CN101869715A - Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof - Google Patents
Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof Download PDFInfo
- Publication number
- CN101869715A CN101869715A CN201010187578A CN201010187578A CN101869715A CN 101869715 A CN101869715 A CN 101869715A CN 201010187578 A CN201010187578 A CN 201010187578A CN 201010187578 A CN201010187578 A CN 201010187578A CN 101869715 A CN101869715 A CN 101869715A
- Authority
- CN
- China
- Prior art keywords
- cell
- cell particles
- sirna
- disease
- ribonucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention provides interfering ribonucleic acid (RNA)-containing cell particles, and a medicinal composition and a kit containing the interfering RNA-containing cell particles. Through the interfering RNA-containing cell particles and the medicinal composition and the kit containing the interfering RNA-containing cell particles, the effect of the interfering RNA on acceptor cells can be researched, and the interfering RNA can be stably, efficiently and specifically conveyed to treat related diseases. Meanwhile, the invention also provides a method for preparing the interfering RNA-containing cell particles and the medicinal composition and the kit containing the interfering RNA-containing cell particles.
Description
Invention field
The present invention relates to be loaded with cell particles, preparation method and the application thereof of disturbance ribonucleic acid.Particularly, the present invention relates to provide the cell particles that is loaded with disturbance ribonucleic acid, disturbance ribonucleic acid is carried on the method for cell particles and the effect of the method in biomedicine experiment technique improvement and disease prevention/treatment.
Background technology
Cell particles (microvesicles) be a class size between 10-500nm, have the biological vesicle structure of bilayer lipid membrane.As far back as 1967 report is just arranged, be called as " platelet dust " at that time, it derives from platelet, comprises vesicle, has the agglomerative effect of promotion.In vitro study finds that endotheliocyte, vascular smooth muscle cell, platelet, leukocyte, lymphocyte, erythrocyte etc. can both release microparticles.According to the approach that micropartical produces, micropartical can be divided into exosomes and shedding vesicles again.Exosomes is a cell by under the situation about stimulating, by many vesicles corpusculum (Multivesicular bodies, MVBs) exocytosis is to extracellular, shedding vesicles directly secretes out in the mode of sprouting from cell surface.At present, the shedding vesicles of different emiocytosises is named as different titles, such as neutrophilic granulocyte and the excretory ectosomes that is called as of mononuclear cell, secretion of platelet then be called as microparticles.
The film component of cell particles depends on the cell in its source, mainly be made up of lipid and protein, but the internal component of cell particles it be unclear that.The plasma membrane of cell particles contains the feature of derived cell, i.e. the molecular marker of derived cell surface specific and cell receptor/part.The clear and definite physiological function of cell particles is not studied clear so far as yet.
Disturbance ribonucleic acid (small interfering RNA, siRNA) be the double stranded rna molecule that a class is made up of more than 20 nucleotide, can degrading by specificity, (messager RNA mRNA) plays the effect that silent gene is expressed for the Messenger RNA of target gene.This process be called as RNA disturb (RNA interference, RNAi).
It is a kind of mode reticent after the genetic transcription that RNA disturbs, and is one of phenomenon of the ancient and high conservative of evolving of biosphere.By the identification of siRNA mediation, and the mode of targeting cutting homology said target mrna, the specific efficient inhibition of gene expression.RNA disturbs has the biocatalytic reaction feature, needs the multiple protein factor and ATP to participate in the reaction.
The RNA The Study of Interference had obtained breakthrough in recent years, was chosen as one of ten big sciences progress of calendar year 2001 by " Science " magazine, and ranked first of 2002 the ten big science progress.Owing to use the RNA perturbation technique can specificity to reject or close the expression of specific gene, so this technology has been widely used in biomedicine experiment research and various diseases
Gene therapyThe field.
Before the RNA perturbation technique occurred, gene knockout (gene knockout) was main reverse genetics (reverse genetics) research means, but its technical difficulty height, complicated operation, the cycle is long.Since RNA disturb can utilize siRNA or siRNA expression vector fast, have the sequence specificity of height economical, easy the time again, can make the specific gene silence specifically, obtain afunction or lower the special mode of mutant nucleotide sequence to reject destination gene expression, so become the important research means of exploring gene function now.In functional genome research, need or lower sudden change to the specific gene afunction, determining its function, so RNA disturbs and can be used as a kind of strong research tool, is used for the research of functional genome.The foundation of siRNA expression library construction method simultaneously, making the RNA perturbation technique carry out high flux screening becomes possibility, to illustrating signal transduction pathway, finds that new drug target is significant.
The RNA perturbation technique also is widely used and treats the disease field.Utilizing the RNA perturbation technique HIV-1, hepatitis B, hepatitis C etc. to be carried out find in the gene therapy research, the sequence of selecting in the viral genome not have a homology with human genome can be avoided toxic and side effects to normal structure as suppressing sequence when suppressing virus replication.To suppress sequence selection simultaneously in specific site, and can have the malignant cell of clear and definite gene mutation to produce apoptosis-induced effect part.In addition still can be by using tumor-specific promoters, guide needle is expressed the siRNA or the shRNA of some oncogene or anti-apoptosis molecule, thereby reaches the purpose of specific killing tumor cell.
Because it is at the gene silencing of transcribing after-stage that RNA disturbs, to knocking out on the gene level, whole flow scheme design is easier with respect to traditional gene therapy, and effect rapidly, and effect is obvious, for new approach has been opened up in gene therapy.Its general thought is by strengthening the RNA interference mechanism of key gene, occurring duplicating and expressing of synthetic process of unusual albumen or the pathogenic nucleic acid of external source in the control disease, especially at causing some nucleic acid virus to the human health serious harm.
At present, study verifiedly, siRNA can suppress HIV virus duplicating in cultured cell in vitro effectively.SiRNA can reach the purpose that stops HIV to infect by suppressing HIV virus autogene (as ple, gag, rev, tat and env) or host gene (as the major receptors CD4 of HIV).Discover simultaneously; inject the siRNA that suppresses Fas at the mouse model medium-sized vein of two kinds of autoimmune hepatitiss and enter mice; Fas mRNA and protein level in the hepatocyte all reduce, so protected hepatocyte to avoid the apoptotic injury that autoimmune hepatitis causes.More discover: utilize RNA to disturb and remove reticent P53 gene, can suppress tumor cell conversion from optimum to virulent.
Be widely used in the biomedical research various aspects though RNA disturbs, this technology still has some insoluble problems at present.For example, use existing liposome transfection method, siRNA enters some cell, and is very low as the efficient of immunocyte.This just influences its further application in this field.
Simultaneously, although the research and development of siRNA medicine have obtained many achievements, it really is used for medical treatment as medicine and also face a lot of problems.Though can directly siRNA be expelled in the animal body, the half-life of the siRNA of this not process parcel is extremely short, and therapeutic effect is barely satisfactory.At present, the carrier that the siRNA medicine transports mainly contains liposome, millimicro type glue is assisted (Nanocapsules/Nanoparticles), beta cyclodextrin inclusion (β-cyclodextrininclusionCompound or title beta cyclodextrin glue are assisted) etc., though can prolong drug retention time in vivo and improve the absorbance of siRNA medicine to a certain extent, its targeting and high efficiency that transmits medicine is still not enough.How the people is carried out effective administration, can guarantee that drug effect effectively discharges at the target organ target tissue, also will have the further research of all still needing of tight security or the like problem.
SiRNA is as important means and potential medicine biological, medical research, also there are some an open questions at present, the specificity (targeting) of sending siRNA is poor, poor stability, efficient is low is the main cause that hinders its application, therefore, press for a kind of stable, efficient, special more mode of transporting siRNA, transmit siRNA efficiently, specifically.
The applicant is surprised to find that: cell particles is a kind of height of transport efficacy in vivo, the biological vesicle carrier of high specificity.These cell particles are not of uniform size, are distributed in the 10-500 nanometer range.The atomic film telogenesis branch (comprising specific surfaces receptor and film fat structure) that different in principle cells discharge is identical with the plasma membrane composition of corresponding cell.Therefore, cell particles has distinctive receptor protein in derived cell surface or film fat structure, with corresponding target cell high-affinity is arranged.If adopt cell particles as the carrier that transports siRNA, just can high efficiency, optionally send siRNA and arrive target cell/tissue, thus the effect that improves siRNA regulating cell function greatly.Obviously, because cell particles (comprises that all have the film lipid vesicle structure of cell particles feature, claim such as exosome and shedding vesicles and at the spy of the shedding vesicles of various emiocytosises) itself have and particular organization and the bonded specificity of cell, its contained siRNA also presents stronger targeting, stability and high efficiency, and it is having the major application prospect aspect the research of disease mechanisms and the treatment.
The inventor discovers: transport disturbance ribonucleic acid (microRAN) with cell particles as carrier and enter target cell, because cell particles is the excretory material of cell self, have bioaffinity, can not damage organism itself; Simultaneously,, its target cell is had high-affinity, therefore can efficiently, idiocratically enter target cell because the special surface molecular of derived cell has been carried on the cell particles surface.The disturbance ribonucleic acid that enters target cell can be brought into play its function, by with the combining of target gene Messenger RNA particular sequence, blocking-up target gene protein matter translation process, thus play the effect of specific inhibition gene expression.
The application cell micropartical is as the advantage that carrier transports siRNA: at first, cell particles derives from cell, is that organism itself exists, thus can overcome present synthetic the pharmaceutical carrier pair cell toxicity and to the infringement of health; Secondly, the siRNA parcel is entered applied various technological means all are easy to realize in the process of cell particles, it is very high to wrap up efficient simultaneously, and this has strengthened the potentiality of its practical application to a certain extent; The more important thing is that cell particles is the vesicle structure with double-deck plasma structure, adventitia and cytoplasma membrane similar can be by entering cell with cell membrane fusion, endocytosis.Simultaneously, because cell particles film surface carries the molecular marked compound of the plasma membrane surfaces of derived cell,, can enter target cell efficiently by specific identification as surface protein, various receptor/ligand etc.The excretory cell particles parcel of the primary culture of patient autologous tissue or cell siRNA also can reduce immunologic rejection and the further cell particles that improves carries the efficient that siRNA enters organism if use.Based on above advantage, cell particles transports siRNA as carrier will play important effect as medicine in the prevention of drug development and clinical disease and treatment.
Summary of the invention
The invention provides the cell particles that contains disturbance ribonucleic acid.
The present invention also provides a kind of pharmaceutical composition, comprises available carrier on the cell particles that contains disturbance ribonucleic acid and the medicine.
The present invention further provides a kind of test kit, comprising the cell particles that contains disturbance ribonucleic acid or contain the pharmaceutical composition of the cell particles of disturbance ribonucleic acid, and operation instruction.
The present invention provides a kind of preparation to contain the method for the cell particles of disturbance ribonucleic acid in addition, comprises the following steps:
The application cell rotaring dyeing technology changes disturbance ribonucleic acid over to cell; Or the viral vector method changes disturbance ribonucleic acid over to cell;
Separate the cell particles that contains disturbance ribonucleic acid.
The present invention also provides a kind of research method, comprising:
SiRNA and control sequence thereof are imported in the donorcells, preferably by transfection or viral vector method;
Separate the cell particles that contains disturbance ribonucleic acid;
This cell particles that contains disturbance ribonucleic acid is added receptor, preferred recipient cell;
Study the influence after this cell particles that contains disturbance ribonucleic acid enters recipient cell.
The present invention also provides a kind of method that prevents and/or treats disease, comprising: the cell particles that will contain disturbance ribonucleic acid changes receptor over to.
The present invention also provides the purposes of the cell particles that contains disturbance ribonucleic acid in carrying disturbance ribonucleic acid.
Description of drawings
Fig. 1 shows the atomic transmission electron microscope picture of normal human serum/plasma cell.
Fig. 2-A Real time-PCR method detects c-myb gene siRNA jamming effectiveness
Fig. 2-B flow cytometer detects the result of transfection efficiency
Fig. 2-C fluorescence microscope detects the result of transfection efficiency
Fig. 3-A shows that the fluidic cell method detects cell particles
Fig. 3-B shows that the fluidic cell method detects the cell particles that contains siRNA
Fig. 3-C shows that siRNA enters target cell with cell particles as carrier
Fig. 4-A shows that siRNA reduces the target protein expression at the target cell specificity
Fig. 4-B demonstration does not contain the influence of the cell particles of siRNA to the target cell transfer ability
Fig. 4-C contains the influence of the cell particles of siRNA to the target cell transfer ability
Fig. 4-D demonstration contains the statistical result of the cell particles of siRNA to the influence of target cell transfer ability
Fig. 5 contains the inhibitory action of the cell particles of siRNA to HIV virus
The specific embodiment
The cell particles that contains disturbance ribonucleic acid
Cell particles comprises all size between 10-500nm, by the natural biological vesicle with bilayer lipid membrane of emiocytosis, comprises by many vesicles corpusculum (Multivesicular bodies, MVBs) excretory Exosome; Cell claims with the excretory shedding vesicles of the mode of sprouting and at the spy of the shedding vesicles of various emiocytosises.
Cell particles comprises the cell particles from human or animal's various cells generations, especially, the cell that comprises normal or ill human or animal, can be primary culture, subculture (cell line), for example endotheliocyte, vascular smooth muscle cell, platelet, leukocyte, lymphocyte and erythrocyte.
SiRNA comprises all siRNA sequences of passing through RNA interference principle specificity degraded target gene at the acceptor gene design.
The present invention also provides pharmaceutical composition and the test kit that can be used for disease treatment.
According to one embodiment of the invention, the invention provides a kind of pharmaceutical composition, comprise available carrier on the cell particles that contains disturbance ribonucleic acid and the medicine.Carrier for example comprises normal saline, serum, cell culture fluid, phosphate buffer (PBS) etc.
According to one embodiment of the invention, the invention provides a kind of test kit, comprising the cell particles that contains disturbance ribonucleic acid or contain the pharmaceutical composition of the cell particles of disturbance ribonucleic acid, and operation instruction.
Use contains the cell particles of disturbance ribonucleic acid or contains the pharmaceutical composition of this cell particles that contains disturbance ribonucleic acid or disease that test kit can prevent and/or treat comprises various tumors; Various acute and chronic infectious disease, viral diseases such as for example viral influenza, viral hepatitis, acquired immune deficiency syndrome (AIDS), SARS, the acute and chronic infectious disease that for example bacterial disease such as tuberculosis, bacterial pneumonia, and other various pathogenic microorganisms causes; Other acute and chronic diseases, respiratory system disease for example, disease of immune system, blood and disease of hematopoietic system, blood circulation diseases, hormonal system metabolic disease, digestive system disease, nervous system disease, diseases of urinary system, reproductive system disease and locomotor disease.
Method
The present invention provides a kind of preparation to contain the method for the cell particles of disturbance ribonucleic acid in addition, comprises the following steps:
The application cell rotaring dyeing technology changes disturbance ribonucleic acid over to cell; Or the viral vector method changes disturbance ribonucleic acid over to cell;
Separate the cell particles that contains disturbance ribonucleic acid.
The method for preparing cell particles comprises, for example differential centrifugation, immunoabsorption and ultrafiltration.
The preferred differential centrifugation that adopts prepares cell particles, for example comprise the steps: earlier that the cell or tissue of body fluid, blood, cell, tissue, In vitro culture is centrifugal, remove various types of cells and fragment, then with the supernatant ultracentrifugation, getting precipitation is cell particles.
Perhaps preferably, use immunoabsorption to prepare cell particles, for example may further comprise the steps: (1) is earlier centrifugal with the cell or tissue of body fluid, blood, cell, tissue, In vitro culture, removes various cells and fragment, gets supernatant; (2) will be adsorbed on the antibody of the cell-specific on tissue culture's ware or immunomagnetic beads (Invitrogen, the U.S.) and supernatant incubation (for example 30～60 minutes), the cell particles that obtains being adsorbed.
Perhaps preferably, adopt the ultrafiltration that for example may further comprise the steps:
(1) earlier with various cells of the centrifugal removal of the cell or tissue of body fluid, blood, cell, tissue, In vitro culture and fragment, gets supernatant; (2) supernatant is put into the concentrated centrifuge tube (Millipore, the U.S.) that has the 100KD filter membrane, carried out centrifugally in 4000 rev/mins, concentrate and promptly to get cell particles.
Preferably, the invention provides a kind of method that load has the cell particles of siRNA for preparing, this micropartical can efficiently, special enter recipient cell or organism, disturbs the protein expression of its target gene by siRNA.
According to one embodiment of the invention, this method comprises:
1) the siRNA parcel is entered the donorcells micropartical;
2) separate the excretory cell particles of donorcells;
3) efficiency of loading of siRNA in the detection cell particles;
4) cell particles that will contain siRNA is introduced receptor, and for example recipient cell is preferably annotated (penetrating) and gone into organism.
According to another embodiment of the invention, the method that preparation contains the cell particles of disturbance ribonucleic acid comprises:
1) design is at the siRNA sequence of target gene;
2) ripe siRNA of chemosynthesis or structure siRNA expression vector;
3) the application cell rotaring dyeing technology changes siRNA cell over to or changes the siRNA expression vector over to cell.
Preferably, the design of target gene siRNA sequence abides by the principle:
(1) the siRNA fragment satisfies AAN19TT, NAN19NN, NARN17YNN and NANN17YNN (N represents any base, and R and Y represent purine and pyrimidine respectively).
(2) select the complementary DNA exon sequence of no repetitive sequence and antisense strand with balanced A, G, C, T content (or GC content is 30%～70%).
(3) avoid having in the sequence single base, especially the G base of bunchiness.
(4) avoid 3 ' and 5 ' hold untranslated zone (5 '-UTR, 3 '-UTR), these sites are the protein-bonded binding sites of mRNA usually.
(5) avoid the juncture area (exon-exonboundaries) of start codon or exon and exon.
The siRNA sequence of design is carried out the BLAST retrieval EST or the Unigene data base of U.S. NCBI (National Center for BiotechnologyInfermation), to guarantee the specificity of siRNA sequence to target gene.
Preferably, the method that makes up the siRNA expression vector comprises: will be about containing of 70bp specific stem ring and the dna molecular of termination signal be inserted in the specific support.
Preferably, the method for transfection siRNA adopts liposome (Lipofectamine2000 of Invitrogen company) method.
The preparation method of cell particles is selected from one or more in differential centrifugation, immunoabsorption and the ultrafiltration.
The method of siRNA efficiency of loading is selected from one or more in RT-PCR, Realtime-PCR, Northern blot, immunofluorescence, the fluidic cell method in the detection cell particles.
The RT-PCR method for example may further comprise the steps:
(1) the total RNA of cell/tissue after extraction RNA disturbs obtains the cDNA sample by reverse transcription reaction;
(2) use the target gene specific primer and carry out the PCR reaction;
(3) carry out the agarose gel electrophoresis of PCR product;
(4) EB dyeing back observed result under uviol lamp.
The Real-time PCR method for example may further comprise the steps:
(1) cell/tissue after extraction RNA disturbs obtains the cDNA sample by the RNA reverse transcription reaction;
(2) design target gene specific primer;
(3) add fluorescent probe and carry out the PCR reaction;
Northern blotting method for example may further comprise the steps:
(1) collects blood serum and cell, tissue samples;
(2) extract total RNA by Trizol reagent;
(3) carry out degeneration PAGE electrophoresis and film shift experiment;
(4) preparation isotopic labeling target gene probe;
(5) carry out the film hybridization;
(6) isotope signal detection such as phosphorus shield scanning detecting result.
Immunofluorescence method for example may further comprise the steps:
(1) with cell attachment on holder;
(2) application cell fixative such as paraformaldehyde etc. are with cell fixation;
(3) using skim milk or bovine serum albumin pair cell seals;
(4) use fluorescent-labeled antibody labelling specific target gene protein;
(5) fluorescence microscope is observed cell fluorescence intensity down.
Recipient cell comprises the primary culture of existing all cells system, cell strain and normal person or disease patient autologous tissue/cell.
The organism that cell particles can enter comprises the mankind, various animal and various pathogenic microorganism.Animal comprises selachian, bony fish, Amphibian, reptile, birds and mammals, and pathogenic microorganism comprises antibacterial, spirillum, mycoplasma, rickettsia, chlamydia and actinomycetes.Especially, described pathogenic microorganism comprises each DNA and RNA viruses, as hepatitis B virus, smallpox virus, HIV (human immunodeficiency virus) (Human Immunodeficiency Virus), SARS virus, influenza virus etc.
The present invention also provides a kind of research method, comprising:
By transfection siRNA and control sequence thereof are imported in the donorcells;
Separate the cell particles that contains siRNA;
This cell particles that contains siRNA is added recipient cell;
Study the influence after this cell particles that contains siRNA enters recipient cell.
According to one embodiment of the invention, use the method that the cell particles carry siRNA carries out gene functional research and comprise:
(1) by transfection siRNA and control sequence thereof are imported in the donorcells;
(2) separate the donorcells micropartical that preparation contains siRNA;
(3) cell particles is added recipient cell;
(4) the research cell particles carries siRNA and enters behind the recipient cell influence to the recipient cell function, thereby studies the influence of its target gene cellular function;
The cell particles that research contains siRNA enters behind the receptor method to the influence of recipient cell function and comprises one or more of confocal fluorescent microscopic method, Western bloting method, cell migration method.
For example, Western blot method may further comprise the steps:
(1) uses protein cleavage liquid and extract the cell or tissue total protein;
(2) carry out SDS-PAGE electrophoresis and film shift experiment;
(3) using skim milk or bovine serum albumin seals film;
(4) use the specific antibody that the HRP labelling is crossed, the specific target gene protein on the film is carried out labelling;
(5) add the HRP substrate, produce luminescence-producing reaction;
(6) autoradiography.
The present invention also provides a kind of method that prevents and/or treats disease, comprising: the cell particles that will contain disturbance ribonucleic acid changes receptor over to.
According to one embodiment of the invention, the method for using the cell particles preventing/treating disease of carrying siRNA comprises:
1) by transfection siRNA is imported in the donorcells;
2) separate the donorcells micropartical that preparation contains siRNA;
3) cell particles is added in recipient cell or the injection patient body.
4) cell particles carries siRNA and enters recipient cell or tissue of patient, by disturbing its expression of target gene, causes the change of target gene protein matter content.
5) influence cell function by changing intracellular protein, thereby play the effect of preventing/treating disease.
Disease comprises various tumors; Various acute and chronic infectious disease, viral diseases such as for example viral influenza, viral hepatitis, acquired immune deficiency syndrome (AIDS), SARS, the acute and chronic infectious disease that for example bacterial disease such as tuberculosis, bacterial pneumonia, and other various pathogenic microorganisms causes; Other acute and chronic diseases, respiratory system disease for example, disease of immune system, blood and disease of hematopoietic system, blood circulation diseases, hormonal system metabolic disease, digestive system disease, nervous system disease, diseases of urinary system, reproductive system disease and locomotor disease.
SiRNA comprises all siRNA sequences of passing through RNA interference principle specificity degraded target gene at the Disease-causing gene design;
Gene comprises that all can be transcribed into the genetic fragment of functional molecular, for example protein gene, mciroRNA gene etc.Disease-causing gene comprises the mankind, and various animals comprise that the range gene of development takes place biologies such as selachian, bony fish, Amphibian, reptile, birds and mammal self involved in diseases, and various pathogenic microorganism gene.
Above-mentioned pathogenic microorganism comprises antibacterial, spirillum, mycoplasma, rickettsia, chlamydia and actinomycetes.Especially, described pathogenic microorganism comprises various DNA and RNA viruses, as hepatitis B virus, smallpox virus, HIV (human immunodeficiency virus) (Human Immunodeficiency Virus), SARS virus, influenza virus etc.
The present invention also provides the purposes of the cell particles that contains disturbance ribonucleic acid in carrying disturbance ribonucleic acid.
Embodiment
Be understandable that specific implementations described here represents that by way of example it is not as limitation of the present invention.Under the situation that does not deviate from the scope of the invention, principal character of the present invention can be used for various embodiments.One skilled in the art will appreciate that maybe and can confirm that use normal experiment, many equivalents can both be applied in the particular step described herein.These equivalent places of being considered to and are covered by claim within the scope of the present invention.
Embodiment 1Cell particles separates and detection in blood serum and the cell culture fluid
Present embodiment adopts the differential centrifugation method to isolate cell particles in blood serum and the cell culture fluid respectively:
Particularly, earlier, get supernatant with blood serum or cultured cell centrifugal 5 minutes in 300g; (2) with supernatant centrifugal 20 minutes, get supernatant in 1500g; (3) with supernatant centrifugal 30 minutes, get supernatant in 10000g.(4) with supernatant centrifugal 70 minutes, get precipitation and be cell particles in 110000g.
The cell particles that separation obtains is observed under transmission electron microscope, being comprised: the cell particles precipitation is fixedly spent the night at 4 ℃ with 2.5% glutaraldehyde fixative, and PBS rinsing three times is every all over 10 minutes.Fix 60 minutes with 1% Osmic acid. room temperature afterwards.Sample after fixing is with 10% gelatin embedding, then 4 ℃ fix again with glutaraldehyde after, be cut into small pieces sample (volume is less than 1 cubic millimeter).The sample alcoholic solution dehydration (30%, 50%, 70%, 90%, 95%and100% * 3) of increased concentrations successively.After soaking into embedding with epoxy resin,, observe under the 120kV condition with FEI Tecnai T20 transmission electron microscope at last with the section of Leica UC6 ultramicrotome.
The transmission electron microscope picture that adopts differential centrifugation to separate to obtain cell particles shows that the cell particles that is separated to is not of uniform size as shown in Figure 1 from normal human serum/blood plasma, be distributed in the 10-500nm scope.
Embodiment 2The siRNA transfection enters donorcells
Present embodiment adopts following steps that fluorescently-labeled siRNA transfection is entered cell, and detects transfection efficiency.
At first the different loci at people c-myb gene order designs the siRNA sequence:
(positive-sense strand+ring+antisense strand): 5 '-GGTGGAACAGAATGGAACATTGAAGAAG TGTTCCATTCTGTTCCACC TT-3 ';
Design a random sequence simultaneously as negative control:
(positive-sense strand+ring+antisense strand) 5 '-GACTTCATAAGGCGCATGC TTGAAGAAGGCATGCGCCTTATGAAGTC TT-3 '.
Next, the siRNA of commercial synthetic above-mentioned design adopts the siRNA of green fluorescence dyestuff FITC labelling at the c-myb gene simultaneously.
Adopting liposome Lipofectamine 2000 (Invitrogen, the U.S.) that the siRNA transfection is entered people's Monocytes is THP-1 cell (Chinese Academy of Sciences's Shanghai cell bank), and concrete grammar is as follows:
(1) the THP-1 cell culture is adding in RPMI 1640 culture medium (Gibco, the U.S.) of 10% hyclone (Gibco, the U.S.) 5%CO
2, 37 ℃ of cultivations.
(2) the negative control siRNA with 30 μ llipofectamine 2000 and 600pmol mixes with 1ml OPTI-MEM (Gibco, the U.S.) respectively, forms mixture A and mixture B, places 5min under the room temperature.
(3) the c-myb siRNA with 30 μ l lipofectamine 2000 and 600pmol mixes with 1ml OPTI-MEM (Gibco, the U.S.) respectively, forms mixture C and mixture D, places 5min under the room temperature.
(4) mixture A and mixture B are mixed, generate mixture E, place 20min.
(5) mixture C and mixture D are mixed, generate mixture F, place 20min.
(6) mixture E and F are added respectively in matched group and the experimental group cell, supply OPTI-MEM to 15ml.5%CO2,37 ℃ of cultivations.
Be replaced with normal culture fluid after (7) 6 hours.
(8) transfection finishes behind 24h～48h, can collect sample.
Adopt Real time-PCR method to detect c-myb gene messenger rna level, comprising to detect jamming effectiveness:
(1) the THP-1 cell after the collection transfection
(2) preparation cDNA sample: adopt Trizol reagent (Invitrogen, the U.S.) to extract total RNA, total RNA reverses and promptly obtains the cDNA sample.The reaction system of reverse transcription comprises 4 μ l, 5 * AMV buffer, 2 μ l 10mM each dNTP mixture (Takara, Japan), 0.5 μ l RNase Inhibitor (Takara, Japan), 2 μ l AMV (Takara, Japan) and 0.5 μ lOligodT (Takara, Japan).Reactions steps is 16 ℃ hatched 15 minutes, and 42 ℃ were reacted 1 hour, and hatched 5 minutes for 85 ℃;
(3) Real-time PCR reaction: get 1 μ l cDNA, add 0.3 μ l Taq enzyme (Takara, Japan), 0.5 μ l, 10 μ M forward and reverse primers, 1.2 μ l 25mM MgCl
2, 1.6 μ l 2.5mM eachdNTP mixture (Takara, Japan), 1 μ l, 20 * EVA GREEN, 2 μ l, 10 * PCR buffer, 12.4 μ lH
2O, 20 μ l systems are carried out PCR.What instrument used is ABI Prism 7300 quantitative real time PCR Instruments, and reaction condition is to carry out 1 circulation → 95 ℃, 15 seconds in 95 ℃, 5 minutes, carries out 40 circulations in 60 ℃, 1 minute;
(4) date processing: data processing method is Δ C
TMethod, Δ C
TBe made as the period of reacting when reaching thresholding, then the comparison of two groups of sample disturbance ribonucleic acids can be used equation 2
-Δ CTExpression, wherein Δ C
T=C
T group1-C
T group2The tissue and the cell data processing method be with U6 as interior mark, then the comparison of two groups of sample mRNA expressions can be used equation 2
-Δ CTExpression, wherein Δ C
T=[C
TmiRNA-C
T U6]
Groupl-[C
T miRNA-C
T U6]
Group2
The result crosses the negative control (left post) of random sequence and compares shown in Fig. 2-A with transfection, the m rna expression amount that c-myb gene in the cell of c-mybsiRNA is crossed in transfection significantly reduces, illustrate the transfection method that adopts in this experiment reliably and efficiently.
Adopt the fluidic cell method to detect the efficient that siRNA enters cell simultaneously, the result is shown in Fig. 2-B.The fluidic cell method comprises the steps: to collect the THP-1 cell after the interference, and cell concentration is adjusted to 10
6Individual/ml; (BD FACS Calibur) surveys cell fluorescence intensity, and forward side is lin to the voltage amplification pattern during detection, adopts the FL1-H fluorescence intensity, and FL-1H channel voltage amplification mode is log to use the flow cytometer inspection.By the result as can be seen, compare with contrast (fine rule), transfection the fluorescence intensity of experimental group (thick line) of c-myb siRNA strengthen, the transfection efficiency height of siRNA is described, this kind method is a kind of intuitive and efficient method of the siRNA of detection transfection efficiency.
In addition, can also adopt fluorescence microscopy to detect the efficient that siRNA enters recipient cell, concrete steps comprise: the THP-1 cell that transfection is crossed behind the c-myb siRNA places fluorescence inverted microscope (OLYMPUS) object stage, and excitation wavelength 488nm detects.
The result is shown in Fig. 2-C, and the cell of transfection can show green fluorescence (shown in bright spot among Fig. 2-C), and it is very high to illustrate that siRNA enters the efficient of cell.
Embodiment 3Cell particles carries siRNA and enters recipient cell
Present embodiment detects the efficient that it loads siRNA by collecting the cell particles that the THP-1 cell of c-myb siRNA is crossed in transfection, and it is added its target cell, detects the efficient that it enters target cell.
Be chosen in person monocytic cell/macrophage system THP-1 of playing an important role in the inflammatory reaction as object of study, the THP-1 cell culture in the RPMI1640 culture medium of having added 10% hyclone (Gibco, the U.S.) (Gibco, the U.S.), 5%CO
2, 37 ℃ cultivate down.At first, the siRNA transfection method in the Application Example 2, the THP-1 cell of c-myb siRNA is crossed in the preparation transfection.
Next, the separation method of cell particles in the Application Example 1 separates the THP-1 cell particles that c-mybsiRNA is crossed in transfection.
Detect the efficient that institute's isolated cells micropartical is loaded siRNA by the fluidic cell method again.
The result is shown in Fig. 3-A.Forward side is log to the voltage amplification pattern during detection, adopts the FL1-H fluorescence intensity, and FL-1 channel voltage amplification mode is log.As can be seen from the results, in the excretory cell particles of THP-1, some (Fig. 3-B vertical line is with right half) is labeled fluorescent labeling.Because c-myb siRNA by fluorescent labeling, therefore, uses the fluorescence intensity of flow cytometer detection of particles, just can reflect the efficient of micropartical loading siRNA.
The micropartical that will carry the THP-1 emiocytosis of c-myb siRNA at last adds in the cell culture fluid of people venule endotheliocyte HMEC-1 (State of Georgia, US Disease Control and Prevention Center).HMCE-1HMEC-1 cultivates in the MCDB-131 culture medium of having added 10ng/mL epidermal growth factor (Becton-Dickinson, the U.S.), 10ng/mL hydrocortisone (Sigma) and 10% hyclone (Gibco, the U.S.), 5%CO
2, 37 ℃ cultivate down.
Because under physiological situation, Monocytes can interact with vascular endothelial cell, and the molecule on mononuclear cell surface can be specifically and the ligand/receptor combination of endothelial cell surface, brings out a series of signal conduction and cell physiological activity.Therefore, using Monocytes is the interaction that THP-1 and venule endothelial cell line HMEC-1 just can interior these the two kinds of cells of analogue body.
Detection has added the efficient that the THP-1 micropartical of carrying siRNA enters the HMCE-1 cell.Because cell particles by the green fluorescence labelling, therefore, is used fluorescence microscope and is detected HMEC-1 fluorescence result, just can reflect that micropartical enters the efficient of HMEC-1.The result is shown in Fig. 3-C.
By the result as can be seen, the cell particles that carries siRNA can efficiently specificly enter target cell HMEC-1 (bright spot among Fig. 3-C).Again because all cells can both be as hemocyte secretory cell micropartical; And all cells also can be accepted cell particles with the emiocytosis of its specific effect as endotheliocyte.Therefore, the THP-1 cell particles model of action that enters the HMEC-1 cell can simulate also that all cells micropartical enters the model of action of its target cell on the organism.
Be not difficult to find that cell particles is the carrier of ideal stable, efficient, special delivery siRNA, can siRNA be passed to its recipient cell by cell particles by above experimental result.Prompting can be passed through micropartical, will be as the siRNA high-affinity of medicine, specific being delivered in the target cell, and the function of the target cell by influencing the involved in diseases morbidity reaches the purpose of chemoprophylaxis/treatment.
Embodiment 4The cell particles research gene function of siRNA is carried in application
This implementation column application cell micropartical will change in the recipient cell efficiently, specifically at the siRNA of target gene, reduce target gene expression in the recipient cell by specificity, simulation pathological condition or play the effect of gene knockout is with the physiological function of research target gene in cell.
Present embodiment has selected the c-myb gene as object of study, and cell transcription factor of c-myb gene code plays a significant role in the survival of differentiation, propagation, migration and the hemocyte of cell.C-myb has been proved to be an important proto-oncogene, with the generation of multiple cancer development substantial connection is arranged.
In order to study the function of c-myb gene in endotheliocyte, designed following experiment:
1) the siRNA transfection method in the Application Example 2, the THP-1 cell of c-myb siRNA is crossed in the preparation transfection.
2) separation method of cell particles in the Application Example 1 separates the THP-1 cell particles that c-myb siRNA is crossed in transfection
3) cell particles that will carry c-myb siRNA joins in the culture fluid of HMEC-1 cell, and collecting cell after 6 hours carries out Western Blot experiment according to following steps.Concrete steps comprise:
(1) uses protein cleavage liquid and extract total protein of cell;
(2) under the 90V constant-pressure conditions, carry out the SDS-PAGE electrophoresis;
(3) under the 160mA constant current conditions, carry out the film shift experiment;
(4) using 5% skim milk seals film;
(5) use the monoclonal antibody (Santa Cluz company) of anti-c-myb and the monoclonal antibody of anti-GAPDH (Santa Cluz company) respectively and respectively c-myb and GAPDH are carried out labelling.
(6) adding corresponding HRP labelling two resists;
(7) add the HRP substrate, produce luminescence-producing reaction;
(8) autoradiography.
Because siRNA by combining with its target gene mRNA, recruits intracellular reticent complex its target gene mRNA is degraded, thereby cause the decline of its target gene protein expression.Therefore, the Western blot technology by the detection specificity protein expression level just can detect the efficient that siRNA enters recipient cell.
The result is shown in Fig. 4-A.By the result as seen, GAPDH proves that as confidential reference items the total protein concentration that adds in the Western blot process all is the same in all bands.Simultaneously, compare with the cell (band 2) of transfection negative control, the middle proteic expression of c-myb of cell (band 3) that c-myb siRNA is crossed in transfection has obvious decline.Thus, the inventor proves: the c-mybsiRNA that cell particles carries has entered the HMEC-1 cell, and interference effect has been played in the proteic expression of c-myb in the HMEC-1 cell.Proved that further cell particles can siRNA is efficiently, specific enter target cell, as a kind of laboratory facilities, studied the function of gene in specific cells with this.
Simultaneously present embodiment has also detected siRNA that micropartical the carries influence to its target cell HMEC-1 cell migration ability.
The c-myb gene is as an important transcription factor, and the growth of pair cell, migration and differentiation have material impact.Though research has proved that c-myb has obvious regulating and controlling effect to the migration of various kinds of cell, yet whether it plays a role for endothelial cell migration still requires study.
Therefore present embodiment passes through the contained siRNA of application cell micropartical as a kind of experimental technique, reduce the c-myb protein expression in the endothelial cell line HMEC-1 cell specifically, to detect the shift function of cell in this case, whether effect is arranged with this shift function of studying c-myb gene pairs endotheliocyte.
Concrete experimental procedure comprises:
(1) the siRNA transfection method in the Application Example 2, the THP-1 cell of c-myb siRNA is crossed in the preparation transfection.
(2) separation method of cell particles in the Application Example 1 separates the cell particles that the THP-1 cell of c-mybsiRNA is crossed in transfection
(3) the THP-1 cell particles that carries c-myb siRNA was hatched the HMEC-1 cell 2 hours.
(4) detect HMEC-1 cell migration situation.
The cell migration experiment detection method comprises: with the polycarbonate membrane (8-μ m aperture) of the top cell bottom of Transwell Boyden Chamber (6.5mm, Costar, Cambridge, MA, the U.S.) with 0.1% gelatin covering; The HMEC-1 cell hangs with the culture medium that does not contain serum, and concentration is controlled at (1-10) * 10
5Cells/mL; Cell with or the cell particles that comprises siRNA that need not derive from the THP-1 cell hatched 2 hours, the cell above then the HMCE-1 cell being added, cell below adds the culture medium that contains 10% hyclone of 0.5mL simultaneously; 5%CO
2Cell culture incubator hatch 4h; The cell of moving to lower floor is at room temperature fixed 15 minutes with 90% ethanol; Washing; Crystal violet room temperature dyeing with 0.1% 15 minutes; The cell of staying on the filter membrane is scraped carefully; Take pictures (Olympus, BX51, Japan); Cell counting.
Cell microscopic sheet after the migration as Fig. 4-B C shown in the D.By the result as seen, (Fig. 4-B) compare, (transfer ability of Fig. 4-C) obviously strengthens to be carried the HMCE-1 cell that the cell particles of c-myb siRNA handled with negative control.5 of cell countings are the cell number in the visual field at random, and the result compared with the control, is carried the cell number that HMCE-1 cell migration that the cell particles of c-myb siRNA handled crosses and significantly can adds shown in Fig. 4-D.
This shows that the c-myb gene that has reduced expression can significantly strengthen the transfer ability of HMEC-1 cell, therefore, opposite can illustrate, the migration of c-myb gene pairs endotheliocyte has inhibitory action.
Therefore, present embodiment proves, preparation can be loaded with the cell particles of siRNA and the correlation technique research means as a kind of Medical Biology, reduces the function that certain expression of gene in the cell is studied this gene by specificity.
Embodiment 5The cell particles that application is loaded with siRNA carries out the preventing/treating of disease
Present embodiment is used the cell particles be loaded with at the siRNA of HIV (human immunodeficiency virus) (Human Immunodeficiency Virus) (HIV) gene and is suppressed HIV and survive in its host cell and breed.
Specifically may further comprise the steps:
1) at HIV genome sequence design siRNA sequence;
2) the siRNA sequence is inserted in the carrier;
3) the carrier transfection that will carry HIV siRNA enters in the donorcells 293T cell;
4) collect the excretory cell particles of donorcells;
5) the excretory cell particles that is loaded with HIV siRNA of donorcells is added the HIV host cell;
6) detect viral level in the host cell.
The result as shown in Figure 5, vertical coordinate has shown the content of HIV virus in host cell.If will not add viral blank cell (pillar of transverse axis 1 representative) in contrast fully, its value be made as 1; It is so single that to add virus and do not take the viral level in the cell (pillars of transverse axis 2 representatives) of any treatment measure will be more than 16 times of control cells.Yet if adopt the cell particles that is loaded with viral siRNA as treatment means, the viral level in the host cell will reduce in a large number.From the result as seen, add the contained siRNA of cell particles (pillars of transverse axis 5,6 representatives) after, the virus in the host cell is to be reduced to (pillars of transverse axis 6 representatives) about 40%.The more important thing is, if increase the consumption (pillars of transverse axis 5 representatives) of the contained siRNA of micropartical, HIV virus in the host cell even can be suppressed fully, the content of HIV virus can drop to and not add the identical level of virus group (pillar that transverse axis 1 is represented).
In addition, is because carrier itself in order to get rid of the cell particles that is loaded with siRNA to the inhibitory action of HIV, rather than siRNA causes, we also in the host cell of HIV viral infection, changed over to do not contain siRNA blank carrier as another contrast (pillars of transverse axis 3 representatives).As can be seen from the results, only empty carrier can't produce inhibitory action to HIV virus, has proved that also the generation viral inhibition is not carrier but siRNA itself.
Simultaneously, we have also added a kind of anti-AIDS drug of small peptide class as positive control (pillars of transverse axis 4 representatives).By the result as can be seen, this medicine also can only be reduced to HIV content about 50%.Therefore, the cell microgranule that is loaded with HIV siRNA is as can be seen compared with the medicine of conventional therapy acquired immune deficiency syndrome (AIDS), and its functioning efficiency is higher, suppresses the better effects if of virus.Also further specify and use the cell particles treatment disease be loaded with siRNA and have huge development potentiality.
Embodiment 6The calibrating of the pharmaceutical composition that cell particles and the siRNA that is loaded with thereof form
The existence of the pharmaceutical composition that present embodiment is formed by serial of methods calibrating cell particles and the siRNA that is loaded with thereof.
1) by embodiment 2 described methods fluorescently-labeled siRNA is transfected into donorcells.The result is shown in Fig. 2-C, and the siRNA transfection of observing the visible fluorescence labelling under fluorescence microscope enters cell.
2) cross the excretory cell particles of donorcells of fluorescently-labeled siRNA by embodiment 1 described method isolation identification transfection.As seen the result separates the cell particles that obtains and all meets the specific of cell particles from aspects such as form, size, membrane structures as shown in Figure 1.
3) according to the method for embodiment 3, detect separation and purification and be accredited as in the granule of cell particles whether be enclosed with siRNA by flow cytometer, promptly whether formed cell particles and siRNA complex, the result is shown in Fig. 3-B.Because siRNA is by fluorescently-labeled, if contain siRNA in the cell particles, so, cell particles is also one surely by fluorescent labeling.Therefore, we adopt the Flow cytometry cell particles with the fluorescence situation.By Fig. 3-B as seen, there are a large amount of cell particles to carry fluorescence (Fig. 3-B vertical line is with right half), prove to be enclosed with siRNA in the cell particles, also promptly proved the existence of cell particles-siRNA medicinal composition.
The invention provides and comprise: (1) is loaded with the cell particles of disturbance ribonucleic acid.(2) the contained siRNA of application cell micropartical carries out various clinical diseases and (comprises various tumors; Various acute and chronic infectious disease, and the acute and chronic infectious disease that causes of other various pathogenic microorganisms; Other acute and chronic diseases, as respiratory system disease, disease of immune system, blood and disease of hematopoietic system, the blood circulation diseases of cardiovascular and cerebrovascular disease for example, endocrine metabolism systemic disease, digestive system disease, nervous system disease, diseases of urinary system, reproductive system disease and locomotor disease) research of treatment; (3) efficient, the specific delivery interference ribose nuclear of application cell micropartical, as laboratory facilities, research specific gene function.
By above-mentioned a series of research, very clearly the invention provides the method that a kind of preparation is loaded with the cell particles of disturbance ribonucleic acid, this method has higher targeting, stability and high efficiency.
According to said method, the inventor proves that siRNA can enter target cell by cell particles is stable, efficient, specific, by acting on its target gene, the function of target cell is produced certain influence.Thus, the cell particles that is loaded with siRNA not only can be used as a kind of biomedical research means, plays a role in gene functional research; Simultaneously can also efficiently enter organism specifically, play change gene expression, influence cell function as medicine, thus the effect of treatment prevention/disease.
Claims (15)
1. the cell particles that contains disturbance ribonucleic acid.
2. according to the cell particles of claim 1, wherein said cell particles is from human or animal's donorcells.
3. according to the cell particles of claim 2, wherein said donorcells comprises: cell line, primary cell culture.
4. according to the cell particles of claim 1, wherein disturbance ribonucleic acid is wrapped in the cell particles.
5. according to the cell particles of claim 1, wherein the mean diameter of cell particles is the 10-500 nanometer.
6. according to the cell particles of claim 1, wherein cell particles comprises exosome and shedding vesicle and other biological vesicle structure from cell.
7. a test kit comprises according to each described cell particles that contains disturbance ribonucleic acid among the claim 1-6.
8. a pharmaceutical composition comprises each described cell particles that contains disturbance ribonucleic acid among the claim 1-6.
9. prepare the method for each described cell particles among the claim 1-6, comprise the following steps:
Change disturbance ribonucleic acid over to cell, advantageous applications cell transfecting technology or viral vector method;
Separate the cell particles that contains disturbance ribonucleic acid.
10. the method for claim 9 is wherein separated the cell particles that contains disturbance ribonucleic acid by being selected from differential centrifugation, immunoabsorption and the ultrafiltration one or more.
11. a research method comprises:
Each the cell particles that contains disturbance ribonucleic acid among the claim 1-6 is introduced receptor;
Study this cell particles that contains disturbance ribonucleic acid and enter behind the receptor influence function of receptors.
12. a method that prevents and/or treats disease comprises: each described cell particles that contains disturbance ribonucleic acid among the claim 1-6 is introduced in the recipient cell.
13. according to the method for claim 12, wherein said disease comprises
Tumor; The acute and chronic infectious disease, bacterial disease, and the acute and chronic infectious disease that causes of other various pathogenic microorganisms; Respiratory system disease, disease of immune system, blood and disease of hematopoietic system, blood circulation diseases, hormonal system metabolic disease, digestive system disease, nervous system disease, diseases of urinary system, reproductive system disease and locomotor disease.
14. according to the method for claim 13, wherein said disease comprises viral influenza, viral hepatitis, acquired immune deficiency syndrome (AIDS), SARS, the acute and chronic infectious disease that bacterial diseasees such as tuberculosis, bacterial pneumonia, pathogenic microorganism cause.
15. the purposes of the cell particles that contains disturbance ribonucleic acid among the claim 1-6 in each claim in carrying disturbance ribonucleic acid.
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010187578A CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
| CN201010601506.XA CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
| US13/700,062 US9421167B2 (en) | 2010-05-26 | 2010-12-09 | Preparation of microvesicle-siRNA complexes and use thereof in AIDS treatment |
| EP10852044.6A EP2578236B1 (en) | 2010-05-26 | 2010-12-09 | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT |
| PCT/CN2010/079602 WO2011147175A1 (en) | 2010-05-26 | 2010-12-09 | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT |
| HK12105108.4A HK1164369A1 (en) | 2010-05-26 | 2012-05-24 | Preparation of microvesicle-sirna composition and use of the same in aids treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010187578A CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101869715A true CN101869715A (en) | 2010-10-27 |
Family
ID=42994919
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010187578A Pending CN101869715A (en) | 2010-05-26 | 2010-05-26 | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof |
| CN201010601506.XA Expired - Fee Related CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201010601506.XA Expired - Fee Related CN102260667B (en) | 2010-05-26 | 2010-12-09 | Preparation of cell microparticle-siRNA composite and application thereof in treating AIDS |
Country Status (2)
| Country | Link |
|---|---|
| CN (2) | CN101869715A (en) |
| HK (1) | HK1164369A1 (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011147175A1 (en) * | 2010-05-26 | 2011-12-01 | Zhang Chenyu | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT |
| WO2013189309A1 (en) * | 2012-06-21 | 2013-12-27 | 北京命码生科科技有限公司 | Microparticle comprising functional microrna/sirna and application thereof |
| CN103757001A (en) * | 2010-12-09 | 2014-04-30 | 江苏命码生物科技有限公司 | Preparation of cell fine particle-siRNA (small interfering Ribose Nucleic Acid) compound and application of cell fine particle-siRNA compound to treatment of AIDS |
| CN105051192A (en) * | 2012-11-13 | 2015-11-11 | 扬·洛特温尔 | Delivery of therapeutic agent |
| US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
| WO2016078572A1 (en) * | 2014-11-17 | 2016-05-26 | 江苏命码生物科技有限公司 | Novel precursor mirna and application thereof in tumor treatment |
| US9376679B2 (en) | 2010-05-26 | 2016-06-28 | Micromedmark Biotech Co. Ltd. | Microvesicles carrying small interfering RNAs, preparation methods and uses thereof |
| US10959952B2 (en) | 2015-06-10 | 2021-03-30 | Board Of Regents, The University Of Texas System | Use of exosomes for the treatment of disease |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014142235A1 (en) * | 2013-03-13 | 2014-09-18 | Li Zhong | Microvesicle, and manufacturing method for same |
| CN103212090A (en) * | 2013-04-18 | 2013-07-24 | 南京大学 | Application of microvesicle containing TGF (transforming growth factor)-beta1 siRNA (small interfering Ribonucleic Acid) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2621917A1 (en) * | 2005-09-08 | 2007-03-15 | The Research Foundation For Microbial Diseases Of Osaka University | Promoter for introducing gene into lymphocyte or blood cell and application thereof |
| CN101432432A (en) * | 2006-05-03 | 2009-05-13 | 扬·奥洛夫·洛特温尔 | Exosome transfer of nucleic acids to cells |
| US20110177054A1 (en) * | 2008-06-06 | 2011-07-21 | Derrick Gibbings | Use of endo-lysosomal system and secreted vesicles (exosome-like) in treatments and diagnostics based on small rna and experimental study of small rna |
-
2010
- 2010-05-26 CN CN201010187578A patent/CN101869715A/en active Pending
- 2010-12-09 CN CN201010601506.XA patent/CN102260667B/en not_active Expired - Fee Related
-
2012
- 2012-05-24 HK HK12105108.4A patent/HK1164369A1/en not_active IP Right Cessation
Cited By (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011147175A1 (en) * | 2010-05-26 | 2011-12-01 | Zhang Chenyu | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT |
| US9421167B2 (en) | 2010-05-26 | 2016-08-23 | Micromedmark Biotech Co. Ltd. | Preparation of microvesicle-siRNA complexes and use thereof in AIDS treatment |
| US9376679B2 (en) | 2010-05-26 | 2016-06-28 | Micromedmark Biotech Co. Ltd. | Microvesicles carrying small interfering RNAs, preparation methods and uses thereof |
| CN103757001B (en) * | 2010-12-09 | 2016-03-16 | 江苏命码生物科技有限公司 | The preparation of cell particles-siRNA mixture and the application in treating AIDS thereof |
| CN103757001A (en) * | 2010-12-09 | 2014-04-30 | 江苏命码生物科技有限公司 | Preparation of cell fine particle-siRNA (small interfering Ribose Nucleic Acid) compound and application of cell fine particle-siRNA compound to treatment of AIDS |
| US10308932B2 (en) | 2012-06-21 | 2019-06-04 | Micromedmark Biotech Co., Ltd. | Method for expressing, secreting and transferring functional microRNAs/siRNAs and application thereof |
| CN104411339A (en) * | 2012-06-21 | 2015-03-11 | 北京命码生科科技有限公司 | Microparticle comprising functional microRNA/siRNA and application thereof |
| WO2013189309A1 (en) * | 2012-06-21 | 2013-12-27 | 北京命码生科科技有限公司 | Microparticle comprising functional microrna/sirna and application thereof |
| CN104411339B (en) * | 2012-06-21 | 2020-11-17 | 北京命码生科科技有限公司 | Method for expressing, secreting and transporting functional microRNA/siRNA and application thereof |
| CN105051192A (en) * | 2012-11-13 | 2015-11-11 | 扬·洛特温尔 | Delivery of therapeutic agent |
| US9856477B2 (en) | 2012-11-13 | 2018-01-02 | Codiak Biosciences, Inc. | Delivery of therapeutic agent |
| US10370663B2 (en) | 2012-11-13 | 2019-08-06 | Codiak Biosciences, Inc. | Delivery of therapeutic agent |
| CN105051192B (en) * | 2012-11-13 | 2020-04-17 | 科迪艾克生物科学公司 | Delivery of therapeutic agents |
| US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
| WO2016078572A1 (en) * | 2014-11-17 | 2016-05-26 | 江苏命码生物科技有限公司 | Novel precursor mirna and application thereof in tumor treatment |
| CN106177990A (en) * | 2014-11-17 | 2016-12-07 | 江苏命码生物科技有限公司 | A kind of new precursor miRNA and the application in oncotherapy thereof |
| US10959952B2 (en) | 2015-06-10 | 2021-03-30 | Board Of Regents, The University Of Texas System | Use of exosomes for the treatment of disease |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102260667A (en) | 2011-11-30 |
| HK1164369A1 (en) | 2012-09-21 |
| CN102260667B (en) | 2014-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102858375B (en) | It is loaded with the cell particles of disturbance ribonucleic acid, its preparation method and application thereof | |
| CN101869715A (en) | Cell particles carrying interfering ribonucleic acid (RNA), preparation method and application thereof | |
| Deng et al. | Long noncoding RNA CCAL transferred from fibroblasts by exosomes promotes chemoresistance of colorectal cancer cells | |
| Hsieh et al. | Snail-overexpressing cancer cells promote M2-like polarization of tumor-associated macrophages by delivering MiR-21-abundant exosomes | |
| Zhang et al. | Therapeutic potential of exosomal circRNA derived from synovial mesenchymal cells via targeting circEDIL3/miR-485-3p/PIAS3/STAT3/VEGF functional module in rheumatoid arthritis | |
| Sommerkamp et al. | Differential alternative polyadenylation landscapes mediate hematopoietic stem cell activation and regulate glutamine metabolism | |
| Chen et al. | Exosomal miR-222 from adriamycin-resistant MCF-7 breast cancer cells promote macrophages M2 polarization via PTEN/Akt to induce tumor progression | |
| Gu et al. | Breast tumor-derived exosomal microRNA-200b-3p promotes specific organ metastasis through regulating CCL2 expression in lung epithelial cells | |
| Silvestri et al. | Persistence of drug-resistant leukemic stem cells and impaired NK cell immunity in CML patients depend on MIR300 antiproliferative and PP2A-activating functions | |
| CN109402176A (en) | The extracellular vesica separated from erythrocyte and its purposes | |
| CN105177005B (en) | A kind of long non-coding RNA and its application | |
| Xue et al. | miR-371b-5p-engineered exosomes enhances tumor inhibitory effect | |
| CN114929860A (en) | Methods and compositions for modulating cellular aging | |
| Bongolo et al. | Exosomes derived from microRNA-27a-3p overexpressing mesenchymal stem cells inhibit the progression of liver cancer through suppression of Golgi membrane protein 1 | |
| Zhang et al. | Immortalized mesenchymal stem cells: a safe cell source for cellular or cell membrane-based treatment of glioma | |
| CN113718030B (en) | Target PABPC1 related to leukemia diagnosis and treatment and application thereof | |
| CN108239646B (en) | Aptamer combined with liver cancer cell, application of aptamer and detection method using aptamer | |
| Kim et al. | Transient silencing of PTEN in human CD34+ cells enhances their proliferative potential and ability to engraft immunodeficient mice | |
| US20080305085A1 (en) | Compositions And Methods For Stem Cell Expansion | |
| CN115737841A (en) | Gene nano-medicament for enhancing anti-tumor immune effect of T cells and preparation method and application thereof | |
| CN111518900A (en) | Application of miR-1246 as marker for diagnosing and treating acute myeloid leukemia | |
| Wu et al. | Multiple gene knockdown strategies for investigating the properties of human leukemia stem cells and exploring new therapies | |
| CN110079528B (en) | Application of small interfering RNA (ribonucleic acid) targeting OTUD7B gene in glioma targeted therapy | |
| CN113774137B (en) | Application of reagent for detecting biomarker expression in preparation of kit for identifying leukemia drug resistance and/or adverse prognosis | |
| CN112280859B (en) | Breast cancer marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20101027 |