS)
The medical science name of acquired immune deficiency syndrome (AIDS) is called " acquired immune deficiency syndrome (AIDS) " (english abbreviation AIDS), is the serious transmissible disease that a kind of case fatality rate is very high.It is infected and is caused by human immunodeficiency virus (HIV), take T cellular immune function defect as main a kind of comprehensive immunodeficient disease.It destroys T4 lymphocyte, thereby whole human immune system is destroyed using most important T4 lymphocyte in human immune system as target of attack.When human body is during in standard state, vivo immuning system can effectively be resisted the attack of various viruses.Once hiv virus is invaded in body, this good defense system just can be disintegrated, and various virus is seized the opportunity by blood, damaged wound and driven straight in.In addition, some undesired cells as cancer cells and so in human body, also can ramp, breeding, finally develops into each carcinoid tumor.Generally, hiv virus is by destroying people's immunity system and body resistivity, finally causes human body to be lost the resistivity of various diseases is caused dead.
HIV is with tunicary RNA retrovirus, in classification, belongs to the lentiviridae in Retroviridae, has found at present HIV-1 type and HIV-2 type.HIV is ball-type or ovum type, and diameter 100-150nm is bilayer structure.The core of virus is positioned at the central or eccentric of virosome, core is comprised of RNA and nucleocapsid protein matter (P7, P9), reversed transcriptive enzyme (Reverse Transcriptase, RT), ribonuclease H (Ribo H) and intergrase (INT); Core is viral capsid outward, is 20 bodies three-dimensional symmetrical, protein (P17/P18, P24/P25), consists of.Virus outermost layer is membranin.On coating, there are 72 furcellas (Spike), containing glycoprotein gp120, and in lipid bilayer, have gP41 albumen.
Hiv virus is directly invaded human immune system after invading human body, attack and kill and wound be most important in human immune system, there is offensive T4 lymphocyte most, make the body status in forfeiture defence capability at the very start.Once hiv virus enters human body, just parasitize most crucial position in T4 lymphocyte, and integrate with nuclear hereditary material DNA, and utilize T4 lymphocyte to carry out copying of self genetic material.The breeding of virus and copy and immunocyte is destroyed and destroy, and emit more virus.New virus of proliferation infects more cell again.Like this, virus copies generation upon generation ofly, breeds, and immunocyte is constantly dead.
Acquired immune deficiency syndrome (AIDS) trafficability characteristic, blood and three kinds of ways of contact of mother and baby are propagated, and are a kind of communicable diseases of serious harm health.Acquired immune deficiency syndrome (AIDS) is from finding so far only decades, but it in the whole world caused being widely current, made more than 3,000 ten thousand people be infected, more than 1,000 ten thousand people have lost life, have every day in the world more than ten thousand people newly to infect hiv virus.
Treating AIDS present situation
At present, the medicine of AIDS virus resisting treatment comprises: efabirenz, non-nucleoside reverse transcriptase inhibitor, proteinase inhibitor etc.
The effect of efabirenz is by the reverse transcription of blocking virus rna gene, i.e. the formation of the distrand DNA of blocking virus, the template that virus is lost copy.First these medicines enter infected cell, and then phosphorylation forms the activated triphosphoric acid compound of tool.AZT and d4T are the analogues that viral nucleic acid copies natural substrate deoxythymidine dT; DdC and 3TC are the analogues of Deoxyribose cytidine dC, these dideoxyribonucleoside triphosphate salt are HIV1-RT competitive inhibitors, when they insert the DNA chain of growth, can cause immature DNA chain termination, viral DNA biosynthesis block also and then causes virus replication to be suppressed.
Non-nucleoside reverse transcriptase inhibitor is one group and has nothing to do with nucleosides, the diverse specificity of chemical structure suppresses the compound of HIV1-RT, they are not HIV1-RT substrate competition inhibitor, but by being combined and suppressing reversed transcriptive enzyme with near p66 hydrophobic region enzymic activity point.
Proteinase inhibitor is the compound based on peptide class, they or competitive inhibition protease activity, or as the inhibitor of complementary protease activity point, and function that can protease inhibition, makes the new virus producing can not be ripe.
Popular highly active antiretroviral therapy, is commonly called as " drug cocktail therapy (treatment) " at present, is to adopt proteinase inhibitor to add method treatment the infected of two kinds of efabirenzs and patient's method.This kind of medicine has stronger antivirus action, after using, can in blood plasma, can't detect virus, and can this curative effect of long term maintenance.In addition, it can also make the human immunity gain-of-function being destroyed by hiv virus recover or part recovery.But this therapy has the limitation of itself, comprise the shortcomings such as the high and side effect of medical expense is obvious.
Disturbance ribonucleic acid (small interfering RNA, siRNA)
This is the double stranded rna molecule that a class is comprised of more than 20 Nucleotide, can play the effect that silencer is expressed by the degrade messenger RNA(mRNA) (messager RNA, mRNA) of target gene of specificity.This process is called as RNA and disturbs (RNA interference, RNAi).
It is a kind of mode regulating and controlling after genetic transcription that RNA disturbs.SiRNA can carry out specific recognition to its target gene, and can recruit the protein complex that is called as silencing complex (RNA induced silencing complex, RISC).RISC comprises rnase etc., can cut by target the mode of homology mRNA, special, the expression of suppressor gene efficiently.Owing to using the RNA perturbation technique can specific depletion or close the expression of specific gene, so this technology has been widely used in the treatment field of biomedicine experiment research and various diseases.
The acquired immune deficiency syndrome (AIDS) of application RNA interference method treatment has at present become the focus for the treatment of AIDS research, by designing for the virus genomic siRNA of HIV, and can specificity degraded viral genome, fundamentally kill virus.Study verifiedly, siRNA can suppress HIV virus copying in culturing cell in vitro effectively.SiRNA can reach the object that stops HIV to infect by suppressing HIV virus autogene (as ple, gag, rev, tat and env) or host gene (as the principal recipient CD4 of HIV).
Yet application siRNA treatment acquired immune deficiency syndrome (AIDS) also exists some to have problem to be solved, comprise that siRNA imports the problems such as poor stability of the low and siRNA of efficiency.At present, the mode of carrier delivery or antibody coupling is mainly taked in the importing of siRNA.Carrier comprises that liposome, nanometre glue are assisted, cyclodextrin inclusion etc., although these carriers can prolong drug retention time in vivo and be improved to a certain extent the specific absorption of siRNA medicine, its targeting and high efficiency that transmits medicine is still not enough.Although the mode of antibody coupling can improve the targeting of siRNA, siRNA stability in vivo can not be guaranteed.
Therefore, as treatment AIDS patients and HIV virus infection crowd's potential drug, also there are some open questions in RNA interference method at present, and sending the poor specificity of siRNA and efficiency low is the major cause of anti-its application of obstruction.
Cell particles (Microvesicles)
This is that a class size is between 10-500nm, for example, by cell generation biology (vesica) structure (secretion), that have bilayer lipid membrane.As far back as 1967, just have report, it derives from thrombocyte, comprises vesica, is called as at that time " platelet dust ", has the effect that promotion is condensed.In vitro study afterwards finds that endotheliocyte, vascular smooth muscle cell, white corpuscle, lymphocyte, red corpuscle etc. also can discharge (cell) micropartical.The approach producing according to micropartical, can divide into micropartical exosomes and shedding vesicles again.Exosomes be cell in the situation that being stimulated, by many vesicas corpusculum (Multivesicular bodies, MVBs) exocytosis, to extracellular, shedding vesicles directly secretes out in the mode of sprouting from cell surface.At present, the shedding vesicles of different emiocytosises is named as different titles, such as the ectosomes that is called as of neutrophil leucocyte and monocyte secretion, secretion of platelet be called as microparticles.The film component of cell particles depends on the cell in its source, mainly lipid and protein, consists of.
We study and find that cell particles derives from organism, organism is had to high-affinity, desirable medicine carrier, can be used in RNA interference method for as treatment aids patient and HIV virus infection crowd to send efficiently, specifically siRNA.
Particularly, we find: cell particles is that a kind of transport efficacy is in vivo high, the biological vesicle carrier of high specificity, and the atomic film telogenesis that different cells discharge divides (comprising specific surfaces acceptor and film fat structure) identical with the plasma membrane composition of corresponding cell, therefore, cell particles, with the derived cell distinctive receptor protein in surface or film fat structure, has high-affinity with corresponding target cell; Simultaneously, owing to also containing the siRNA required important albumen that plays a role in cell particles, therefore, if adopt cell particles as the carrier that transports siRNA, just can high-level efficiency, optionally send siRNA to target cell/tissue, thereby the effect that greatly improves siRNA regulating cell function.Therefore, because cell particles (comprise all film lipid vesicle structures with cell particles feature, claim such as exosome and shedding vesicles and for the spy of the shedding vesicles of various emiocytosises) can improve specificity, targeting and the stability of siRNA transportation; And can promote the advantages such as siRNA action effect, can be effective in the treatment of acquired immune deficiency syndrome (AIDS).
Therefore, the invention provides a kind of application cell micropartical and transport the method for the virus genomic siRNA of HIV.The invention still further relates to the mixture of cell particles-anti-HIV specific siRNA, its preparation method, and in the application for the treatment of the aspects such as acquired immune deficiency syndrome (AIDS) and HIV the infected.
Summary of the invention
The invention provides a kind of medicinal composition for the treatment of acquired immune deficiency syndrome (AIDS), can be used for the medicine of effective delivering therapeutic acquired immune deficiency syndrome (AIDS).Described medicinal composition is the mixture of siRNA and cell particles, comprises for the virus genomic siRNA of HIV and as the cell particles of carrier;
Described HIV virus comprises two types of HIV-1 and HIV-2.
Preferably, described HIV virus is HIV-1 C-type virus C.
Described siRNA comprise all can be for HIV genome, and can cause the siRNA sequence of HIV genome specificity degraded.
Preferably, described siRNA sequence be following sequence one or more:
1)HIV-G1：GCCCTTCAGACAGGATCAGAA
2)HIV-G2：AAGCAGCCATGCAAATGTTAA
3)HIV-G3：TCCCAGTAGGAGAAATCTATA
4)HIV-G4：GCAAGCTTCACAGGAGGTAAA
5)HIV-T1：AGATCCTAGACTAGAGCCCTG
6)HIV-T2：TGGAAGCATCCAGGAAGTCAG
7)HIV-T3：GCATCCAGGAAGTCAGCCTAA
8)HIV-T4：TCAAAGCAACCCACCTCCCAA
Described cell particles comprises that all size is between 10-500nm, by emiocytosis, for example, to sprout or exocytosis form natural biological vesica secretion, that there is bilayer lipid membrane, comprise and be called as the structure of exosome, shedding vesicles and the shedding vesicles of various emiocytosises.
Described cell particles and siRNA exist with parcel and wrapped relation;
Described cell particles-siRNA mixture has the secretion of the host cell of siRNA to produce for expressing;
Described host cell comprises the primary culture of existing all cells system, cell strain and normal people or Disease autologous tissue/cell.
The present invention also provides a kind of method of preparing above-mentioned cell particles-siRNA mixture medicine.
Described mixture medicine comprises for the virus genomic siRNA of HIV and as the cell particles of carrier;
The described method of preparing medicine comprises siRNA is imported to host cell and the step of the cell particles that is loaded with siRNA of purifying out from cell.
The described method that siRNA is imported to host cell comprises: 1) the ripe body siRNA of application liposome transfection synthetic; 2) application liposome or electrotransfection method, virus vector or the plasmid of siRNA expressed sequence carried in transfection; And 3) set up three kinds of methods such as the permanent expression cell line of siRNA.
Preferably, the method for the ripe body siRNA of application liposome transfection synthetic comprises the following steps:
1) design is for the virus genomic siRNA sequence of HIV;
Described siRNA comprise all can be for HIV genome, and can cause the siRNA sequence of HIV genome specificity degraded.Method of design is referring to this area routine techniques method.Preferably, described siRNA sequence be following sequence one or more:
i.HIV-G1：GCCCTTCAGACAGGATCAGAA
ii.HIV-G2：AAGCAGCCATGCAAATGTTAA
iii.HIV-G3：TCCCAGTAGGAGAAATCTATA
iv.HIV-G4：GCAAGCTTCACAGGAGGTAAA
v.HIV-T1：AGATCCTAGACTAGAGCCCTG
vi.HIV-T2：TGGAAGCATCCAGGAAGTCAG
vii.HIV-T3：GCATCCAGGAAGTCAGCCTAA
viii.HIV-T4：TCAAAGCAACCCACCTCCCAA
2) according to the sequence synthetic siRNA designing;
3) application liposome is by siRNA transfered cell.
Preferably, application liposome or electroporation transfection method, the virus vector of siRNA expressed sequence is carried in transfection or the method for plasmid comprises the following steps:
1) design is for the virus genomic siRNA expressed sequence of HIV;
Described expressed sequence comprises that any one or more is for the reverse complementary sequence of the genomic siRNA of HIV.
2) according to the sequence synthetic expressed sequence designing;
3) expressed sequence is inserted in the virus vector or plasmid that is applicable to its expression;
4), by virus vector or plasmid application liposome or the electrotransfection method of restructuring, import in host cell;
5) make siRNA expression vector at cell inner expression siRNA.
Preferably, the method for setting up the permanent expression cell line of siRNA comprises:
1) design is for the virus genomic siRNA expressed sequence of HIV;
2) build siRNA expression vector; Preferably, described carrier is lentiviral vectors;
3), for the correct recombinant plasmid of order-checking, extraction and purifying are high-quality containing endotoxic recombinant plasmid;
4) use efficient recombinant vectors (liposome) and recombinant plasmid cotransfection 293T cell, carry out virus packing and produce, collect virus liquid;
5) concentrated, purified virus liquid;
6) adopt GFP Fluorometric assay virus titer;
7) with high-quality virus liquid host cells infected;
8) detect the silence efficiency of gene function or siRNA;
9) use microbiotic to carry out the screening of stable transfected cells strain;
10) adopt mono-clonal to cultivate, set up the permanent transgenosis monoclonal cell strain of expressing.
Described host cell comprises the primary culture of existing all cells system, cell strain and normal people or Disease autologous tissue/cell.
The method that described purification is loaded with the cell particles of siRNA comprises the following steps:
1) collect the nutrient solution of the cell after siRNA imports;
2) adopt certain method separating-purifying cell particles wherein.
The method of described purification cell particles comprises one or more in differential centrifugation, immunoabsorption and ultrafiltration process.
Preferably, described preparation method is differential centrifugation, the differential centrifugation for example comprising the following steps: (1) first, by cell or tissue in 300g centrifugal 5 minutes, gets supernatant; (2) by supernatant in 1500g centrifugal 20 minutes, get supernatant; (3) by supernatant in 10000g centrifugal 30 minutes, get supernatant.(4) by supernatant in 110000g centrifugal 70 minutes, get precipitation and be cell particles.
Or preferably, described preparation method is immunoabsorption, the immunoabsorption for example comprising the following steps: (1) first, by cell or tissue under 3000 revs/min centrifugal 30 minutes, gets supernatant; (2) by being adsorbed on the antibody of the cell-specific on tissue culture ware or immunomagnetic beads and supernatant incubation 30～60 minutes, reclaim the cell particles being adsorbed.
Or preferably, described preparation method is ultrafiltration process, the ultrafiltration process for example comprising the following steps: (1) first, by cell or tissue under 3000 revs/min centrifugal 30 minutes, gets supernatant; (2) supernatant is put into the concentrated centrifuge tube with certain pore size filter membrane, in 4000 revs/min, carried out centrifugally, concentrate and get final product.
The present invention also provides the application of a kind of this mixture medicine in acquired immune deficiency syndrome (AIDS) and HIV virus carrier's treatment.
By medicinal composition treatment acquired immune deficiency syndrome (AIDS) of the present invention or HIV virus carrier, can adopt following methods to realize:
1) by above-mentioned complex body infusion of medicine acceptor or add recipient cell;
2) expansion of the silence effect blocking-up HIV virus mediating by siRNA;
3) optionally, detect the variation of HIV viral level, i.e. the effect of Composite drug treatment of menopausal acquired immune deficiency syndrome (AIDS);
Described acceptor comprises AIDS patient and/or HIV virus infection person.
Described recipient cell comprises the primary culture of all clone being infected by HIV, cell strain and AIDS patient JiHIV the infected autologous tissue/cell.
The method of described detection HIV content comprises viral nucleic acid detection method, P24 Detection of antigen method etc.
Preferably, described viral nucleic acid detection method is application fluorescence real-time quantitative PCR method (Real-timePCR) detection HIV viral nucleic acid content.Specifically comprise the following steps: 1) extract viral RNA; 2) HIV RNA is carried out to reverse transcription (RT), then its product cDNA is carried out to pcr amplification.According to the CT value obtaining in PCR reaction, derive the template number of the viral cDNA of initial participation reaction, and then obtain viral level.
Preferably, P24 Detection of antigen method is application enzyme linked immunosorbent assay (ELISA) detection P24 antigen: conventionally adopt sandwich method ELISA, at the bottom of soon the known antibodies of purifying will be coated on solid state reaction plate hole, after adding test serum, if contain p24 antigen in serum, form antigen-antibody complex with coated antibody, then add the antibody of enzyme (HRP) mark, add after substrate colour developing the absorbancy of detection reaction product in microplate reader (OD value).Due within the specific limits, the content of the size of OD value and P24 antigen is linear relevant, thus OD value just can intuitively reflect viral level number.
Accompanying drawing explanation
The structure iron of the routine transient expression carrier of Fig. 1 mono-.
The structure iron of the permanent expression vector of Fig. 2 mono-example.
Fig. 3 observed under electron microscope cell particles.
The 293T cell of fluorescently-labeled siRNA is crossed in Fig. 4 transfection.
Cell particles-siRNA complex body that Fig. 5 fluidic cell method detects.
Fig. 6 mixture medicine and the impact of corresponding contrast on pseudovirus.
The inhibiting rate of mixture medicine corresponding to eight kinds of siRNA sequences of Fig. 7 to pseudovirus.
The inhibiting rate of Fig. 8 mixture medicine HIV-T3 to HIV virus.
Embodiment
Be understandable that, particular implementation described here represents by way of example, and it is not as limitation of the present invention.In the situation that not deviating from the scope of the invention, principal character of the present invention can be for various embodiments.One skilled in the art will appreciate that maybe and can confirm, use normal experiment, many equivalents can be applied in particular step described herein.These equivalent places of being considered within the scope of the present invention, and are covered by claim.
embodiment 1the ripe body of siRNA of transfection synthetic
The present embodiment enters cell by the ripe body siRNA transfection of synthetic, specifically comprises the following steps:
1) design is for the virus genomic siRNA sequence of HIV-1, and particularly, we have designed 8 interference RNA sequences for the conservative region of the genomic gag of HIV-1 and tat gene:
HIV-G1：GCCCTTCAGACAGGATCAGAA
HIV-G2：AAGCAGCCATGCAAATGTTAA
HIV-G3：TCCCAGTAGGAGAAATCTATA
HIV-G4：GCAAGCTTCACAGGAGGTAAA
HIV-T1：AGATCCTAGACTAGAGCCCTG
HIV-T2：TGGAAGCATCCAGGAAGTCAG
HIV-T3：GCATCCAGGAAGTCAGCCTAA
HIV-T4：TCAAAGCAACCCACCTCCCAA
2) the above-mentioned ripe body siRNA of synthetic.
3) application liposome (adopts liposome Lipofectamine 2000 (Invitrogen, the U.S.) siRNA transfection is entered to embryonic kidney epithelial cell line 293T cell (USS type culture collection institute, American Type Culture Collection, ATCC), concrete grammar is as follows:
(1) 293T cell cultures has been in having added the DMEM in high glucose substratum of 10% foetal calf serum (Gibco, the U.S.) (Gibco, the U.S.), 5%CO2,37 ℃ of cultivations.
(2) by the negative control siRNA of 30 μ l lipofectamine 2000 and 600pmol (the non-specific siRNA sequence of random synthesis) respectively with 1ml OPTI-MEM (Gibco, the U.S.) mix, form mixture A and mixture B, under room temperature, place 5min.
(3) siRNA of 30 μ l lipofectamine 2000 and 600pmol is mixed with 1mlOPTI-MEM (Gibco, the U.S.) respectively, form mixture C and mixture D, under room temperature, place 5min.
(4) mixture A and mixture B are mixed, generate mixture E, place 20min.
(5) mixture C and mixture D are mixed, generate mixture F, place 20min.
(6) mixture E and F are added respectively in control group and experimental group cell, supply OPTI-MEM to 15ml.5%CO2,37 ℃ of cultivations.
After (7) 6 hours, be replaced with normal nutrient solution.
(8) after 24h～48h, transfection finishes, and collects sample.
embodiment 2transfection is for the transient expression carrier of the virus genomic siRNA of HIV
The present embodiment adopts molecular biology method to build the transient expression carrier of siRNA, for express siRNA in culturing cell, specifically comprises the following steps:
1) in design implementation example 1 for the expressed sequence of the virus genomic siRNA of HIV;
2) the above-mentioned siRNA expressed sequence of synthetic, and synthetic sequence is inserted in siRNA carrier for expression of eukaryon pcDNA6.2GW/EmGFP-miR (the invitrogen U.S.), build recombinant vectors.The structural representation of expression vector as shown in Figure 1;
3) recombinant vectors is adopted liposome method or the transfection of electroporation transfection method enter host cell 293T cell (American type culture collection, American Type Culture Collection, ATCC).
The concrete steps of liposome transfection method comprise: 24h before (1) transfection, with tryptic digestion, collect the cell in logarithmic phase, cell adds in 12 orifice plates, adds the cell suspension of the good concentration of 2ml adjusted in each hole, and making each hole inner cell number is 3 * 10
5individual, 37 ℃, 5%CO
2incubator is hatched; (2) after 24h, cell density reaches 80% left and right, can be used for transfection; (3) according to Lipo-fectamine2000 liposome working instructions, get 3.0 μ g and for the carrier of transfection, add the Opti-MEM liquid of 100 μ l serum-frees, antibiotic-free, mix gently; (4) get 2 μ l liposomes and add 100 μ lOpti-MEM, mix gently, under room temperature, hatch 5min; (5) Lipofectamine2000 of the plasmid of dilution and dilution is mixed, mix gently, under room temperature, hatch 20min; (6) mixture is added in each hole of 12 orifice plates, the volume that adds mixture in each hole is 100 μ l, mixes gently; (7) 37 ℃, 5%CO
2incubator after hatching 4～6h is changed the nutrient solution that contains liposome and plasmid, replaces the DMEM nutrient solution that contains 10% foetal calf serum, is placed in 37 ℃, 5%CO
2, incubator is hatched; (8) utilize inverted fluorescence microscope to observe the expression of green fluorescent protein, the transfection efficiency of counting cells is 80%.
The concrete steps of electroporation transfection method comprise: (1) Growth of Cells, to logarithmic phase, is used trysinization, 4 ℃, and the centrifugal 5min of 1000g; (2) with the electroporation liquid re-suspended cell of 0.5 times of volume, cell density is adjusted to 3 * 10
6cells/ml; (3) by the cell suspension of 400 μ l (10
6-10
7cell) carrier DNA that adds 30 μ l in, mixes cell and DNA gently with suction pipe; (4) mixture is added in electric conversion pool to ice bath.Electric conversion pool is moved to electric interpolar discharge, after 1～2min, take out electric conversion pool, ice bath, carries out next step operation immediately; (5) with the suction nozzle of sterilizing, the cell of electroporation is transferred in culture dish, adds cell complete culture solution, be placed in containing 5%CO
2, 37 ℃ of incubators hatch, for transfection efficiency, observe; (6) utilize inverted fluorescence microscope to observe the expression of green fluorescent protein, and the transfection efficiency of counting cells, be 75%.
embodiment 3the transgenosis cell strain of siRNA can be forever expressed in foundation
In order to obtain stably express, for the virus genomic siRNA of HIV, the present embodiment is by building the permanent expression vector of siRNA, its transfection is entered to host cell, simultaneously by screening, select carrier to be inserted into the permanent table Dyclonine of host cell gene group, its mono-clonal is cultivated, thereby set up the transgenosis cell strain that can forever express siRNA.
Concrete steps comprise:
1) in synthetic embodiment 1 for the expressed sequence of the virus genomic siRNA of HIV;
2) build lentiviral vectors: the sequence of synthetic is inserted respectively to lentiviral vectors pLenti6.3/V5-DEST (invitrogen, the U.S.), build recombinant vectors.Carrier structure schematic diagram is as shown in 2;
3) slow virus packing: by recombinant vectors transfection 293T cell, packaging virus.Specifically comprise the following steps: the cultivation of 1.293T cell; 2. the cell of suitable quantity is inoculated to the culture dish into 4 * 10cm, incubated overnight; 3. with packaging plasmid (Invitrogen, the U.S.) and virus vector cotransfection; 4. change liquid, continue to cultivate; 5. collect virus liquid; 2000g, centrifugal 10min removes cell and fragment, and crosses 0.45 μ m filter membrane, obtains virus stock solution used, and concentrating virus liquid, is resuspended in 400 μ l substratum.6. the mensuration of virus activity titre: HEK293 cell is inoculated to 96 orifice plates, and gradient dilution virus liquid, adds in HEK293 cell, observation band GFP fluorocyte after 72 hours, calculates virus activity titre.HEK293 cell adopts the DMEM substratum (Gibco, the U.S.) that has added 10% foetal calf serum, at 5%CO
2, cultivate at 37 ℃.
4) virus infection and the screening of mono-clonal positive colony.Specifically comprise the following steps: 1. cultivate 293T cell to logarithmic phase; 2. the cell of suitable quantity is inoculated into culture dish to incubated overnight; 3. with the slow virus of preparation in early stage, infect 293T cell; 4. change liquid, continue to cultivate; 5. add resistance screening (adopting if desired airflow classification positive cell); Choose a plurality of mono-clonal screening positive clones; 6. amplifying cells is to sufficient amount.
embodiment 4separation and purification is loaded with the cell particles of siRNA
Intracellular siRNA can be wrapped up by the cell particles of emiocytosis, is closely secreted into extracellular.By collecting cell nutrient solution, through a series of separation and purification, just can obtain being loaded with the cell particles of siRNA, i.e. cell particles-siRNA mixture.
The cell particles that is loaded with siRNA that the emiocytosis that the present embodiment adopts respectively following methods separation to proceed to siRNA goes out:
(1) differential centrifugation: first that culturing cell is centrifugal by 300g, 1500g and 10000g successively, remove various types of cells and fragment, then by centrifugal 70 minutes of supernatant ultracentrifugation 110000g, getting precipitation was the cell particles that is loaded with siRNA of emiocytosis.
(2) immunoabsorption: the antibody of cell-specific is adsorbed on tissue culture ware or directly
With immunomagnetic beads, will remove serum/plasma after various types of cells and fragment or cell culture fluid directly and culture dish or immunomagnetic beads incubation (30 minutes or 1 hour), the cell particles of different cells can directly be adsorbed and reclaim.
(3) filtration method: serum/plasma or the cell culture fluid removed after various types of cells and fragment is straight
Connect the concentrated centrifuge tube being placed on 100KD filter membrane, carry out centrifugally at 4000 revs/min, cell particles will be stayed and in centrifuge tube, be concentrated acquisition.
The cell particles that separation is obtained is observed under transmission electron microscope, specifically comprises: cell particles precipitation is fixedly spent the night at 4 ℃ with 2.5% glutaraldehyde stationary liquid, and PBS rinsing three times is every all over 10 minutes.By 1% perosmic anhydride room temperature, fix 60 minutes afterwards.10% gelatin embedding for sample after fixing, after then fixing by glutaraldehyde at 4 ℃, be cut into small pieces sample (volume is less than 1 cubic millimeter) again.The ethanolic soln dehydration (30%, 50%, 70%, 90%, 95% and 100% * 3) of increased concentrations successively for sample.With epoxy resin, soak into after embedding, with the section of Leica UC6 ultramicrotome, finally with FEI TecnaiT20 transmission electron microscope, under 120kV condition, observe.
The transmission electron microscope picture of the cell particles that the separation of employing differential centrifugation obtains as shown in Figure 3, shows that the cell particles being separated to from culturing cell is not of uniform size, is distributed in 10-500nm scope.
embodiment 5the calibrating of the medicinal composition that cell particles and the siRNA being loaded with thereof form
The present embodiment is examined and determine cell particles by serial of methods and the existence of the medicinal composition that the siRNA that is loaded with forms.
1) by method described in embodiment 1, fluorescently-labeled siRNA is transfected into cell.Result as shown in Figure 4, enters cell in transfection of the siRNA of fluorescence microscopy Microscopic observation visible fluorescence mark (arrow indication bright spot).
2) by method isolation identification transfection described in embodiment 4, cross the cell particles of the donorcells secretion of fluorescently-labeled siRNA.Result as shown in Figure 3; the cell particles that visible separation obtains all meets the feature of cell particles, and (described feature is referring to Thery, C., Zitvogel from aspects such as form, size, membrane structures; L.; and Amigorena, S. (2002) .Exosomes:composition, biogenesis andfunction.Nat Rev Immunol 2; 569-579.Cocucci; E., Racchetti, G.& Meldolesi, J.Shedding microvesicles:artefacts no more.Trends Cell Biol 19,43-51 (2009)).
3) by fluidic cell method, detect separation and purification and be accredited as in the particle of cell particles whether be enclosed with siRNA, whether having formed cell particles-siRNA mixture, result as shown in Figure 5.Because siRNA is by fluorescently-labeled, if contain siRNA in cell particles, so, cell particles is also one surely by fluorescent mark.Therefore, we adopt fluidic cell method detect cell particles with fluorescence situation.As seen from Figure 5, there are a large amount of cell particles to carry fluorescence (Fig. 5 vertical line is with right half), prove in cell particles and be enclosed with siRNA, also proved the existence of cell particles-siRNA medicinal composition.
embodiment 6application cell micropartical-siRNA mixture medicine suppresses HIV pseudovirus in vitro
The simulation HIV virus function mode of HIV pseudovirus for forming by other low harm virus capsid protein parcel HIV viral genome, but the imitative HIV virus that hazardness reduces far away.The general method of manufacturing HIV pseudovirus comprises: other low harm viruses of the recombinant expression plasmid of construction expression HIV gene and expression, as the recombinant expression plasmid of the shell G glycoprotein gene of stomatitis herpesvirus, by two kinds of plasmid co-transfection mammalian cells, obtain false type slow virus.
The present embodiment is by detecting cell particles-siRNA mixture medicine for the restraining effect of HIV pseudovirus, for mixture medicine provides support to the result for the treatment of of acquired immune deficiency syndrome (AIDS).
Specific experiment step comprises: the transgenosis cell strain that 1) builds the permanent siRNA of expression according to the method for embodiment 3; 2) according to the cell particles that is loaded with siRNA of the method separation and purification transgenic cell secretion of embodiment 4, i.e. cell particles-siRNA mixture; 3) mixture medicine is joined in Hela (CD4-LTR/ β-Gal) cell (American type culture collection, American Type Culture Collection, ATCC) that has infected HIV pseudovirus.Hela cell adopts the DMEM in high glucose substratum (Gibco, the U.S.) that has added 10% foetal calf serum, at 5%CO
2, cultivate at 37 ℃; 4) detect virus titer, analyze the restraining effect of mixture medicine to HIV pseudovirus.
As shown in Figure 6, ordinate zou has shown the content of HIV pseudovirus in 293T cell to result.By not adding viral blank cell (pillar of transverse axis 1 representative) in contrast completely, its value is made as to 1; Singly adding virus and not taking the pseudovirus content in the cell (transverse axis 2 representative pillars) of any treatment measure is more than 16 times of control cells.Yet, add cell particles-siRNA mixture medicine as treatment means, the pseudovirus content in host cell is a large amount of minimizing just.From result, add after medicine (pillars of transverse axis 5,6 representatives), the pseudovirus in host cell has been reduced to 40% left and right (pillars of transverse axis 6 representatives).The more important thing is, increase the consumption (pillars of transverse axis 5 representatives) of medicine, the HIV pseudovirus in host cell is even suppressed completely, and the content of HIV pseudovirus drops to and do not add the identical level of pseudovirus group (pillar of transverse axis 1 representative).
In addition, in order to determine that cell particles-siRNA mixture medicine is due to siRNA to the restraining effect of HIV pseudovirus, rather than cell particles causes, in the host cell that we also infect to HIV pseudovirus, proceeded to not cell particles containing siRNA as another contrast (pillars of transverse axis 3 representatives).As can be seen from the results, only cell particles cannot produce restraining effect to HIV pseudovirus, has also proved that generation viral inhibition is not cell particles but siRNA itself.
Meanwhile, we have also added a kind of anti-AIDS drug of small peptide class as positive control (pillars of transverse axis 4 representatives).By result, can be found out, this medicine also can only be reduced to 50% left and right by HIV pseudovirus content.Therefore, can find out that cell particles-siRNA mixture medicine compares with the medicine of conventional treatment acquired immune deficiency syndrome (AIDS), its functioning efficiency is higher, suppresses the better effects if of pseudovirus.
The complex body medicine that in embodiment 1, all 8 kinds of siRNA sequences are corresponding to the inhibition of HIV pseudovirus as shown in Figure 7.As seen from the figure, all medicines all reach more than 60% the inhibiting rate of HIV pseudovirus, and what have even reaches 86%.Meanwhile, all medicines all decline along with the reduction of drug level to the inhibiting rate of pseudovirus.
This result proved, in the present embodiment, 8 kinds of cell particles-siRNA mixture medicines have very strong restraining effect to HIV pseudovirus, and this effect is simultaneously concentration dependent, is not accidental and random phenomenon.
embodiment 7application cell micropartical-siRNA mixture medicine suppresses HIV-1 virus in vitro
The present embodiment has detected mixture medicine that siRNA sequence HIV-T3 the is corresponding restraining effect to HIV-1 virus.
Specific experiment step comprises: 1) according to the method for embodiment 3, build permanent transgenosis cell strain of expressing siRNA sequence HIV-T3; 2) according to the cell particles that is loaded with siRNA of the method separation and purification transgenic cell secretion of embodiment 4, i.e. cell particles-siRNA mixture; 3) mixture medicine is joined in the T chronic myeloid leukemia clone Jurkat cell (ATCC) that has infected HIV-1 virus, Jurkat cell adopts 1640 substratum (Gibco, the U.S.) that added 10% foetal calf serum, at 5%CO
2, cultivate at 37 ℃; 4) detect virus titer, analyze the restraining effect of mixture medicine to HIV virus.
Result as shown in Figure 8.From result, the mixture medicine that siRNA sequence HIV-T3 is corresponding has very strong restraining effect to HIV-1 virus.When adding medicine stoste (the corresponding pillar of transverse axis 1), medicine can reach 95.95% to the inhibiting rate of HIV-1 virus, and when medicine is during with 2 times of gradient dilutions (pillar that transverse axis 2-6 is corresponding), its inhibiting rate to HIV-1 virus also decreases.
This result further proved cell particles-siRNA mixture medicine in extracellular the restraining effect to HIV virus, for the later development of this medicine is laid a good foundation.
According to aforesaid method, the inventor proves that above-mentioned cell particles-siRNA mixture can be used as medicine, plays restraining effect to HIV virus.Its action principle is: for the virus genomic siRNA of HIV, can efficiently by cell particles, specific enter the target cell that is subject to HIV virus infection, by siRNA, mediate, to the specific cutting action of viral genome, thereby play the effect that suppresses viral.
The advantage of using siRNA to carry out disease treatment is: siRNA is that recruitment silencing complex carries out specificity cutting to its goal gene and plays a role by matching as recognition signal with its target gene.The pharmaceutically-active target spot of siRNA only has its target gene, and can not disturb the normal expression of other genes in organism, and therefore, it has higher specificity and less side effect.Application siRNA treatment acquired immune deficiency syndrome (AIDS) has more its distinctive advantage, because HIV viral genome is the Yeast Nucleic Acid that external source enters human body, therefore, siRNA medicine can not have influence on the normal physiological function of other cells of human body completely to the inhibition of HIV virus, therefore can not damage human body.
Meanwhile, the advantage that application cell micropartical transports siRNA as carrier is: first, cell particles derives from cell, be that organism itself exists, thereby the pharmaceutical carrier that can overcome current synthetic is to the toxicity of cell and the infringement to health; Secondly, siRNA parcel is entered to applied various technique means in the process of cell particles and be all easy to realize, wrap up efficiency very high simultaneously, this has strengthened the potentiality of its practical application to a certain extent; The more important thing is that cell particles is the imitated vesicle structure with double-deck plasma structure, adventitia and cytoplasmic membrane similar, can be by entering cell with cytolemma fusion, endocytosis.Meanwhile, because cell particles also carries the protein that some contribute to RNA interference effect, therefore can improve the functioning efficiency of siRNA.If the cell particles parcel siRNA of the primary culture of application patient autologous tissue or cell secretion also can reduce immunological rejection and further improve cell particles and carry the efficiency that siRNA enters organism.Based on above advantage, cell particles transports siRNA as carrier will play important effect as medicine in the prevention of drug development and clinical disease and treatment.
Claims (12)
1. the mixture of cell particles-anti-HIV specific siRNA,
Wherein the sequence of anti-HIV specific siRNA is:
GCCCUUCAGACAGGAUCAGAA，
Wherein cell particles comprises exosome and shedding vesicle.
2. according to the mixture of claim 1, wherein said cell particles is from human or animal's donorcells.
3. according to the mixture of claim 2, wherein said donorcells comprises: clone, primary cell culture.
4. according to the mixture of claim 2, wherein said cell particles is biological imitated vesicle structure.
5. according to the mixture of claim 1, wherein anti-HIV specific siRNA is wrapped in cell particles.
6. according to the mixture of claim 1, wherein the median size of cell particles is 10-500 nanometer.
7. the purposes of the mixture of cell particles-anti-HIV specific siRNA in the medicine infecting for the preparation for the treatment of acquired immune deficiency syndrome (AIDS) or HIV,
Wherein the sequence of anti-HIV specific siRNA is:
GCCCUUCAGACAGGAUCAGAA，
Wherein cell particles comprises exosome and shedding vesicle.
8. a pharmaceutical composition, comprises the cell particles described in any one in claim 1-7-anti-HIV specific siRNA mixture.
9. the method for the cell particles-anti-HIV specific siRNA mixture described in any one in preparation claim 1-7, comprises the following steps:
To resist HIV specific siRNA to proceed to cell, and apply transfection ripe body siRNA method or transfection siRNA transient expression carrier method or set up the permanent expression cell line method of siRNA;
Isolated cell micropartical-anti-HIV specific siRNA mixture.
10. the method for claim 9, wherein by being selected from one or more isolated cell microparticals-anti-HIV specific siRNA mixture in differential centrifugation, immunoabsorption and ultrafiltration process,
Wherein the sequence of anti-HIV specific siRNA is:
GCCCUUCAGACAGGAUCAGAA，
Wherein cell particles comprises exosome and shedding vesicle.
The purposes of cell particles in 11. claim 1-7 described in any one-anti-HIV specific siRNA mixture in preparing the medicine for the treatment of the acceptor of suffering from acquired immune deficiency syndrome (AIDS), wherein said acceptor comprises AIDS patient or HIV virus infection person.
12. according to the purposes of claim 11, and the cell of described acceptor comprises the clone that infected by HIV or the primary culture of cell strain or AIDS patient JiHIV the infected autologous tissue/cell.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310714823.6A CN103757001B (en) | 2010-12-09 | 2010-12-09 | The preparation of cell particles-siRNA mixture and the application in treating AIDS thereof |
| CN201010601506.XA CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010187578.4 | 2010-05-26 | ||
| CN201010187578A CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
| CN201010601506.XA CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310714823.6A Division CN103757001B (en) | 2010-12-09 | 2010-12-09 | The preparation of cell particles-siRNA mixture and the application in treating AIDS thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102260667A CN102260667A (en) | 2011-11-30 |
| CN102260667B true CN102260667B (en) | 2014-01-15 |
Family
ID=42994919
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010187578A Pending CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
| CN201010601506.XA Expired - Fee Related CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010187578A Pending CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (2) | CN101869715A (en) |
| HK (1) | HK1164369A1 (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102858375B (en) | 2010-05-26 | 2016-08-10 | 江苏命码生物科技有限公司 | It is loaded with the cell particles of disturbance ribonucleic acid, its preparation method and application thereof |
| EP2578236B1 (en) | 2010-05-26 | 2016-03-30 | Micromedmark Biotech Co., Ltd | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT |
| CN103757001B (en) * | 2010-12-09 | 2016-03-16 | 江苏命码生物科技有限公司 | The preparation of cell particles-siRNA mixture and the application in treating AIDS thereof |
| CN103505743A (en) * | 2012-06-21 | 2014-01-15 | 北京命码生科科技有限公司 | Cell micro-particles containing functional microRNA/siRNA and application thereof |
| EP2920306B1 (en) | 2012-11-13 | 2018-06-27 | Codiak BioSciences, Inc. | Delivery of therapeutic agent |
| WO2014142235A1 (en) * | 2013-03-13 | 2014-09-18 | Li Zhong | Microvesicle, and manufacturing method for same |
| JP2016516804A (en) | 2013-04-17 | 2016-06-09 | ファイザー・インク | N-piperidin-3-ylbenzamide derivatives for treating cardiovascular diseases |
| CN103212090A (en) * | 2013-04-18 | 2013-07-24 | 南京大学 | Application of microvesicle containing TGF (transforming growth factor)-beta1 siRNA (small interfering Ribonucleic Acid) |
| CN106177990B (en) * | 2014-11-17 | 2020-08-28 | 江苏命码生物科技有限公司 | New precursor miRNA and application thereof in tumor treatment |
| JP2018520125A (en) | 2015-06-10 | 2018-07-26 | ボード・オブ・リージエンツ，ザ・ユニバーシテイ・オブ・テキサス・システム | Use of exosomes for treatment of disease |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101300350A (en) * | 2005-09-08 | 2008-11-05 | 财团法人阪大微生物病研究会 | Promoter for introducing gene into lymphocyte or blood cell and application thereof |
| CN101432432A (en) * | 2006-05-03 | 2009-05-13 | 扬·奥洛夫·洛特温尔 | Exosome transfer of nucleic acids to cells |
| WO2009147519A1 (en) * | 2008-06-06 | 2009-12-10 | Centre National De La Recherche Scientifique - Cnrs- | Use of endo-lysosomal system and secreted vesicles (exosome-like) in treatments and diagnostics based on small rna and experimental study of small rna |
-
2010
- 2010-05-26 CN CN201010187578A patent/CN101869715A/en active Pending
- 2010-12-09 CN CN201010601506.XA patent/CN102260667B/en not_active Expired - Fee Related
-
2012
- 2012-05-24 HK HK12105108.4A patent/HK1164369A1/en not_active IP Right Cessation
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101300350A (en) * | 2005-09-08 | 2008-11-05 | 财团法人阪大微生物病研究会 | Promoter for introducing gene into lymphocyte or blood cell and application thereof |
| CN101432432A (en) * | 2006-05-03 | 2009-05-13 | 扬·奥洛夫·洛特温尔 | Exosome transfer of nucleic acids to cells |
| WO2009147519A1 (en) * | 2008-06-06 | 2009-12-10 | Centre National De La Recherche Scientifique - Cnrs- | Use of endo-lysosomal system and secreted vesicles (exosome-like) in treatments and diagnostics based on small rna and experimental study of small rna |
Non-Patent Citations (6)
| Title |
|---|
| Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells;Hadi Valadi et al;《Nature Cell Biology》;20070507;第9卷(第6期);654-659 * |
| Hadi Valadi et al.Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells.《Nature Cell Biology》.2007,第9卷(第6期),654-659. |
| 孟二红 等.膜微粒子与造血调控.《中国实验血液学杂志》.2005,第13卷(第4期),713-717. |
| 膜微粒子与造血调控;孟二红 等;《中国实验血液学杂志》;20050831;第13卷(第4期);713-717 * |
| 血小板微粒子及其检测方法研究进展;马文新 林其隧;《中华检验医学杂志》;20020228;第25卷(第1期);55-57 * |
| 马文新 林其隧.血小板微粒子及其检测方法研究进展.《中华检验医学杂志》.2002,第25卷(第1期),55-57. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102260667A (en) | 2011-11-30 |
| CN101869715A (en) | 2010-10-27 |
| HK1164369A1 (en) | 2012-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102260667B (en) | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS | |
| CN109071597A (en) | Therapeutic membrane vesicle | |
| Dias et al. | The ambiguous roles of extracellular vesicles in HIV replication and pathogenesis | |
| US20230048730A1 (en) | Platelets transfected by exogenous genetic material and platelet microparticles obtained by said transfected platelets, method for the preparation and uses thereof | |
| CN107586777A (en) | People's PDCD1 genes sgRNA purposes and its related drugs | |
| CN101805750B (en) | Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector | |
| RU2693088C2 (en) | Microvesicle and method for its preparation | |
| WO2011147086A1 (en) | Microvesicles carrying small interfering rnas, preparation methods and uses thereof | |
| CN106967685A (en) | The anti-EGFRvIII Chimeric antigen receptors that are co-expressed and immunologic test point suppress transgenosis lymphocyte of molecule and application thereof | |
| CN107699591A (en) | A kind of knockout PD 1 T cell preparation method and applications | |
| CN105063044A (en) | Active molecule capable of suppressing gene replication of Ebola virus and usage method thereof | |
| EP2578236B1 (en) | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT | |
| Jayasinghe et al. | Red Blood Cell-Derived Extracellular Vesicles Display Endogenous Antiviral Effects and Enhance the Efficacy of Antiviral Oligonucleotide Therapy | |
| CN103757001B (en) | The preparation of cell particles-siRNA mixture and the application in treating AIDS thereof | |
| CN114672460B (en) | Preparation method and application of CD 44-targeted heterogeneous CIC cell model | |
| CN111110848B (en) | Application of PIWIL4 as target of medicine for activating HIV-1 latent infection | |
| CN107019703A (en) | LSECtin is being used as the application in treating and/or preventing the target spot of Ebola virus | |
| CN106267416A (en) | AIDS therapeutic equipment | |
| CN106110426B (en) | AIDS immunization therapy instrument | |
| EP1582591A2 (en) | Sirna and their use for knock down expression of porcine endogenous retrovirus | |
| Habib et al. | Exosomes multifunctional roles in HIV-1: insight into the immune regulation, vaccine development and current progress in delivery system | |
| CN106267414A (en) | Acquired immune deficiency syndrome (AIDS) immunologic purging device | |
| Güner | Entry of the Human Pegivirus (HPgV) Into Jurkat Cells and the Expression Level of ULK-1 in TMEM55B Knocked-down MDA-MB-231 Cells: A Thesis in Two Parts | |
| KR20220061686A (en) | Tumor-specific CRISPR/Cas9 delivery of HCV/E1E2 envelope glycoproteins-pseudotyped lentivirus to tumor and its use as antitumor therapeutics | |
| CN114181967A (en) | Plasmid structure capable of simultaneously expressing CD19CAR and knocking out expression of PD-1 on surface of T cell and construction method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| ASS | Succession or assignment of patent right |
Owner name: JIANGSU MINGMA BIOLOGY TECHNOLOGY CO., LTD. Free format text: FORMER OWNER: ZHANG CHENYU Effective date: 20111208 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20111208 Address after: 100738 Dongfang Plaza C2-507, East Chang'an Avenue, Beijing, Dongcheng District Applicant after: Jiangsu MicroMedMark Biotech Co., Ltd. Address before: 100738 C2-507, East Chang'an Avenue, Beijing Applicant before: Zhang Chenyu |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 1164369 Country of ref document: HK |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1164369 Country of ref document: HK |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140115 Termination date: 20191209 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |