CA2459219A1 - Methods of diagnosis of cancer compositions and methods of screening for modulators of cancer - Google Patents

Abstract

Described herein are genes whose expression are up-regulated or down-regulat ed in specific cancers. Related methods and compositions that can be used for diagnosis and treatment of those cancers are disclosed. Also described herei n are methods that can be used to identify modulators of selected cancers.</SD OAB>

Description

DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

METHODS OF DIAGNOSIS OF CANCER, COMPOSITIONS AND METHODS OF
SCREENING FOR MODULATORS OF CANCER
CROSS-REFERENCES TO RELATED APPLICATIONS
This application claims priority to USSN 60/323,469, filed Setember 17, 2001;
USSN
60/355,145, filed February 8, 2002; USSN 60/369,899, filed April 4, 2002; USSN
60/323,887, filed September 20, 2001; USSN 60/355,257, filed February 8, 2002; USSN
60/325,114, filed September 25, 2001; USSN 60/340,944, filed October 29, 2001; USSN 60/350,666, filed LO November 13, 2001; and USSN 60/372,246, filed April 12, 2002; each of which is incorporated herein by reference for all purposes.

The invention relates to the identification of nucleic acid and protein expression profiles and nucleic acids, products, and antibodies thereto that are involved in cancer; and to the use of 15 such expression profiles and compositions in the diagnosis, prognosis, and therapy of cancer.
The invention further relates to methods for identifying and using agents and/or targets that modulate cancer.
BACKGROUND OF THE INVENTION
Cancer is a major cause of morbidity in the United States. For example, in 1996, the 20 American Cancer Society estimated that 1,359,150 people were diagnosed with a malignant neoplasm and 554,740 died from one of these diseases. Cancer is responsible for 23.9 percent of all American deaths and is exceeded only by heart disease as a cause of mortality (33 percent). Unfortunately, cancer mortality is increasing and sometime early in this century, cancer is expected to become the leading cause of mortality in the United States as it already is 25 in Japan.
Cancers share the charactaristic of disordered control over normal cell division, growth, and differentiation. Their initial clinical manifestations are extremely heterogeneous, with over 70 types of cancer arising in virtually every organ and tissue of the body.
Moreover, some of those similarly classified cancer types may represent multiple different molecular diseases.
30 Unfortunately, some cancers may be virtually asymptomatic until late in the disease course, when treatment is more difficult, and prognosis grim.

Treatment for cancer typically includes surgery, chemotherapy, and/or radiation therapy.
Although nearly 50 percent of cancer patients can be effectively treated using these methods, the current therapies all induce serious side effects which diminish quality of life. The identification of novel therapeutic targets and diagnostic markers will be important for improving the diagnosis and treatment of cancer patients.
Recent advances in molecular medicine have increased the interest in tumor-specific antigens that could serve as targets for various immunotherapeutic or small molecule strategies.
Antigens suitable for immunotherapeutic strategies should be highly expressed in cancer tissues, preferably accessible from the vasculature and at the cell surface, and ideally not expressed in normal adult tissues. Expression in tissues that are dispensable for life, however, may be tolerated, e.g., reproductive organs. Examples of antigens that are currently available for the detection and treatment of certain cancers include Her2/neu and the B-cell antigen CD20.
Humanized monclonal antibodies directed to Her2/neu (Herceptin~/trastuzumab) are currently in use for the treatment of metastatic breast cancer. See Ross and Fletcher (1998) Stem Cells 16:413-428. Similarly, anti-CD20 monoclonal antibodies (Rituxin~/rituximab) are used to effectively treat non-Hodgkin's lymphoma. See Maloney, et al. (1997) Blood 90:2188-2195;
Leget and Czuczman (1998) Curr. Opin. Oncol. 10:548-551.
The elucidation of a role for novel proteins and compounds in disease states for identification of therapeutic targets and diagnostic markers is valuable for improving the current treatment of cancer patients. Accordingly, provided herein are molecular targets for therapeutic intervention in various defined cancers. Additionally, provided herein are methods that can be used in diagnosis and prognosis of cancer. Further provided are methods that can be used to screen candidate bioactive agents for the ability to modulate cancer.
SUMMARY OF THE INVENTION
The present invention provides methods for determining the presence or absence of a pathological cell in a patient, the method comprising detecting a nucleic acid comprising a sequence at least 80% identical to a sequence as described in Tables 2A-68 in a biological sample from the patient, thereby determining the presence or absence of the pathological cell.
In certain embodiments of the method, the pathology is described in Table 1, including a cancer; the biological sample comprises isolated nucleic acids; the nucleic acids are mRNA; the biological sample is tissue from an organ which is affected by the pathology of Table 1, including a cancer; a further step is used of amplifying nucleic acids before the step of detecting the nucleic acid; the detecting is of a protein encoded by the nucleic acid;
the nucleic acid comprises a sequence as described in Tables 2A-68; the detecting step is carned out by using a labeled nucleic acid probe, utilizing a biochip comprising at sequence at least 80% identical to a sequence as described in Tables 2A-68, or detecting a polypeptide encoded by the nucleic acid;
or the patient is undergoing a therapeutic regimen to treat the pathology of Table 1, or is suspected of having the pathology or cancer.
Compostions are also provided, e.g., an isolated nucleic acid molecule comprising a sequence as described in Tables 2A-68, including, e.g., those which are labeled; an expression vector comprising such nucleic acid; a host cell comprising such expression vector; an isolated polypeptide which is encoded by such a nucleic acid molecule comprising a sequence as described in Tables 2A-68; or an antibody that specifically binds the polypeptide. In particular embodiments, the antibody is: conjugated to an effector component, is conjugated to a detectable label (including, e.g., a fluorescent label, a radioisotope, or a cytotoxic chemical), an antibody fragment, or is a humanized antibody.
Additional methods are provided, including methods for specifically targeting a compound to a pathological cell in a patient, the method comprising administering to the patient an antibody, as described, thereby providing the targetting. Others include, e.g., methods for determining the presence or absence of a pathological cell in a patient, the methods comprising contacting a biological sample with an antibody, as described. In more particular methods, the antibody is: conjugated to an effector component, or to a fluorescent label;
or the biological sample is a blood, serum, urine, or stool sample.
Further methods include those for identifying a compound that modulates a pathology-associated polypeptide, the method comprising steps of: contacting the compound with a pathology-associated polypeptide, the polypeptide encoded by a polynucleotide that selectively hybridizes to a sequence at least 80% identical to a sequence as described in Tables 2A-68; and determining the functional effect of the compound upon the polypeptide.
Another drug screening assay method comprises steps of administering a test compound to a mammal having a pathology of Table 1 or a cell isolated therefrom; and comparing the level of gene expression of a polynucleotide that selectively hybridizes to a sequence at least 80%
identical to a sequence as described in Tables 2A-68 in a treated cell or mammal with the level of gene expression of the polynucleotide in a control cell or mammal, wherein a test compound that modulates the level of expression of the polynucleotide is a candidate for the treatment of the pathology.

DETAILED DESCRIPTION OF THE INVENTION
In accordance with the objects outlined above, the present invention provides novel methods for diagnosis and prognosis evaluation for various disorders, e.g., angiogenesis, fibrosis, and various defined forms of cancer, including metastatic cancer, as well as methods S for screening for compositions which modulate such conditions. Also provided are methods for treating such disorders or cancers. See, e.g., American Society of Clinical Oncology (ed. 2001) ASCO Curnculum: Symptom Management Kendall/Hunt, ISBN: 0787277851; Bonadonna, et al. (2001) Textbook of Breast Cancer (2d ed.) Dunitz Martin, ISBN: 1853178241;
Devita and Hellman (eds. 2001) Cancer Principles and Practice of Oncology (2 vols.), Lippincott Williams, ISBN: 0781723876; Howell, et al. (2001) Breast Cancer Isis Medical Media, ISBN:
1901865584; Kaye and Laws (2001) Brain Tumours: An Encyclopedic Approach (2d ed.) Churchill Livingstone, ISBN: 0443064261; Mihm, et al. (2001) The Melanocytic Proliferation:
A Comprehensive Textbook of Pigmented Lesions Wiley-Liss, ISBN: 0471252719;
Montgomery and Aaron (2001) Clinical Pathology of Soft-Tissue Tumors Marcel Dekker, ISBN: 0824702905; Petrovich, et al. (eds. 2001) Combined Modalit,~r of Central Nervous System Tumors (Medical Radiology) Springer Verlag, ISBN: 3540660534; Rosen (2001) Rosen's Breast Patholo~y Lippincott Williams and Wilkins, ISBN: 0781723795;
Shah, et al.
(2001) Oral Cancer Isis Medical Media, ISBN: 189906687X; Weiss and Goldblum (2001) Enzin er and Weiss's Soft Tissue Tumors (4th ed.) Mosby, ISBN: 0323012000;
Abeloff, et al.
(eds. 2000) Clinical Oncology (2d ed.) Churchill Livingstone, ISBN:
044307545X; American Society of Clinical Oncology (ed. 2000) Cancer Genetics and Cancer Predisposition Testing Kendall/Hunt, ISBN: 0787276154; Fletcher (2000) Diagnostic Histopathology of Tumors (2 vols. 2d ed.) Churchill Livingstone, ISBN: 0443079927; Vogelzang (ed. 2000) Comprehensive Textbook of GenitourinarYOncolo~y (2d ed.) Lippincott Williams and Wilkins, ISBN:
0683306456; Holland, et al. (eds. 2000) Holland-Frei Cancer Medicine (Book with CD-ROM
5th ed.) Decker, ISBN: 1550091131; Turnsi, et al. (2000) Lung Cancer Isis Medical Media, ISBN: 1901865428; Bartolozzi and Lencioni (eds. 1999) Liver Mali~ancies:
Diagnostic and Interventional Radiolo~y (Medical Radiology) Springer Verlag, ISBN:
3540647562; Gasparini (ed. 1999) Pro ostic Variables in Node-Negative and Node-Positive Breast Cancer Kluwer, ISBN: 0792384474; Hansen (ed. 1999) The LASLC Textbook of Lung Cancer:
International Association for the Study of Lung Cancer Dunitz Martin, ISBN: 1853177083;
Raghavan, et al.
(eds. 1999) Textbook of Uncommon Cancer (2nd ed.) Wiley, ISBN: 0471929212;
Thawley, et al. (eds. 1999) Comprehensive Management of Head and Neck Tumors (2 vols.) Saunders, ISBN: 0721655823; Whittaker and Holmes (eds. 1999) Leukemia and Related Disorders (3d ed.) Blackwell Science, ISBN: 0865426074; Aapro (ed. 1998) OncoMedia: Medical Oncolo~y (CD-ROM) Elsevier Science, ISBN: 0080427480; Abeloff (1998) Clinical Oncolo~y (Library Version 2 CD-ROM Individual Version 2.0 Windows and Macintosh) Harcourt Brace, ISBN:
0443075557; Benson (ed. 1998) Gastrointestinal Oncolo~y (Cancer Treatment and Research, CTAR 98) Kluwer, ISBN: 0792382056; Brambilla and Brambilla (eds. 1998) Lun~LTumors:
Fundamental Biology and Clinical Management (Vol 124) Marcel Dekker, ISBN:
0824701607;
Canellos, et al. (eds. 1998) The Lym~homas Saunders, ISBN: 0721650309;
Greenspan and Remagen (1998) Differential Diagnosis of Tumors and Tumor-Like Lesions of Bones and Joints Lippincott Williams and Wilkins Publishers, ISBN: 0397517106; Hiddemann (ed.
1998) Acute Leukemias VII- Experimental Approaches and Novel Therapies (Haematologie Und Bluttransfusion, Vol 39), Springer Verlag, ISBN: 3540635041; Husband and Reznek (1998) Imaging in Oncolo~y (2 vols.) Mosby, ISBN: 1899066489; Leibel and Phillips (eds. 1998) Textbook of Radiation Oncolo~y Saunders, ISBN: 0721653367; Maloney and Miller (eds.
1998) Cutaneous Oncology' Patho_physiology Diagnosis and Management Blackwell Science, ISBN: 0865425175; Mittal, et al. (eds. 1998) Advances in Radiation Therapy Kluwe, ISBN:
0792399811; Oldham (ed. 1998) Principles of Cancer Biotherapy (3d ed.) Kluwer, ISBN:
0792335074; Ozols (ed. 1998) Gynecolo~ic Oncolo~y Kluwer, ISBN: 0792380703;
Parkin, et al. (eds. 1998) Cancer Incidence in Five Continents (Iarc Scientific Publications, No 143) Oxford University Press, ISBN: 9283221435; Perez and Brady (eds. 1998) Principles and Practice of Radiation Oncolo~y Lippincott Williams and Wilkins, ISBN:
0397584164; Black, et al. (eds. 1997) Cancer of the Nervous System Blackwell Science, ISBN:
0865423849;
Bonadonna, et al. (1997) Textbook of Breast Cancer: A Clinical Guide to Therapy Blackwell Science, ISBN: 1853173487; Pollock (ed. 1997) Sur ical Oncolo~y Kluwer, ISBN:
0792399005; Sheaves, et al. (eds. 1997) Clinical Endocrine Oncolo~y Blackwell Science, ISBN: 086542862X; Vahrson (1997) Radiation Oncolo_gu of Gynecological Cancers Springer Verlag, ISBN: 0387567682; Walterhouse and Cohn (eds. 1997) Diagnostic and Therapeutic Advances in Pediatric Oncolo~y Kluwer, ISBN: 0792399781; Aisner (ed. 1996) Comprehensive Textbook of Thoracic Oncolo~y Lippincott, Williams and Wilkins, ISBN:
0683000624;
Bertino, et al. (eds. 1996) Encyclopedia of Cancer (3 vols.) Academic, ISBN:
012093230X;
Cavalli, et al. (1996) Textbook of Medical Oncolo~y Dunitz Martin, ISBN:
1853172901;

Peckham, et al. (eds. 1995) Oxford Textbook of Oncolo~y (2-Vols.) Oxford University Press, ISBN: 0192616854; and Freireich and I~antarjian (eds. 1996) Molecular Genetics and Therapy of Leukemia (Cancer Treatment and Research, V. 84) Kluwer, ISBN: 0792339126.
In particular, identification of markers selectively expressed on defined cancers allows for use of that expression in diagnostic, prognostic, or therapeutic methods.
As such, the invention defines various .compositions, e.g., nucleic acids, polypeptides, antibodies, and small molecule agonists/antagonists, which will be useful to selectively identify those markers. For example, therapeutic methods may take the form of protein therapeutics which use the marker expression for selective localization or modulation of function (for those markers which have a causative disease effect), for vaccines, identification of binding partners, or antagonism, e.g., using antisense or RNAi. The markers may be useful for molecular characterization of subsets of the diseases, e.g., as provided in Table 1, which subsets may actually require very different treatments. Moreover, the markers may also be important in related diseases to the specific disorders and cancers, e.g., which affect similar tissues in non-malignant diseases, or have similar mechanisms of induction/maintenance. Metastatic processes or characteristics may also be targeted. Diagnostic and prognostic uses are made available, e.g., to subset related but distinct diseases, or to determine treatment strategy. The detection methods may be based upon nucleic acid, e.g., PCR or hybridization techniques, or protein, e.g., ELISA, imaging, IHC, etc.
The diagnosis may be qualitative or quantitative, and may detect increases or decreases in expression levels.
Tables 2B-66C provide unigene cluster identification numbers for the nucleotide sequence of genes that exhibit increased or decreased expression in cancer samples, particularly sequences involved in angiogenisis, prostate cancer (including androgen independent and taxol resistant prostate cancer), breast cancer, colorectal cancer, cervical cancer, bladder cancer, lung cancer, ovarian cancer, uterine cancer, glioblastoma, Ewing saxeoma, and lung fibrosis. Tables 2A-67 also provide an exemplar accession number that provides a nucleotide sequence that is part of the unigene cluster.
Definitions The term "cancer protein" or "cancer polynucleotide" or "cancer-associated transcript"
refers to nucleic acid and polypeptide polymorphic variants, alleles, mutants, and interspecies homologues that: (1) have a nucleotide sequence that has greater than about 60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably about 92%, 94%, 96%, 97%, 98%, or 99% or greater nucleotide sequence identity, preferably over a region of over a region of at least about 25, 50, 100, 200, 500, 1000, or more nucleotides, to a nucleotide sequence of or associated with a gene of Tables 1-68; (2) bind to antibodies, e.g., polyclonal antibodies, raised against an immunogen comprising an amino acid sequence encoded by a nucleotide sequence of or associated with a gene of Tables 1-68, and conservatively modified variants thereof; (3) specifically hybridize under stringent hybridization conditions to a nucleic acid sequence, or the complement thereof of Tables 1-68 and conservatively modified variants thereof; or (4) have an amino acid sequence that has greater than about 60% amino acid sequence identity, 65%, 70%, 75%, 80%, 85%, preferably 90%, 91%, 93%, 95%, 97%, 98%, or 99% or greater amino sequence identity, preferably over a region of over a region of at least about 25, S0, 100, 200, 500, 1000, or more amino acids, to an amino acid sequence encoded by a nucleotide sequence of or associated with a gene of Tables 1-68. A polynucleotide or polypeptide sequence is typically from a mammal including, but not limited to, primate, e.g., human;
rodent, e.g., rat, mouse, hamster; cow, pig, horse, sheep, or other mammal. A "cancer polypeptide" and a "cancer polynucleotide," include both naturally occurring or recombinant forms.
A "full length" cancer protein or nucleic acid refers to a cancer polypeptide or polynucleotide sequence, or a variant thereof, that contains elements normally contained in one or more naturally occurring, wild type cancer polynucleotide or polypeptide sequences. The "full length" may be prior to, or after, various stages of post-translational processing or splicing, including alternative splicing.
"Biological sample" as used herein is a sample of biological tissue or fluid that contains nucleic acids or polypeptides, e.g., of a cancer protein, polynucleotide, or transcript. Such samples include, but are not limited to, tissue isolated from primates, e.g., humans, or rodents, e.g., mice, and rats. Biological samples may also include sections of tissues such as biopsy and autopsy samples, frozen sections taken for histologic purposes, archival samples, blood, plasma, serum, sputum, stool, tears, mucus, hair, skin, etc. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues. A
biological sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; or a bird; reptile; or fish. Livestock and domestic animals are of interest.
"Providing a biological sample" means to obtain a biological sample for use in methods described in this invention. Most often, this will be done by removing a sample of cells from an animal, but can also be accomplished by using previously isolated cells (e.g., isolated by another person, at another time, and/or for another purpose), or by performing the methods of the invention in vivo. Archival tissues or materials, having treatment or outcome history, will be particularly useful.
The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., about 70% identity, preferably 75%, 80%, 85%, 90%, 91%, 93%, 95%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using, e.g., a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://www.ucbi.nlm.nih.gov/BLAST/
or the like). Such sequences are then said to be "substantially identical."
This definition also refers to, or may be applied to, the complement of a test sequence. The definition also includes sequences that have deletions and/or insertions, substitutions, and naturally occurring, e.g., polymorphic or allelic variants, and man-made variants. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50=
100 amino acids or nucleotides in length.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
A "comparison window", as used herein, includes reference to a segment of contiguous positions selected from the group consisting typically of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known.
Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482-489, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, by the search for similarity method of Pearson and Lipman (1988) Proc. Nat'1. Acad. Sci. USA
85:2444-2448, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA
in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Ausubel, et al. (eds.
1995 and supplements) Current Protocols in Molecular Biolo~y Wiley).
Preferred examples of algorithms that are suitable for determining percent sequence identity and sequence similarity include the BLAST and BLAST 2.0 algorithms, which are described in Altschul, _et al. (1977) Nuc. Acids Res. 25:3389-3402 and Altschul, et al. (1990) J.
Mol. Biol. 215:403-410. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov~. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul, et al., supra). These initial neighborhood word hits act as seeds for initiating searches to fmd longer HSPs containing them.
The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased.-Cumulative scores are calculated using, e.g., for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N
(penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
The BLASTN
program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) o~f 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP
program uses as defaults a wordlength of 3, and expectation (E) of 10, and the scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA
89:10915-919) alignments (B) of 50, expectation (E) of 10, M=S, N=-4, and a comparison of both strands.
The BLAST algorithm also performs a statistical analysis of the similarity between two sequences. See, e.g., Marlin and Altschul (1993) Proc. Nat'1. Acad. Sci. USA
90:5873-5787.
One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(I~), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001. Log values may be negative large numbers, e.g., 5, 10, 20, 30, 40, 40, 70, 90, 110, 150, 170, etc.
An indication that two nucleic acid sequences are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid.
Thus, a polypeptide is typically substantially identical to a second polypeptide, e.g., where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequences.
A "host cell" is a naturally occurnng cell or a transformed cell that contains an expression vector and supports the replication or expression of the expression vector. Host cells may be cultured cells, explants, cells in vivo, and the like. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect, amphibian, or mammalian cells such as CHO, HeLa, and the like (see, e.g., the American Type Culture Collection catalog or web site, www.atcc.org).
The terms "isolated," "purified," or "biologically pure" refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein or nucleic acid that is the predominant species present in a preparation is substantially purified. In particular, an isolated nucleic acid is separated from some open reading frames that naturally flank the gene and encode proteins other than protein encoded by the gene. The term "purified" in some embodiments denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel.
Preferably, it means that the nucleic acid or protein is at least about 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure. "Purify" or "purification" in other embodiments means removing at least one contaminant or component from the composition to be purified. In this sense, purification does not require that the purified compound be homogeneous, e.g., 100% pure.
The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurnng amino acid, as well as to naturally occurnng amino acid polymers, those containing modified residues, and non-naturally occurring amino acid polymers.
The term "amino acid" refers to naturally occurnng and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to the naturally occurnng amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, 'y carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, e.g., an ex carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs may have modified R
groups (e.g., norleucine) or modified peptide backbones, but retain somebasic chemical structure as a naturally occurnng amino acid. Amino acid mimetic refers to a chemical compound that has a structure that is different from the general chemical structure of an amino acid, but that functions similarly to another amino acid.
Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the lUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
"Conservatively modified variant" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical or associated, e.g., naturally contiguous, sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode most proteins. For instance, the colons GCA, GCC, GCG, and GCU each encode the amino acid alanine. Thus, at each position where an alanine is specified by a colon, the colon can be altered to another of the corresponding colons described without altering the encoded polypeptide.
Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes silent variations of the nucleic acid. In certain contexts each colon in a nucleic acid (except AUG, which is ordinarily the only colon for methionine, and TGG, which is ordinarily the only colon for tryptophan) can be modified to yield a functionally similar molecule. Accordingly, a silent variation of a nucleic acid which encodes a polypeptide ~is implicit in a described sequence with respect to the expression product, but not necessarily with respect to actual probe sequences.
As to amino acid sequences, one of skill will recognize that individual substitutions, deletions, or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds, or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention. Typically conservative substitutions include for one another: 1 ) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (I~); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V);
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton (1984) Proteins: Structure and Molecular Properties Freeman).
Macromolecular structures such as polypeptide structures can be described in terms of various levels of organization. For a general discussion of this organization, see, e.g., Alberts, et al. (eds. 2001) Molecular Biology of the Cell (4th el.) Garland; and Cantor and Schimmel (1980) Biophysical Chemistry Part I: The Conformation of Biological Macromolecules Freeman. "Primary structure" refers to the amino acid sequence of a particular peptide.
"Secondary structure" refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains. Domains are portions of a polypeptide that often form a compact unit of the polypeptide and are typically 25 to approximately 500 amino acids long. Typical domains are made up of sections of lesser organization such as stretches of (3-sheet and a-helices. "Tertiary structure"
refers to the complete three dimensional structure of a polypeptide monomer. "Quaternary structure" refers to the three dimensional structure formed, usually by the noncovalent association of independent tertiary units. Ariisotropic terms are also known as energy terms.
"Nucleic acid" or "oligonucleotide" or "polynucleotide" or grammatical equivalents used herein means at least two nucleotides covalently linked together.
Oligonucleotides are typically from about 5, 6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50, or more nucleotides in length, up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10,000, etc. A
nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have at least one different linkahge, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein (1992) Oli~onucleotides and Analogues: A Practical Approach Oxford Univ.
Press); and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7 of Sanghvi and Cook (eds. 1994) Carbohydrate Modifications in Antisense Research ACS
Symposium Series 580. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurnng nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made.
A variety of references disclose such nucleic acid analogs, including, e.g., phosphoramidate (Beaucage, et al. (1993) Tetrahedron 49:1925-1963 and references therein;
Letsinger (1970) J. Or~,_Chem. 35:3800-3803; Sprinzl, et al. (1977) Eur. J.
Biochem. 81:579-589; Letsinger, et al. (1986) Nucl. Acids Res. 14:3487-499; Sawai, et al.
(1984) Chem. Lett.
805, Letsinger, et al. (1988) J. Am. Chem. Soc. 110:4470-4471; and Pauwels, et al. (1986) Chemica Scripta 26:141-149), phosphorothioate (Mag, et al. (1991) Nucleic Acids Res.
19:1437-441; and U.S. Patent No. 5,644,048), phosphorodithioate (Brill, et al.
(1989) J. Am.

Chem. Soc. 111:2321-2322), O-methylphophoroamidite linkages (see Eckstein (1992) Oligonucleotides and Analogues: A Practical Approach, Oxford Univ. Press), and peptide nucleic acid backbones and linkages (see Egholm (1992) J. Am. Chem. Soc.
114:1895-1897;
Meier, et al. (1992) Chem. Int. Ed. En~l. 31:1008-1010; Nielsen (1993) Nature 365:566-568;
Carlsson, et al. (1996) Nature 380:207, all of which are incorporated by reference). Other analog nucleic acids include those with positive backbones (Denpcy, et al.
(1995) Proc. Natl.
Acad. Sci. USA 92:6097-101; non-ionic backbones (U.5. Patent Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141, and 4,469,863; I~iedrowski, et al. (1991) dew. Chem.
Intl. Ed. En 1g ish 30:423-426; Letsinger, et al. (1988) J. Am. Chem. Soc. 110:4470-4471;
Letsinger, et al. (1994) Nucleoside and Nucleotide 13:1597-xxx; Chapters 2 and 3 in Sanghvi and Cook (eds. 1994) Carbohydrate Modifications in Antisense Research ACS Symposium Series 580;
Mesmaeker, et al. (1994) Bioorganic and Medicinal Chem. Lett. 4:395-398; Jeffs, et al.
(1994) J. Biomolecular NMR 34:17; Horn, et al. (1996) Tetrahedron Lett. 37:743-xxx) and non-ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and 5,034,506, and Chapters 6 and T in Sanghvi and Cook (eds. 1994) Carbohydrate Modifications in Antisense Research ACS
Symposium Series 580. Nucleic acids containing one or more carbocyclic sugars are also included within one definition of nucleic acids (see Jenkins, et al. (1995) Chem. Soc. Rev. pp 169-176). Several nucleic acid analogs are described in Rawls (page 35, June 2, 1997) C&E
News.
Particularly preferred are peptide nucleic acids (PNA) which includes peptide nucleic acid analogs. These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids. This results in at least two advantages. The PNA backbone exhibits improved hybridization kinetics.
PNAs have larger changes in the melting temperature (Tm) for mismatched versus perfectly matched basepairs. DNA and RNA typically exhibit a 2-4° C drop in Tm for an internal mismatch. With the non-ionic PNA backbone, the drop is closer to 7-9°
C. Similarly, due to their non-ionic nature, hybridization of the bases attached to these backbones is relatively insensitive to salt concentration. In addition, PNAs are not degraded by cellular enzymes, and thus can be more stable.
The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence. The depiction of a single strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement of the sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thyrnine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc.
"Transcript" typically refers to a naturally occurnng RNA, e.g., a pre-mRNA, hnRNA, or mRNA. As used herein, the term "nucleoside" includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides. In addition, "nucleoside"
includes non-naturally occurring analog structures. Thus, e.g., the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside.
A "label" or a "detectable moiety" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, physiological, chemical, or other physical means. In general, labels fall into three classes: a) isotopic labels, which may be radioactive or heavy isotopes; b) immune labels, which may be antibodies, antigens, or epitope tags; and c) colored or fluorescent dyes. The labels may be incorporated into the cancer nucleic acids, proteins, and antibodies. For example, the label should be capable of producing, either directly or indirectly, a detectable signal. The detectable moiety may be a radioisotope, such as 3H, 14C~ 32p~ 355 or 1251, electron-dense reagents, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin, or an enzyme (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins or other entities which can be made detectable such as alkaline phosphatase, beta-galactosidase, or horseradish peroxidase.
Methods are known for conjugating the antibody to the label. See, e.g., Hunter, et al. (1962) Nature 144:945; David, et al. (1974) Biochemistry 13:1014-1021; Pain, et al.
(1981) J.
Immunol. Meth. 40:219-230; and Nygren (1982) J. Histochem. and Cytochem.
30:407-412.
An "effector" or "effector moiety" or "effector component" is a molecule that is bound (or linked, or conjugated), either covalently, through a linker or a chemical bond, or noncovalently, through ionic, van der Waals, electrostatic, or hydrogen bonds, to an antibody.
The "effector" can be a variety of molecules including, e.g., detection moieties including radioactive compounds, fluorescent compounds, enzymes or substrates, tags such as epitope tags, toxins; activatable moieties, chemotherapeutic agents; lipases;
antibiotics; or radioisotopes, e.g., emitting "hard" beta, radiation.
A "labeled nucleic acid probe or oligonucleotide" is one that is bound, e.g., covalently, through a linker or a chemical bond, or noncovalently, through ionic, van der Waals, electrostatic, or hydrogen bonds to a label such that the presence of the probe may be detected by detecting the presence of the label bound to the probe. Alternatively, methods using high affinity interactions may achieve the same results where one of a pair of binding partners binds to the other, e.g., biotin, streptavidin.
As used herein a "nucleic acid probe or oligonucleotide" is a nucleic acid capable of binding to a target nucleic acid of complementary sequence through one or more types of chemical bonds, usually through complementary base pairing, e.g., through hydrogen bond formation. As used herein, a probe may include natural (e.g., A, G, C, or T) or modified bases (7-deazaguanosine, inosine, etc.). In addition, the bases in a probe may be joined by a linkage other than a phosphodiester bond, preferably one that does not functionally interfere with hybridization. Thus, e.g., probes may be peptide nucleic acids in which the constituent bases are joined by peptide bonds rather than phosphodiester linkages. Probes may bind target sequences lacking complete complementarity with the probe sequence depending upon the stringency of the hybridization conditions. The probes are preferably directly labeled, e.g., with isotopes, chromophores, lumiphores, chromogens, or indirectly labeled, e.g., with biotin to which a streptavidin complex may later bind. By assaying for the presence or absence of the probe, one can detect the presence or absence of the select sequence or subsequence. Diagnosis or prognosis may be based at the genomic level, or at the level of RNA or protein expression.
The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein, or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, e.g., recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed, or not expressed at all.
By the term "recombinant nucleic acid" herein is meant nucleic acid, originally formed in vitro, in general, by the manipulation of nucleic acid, e.g., using polymerases and endonucleases, in a form not normally found in nature. In this manner, operably linkage of different sequences is achieved. Thus an isolated nucleic acid, in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, e.g., using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non recombinantly, are still considered recombinant for the purposes of the invention.
Similarly, a "recombinant protein" is a protein made using recombinant techniques, e.g., through the expression of a recombinant nucleic acid as depicted above. A
recombinant protein is distinguished from naturally occurring protein by at least one or more characteristics. The protein may be isolated or purified away from some or most of the proteins and compounds with which it is normally associated in its wild type host, and thus may be substantially pure.
An isolated protein is unaccompanied by at least some of the material with which it is normally associated in its natural state, preferably constituting at least about 0.5%, more preferably at least about 5% by weight of the total protein in a given sample. A
substantially pure protein comprises at least about 75% by weight of the total protein, with at least about 80% being preferred, and at least about 90% being particularly preferred. The definition includes the production of a skin cancer protein from one organism in a different organism or host cell.
Alternatively, the protein may be made at a significantly higher concentration than is normally seen, through the use of an inducible promoter or high expression promoter, such that the protein is made at increased concentration levels. Alternatively, the protein may be in a form not normally found in nature, as in the addition of an epitope tag or amino acid substitutions, insertions and deletions, as discussed below.
The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not normally found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences, e.g., from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein will often refer to two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
A "promoter" is typically an array of nucleic acid control sequences that direct transcription of a nucleic acid. As used herein, a promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements, which can be located as much as several thousand base pairs from the start site of transcription. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation. The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, e.g., wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.
An "expression vector" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed in operable linkage to a promoter.
The phrase "selectively (or specifically) hybridizes to" refers to the binding, duplexing, or hybridizing of a molecule selectively to a particular nucleotide sequence under stringent hybridization conditions when that sequence is present in a complex mixture (e.g., total cellular or library DNA or RNA).
The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in "Overview of principles of hybridization and the strategy of nucleic acid assays" in Tijssen (1993) Hybridization with Nucleic Probes (Laboratory_Techniques in Biochemistry and Molecular Biolo~y) (vol. 24) Elsevier. Generally, stringent conditions are selected to be about S-10° C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which SO% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
Stringent conditions will be those in which the salt concentration is less than about 1.0 M
sodium ion, typically about 0.01-1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C for short probes (e.g., about 10-50 nucleotides) and at least about 60° C for long probes (e.g., greater than about 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
For selective or specific hybridization, a positive signal is typically at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, Sx SSC, and 1% SDS, incubating at 42° C, or, Sx SSC, 1% SDS, incubating at 65° C, with wash in 0.2x SSC, and 0.1%
SDS at 65° C. For PCR, a temperature of about 36° C is typical for low stringency amplification, although annealing temperatures may vary between about 32°-48° C
depending on primer length. For high stringency PCR amplification, a temperature of about 62° C is typical, although high stringency annealing temperatures can range from about 50-65° C, depending on the primer length and specificity. Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90-95° C for 30-120 sec, an annealing phase lasting 30-120 sec, and an extension phase of about 72° C for 1-2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis, et al. (1990) PCR Protocols: A
Guide to Methods and Applications, Academic Press, NY.
Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, e.g.; when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCI, 1%
SDS at 37° C, and a wash in 1X SSC at 45° C. A positive hybridization is typically at least twice background.
Alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g., Ausubel, et al. (eds. 1991 and supplements) Current Protocols in Molecular Biolo~y Wiley.
The phrase "functional effects" in the context of assays for testing compounds that modulate activity of a cancer protein includes the determination of a parameter that is indirectly or directly under the influence of the cancer protein or nucleic acid, e.g., a physiological, functional, physical, or chemical effect, such as the ability to decrease cancer. It includes ligand binding activity; cell viability; cell growth on soft agar; anchorage dependence; contact inhibition and density limitation of growth; cellular proliferation; cellular transformation;
growth factor or serum dependence; tumor specific marker levels; invasiveness into Matrigel;
tumor growth and metastasis in vivo; mRNA and protein expression in cells undergoing metastasis; and other characteristics of cancer cells. "Functional effects"
include in vitro, in vivo, and ex vivo activities.
By "determining the functional effect" is meant assaying for a compound that increases or decreases a parameter that is indirectly or directly under the influence of a cancer protein sequence, e.g., physiological, functional, enzymatic, physical, or chemical effects. Such functional effects can be measured, e:g., changes in spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index), hydrodynamic (e.g., shape), chromatographic, or solubility properties for the protein, measuring inducible markers or transcriptional activation of the cancer protein, measuring binding activity or binding assays, e.g., binding to antibodies or other ligands, and measuring growth, cellular proliferation, cell viability, cellular transformation, growth factor or serum dependence, tumor specific marker levels, invasiveness into Matrigel, tumor growth and metastasis in vivo, mRNA and protein expression, and other characteristics of cancer cells. The functional effects can be evaluated by many means, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in RNA or protein levels for cancer-associated sequences, measurement of RNA stability, identification of downstream or reporter gene expression (CAT, luciferase, ~i-gal, GFP, and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, and ligand binding assays.
"Inhibitors", "activators," and "modulators" of cancer polynucleotide and polypeptide sequences are used to refer to activating, inhibitory, or modulating molecules or compounds identified using in vitro and in vivo assays of cancer polynucleotide and polypeptide sequences.
Inhibitors are compounds that, e.g., bind to, partially or totally block activity, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity or expression of cancer proteins, e.g., antagonists. Antisense or inhibitory nucleic acids may seem to inhibit expression and subsequent function of the protein. "Activators" are compounds that increase, open, activate, facilitate, enhance activation, sensitize, agonize, or up regulate cancer protein activity.
Inhibitors, activators, or modulators also include genetically modified versions of cancer proteins, e.g., versions with altered activity, as well as naturally occurring and synthetic ligands, antagonists, agonists, antibodies, small chemical molecules, and the like.
Such assays for inhibitors and activators include, e.g., expressing the cancer protein in vitro, in cells, or cell membranes, applying putative modulator compounds, and then determining the functional effects on activity, as described above. Activators and inhibitors of cancer can also be identified by incubating cancer cells with the test compound and determining increases or decreases in the expression of 1 or more cancer proteins, e.g., 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, or more cancer proteins, such as cancer proteins encoded by the sequences set out in Tables 1-68.
Samples or assays comprising cancer proteins that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of inhibition. Control samples (untreated with inhibitors) are assigned a relative protein activity value of 100%. Inhibition of a polypeptide is achieved when the activity value relative to the control is about 80%, preferably 50%, more preferably 25-0%.
Activation of a cancer polypeptide is achieved when the activity value relative to the control (untreated with activators) is 110%, more preferably 150%, more preferably 200-500% (e.g., two to five fold higher relative to the control), more preferably 1000-3000%
higher.
The phrase "changes in cell growth" refers to any change in cell growth and proliferation characteristics in vitro or in vivo, such as cell viability, formation of foci, anchorage independence, semi-solid or soft agar growth, changes in contact inhibition and density limitation of growth, loss of growth factor or serum requirements, changes in cell morphology, gaining or losing immortalization, gaining or losing tumor specific markers, ability to form or suppress tumors when injected into suitable animal hosts, and/or immortalization of the cell.
See, e.g., pp. 231-241 in Freshney (1994) Culture of Animal Cells a Manual of Basic Technigue (2d ed.) Wiley-Liss.
"Tumor cell" refers to precancerous, cancerous, and normal cells in a tumor.
"Cancer cells," "transformed" cells or "transformation" in tissue culture, refers to spontaneous or induced phenotypic changes that do not necessarily involve the uptake of new genetic material. Although transformation can arise from infection with a transforming virus and incorporation of new genomic DNA, or uptake of exogenous DNA, it can also arise spontaneously or following exposure to a carcinogen, thereby mutating an endogenous gene.
Transformation is associated with phenotypic changes, such as immortalization of cells, aberrant growth control, nonmorphological changes, and/or malignancy. See, Freshney (2000) Culture of Animal Cells A Manual of Basic Technigue (4th ed.) Wiley-Liss.
"Antibody" refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen.
The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes.

Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD, and IgE, respectively. Typically, the antigen-binding region of an antibody or its functional equivalent will be most critical in specificity and affinity of binding. See Paul (ed.
1999) Fundamental Immunolo~y (4th ed.) Raven.
An exerriplary immunoglobulin (antibody) structural unit comprises a tetramer.
Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light"
(about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively.
Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, e.g., pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2~ a dimer of Fab which itself is a light chain joined to VH-CHl by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)'2 dimer into an Fab' monomer. The Fab' monomer is essentially Fab with part of the hinge region (see Paul (ed. 1999) Fundamental Immunolo~y (4th ed.) Raven. While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modifieation of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty, et al. (1990) Nature 348:552-554).
For preparation of antibodies, e.g., recombinant, monoclonal, or polyclonal antibodies, many techniques known. See, e.g., Kohler and Milstein (1975) Nature 256:495-497; Kozbor, et al. (1983) Immunology Today 4:72; Cole, et al. (1985) pp. 77-96 in Reisfeld and Sell (1985) Monoclonal Antibodies and Cancer Therapy Liss; Coligan (1991) Current Protocols in Immunolo~y Lippincott; Harlow and Lane (1988) Antibodies: A Laboratory Manual CSH
Press; and Goding (1986) Monoclonal Antibodies: Principles and Practice (2d ed.) Academic Press. Techniques for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized antibodies.
Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens. See, e.g., McCafferty, et al. (1990) Nature 348:552-554; Marks, et al. (1992) Biotechnolo~y 10:779-753.
A "chimeric antibody" is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced, or exchanged so that the antigen binding site (variable region) is linleed to a constant region of a different or altered class, effector function, and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced, or exchanged with a variable region having a different or altered antigen specificity.
Identification of cancer-associated sequences In one aspect, the expression levels of genes are determined in different patient samples for which diagnosis information is desired, to provide expression profiles. An expression profile of a particular sample is essentially a "fingerprint" of the state of the sample; while two states may have any particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is characteristic of the state of the cell. That is, normal tissue may be distinguished from cancerous or metastatic cancerous tissue, or cancer tissue or metastatic cancerous tissue can be compared with tissue from surviving cancer patients. By comparing expression profiles of tissue in known different cancer states, information regarding which genes are important (including both up-and down-regulation of genes) in each of these states is obtained. Molecular profiling may distinguish subtypes of a currently collective disease designation, e.g., different forms of a cancer.
The identification of sequences that are differentially expressed in cancer versus non-cancer tissue allows the use of this information in a number of ways. For example, a particular treatment regime may be evaluated: does a chemotherapeutic drug act to down-regulate cancer, and thus tumor growth or recurrence, in a particular patient. Alternatively, a treatment step may induce other markers which may be used as targets to destroy tumor cells.
Similarly, diagnosis and treatment outcomes may be done or confirmed by comparing patient samples with the known expression profiles. Maliganant disease may be compared to non-malignant conditions.
Metastatic tissue can also be analyzed to determine the stage of cancer in the tissue, or origin of primary tumor, e.g., metastasis from a remote primary site. Furthermore, these gene expression profiles (or individual genes) allow screening of drug candidates with an eye to mimicking or altering a particular expression profile; e.g., screening can be done for drugs that suppress the cancer expression profile. This may be done by making biochips comprising sets of the important cancer genes, which can then be used in these screens. These methods can also be done on the protein basis; that is, protein expression levels of the cancer proteins can be evaluated for diagnostic purposes or to screen candidate agents. In addition, the cancer nucleic acid sequences can be administered for gene therapy purposes, including the administration of antisense nucleic acids, or the cancer proteins (including antibodies and other modulators thereof) administered as therapeutic drugs.
Thus the present invention provides nucleic acid and protein sequences that are differentially expressed in cancer relative to normal tissues and/or non-malignant disease, or in different types of related diseases, herein termed "cancer sequences." As outlined below, cancer sequences include those that are up-regulated (e.g., expressed at a higher level) in cancer, as well as those that are down-regulated (e.g., expressed at a lower level). In a preferred embodiment, the cancer sequences are from humans; however, cancer sequences from other organisms may be useful in animal models of disease and drug evaluation; thus, other cancer sequences are provided, from vertebrates, including mammals, including rodents (rats, mice, hamsters, guinea pigs, etc.), primates, farm animals (including sheep, goats, pigs, cows, horses, etc.) and pets (e.g., dogs, cats, etc.). Cancer sequences from other organisms may be obtained using the techniques outlined below.
Cancer sequences can include both nucleic acid and amino acid sequences. In a preferred embodiment, the skin cancer sequences are recombinant nucleic acids.
These nucleic acid sequences are useful in a variety of applications, including diagnostic applications, which will detect naturally occurnng nucleic acids, as well as screening applications; e.g., biochips comprising nucleic acid probes or PCR microtiter plates with selected probes to the cancer sequences.
A cancer sequence can be initially identified by substantial nucleic acid and/or amino acid sequence homology to 'the cancer sequences outlined herein. Such homology can be based upon the overall nucleic acid or amino acid sequence, and is generally determined as outlined below, e.g., using homology programs or hybridization conditions.
For identifying cancer-associated sequences, the cancer screen typically includes comparing genes identified in different tissues, e.g., normal and cancerous tissues, cancer and non-malignant conditions, non-malignant conditions and normal tissues, or tumor tissue samples from patients who have metastatic disease vs. non metastatic tissue.
Other suitable tissue comparisons include comparing cancer samples with metastatic cancer samples from other cancers, such as lung, stomach, gastrointestinal cancers, etc. Samples of different stages of cancer, e.g., survivor tissue, drug resistant states, and tissue undergoing metastasis, are applied to biochips comprising nucleic acid probes. The samples are first microdissected, if applicable, and treated for preparation of mRNA. Suitable biochips are commercially available, e.g., from Affymetrix, Santa Clara, CA. Gene expression profiles as described herein are generated and the data analyzed.
In one embodiment, the genes showing changes in expression as between normal and disease states are compared to genes expressed in other normal tissues, including, and not limited to lung, heart, brain, liver, stomach, kidney, muscle, colon, small intestine, large intestine, spleen, bone, and/or placenta. In a preferred embodiment, those genes identified during the cancer screen that are expressed in a significant amount in other tissues (e.g., essential organs) are removed from the profile, although in some embodiments, this is not necessary (e.g., where organs may be dispensible, e.g., female or male specific). That is, when screening for drugs, it is usually preferable that the target expression be disease specific, to minimize possible side effects on other organs were there expression.
In a preferred embodiment, cancer sequences are those that are up-regulated in cancer;
that is, the expression of these genes is higher in the cancer tissue as compared to non-cancer or non-malignant tissue. "Up-regulation" as used herein often means at least about a two-fold change, preferably at least about a three fold change, with at least about five-fold or higher being preferred. Another embodiment is directed to sequences up-regulated in non-malignant conditions relative to normal. Uniformity among relevant samples is also preferred.
Unigene cluster identification numbers and accession numbers herein are for the GenBank sequence database and the sequences of the accession numbers are hereby expressly incorporated by reference. GenBank is available, see, e.g., Benson, et al.
(1998) Nuc. Acids Res. 26:1-7; and http://www.ncbi.nlm.nih.gov/. Sequences are also available in other databases, e.g., European Molecular Biology Laboratory (EMBL) and DNA Database of Japan (DDBJ).
In some situations, the sequences may be derived from assembly of available sequences or be predicted from genomic DNA using exon prediction algorithms, such as FGENESH.
See Salamov and Solovyev (2000) Genome Res. 10:516-522. In other situations, sequences have been derived from cloning and sequencing of isolated nucleic acids.
In another preferred embodiment, cancer sequences are those that are down-regulated in the cancer; that is, the expression of these genes is lower in cancer tissue as compared to non-cancerous tissue. "Down-regulation" as used herein often means at least about a two-fold change, preferably at least about a three fold change, with at least about five-fold or higher being preferred.
Informatics The ability to identify genes that axe over or under expressed in cancer can additionally provide high-resolution, high-sensitivity datasets which can be used in the areas of diagnostics, therapeutics, drug development, pharmacogenetics, protein structure, biosensor development, and other related areas. For example, the expression profiles can be used in diagnostic or prognostic evaluation of patients with cancer or related diseases. See Tables 1 and 3. Or as another example, subcellular toxicological information can be generated to better direct drug structure and activity correlation (see Anderson (June 11-12, 1998) Pharmaceutical Proteomics:
Targets Mechanism, and Function, paper presented at the IBC Proteomics conference, Coronado, CA). Subcellular toxicological information can also be utilized in a biological sensor device to predict the likely toxicological effect of chemical exposures and likely tolerable exposure thresholds (see U.S. Patent No. 5,811,231). Similar advantages accrue from datasets relevant to other biomolecules and bioactive agents (e.g., nucleic acids, saccharides, lipids, drugs, and the like).
Thus, in another embodiment, the present invention provides a database that includes at least one set of assay data. The data contained in the database is acquired, e.g., using array analysis either singly or in a library format. The database can be in a form in which data can be maintained and transmitted, but is preferably an electronic database. The electronic database of the invention can be maintained on any electronic device allowing for the storage of and access to the database, such as a personal computer, but is preferably distributed on a wide area network, such as the World Wide Web.
The focus of the present section on databases that include peptide sequence data is for clarity of illustration only. Similar databases can be assembled for assay data acquired using an assay of the invention.

The compositions and methods for identifying andlor quantitating the relative and/or absolute abundance of a variety of molecular and macromolecular species from a biological sample representing cancer, e.g., the identification of cancer-associated sequences described herein, provide an abundance of information which can be correlated with pathological conditions, predisposition to disease, drug testing, therapeutic monitoring, gene-disease causal linkages, identification of correlates of immunity and physiological status, among others.
Although the data generated from the assays of the invention is suited for manual review and analysis, in a preferred embodiment, data processing using high-speed computers is utilized.
An array of methods for indexing and retrieving biomolecular information is available.
For example, U.S. Patents 6,023,659 and 5,966,712 disclose a relational database~system for storing biomolecular sequence information in a manner that allows sequences to be catalogued and searched according to one or more protein function hierarchies. U.S.
Patent 5,953,727 discloses a relational database having sequence records containing information in a format that allows a collection of partial-length DNA sequences to be catalogued and searched according to association with one or more sequencing projects for obtaining full-length sequences from the collection of partial length sequences. U.S. Patent 5,706,498 discloses a gene database retrieval system for making a retrieval of a gene sequence similar to a sequence data item in a gene database based on the degree of similarity between a key sequence and a target sequence. U.S:
Patent 5,538,897 discloses a method using mass spectroscopy fragmentation patterns of peptides to identify amino acid sequences in computer databases by comparison of predicted mass spectra with experimentally-derived mass spectra using a closeness-of fit measure. U.S.
Patent 5,926,818 discloses a mufti-dimensional database comprising a functionality for multi-dimensional data analysis described as on-line analytical processing (OLAP), which entails the consolidation of projected and actual data according to more than one consolidation path or dimension. U.S. Patent 5,295,261 reports a hybrid database structure in which the fields of each database record are divided into two classes, navigational and informational data, with navigational fields stored in a hierarchical topological map which can be viewed as a tree structure or as the merger of two or more such tree structures. See also Baxevanis, et al. (2001) Bioinformatics: A Practical Guuide to the Analysis of Genes and Proteins Wiley; Mount (2001) Bioinformatics: Sequence and Genome Analysis CSH Press, NY; Durbin, et al.
(eds. 1999) Biological Sequence Ana~sis: Probabilistic Models of Proteins and Nucleic Acids Cambridge University Press; Baxevanis and Oeullette (eds. 1998) Bioinformatics: A
Practical Guide to the Analysis of Genes and Proteins (2d. ed.) Wiley-Liss; Rashidi and Buehler (1999) Bioinformatics: Basic Applications in Biological Science and Medicine CRC
Press; Setubal, et al. (eds. 1997) Introduction to Computational Molecular Biolo~y Brooks/Cole;
Misener and Krawetz (eds. 2000) Bioinformatics: Methods and Protocols Humana Press;
Higgins and Taylor S (eds. 2000) Bioinformatics: Sequence Structure, and Databanks: A Practical Approach Oxford University Press; Brown (2001) Bioinformatics: A Biologist's Guide to Biocomputing and the Internet Eaton Pub.; Han and I~amber (2000) Data Mining: Concepts and Techniques I~aufinann Pub.; and Waterman (1995) Introduction to Computational Biology:
Maps Sequences, and Genomes Chap and Hall.
The present invention provides a computer database comprising a computer and software for storing in computer-retrievable form assay data records cross-tabulated, e.g., with data specifying the source of the target-containing sample from which each sequence specificity record was obtained.
In an exemplary embodiment, at least one of the sources of target-containing sample is from a control tissue sample known to be free of pathological disorders. In a variation, at least one of the sources is a known pathological tissue specimen, e.g., a neoplastic lesion or another tissue specimen to be analyzed for cancer. In another variation, the assay records cross-tabulate one or more of the following parameters for each target species in a sample:
(1) a unique identification code, which can include, e.g., a target molecular structure and/or characteristic separation coordinate (e.g., electrophoretic coordinates); (2) sample source;
and (3) absolute and/or relative quantity of the target species present in the sample.
The invention also provides for the storage and retrieval of a collection of target data in a computer data storage apparatus, which can include magnetic disks, optical disks, magneto-optical disks, DRAM, SRAM, SGRAM, SDRAM, RDRAM, DDR RAM, magnetic bubble memory devices, and other data storage devices, including CPU registers and on-CPU data storage arrays. Typically, the target data records are stored as a bit pattern in an array of magnetic domains on a magnetizable medium or as an array of charge states or transistor gate states, such as an array of cells in a DRAM device (e.g., each cell comprised of a transistor and a charge storage area, which may be on the transistor). In one embodiment, the invention provides such storage devices, and computer systems built therewith, comprising a bit pattern encoding a protein expression fingerprint record comprising unique identifiers for at least 10 target data records cross-tabulated with target source.

When the target is a peptide or nucleic acid, the invention preferably provides a method for identifying related peptide or nucleic acid sequences, comprising performing a computerized comparison between a peptide or nucleic acid sequence assay record stored in or retrieved from a computer storage device or database and at least one other sequence. The comparison can include a sequence analysis or comparison algorithm or computer program embodiment thereof (e.g., FASTA, TFASTA, GAP, BESTFIT) and/or the comparison may be of the relative amount of a peptide or nucleic acid sequence in a pool of sequences determined from a polypeptide or nucleic acid sample of a specimen.
The invention also preferably provides a magnetic disk, such as an IBM-compatible (DOS, Windows, Windows95/98/2000, Windows NT, OS/2) or other format (e.g., Linux, SunOS, Solaris, AIX, SCO Unix, VMS, MV, Macintosh, etc.) floppy diskette or hard (fixed, Winchester) disk drive, comprising a bit pattern encoding data from an assay of the invention in a file format suitable for retrieval and processing in a computerized sequence analysis, comparison, or relative quantitation method.
The invention also provides a network, comprising a plurality of computing devices linked via a data link, such as an Ethernet cable (coax or lOBaseT), telephone line, ISDN line, wireless network, optical fiber, or other suitable signal transmission medium, whereby at least one network device (e.g., computer, disk array, etc.) comprises a pattern of magnetic domains (e.g., magnetic disk) and/or charge domains (e.g., an array of DRAM cells) composing a bit pattern encoding data acquired from an assay of the invention.
The invention also provides a method for transmitting assay data that includes generating an electronic signal on an electronic communications device, such as a modem, ISDN terminal adapter, DSL, cable modem, ATM switch, or the like, wherein the signal includes (in native or encrypted format) a bit pattern encoding data from an assay or a database comprising a plurality of assay results obtained by the method of the invention.
In a preferred embodiment, the invention provides a computer system for comparing a query target to a database containing an array of data structures, such as an assay result obtained by the method of the invention, and ranking database targets based on the degree of identity and gap weight to the target data. A central processor is preferably initialized to load and execute the computer program for alignment and/or comparison of the assay results.
Data for a query target is entered into the central processor via an I/O device. Execution of the computer program results in the central processor retrieving the assay data from the data file, which comprises a binary description of an assay result.
The target data or record and the computer program can be transferred to secondary memory, which is typically random access memory (e.g., DRAM, SRAM, SGRAM, or SDRAM). Targets are ranked according to the degree of correspondence between a selected assay characteristic (e.g., binding to a selected affinity moiety) and the same characteristic of the query target and results are output via an UO device. For example, a central processor can be a conventional computer (e.g., Intel Pentium, PowerPC, Alpha, PA-8000, SPARC, MIPS
4400, M1PS 10000, VAX, etc.); a program can be a commercial or public domain molecular biology software package (e.g., UWGCG Sequence Analysis Softwaxe, Darwin); a data file can be an optical or magnetic disk, a data server, a memory device (e.g., DRAM, SRAM, SGRAM, SDRAM, EPROM, bubble memory, flash memory, etc.); an I/O device can be a terminal comprising a video display and a keyboard, a modem, an ISDN terminal adapter, an Ethernet port, a punched card reader, a magnetic strip reader, or other suitable I/O
device.
The invention also preferably provides the use of a computer system, such as that described above, which comprises: (1) a computer; (2) a stored bit pattern encoding a collection of peptide sequence specificity records obtained by the methods of the invention, which may be stored in the computer; (3) a comparison target, such as a query target; and (4) a program for alignment and comparison, typically with rank-ordering of comparison results on the basis of computed similarity values. See, e.g., Ewens and Grant (2001) Statistical Methods in Bioinformatics: An Introduction Springer-Verlag. Mathematical approaches can also be used to conclude whether similarities or differences in the gene expression exhibited by different samples are significant. See, e.g., Golub, et al. (1999) Science 286:531-537;
Duda, et al. (2001) Pattern Classification Wiley; and Hastie, et al. (2001) The Elements of Statistical Learning:
Data Mining Inference, and Prediction Springer-Verlag. One approach to determine whether a sample is more similar to or has maximum similarity with a given condition between the sample and one or more pools representing different conditions for comparison; the pool with the smallest vector angle is then chosen as the most similar to the biological sample among the pools compared.
Characteristics of cancer-associated proteins Cancer proteins of the present invention may be classified as secreted proteins, transmembrane proteins, or intracellular proteins. In one embodiment, the cancer protein is an intracellular protein. Intracellular proteins may be found in the cytoplasm and/or in the nucleus.
Intracellular proteins are involved in all aspects of cellular function and replication (including, e.g., signaling pathways); aberrant expression of such proteins often results in unregulated or disregulated cellular processes (see, e.g., Alberts, et al. (eds. 1994) Molecular Biolo~;y of the Cell (3d ed.) Garland). For example, many intracellular proteins have enzymatic activity such as protein kinase activity, protein phosphatase activity, protease activity, nucleotide cyclase activity, polymerase activity, and the like. Intracellular proteins also serve as docking proteins that are involved in organizing complexes of proteins, or targeting proteins to various subcellular localizations, and are involved in maintaining the structural integrity of organelles.
An increasingly appreciated concept in characterizing proteins is the presence in the proteins of one or more structural motifs for which defined functions have been attributed. In addition to the highly conserved sequences found in the enzymatic domain of proteins, highly conserved sequences have been identified in proteins that are involved in protein-protein interaction. For example, Src-homology-2 (SH2) domains bind tyrosine-phosphorylated targets in a sequence dependent manner. PTB domains, which are distinct from SH2 domains, also bind tyrosine phosphorylated targets. SH3 domains bind to proline-rich targets. In addition, PH
domains, tetratricopeptide repeats and WD domains to name only a few, have been shown to mediate protein-protein interactions. Some of these may also be involved in binding to phospholipids or other second messengers. These motifs can be identified on the basis of amino acid sequence; thus, an analysis of the sequence of proteins may provide insight into both the enzymatic potential of the molecule and/or molecules with which the protein may associate.
One useful database is Pfam (protein families), which is a large collection of multiple sequence alignments and hidden Markov models covering many common protein domains.
Versions are available via the Internet from Washington University in St. Louis, the Sanger Center in England, and the Karolinska Institute in Sweden. See, e.g., Bateman, et al.
(2000) Nuc. Acids Res. 28:263-266; Sonnhammer, et al. (1997) Proteins 28:405-420 ; Bateman, et al. (1999) Nuc.
Acids Res. 27:260-262; and Sonnhammer, et al. (1998) Nuc. Acids Res. 26:320-322.
In another embodiment, the cancer sequences are transmembrane proteins.
Transmembrane proteins are molecules that span a phospholipid bilayer of a cell. They may have an intracellular domain, an extracellular domain, or both. The intracellular domains of such proteins may have a number of functions including those already described for intracellular proteins. For example, the intracellular domain may have enzymatic activity and/or may serve as a binding site for additional proteins. Frequently the intracellular domain of transmembrane proteins serves both roles. For example certain receptor tyrosine kinases have both protein kinase activity and SH2 domains. In addition, autophosphorylation of tyrosines on the receptor molecule itself, creates binding sites for additional SH2 domain containing proteins.
Transmembrane proteins may contain from one to many transmembrane domains. For example, receptor tyrosine kinases, certain cytokine receptors, receptor guanylyl cyclases and receptor serine/threonine protein kinases contain a single transmembrane domain. However, various other proteins including channels and adenylyl cyclases contain numerous transmembrane domains. Many important cell surface receptors such as G protein coupled receptors (GPCRs) are classified as "seven transmembrane domain" proteins, as they contain 7 membrane spanning regions. Characteristics of transmembrane domains include approximately 17 consecutive hydrophobic amino acids that may be followed by charged amino acids.
Therefore, upon analysis of the amino acid sequence of a particular protein, the localization and number of transmembrane domains within the protein may be predicted (see, e.g., PSORT web site http://psort.nibb.ac.jpn. Important transmembrane protein receptors include, but are not limited to the insulin receptor, insulin-like growth factor receptor, human growth hormone receptor, glucose transporters, transferrin receptor, epidermal growth factor receptor, low density lipoprotein receptor, epidermal growth factor receptor, leptin receptor, and interleukin receptors, e.g., IL-1 receptor, IL-2 receptor, etc.
The extracellular domains of transmembrane proteins are diverse; however, conserved motifs are found repeatedly among various extracellular domains. Conserved structure and/or functions have been ascribed to different extracellular motifs. Many extracellular domains are involved in binding to other molecules. In one aspect, extracellular domains are found on receptors. Factors that bind the receptor domain include circulating ligands, which may be peptides, proteins, or small molecules such as adenosine and the like. For example, growth factors such as EGF, FGF, and PDGF are circulating growth factors that bind to their cognate receptors to initiate a variety of cellular responses. Other factors include cytokines, mitogenic factors, neurotrophic factors, and the like. Extracellular domains also bind to cell-associated molecules. In this respect, they may mediate cell-cell interactions. Cell-associated ligands can be tethered to the cell, e.g., via a glycosylphosphatidylinositol (GPI) anchor, or may themselves be transmembrane proteins. Extracellular domains may also associate with the extracellular matrix and contribute to the maintenance of the cell structure.
Cancer proteins that are transmembrane are particularly preferred in the present invention as they are readily accessible targets for immunotherapeutics, as are described herein.
In addition, as outlined below, transmembrane proteins can be also useful in imaging modalities. Antibodies may be used to label such readily accessible proteins in situ.
Alternatively, antibodies can also label intracellular proteins, in which case samples are typically permeablized to provide access to intracellular proteins. In addition, some membrane proteins can be processed to release a soluble protein, or to expose a residual fragment.
Released soluble proteins may be useful diagnostic markers, processed residual protein fragments may be useful lung markers of disease.
It will also be appreciated that a transmembrane protein can be made soluble by removing transmembrane sequences, e.g., through recombinant methods.
Furthermore, transmembrane proteins that have been made soluble can be made to be secreted through recombinant means by adding an appropriate signal sequence.
In another embodiment, the cancer proteins are secreted proteins; the secretion of which can be either constitutive or regulated. These proteins may have a signal peptide or signal sequence that targets the molecule to the secretory pathway. Secreted proteins are involved in numerous physiological events; e.g., if circulating, they often serve to transmit signals to various other cell types. The secreted protein may function in an autocrine manner (acting on the cell that secreted the factor), a paracrine manner (acting on cells in close proximity to the cell that secreted the factor), an endocrine manner (acting on cells at a distance, e.g, secretion into the blood stream), or exocrine (secretion, e.g., through a duct or to adjacent epithelial surface as sweat glands, sebaceous glands, pancreatic ducts, lacrimal glands, mammary glands, wax producing glands of the ear, etc.). Thus secreted molecules often find use in modulating or altering numerous aspects of physiology. Cancer proteins that are secreted proteins are particularly preferred in the present invention as they serve as good targets for diagnostic markers, e.g., for blood, plasma, serum, or stool tests. Those which are enzymes may be antibody or small molecule targets. Others may be useful as vaccine targets, e.g., via CTL
mechanisms.

Use of cancer nucleic acids As described above, cancer sequence is initially identified by substantial nucleic acid and/or amino acid sequence homology or linkage to the cancer sequences outlined herein. Such homology can be based upon the overall nucleic acid or amino acid sequence, and is generally determined as outlined below, using either homology programs or hybridization conditions.
Typically, linked sequences on a mRNA are found on the same molecule.
As detailed elsewhere, percent identity can be determined using an algorithm such as BLAST. A preferred method utilizes the BLASTN module of WU-BLAST-2 set to the default parameters, with overlap span and overlap fraction set to 1 and 0.125, respectively. Alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than those of the nucleic acids described, the percentage of homology may be determined based on the number of homologous nucleosides in relation to the total number of nucleosides. Thus, e.g., homology of sequences shorter than those of the sequences identified will be determined using the number of nucleosides in the shorter sequence.
In one embodiment, the nucleic acid homology is determined through hybridization studies. Thus, e.g., nucleic acids which hybridize under high stringency to a described nucleic acid, or its complement, or is also found on naturally occurnng mRNAs is considered a cancer sequence. In another embodiment, less stringent hybridization conditions are used; e.g., moderate or low stringency conditions may be used; see Ausubel, supra, and Tijssen, supra.
The cancer nucleic acid sequences of the invention, e.g., the sequences in Tables 1-68, can be fragments of larger genes, e.g., they are nucleic acid segments.
"Genes" in this context includes coding regions, non-coding regions, and mixtures of coding and non-coding regions.
Accordingly, using the sequences provided herein, extended sequences, in either direction, of the cancer genes can be obtained, using techniques well known for cloning either longer sequences or the full length sequences; see Ausubel, et al., supra. Much can be done by informatics and many sequences can be clustered to include multiple sequences corresponding to a single gene, e.g., systems such as UniGene (see, http://www.ncbi.nlm.nih.gov/UniGene/).
Once a cancer nucleic acid is identified, it can be cloned and, if necessary, its constituent parts recombined to form the entire cancer nucleic acid coding regions or the entire mRNA
sequence. Once isolated from its natural source, e.g., contained within a plasmid or other vector or excised therefrom as a linear nucleic acid segment, the recombinant cancer nucleic acid can be further used as a probe to identify and isolate other cancer nucleic acids, e.g., extended coding regions. It can also be used as a "precursor" nucleic acid to make modified or variant cancer nucleic acids and proteins.
The cancer nucleic acids of the present invention are used in several ways. In one embodiment, nucleic acid probes to the cancer nucleic acids are made and attached to biochips to be used in screening and diagnostic methods, as outlined below, or for administration, e.g., for gene therapy, vaccine, RNAi, and/or antisense applications. Alternatively, cancer nucleic acids that include coding regions of cancer proteins can be put into expression vectors for the expression of cancer proteins, again for screening purposes or for administration to a patient.
In a preferred embodiment, nucleic acid probes to cancer nucleic acids (both the nucleic acid sequences outlined in the figures and/or the complements thereof) are made. The nucleic acid probes attached to the biochip are designed to be substantially complementary to the cancer nucleic acids, e.g., the target sequence (either the target sequence of the sample or to other probe sequences, e.g., in sandwich assays), such that hybridization of the target sequence and ~ the probes of the present invention occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. Thus, by "substantially complementary" herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions, particularly high stringency conditions, as outlined herein.
A nucleic acid probe is generally single stranded but can be partially single and partially double stranded. The strandedness of the probe is dictated by the structure, composition, and properties of the target sequence. In general,~the nucleic acid probes range from about 8-100 bases long, with from about 10-80 bases being preferred, and from about 30-50 bases being particularly preferred. That is, generally whole genes are not used. In some embodiments, much longer nucleic acids can be used, up to hundreds of bases.
In a preferred embodiment, more than one probe per sequence is used, with either overlapping probes or probes to different sections of the target being used.
That is, two, three, four or more probes, with three being preferred, are used to build in a redundancy for a particular target. The probes can be overlapping (e.g., have some sequence in common), or separate. In some cases, PCR primers may be used to amplify signal for higher sensitivity.
Nucleic acids can be attached or immobilized to a solid support in a wide variety of ways. By "immobilized" and grammatical equivalents herein is meant the association or binding between the nucleic acid probe and the solid support is sufficient to be stable under the conditions of binding, washing, analysis, and removal as outlined. The binding can typically be covalent or non-covalent. By "non-covalent binding" and grammatical equivalents herein is meant one or more of electrostatic, hydrophilic, and hydrophobic interactions.
Included in non-covalent binding is the covalent attachment of a molecule, e.g., streptavidin to the support and the non-covalent binding of the biotinylated probe to the streptavidin. By "covalent binding"
and grammatical equivalents herein is meant that the two moieties, the solid support and the probe, are attached by at least one bond, including sigma bonds, pi bonds, and coordination bonds. Covalent bonds can be formed directly between the probe and the solid support or can be formed by a cross linker or by inclusion of a specific reactive group on either the solid support or the probe or both molecules. Immobilization may also involve a combination of covalent and non-covalent interactions.
In general, the probes are attached to the biochip in a wide variety of ways.
As described herein, the nucleic acids can either be synthesized first, with subsequent attachment to the biochip, or can be directly synthesized on the biochip.
The biochip comprises a suitable solid substrate. By "substrate" or "solid support" or - other grammatical equivalents herein is meant a material that can be modified for the attachment or association of the nucleic acid probes and is amenable to at least one detection method. Often, the substrate may contain discrete individual sites appropriate for individual partitioning and identification. The number of possible substrates is very large, and include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TeflonJ, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, etc. In general, the substrates allow optical detection and do not appreciably fluoresce. See WO 0055627.
Generally the substrate is planar, although other configurations of substrates may be used as well. For example, the probes may be placed on the inside surface of a tube for flow-through sample analysis to minimize sample volume. Similarly, the substrate may be flexible, such as a flexible foam, including closed cell foams made of particular plastics.
In a preferred embodiment, the surface of the biochip and the probe may be derivatized with chemical functional groups for subsequent attachment of the two. Thus, e.g., the biochip is derivatized with a chemical functional group including, but not limited to, amino groups, carboxy groups, oxo groups, and thiol groups, with amino groups being particularly preferred.
Using these functional groups, the probes can be attached using functional groups on the probes.
For example, nucleic acids containing amino groups can be attached to surfaces comprising amino groups, e.g., using linkers; e.g., homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200). In addition, in some cases, additional linkers, such as alkyl groups (including substituted and heteroalkyl groups) may be used.
In this embodiment, oligonucleotides are synthesized, and then attached to the surface of the solid support. Either the S' or 3' terminus may be attached to the solid support, or attachment may be via linkage to an internal nucleoside. In another embodiment, the immobilization to the solid support may be very strong, yet non-covalent. For example, biotinylated oligonucleotides can be made, which bind to surfaces covalently coated with streptavidin, resulting in attachment.
Alternatively, the oligonucleotides may be synthesized on the surface. For example, photoactivation techniques utilizing photopolymerization compounds and techniques are used.
In a preferred embodiment, the nucleic acids can be synthesized in situ, using known photolithographic techniques, such as those described in WO 95/25116; WO
95/35505; U.S.
Patent Nos. 5,700,637 and 5,445,934; and references cited within, all of which are expressly incorporated by reference; these methods of attachment form the basis of the Affymetrix GeneChipTM technology.
Often, amplification-based assays are performed to measure the expression level of cancer-associated sequences. These assays are typically performed in conjunction with reverse transcription. In such assays, a cancer-associated nucleic acid sequence acts as a template in an amplification reaction (e.g., Polymerase Chain Reaction, or PCR). In a quantitative amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls provides a measure of the amount of cancer-associated RNA. Methods of quantitative amplification are well known.

Detailed protocols for quantitative PCR are provided, e.g., in Innis, et al.
(1990) PCR Protocols, A Guide to Methods and Applications Academic Press.
In some embodiments, a TaqMan based assay is used to measure expression.
TaqMan based assays use a fluorogenic oligonucleotide probe that contains a 5' fluorescent dye and a 3' quenching agent. The probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3' end. When the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase, e.g., AmpliTaq, results in the cleavage of the TaqMan probe. This cleavage separates the 5' fluorescent dye and the 3' quenching agent, thereby resulting in an increase in fluorescence as a function of amplification (see, e.g., literature provided by Perkin-Elmer, e.g., www2.perkin-elmer.com).
Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR) (see Wu and Wallace (1989) Genomics 4:560-569, Landegren, et al. (1988) Science 241:1077-1080, and Barnnger, et al. (1990) Gene 89:117-122), transcription amplification (Kwoh, et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), self sustained sequence replication (Guatelli, et al. (1990) Proc. Nat. Acad. Sci. USA
87:1874-1878), dot PCR, linker adapter PCR, etc.
Expression of cancer proteins from nucleic acids In a preferred embodiment, cancer nucleic acids, e.g., encoding cancer proteins, are used to make a variety of expression vectors to express cancer proteins which can then be used in screening assays, as described below. Expression vectors and recombinant DNA
technology are -well known (see, e.g., Ausubel, supra, and Fernandez and Hoeffler (eds. 1999) Gene Expression S sS terns Academic Press) to express proteins. The expression vectors may be either self replicating extrachromosomal vectors or vectors which integrate into a host genome. Generally, these expression vectors include transcriptional and translational regulatory nucleic acid operably linked to the nucleic acid encoding the cancer protein. The term "control sequences"
refers to DNA sequences used for the expression of an operably linked coding sequence in a particular host organism. Control sequences that are suitable for prokaryotes, e.g., include a promoter, optionally an operator sequence, and a ribosome binding site.
Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
Generally, "operably linked"
means that the DNA sequences being linked are contiguous, and, in the case of a secretory S leader, contiguous and in reading phase. However, enhancers do not have to be contiguous.
Linking is typically accomplished by ligation at convenient restriction sites.
If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice. Transcriptional and translational regulatory nucleic acid will generally be appropriate to the host cell used to express the cancer protein. Numerous types of appropriate expression vectors and suitable regulatory sequences are known for a variety of host cells.
In general, transcriptional and translational regulatory sequences may include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptiorial start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. In a preferred embodiment, the regulatory sequences include a promoter and transcriptional start and 1 S stop sequences.
Promoter sequences may be either constitutive or inducible promoters. The promoters may be either naturally occurring promoters or hybrid promoters. Hybrid promoters, which combine elements of more than one promoter, are also known, and are useful in the present invention.
An expression vector may comprise additional elements. For example, the expression vector may have two replication systems, thus allowing it to be maintained in two organisms, e.g., in mammalian or insect cells for expression and in a prokaryotic host for cloning and amplification. Furthermore, for integrating expression vectors, the expression vector often contains at least one sequence homologous to the host cell genome, and preferably two homologous sequences which flank the expression construct. The integrating vector may be directed to a specific locus in the, host cell by selecting the appropriate homologous sequence for inclusion in the vector. Constructs for integrating vectors are available.
See, e.g., Fernandez and Hoeffler, supra; and Kitamura, et al. (1995) Proc. Nat'1 Acad.
Sci. USA 92:9146-9150.
In addition, in a preferred embodiment, the expression vector contains a selectable marker gene to allow the selection of transformed host cells. Selection genes are well known and will vary with the host cell used.

The cancer proteins of the present invention are usually produced by culturing a host cell transformed with an expression vector containing nucleic acid encoding a cancer protein, under the appropriate conditions to induce or cause expression of the cancer protein. Conditions appropriate for cancer protein expression will vary with the choice of the expression vector and the host cell, and will be easily ascertained through routine experimentation or optimization.
For example, the use of constitutive promoters in the expression vector will require optimizing the growth and proliferation of the host cell, while the use of an inducible promoter requires the appropriate growth conditions for induction. In addition, in some embodiments, the timing of the harvest is important. For example, the baculoviral systems used in insect cell expression are lytic viruses, and thus harvest time selection can be crucial for product yield.
Appropriate host cells include yeast, bacteria, archaebacteria, fungi, and insect and animal cells, including mammalian cells. Of particular interest are Saccharomyces cerevisiae and other yeasts, E. coli, Bacillus subtilis, Sf~3 cells, C129 cells, 293 cells, Neurospora, BHK, CHO, COS, HeLa cells, HLJVEC (human umbilical vein endothelial cells), THP1 cells (a macrophage cell line), and various other human cells and cell lines.
In a preferred embodiment, the cancer proteins are expressed in mammalian cells.
Mammalian expression systems may be used, and include retroviral and adenoviral systems.
One expression vector system is a retroviral vector system such as is generally described in PCT/LJS97/01019 and PCT/US97/01048. Of particular use as mammalian promoters are the promoters from mammalian viral genes, since the viral genes are often highly expressed and have a broad host range. Examples include the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter, herpes simplex virus promoter, and the CMV promoter (see, e.g., Fernandez and Hoeffler, supra). Typically, transcription termination and polyadenylation sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence. Examples of transcription terminator and polyadenlyation signals include those derived from SV40.
Methods of introducing exogenous nucleic acid into mammalian hosts, as well as other hosts, are available, and will vary with the host cell used. Techniques include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, viral infection, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei.

In a preferred embodiment, cancer proteins are expressed in bacterial systems.
Promoters from bacteriophage may also be used. In addition, synthetic promoters and hybrid promoters are also useful; e.g., the tac promoter is a hybrid of the trp and lac promoter sequences. Furthermore, a bacterial promoter can include naturally occurnng promoters of non-bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription.
In addition to a functioning promoter sequence, an efficient ribosome binding site is desirable.
The expression vector may also include a signal peptide sequence that provides for secretion of the cancer protein in bacteria. The protein is either secreted into the growth media (gram-positive bacteria) or into the periplasmic space, located between the inner and outer membrane of the cell (gram-negative bacteria). The bacterial expression vector may also include a selectable marker gene to allow for the selection of bacterial strains that have been transformed.
Suitable selection genes include genes which render the bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin, neomycin, and tetracycline. Selectable markers also include biosynthetic genes, such as those in the histidine, tryptophan, and leucine biosynthetic pathways. These components are assembled into expression vectors.
Expression vectors for bacteria are well known, and include vectors for Bacillus subtilis, E. coli, Streptococcus cremoris, and Streptococcus lividans, among others (e.g., Fernandez and Hoeffler, supra). The bacterial expression vectors are transformed into bacterial host cells using techniques such as calcium chloride treatment, electroporation, and others.
In one embodiment, cancer proteins axe produced in insect cells using, e.g., expression vectors forthe transformation of insect cells, and in particular, baculovirus-based expression vectors.
In a preferred embodiment, a cancer protein is produced in yeast cells. Yeast expression systems are well known, and include expression vectors for Saccharomyces cerevisiae, Candida albicans and C. maltosa, Hansenula polymorpha, Kluyveromyces fragilis and K.
lactis, Pichia guillerimondii and P. pastoris, Schizosaccharomyces pombe, and Yarrowia lipolytica.
The cancer protein may also be made as a fusion protein, using available techniques.
Thus, e.g., for the creation of monoclonal antibodies, if the desired epitope is small, the cancer protein may be fused to a carrier protein to form an immunogen. Alternatively, the cancer protein may be made as a fusion protein to increase expression, or for other reasons. For example, when the cancer protein is a cancer peptide, the nucleic acid encoding the peptide may n r.
G~ ;:.t ' (;:;" sa ",~ It ~ -~ ~~; ~ '' ,.fit. t( .~t~ tF '_ : ~~MA :i ;' ~' I "',iA? ~
t~e .~~ 1~ t ' ~~~' I :' i ~,./~_."
be linked to other nucleic acid for expression purposes. Fusion with detection epitope tags can be made, e.g., with FLAG, His6 (SEQ,.II? NO:409), myc, HA, etc.
Tn a preferred embodiment, the cancer protein is purified or isolated after expression. .
Cancer proteins may be isolated or purified in a variety of ways depending on what other components are present in the sample and the requirements for purified product, e.g., natural conformation or denatured. Standard purification methods include ammonium sulfate precipitations, electrophoretic, molecular, immunological, and chromatographic techniques, including ion exchange, hydrophobic, affinity, and reverse-phase HPLC
chromatography, and chromatofocusing. For example, the cancer protein may be purified using a standard anti-cancer protein antibody column. Ultraf ltration and diafiltration techniques, in conjunction with .
protein concentration, are also useful. See, e.g., Walsh (2002) Proteins:
Biochemistry and Biotechnolo~y Wiley; Hardin, et al. (eds. 2001) Cloning, Gene Expression and Protein Purification Oxford Univ. Press; Wilson, et al. (eds. 2000) Encyclopedia of Separation Science Academic Press; and Scopes (1993) Protein Purification Springer-Verlag. The degree of purification necessary will vary depending on the use of the cancer protein.
In some instances no purification will be necessary.
Once expres~ed and purified if necessary, the cancer proteins and nucleic acids are useful in a number of applications. They may be used as immunoselection reagents, as vaccine reagents, as screening agents, therapeutic entities, for production of antibodies, as transcription or translation inhibitors, etc.
Variants of cancer proteins Also included within one embodiment of cancer proteins are amino acid variants of the naturally occurring sequences, as determined herein. Preferably, the variants are preferably greater than about 75% homologous to the wild-type sequence, more preferably greater than about 80%, even more preferably greater than about 85%, and most preferably greater than 90%. In some embodiments the homology will be as high as about 93-95% or 98%.
As for nucleic acids, homology in this context means sequence similarity or identity, with identity being preferred. This homology will be determined using standard techniques, as are outlined above for nucleic acid homologies.
Cancer proteins of the present invention may be shorter or longer than the wild type amino acid sequences. Thus, in a preferred embodiment, included within the definition of '~ ~n~ v'y,y, ~ ~~ ~Jl~.~V
cancer proteins are portions or fragments of the wild type sequences herein.
In addition, as P
i %~
42a outlined above, the cancer nucleic acids of the invention may be used to obtain additional coding regions, and thus additional protein sequence.
In one embodiment, the cancer proteins are derivative or variant cancer proteins as compared to the wild-type sequence. That is, as outlined more fully below, the derivative S cancer peptide will often contain at least one amino acid substitution, deletion, or insertion, with amino acid substitutions being particularly preferred. The amino acid substitution, insertion, or deletion may occur at many residue positions within the cancer peptide.
Also included within one embodiment of cancer proteins of the present invention are amino acid sequence variants. These variants typically fall into one or more of three classes:
substitutional, insertional, or deletional variants. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the cancer protein, using cassette or PCR mutagenesis or other techniques, to produce DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture as outlined above. However, variant cancer protein fragments having up to about 100-150 residues may be prepared by in vitro'synthesis using established techniques. Amino acid sequence variants are characterized by the predetermined nature of the variation, a feature that sets them apart from naturally occurring allelic or interspecies variation of the cancer protein amino acid sequence.
The variants typically exhibit a similar qualitative biological activity as a naturally occurnng analogue, although variants can also be selected which have modified characteristics.
While the site or region fox introducing an amino acid sequence variation is often predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed cancer variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, e.g., M13 primer mutagenesis and PCR
mutagenesis. Screening of mutants is often done using assays of cancer protein activities.
Amino acid substitutions are typically of single residues; insertions usually will be on the order of from about 1-20 amino acids, although considerably larger insertions may be tolerated. Deletions generally range from about 1-20 residues, although in some cases deletions may be much larger.
Substitutions, deletions, insertions, or combination thereof may be used to arnve at a final derivative. Generally these changes are done on a few amino acids to minimize the alteration of the molecule. However, larger changes may be tolerated in certain circumstances.
When small alterations in the characteristics of the cancer protein are desired, substitutions are generally made in accordance with the amino acid substitution relationships described.
The variants typically exhibit essentially the same qualitative biological activity and will elicit the same immune response as a naturally-occurring analog, although variants also are selected to modify the characteristics of cancer proteins as needed.
Alternatively, the variant may be designed such that a biological activity of the cancer protein is altered. For example, glycosylation sites may be added, altered, or removed.
Substantial changes in function or immunological identity are sometimes made by selecting substitutions that are less conservative than those described above.
For example, substitutions may be made which more significantly affect: the structure of the polypeptide backbone in the area of the alteration, for example the alpha-helical or beta-sheet structure; the charge or hydrophobicity of the molecule at the target site; or the bulk of the side chain.
Substitutions which generally are expected to produce the greatest changes in the polypeptide's properties are those in which (a) a hydrophilic residue, e.g., serine or threone is substituted for (or by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, valine, or alanine; (b) a cysteine or proline is substituted for (or by) another residue; (c) a residue having an electropositive side chain, e.g., lysine, arginine, or histidine, is substituted for (or by) an electronegative residue, e.g., glutamic or aspartic acid; (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine; or (e) a proline residue is incorporated or substituted, which changes the degree of rotational freedom of the peptidyl bond.
Variants typically exhibit a similar qualitative biological activity and will elicit the same immune response as the naturally-occurring analog, although variants also are selected to modify the characteristics of the skin cancer proteins as needed.
Alternatively, the variant may be designed such that the biological activity of the cancer protein is altered. For example, glycosylation sites may be altered or removed.
Covalent modifications of cancer polypeptides are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of a cancer polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N-or C-terminal residues of a cancer polypeptide.
Derivatization with bifunctional agents is useful, for instance, for crosslinking cancer polypeptides to a water-insoluble support matrix or surface for use in a method for purifying anti-cancer polypeptide antibodies or screening assays, as is more fully described below. Commonly used crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, e.g., esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifurictional maleimides such as bis-N-maleimido-1,8-octane and agents such as methyl-3-((p-azidophenyl)dithio)propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of serinyl, threonyl, or tyrosyl residues, methylation of the amino groups of the lysine, arginine, and histidine side chains (e.g., pp. 79-86, Creighton (1992) Proteins: Structure and Molecular Pro ep rties Freeman), acetylation of the N-terminal amine, and amidation of a C-terminal carboxyl group.
Another type of covalent modification of the cancer polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
"Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence cancer polypeptide, and/or adding one or more glycosylation sites that are not present in the native sequence cancer polypeptide.
Glycosylation patterns can be altered in many ways. Different cell types to express cancer-associated sequences can result in different glycosylation patterns.
Addition of glycosylation sites to cancer polypeptides may also be accomplished by altering the amino acid sequence thereof. The alteration may be made, e.g., by the addition of, or substitution by, one or more serine or threonine residues to the native sequence cancer polypeptide (for O-linked glycosylation sites). The cancer amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA
encoding the cancer polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.
Another means of increasing the number of carbohydrate moieties on the cancer polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. See, e.g., WO 87/05330; pp. 259-306 in Aplin and Wriston (I981) CRC Crit. Rev. Biochem.
Removal of carbohydrate moieties present on the cancer polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for ._ .. ' . ~~.~,~...~,..~.. .' ~ ~ ~'7 m~ ~, y ..,; ,.... ,,... , ,~. ~."'41~.
.,~..;~,;~., ....,~
~ ~ : 1~ 1~"y;t>y _ : ~rwk.ta'~: . ( '~~ ~~~ ~~'~~~~~'~Ns~ .::b amino acid residues that serve as targets for glycosylation. Chemical de~3ycosylation techniques are applicable; See, e.g., Sojax and Bahl (1987) Arch. Biochem.
Biophys. 259:52-57 and Edge, et al. (1981) Anal. Bioch~m. 118:131-137. Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by tla~ i~~a variety of endo-and exo-glycosidases.
S See, e.g., Thotakura, et al. (1987) Meth. Enzymol. 138:350-359.
Another type of covalent modification of cancer comprises linking the cancer polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S.
Patent Nos.
4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192, or4,179,337.
I O Cancer polypeptides of the present invention may also be modified in a way to form chimeric molecules comprising a cancer polypeptide fused to another heterologous polypeptide or amino acid sequence. In one embodiment, such a chimeric molecule comprises a fusion of a 'cancer polypeptide with a tag polypeptide which provides an epitope to which an anti-tag , antibody can selectively bind. The epitope.tag is generally placed at the amino-or carboxyl-1 S terminus of the cancer polypeptide. The presence of such epitope-tagged forms of a cancer polypeptide can be detected using an antibody against the tag polypeptide.
Also, provision of the epitope tag enables the cancer polypeptide to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. In an alternative embodiment, the chimeric molecule may comprise a fusion of a cancer polypeptide 20 with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule, such a fusion could be to the Fc region of an IgG
molecule.
Various tag polypeptides and their respective antibodies are available.
Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; His6 (SEQ ID
N0:409) and metal chelation tags, the flu HA tag polypeptide and its antibody 12CAS (Field, et 2S al. (1988) Mol. Cell. Biol. 8:2159-2165); the c-myc tag and the 8F9, 3C7, 6E10, G4, B7, and 9EI0 antibodies thereto (Evan, et al. (1985) Molecular and Cellular Biology 5:3610-3616); and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody (Paborsky, et al. (1990) Protein Engineering 3(6):547-553). Other tag polypeptides include the Flag-peptide (Hopp, et al. (1988) BioTechnologv 6:1204-1210); the KT3 epitope peptide (Martin, et al.
(1992) Science 30 255:192-194); tubulin epitope peptide (Skinner, et al. (1991) J. Biol.
Chem. 266:15163-15166);
,46 r:;;.' t~..' ..,'~..'1 ' n~.~ ~..".i< l~;,j~ u~ ' , ' ~ sr~'~ ~;.;Ej-'x~,." :
~f~.;. ~t'~',~ t'~ "'T ~ . ,'t:.'".':~ ~ ~". ' ~°ij .,: is ~.._ u,~:;:~:~, ~_~ ...w:::
".
and the T7 gene 10 protein peptide tag (Lutz-Freyermuth, et al. (1990) Proc:
Natl. Acad. Sci.
USA 87:6393-63~~7).
e~,~3 .
~6a ,r . ..-,nre~ !fAl.p ~i~

Also included are other cancer proteins of the cancer family, and cancer proteins from other organisms, which are cloned and expressed as outlined below. Thus, probe or degenerate polymerase chain reaction (PCR) primer sequences may be used to find other related cancer proteins from humans or other organisms. Particularly useful probe andlor PCR
primer S sequences include the unique areas of the cancer nucleic acid sequence.
Preferred PCR primers are from about 15-35 nucleotides in length, with from about 20-30 being preferred, and may contain inosine as needed. The conditions for PCR reaction have been well described (e.g., Innis, PCR Protocols, supra).
In addition, cancer proteins can be made that are longer than those encoded by the nucleic acids of the Tables, e.g., by the elucidation of extended sequences, the addition of epitope or purification tags, the addition of other fusion sequences, etc.
Cancer proteins may also be identified as being encoded by cancer nucleic acids. Thus, cancer proteins are encoded by nucleic acids that will hybridize to the sequences of the sequence listings, or their complements, as outlined herein.
Antibodies to cancer proteins In a preferred embodiment, when the cancer protein is to be used to generate antibodies, e.g., for immunotherapy or immunodiagnosis, the cancer protein should share at least one epitope or determinant with the full length protein. By "epitope" or "determinant" herein is typically meant a portion of a protein which will generate and/or bind an antibody or T-cell receptor in the context of MHC. Thus, in most instances, antibodies made to a smaller cancer protein will be able to bind to the full-length protein, particularly linear epitopes. In a preferred embodiment, the epitope is unique; that is, antibodies generated to a unique epitope show little or no cross-reactivity. In a preferred embodiment, the epitope is selected from a protein sequence set out in the tables.
Methods of preparing polyclonal antibodies exist (e.g., Coligan, supra; and Harlow and Lane, supra). Polyclonal antibodies can be raised in a mammal, e.g., by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
The immunizing agent may include a protein encoded by a nucleic acid of Tables 1-68 or fragment thereof or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). Various immunization protocols may be used.
The antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies maybe prepared using hybridoma methods, such as those described by I~ohler and Milstein (1975) Nature 256:495. In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
Alternatively, the lymphocytes may be immunized in vitro. The immunizing agent will typically include a polypeptide encoded by a nucleic acid of the tables or fragment thereof, or a fusion protein thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (e.g., pp.
59-103 in Goding (1986) Monoclonal Antibodies: Principles and Practice Academic Press).
Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, or human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
In one embodiment, the antibodies are bispecific antibodies. Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens or that have binding specificities for two epitopes on the same antigen. In one embodiment, one of the binding specificities is for a protein encoded by a nucleic acid of the tables or a fragment thereof, the other one is for another antigen, and preferably for a cell-surface protein or receptor or receptor subunit, preferably one that is tumor specific. Alternatively, tetramer-type technology may create multivalent reagents.

In a preferred embodiment, the antibodies to cancer protein are capable of reducing or eliminating a biological function of a cancer protein, in a naked form or conjugated to an effector moiety, as is described below. That is, the addition of anti-cancer protein antibodies (either polyclonal or preferably monoclonal) to cancer tissue (or cells containing cancer) may reduce or eliminate the cancer. Generally, at least a 25% decrease in activity, growth, size, or the like is preferred, with at Ieast about 50% being particularly preferred and about a 95-100%
decrease being especially preferred.
In a preferred embodiment the antibodies to the cancer proteins are humanized antibodies (e.g., Xenerex Biosciences, Medarex, Inc., Abgenix, Inc., Protein Design Labs, Inc.) Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the 1 S recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.
In some instances, Fv framework residues of a human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, a humanized antibody will comprise substantially all of at Ieast one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially alI of the framework (FR) regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will typically comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones, et al. (1986) Nature 321:522-525; Riechmann, et al.
(1988) Nature 332:323-329; and Presta (1992) Cunr. Op. Struct. Biol. 2:593-596).
Humanization can be essentially performed following the method of Winter and co-workers (Jones, et al. (1986) Nature 321:522-525; Riechmann, et al. (1988) Nature 332:323-327; Verhoeyen, et al. (1988) Science 239:1534-1536), by substituting rodent CDRs or CDR sequences for corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (LJ.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by corresponding sequence from a non-human species.

Human antibodies can also be produced using phage display libraries (Hoogenboom and Winter (1992) J. Mol. Biol. 227:381-388; Marks, et al. (1991) J. Mol. Biol.
222:581-597) or human monoclonal antibodies (e.g., p. 77, Cole, et al. in Reisfeld and Sell (1985) Monoclonal Antibodies and Cancer Therapy Liss; and Boerner, et al. (1991) J. Immunol.
147:86-95).
Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in nearly all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, e.g., in U.S.
Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks, et al. (1992) Bio/Technolo~y 10:779-783; Lonberg, et al. (1994) Nature 368:856-859; Mornson (1994) Nature 368:812-13; Fishwild, et al. (1996) Nature Biotechnolo~y 14:845-851; Neuberger (1996) Nature Biotechnolo~y 14:826;
and Lonberg and Huszar (1995) Intern. Rev. lmmunol. 13:65-93.
By immunotherapy is meant treatment of cancer with an antibody raised against cancer proteins. As used herein, immunotherapy can be passive or active. Passive immunotherapy as defined herein is the passive transfer of antibody to a recipient (patient).
Active immunization is the induction of antibody and/or T-cell responses in a recipient (patient).
Induction of an immune response is the result of providing the recipient with an antigen to which antibodies are raised. The antigen may be provided by injecting a polypeptide against which antibodies are desired to be raised into a recipient, or contacting the recipient with a nucleic acid capable of expressing the antigen and under conditions for expression of the antigen, leading to an immune response.
In a preferred embodiment the cancer proteins against which antibodies are raised are secreted proteins as described above. Without being bound by theory, antibodies used for treatment may bind and prevent the secreted protein from binding to its receptor, thereby inactivating the secreted cancer protein, e.g., in autocrine signaling.
In another preferred embodiment, the cancer protein to which antibodies are raised is a transmembrane protein. Without being bound by theory, antibodies used for treatment may bind the extracellular domain of the cancer protein and prevent it from binding to other proteins, such as circulating ligands or cell-associated molecules. The antibody may cause down-regulation of the transmembrane cancer protein. The antibody may be a competitive, non-competitive or uncompetitive inhibitor of protein binding to the extracellular domain of the cancer protein. The antibody may also be an antagonist of the cancer protein.
Further, the antibody may prevent activation of the transmembrane cancer protein, or may induce or suppress a particular cellular pathway. In one aspect, when the antibody prevents the binding of other molecules to the cancer protein, the antibody prevents growth of the cell. The antibody may also be used to target or sensitize the cell to cytotoxic agents, including, but not limited to TNF-a, TNF-(3, IL-1, INF-y, and IL-2, or chemotherapeutic agents including SFU, vinblastine, actinomycin D, cisplatin, methotrexate, and the like. In some instances the antibody may belong to a sub-type that activates serum complement when complexed with the transmembrane protein thereby mediating cytotoxicity or antigen-dependent cytotoxicity (ADCC). Thus, cancer may be treated by administering to a patient antibodies directed against the transmembrane cancer protein. Antibody-labeling may activate a co-toxin, localize a toxin payload, or otherwise provide means to locally ablate cells.
In another preferred embodiment, the antibody is conjugated to an effector moiety. The effector moiety can be various molecules, including labeling moieties such as radioactive labels or fluorescent labels, or can be a therapeutic moiety. In one aspect the therapeutic moiety is a small molecule that modulates the activity of a cancer protein. In another aspect the therapeutic moiety may modulate the activity of molecules associated with or in close proximity to a cancer protein. The therapeutic moiety may inhibit enzymatic or signaling activity such as protease or collagenase or protein kinase activity associated with cancer, or be an attractant of other cells, such as NK cells.
In a preferred embodiment, the therapeutic moiety can also be a cytotoxic agent. In this method, targeting the cytotoxic agent to cancer tissue or cells results in a reduction in the number of afflicted cells, thereby reducing symptoms associated with cancer.
Cytotoxic agents are numerous and varied and include, but are not limited to, cytotoxic drugs or toxins or active fragments of such toxins. Suitable toxins and their corresponding fragments include diphtheria A chain, exotoxin A chain, ricin A chain, abrin A chain, curcin, croon, phenomycin, enomycin, saporin, auristatin, and the like. Gytotoxic agents also include radiochemicals made by conjugating radioisotopes to antibodies raised against cancer proteins, or binding of a radionuclide to a chelating agent that has been covalently attached to the antibody. Targeting the therapeutic moiety to transmembrane cancer proteins not only serves to increase the local concentration of therapeutic moiety in the cancer afflicted area, but also serves to reduce deleterious side effects that may be associated with the untargeted therapeutic moiety.
In another preferred embodiment, the cancer protein against which the antibodies are raised is an intracellular protein. In this case, the antibody may be conjugated to a protein which facilitates entry into the cell. In one case, the antibody enters the cell by endocytosis. In another embodiment, a nucleic acid encoding the antibody is administered to the individual or cell. Moreover, wherein the cancer protein can be targeted within a cell, e.g., the nucleus, an antibody thereto may contain a signal for that target localization, e.g., a nuclear localization signal.
The cancer antibodies of the invention specifically bind to cancer proteins.
By "specifically bind" herein is meant that the antibodies bind to the protein with a I~ of at least about 0.1 mM, more usually at least about 1 ~,M, preferably at least about 0.1 ~.M or better, and most preferably, 0.01 ~,M or better. Selectivity of binding to the specific target and not to related sequences is often also important.
Detection of cancer sequence for diagnostic and therapeutic applications In one aspect, the RNA expression levels of genes are determined for different cellular states in the cancer phenotype. Expression levels of genes in normal tissue (e.g., not undergoing cancer) and in cancer tissue (and in some cases, for varying severities of cancer that relate to prognosis, as outlined below), or in non-malignant disease are evaluated to provide expression profiles. A gene expression profile of a particular cell state or point of development is essentially a "fingerprint" of the state of the cell. While two states may have a particular gene similarly expressed, the evaluation of a number of genes simultaneously allows the generation of a gene expression profile that is reflective of the state of the cell. By comparing expression profiles of cells in different states, information regarding which genes are important (including both up- and down-regulation of genes) in each of these states is obtained.
Then, diagnosis may be performed or confirmed to determine whether a tissue sample has the gene expression profile of normal or cancerous tissue. This will provide for molecular diagnosis of related conditions.
"Differential expression," or grammatical equivalents as used herein, refers to qualitative or quantitative differences in the temporal and/or cellular gene expression patterns within and among cells and tissue. Thus, a differentially expressed gene can qualitatively have its expression altered, including an activation or inactivation, in, e.g., normal versus cancer tissue.
Genes may be turned on or turned off in a particular state, relative to another state thus permitting comparison of two or more states. A qualitatively regulated gene will exhibit an expression pattern within a state or cell type which is detectable by standard techniques. Some genes will be expressed in one state or cell type, but not in both.
Alternatively, the difference in expression may be quantitative, e.g., in that expression is increased or decreased; e.g., gene expression is either upregulated, resulting in an increased amount of transcript, or downregulated, resulting in a decreased amount of transcript. The degree to which expression differs need only be large enough to quantify via standard characterization techniques as outlined below, such as by use of Affymetrix GeneChipTM expression arrays.
See, Lockhart (1996) Nature Biotechnology 14:1675-1680. Other techniques include, but are not limited to, quantitative reverse transcriptase PCR, northern analysis, and RNase protection. As outlined above, preferably the change in expression (e.g., upregulation or downregulation) is at least about 50%, more preferably at least about 100%, more preferably at least about 150%, more preferably at least about 200%, with from 300 to at least 1000% being especially preferred.
Evaluation may be at the gene transcript or the protein level. The amount of gene expression may be monitored using nucleic acid probes to the RNA or DNA
equivalent of the gene transcript, and the quantification of gene expression levels, or, alternatively, the final gene product itself (protein) can be monitored, e.g., with antibodies to the cancer protein and standard immunoassays (ELISAs, etc.) or other techniques, including mass spectroscopy assays, 2D gel electrophoresis assays, etc. Proteins corresponding to cancer genes, e.g., those identified as being important in a cancer or disease phenotype, can be evaluated in a cancer diagnostic test.
In a preferred embodiment, gene expression monitoring is performed simultaneously on a number of genes. Multiple protein expression monitoring can be performed as well.
In this embodiment, the cancer nucleic acid probes are attached to biochips as outlined herein for the detection and quantification of cancer sequences in a particular cell. The assays are further described below in the example. PCR techniques can be used to provide greater sensitivity.
In a preferred embodiment nucleic acids encoding the cancer protein are detected.
Although DNA or RNA encoding the cancer protein may be detected, of particular interest are methods wherein anlmRNA encoding a cancer protein is detected. Probes to detect mRNA can be a nucleotideldeoxynucleotide probe that is complementary to and hybridizes with the mRNA
and includes, but is not limited to, oligonucleotides, cDNA, or RNA. Probes also should contain a detectable label, as defined herein. In one method the mRNA is detected after immobilizing the nucleic acid to be examined on a solid support such as nylon membranes and hybridizing the probe with the sample. Following washing to remove the non-specifically bound probe, the label is detected. In another method, detection of the mRNA
is performed in situ. In this method permeabilized cells or tissue samples are contacted with a detectably labeled nucleic acid probe for sufficient time to allow the probe to hybridize with the target mRNA. Following washing to remove the non-specifically bound probe, the label is detected.
For example a digoxygenin labeled riboprobe (RNA probe) that is complementary to the mRNA
encoding a cancer protein is detected by binding the digoxygenin with an anti-digoxygenin secondary antibody and developed with nitro blue tetrazolium and 5-bromo-4-chloro-3-indoyl phosphate.
In a preferred embodiment, various proteins from the three classes of proteins as described herein (secreted, transmembrane, or intracellular proteins) are used in diagnostic assays. The cancer proteins, antibodies, nucleic acids, modified proteins, and cells containing cancer sequences are used in diagnostic assays. This can be performed on an individual gene or corresponding polypeptide level. In a preferred embodiment, the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes and/or corresponding polypeptides.
As described and defined herein, cancer proteins, including intracellular, transmembrane, or secreted proteins, find use as markers of cancer, e.g., for prognostic or ~0 diagnostic purposes. Detection of these proteins in putative cancer tissue allows for detection, prognosis, or diagnosis of cancer or similar disease, and for selection of therapeutic strategy. In one embodiment, antibodies are used to detect cancer proteins. A preferred method separates proteins from a sample by electrophoresis on a gel (typically a denaturing and reducing protein gel, but may be another type of gel, including isoelectric focusing gels and the like). Following separation of proteins, the cancer protein is detected, e.g., by immunoblotting with antibodies raised against the cancer protein.
In another preferred method, antibodies to the cancer protein find use in in situ imaging techniques, e.g., in histology. See, e.g., Asai, et al. (eds. 1993) Methods in Cell Biology:
Antibodies in Cell Biology (vol. 37) Academic Press. In this method, cells are contacted with from one to many antibodies to the cancer protein(s). Following washing to remove non-specific antibody binding, the presence of the antibody or antibodies is detected. In one embodiment the antibody is detected by incubating with a secondary antibody that contains a detectable label. In another method the primary antibody to the cancer proteins) contains a detectable label, e.g., an enzyme marker that can act on a substrate. In another preferred embodiment each one of multiple primary antibodies contains a distinct and detectable label.
This method finds particular use in simultaneous screening for a plurality of cancer proteins.
Many other histological imaging techniques are also provided by the invention.
In a preferred embodiment the label is detected in a fluorometer which has the ability to detect and distinguish emissions of different wavelengths. In addition, a fluorescence activated cell sorter (FACS) can be used in the method.
In another preferred embodiment, antibodies find use in diagnosing cancer from blood, serum, plasma, stool, and other samples. Such samples, therefore, are useful as samples to be probed or tested for the presence of cancer proteins. Antibodies can be used to detect a cancer protein by previously described immunoassay techniques including ELISA, immunoblotting (western blotting), immunoprecipitation, BIACORE technology and the like.
Conversely, the presence of antibodies may indicate an immune response against an endogenous cancer protein.
In a preferred embodiment, in situ hybridization of labeled cancer nucleic acid probes to tissue arrays is done. For example, arrays of tissue samples, including cancer tissue and/or normal tissue, are made. In situ hybridization (see, e.g., Ausubel, supra) is then performed.
When comparing the fingerprints between an individual and a standard, a diagnosis, a prognosis, or a prediction may be based on the findings. It is further understood that the genes which indicate the diagnosis may differ from those which indicate the prognosis and molecular profiling of the condition of the cells may lead to distinctions betweemresponsive or refractory conditions or may be predictive of outcomes.
In a preferred embodiment, the cancer proteins, antibodies, nucleic acids, modified proteins, and cells containing cancer sequences are used in prognosis assays.
As above, gene expression profiles can be generated that correlate to cancer, clinical, pathological, or other information, in terms of long term prognosis. Again, this may be done on either a protein or gene level, with the use of genes being preferred. Single or multiple genes may be useful in various combinations. As above, cancer probes may be attached to biochips for the detection and quantification of cancer sequences in a tissue or patient. The assays proceed as outlined above for diagnosis. PCR method may provide more sensitive and accurate quantification.

Assays for therapeutic compounds In a preferred embodiment, the proteins, nucleic acids, and antibodies as described herein are used in drug screening assays. The cancer proteins, antibodies, nucleic acids, modified proteins, and cells containing cancer sequences are used in drug screening assays or by evaluating the effect of drug candidates on a "gene expression profile" or expression profile of polypeptides. In a preferred embodiment, the expression profiles are used, preferably in conjunction with high throughput screening techniques, to allow monitoring for expression profile genes after treatment with a candidate agent (e.g., Zlokarnik, et al.
(1998) Science 279:84-88; Heid (1996) Genome Res. 6:986-994.
In a preferred embodiment, the cancer proteins, antibodies, nucleic acids, modified proteins and cells containing the native or modified cancer proteins are used in screening assays. That is, the present invention provides novel methods for screening for compositions which modulate the cancer phenotype or an identified physiological function of a cancer protein. As above, this can be done on an individual gene level or by evaluating the effect of drug candidates on a "gene expression profile". In a preferred embodiment, the expression profiles are used, preferably in conjunction with high throughput screening techniques, to allow monitoring for expression profile genes after treatment with a candidate agent, see Zlokarnik, supra.
Having identified the differentially expressed genes herein, a variety of assays may be performed. In a preferred embodiment, assays may be run on an individual gene or protein level. That~is, having identified a particular gene as up regulated in cancer, test compounds can be screened for the ability to modulate gene expression or for binding to the cancer protein.
"Modulation" thus includes both an increase and a decrease in gene expression.
The preferred amount of modulation will depend on the original change of the gene expression in normal versus tissue undergoing cancer, with changes of at least 10%, preferably 50%, more preferably 100-300%, and in some embodiments 300-1000% or greater. Thus, if a gene exhibits a 4-fold increase in cancer tissue compared to normal tissue, a decrease of about four-fold is often desired; similarly, a 10-fold decrease in cancer tissue compared to normal tissue often provides a target value of a 10-fold increase in expression to be induced by the test compound.
The amount of gene expression may be monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, the gene product itself can be monitored, e.g., through the use of antibodies to the cancer protein and standard immunoassays.
Proteomics and separation techniques may also allow quantification of expression.
In a preferred embodiment, gene expression or protein monitoring of a number of entities, e.g., an expression profile, is monitored simultaneously. Such profiles will typically involve a plurality of those entities described herein.
In this embodiment, the cancer nucleic acid probes are attached to biochips as outlined herein for the detection and quantification of cancer sequences in a particular cell.
Alternatively, PCR may be used. Thus, a series, e.g., of microtiter plate, may be used with dispensed primers in desired wells. A PCR reaction can then be performed and analyzed for each well.
Modulators of cancer Expression monitoring can be performed to identify compounds that modify the expression of one or more cancer-associated sequences, e.g., a polynucleotide sequence set out in the tables. Generally, in a preferred embodiment, a test modulator is added to the cells prior to analysis. Moreover, screens are also provided to identify agents that modulate cancer, modulate cancer proteins, bind to a cancer protein, or interfere with the binding of a cancer protein and an antibody or other binding partner.
The term "test compound" or "drug candidate" or "modulator" or grammatical equivalents as used herein describes a molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., to be tested for the capacity to directly or indirectly alter the cancer phenotype or the expression of a cancer sequence, e.g., a nucleic acid or protein sequence. In preferred embodiments, modulators alter expression profiles, or expression profile nucleic acids or proteins provided herein. In one embodiment, the modulator suppresses a cancer phenotype, e.g., to a normal or non-malignant tissue fingerprint. In another embodiment, a modulator induced a cancer phenotype. Generally, a plurality of assay mixtures are run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, e.g., at zero concentration or below the level of detection.
Drug candidates encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 daltons. Preferred small molecules are less than 2000, or less than 1500, or less than 1000, or less than 500 D. Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccha.rides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs, or combinations thereof. Particularly preferred are peptides.
In one aspect, a modulator will neutralize the effect of a cancer protein. By "neutralize"
is meant that activity of a protein is inhibited or blocked and the consequent effect on the cell.
In certain embodiments, combinatorial libraries of potential modulators will be screened for an ability to bind to a cancer polypeptide or to modulate activity.
Conventionally, new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. Often, high throughput screening (HTS) methods are employed for such an analysis. See, e.g., Janzen (2002) High Throughput Screening: Methods and Protocols Humana; Devlin (ed. 1997) High Throughput Screening: The Discovery of Bioactive Substances Dekker; and Mei and Czarnik (eds. 2002) Integrated Drug Discovery Techniques Dekker.
In one preferred embodiment, high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds).
Such "combinatorial chemical libraries" axe then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics.
A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library, such as a polypeptide (e.g., mutein) library, is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (e.g., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks (Gallop, et al.
(1994) J. Med. Chem. 37:1233-1251).
Preparation and screening of combinatorial chemical libraries is well known.
Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S.
Patent No. 5,010,175, Furka (1991) Pelt. Prot. Res. 37:487-493, Houghton, et al. (1991) Nature 354:84-88), peptoids (PCT Publication No WO 91/19735), encoded peptides (PCT
Publication WO 93/20242), random bio-oligomers (PCT Publication WO 92/00091), benzodiazepines (U.5.
Pat. No. 5,288,514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs, et al. (1993) Proc. Nat. Acad. Sci. USA 90:6909-6913, vinylogous polypeptides (Hagihara, et al.
(1992) J. Amer. Chem. Soc. 114:6568-570), nonpeptidal peptidomimetics with a Beta-D-Glucose scaffolding (Hirschmann, et al. (1992) J. Amer. Chem. Soc. 114:9217-9218), analogous organic syntheses of small compound libraries (Chen, et al. (1994) J. Amer. Chem.
Soc. 116:2661-662), oligocarbamates (Cho, et al. (1993) Science 261:1303-1305), and/or peptidyl phosphonates (Campbell, et al. (1994) J. Org. Chem. 59:658-xxx). See, generally, Gordon, et al. (1994) J. Med. Chem. 37:1385-1401, nucleic acid libraries (see, e.g., Stratagene, Corp.), peptide nucleic acid libraries (see, e.g., U.S. Patent 5,539,083), antibody libraries (see, e.g., Vaughn, et al. (1996) Nature Biotechnolo~y 14(3):309-314, and PCTlLJS96/10287), carbohydrate libraries (see, e.g., Liang, et al. (1996) Science 274:1520-1522, and U.S. Patent No. 5,593,853), and small organic molecule libraries (see, e.g., benzodiazepines, page 33 Baum (Jan 18, 1993) C&EN; isoprenoids, U.S. Patent No. 5,569,588; thiazolidinones and metathiazanones, U.S. Patent No. 5,549,974; pyrrolidines, U.S. Patent Nos.
5,525,735 and 5,519,134; morpholino compounds, U.S. Patent No. 5,506,337; benzodiazepines, U.S. Patent No. 5,288,514; and the like).
Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA).
A number of well known robotic systems have also been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate II, Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett-Packard, Palo Alto, Calif.), which mimic the manual synthetic operations performed by a chemist. The above devices are suitable for use with the present invention.
The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent. In addition, numerous combinatorial libraries are themselves commercially available (see, e.g., ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, MO, ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, PA, Martek Biosciences, Columbia, MD, etc.).
The assays to identify modulators are amenable to high throughput screening.
Preferred assays thus detect enhancement or inhibition of cancer gene transcription, inhibition, or enhancement of polypeptide expression, and inhibition or enhancement of polypeptide activity.
High throughput assays for the presence, absence, quantification, or other properties of particular nucleic acids or protein products are well known. Similarly, binding assays and reporter gene assays are similarly well known. Thus, e.g., U.S. Patent No.
5,559,410 discloses high throughput screening methods for proteins, U.S. Patent No. 5,55,639 discloses high throughput screening methods for nucleic acid binding (e.g., in arrays), while U.S. Patent Nos.
5,576,220 and 5,541,061 disclose high throughput methods of screening for ligand/antibody binding.
In addition, high throughput screening systems are commercially available (see, e.g., Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA, etc.). These systems typically automate entire procedures, including sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detectors) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degre~of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, e.g., Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
In one embodiment, modulators are proteins, often naturally occurring proteins or fragments of naturally occurring proteins. Thus, e.g., cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, may be used. In this way libraries of proteins may be made for screening in the methods of the invention.
Particularly preferred in this embodiment are libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred. Particularly useful test compound will be directed to the class of proteins to which the target belongs, e.g., substrates for enzymes or ligands and receptors.
In a preferred embodiment, modulators are peptides of from about 5-30 amino acids, with from about 5-20 amino acids being preferred, and from about 7-15 being particularly preferred. The peptides may be digests of naturally occurnng proteins, random peptides, or "biased" random peptides. By "randomized" or grammatical equivalents herein is meant that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. Since generally these random peptides (or nucleic acids, discussed below) are chemically synthesized, they may incorporate a nucleotide or amino acid at any position. The synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized candidate bioactive proteinaceous agents.
In one embodiment, the library is fully randomized, with no sequence preferences or constants at any position. In a preferred embodiment, the library is biased.
That is, some positions within the sequence are either held constant, or are selected from a limited number of possibilities. For example, in a preferred embodiment, the nucleotides or amino acid residues are randomized within a defined class, e.g., of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines, or histidines for phosphorylation sites, etc., or to purines, etc.
Modulators of cancer can also be nucleic acids, as defined above.
As described above generally for proteins, nucleic acid modulating agents may be naturally occurring nucleic acids, random nucleic acids, or "biased" random nucleic acids. For example, digests of prokaryotic or eukaryotic genomes may be used as is outlined above for proteins.
In a preferred embodiment, the candidate compounds are organic chemical moieties, a wide variety of which are available in the literature.
After the candidate agent has been added and the cells allowed to incubate for some period of time, the sample containing a target sequence to be analyzed is added to the biochip.
If required, the target sequence is prepared using known techniques. For example, the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR performed as appropriate. For example, an in vitro transcription with labels covalently attached to the nucleotides is performed. Generally, the nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5.
In a preferred embodiment, the target sequence is labeled with, e.g., a fluorescent, a chemiluminescent, a chemical, or a radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe. The label also can be an enzyme, such as, alkaline phosphatase or horseradish peroxidase, which when provided with an appropriate substrate produces a product that can be detected. Alternatively, the label can be a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme. The label also can be a moiety or compound, such as, an epitope tag or biotin which specifically binds to streptavidin. For the example of biotin, the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence. Unbound labeled streptavidin is typically removed prior to analysis.
These assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as is generally outlined in U.S.
Patent Nos. 5,681,702, 5,597,909, 5,545,730, 5,594,117, 5,591,584, 5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802, 5,635,352, x,594,118, 5,359,100, 5,124,246, and 5,681,697, all of which are hereby incorporated by reference. In this embodiment, in general, the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex.
A variety of hybridization conditions may be used in the present invention, including high, moderate, and low stringency conditions as outlined above. The assays are generally run under stringency conditions which allows formation of the label probe hybridization complex only in the presence of target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc.
These parameters may also be used to control non-specific binding, as is generally outlined in U.S. Patent No. 5,681,697. Thus it may be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding.
The reactions outlined herein may be accomplished in a variety of ways.
Components of the reaction may be added simultaneously, or sequentially, in different orders, with preferred embodiments outlined below. In addition, the reaction may include a variety of other reagents.
These include salts, buffers, neutral proteins, e.g., albumin, detergents, etc. which may be used to facilitate optimal hybridization and detection, andlor reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may also be used as appropriate, depending on the sample preparation methods and purity of the target.
The assay data are analyzed to determine the expression levels, and changes in expression levels as between states of individual genes, forming a gene expression profile.
Screens are performed to identify modulators of the cancer phenotype. In one embodiment, screening is performed to identify modulators that can induce or suppress a particular expression profile, thus preferably generating the associated phenotype. In another embodiment, e.g., for diagnostic applications, having identified differentially expressed genes important in a particular state, screens can be performed to identify modulators that alter expression of individual genes. In an another embodiment, screening is performed to identify modulators that alter a biological function of the expression product of a differentially expressed gene. Again, having identified the importance of a gene in a particular state, screens are performed to identify agents that bind and/or modulate the biological activity of the gene product.
In addition, screens can be done for genes that are induced in response to a candidate agent or treatment process. After identifying a modulator based upon its ability to suppress a cancer expression pattern leading to a normal expression pattern (or its converse), or to modulate a single cancer gene expression profile so as to mimic the expression of the gene from normal tissue, a screen as described above can be performed to identify genes that are specifically modulated in response to the agent. Comparing expression profiles between normal tissue and agent treated cancer tissue reveals genes that are not expressed in normal tissue or cancer tissue, but are expressed in agent treated tissue. These agent-specific sequences can be identified and used by methods described herein for cancer genes or proteins.
In particular, these sequences and the proteins they encode fmd use in marking or identifying agent treated cells. In addition, antibodies can be raised against the agent induced proteins and used to target novel therapeutics to the treated cancer tissue sample.
Thus, in one embodiment, a test compound is administered to a population of cancer cells that have an associated cancer expression profile. By "administration"
or "contacting"
herein is meant that the candidate agent is added to the cells in such a manner as to allow the agent to act upon the cell, whether by uptake and intracellular action, or by action at the cell surface. In some embodiments, nucleic acid encoding a proteinaceous candidate agent (e.g., a peptide) may be put into a viral construct such as an adenoviral or retroviral construct, and added to the cell, such that expression of the peptide agent is accomplished, e.g., PCT
LTS97/01019. Regulatable gene therapy systems can also be used.
Once a test compound has been administered to the cells, the cells can be washed if desired and are allowed to incubate under preferably physiological conditions for some period of time. The cells are then harvested and a new gene expression profile is generated, as outlined herein.
Thus, e.g., cancer or non-malignant tissue may be screened for agents that modulate, e.g., induce or suppress a cancer phenotype. A change in at least one gene, preferably many, of the expression profile indicates that the agent has an effect on cancer activity. By defining such a signature for the cancer phenotype, screens for new drugs that alter the~phenotype can be devised. With this approach, the drug target need not be known and need not be represented in the original expression screening platform, nor does the level of transcript for the target protein need to change.
In a preferred embodiment, as outlined above, screens may be done on individual genes and gene products (proteins). That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of either the expression of the ' gene or the gene product itself can be done. The gene products of differentially expressed genes are sometimes referred to herein as "cancer proteins" or a "cancer modulatory protein". The cancer modulatory protein may be a fragment, or alternatively, be the full length protein to the fragment encoded by the nucleic acids of the Tables. Preferably, the cancer modulatory protein is a fragment. In a preferred embodiment, the cancer amino acid sequence which is used to determine sequence identity or similarity is encoded by a nucleic acid of the Tables. In another embodiment, the sequences are naturally occurring allelic variants of a protein encoded by a nucleic acid of the Tables. In another embodiment, the sequences are sequence variants as further described herein.
Preferably, the cancer modulatory protein is a fragment of about 14-24 amino acids long. More preferably the fragment is a soluble fragment. Preferably, the fragment includes a non-transmembrane region. In a preferred embodiment, the fragment has an N-terminal Cys to aid in solubility. In one embodiment, the C-terminus of the fragment is kept as a free acid and the N-terminus is a free amine to aid in coupling, e.g., to cysteine.

In one embodiment the cancer proteins are conjugated to an immunogenic agent as discussed herein. In one embodiment the cancer protein is conjugated to BSA.
Measurements of cancer polypeptide activity, or of cancer or the cancer phenotype can be performed using a variety of assays. For example, the effects of the test compounds upon the function of the cancer polypeptides can be measured by examining parameters described above.
A suitable physiological change that affects activity can be used to assess the influence of a test compound on the polypeptides of this invention. When the functional consequences are determined using intact cells or animals, one can also measure a variety of effects such as, in the case of cancer associated with tumors, tumor growth, tumor metastasis, neovascularization, hormone release, transcriptional changes to both known and uncharacterized genetic markers (e.g., northern blots), changes in cell metabolism such as cell growth or pH
changes, and changes in intracellular second messengers such as cGMP. In the assays of the invention, mammalian cancer polypeptide is typically used, e.g., mouse, preferably human.
Assays to identify compounds with modulating activity can be performed in vitro. For example, a cancer polypeptide is first contacted with a potential modulator and incubated for a suitable amount of time, e.g., from 0.5-48 hours. In one embodiment, the cancer polypeptide levels are determined in vitro by measuring the level of protein or mRNA. The level of protein is typically measured using immunoassays such as western blotting, ELISA, and the like with an antibody that selectively binds to the cancer polypeptide or a fragment thereof. For measurement of mRNA, amplification, e.g., using PCR, LCR, or hybridization assays, e.g., northern hybridization, RNAse protection, dot blotting, are preferred. The level of protein or mRNA is typically detected using directly or indirectly labeled detection agents, e.g., fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
Alternatively, a reporter gene system can be devised using a cancer protein promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or ~3-gal.
The reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques.
In a preferred embodiment, as outlined above, screens may be done on individual genes and gene products (proteins). That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of the expression of the gene or the gene product itself can be done. The gene products of differentially expressed genes are sometimes referred to herein as "cancer proteins." The cancer protein may be a fragment, or alternatively, the full length protein to a fragment shown herein.
In one embodiment, screening for modulators of expression of specific genes is performed. Typically, the expression of only one or a few genes are evaluated.
In another embodiment, screens are designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for the ability to modulate differentially expressed activity. Moreover, once initial candidate compounds are identified, variants can be further screened to better evaluate structure activity relationships.
In a preferred embodiment, binding assays are done. In general, purified or isolated gene product is used; that is, the gene products of one or more differentially expressed nucleic acids are made. For example, antibodies are generated to the protein gene products, and standard immunoassays are run to determine the amount of protein present.
Alternatively, cells comprising the cancer proteins can be used in the assays.
Thus, in a preferred embodiment, the methods comprise combining a cancer protein and a candidate compound, and determining the binding of the compound to the cancer protein.
Preferred embodiments utilize the human cancer protein, although other mammalian proteins may also be used, e.g., for the development of animal models of human disease.
In some embodiments, as outlined herein, variant or derivative cancer proteins may be used.
Generally, in a preferred embodiment of the methods herein, the cancer protein or the candidate agent is non-diffusably bound to an insoluble support, preferably having isolated sample receiving areas (e.g., a microtiter plate, an array, etc.). The insoluble supports may be made of a composition to which the compositions can be bound, is readily separated from soluble material, and is otherwise compatible with the overall method of screening. The surface of such supports may be solid or porous and of a convenient shape. Examples of suitable insoluble supports include microtiter plates, arrays, membranes, and beads.
These are typically made of glass, plastic (e.g., polystyrene), polysaccharides, nylon or nitrocellulose, teflonTM, etc.
Microtiter plates and arrays are especially convenient because a large number of assays can be carned out simultaneously, using small amounts of reagents and samples. The particular manner of binding of the composition is typically not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition, and is nondiffusable. Preferred methods of binding include the use of antibodies (which do not sterically block either the ligand binding site or activation sequence when the protein is bound to the support), direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or agent, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein, or other innocuous protein or other moiety.
In a preferred embodiment, the cancer protein is bound to the support, and a test compound is added to the assay. Alternatively, the candidate agent is bound to the support and the cancer protein is added. Novel binding agents include specific antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc. Of particular interest are screening assays for agents that have a low toxicity for human cells. A wide variety of assays may be used for this purpose, including labeled in vitro protein-protein binding assays, electrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.), and the like.
The determination of the binding of the test modulating compound to the cancer protein may be done in a number of ways. In a preferred embodiment, the compound is labeled, and binding determined directly, e.g., by attaching all or a portion of the cancer protein to a solid support, adding a labeled candidate agent (e.g., a fluorescent label), washing off excess reagent, and determining whether the label is present on the solid support. Various blocking and washing steps may be utilized as appropriate.
In some embodiments, only one of the components is labeled, e.g., the proteins (or proteinaceous candidate compounds) can be labeled. Alternatively, more than one component can be labeled with different labels, e.g., 125I for the proteins and a fluorophor for the compound. Proximity reagents, e.g., quenching or energy transfer reagents are also useful.
In one embodiment, the binding of the test compound is determined by competitive binding assay. The competitor may be a binding moiety known to bind to the target molecule (e.g., a cancer protein), such as an antibody, peptide, binding partner, ligand, etc. TJnder certain circumstances, there may be competitive binding between the compound and the binding moiety, with the binding moiety displacing the compound. In one embodiment, the test compound is labeled. Either the compound, or the competitor, or both, is added first to the protein for a time sufficient to allow binding, if present. Incubations may be performed at a temperature which facilitates optimal activity, typically between about 4-40° C. Incubation periods are typically optimized, e.g., to facilitate rapid high throughput screening. Typically between 0.1-1 hour will be sufficient. Excess reagent is generally removed or washed away.
The second component is then added, and the presence or absence of the labeled component is followed, to indicate binding.
In a preferred embodiment, the competitor is added first, followed by a test compound.
Displacement of the competitor is an indication that the test compound is binding to the cancer protein and thus is capable of binding to, and potentially modulating, the activity of the cancer protein. In this embodiment, either component can be labeled. Thus, e.g., if the competitor is labeled, the presence of label in the wash solution indicates displacement by the agent.
Alternatively, if the test compound is labeled, the presence of the label on the support indicates displacement.
In an alternative embodiment, the test compound is added first, with incubation and washing, followed by the competitor. The absence of binding by the competitor may indicate that the test compound is bound to the cancer protein with a higher affinity.
Thus, if the test compound is labeled, the presence of the label on the support, coupled with a lack of competitor binding, may indicate that the test compound is capable of binding to the cancer protein.
In a preferred embodiment, the methods comprise differential screening to identity agents that are capable of modulating the activity of the cancer proteins. In one embodiment, the methods comprise combining a cancer protein and a competitor in a first sample. A second sample comprises a test compound, a cancer protein, and a competitor. The binding of the competitor is determined for both samples, and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to the cancer protein and potentially modulating its activity. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent is capable of binding to the cancer protein.
Alternatively, differential screening is used to identify drug candidates that bind to the native cancer protein, but cannot bind to modified cancer proteins. The structure of the cancer protein may be modeled, and used in rational drug design to synthesize agents that interact with that site. Drug candidates that affect the activity of a cancer protein are also identified by screening drugs for the ability to either enhance or reduce the activity of the protein.
Positive controls and negative controls may be used in the assays. Preferably control and test samples are performed in at least triplicate to obtain statistically significant results.
Incubation of all samples is for a time sufficient for the binding of the agent to the protein.

Following incubation, samples are washed free of non-specifically bound material and the amount of bound, generally labeled agent determined. For example, where a radiolabel is employed, the samples may be counted in a scintillation counter to determine the amount of bound compound.
A variety of other reagents may be included in the screening assays. These include reagents like salts, neutral proteins, e.g., albumin, detergents, etc., which may be used to facilitate optimal protein-protein binding andlor reduce non-specific or background interactions.
Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used. The mixture of components may be added in an order that provides for the requisite binding.
In a preferred embodiment, the invention provides methods for screening for a compound capable of modulating the activity of a cancer protein. The methods comprise adding a test compound, as defined above, to a cell comprising cancer proteins. Preferred cell types include almost any cell. The cells contain a recombinant nucleic acid that encodes a cancer protein. In a preferred embodiment, a library of candidate agents are tested on a plurality of cells.
In one aspect, the assays are evaluated in the presence or absence or previous or subsequent exposure of physiological signals, e.g., hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (e.g., cell-cell contacts). In another example, the determinations are determined at different stages of the cell cycle process.
In this way, compounds that modulate cancer agents are identified. Compounds with pharmacological activity are able to enhance or interfere with the activity of the cancer protein.
Once identified, similar structures are evaluated to identify critical structural feature of the compound.
In one embodiment, a method of inhibiting cancer cell division is provided.
The method comprises administration of a cancer inhibitor. In another embodiment, a method of inhibiting cancer is provided. The method may comprise administration of a cancer inhibitor. In a further embodiment, methods of treating cells or individuals with cancer are provided, e.g., comprising administration of a cancer inhibitor.
In one embodiment, a cancer inhibitor is an antibody as discussed above. In another embodiment, the cancer inhibitor is an antisense molecule.

A variety of cell growth, proliferation, viability, and metastasis assays are available, as described below.
Soft agar growth or colony formation in suspension Normal cells require a solid substrate to attach and grow. When the cells are transformed, they lose this phenotype and grow detached from the substrate.
For example, transformed cells can grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or soft agar. The transformed cells, when transfected with tumor suppressor genes, regenerate normal phenotype and require a solid substrate to attach and grow. Soft agar growth or colony formation in suspension assays can be used to identify modulators of cancer sequences, which when expressed in host cells, inhibit abnormal cellular proliferation and transformation. A therapeutic compound would reduce or eliminate the host cells' ability to grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or soft.
Techniques for soft agar growth or colony formation in suspension assays are described, e.g., in Freshney (1998) Culture of Animal Cells: A Manual of Basic Technique (3d ed.) Wiley-Liss; Freshney (2000) Culture of Animal Cells: A Manual of Basic Technique (4th ed.) Wiley-Liss; and Garkavtsev, et al. (1996) Nature Genet. 14:415-20.
Contact inhibition and density limitation of growth Normal cells typically grow in a flat and organized pattern in a petri dish until they touch other cells. When the cells touch one another, they are contact inhibited and stop growing. When cells are transformed, however, the cells are not contact inhibited and continue to grow to high densities in disorganized foci. Thus, the transformed cells grow to a higher saturation density than normal cells. This can be detected morphologically by the formation of a disoriented monolayer of cells or rounded cells in foci within the regular pattern of normal surrounding cells. Alternatively, labeling index with (3H)-thymidine at saturation density can be used to measure density limitation of growth. See Freshney (2000), supra.
The transformed cells, when transfected with tumor suppressor genes, regenerate a normal phenotype and become contact inhibited and would grow to a lower density.
In this assay, labeling index with (3H)-thymidine at saturation density is a preferred method of measuring density limitation of growth. Transformed host cells are transfected with a cancer-associated sequence and are grown for 24 hours at saturation density in non-limiting medium conditions. The percentage of cells labeling with (3H)-thymidine is determined autoradiographically. See, Freshney (1998), supra.

Growth factor or serum dependence Transformed cells typically have a lower serum dependence than their normal counterparts (see, e.g., Temin (1966) J. Natl. Cancer Insti. 37:167-175;
Eagle, et a1.(1970) J.
Exp. Med. 131:836-879); Freshney, supra. This is in part due to release of various growth factors by the transformed cells. Growth factor or serum dependence of transformed host cells can be compared with that of control.
Tumor specific markers levels Tumor cells release an increased amount of certain factors (hereinafter "tumor specific markers") than their normal counterparts. For example, plasminogen activator (PA) is released from human glioma at a higher level than from normal brain cells (see, e.g., Gullino "Angiogenesis, tumor vascularization, and potential interference with tumor growth" pp. 178-184 in Mihich (ed. 1985) Biolo ,ical Responses in Cancer Plenum. Similarly, tumor angiogenesis factor (TAF) is released at a higher level in tumor cells than their normal .
counterparts. See, e.g., Folkman (1992) Sem. Cancer Biol. 3:89-96.
Various techniques which measure the release of these factors are described in Freshney (1998), supra. Also, see, Unkeless, et al. (1974) J. Biol. Chem. 249:4295-4305; Strickland and Beers (1976) J. Biol. Chem. 251:5694-5702; Whur, et al. (1980) Br. J. Cancer 42:305-312;
Gullino "Angiogenesis, tumor vascularization, and potential interference with tumor growth"
pp. 178-184 in Mihich (ed. 1985) Biological Responses in Cancer Plenum;
Freshney (1985) Anticancer Res. 5:111-130.
Invasiveness into Matrigel The degree of invasiveness into Matrigel or some other extracellular matrix constituent can be used as an assay to identify compounds that modulate cancer-associated sequences.
Tumor cells exhibit a good correlation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent. In this assay, tumorigenic cells are typically used as host cells. Expression of a tumor suppressor gene in these host cells would decrease invasiveness of the host cells.
Techniques described in Freshney (1994), supra, can be used. Briefly, the level of invasion of host cells can be measured by using filters coated with Matrigel or some other extracellular matrix constituent. Penetration into the gel, or through to the distal side of the filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeling the cells with 1251 and counting the radioactivity on the distal side of the filter or bottom of the dish. See, e.g., Freshney (1984), supra.
Tumor growth in vivo Effects of cancer-associated sequences on cell growth can be tested in transgenic or immune-suppressed mice. Knock-out transgenic mice can be made, in which the cancer gene is disrupted or in which a cancer gene is inserted. Knock-out transgenic mice can be made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting the endogenous cancer gene with a mutated version of the cancer gene, or by mutating the endogenous cancer gene, e.g., by exposure to carcinogens.
A DNA construct is introduced into the nuclei of embryonic stem cells. Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re-implanted into a recipient female. Some of these embryos develop into chimeric mice that possess germ cells partially derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (see, e.g., Capecchi, et al. (1989) Science 244:1288-1292). Chimeric targeted mice can be derived according to Hogan, et al. (1988) Mani~ulatin~ the Mouse Embryo: A
Laboratory Manual CSH Press; and Robertson (ed. 1987) Teratocarcinomas and Embryonic Stem Cells: A
Practical Approach IRL Press, Washington, D.C.
Alternatively, various immune-suppressed or immune-deficient host animals can be used. For example, genetically athyrnic "nude" mouse (see, e.g., Giovanella, et al. (1974) J.
Natl. Cancer Inst. 52:921-930), a SCID mouse, a thymectomized mouse, or an irradiated mouse (see, e.g., Bradley, et al. (1978) Br. J. Cancer 38:263-272; Selby, et al.
(1980) Br. J. Cancer 41:52-61) can be used as a host. Transplantable tumor cells (typically about 106 cells) injected into isogenic hosts will produce invasive tumors in a high proportions of cases, while normal cells of similar origin will not. In hosts which developed invasive tumors, cells expressing a cancer-associated sequences are injected subcutaneously. After a suitable length of time, preferably 4-8 weeks, tumor growth is measured (e.g., by volume or by its two largest dimensions) and compared to the control. Tumors that have statistically significant reduction (using, e.g., Student's T test) are said to have inhibited growth.

Polynucleotide modulators of cancer Antisense and RNAi Polynucleotides In certain embodiments, the activity of a cancer-associated protein is down-regulated, or entirely inhibited, by the use of an inhibitory or antisense polynucleotide, e.g., a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e.g., a cancer protein mRNA, or a subsequence thereof. Binding of the antisense polynucleotide to the mRNA reduces the translation andlor stability of the mRNA.
In the context of this invention, antisense polynucleotides can comprise naturally-occurring nucleotides, or synthetic species formed from naturally-occurnng subunits or their close homologs. Antisense polynucleotides may also have altered sugar moieties or inter-sugar linkages. Exemplary among these are the phosphorothioate and other sulfur containing species.
Analogs are comprehended by this invention so long as they function effectively to hybridize with the cancer protein mRNA. See, e.g., Isis Pharmaceuticals, Carlsbad, CA;
Sequitur, Inc., Natick, MA.
Such antisense polynucleotides can readily be synthesized using recombinant means, or can be synthesized in vitro. Equipment for such synthesis is sold by several vendors, including Applied Biosystems. The preparation of other oligonucleotides such as phosphorothioates and alkylated derivatives is also well known.
Antisense molecules as used herein include antisense or sense oligonucleotides. Sense oligonucleotides can, e.g., be employed to block transcription by binding to the anti-sense strand. The antisense and sense oligonucleotide comprise a single-stranded nucleic acid sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA
(antisense) sequences for cancer molecules. A preferred antisense molecule is for a cancer sequences in the Tables, or for a ligand or activator thereof. Antisense or sense oligonucleotides, according to the present invention, comprise a fragment generally at least about 14 nucleotides, preferably from about 14-30 nucleotides. The ability to derive an antisense or a sense oligonucleotide, based upon a cDNA sequence encoding a given protein is described in, e.g., Stein and Cohen (1988) Cancer Res. 48:2659-2668; and van der Krol, et al. (1988) BioTechniques 6:958-976.
RNA interference is a mechanism to suppress gene expression in a sequence specific manner. See, e.g., Brumelkamp, et al. (2002) Sciencexpress (2lMarch2002);
Sharp (1999) Genes Dev. 13:139-141; and Cathew (2001) Curr. Op. Cell Biol. 13:244-248. In mammalian cells, short, e.g., 21 nt, double stranded small interfering RNAs (siRNA) have been shown to be effective at inducing an RNAi response. See, e.g., Elbashir, et al. (2001) Nature 411:494-498.
The mechanism may be used to downregulate expression levels of identified genes, e.g., treatment of or validation of relevance to disease.
Ribozymes In addition to antisense polynucleotides, ribozymes can be used to target and inhibit transcription of cancer-associated nucleotide sequences. A ribozyme is an RNA
molecule that catalytically cleaves other RNA molecules. Different kinds of ribozymes have been described, including group I ribozymes, hammerhead ribozyrnes, hairpin ribozymes, RNase P, and axhead ribozymes (see, e.g., Castanotto, et al. (1994) Adv. in Pharmacology 25: 289-317 for a general review of the properties of different ribozymes).
The general features of hairpin ribozymes are described, e.g., in Hampel, et al. (1990) Nucl. Acids Res. 18:299-304; European Patent Publication No. 0 360 257; U.S.
Patent No.
5,254,678. Methods of preparation are described in, e.g., WO 94/26877; Ojwang, et al. (1993) Proc. Natl. Acad. Sci. USA 90:6340-6344; Yamada, et al. (1994) Human Gene Therapy 1:39-45; Leavitt, et a1.(1995) Proc. Natl. Acad. Sci. USA 92:699-703; Leavitt, et al. (1994) Human Gene Theratw 5:1151-120; and Yamada, et al. (1994) Virolo~y 205: 121-126.
Polynucleotide modulators of cancer may be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand binding molecule, as described in WO 91/04753. Suitable ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell.
Alternatively, a polynucleotide modulator of cancer may be introduced into a cell containing the target nucleic acid sequence, e.g., by formation of an polynucleotide-lipid complex, as described in WO 90/10448. It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods of treatment.
Thus, in one embodiment, methods of modulating cancer in cells or organisms are provided. In one embodiment, the methods comprise administering to a cell an anti-cancer antibody that reduces or eliminates the biological activity of an endogenous cancer protein.
Alternatively, the methods comprise administering to a cell or organism a recombinant nucleic acid encoding a cancer protein. This may be accomplished in any number of ways. In a preferred embodiment, e.g., when the cancer sequence is down-regulated in cancer, such state may be reversed by increasing the amount of cancer gene product in the cell.
This can be accomplished, e.g., by overexpressing the endogenous cancer gene or administering a gene encoding the cancer sequence, using known gene-therapy techniques. In a preferred embodiment, the gene therapy techniques include the incorporation of the exogenous gene using enhanced homologous recombination (EHR), e.g., as described in PCT/US93/0386.
Alternatively, e.g., when the cancer sequence is up-regulated in cancer, the activity of the endogenous cancer gene is decreased, e.g., by the administration of a cancer antisense or other inhibitor, e.g., RNAi.
In one embodiment, the cancer proteins of the present invention may be used to generate polyclonal and monoclonal antibodies to cancer proteins. Similarly, the cancer proteins can be coupled, using standard technology, to affinity chromatography columns. These columns may then be used to purify cancer antibodies useful for production, diagnostic, or therapeutic purposes. In a preferred embodiment, the antibodies are generated to epitopes unique to a cancer protein; that is, the antibodies show little or no cross-reactivity to other proteins. The cancer antibodies may be coupled to standard affinity chromatography columns and used to~
purify cancer proteins. The antibodies may also be used as blocking polypeptides, as outlined above, since they will specifically bind to the cancer protein.
Methods of identifying variant cancer-associated sequences Without being bound by theory, expression of various cancer sequences is correlated with cancer. Accordingly, disorders based on mutant or variant cancer genes may be determined. In one embodiment, the invention provides methods for identifying cells containing variant cancer genes, e.g., determining all or part of the sequence of at least one endogenous cancer gene in a cell. In a preferred embodiment, the invention provides methods of identifying the cancer genotype of an individual, e.g., determining all or part of the sequence of at least one cancer gene of the individual. This is generally done in at least one tissue of the individual, and may include the evaluation of a number of tissues or different samples of the same tissue. The method may include comparing the sequence of the sequenced cancer gene to a known cancer gene, e.g., a wild-type gene.
The sequence of all or part of the cancer gene can then be compared to the sequence of a known cancer gene to determine if any differences exist. This can be done using known homology programs, such as Bestfit, etc. In a preferred embodiment, the presence of a difference in the sequence between the cancer gene of the patient and the known cancer gene correlates with a disease state or a propensity for a disease state, as outlined herein.
In a preferred embodiment, the cancer genes are used as probes to determine the number of copies of the cancer gene in the genome.
In another preferred embodiment, the cancer genes are used as probes to determine the chromosomal localization of the cancer genes. Information such as chromosomal localization finds use in providing a diagnosis or prognosis in particular when chromosomal abnormalities such as translocations, and the like are identified in the cancer gene locus.
Administration of pharmaceutical and vaccine compositions In one embodiment, a therapeutically effective dose of a cancer protein or modulator thereof, is administered to a patient. By "therapeutically effective dose"
herein is meant a dose that produces effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable using known techniques. See, e.g., Ansel, et al. (1999) Pharmaceutical Dosage Forms and Drug Delivery Lippincott; Lieberman (1992) Pharmaceutical Dosa= a Forms (vols. 1-3) Dekker, ISBN 0824770846, 082476918X, 0824712692, 0824716981;
Lloyd (1999) The Art, Science and Technolo~y of Pharmaceutical Compounding Amer.
Pharmaceut. Assn.; and Pickar (1998) Dosa ,e Calculations Thomson. Adjustments for cancer degradation, systemic versus localized delivery, and rate of new protease synthesis, as well as the age, body weight, general health, sex, diet, time of administration, drug interaction and the severity of the condition may be necessary. U.S. Patent Application No.
09/687,576, further discloses the use of compositions and methods of diagnosis and treatment in cancer.
A "patient" for the purposes of the present invention includes both humans and other animals, particularly mammals. Thus the methods are applicable to both human therapy and veterinary applications. In the preferred embodiment the patient is a mammal, preferably a primate, and in the most preferred embodiment the patient is human.
The administration of the cancer proteins and modulators thereof of the present invention can be done in a variety of ways, including, but not limited to, orally, subcutaneously, intravenously, intranasally, transdermally, intraperitoneally, intramuscularly, intrapulmonary, vaginally, rectally, or intraocularly. In some instances, e.g., in the treatment of wounds and inflammation, the cancer proteins and modulators may be directly applied as a solution or spray.

The pharmaceutical compositions of the present invention comprise a cancer protein in a form suitable for administration to a patient. In the preferred embodiment, the pharmaceutical compositions are in a water soluble form, such as being present as pharmaceutically acceptable salts, which is meant to include both acid and base addition salts.
"Pharmaceutically acceptable acid addition salt" refers to those salts that retain the biological effectiveness of the free bases and that are not biologically or otherwise undesirable, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the,like, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, malefic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cirmamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and the like. "Pharmaceutically acceptable base addition salts" include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. Particularly preferred are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine.
The pharmaceutical compositions may also include one or more of the following:
carrier proteins such as serum albumin; buffers; fillers such as microcrystalline cellulose, lactose, corn and other starches; binding agents; sweeteners and other flavoring agents;
coloring agents; and polyethylene glycol.
The pharmaceutical compositions can be administered in a variety of unit dosage forms depending upon the method of administration. For example, unit dosage forms suitable for oral administration include, but are not limited to, powder, tablets, pills, capsules and lozenges. It is recognized that cancer protein modulators (e.g., antibodies, antisense constructs, ribozymes, small organic molecules, etc.) when administered orally, should be protected from digestion.
This is typically accomplished either by complexing the molecules) with a composition to render it resistant to acidic and enzymatic hydrolysis, or by packaging the molecules) in an appropriately resistant carrier, such as a liposome or a protection barrier.
Means of protecting agents from digestion are available.

The compositions for administration will commonly comprise a cancer protein modulator dissolved in a pharmaceutically acceptable carrier, preferably an aqueous carrier. A
variety of aqueous Garners can be used, e.g., buffered saline and the like.
These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, and the like, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like in accordance with the particular mode of administration selected and the patient's needs (e.g., (1980) Remin~ton's Pharmaceutical Science (18th ed.) Mack, and Hardman and Limbird (eds. 2001) Goodman and Gilman: The Pharmacolo~ial Basis of Therapeutics (10th ed.) McGraw-Hill.
Thus, a typical pharmaceutical composition for intravenous administration would be about 0.1 to 10 mg per patient per day. Dosages from 0.1 up to about 100 mg per patient per day may be used, particularly when the drug is administered to a secluded site and not into the blood stream, such as into a body cavity or into a lumen of an organ.
Substantially higher dosages are possible in topical administration. Actual methods for preparing parenterally administrable compositions will be known or apparent.
The compositions containing modulators of cancer proteins can be administered for therapeutic or prophylactic treatments. In therapeutic applications, compositions are administered to a patient suffering from a disease (e.g., a cancer) in an amount sufficient to cure or at least partially arrest the disease and its complications. An amount adequate to accomplish this is defined as a "therapeutically effective dose." Amounts effective for this use will depend upon the severity of the disease and the general state of the patient's health. Single or multiple administrations of the compositions may be administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the composition should provide a sufficient quantity of the agents of this invention to effectively treat the patient. An amount of modulator that is capable of preventing or slowing the development of cancer in a mammal is referred to as a "prophylactically effective dose." The particular dose required for a prophylactic treatment will depend upon the medical condition and history of the mammal, the particular cancer being prevented, as well as other factors such as age, weight, gender, administration route, efficiency, etc. Such prophylactic treatments may be used, e.g., in a mammal who has previously had cancer to prevent a recurrence of the cancer, or in a mammal who is suspected of having a significant likelihood of developing cancer based, at least in part, upon gene expression profiles. Vaccine strategies may be used, in either a DNA
vaccine form, or protein vaccine.
It will be appreciated that the present cancer protein-modulating compounds can be administered alone or in combination with additional cancer modulating compounds or with other therapeutic agent, e.g., other anti-cancer agents or treatments.
In numerous embodiments, one or more nucleic acids, e.g., polynucleotides comprising nucleic acid sequences set forth in the Tables, such as RNAi, antisense polynucleotides or ribozymes, will be introduced into cells, in vitro or in vivo. The present invention provides methods, reagents, vectors, and cells useful for expression of cancer-associated polypeptides and nucleic acids using in vitro (cell-free), ex vivo or in vivo (cell or organism-based) recombinant expression systems.
The particular procedure used to introduce the nucleic acids into a host cell for expression of a protein or nucleic acid is application specific. Many procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, spheroplasts, electroporation, liposomes, microinjection, plasma vectors, viral vectors, and other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into a host cell (see, e.g., Berger and I~immel (1987) Guide to Molecular Cloning Techniques from Methods in Enzymolo~y (vol.
152) Academic Press; Ausubel, et al. (eds. 1999 and supplements) Current Protocols Lippincott;
and Sambrook, et al. (2001) Molecular Cloning: A Laboratory Manual (3d ed., Vol. 1-3) CSH
Press.
In a preferred embodiment, cancer proteins and modulators are administered as therapeutic agents, and can be formulated as outlined above. Similarly, cancer genes (including both the full-length sequence, partial sequences, or regulatory sequences of the cancer coding regions) can be administered in a gene therapy application. These cancer genes can include inhibitory applications, e.g., as inhibitory RNA, gene therapy (e.g., for incorporation into the genome), or antisense compositions.
Cancer polypeptides and polynucleotides can also be administered as vaccine compositions to stimulate HTL, CTL, and antibody responses. Such vaccine compositions can include, e.g., lipidated peptides (see, e.g.,Vitiello, et al. (1995) J. Clin.
Invest. 95:341-349), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG") microspheres (see, e.g., Eldridge, et al. (1991) Molec. Immunol. 28:287-294,; Alonso, et al. (1994) Vaccine 12:299-306; Jones, et al. (1995) Vaccine 13:675-681), peptide compositions contained in immune stimulating complexes (ISCOMS) (see, e.g., Takahashi, et al. (1990) Nature 344:873-875; Hu, et al. (1998) Clin Ex~ Immunol. 113:235-243), multiple antigen peptide systems (MAPS) (see, e.g., _Tam (1988) Proc. Natl. Acad. Sci. USA 85:5409-5413; Tam (1996) J.
Immunol. Methods 196:17-32), peptides formulated as multivalent peptides;
peptides for use in ballistic delivery systems, typically crystallized peptides, viral delivery vectors (Perkus, et al., p.
379, in Kaufinann (ed. 1996) Concerts in Vaccine Development de Gruyter;
Chakrabarti, et al.
(1986) Nature 320:535-537; Hu, et al. (1986) Nature 320:537-540; Kieny, et al.
(1986) Bio/Technolo~y 4:790-795; Top, et al. (1971) J. Infect. Dis. 124:148-154;
Chanda, et al. (1990) Virolo~y 175:535-547), particles of viral or synthetic origin (see, e.g., Kofler, et al. (1996) J.
Immunol. Methods 192:25-35; Eldridge, et al. (1993) Sem. Hematol. 30:16-24;
Falo, et al.
(1995) Nature Med. 1:649-653), adjuvants (Warren, et al. (1986) Annu. Rev.
Immunol. 4:369-388; Gupta, et al. (1993) Vaccine 11:293-306), liposomes (Reddy, et al. (1992) J. Immunol.
148:1585-1589; Rock (1996) Immunol. Today 17:131-137), or, naked or particle absorbed cDNA (Ulmer, et al. (1993) Science 259:1745-1749; Robinson, et al. (1993) Vaccine 11:957-960; Shiver, et al., p 423, in Kaufmann (ed. 1996) Concepts in Vaccine Development de Gruyter; Cease and Berzofsky (1994) Annu. Rev. Immunol. 12:923-989; and Eldridge, et al.
(199 Sem. Hematol. 30:16-24). Toxin-targeted delivery technologies, also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
Vaccine compositions often include adjuvants. Many adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a stimulator of immune responses, such as lipid A, Bortadella pertussis, or Mycobacterium tuberculosis derived proteins. Certain adjuvants are commercially available as, e.g., Freund's Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit, MI);
Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ); AS-2 (SmithKline Beecham, Philadelphia, PA); aluminum salts such as aluminum hydroxide gel (alum) or aluminum phosphate; salts of calcium, iron, or zinc; an insoluble suspension of acylated tyrosine; acylated sugars; cationically or anionically derivatized polysaccharides;
polyphosphazenes;

biodegradable microspheres; monophosphoryl lipid A and quil A. Cytokines, such as GM-CSF, interleukin-2, -7, -12, and other like growth factors, may also be used as adjuvants.
Vaccines can be administered as nucleic acid compositions wherein DNA or RNA
encoding one or more of the polypeptides, or a fragment thereof, is administered to a patient.
This approach is described, for instance, in Wolff et. al. (1990) Science 247:1465-1468, as well as U.S. Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524;
5,679,647; WO
98/04720; and in more detail below. Examples of DNA-based delivery technologies include "naked DNA", facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated ("gene gun") or pressure-mediated delivery (see, e.g., U.S.
Patent No. 5,922,687).
For therapeutic or prophylactic immunization purposes, the peptides of the invention can be expressed by viral or bacterial vectors. Examples of expression vectors include attenuated viral hosts, such as vaccinia or fowlpox. This approach involves the use of vaccinia virus, e.g., as a vector to express nucleotide sequences that encode cancer polypeptides or polypeptide fragments. Upon introduction into a host, the recombinant vaccinia virus expresses the immunogenic peptide, and thereby elicits an immune response. Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No.
4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover, et al. (1991) Nature 351:456-460. A wide variety of other vectors are availablel for therapeutic administration or immunization, e.g., adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like. See, e.g., Shata, et al. (2000) Mol Med Today 6:66-71; Shedlock, et al. (2000) J. Leukoc.
Biol. 68:793-806; Hipp, et al. (2000) In Vivo 14:571-85.
Methods for the use of genes as DNA vaccines are well known, and include placing a cancer gene or portion of a cancer gene under the control of a regulatable promoter or a tissue-specific promoter for expression in a cancer patient. The cancer gene used for DNA vaccines can encode full-length cancer proteins, but more preferably encodes portions of the cancer proteins including peptides derived from the cancer protein. In one embodiment, a patient is immunized with a DNA vaccine comprising a plurality of nucleotide sequences derived from a cancer gene. For example, cancer-associated genes or sequence encoding subfragments of a cancer protein axe introduced into expression vectors and tested for their immunogenicity in the context of Class I MHC and an ability to generate cytotoxic T cell responses.
This procedure provides for production of cytotoxic T cell responses against cells which present antigen, including intracellular epitopes.
In a preferred embodiment, DNA vaccines include a gene encoding an adjuvant molecule with the DNA vaccine. Such adjuvant molecules include cytokines that increase the immunogenic response to the cancer polypeptide encoded by the DNA vaccine.
Additional or alternative adjuvants are available.
In another preferred embodiment, cancer genes find use in generating animal models of cancer. When the cancer gene identified is repressed or diminished in cancer tissue, gene therapy technology, e.g., wherein inhibitory or antisense RNA directed to the cancer gene will also diminish or repress expression of the gene. Animal models of cancer fmd use in screening for modulators of a cancer-associated sequence or modulators of cancer.
Similarly, transgenic animal technology, including gene knockout technology, e.g., as a result ~of homologous recombination with an appropriate gene targeting vector, will result in the absence or increased expression of the cancer protein. When desired, tissue-specific expression or knockout of the cancer protein may be necessary.
It is also possible that the cancer protein is overexpressed in cancer. As such, transgenic animals can be generated that overexpress the cancer protein. Depending on the desired expression level, promoters of various strengths can be employed to express the transgene.
Also, the number of copies of the integrated transgene can be determined and compared for a determination of the expression level of the transgene. Animals generated by such methods will find use as animal models of cancer and are additionally useful in screening for modulators to treat cancer.
Kits for Use in Diagnostic and/or Prognostic Applications For use in diagnostic, research, and therapeutic applications suggested above, kits are also provided by the invention. In diagnostic and research applications, such kits may include at least one of the following: assay reagents, buffers, cancer-specific nucleic acids or antibodies, hybridization probes and/or primers, antisense polynucleotides, ribozymes, dominant negative cancer polypeptides or polynucleotides, small molecule inhibitors of cancer-associated sequences etc. A therapeutic product may include sterile saline or another pharmaceutically acceptable emulsion and suspension base.
Iii addition, the kits may include instructional materials containing instructions (e.g., protocols) for the practice of the methods of this invention. While the instructional materials typically comprise written or printed materials, they are not limited to such.
A medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like.
Such media may include addresses to Internet sites that provide such instructional materials.
The present invention also provides for kits for screening for modulators of cancer-associated sequences. Such kits can be prepared from readily available materials and reagents.
For example, such kits can comprise one or more of the following materials: a cancer-associated polypeptide or polynucleotide, reaction tubes, and instructions for testing cancer-associated activity. Optionally, the kit contains biologically active cancer protein. A
wide variety of kits and components can be prepared according to the present invention, depending upon the intended user of the kit and the particular needs of the user. Diagnosis would typically involve evaluation of a plurality of genes or products. The genes will typically be selected based on correlations with important parameters in disease which may be identified in historical or outcome data.
EXAMPLES
Example 1: Gene Chip Analysis Molecular profiles of various normal and cancerous tissues were determined and analyzed using gene chips. RNA was isolated and gene chip analysis was performed as described (Glynne, et al. (2000) Nature 403:672-676; Zhao, et al. (2000) Genes Dev. 14:981-993).

Table 1 lists medical conditions, abnormalifies, or organs affected by disease, referred to in Tables 2A-68, for which markers have been idenfified, and other related medical conditions (including various stages andlor metastases) in which those markers will also be useful, e.g., in therapeutic, diagnosfic, prognostic, subsetting, vaccine, and other uses.
blood vesselslangiogenesis: hemangiomas, lymphangiomas, wound healing, tissue remodeling, psoriasis, ischemic, heart disease, inflammatory diseases (e.g., arfhrifis, asthma, chronic bronchitis), alherosclerosis, endometriosis, presumed ocular histoplasmosis syndrome, hypoxia, solid tumors, lymphomas, autoimmune diseases (e.g., RA, SLE, juvenile chronic arthritis, pigmented villonodular synovifis, etc.), retinal neovascularization syndromes (e.g., diabetic refinopathy, macular degenerafion, presumed ocular histoplasmosis syndrome, etc.), scleritislconjunctivitis, hyperirophic scars (keloid), birth control, uterine fibroids bladder. carcinoma in situ, papillary carcinomas, Uansitional cell carcinoma bone marrow: Ewing sarooma, sarcomas arising from skeletal and extraskeletal connecfive fissues, including the peripheral nervous system 1 ~ brain: glioblastoma, oligodendroglioma, anablasfic astrocytoma, meningioma, medulablastoma, neuroblastoma, ependymoma, schwannoma, craniopharyngioma, pineoblastoma, pineocytoma breast: ductal caroinoma in situ, lobular carcinoma in situ cervix: cancer of the cervix, vagina, or vulva colonlrectum: precancerous colorectal disease (e.g., neoplasfic polyps (adenomas), familial adenomatous poiyposis, ulcerative colitis), colon cancer, e.g., epithelial tumor (e.g., I S adenocarcinoma, mutinous adenocaroinoma, signet-ring cell adenocarcinoma, squamcus cell carcinoma, adenosquamous carcinoma, undifferentiated caroinoma, unclassified carcinoma), carinoid tumor (e.g., argenta~n, nonargentaffin, composite), non-epithelial tumor (e.g., leimyo sarcroma, others), inflammatory bowel disease (e.g., ulcerafive colifis, Crohn's disease (granulomatous colitis), dysplasia), rectal cancer, cancer of the anal region (e.g., squamous cell caroinoma, transifional caroinoma, adenocaroinoma, carcinoma, papillary villous caroinoma, mutinous adenocarcinoma, melanoma) 2o esophagus: premalignant or predisposing conditions (e.g., esophagifis), squamous cell cancers (e.g., cancers of the head and neck, lung, or cervix), gastrodigestive carcinomas (e.g., cancers of the stomach, colon, or rectum) fibrosis: lung fibrosis (idiopathic pulmonary fibrosis, hypersensitivity pneumonitis,interstitiat pneumonifis, nonspecific idiopathic pneumonifis), chronic obstructive pulmonary disease (e.g., emphysema, chronic bronchifis), asthma, bronchiectasis, cirrhosis (liver fibrosis), renal fibrosis, sclerodertna, wound healing head and neck: tumors of the nasal cavity, paranasal sinuses, nasopharynx, oral cavity, oral pharynx, lip, larynx, hypopharynx, salivary glands, paragangliomas, esophagus kidney: clear cell (nonpapillary) carcinoma, papillary carcinoma, chromophobe renal carcinoma, hypemephroma, adenocaroinoma, sporadic renal carcinomas, hereditary renal carcinomas (von Hippei-Lindau disease), carcinoma pf the renal pelvis, ureteral carcinoma, fibroma, papillary adenoma, angiomyolipoma, oncocytoma leukocytes: acute lymphoblastic leukemiallymphoma, malignant transformafion of immature, precursor B (pre-B) or precursor T (pre-T) lymphocytes, or lymphoblasts, arthrifis, inflammation, wound healing liver: hepatitis (e.g., types A, B, C), benign epithelial tumors and tumor bile condifions, primary malignant epithelial tumors, primary malignant mesenchymal tumors, tumors of the gallbladder or bile duct 30 lung: lung cancer, small cell lung carcinoma (oat cell carcinoma), non-small cell carcinomas (e.g., squamous cell carcinoma, adenocarcinoma, large cell lung carcinoma, carcinoid, granulomatous), fibrosis (idiopathic pulmonary fibrosis, hypersensitivity pneumonitis,interstifial pneumonilis, nonspecific idiopathic pneumonitis), chronic obstructive pulmonary disease (e.g., emphysema, chronic bronchifis), asthma, bronchiectasis, esophageal cancer ovary: ovarian carcinoma (e.g., epithelial (serous tumors, mutinous tumors, endometrioid tumors), germ cell (e.g., teratomas, choriocarcinomas, polyembryomas, embryomal carcinoma, endodermal sinus tumor, dysgerminoma, gonadoblasloma), stromal carcinomas (e.g., granulosal stromal cell tumors)), fallopian tube carcinoma, peritoneal carcinoma, 3 5 leiomyoma pancreas: adenocarcinoma ductal adenocaroinoma, mutinous cyst adenocarcinoma, acinar cell carcinoma, unclassified large cell carcinoma, small cell carcinoma, pancreatoblastoma, duct-ectafic mucin-hypersecreting tumor, mutinous cyst adenoma, papillary cysfic neoplasm, serous cyst adenoma, diabetes melifis, chronic pancreatifis prostate: epithelial neoplasms (e.g., adenocarcinoma, small cell tumors, transitional cell carcinoma, caroinoma in situ, and basal cell carcinoma), caroinosarcoma non-epithelial 4o neoplasms (e.g., mesenchymal and lymphoma), germ cell tumors, prostatic intraepithelial neoplasia (PIN), hormone independent prostate cancer, benign prostate hyperplasia, prostatitis skin/melanoma: melanoma, lentigo (common benign localized hyperplasia of melanocytes), nevocellular nevi (congenital or acquired neoplasm of melanocytes), acfinic keratosis (overgrowth of outer layers of skin), basal cell carcinoma, Merkel cell carcinoma, benign fibrous hisfiocyloma (dermal neoplasms of fibroblasts and histiocytes), dermatofibrosarcoma protuberans (well differentiated fibrosarcoma of the skin), xanthomas (tumor-like collecfions of foamy his6ocytes within the dertnis), dermal vascular tumors, seborrheic keratoses (benign tumor), acanthosis nigricans (benign or malignant hyperplasia and hyperpigmentation of skin), and squamous cell carcinomas of the skin, lung, 45 cervix, esophagus, uterus, head, neck, or bladder stomach: adenocarcinoma, squamous cell caroinoma, adenoacanthoma, caroinoid, leiomyosarcoma, gastritis (chronic atrophic, H. pylori associated), hyperplasfic polyps, lipoma, leiomyoma, esophageal adenocarcinomas testicles: germ cell tumors (including seminomas, embryonal carcinomas, teratomas, choriocarcinomas, yolk sac tumors), sex chord stromal tumors (including Leydig cell tumors, Sertoli cell tumors, and Granulosa cell tumors), germ cell and gonadal stromal elements (e.g., gonadoblastomas), adnexal and paratesticular tumors (e.g., mesotheliomas, soff tissue sarcomas, and adnexal of the rete testes), miscellaneous necplasms (including carcinoid, lymphoma, and cysts) uterus: epithelial tumors (e.g., endometrioid, papillary endometrioid, papillary serous, clear cell, mutinous), mesenchymal tumors (e.g., endometrial stromal sarooma, leiomyosarcoma, nonspecific saroomas), mixed tumors (e.g., malignant mixed mullerian tumors, adenosarcoma) 5 Tables 2B-66C list accession numbers for Pkeys lacking UnigenelD's for Tables 2A-66C, respecfively. For each probeset is listed gene cluster number from which oligonucleotides were designed. Gene clusters were compiled using sequences derived from Genbank ESTs and mRNAs. These sequences were clustered based on sequence similarity using Clustering and Alignment Tools (DoubIeTwist, Oakland California). Genbank accession numbers for sequences comprising each cluster are listed in the °Accession" column.
6o Tables 2G66C list genomic positioning for Pkeys lacking Unigene ID's and accession numbers in Tables 2A-66C, respectively. For each predicted exon is listed genomic sequence source used for prediction. Nucleotide locafions of each predicted exon are also listed.
TABLE 2A: ABOUT 1031 GENES UP-REGULATED IN ACUTE LYMPHOCYTIC LEUKEMIA (ALL) Table 2A lists about 1031 genes up-regulated in acute lymphocyfic leukemia (ALL) compared to normal adult tissues. These were selected from 35403 probesets on the AftymetrixlEos Hu01 GeneChip array such that the ratio of "average" leukemia to "average" normal adult tissues was greater than or equal to 1.7. The "average" leukemia level was set to the 75"~ percentile amongst various ALL samples. The "average" normal adult tissue level was set to the 85"~ peroentile amongst various non-malignant fissues. In order to remove gene-specific background levels of non-specific hybridization, the 7.5'" percentile value amongst various non-malignant tissues was subtracted from both the numerator and the denominator before the ratio was evaluated.
Pkey: Unique Eos probeset idenfifier number ExAccn: Exemplar Accession number, Genbank accession number 7o UnigenelD: Unigene number Unigene Title: Unigene gene title R1: Ratio of leukemia to normal body tissue Pkey ExAccUniGeneIDUniGeneTifie R1 75 100458S74019Hs.247979pre-B lymphocyte gene46.8 113089 T40707Hs.270862ESTs 20.4 106956 806428Hs.226351ESTs 15.8 101447 M21305 gb:Human alpha satellite13.8 and satellite 3 113009 T23699Hs.7246ESTs 12.5 126947 240778Hs.191837ESTs 11.4 100893 BE245294Hs.180789S164 protein 11.1 101050 AU077324Hs.1832neurapeptideY 11.0 132114 NM_006152Hs.40202lymphoid-restricted 10.7 membrane protein ~4 101304AA001021Hs.6685thyroid hormone receptor10.4 interaclor 8 105667AA767526Hs.22030paired box gene 5 (Bell9.1 lineage specif 112727791029Hs.15069ESTs 9.0 109788779971Hs.12432Homo Sapiens clone 8.7 24407 mRNA sequence 113374779925Hs.269165ESTs, Weakly similar 7.8 to ALU1 HUMAN ALU

130466W19744Hs.180059Homo Sapiens cDNA FLJ206537.7 fis, clone KA

109384AA219172Hs.86849ESTs 7.6 112602AW004045Hs.203365ESTs 6.6 125278AI218439Hs.i29998enhancerofpolycombi 6.5 1 112167N99591Hs.25587ESTs, Weakly similar 6.4 ~ to 700329 hypotheti 116355AA789133Hs.88650ESTs 5.8 123440A1733692Hs.112488ESTs 5.5 100918AK001335Hs.31137protein tyrosine phosphatase,5.4 receptor t 101879AA176374Hs.243886nuclear autoaniigenic 5.4 sperm protein (his 15 109260AW978515Ns.131915KIAA0863 protein 5.4 129213AI146494Hs.109525ESTs, Weakly similar 5.4 to IRX2 HUMAN IROQU

120809AA346495 gb:EST52657 Fetal heart5.4 II Homo Sapiens 105498H68279Hs.24937Uansformer-2 alpha 5.1 (hUa-2 alpha) 114840AA447591Hs.87359ESTs, Highly similar 5.0 to RB18 HUMAN RAS-R

103304BE561801Hs.2484T-cell leukemiallymphoma4.9 113983W87415Hs.55296HLA-B associated Uanscript-14.8 115844AI373062Hs.332938hypothetical protein 4.8 120712AF193339Hs.102506eukaryotic translation4.8 initiation factor 107794AA019255 gb:ze56e10.s15oares 4.7 retina N2b4HR Homo 25 135101U82275Hs.94498leukocyte immunoglobulin-like4.6 receptor, 129898AI672731Hs.i3256ESTs 4.6 113494791451Hs.86538ESTs 4.6 115004AA329340Hs.4867mannosyl (alpha-1,3-)-glycoprotein4.5 beta-113074AK001335Hs.31137protein tyrosine phosphatase,4.5 receptor t 112326855822Hs.4268ESTs 4.4 105169BE245294Hs.180789S164 protein 4.4 117048H89732Hs.230113EST 4.3 123133AA487264Hs.154974Homo sapiens mRNA; 4.3 cDNA DKFZp667N064 (fr 111394AA412227Hs.16131hypothetical protein 4.3 35 106112AL117518Hs.3686KIAA0978 protein 4.2 114414AW152166Hs.182113ESTs 4.2 125219AI804331Hs.99423ATP-dependent RNA helicase4.2 114995AA769266Hs.193657ESTs 4.2 123338AA504249Hs.187585ESTs 4.1 126666AA648886Hs.151999ESTs 4.1 112908BE281000Hs.3530TLS-associated serine-arginine4.1 protein 2 116640X89984Hs.211563B-cell CLLnymphoma 4.0 109292AW975746Hs.188662KIAA1702 protein 4.0 131724AK001335Hs.31137protein tyrosine phosphatase,4.0 receptor t 45 119772AJ250839Hs.58241gene for serinelthreonine4.0 protein kinase 134453AI272141Hs.83484SRY (sex determining 4.0 region Y)-box 4 123562AA177088Hs.190065ESTs 4.0 103226X75042Hs.44313v-rel avian reticuloendotheliosis3.9 viral 127610AA960867Hs.150271ESTs, Highly similar 3.9 to unnamed protein 119873AI660149Hs.44865lymphoid enhancer-binding3.9 factor 1 115553AJ275986Hs.71414Uanscriptionfactor(SMIF3.9 gene) 131844A1419294Hs.324342ESTs 3.8 123360AA532718Hs.178604ESTs 3.8 11 A1798851Hs.283108hemoglobin, gamma G 3.8 t 129426AF077953Hs.111323Protein inhibitor of 3.8 5 activated STAT X

105434AA252111Hs.15200ESTs 3.8 119073BE245360Hs.279477ESTs 3.8 127003AW816515Hs.173540ATPase, Class V, type 3.7 119325751136Hs.90489ESTs 3.7 115998AA448488Hs.336629ribosomal protein L44 3.7 119830AW054922Hs.53478Homo sapiens cDNA FLJ123663.7 fis, clone MA

104584AA704538Hs.193777ESTs 3.6 105212AA205334Hs.324278Homo Sapiens mRNA; 3.6 cDNA DKFZp566M063 (f 109223AW000714Hs.65818ESTs 3.6 65 112605879374Hs.29852ESTs 3.5 105733AA767669Hs.10242ESTs 3.5 120562BE244580Hs.302267hypothetical protein 3.5 112268W39609Hs.22003solute tamer family 3.5 6 (neuroUansmitte 12783dAW301022Hs.337631EST 3.5 70 115147AA745781Hs.38399hypothetical protein 3.5 115185BE299677Hs.105461hypothetical protein 3.5 113921AW976530Hs.28355hypothetical protein 3.5 115835AA521410Hs.41371ESTs 3.5 123503AW975051Hs.293156ESTs, Weakly similar 3.5 to 178885 serinelth 75 128527AA504583Hs.101047Uanscription factor 3.4 3 (E2A immunoglobul 128743844284Hs.2730heterogeneous nuclearribonucleoprotein3.4 117031H88353 gb:yw21a02.s1 Morton 3.4 Fetal Cochlea Homo 123149AI734179Hs.105676ESTs 3.4 102581AU077228Hs.77256enhancer of zeste (Drosophila)3.4 homolog 2 80 103158BE242587Hs.118651hematopoietically expressed3.4 homeobox 107599AW664072Hs.60136ESTs 3.4 125556AB033064Hs.334806KIAA1238 protein 3.4 103331AI825463Hs.147996protein kinase, X-linked3.4 114387AI655141Hs.107720ESTs, Weakly similar 3.4 to A54295 interfer 119040802394Hs.269436ESTs, Moderately similar3.4 to PC4259 fem 100305NM Hs.171872DEADIH (Asp-Glu-Ala-AspIHis)3.4 004941 box polypep 129818T71092Hs.172572hypothetical protein 3.3 133445AC005262Hs.73797guanine nucleotide binding3.3 protein (G pr 132111AW500857Hs.40137anaphase-promoting complex3.3 1; meiotic ch 105292AF128542Hs.166846polymerase (DNA directed),3.3 epsilon 118397BE139479Hs.i61492ESTs 3.3 118922AW206193Hs.91065hypothetical protein 3.2 1 132 OKFZp761B2423 d 44 3 AW977189Hs.45719KIAA0823 protein 3.2 129889AA810932Hs.131899ESTs, Weakly similar 3,2 to T00370 hypotheti 123670AI189844Hs.112708ESTs, Moderately similar3.2 to ZN91 HUMAN Z

f AW410377Hs.d1502hypothetical protein 3,2 16291 FlJ21276 105289AB020638Hs.103000KIAA0831 protein 3,2 I
S

105583AA278907Ns.3530TLS-associated serine-arginine3,2 protein 104796BE620712Hs.33026hypothetical protein 3,2 111657807364Hs.268667ESTs,WeaklysimilartoALU13.2 FIUMANALU

134174AF283770Hs.79630CD79A antigen (immunoglobulin-associated3.2 126077M78772Hs.210836ESTs 3.1 3733 AK000476Hs.75798hypotheticalprotein 3.1 124847W07701Hs.304177Homo Sapiens clone FLB85033_1 PR02286 mRNA, 127879AA768098Hs.189079ESTs 3.1 113108AW516695Hs.8438ESTs 3,1 110343AW136703Hs.17268ESTs 3.1 102935HE561850Hs.80506small nuclear ribonucleoprotein3.1 polypept 111676AB040882Hs.109778KIAA1449 protein 3,1 127311AAd92582Hs.3224Q4hypotheticalprotein 3,1 108830AA131743Hs.193352ESTs 3.1 1113308E247767Hs.18166KIAA0870 protein 3.1 104246AF016032Hs.201377lysosomal apyrase-like 3,1 126668AA011616Hs.269877ESTs 3.1 124724H20816Hs.112423Homo Sapiens mRNA; cDNA3.1 DKFZp586I1420 (f 114794AI751157Hs.101395hypothetical protein 3.1 (34599X99226Ns.284153Fanconi anemia, complementation3.0 35 group A

130314NM Hs.154332KIAA0212geneproduct 3.0 100265D38521Hs.112396KiAA0077 protein 3.0 115005AI760825Hs.111339ESTs 3.0 123433AW450922Hs.112478ESTs 3.0 127798AA737068Hs.294078ESTs 3.0 117403H84455Hs.40639ESTs 3.0 107111A1298448Hs.22670chromodomain helicase 3,0 DNA binding protei 105698AW957300Hs.294142ESTs, Weakly similar 3.0 to C55663 oligodend 108358M81933Hs.1634cell division cycle 3.0 132066AI929392Hs.181195DnaJ (Hsp40) homolog, 2.9 45 subfamily B, membe 130303BE245294Hs.180789S164 protein 2,g 104596AF067804Hs.i5423hypothetical protein 2,g 112197NM Hs.5637ESTs 2,g 132809AF036144Hs.5734meningioma expressed 2,9 antigen 5 (hyaluron 100877X80821Ns.27973KIAA0874 protein 2,g 108147AI972094Hs.286221Homo Sapiens cDNA FLJ137412,9 tis, clone PL

133674AW851121Hs.75497Homo Sapiens cDNA: F1J221392.9 fis, clone H

129001AA443323Hs.107812BPOZ protein 2,g 131920BE002320Hs.287864Homo Sapiens cDNA FLJ140302.9 fis, clone HE

134709NM Hs.211600tumor necrosis factor, 2.8 55 006290 alpha-induced pro 113577AI300699Hs.278937PR00470protein 2,g 1158398E300266Hs.28935transducin-like enhancer2,g of split 1, hom 129969N57818 gb:yv59d07.sfSoaresfetalliverspleen2,g 128659AW630087Hs.103315trinucleotiderepeatcontainingl2,g 105011BE091926Hs.16244mitotic spindle coiled-coil2,g related prat 129294AF172940Hs.1845d2CGI-127 protein 2.8 104518H20816Hs.112423Homo sapiens mRNA; cDNA2,7 DKFZp58611420 (f 107796AA058848Hs.60797ESTs 2.7 106331A8037742Hs.2d336KIAA1321 protein 2,7 127692A1021912Hs.187983ESTs 2.7 131916AA025976Hs.34569ESTs 2.7 124971T23800Hs.151001hypotheticalprotein 2.7 129428AA256906Hs.111364ESTs, Weakly similar 2,7 to ubiquitous TPR m 118348AW408586Hs.91052ESTs, Moderately similar2,7 to ALUS HUMAN A

113219T59257Hs.269528ESTs Moderately similar2.7 1 to ALUB-HUMAN A

3 268128Hs.3109Rho GTPase activating 2.7 720 protein 4 109593AW196801Hs.6685thyroid hormone receptor2,7 interactor 8 135359AF043722Hs.99491R4S guanyl releasing 2.7 protein 2 (calcium 131689AB012124Hs.30696transcription factor-like2,7 5 (basic helix 117457N29682Hs.44071ESTs Weakly similar 2.7 75 1 toALUS-HUMANALU

21073H46199Hs.112184DKFZP586J0619 protein 2.7 125069H81306Hs.194485ESTs 2,7 116456AI381911Hs.334859KIAA1814 protein 2.7 124271AW293223Hs.8928hypothetical protein 2.7 112369AW966243Hs.4243hypothetical protein 2.7 115866AW062629Hs.52081KIAA0867 protein 2.7 132543BE568452Hs.5101protein regulator ofcytokinesisi2.7 124494N54831Hs.271381ESTs, Weakly similar 2,7 to 138022 hypothet 104799AA029703 gb:ze95hOB.s1 Soares-fetal-heart2.7 NbHHI9W

120510AI796395Hs.111377ESTs 2.6 129781AA30fi090Hs.124707ESTs 2.6 122698AA456112Hs.9941DESTs 2.6 106995AB023139Hs.37892KIAA0922 protein 2.6 105502BE464016Hs.238956ESTs 2.6 128671A1885045Hs.211586phosphoinositide-3-kinase,2.6 regulatory s 107059BE614410Hs.23044RAD51 (S. cerevisiae) 2.6 homolog (E colt Re 126502T10077Hs.13453hypothetical protein 2.6 129703BE388665Hs.179999Homo Sapiens, clone 2.6 IMAGE:3457003, mRNA

1 111219N68836Hs.19247ESTs, Moderately similar2.6 ~ to ALUC-HUMAN

133529W45623Hs.74571ADP-ribosylation factor2.6 125626A1038854Hs.180789St64 protein 2.6 111189N67603Hs.272130ESTs, Weakly similar 2.6 to S65824 reverse 113146BE151985Hs.5722hypolheUcal protein 2.6 I 125562AI494372Hs.98968hypothetical protein 2.6 102263029171Hs.75852casein kinase 1, delta 2.6 118835AA535246Hs.50852ESTs 2.fi 103141X66113Hs.75584polymyositislscleroderma2.6 autoanGgen 2 ( 109598840515Hs.21248ESTs 2.fi 127262AA828125 gb:od71a09.siNCl CGAP_Ov2Homosapiens2.6 129620D79338Hs.239720CCR4-NOT transcdpfion 2.6 complex, subunit 125905Ai678638Hs.6456chaperonin containing 2.6 TCP1, subunit 2 (b 123255AA830335Hs.105273ESTs 2.6 133160N54968Hs.66309hypothetical protein 2.6 25 109638AW977747Hs.119120E3 ubiquilin ligase 2.6 119896AA731836Hs.137319ESTs 2.6 134770M89957Hs.89575CD798 antigen (immunoglobulin-associated2.6 119403AL117554Hs.119908nucleolar protein NOP51NOP582.6 129563AF119664Hs.27299transcriptional regulator2.6 protein 111719AI655806Hs.179262ESTs 2.6 103982AA218558Hs.7905sorting nexin 9 2.6 125032T74884 gb:yc58d02.s1 Stratagene2.5 liver (93722d) 131426AL122045Hs.26703CCR4-NOT transcription 2.5 complex, subunit 131938AF176085Hs.34956neural polypydmidine 2.5 tract binding prot 35 102450048251Hs.75871protein kinase C binding2.5 protein 1 133761AF041430Hs.75922brain protein 13 2.5 126339AA152106Hs.4859cyclinLania-6a 2.5 118967AI668670Hs.216756ESTs 2.5 123110AA486256Hs.193510EST 2.5 114092H81213Hs.14825ESTs, Weakly similar 2.5 to KIAA1503 protein 113247T63856Hs.193430ESTs, Weakly similar 2.5 to 2109260A B cell 122024AA431296Hs.139433ESTs 2.5 106657AW854339Hs.33476hypothetical protein 2.5 126127N95428 gb:zb80d09.s1 Soares 2.5 senescent fibroblas 45 111836858394Hs.25119ESTs, Weakly similar 2.5 to YEXO_YEAST HYPOT

121470AA558958Hs.324751ESTs 2.5 120132W57554Hs.125019ESTs 2.5 107731AA016086Hs.2721ESTs, Weakly similar 2.5 O6 to 138022 hypotheli 118122AI186671Hs.48008ESTs 2.5 SD 106589AK000933Hs.28661Homo Sapiens cDNA FLJ100712.5 fis, clone HE

129948AI537162Hs.263988ESTs 2.5 115652BE093589Hs.38178hypothetical protein 2.5 103076NM ribonucleotide reductase2.5 001D34 M2 polypeptide Hs.75319 131019W28614Hs.306155chorionic somatomammotropin2.5 hormone 1 (p 100512D13317Hs.78915GA-binding protein transcription2.5 5 factor, 105393AF167570Hs.256583intedeukin enhancer 2.5 binding factor 3, 9 100571L14561Hs.78546ATPase, Ca++transporting,2.5 plasma membra 106890AA489245Hs.88500mitogen-activated protein2.5 kinase 8 tote 104276AW965275Hs.284288hqp0256 protein 2.5 ()~113283T66813Hs.12947EST 2.5 118078N54321Hs.47790EST 2.5 120796A1247356Hs.96820ESTs 2.5 106265AA412176Hs.236463Homo Sapiens mRNA; cDNA2.5 DKFZp58610521 (f 102507052154Hs.193044potassium inwardly-rectifying2.5 channel, s 65 106508AI205785Hs.30348ESTs 2.5 104568AW629981Hs.172182poly(A)-binding protein,2.5 cytoplasmic 1 103698AA001021Hs.6685thyroid hormone receptor2.5 interactor 8 113947W84768 gb:zh53d03.s1 Soares 2.5 fetal liver-spleen-132112AL021938Hs.40154jumonji (mouse) homolog2.5 70 129052BE275031Hs.158210hypothetical protein 2.4 117265AA451966Hs.43005RAB9-like protein 2.4 107834AA253162Hs.40838ESTs 2.4 113119T47910 gb:yb18b11.s1 Slratagene2.4 fetal spleen (9 133726AI803188Hs.252716oxysterol-binding protein-related2.4 protei 75 120548AA280356Hs.187634ESTs 2.4 121545AA412442Hs.98132ESTs 2.4 131136A8033099Hs.23413KIAA1273 protein 2.4 126589AW027809Hs.187698Homo Sapiens cytomegalovirus2.4 partial fus 115475A8033085Hs.40193hypothetical protein 2.4 103760AA642973Hs.183842ubiquitin B 2.4 127889AI147408Hs.144941ESTs 2.4 124457AK000680Hs.266175phosphoprotein associated2.4 with GEMS

113721AF143885Hs.18190SST 2.4 g7 129079 Hs.108502hypothetical protein 2.4 123530 Hs.187772ESTs 2.4 123592AAB05331Hs.112637ESTs 2.4 113474850752Hs.23856hypothetical protein 2.4 116728F13687Hs.227976EST 2~4 101759M80244Hs.184601solute carrier family 2.4 7 (cationic amino 131686NM Hs.30687GRB2-associated binding2.4 012296 protein 2 127841AW136558Hs.125246ESTs 2.4 102737851790Hs.239483Human clone 23933 mRNA2.4 sequence l 129673D38552Hs.1191KIAA0073 protein 2.4 133095BE046490Hs.180677zinc finger protein 2.4 124540N63232 gb:yz39a12.s1 Morton 2.4 Fetal Cochlea Homo 113609T93263Hs.16B75ESTs, Weakly similar 2.4 to 523650 retrovir 128826240313Hs.106330Homo Sapiens clone 2.4 IMAGE:23371, mRNA
seq 15 129059AW069534Hs.279583CGI-81 protein 2.4 134092AA218558Hs.7905sorting nexin 9 2.4 132317BE262438Hs.44592beta-1,4 mannosyltransferase2.4 135278AA399542Hs.229671EST, Moderately similar2.4 to PEPTIDYL-PROL

128468T23625Hs.150580putative Uanslation 2.4 initiation factor 127407AW089514Hs.279681heterogeneous nuclear 2.4 ribonucleoprolein 132342AW162758Hs.45232ESTs, Weakly similar 2.4 1o ALU5_HUMAN ALU

113518AW367788Hs.323954postmeiotic segregation2.4 increased 2-lik 100330AW410976Hs.77152minichromosome maintenance2.4 deficient (S.

116046BE395293Hs.94491hypotheGcalprotein 2.4 123910AA621262Hs.179923ESTs, Weakly similar 2.4 to S65657 alpha-1 G

101651AL037111Hs.75641galactose-1-phosphate 2.4 uridylyltransferas 100114X02308Hs.82962thymidylate synthetase2.4 125038AA812234Hs.270134hypothetical protein 2.4 135191X16866Hs.301086cytochrome P450, subfamily2.4 IID (debrisoq 30 123258AA490929Hs.105274ESTs, Weakly similar 2.d to RMS1 HUMAN REGUL

132380AW373665Hs.46853ESTs 2.4 114046BE018658Hs.141003Homo Sapiens cDNA: 2.3 FLJ21691 fis, clone C

133582BE391579Hs.75087Fas-activated sednelthreonine2.3 kinase 134839D63479Hs.115907diacylglycerol kinase,2.3 delta (130kD) 3 105734AI952797Hs.10888hypothetical protein 2.3 101086AA382524Hs.250959histatin 1 2.3 118349N63786Hs.94149ESTs, Weakly similar 2.3 to ALU1 HUMAN ALU
S

101194L20971Hs.188phosphodiesterase 4B, 2.3 cAMP-specific (dun 130588AL030996Hs.16411hypothetical protein 2.3 101875BE241753Hs.74592special AT-rich sequence2.3 binding protein 118751N74210Hs.50454ESTs 2.3 125174W51835Hs.231082EST 2.3 105966AA142984Hs.5344adaptor-related protein2.3 complex 1, gamma 104624AA353125Ns.184721ESTs 2.3 45 131263AU077002Hs.24950regulator of G-protein2.3 signalling 5 105014AA121123Hs.269267ESTs, Weakly similar 2.3 to AF161361 1 HSPC

123423AA598484 gb:ae38f04.s1 Gessler 2.3 Wilms tumor Nomo s 128531H03721Hs.2953ribosomal protein Sl5a2.3 108876AI733860Hs.191453ESTs 2.3 130215BE301883Hs.152707glioblastomaamplifiedsequence2.3 132232AI522273Hs.42640ESTs 2.3 132664A1740461Hs.54542ESTs 2.3 105991AA215701Hs.186541ESTs, Weakly similar 2.3 to 138022 hypotheti 100253D38024Hs.157425double homeobox, 2 2.3 Jr 105574AA045281Ns.266175phosphoprotein associated2.3 with GEMS

100780BE561958Hs.302063immunoglobulin heavy 2.3 constant mu 134964AI803516Hs.272891hippocalcin-like protein2.3 132786BE083422Hs.56851hypothetical protein 2.3 104952AW076098Hs.74316desmoplakin (DPI, DPII)2.3 119127AA708035Hs.12248ESTs 2.3 104857A1920902Hs.19058ESTs, Moderately similar2.3 to 565657 alpha 107592AA694264Hs.60049ESTs 2.3 113378T80738Hs.14757ESTs 2.3 129226U40714Hs.239307tyrosyl-tRNA synthetase2.3 65 106898AA490069Hs.306676Homo Sapiens cDNA FLJ143022.3 fis, clone PL

130734AW137091Hs.18624KIAA1052 protein 2.3 125728AW954565Hs.57987B-cell CLLllymphoma 2.3 118 (zinc finger pro 113697T97183Hs.17992Homo Sapiens mRNA; 2.3 cDNA DKFZp434Ji726 (f 107104AU0766d0Hs.15243nucleolar protein 1 2.3 (120kD) 7~ 134267AI174596Hs.196209RAE1 (RNA export 1, 2.3 S.pombe) homolog 105777842755Hs.23096ESTs 2.3 115306AA280288Hs.88746ESTs 2.3 133363A1866286Hs.71962~ ESTs, Weakly similar2.3 to 836298 praline-r 129535AA397972Hs.169965chimerin (chimaerin) 2.3 75 121520AA412163Hs.164785ESTs 2.3 123808AA620552 gb:ae58g11.s1 Stratagene2.3 lung carcinoma 105700AW580830Hs.35254hypothetical protein 2.3 120820AA347417Hs.96869EST 2.3 128721AW403911Hs.266175phosphoprotein associated2.3 with GEMS

g0 107711W96141Hs.220687ESTs 2.3 102564U59423Hs.79067MAD (mothers against 2.3 decapentaplegic, Or 131868AW408296Hs.33532zinc finger protein 2.3 151 (pHZ-67) 122333AA625872Hs.98977ESTs, Moderately similar2.3 to T34561 hypot $g 118865AA736405Hs.54530ESTs 2.3 128952AL043463Hs.6755RaP2 interacting protein2.3 133772BE379867Hs.76038isopentenyl-diphosphate2.3 delta isomerase 111795AI435437Hs.24567ESTs, Weakly similar 2.3 to KBF3 HUMAN NUCL

103437AV655598Hs.184211peptidase (mitochonddal2.3 processing) bet 123060AA482027Hs.142569ESTs, Weakly similar 2.3 to 138022 hypotheti 125466806234Hs.180461ESTs 2.3 100892BE245294Hs.180789S164 protein 2.3 121613AA416879Hs.193195ESTs, Weakly similar 2.3 to 2109260A B cell 1 133665AL036883Hs.75450delta sleep inducing 2.2 ~ peptide, immunoreac 129248W04606Hs.171637hypothetical protein 2.2 126153H85692Hs.40730ESTs 2.2 125590823858Hs.143375Homo sapiens, clone 2.2 IMAGE:3840937, mRNA, 104960AA558677Hs.8928hypothetical protein 2.2 1 113941AA531016Hs.22399hypotheGcalprotein 2.2 s FLJ14824 112540869751 gb:yi40a10.s1 Scares 2.2 placenta Nb2HP Homo 105322T87179Hs.16346ESTs, Weakly similar 2.2 to S57447 HPBRII-7 112003AW978731Hs.30i824hypothetical protein 2.2 134733N87353Hs.89421CBFiinteracting coreprescor2.2 114620AA642974 gb:nr60h01.s1 NCI CGAP-Lym32.2 Homo sapiens 123451AI793211Hs.165372ESTs, Moderately similar2.2 to ALU1 HUMAN A

130850AB040922Hs.20237DKFZP566C134 protein 2.2 105561AA262881Hs.323836ESTs, Weakly similar 2.2 to altema6vely s 125957H41694 gb:yo06b06.r1 Scares 2.2 adult brain N2b5HB5 25 130362BE513050Hs.279681heterogeneous nuclearribonucleoprotein2.2 122682AA984531Hs.i59293ESTs 2.2 124250AA350256Hs.323875EST, Weakly similar 2.2 to 2109260A B cell 131392AA235153Hs.26320TRABID protein 2.2 128845AW503976Hs.10649basement membrane-induced2.2 gene 130453U80735Hs.173854PAX transcription activation2.2 domain tote 126973W46653Hs.251928nuclear pore complex 2.2 interacting protein 103156BE259039Hs.129953Ewing sarcoma breakpoint2.2 region 1 103163AU077018Hs.3235keratin 4 2.2 109252BE440157Hs.85944ESTs 2.2 35 131163AA099524Hs.23754ESTs 2.2 115292AA279956Hs.88672ESTs 2.2 122591A1188219Hs.99311ESTs, Weakly similar 2.2 to HSJ2-HUMAN DNAJ

124977F04819Hs.190452KIAA0365 gene product 2.2 103319X83492Hs.82359tumornecrosisfactorreceptorsupedami2.2 40 100370D79989Hs.184884KIAA0167 gene product 2.2 128992H04150Hs.107708ESTs 2.2 129928A1338993Hs.134535ESTs 2.2 108451AA079195 gb:zm92hi2.s1 Stratageneovariancancer2.2 133910AW835281Hs.77500ubiquitin specific 2.2 protease 4 (proto-one 45 106288A8037742Hs.24336KIAA1321 protein 2.2 134125NM-014781Hs.50421KIAA0203 gene product 2.2 101379X02994Hs.1217adenosine deaminase 2.2 112276853442Hs.26038ESTs, Weakly similar 2.2 to 138022 hypothet 106251Ri Hs.35101praline-rich Gla (G-carboxyglutamic2.2 2607 acid 50 125394BE178502Ns.173772ESTs, Weakly similar 2.2 to 178885 serinelth 103392X94563 gb:H.sapiens dbilacbp 2.2 gene exon 18 2.

112853T02843 gb:FB1 1H5 Fetal brain,2.2 Stratagene Homo s 133195AI434760Hs.279949KIAA1007 protein 2.2 135060AK001887Hs.259842protein kinase, AMP-activated,2.2 gamma 2 n 55 131381M92642Hs.26208collagen, type XVI, 2.2 alpha 1 134104L35253Hs.79107mitogen-activated protein2.2 kinase 14 105225AA211777 gb:zn57d02.s1 Stratagene2.2 muscle 937209 H

131320AA505691Hs.145696splicing factor (CC1.3)2.2 119419AI248013Hs.106532ESTs, Weakly similar 2.2 to 138588 reverse t 103634BE541733Hs.180877H3 histone, family 2.2 3B (H3.38) 134624AF035119Hs.8700deleted in liver cancer2,2 126524245455Hs.182447heterogeneous nuclear 2.2 dbonucleoprotein 115556AL031778Hs.797nuclear transcription 2.2 factory, alpha 111898838944Hs.183475Homo sapiens clone 2.2 25061 mRNA sequence 65 100415D86970Hs.75822TGF81-induced anti-apoptotic2.2 factor 1 103898AA248884 gb:k3517.seq.F Human 2.2 fetal heart, Lambda 129501AI631811Hs.180403STRIN protein 2.2 127251AA936428Hs.128638ESTs 2.2 100613X52078Hs.101047transcription factor 2.2 3 (E2A immunoglobul 7~ 116332AA491208Hs.62620chromosome 6 open reading2.2 frame 1 128897AW979134Hs.10700hypothetical protein 2.2 111777AK001100Hs.41690desmocollin 3 2.2 128604AI879099Hs.102397GIOT-3 for gonadoiropin2.2 inducible transc 125585AW298113Hs.92909SON DNA binding protein2.2 75 129584AV656017Hs.184325CGI-76 protein 2.2 114461AA531187Hs.126705ESTs 2.2 121387AA405854 gb:zu66g08.s1 Scares 2.2 testis NHT Homo sap 109339AA3i4554Hs.27774ESTs, Highly similar 2.2 to AF1613491 HSPCO

129179AW969025Hs.109154ESTs 2.2 80 106711BE390125Ns.143187hypotheticalprotein 2.2 106424H61005Hs.37902ESTs 2.2 123949AA621665Hs.208957EST 2.2 127256A1738610Hs.267967ESTs, Moderately similar2.2 to ALUS_HUMAN

104868AF173867Hs.28906glucocorticoid modulatory2.2 element bindin 132984BE539199Hs.62112zinc finger protein 2.2 126383AB032977Hs.6298KIAA1151 protein 2.2 130557H51825Hs.268911ESTs, Weakly similar 2.2 to S65824 reverse 119232AI655226Hs.117659ESTs, Weakly similar 2.2 to T46481 hypotheti 105715BE621800Hs.29444putative small membrane2.2 protein NID67 124691805835Hs.110153ESTs 2.2 113649N94768Hs.16400ESTs, Weakly similar 2.2 to KIAA1435 protein 117040AW970600Hs.303261ESTs 2.2 1 128767M85169Hs.1050pleckstdn homology, 2.2 ~ Sec7 and coiledlcoi 120602AA808018Hs.109302ESTs 2.2 107182A1311782Hs.20013GCIP-interacting protein2.2 p29 107357U63973Hs.103501rhodopsin kinase 2.2 125499H10543 gb:ym04c06.r1 Soares 2.1 infant brain 1 NIB
H

15126872AW450979 gb:Ul-H-BI3-ala-a-12-0.ULs12.1 NCI-CGAP_Su 113233T61955Hs.279867CGI-59 protein 2.1 128367AW611791Hs.150742ESTs 2.1 127432AW067708Hs.170311heterogeneous nuclear 2.1 ribonucleoprotein 114021AW235215Hs.16145ESTs 2.1 104455AL110261Hs.157211DKFZP586B0621 protein 2.1 134966AW402389Hs.920modulator recognition 2.1 factor 1 129765M86933Hs.1238amelogenin(Ychromosome)2.1 133461NM Hs.334345cytochrome P450, subfamily2.1 000762 IIA (phenobar 109639AA082650Hs.6217Homo Sapiens cDNA FLJ125212.1 fis, clone NT

25129794AF161399Hs.23259hypothetical protein 2.1 FLJi3433 134869AL157518Hs.90421PR02463 protein 2.1 110256H63947Hs.237955RAB7, member RAS oncogene2.1 family 128817BE395776Hs.168640ankylosis, progressive2.1 (mouse) homolog 120906NM Hs.97087CD3Z antigen, zeta 2.1 000734 polypeptide (TiT3 com 30134354M90391Hs.82127intedeukin 16 (lymphocyte2.1 chemoattracta 106048AW883367Hs.301732hypothetical protein 2.1 128352AW137413Hs.169942ESTs 2.1 115348AA281562Hs.292100ESTs 2.1 123474AA599209 gb:ag34b11.s1 Jia bone2.1 marrow stroma Hom 35107121A8015427Hs.250493zinc fingerprotein219 2.1 118509N22617Hs.43228Homo sapiens cDNA FLJ118352.1 fis, clone HE

135051AI272141Hs.83484SRY (sex determining 2.1 region Y)-box 4 109442AW296134Hs.86999ESTs, Weakly similarfo2.1 S65657 alpha-1G

126661AA009835Hs.269521ESTs 2.1 40129270AA357185Hs.109918ras homolog gene family,2.1 member H

125568AW615396Hs.105613ESTs 2.1 132867AF226667Hs.58553CTP synthase II 2.1 124656AW297702Hs.102915ESTs 2.1 128954AA346839Hs.209100DKFZP434C171 protein 2.1 45132985AL045579Hs.62113KIAA0717 protein 2.1 119247BE269047Hs.65234hypothetical protein 2.1 106686N66397Hs.334825Homo Sapiens cDNA FLJ147522.1 fis, clone NT

131009AF169802Hs.22142cytochrome b5 reductase2.1 b58.2 112170BE246743Hs.288529hypothetical protein 2.1 50130755BE293520Hs.18910prostate canceroverexpressedgenel2.1 117357N24829 gb:yx98h12.s1 Soares 2.1 melanocyte 2NbHM Ho 101613M24283Hs.168383intercellular adhesion2.1 molecule 1 (CD54) 127644N88858Hs.155101ATP synthase, H+transporting,2.1 mitochond 101183AA442324Hs.795H2A histone family, 2.
member 0 1 55100420D86983Hs.118893Melanoma associated 2.1 gene 129879AK001696Hs.13109Ran binding protein 2.1 122311NM Hs.i31915KIAA0863protein 2.1 130566885474Hs.16073ESTs 2.1 113517A1874223Hs.293560ESTs 2,1 60115810AA426026Hs.187615ESTs 2.1 108743AI580150Hs.71074ESTs 2,1 129255AI961727Hs.109804H1histonefamily,memberX2.1 120766AA764879Hs.12570tubulin-specific chaperone2.1 d 126893AJ252060Hs.26320TRABID protein 2.1 65115254AA279024Hs.269316ESTs, Weakly similar 2.1 to S65657 alpha-1 C

105865BE279383Hs.26557plakophilin 3 2.1 120999AI972375Hs.29626hypothetical brain 2.1 protein my038 125636H12382Hs.25119ESTs, Weakly similar 2.1 to YEXO-YEAST HYPOT

117997N52090Hs.47420EST 2.1 70104333D82418Hs.29626hypothetical brain 2.1 protein my038 134315AA291183Hs.81648hypothetical protein 2.1 FLJ11021 similar 1o 135332AW393883Hs.98968hypothetical protein 2.1 107279S57296Hs.323910v-erb-b2 avian erythroblastic2.1 leukemia 133097W03512Hs.6479hypothetical protein 2.1 75112563AW961220Hs.29282mitogen-activated protein2.1 kinase kinase 121782AW452957Hs.334698Homo Sapiens, clone 2.1 MGC:15203, mRNA, cam 111567F12628Hs.334786hypothetical protein 2.1 133912H42679Hs.77522major histocompatibility2.1 complex, class 134076AF086215 gb:Homo Sapiens full 2.1 length insertcDNA

g0116665F04405 gb:HSC2S8082 normalized2.1 infant brain cDN

133562M60721Hs.74870H2.0 (Drosophila)-like2.1 homeo box 1 129092D56365Hs.63525poly(rC)-binding protein2.1 106869AW975362Hs.292679ESTs 2.1 130820 Hs.288798hypotheticalprotein 2.1 126277 Hs.15441Crm (Cramped Drosophila)-like2.1 106392BE350058Hs.36787chromodomain helicase 2.1 DNA binding prolei 131902AA180145Hs.34348Homo sapiens mRNA; cDNA2.1 DKFZp434P0235 (f 120734AA299948 gb:ESTi 2544 Uterus 2.1 tumor I Homo Sapiens 113070AB032977Hs.6298KIAA1151 protein 2.1 116031AA452239Hs.103329KIAA0970 protein 2.1 123869AA620924Hs.112923EST 2.1 106145AA424791Hs.5734meningioma expressed 2.1 anfigen 5 (hyaluron 1 109061AA160896 gb:zo79c07.s1 Stratagene2.1 0 pancreas(93720 126348T16243Hs.6473Homo Sapiens cDNA FLJ139922.1 fis, clone Y7 133231AK000517Hs.6844hypotheticalprotein 2.1 123132A1061582Hs.324179Homo Sapiens cDNA FLJ123712.1 fis, clone MA

117452N34687Hs.44054otoein (GSK38 interacting2.1 protein) 1 128538844214Hs.101189ESTs 2.1 111945840663Hs.12494dESTs 2.1 119155861715Hs.310598ESTs,ModeratelysimilartoALU12.1 HUMAN

124362AL046406Hs.103483KIAA1798 protein 2.1 129198N57532Hs.109315KIAA1415 protein 2.1 122059AA431737Hs.98749EST, Moderately similar2.1 to T42671 hypoth 115643AA404276Hs.123253hypothetical protein 2.0 112558AK001621Hs.15921hypotheficalprotein 2.0 115355AA262292Hs.88445ESTs 2.0 130724AK001507Hs.306084Homo Sapiens clone FLB69142.0 PR01821 mRNA, 25 125360AW898892Hs.189741ESTs 2.0 104926BE298808Hs.33363DKFZP434N093 protein 2.0 119468A1911535Hs.6657hypothetical protein 2.0 bK1048E9.5 132891BE267143Hs.59271U2(RNU2) small nuclear 2.0 RNA auxiliary fac 100237D30715Hs.306333Human PAP (pancreafitis-associated2.0 prot 30 105335AW291165Hs.25447ESTs 2.0 106727AA357001Hs.34045hypothetical protein 2.0 126053H64450 gb:yu62d01.r1 Weizmann 2.0 Olfactory Epithet 115084BE383668Hs.42484hypothetical protein 2.0 128408AI183407Hs.143704EST 2.0 35 132311AI765559Hs.20072myosin regulatory light2.0 chain interactin 113626T94318Hs.17359ESTs, Moderately similar2.0 to RL44 HUMAN 6 116379AA448588Hs.71252hypotheticalprotein 2.0 DKFZp761C169 105474AL134843Hs.219614f-box and leucine-rich 2.0 repeat protein 11 108922AA115268Hs.269263ESTs 2.0 123720AA609734Hs.112755EST 2.0 128902AA036637Hs.107052ESTs 2.0 113226A1821008Hs.10697ESTs 2.0 106798BE252749Hs.20558hypothetical protein 2.0 106665BE090009Hs.323164hypothetical protein 2.0 105952AI767152Hs.lBiESTs, Weakly similar 2.0 400 to 178885 serinelth 127248AA364195 gb:EST75015 Pineal gland2.0 7l Homo Sapiens 112972AI684745Hs.165983hypothefical C2H2 zinc 2.0 finger protein FL

128148AA918175Hs.126637ESTs 2.0 116176AA311152Hs.288708hypothetical protein 2.0' 126457AA007489Hs.50382ESTs 2.0 112610AW500106Hs.23643serinelthreonine protein2.0 kinase MASK

109249AA194730Hs.268189hypothetical protein 2.0 121292AA401807 gb:zv65f11.s1 Soares-total_fetus-Nb2HF8-2.0 128605AW058113Hs.102402Mad4 homolog 2~0 55 127705AJ003322 gb:AJ003322 Selected 2.0 chromosome 21 cDNA

134674AF219139Hs.87726KIAA0154 protein; ADP-ribosylalion2.0 facto 107529BE515065Hs.296585nucleolar protein (KKEID2.0 repeat) 116411AA608897Hs.321618hypothetical protein 2.0 111576T88827Hs.15489ESTs 2.0 127002AL353940Hs.24979hypotheficalprotein 2.0 DKFZp761P1010 112662885436Hs.268814ESTs 2.0 126250AL050391Hs.321247Homo sapiens mRNA; cDNA2.0 DKFZp586A181 (fr 101045J05614 gb:Human proliferating 2.0 cell nuclear anfi 117186H98988Hs.42612ESTs, Weakly similar 2.0 to ALU1 HUMAN ALU S

6S 122110AI123000Hs.301240melanocortin 1 receptor2.0 (alpha melanocyt 119849A1074585Hs.58440ESTs 2.0 124395N29963Hs.272095ESTs, Weakly similar 2.0 to 138022 hypotheti 131600NM 7 carnitine palmitoyltransferase2.0 00437Hs.29331I, muscle 112774895770Hs.35455ESTs 2.0 7~ 109751AB033492Hs.6679hHDC for homolog of 2.0 Drosophila headcase 102377U40343Hs.29656cyclin-dependent kinase2.0 inhibitor 2D (p1 115197818656Hs.6749ESTs 2.0 102808BE242818Hs.179606nuclear RNA helicase, 2.0 DECD variant of DE

128869AA768242Hs.80618hypothetical protein 2.0 75 111229AW389845 ESTs 2.0 Hs.110855 129330AL079310Hs.92260high-mobility group 2.0 protein 2-like 1 105448NM_001186 BTB and CNC homology 2.0 Hs.154276 1, basic leucine z1 127391AW380893 hypothetical protein 2.0 Hs.11039 MGC2722 102337AI814663Hs.170133forkhead box 01A (rhabdomyosarcoma)2.0 g0 121897AA427419Hs.229162EST, Weakly similar 2.0 to ZN91 HUMAN ZINC

107902AA02fi627Hs.61358ESTs 2.0 129340H75334Hs.11050F-box only protein 9 2.0 101097BE245301Hs.89414chemokine (C-X-C motif),2.0 receptor 4 (fus 124864AW970168Hs.185706ESTs 2.0 118485AA508515Hs.291049ESTs 2.0 116715AL117440Hs.170263tumor protein p53-binding2.0 protein,1 130743AL049266Hs.18724Homo Sapiens mRNA; 2.0 cDNA DKFZp564F093 (fr 118677AW971146Hs.293187ESTs 2.0 100020 2.0 123252AW968776Hs.287586Homo Sapiens cDNA FLJ136482.0 fis, clone PL

134977AL044963Hs.306121leukocyte receptor 2.0 cluster (LRG) encoded 115334AA702972Hs.65300ESTs 2.0 ' 111790AW769683Hs.6734ESTs, Weakly similar 2.0 to S26650 DNA-bindi 129101NM Hs.108665zinedin 2.0 132676N925B9Hs.261038ESTs, Weakly similar 2.0 to 138022 hypothet 111018AI287912Hs.3628mitogen-acfivated protein2.0 kinase kinase 105933AF078544Hs.194686solute tamer family 2.0 25 (mitochonddal 1 110679AA004798Hs.108311ESTs, Weakly similar 2.0 s to T00351 hypolhefi 120861AA350394Hs.96952ESTs . 2.0 132430AW973652Hs.283105ESTs 2.0 115026AA251972Hs.188718ESTs 2.0 128660AA011597Hs.177398ESTs 2.0 2~ 134554A1184316Hs.85273relinoblastoma-binding2.0 protein 6 109592AI198059Ns.26370ESTs 2.0 123636AA609263 gb:af13cO8.s1 Scares 2.0 tesfis NHT Homo sap 132610AA160511Hs.5326amino acid system N 2.0 transporter 2; porcu 122652AA454641 gb:zx99d05.s1 Soaves-NhHMPu_S12.0 Homosapi 25 120467AW292562Hs.187628ESTs 2.0 126046AA804957Hs.119840ESTs 2.0 128179AW293689Hs.127116ESTs 2.0 123349A8033042Hs.29679cofactor roquired far 2.0 Sp1 transcriptions 106208AK001674Hs.22630cofactor required for 2.0 Sp1 transcriptions 125832AA628600Hs.117587ESTs 2.0 133317AC005258Hs.70830U6 snRNA-associated 2.0 Sm-like protein LSm7 132886AW978168Hs.5912F-box only protein 2.0 127447AA386192Hs.193482Homo Sapiens cDNA FLJ119032.0 fis, clone HE

133149AA370045Hs.6607AXINi up-regulated 2.0 35 120468AW967675Hs.96487ESTs, Highly similar 2.0 to S08228 ribosomal 106487AI697340Hs.135265Homo Sapiens clone 2.0 FLB8436 PR02277 mRNA, 126770A1292320Hs.81361heterogeneous nucleardbonucleoprotein2.0 120592AA830664Hs.i43974ESTs 2.0 100944L07518Hs.159593mucin 6, gastric 2.0 40 101887AW967413Hs.83958transducin-like enhancer2.0 of split 4, hom 125324807785 gb:yf15c06.ri Soaresfetalliverspleen2.0 133906BE386038Hs.77492heterogeneous nuclear 2.0 ribonucleoprotein 113408NM Hs.115945mannosidase, beta A, 2.0 005908 lysosomal 115613AW136951Hs.173946hypothetical protein 2.0 45 107468AA740979Hs.91389ESTs 2.0 100554M95923 gb:Human 12-lipoxygenase2.0 mRNA, partial c 120476NM Hs.104305death effectorfilament-forming2.0 014922 Ced-4-li 117160AA322302Hs.183302PCTAIRE protein kinase2.0 115582AW245047Hs.136164cutaneous T-cell lymphoma-associated2.0 to 125536F08266Hs.77948ESTs,WeaklysimilartoALU12.0 100842U05597 gb:Human anion exchanger2.0 3 cardiac isofo 133207AI561173Hs.67688ESTs 2.0 122053AI637498Hs.98745ESTs 2.0 121080AA617830Hs.28310ESTs 2.0 55 113316T70318Hs.268581ESTs 2.0 113137AW952129Hs.293225ESTs, Weakly similar 1.9 to FLDED-1 [H.sapie 100416AW505086Hs.196914minor histocompatibility1.9 anfigen HA-1 133975C18356Hs.295944tissue factor pathway 1.9 inhibitor 2 103872AI816078Hs.21756translafion factor 1.9 suit homolog 132439AK001942Hs.4863hypothetical protein 1.9 DKFZp566A1524 126082H81188Hs.269571ESTs 1.9 124677801073 gb:ye84c03.s1 Scares 1.9 fetal liver spleen 123385BE149685Hs.17767KIAA1554 protein 1.9 103138X65965 gb:H.sapiens SOD-2 1.9 gene for manganese su 65 104867AA278898Hs.225979hypothetical protein 1.9 similar to small G

128668AI754363Hs.103422Homo Sapiens cDNA FLJ146301.9 fis, clone NT

125826M20681Hs.7594solute tamer family 1.9 2 (facilitated glu 113701T97301Hs.18026ESTs 1.9 134447M58603Hs.83428nuclear factor of kappa1.9 light polypeptid 70 128895AW467000Hs.106985ESTs 1.9 112719AI200957Hs.19301Homo sapiens, Similar 1.9 to Nedd-4-like ubi 102552NM tumor protein p53-binding1.9 005426 protein, 2 Hs.44585 131186270200Hs.246112KIAA0788 protein 1.9 133347BE257758Hs.71475acid cluster protein 1.9 75 133388AW245631Hs.182447heterogeneous nuclearribonucleoprotein1.9 112266AI652534Hs.25934ESTs, Weakly similar 1.9 to HSHU11 histone H

100336N76101Hs.8127KIAA0144 gene product 1.9 113479A1023133Hs.10739ESTs 1.9 135231BE613615Hs.74280hypothetical protein 1.9 go 123783AA610112 gb:af19g05.s1 Soares_total-Fetus_Nb2HF8-1.9 113016NM KIAA0414 protein 1.9 Hs.127649 132761AI815537Hs.323502nuclear RNA export 1.9 factor 1 128536AW955065Hs.101150Homo Sapiens, clone 1.9 IMAGE:4054156, mRNA, 126663AW518478Hs.181297ESTs 1.9 103973AA305729Hs.18272amino acid transporter1.9 system A1 106742AW591428Hs.27556hypothetical protein 1.9 129793AW207000Hs.126857Homo sapiens cDNA FLJ129361.9 fis, clone NT

105888AW970672Hs.9247protein kinase, AMP-activated,1.9 alpha 1 c 101892AI825838Hs.75206protein phosphatase 1.9 3 (formerly 2B), cat 125511AJ271379Hs.76194dlwsomal protein 55 1.9 126751AI378328Hs.77256enhancer of zeste (Drosophila)1.9 homolog 2 129111AL080155Hs.226372DKFZP434J154 protein 1.9 1 128750T80270Hs.104788hypothetical protein 1.9 ~ LOC55565 133531BE276738Hs.74578DEADIH (Asp-Glu-Ala-AspIHis)1.9 box polypep 125704855094Hs.26239Human DNA sequence 1.9 from clone RP11-43882 100157D14661Hs.119Wilms'tumour 1-associaUng1.9 protein 125845AK001440Hs.131840hypothetical protein 1.9 I 134682AW882645Hs.88044sprouty (Drosophila) 1.9 S homolog 1 (antagoni 106565NM Hs.227602KIAA1116 protein 1.9 106706AB037810Hs.18760KIAA1389 protein 1.9 125761868351 gb:yh99b03.r1 Soares 1.9 placenta Nb2HP Homo 116470AI272141Hs.83484SRY (sex determining 1.9 region Y)-box d 123264AI681270Hs.99824BCE-1 protein 1.9 126096F08208Hs.283844similar to rat tdcarboxylate1.9 tamer-li 104995AK001690Hs.16390hypotheticalprotein 1.9 133424AA350994Hs.20281KIAA1700 1.9 132450AA100012Hs.48827hypothetical protein 1.9 25131803073737Hs.284289vitiligo-associated 1.9 protein VIT-1 116548D20433 gb:HUMGS0i407 Human 1.9 promyelocyte Homo so 113815AA386192Hs.193482Homo Sapiens cDNA FLJ119031.9 fis, clone HE

100245AL039248Hs.3094KIAA0063 gene product 1.9 113677270200Hs.246112KIAA0788 protein 1.9 3~134470X54942Hs.83758CDC28 protein kinase 1.9 134937AI251449Hs.171939ESTs 1.9 134506AW247364Hs.84285ubiquitin-conjugating 1.9 enzyme E21 (homolo 126469BE384361Hs.182885ESTs, Weakly similar 1.9 to JC5024 UDP-galac 115261AA938293Hs.60088hypothetical protein 1.9 35125198W69474Hs.323140ESTs 1.9 115317AA303799Hs.300141ribosomal protein L39 1.9 112342AW410273Hs.92614longevity assurance 1.9 (LAGt, S. cerevisiae 117329AA524065Hs.93670Homo Sapiens cDNA: 1.9 FLJ22664 fis, clone H

116353AB032966Hs.131728KIAA1140 protein 1.9 114459AW445217Hs.103362ESTs 1.9 133903X63692Hs.77462DNA (cytosine-5-)-methyltransferase1.9 116083AA455706Hs.44581heat shock protein 1.9 hsp70-related protein 130037AI498631Hs.111334femtin,lightpolypeptide1.9 102273BE391815Hs.75981ubiquitin specific 1.9 protease 14 (tRNA-gua 45120452AL022328Hs.104335hypothetical protein 1.9 116432BE271922Hs.71243ESTs, Weakly similar 1.9 to zinc finger prot 115916A1052731Hs.91910ESTs 1.9 120827AA382525Hs.132967Human EST clone 1228871.9 mariner transposo 129602AI282193Hs.198298v-src avian sarooma 1.9 (Schmidt-Ruppin A-2) 105693BE250951Hs.181368U5 snRNP-specific protein1.9 (220 kD), orlh 102316034301 gb:Human nonmuscle 1.9 myosin heavy chain II

131422AW607731Hs.26670Human PAC clone RP3-515N11.9 from 22q11.2-q 128434AI190914Hs.143880ESTs 1.9 1170116AA581602Hs.41840ESTs 1.9 55102006AL048967Hs.172207non-POU-domain-containing,1.9 octamer-bindi 121335AA404418 gb:zw37e02.s1 Soares_total_fetus_Nb2HF8_1.9 105905AA401533Hs.19440ESTs 1.9 125165W45350 gb:zc81 h08.s1 Pancreatic1.9 Islet Homo sapi 109875H03260Hs.30385ESTs 1.9 109152AW380723Hs.73451ESTs, Weakly similar 1.9 to S55024 nebulin, 126203AK001035Hs.130881B-cell CLLllymphoma 1.9 11A (zinc finger pro 122530AW959741Hs.40368adaptor-related protein1.9 complex 1, sigma 124506BE273688Hs.182447heterogeneous nuclearribonucleoprotein1.9 130525AA361850Hs.322149Human clone 137308 1.9 mRNA, partial cds 65127226AL036559Hs.3463ribosomal protein S23 1.9 106465AA971576Hs.225951topoisomerase-rotated 1.9 function protein 4 106970AA52i366Hs.24252ESTs 1.9 134275A1878910Hs.3688cisplatin resistance-associated1.9 overexpr 126825AA100230 gb:z181c01.s1 Stratagene1.9 colon (937204) 7~132443AW246148Hs.268371hypothetical protein 1.8 104631AA002064Hs.18920ESTs 1.8 111468H62647Hs.205481ESTs 1.8 114317AA524839Hs.469succinate dehydrogenase1.8 complex, subunit 126158N55989Hs.16390hypothetical protein 1.8 75113782AK001567Hs.311002Homo Sapiens cDNA FLJ107051.8 fis, clone NT

119229T03229 gb:FB5C2 Fetal brain, 1.8 Slratagene Homo so 105930AF016371Hs.9880peptidyl prolyl isomerase1.8 H (cyclophilin 127245AA323958 gb:EST26810 Cerebellum1.8 II Homo Sapiens c 100967BE011845Hs.251064high-mobility group 1.8 (nonhistone chromoso 105149BE089288Hs.8958Homo Sapiens cDNA FLJ 1.8 12024 fis, clone HE

104542829657 gb:F1-1179D 22 week 1.8 old human fetal live 124236AF086006 gb:Homo Sapiens full 1.8 length insertcDNA

127155AA284993 gb:zt23e10.r1 Soares 1.8 ovary tumor NbHOT
H

126854AJ275986Hs.71414transcription factor 1.8 (SMIF gene) 107021AK001342Hs.14570hypothetical protein 1.8 110023AW294701Hs.31040ESTs 1.8 114899AK000342Hs.77646Homo sapiens mRNA; cDNA1.8 DKFZp761 M0223 (f 127315AFi gb;Homo sapiens clone 1.8 16622 FLBd217 mRNA segue 110384H45282Hs.268798ESTs 1,8 132693BE244200Hs.55075KIAA0410 gene product 1.8 127684AA668631Hs.32556KIAA0379 protein 1.8 127297AW629485Hs.140720GSK-3 binding protein 1.8 1 104249AF004231Hs.22405leukocyte immunoglobulin-like1.8 ~ receptor, 112652BE269699Hs.235782solute carrier family 1.8 21 (organic anion 110312BE256986Hs.1i896hypotheticalprotein 1.8 100417NM Hs.78054pro-mRNA splicing factor1.8 014003 similar to S. c 120532AA262354Hs.i86648ESTs, Weakly similar 1.8 to 138022 hypotheti I 127629AA293279Hs.29173hypothetical protein 1.8 100739M69287Hs.2083CDGlike kinase 1 1.8 110636H72868Hs.19110ESTs 1.8 132957BE244044Hs.61469hypothetical protein 1.8 115467AI366784Hs.48820TATA box binding protein1.8 (TBP)-associate 20 132161W31634Hs.180799hypotheticalprotein 1.8 129510AW968504Hs.123073CDC2-related protein 1.8 kinase 7 126805F32658Hs.101359chromosome 6 open reading1.8 frame 32 129295063127Hs.110121SEC7 homolog 1.8 127823AW972893Hs.78869transcription elongation1.8 factor A (S11), 25 10459DAW373062Hs.83623nuclear receptor subfamily1.8 1, group I, m 111959840978Hs.271498ESTs,ModeratelysimilartoALU1_HUMANA1.8 109303AA199857Hs.269291ESTs 1.8 112501AA972447Hs.288833Nomo sapiens mRNA; cDNA1.8 DKFZp434K087 (fr 127303AA366951 gb:EST77963 Pancreas 1.8 tumor III Homo sapi 115982W92113 gb:zh48e01.r1 Soares 1.8 fetal liver-spleen-123331AA497013 gb:ae32g02.s1 Gessler 1.8 Wilms tumor Homo s 111598811505Hs.268912ESTs 1.8 121643AA640987Hs.193767ESTs 1.8 105012AF098158Hs.9329chromosome 20 open reading1.8 frame 1 35 118761AW7991D9Hs.226755ESTs 1.8 128765AF073310Hs.143648insulin receptor substrate1.8 118103AA4D1733Hs.184134ESTs 1.8 134595NM Hs.29282mitogen-activated protein1.8 002401 kinase kinase 134212AA654353Hs.17779EBP50-PDZ interactor 1 of 64 kD 8 40 128033AI248705Hs.149321ESTs .
1.8 126972NM Hs.95260Autosomal Highly Conserved1.8 016255 Protein 111122N63753Hs.16492DKFZP564G2D22 protein 1.8 114798AA159181Hs.54900serologically defined 1.8 colon cancer antig 106349AW954310Hs.127270KIAA1545 protein 1.8 45 135358BE622827Hs.99486hypothetical protein 1.8 116223AF045458Hs.47061unc-51 (C. elegans)-like1.8 kinase 1 116654226324Hs.79204ESTs, Weakly similar t.8 to 138022 hypolheti 124554N65961 gb:za27d03.s1 Soaresfetalliverspleen1.8 120259AW014786Hs.192742hypothetical protein 1.8 123044AK001035Hs.130881B-cell CLLllymphoma 1.8 11A (zinc finger pro 125261W90351Hs.110134ESTs, Highly similar 1.8 to CREB-binding pro 135026N92165Hs.93231ESTs 1.8 129951AL110282Hs.268024Nomo Sapiens, clone 1.8 IMAGE:3873720, mRNA

125768AI557486Hs.119122ribosomal protein Ll3a 1.6 55 114122846128Hs.12751ESTs 1.8 133047AA310600Hs.63657peptide:N-glycanase 1.8 similar to yeast PNG

133589L37368Hs.75104RNA-binding protein i.8 Si, sedne-rich doma 130872061084Hs.226307phorbolin (similar to 1.8 apolipoprotein B m 1334988E299587Hs.85301calcium binding protein1.8 131144AA305255Hs.23528HSPC038 protein 1.8 104261AW24836dHs.5409RNA polymerase I subunil1.8 115507A1083668Hs.50601hypothetical protein 1.8 109073T05003Hs.10056hypotheticalprotein 1.8 115363AA214618Hs.152759activator of S phase 1.8 kinase 65 112657AW844878Hs.19769hypothetical protein 1.8 102960AI904738Hs.76053DEADIH (Asp-Glu-Ala-AspIHis)1.8 box polypep 125549820215 gb:yg18b09.r1 Soares 1.8 infant brain 1N18 H

133797AL133921Hs.76272retinoblastoma-binding 1.8 protein 2 125048AW440068Hs.59425hypothetical protein 1 103403X95406 gb:H.sapiens cyclin , E gene. 1,8 123546AA608817Hs.112597EST 1.8 124694806108 gb:ye94h05.s1 Soaresfetalliverspleen1.8 102406043177 (NONE) 1,g 130695T97205Hs.17998ESTs, Weakly similar 8 to 2109260A B cell 1 75 123951A8012922Hs.173043metastasis-associated .
1-like 1 1.8 118533N71861Hs.49413ESTs 1_g 123197AA489250 gb:aa57h12.s1 NCI CGAP_6CB11.8 Homosapiens 125656AW516428Hs.78687neutral sphingomyelinase1.8 (N-SMase) activ 100154H60720Hs.81892KIAA0101 gene product 1 106876N52821Hs.269412ESTs, Moderately similar_ to ALU7_HUMAN A 1.8 128339AL121087Hs.296406KIAA0685 gene product 1,8 105939AL137728Hs.12258Homo Sapiens mRNA; cDNA1.8 DKFZpd34B0920 (f 102495NM_006762Hs.79356Lysosomal-associated 1.8 multispanning membr 100221028383 gb:Human mRNA for ATP 1.8 synthase B chain, 101741NM Hs.326198transcription factor 1.8 101701NM-002436Hs.i861membrane protein, palmitoylated1.8 1 (55k0) 107119AI375499Hs.27379ESTs 1.8 Jr 134362U47742Hs.82210zinc finger protein 1.8 127964F06298 gb:HSC13F081 normalized1.8 infant brain cDN

101437M20681Hs.7594solute carver family 1.8 2 (facilitated glu 106204AA188734Hs.21479ubinuclein 1 1.8 112716AW590680Hs.110802von Willebrand factor 1.8 109779AB029396Hs.3353beta-1,3~lucuronyltransferase1.8 1 (glucur 111369AA535740Hs.170263tumor protein p53-binding1.8 protein,1 135204AF067515Hs.183418cell division cycle 1.8 2-like 1 (PITSLRE
pr 105788AB009698Hs.23965solute carver family 1.8 22 (organic anion 110997AW862823Hs.168052KIAA042i protein i.8 I 111620814853Hs.307478EST, Weakly similar 1.8 S to 139058 hypotheti 115618H11695Hs.322901disrupter of silencing1.8 115904AI167560Hs.61297ESTs 1.8 107510BE613332Hs.132055ESTs, Weakly similar 1.8 to GNMSLL reUoviru 116435AAi86761Hs.334812hypothetical protein 1.8 DKFZp586K0717 112399860920Hs.296770KIAA1719 protein 1.8 127426AA854756Hs.124076ESTs 1.8 125175W52355Hs.303030EST 1.8 132972AAD34365Hs.288924Homo Sapiens cDNA FLJ113921.8 tis, clone HE

125982898091 gb:yr30e11.r1 Soares 1.8 fetal liver spleen 115620AA399997Hs.211610CUG triplet repeat, 1.8 RNA-binding protein 128115AI435590Hs.130168ESTs 1.8 106880AI493206Hs.32425ESTs 1.7 101199L22075Hs.1666guanine nucleotide 1.7 binding protein (G
pr 104159BE386983Hs.283685hypothetical protein 1.7 30 101368M13058Hs.73952praline-rich protein 1.7 Haelll subfamily 2 103646AW248439Hs.2340junction plakoglobin 1.7 130717AA334274Ns.i8368DKFZP56480769 protein 1.7 124981N25485Hs.330310maternal G10 Uanscript1.7 124770AA984414Hs.120429ESTs 1.7 35 126926AA179472Hs.832ESTs, Highly similar 1.7 to A41029 integrin 101636BE392781Hs.89474ADP-ribosylation factor1.7 123553AI494291Hs.111977ESTs 1.7 127172AA292208Hs.251278KIAA1201 protein 1.7 130621AW513087Hs.16803LUC7 (S. cerevisiae)-like1.7 116925H73110Hs.260603ESTs, Moderately similar1.7 to A47582 B-ce 108845AW362901Hs.68864ESTs, Weakly similar 1.7 fo phosphalidylseri 128092AA904617Hs.166229ESTs 1.7 128193AJ224442Hs.155020putative methylUansferase1.7 113965AI268666Hs.19631ESTs, Weakly similar 1.7 to 138022 hypotheti 45 106620052562Hs.296317KIAA1789 protein 1.7 102926W28363Hs.239752nuclear receptor subfamily1.7 2, group F, m 114964BE085271Hs.8834~ng finger protein 1.7 101800NM-006433Hs.105806granulysin 1.7 130094NM_001471Hs.167017gamma-aminobutyric 1.7 acid (GABA) B recepto 120112AA180240Hs.6083Homo Sapiens cDNA: 1.7 FlJ21028 fis, clone C

109978H09356Hs.22528ESTs 1.7 121252AA393907Hs.97179ESTs 1.7 127768AW085002Hs.156187ESTs 1.7 125445AI452722Hs.7709WW domain binding protein1.7 55 100052 1.7 119863AA081218Hs.58608Homo Sapiens cDNA FLJ142061.7 fis, clone NT

134333AW888411Hs.81915leukemia-associated 1.7 phosphoprotein p18 ( 123541AW976511Hs.112592ESTs 1.7 134191W26632Hs.7979KIAA0736 gene product 1.7 103305X82279 gb:H.sapiens Fas, Apo-t1.7 gene (promoter a 112411843090Hs.271510ESTs, Moderately similar1.7 to ALU1 HUMAN A

100598AL121734Hs.146409cell division cycle 1.7 42 (GTP-binding prot 113610T93279 gb:ye25f01.s1 Stratagene1.7 lung (937210) H

105593AA279341Hs.174151aldehyde oxidase 1 1.7 65 125317299348Hs.i ESTs, Weakly similar 1.7 12461 to 138022 hypotheti 125956AK000214Hs.129014hypothetical protein 1.7 105105861532Hs.87016hypothetical protein 1.7 132791AB029551Hs.7910RlNG1 and YY1 binding 1.7 protein 116996H83935Hs.40535ESTs 1.7 133335BE251012Hs.263812nuclear distribution 1.7 gene C (A.nidulans) 120959BE247692Hs.102469putative nuclear protein1.7 105621AL040058Hs.6375uncharacterized hypothalamus1.7 protein HTO

106181AI803651Hs.191608ESTs 1.7 125661AA491830Hs.25689ESTs 1.7 75 127585AA604144Hs.190632ESTs 1.7 112035AI955289Hs.300759ribosomal protein L36 1.7 102870M64437Hs.234799breakpoint cluster 1.7 region 108039AA280319Hs.288840PR01575 protein 1.7 125898AK001823Hs.92287Homo Sapiens mRNA; 1.7 cDNA DKFZp564C2478 (f 114740N70103 gb:za53e10.s1 Soaresfetal1.7 liver spleen 120304AA192469Hs.271838ESTs 1.7 103433X98001Hs.78948Rab geranylgeranyltransferase,1.7 beta subu 116180AA463902Hs.13522ESTs, Weakly similar 1.7 to 138022 hypothet 105269AF174499Hs.6764histone deacetylase 1.7 125431AW851639Hs.75584polymyositislsclerodertna1.7 autoantigen 2 ( 133579X75346Hs.75074mitogen-activated protein1.7 kinase-activat 105355AL031447Hs.26938Homo Sapiens, clone 1.7 IMAGE:4053044, mRNA, 129601AB032964Hs.i15726KIAA1138protein 1.7 113739AA356599Hs.173904ESTs 1.7 100840U04816Hs.183418cell division cycle 1.7 2-like 1 (PITSLRE pr 122878AA847744Hs.99640ESTs 1.7 119495BE144608Hs.55533ESTs 1.7 1 125669851308Hs.333256ESTs, Weakly similar 1.7 O to ALUB-HUMAN ALU

109891H04757Hs.323176ESTs 1.7 126884U49436Hs.286236KIAA1856 protein 1.7 132977AA093322Hs.301404RNA binding motif protein1.7 101396BE267931Hs.78996proliferating cell nuclear1.7 antigen I 104730AW139789Hs.16370Homo Sapiens cDNA FLJ116521.7 S fis, clone HE

102205BE242291Hs.197540hypoxia-inducible factor1.7 1, alpha subuni 112945AW138458Hs.20787Homo Sapiens cDNA: FLJ216861.7 fis, clone C

129902AA076278Hs.13277hypotheticalprotein 1.7 107157AW853745Hs.286035hypothetical protein 1.7 ZO 133229AL737480Hs.6834KIAA10i4protein 1.7 129912AF155096Hs.107213hypothetical protein 1.7 119811AW137640Hs.231444Homo sapiens, Similar 1.7 to hypothetical pr 126323N77584Hs.68644Homo Sapiens microsomal1.7 signal peptidase 133134AF198620Hs.65648RNA binding motif protein1.7 115278AK002163Hs.301724hypothetical protein 1.7 133817AW578716Hs.7644H1 histone family, member1.7 130753AA205223Hs.189phosphodiesterase 4C, 1.7 CAMP-specific (dun 107463AW952022Hs.315164hypothetical protein 1.7 similar to actin re 121009NM-001533Hs.2730heterogeneous nuclear 1.7 obonucleoprotein 3O 125546H09950 gb:ym01d12.r1 Soares 1.7 infant brain 1N18 H

129991828386Hs.179925ESTs, Weakly similar 1.7 to ALUB HUMAN ALU

119015N95490Hs.29700hypotheticalprotein 1.7 100058 1.7 116655AF271732Hs.68090bodging integrator-3 1.7 3 119898893325Hs.58690ESTs 1.7 105021H07960Hs.306044CGI-OS protein 1.7 102098N25485Hs.330310maternal G10 transcript1.7 126730AA442429 gb:zv70g02.r1 Soares 1.7 total-fetus-Nb2HF8-113427T85105Hs.15471ESTs 1.7 122317T85253Hs.290874ESTs, Weakly similar 1.7 to ALUB_HUMAN ALU S

130503BE208491Hs.295112KIAA0618 gene product 1.7 117348N24157 gb:yx96b12.s1 5oares 1.7 melanocyte 2NbHM Ho 127033AF769301Hs.9098sulfate transporter 1.7 128554AW972147Hs.101395hypothetical protein 1.7 45 124733820547Hs.100830ESTs 1.7 106310898185Hs.17240ESTs 1.7 122638AL137476Hs.123609Homo Sapiens mRNA; cDNA1.7 DKFZp43410623 (f 101075L03532Hs.79024heterogeneous nuclear 1.7 ribonucleoprotein 126659T16245 gb:NIB1005R Normalized 1.7 infant brain, Ben 127717F12209Hs.173380CK2 interacting protein1.7 1; H00024c prote 105441N28522Hs.8935quinolinate phosphoobosyltransferase1.7 (n 104188AA478423Hs.300870Homo sapiens mRNA; cDNA1.7 DKFZp547M072 (fr 134750L29073Hs.1139cold shock domain protein1.7 A

106826BE253927Hs.24983hypothetical protein 1.7 from EUROIMAGE 2021 55 113511T89578Hs.189740ESTs 1.7 111070NM Hs.171834PCTAIRE protein kinase 1.7 129091AA056483Hs.301463Human Chromosome 16 1.7 BAC clone CIT987SK-A

129710AJ277841Hs.120963ELG protein 1.7 132833U78525Hs.57783eukaryotic translation 1.7 initiation factor 125775AW514585Hs.29205alpha integon binding 1.7 protein 63 113675T81034Hs.14841ESTs 1.7 100487AU076640Hs.15243nucleolar protein 1 1.7 (120kD) 119302T25725 gb:ESTDIR152CD34+DIRECTIONALHomosapie1.7 128245AA993101Hs.170486ESTs 1.7 65 130322NM Hs.154545PDZ domain containing 1.7 014247 guanine nucleotide 135363AW589601Hs.119Wilms' tumour 1-associating1.7 protein 125181840815Hs.12396ESTs, Weakly similar 1.7 to 2004399A chromos 132347BE271016Hs.169850ESTs, Weakly similar 1.7 to T21554 hypotheti 127206AW816490Hs.337508ESTs 1.7 7~ 121880AW946155Hs.7750hypothetical protein 1.7 125797H03117Hs.111497similar to mouse neuronal1.7 protein 15.6 114601AA075566 gb:zm88f06.s1 Stratagene1.7 ovarian cancer 126278AA417302Hs.63042DKFZp564J157 protein 1.7 120964AA398085Hs.142390ESTs 1.7 75 133634AL035071Hs.234279microtubule-associated 1.7 protein, RPIEB fa 107025AA825523Hs.21255ESTs, Weakly similar 1.7 to 138022 hypotheti 105638AA493453Hs.247817H2B histonefamily, memberA1.7 135398M16029Hs.287270ret proto-oncogene (multiple1.7 endocone 115794AA424900Hs.112227membrane-associated 1.7 nucleic acid binding 102063T35901Hs.75117interleukin enhancer 1.7 binding factor 2, 4 100188AW247090Hs.57101minichromosome maintenance1.7 deficient (S.

130868AB037855Hs.171917hypotheticalprotein 1.7 110493A1247707Hs.36915ESTs 1.7 115041AA252457Hs.86543ESTs, Moderately similar to T00256 hypot 1.7 128764AW024282Hs.104938hypothetical protein MGC15906 1.7 134065X78992Hs.78909butyrate responsefactor2(EGF-response 1.7 101082BE616731Hs.80645interferon regulatory factor 1 1.7 130945020582Hs.2i49acfin like protein 1.7 106974AI817130Hs.9195Homo Sapiens cDNA FLJ13698 fis, clone PL 1.7 126752A1073373Hs.326923EST, Weakly similar to 138022 hypothetic 1.7 133327AL390127Hs.7104Kruppel-like factor 13 1.7 127005T81309Hs.251664insulin-like growth factor 2 (somatomedi 1.7 1 105615AA281959Hs.5210glia maturation factor, gamma ~ 1.7 116295AA742596Hs.91216ESTs, Weakly similar to 2004399A
chromos 1.7 111587AI125867Hs.20734ESTs 1.7 104570AW978870Hs.131828ESTs 1.7 134752BE246762Hs.89499arachidonate 5-lipoxygenase 1.7 I 130430W27893Hs.150580putative Uanslalion inifiafion S factor 1.7 119244AW407564Hs.275865ribosomal protein S18 1.7 131152NM Hs.23598CREB binding protein (Rubinstein-Taybi 004380 s 1.7 133419BE242676Hs.73172growlhfactorindependentl 1.7 106542AA339541Hs.24956hypothetical protein FLJ22056 1.7 20 116482AW207000Hs.126857Homo Sapiens cDNA FLJ12936 fis, clone NT 1.7 132555AW500131Hs.171763CD22 anfigen 1.7 125840A8028986Hs.12064ubiquifin specific protease 22 1.7 115416AA283893Hs.337079ESTs 1.7 120041AA830882Hs.59368ESTs 1.7 126295A1281459Hs.270114ESTs 1.7 122528AA449804Hs.292154stromal cell protein 1.7 Table 28:
Pkey: Unique Eos probeset identifier number CAT number: Gene cluster number Accession: Genbank accession numbers Pkey CAT number Accession 115982 173_2 W92113 AA702794 BE044316 W91984 AA679375 T94184 AA679335 BE503t26 125499 1562851~1 H10543 811878 5 127303 258778 1 AA366951 AAd70999 AA469425 126872 142696_1 AW450979 AA136653 AA136656 AW419381 AA984358 AA492073 BE168945 (7~ BE011368 BE011362 BE011215 BE0i1365 BE011363 65 114620 32062_8 AA642974 AA084223 123636 genbank-AA609263 AA609263 100842 tigr_HT4398 005597 116548 genbanILD20433 D20433 7~ 123783 genbanILAA610112 AA610112 125032 genbank T74884 T74884 123808 genbanILAA620552 AA620552 102316 entrez_U34301 034301 102406 entrez 043177 043177 113119 genbank T47910 T47910 104799 genbank_AA029703 AA029703 120809 genbank-AA346495 AA346495 113610 genbank_T93279 T93279 113947 genbanILW84768 101045 enUez J05614 129969genbank 117031genbank-H88353 101447enUez M2i305 124540genbank-N63232 124554genbank-N65961 117348genbank_N24157 117357genbank 124677genbank_R01073 124694genbanILR06108 1 103138entrez_X65965 ~

103305entrez 103392entrez_X94563 103403entrez_X95406 119229genbank 1 119302_ genbank-T2572S

105225genbank_AA211777 121292genbank_AA401807 112853genbank-T02843T02843 20 121387genbank_AA405854 114601genbank-AA075566 100221entrez_D28383D28383 123197genbanILAA489250AA489250 25 123331genbank-AA497013 107794genbanILAA019255 100554figr-HT2241M95923 123423genbank_AA598484 123474genbank 0 genbank-AA160896 TABLE Leukemia (ALL) Compared 3A: to Normal Adult Hematopoiefic About Tissues Genes Up-regulated in Acute Lymphocytic Table leukemia (ALL) compared were selected 3A to normal adult hematopoieticfrom 35403 lists tissues. These probesets on about genes up-regulated in acute lymphocytic 35 the array such AffymetrixlEos that the Hu01 ratio of GeneChip "average' leukemia to "average"
normal adult hematopoietic tissues was greater than or equal to 3Ø The "average"

leukemia level was set to the 65"' percentile amongst various ALL
samples.
The "average"
normal adult hematopoietic tissue level was set to the 75'"
percentile amongst various non-malignant order to background levels of non-specificamongst the hematopoietic remove hybridization, the 10'" tissues was tissues. gene-specificperoenUle value subtracted In from both numerator ated.
the and the denominator before the ratio was evacu Pkey:Unique Eos probesel identifier number ExAccn:Exemplar Accession number, Genbank accession number UnigenelD: Unigene number UnigeneTitle: title Unigene gene R1: Rafio of leukemia to hematopoietic tissues 45 Pkey ExAccn UnigenelD UnigeneTitle R1 129498AA449789 Hs.75511 connective tissue growth 57.88 factor 100458S74019 Hs.247979 pre-B lymphocyte gene 1 49.45 133774X54079 Hs.76067 heat shock 27kD protein 48.42 102564U59423 Hs.79067 MAD (mothers against decapentaplegic,41.49 Dr So 130650AB040951 Hs.284208 DKFZP434N161 protein 35.88 132922AF249745 Hs.6066 Rho guanine nucleofide 35.74 exchangefactor 112254AA852097 Hs.25829 ras-related protein 33.26 106706AB037810 Hs.18760 KIAA1389 protein 32.39 101050AU077324 Hs.1832 neuropeptide Y 30.68 55 102455U48705 Hs.75562 discoidin domain receptor 26.81 family, member 101838BE243845 Hs.75511 connective tissue growth 25.46 factor 113374T79925 Hs.269i65 ESTs, Weakly similar to 24.69 134125NM_014781Hs.50421 KIAA0203 gene product 24.63 106943AW888222 Hs.9973 tensin 23.14 130069AI754813 Hs.146428 collagen, type V, alpha 23.06 119073BE245360 Hs.279477 ESTs 22.53 130444M12125 Hs.300772 tropomyosin 2(beta) 21.96 100420D86983 Hs.118893 Melanoma associated gene 21.05 114324AF084481 Hs.26077 Wolfram syndrome 1 (wolframin)18.95 65 101400M15990 Hs.i94148 v-yes-1 Yamaguchi sarcoma 18.46 viral oncogene 102759NM 005100Hs.788 A kise (PRKA) anchor protein17.88 (gravin) 100893BE245294 Hs.180789 Si64 protein 16.75 131689A8012124 Hs.30696 transcription factor-like 16.60 5 (basic helix 106410AB037787 Hs.26229 neuroligin 2 16.51 101304AA001021 Hs.6685 thyroid hormone receptor 15.60 interactor 8 131524A8040927 Hs.301804 KIAA1494 protein lS.Ot 107794AA019255 gb:ze56e10.s1 Soares yeti 14.78 N2b4HR Homo 129213Ai146494 Hs.109525 ESTs, Weakly similar to 14.76 116068AA328041 Hs.194329 hypothetical protein FLJ2117414.24 75 134416X68264 Hs.211579 melanoma cell adhesion 14.06 molecule 134545AI902899 Hs.85155 butyrate response factor 14.03 1 (EGF-response 114009AI248544 Hs.103000 KIAA0831 protein 13.93 115110AK001671 Hs.11387 KIAA1453 protein 13.75 130107AF112977 Ns.172887 phytanoyl-CoA hydroxylase 13.60 (Refsum diseas 8~ 133558X66945 Hs.748 fibroblast growth factor 13.60 receptor 1 (fms 100871T85231 Hs.179661 tubulin, beta 5 13.50 101462AL035668 Hs.73853 bone morphogenetic protein13.48 120809AA346495 gb:EST52657 Fetal heart 13.33 II Homo sapiens 123340AA504264 Hs.i82937 peptidytprotytisomeraseA(cyclophitin13.25 103460A1021993 Hs.14331 S100 calcium-binding 13.25 protein A13 102460048959 Hs.211582 myosin, light polypeptide13.14 kise 100168H73444 Hs.394 adrenomedullin 13 115844AI373062 Hs.332938 hypothetical protein .
MGC5370 13.00 130103Y13492 Hs.14909B smoothelin 12.92 (02407AW602154 Hs.82143 E74-like factor 2 (ets 12.03 domain transcript 113632T94907 Hs.188572 ESTs 11.85 118951NM 000448Hs.7395B recombition activating 11.73 gene 1 100305NM-004941Hs.171872 DEADIH (Asp-Glu-Ala-AspIHis)11.63 box polypep 109737AA055415 Hs.13233 ESTs, Moderately similar11.55 to A47582 B-cel 122577AA829725 Hs.334437 hypothetical protein 11.49 115147AA745781 Hs.38399 hypothetical protein 11.40 132303BE177330 Hs.325093 Homo sapiens cD: FLJ2121011.37 fis clone C

I 103176AL021154 Hs.76884 , 11.17 5 inhibitor of D binding 3, domint neg 108358M81933 Hs.1634 cell division cycle 11.15 104584AA704538 Hs.i93777 ESTs 11.12 106777AF037261 Hs.33787 vinexin beta (SH3-containing11.08 adapter mot 121054AW976570 Hs.97387 ESTs 10 119400T92767 gb:ye27dO6.s1 Stratagene.
lung (937210) H 10.83 126610AI911353 Hs.191391 ESTs 10.83 134555034879 Hs.85279 hydroxysteroid (17-beta)10.80 dehydrogese 1 131555T47364 Hs.278613 interferon, alpha-inducible10.79 protein 27 130979NM-012446Hs.169833 single-stranded-D-binding10.70 protein ~Jr113783AL359588 Hs.7041 hypothetical protein 10.65 DKFZp762B226 123503AW975051 Hs.293156 ESTs, Weakly similar 10.60 to 178885 serine/th 117031H88353 gb:yw21a02.s1 Morton 10.45 Feiai Cochlea Homo 100752T81309 Hs.251664 insulin-like growth 10.44 factor 2 (somatomedi 102618AL037672 Hs.81071 extracellular maUix 10.36 protein 1 30 113089T40707 Hs.270862 ESTs 10.33 132089W22007 Hs.39122 hypothetical protein 10.29 101663NM-003528Hs.2178 H2B histone family, 10.23 member 0 104876AI933f28 Ns.25220 tike-glycosyttransferase10.23 106370AF039B43 Hs.18676 sprouty (Drosophila) 10 homolog 2 18 3 129406A8018255 Hs.111138 KIAA0712 gene product .
5 10.18 115354AA281636 Hs.334827 ESTs 10.13 123077AA485229 Hs.105649 ESTs 10.05 131273AW206008 Hs.283378 Homo Sapiens cD: FLJ217789.95 fis, clone H

126177AW752782 Hs.129750 hypothetical protein 9.83 133699BE501689 Hs.75617 collagen, type IV, alpha9.80 110855AB007928 Hs.28169 KIAA0459 protein 9.65 111826835975 gb:yh91b07.s1 Soares 9.58 placenta Nb2HP Homo 126947240778 Hs.191837 ESTs 9.50 116674AI768015 Hs.92127 ESTs 9 45 129087AI348027 Hs.108557 hypothetical protein .
PP1057 9.46 114837BE244930 Hs.166895 ESTs 9.45 120009A1080491 Hs.93270 ESTs, Moderately similar9.45 to S65657 alpha 112483AW969785 Hs.285885 Homo Sapiens cD FLJ113219.40 fis, clone PL

103487AA743603 Hs.172108 nucleoparin 88kD 30 105675AL390083 Hs.271277 hypothetical protein .
from EUROIMAGE 3636 9.28 129158NM 004413Hs.109 dipeptidase 1 (rel) 9.23 114394T34462 Hs.103291 neuritin 9,17 133331Y1d487 Hs.738 ritwsomal protein L14 9.11 114787AA156509 Hs.231892 ESTs, Weakly similar 9 to S65657 alpha-1 G 10 55 125502AW977181 Hs.194718 zinc finger protein .
265 9.03 132325N37065 Hs.44856 hypothetical protein 9.01 127968AA83020f Hs.i24347 ESTs 9.00 114605AL157423 Hs.306478 Homo Sapiens m8; cD 8.93 DKFZp76100511 (f 114875AA235609 Hs.236443 Homo Sapiens m8; cD 8 DKFZp564N1063 (f 93 129898A1672731 Hs.13256 ESTs .
8.89 106263W21493 Hs.28329 hypothetical protein 8.89 117130AA748850 Hs.125830 bladdercanceroverexpressed8.88 protein 105553AA256756 Hs.31178 ESTs 8.85 103657273677 gb:H.sapiens gene encoding8.83 plakophilin 1 105831AA329449 Hs.247302 twisted gastrulation 8.82 106375AW872878 Hs.289072 hypothetical protein 8.80 114518AW163267 Hs.106469 suppresser of vari (S.cerevisiae)8.75 3-like 123433AW450922 Hs.112478 ESTs 8.67 134558NM 001773Hs.85289 CD34 antigen 67 115893AI652127 Hs.d8419 ESTs .
8.67 128621AA032197 Hs.102558 Homo Sapiens, clone 8.60 MGC:5352, m8, comp 122798AW366286 Hs.145696 splicing factor (CC1.3)8.58 112554871489 Hs.29196 EST 8.55 129969N57818 gb:yv59d07.s1 Soaresfetalliverspleen8.53 75 131558AA453208 Hs.28726 RAB9, member RAS oncogene8.45 family 134027297630 Hs.226117 Ht hisione family, member8.45 134138AB023169 Hs.7935 KIAA0952 protein 8.43 120030A1076355 Hs.58694 ESTs 6.43 101005NM 005239Hs.85146 v-ets avian erythroblastosis8.33 virus E26 0 115423AI499516 Hs.89303 ESTs 8.33 104946AW242407 Hs.73848 caroinoembryonic an&gen-related8.30 cell ad 131965W79283 Hs.35962 ESTs 8.30 126426AA125984 gb:zn27h06.r1 Slratagene8.28 neuroepithelium 108886AW248434 Hs.91521 hypothetical protein 8,26 107985T40064 Hs.71968 Homo sapiens m8; cD DKFZp564F0538.25 (fr 114239AL137667 Hs.267445Homo sapiens m8; cD DKFZpd34B2318.23 (fr 124281AI333756 Hs.111801arsete resistance protein8.23 7099 H93699 gb:yvt6a11.s1Soaresfetalliverspleen8.20 119432AL120247 Hs.40109 KIAA0872 protein 8,15 115967A1745379 Hs.42911 ESTs 8,15 132355D87942 Hs.46328 fucosylUansferase 2 (secrotor8.13 status in 108339AW151340 Hs.51615 ESTs, Weakly similar to 8.10 ALU7_HUMAN ALU S

131694NM_0002d6Hs.3076 MHCclass II fransactivator8.05 104897N33937 Hs.10336 ESTs 8.03 120266A1807264 Hs.205442ESTs, Weakly similar to 8.03 T34036 hypotheti 130404A1672727 Hs.76753 endoglin (Osier-Rendu-Webersyndrome8.00 1) 115729AA417812 Hs.38775 ESTs 8.00 2 A1798703 Hs.143702ESTs, Weakly similar to 7.95 S70029 probable 131693AW963776 Hs.110796SARI protein 7,83 113107AI821027 Hs.8429 ESTs 7,8D

122282BE246331 Hs.98401 Homo sapiens m8 full lengfh7.90 inserf cDN

111040AI435502 Hs.14931 ESTs 7,80 1 A1022103 Hs.12d511ESTs 7,8p 125317299348 Hs.112461ESTs, Weakly similar to 7,88 138022 hypoiheti 105242AI564857 Hs.27888 ESTs, Weakly similar to 7.75 serinefthreonine t00421D86985 Hs.79276 KIAA0232 gene product 7,71 114359NM 016929Hs.283021chloddeinfracellularchannel57.70 772 AJ250839 Hs.582d1 gene for serinelthreonine7.70 protein lose 124040023752 Hs.32964 SRY (sex determining region7.65 Y)-box 1 t 134361BE549343 Hs.82208 acyf-Coenzyme A dehydrogese,7.57 very long 105476AL117352 Hs.i20828Human D sequence from 7.55 clone RP5-876810 113289T66900 Hs.188446ESTs 7.50 707 NM 002039Hs.239706GRB2-associated binding 7.50 protein 1 130055AI566248 Ns.146355v-abl Abelson murine leukemia7.49 viral onco 108766AF145713 Hs.61490 schwannomin-interacting 7.45 protein 1 107957236842 Hs.57548 ESTs 7.45 123116AW190412 Hs.183738FERM, RhoGEF (ARHGEF) 7.38 3J~123190 and pleckstrin dom AA489212 Ns.105228EST 7.38 129574AA026815 Hs.i 1463UMP-CMP kise 7.38 115274C01566 Hs.86671 ESTs 7.35 102571060115 Hs.239069four and a half LIM domains7,34 116845AA649530 gb:ns44f05.s1 NCI CGAP_Alvi7.33 Homosapiens 134851AB011124 Hs.90232 KIAA0552 gene product 7.33 1D1780M82882 Hs.154365E74-like factor 1 (ets 7.28 domain franscript 125042T78906 Hs.269432ESTs, Moderately similar 7.28 to ALU1 HUMAN A

118472AL157545 Hs.42179 bromodomain and PHD finger7.25 containing, 3 108700AA121518 Hs. t EBTs, Moderately similar 7.23 109 9354D to 2109260A 8 0 411 898881 Hs.109655sex comb on midleg (Drosophila)-like7.20 127692A10219t2 Hs.187983EBTs 7.18 128501AL133572 Hs.199009protein containing CXXC 7.18 domain 2 107727AA149707 Hs.173091ubiquitin-like 3 7,14 118D89AI762507 Hs.d7878 ESTs 7,12 106025AV653785 Hs.173334ELL-RELATED R POLYMERASE 7.10 II, ELONGATIO

1221 AW593206 Hs.98785 Ksp37 protein 7.08 t 119674W60379 Hs.57773 EBTs 7.05 126607W87425 Hs.114688ESTs 7.05 121545AA4124d2 Hs.98132 ESTs 7.05 287 T66847 Hs.194040ESTs, Weakly similar to 7.03 138022 hypotheti 126672AA255592 Hs.203631EBTs, Weakly similar to 7.00 altertively sp 132087H14d86 Hs.3903 Cdc42 effector protein 6,87 4; binder of Rho 118697N22706 Hs.43234 EBTs 8,g7 100295M74782 Hs.172689interleukin 3 receptor, 6.95 101 alpha (low affin 188 L20320 Hs.184298cyclin-dependent kise 6.95 7 (homolog of Xe 121481AA41193i gb:zu03g05.s1 Soares_testis-NHT6.95 Homo sap 113003AW292315 Hs.7215 ESTs 6.93 101851BE260964 Hs.82045 midkine (neurile growth-promoting6.91 factor 113529AI190741 Ns.t77415Finkel-Biskis-Reillymurinesarcomaviru6.90 887 AA195831 Hs.273385guanine nucleotide binding6.90 protein (G pr 113560T91015 Hs.268626ESTs 6.85 123440A1733692 Hs.112488ESTs 6.83 130390AAd90770 Hs.182382ESTs 6.83 133889048959 Hs.211582myosin, light polypeptide6.83 kise 113573889379 Hs.15990 ESTs 6.80 112453863899 Hs.28455 ESTs 8,7g 125221AA236115 Ns.120785ESTs 6.78 134081AL034349 Hs.79005 protein tyrosine phosphatase,6.77 receptor f 127610AA960867 Hs.150271ESTs, Highly similar fo 8.75 1 unmed protein 05486AW449258 Hs.6187 ESTs 6,75 107796AA058848 Hs.60797 ESTs 8,71 132754A1752244 Hs.75309 eukaryolic translation 6.71 elongation factor 105806AF206019 Hs.110347REVi (yeasthomolog)-like 6.70 110837H03109 Hs.108920HT018 protein 6.65 g0 117698N62293 Hs.45107 ESTs 6.65 128994AF205849 Hs.107740Kruppel-like factor 2 6.65 (lung) 129131AB026436 Hs.177534dual specificity phosphatase6.65 108528AA650558 Hs.325202ESTs, Highly similar to 6.62 GRAS-HUMAN GUANI

131009AF169802Hs.22142 cytochrome b5reductase 6.61 b58.2 129389NM 012445Hs.288126 spondin 2, extracellular6.60 matrix protein 125278AI218439Hs.129998 enhancerofpolycomb 1 6.59 124667W24320 Hs.102941 Homo Sapiens cD: FLJ215316.59 fis, clone C

105640AA001021Hs.6685 thyroid hormone receptor6.58 inieractor 8 106474BE383668Hs.42484 hypothefical protein 6.58 105808AI133161Hs.286131 CGI-101 protein 6.53 120087AF186780Hs.79219 RaIGDS-like gene; KIAA09596.52 protein 100514AU076887Hs.28491 spermidinelspermine N1-acetyllransferase6.50 108378A1368460Hs.74615 platelet-derived growth 6.50 factor receptor, 133350AI499220Hs.71573 hypothefical protein 6.50 115673AA406341Hs.269908 Homo Sapiens cD FLJ119916.48 fis, clone HE

133410Y07847 Hs.73088 RAS-related on chromsome6.48 131281AA251716Hs.25227 ESTs 6.46 105510242047 Hs.283978 Homo Sapiens PR02751 6.45 m8, complete cds 128766AW160432Hs.296460 craniofacial development6.45 protein 1 114530AA601038Hs.191797 ESTs, Weakly similar 6.43 to S65657 alpha-1 G

120120BE547267Hs.59791 hypothetical protein 6.40 120593AA748355Hs.193522 ESTs 6.40 125832AA628600Hs.117587 ESTs 6.38 129637NM 004606Hs.1179 TATA box binding protein6.38 (TBP)-associate 115302AL109719Hs.47578 ESTs 6.33 126137AA312594Hs.99115 hypothetical protein 6.30 114465BE621056Hs.131731 hypothetical protein 6.29 125562AI494372Hs.98968 hypotheficalprotein FLJ230586.29 127380AF070554Hs.15535 Homo Sapiens clone 245826.26 m8 sequence 106956806428 Hs.226351 ESTs 6.25 105962AW880358Hs.339808 hypothetical protein 6.25 109416BE268388Hs.86945 ESTs, Weakly similar . 6.23 to A46010 X-linked 3 111116AK002039Hs.26243 Homo Sapiens cD FLJ111776.23 0 fis, clone PL

127282AA347158Hs.185780 ESTs 6.23 113074AK001335Hs.31137 proteintyrosine phosphatase,receptort6.21 101664AA436989Hs.121017 H2Ahistonefamily,memberA6.20 103317X83441 Hs.166091 IigaselV, D,ATP-dependent6.20 133894AW021236Hs.180433 rTS beta protein 6.19 109260AW978515Hs.131915 KIAA0863 protein 6.18 112772AI992283Hs.35437 ESTs, Moderately similar6.18 to 138026 MLN 6 132050AI267615Hs.38022 ESTs 6.18 113009723699 Hs.7246 ESTs 6.17 118835AA535246Hs.50852 ESTs 6.16 125626A1038854Hs.180789 S164 protein 6.15 117086AA581602Hs.41840 ESTs 6.14 101960AL036287Hs.194662 calponin 3, acidic 6.13 104488N56191 Hs.106511 protocadhedn 17 6.13 127695AA714731Hs.291457 ESTs, Weakly similar 6.13 to heterogeneous r1 127894AL121053Hs.5534 Homo Sapiens cD FLJ129616.13 fis, clone NT

113595792056 Hs.290240 ESTs, Moderately similar6.10 to ALU2_HUMAN A

120784AW752101Hs.16580 hypothetical protein 6.10 115004AA329340Hs.4867 mannosyl (alpha-1,3-)-glycoprotein6.08 beta-129740BE165866Hs.83623 nuclear receptor subfamily6.05 1, group I, m 117483N72185 Hs.44189 ESTs 6.04 103815BE245294Hs.180789 S164 protein 6.03 122040AA847758Hs.111030 ESTs 6.03 109638AW977747Hs.119120 E3 ubiquifin ligase SMURFt6.02 SS 112727791029 Hs.15069 ESTs 6.01 120273AA176688Hs.269284 ESTs 6.00 122127AW207175Hs.106771 ESTs 6.00 126046AA804957Hs.119840 ESTs 5.99 119774A8032977Hs.6298 KIAA1151 protein 5.98 106265AA412176Hs.236463 Homo Sapiens m8; cD DKFZp586105215.98 (f 111987NM 015310Hs.6763 KIAA0942 protein 5.98 123619AA602964 gb:no97c02.s1 NCI-CGAP_Pr25.96 Homo Sapiens 128122AI267491Hs.160593 ESTs 5.95 128473778277 Hs.100293 0-linked N-acetylglucosamine5.95 (Glcc) tr 102283AWi61552Hs.83381 guanine nucleotide binding5.94 protein 11 122468AA448172Hs.137687 ESTs, Highly similar 5.93 to K6B1 HUMAN RIBOS

101801M86407 Hs.1216 actinin, alpha 3 5.93 107059BE614410Hs.23044 RAD51 (S. cerevisiae) 5.92 homolog (E colt Re 108908AA136569Hs.10848 KIAA0187 gene product 5.90 121470AA558958Hs.324751 ESTs 5.90 131938AF176085Hs.34956 neural polypyrimidine 5.89 tract binding prot 109613H47315 Hs.27519 ESTs 5.89 109384AA219172Hs.86849 ESTs 5.88 118559N68456 Hs.49519 ESTs 5.88 102010002687 Hs.385 fms-related tyrosine 5.86 kise 3 105921AA421973Hs.169119 ESTs, Weakly similar 5.85 to 725731 hypotheti 124298H91679 gb:yv04a07.s1 Soares 5.85 fetal liver spleen 120827AA382525Hs.132967 Human EST clone 122887 5.84 mariner transposo 103331AI825463Hs.147996 protein kise, X-linked 5.82 g0 135052AL136653Hs.93675 decidual protein induced5.80 by progesterone 115219AA262776Hs.269314 Homo Sapiens cD FLJ141235.78 fis, done MA

121899855341 Hs.50421 KIAA0203 gene product 5.78 135217AA453880Hs.9658 hypothetical protein 5.77 123973C14805 gb:C14805 Clontech human5.77 aorta polyA+mR

112605879374 Hs.29852 ESTs 5.76 110151H18835 Hs.31608 hypothetical protein 5.75 129889AA810932 Hs.131899 ESTs, Weakly similar 5.75 to T00370 hypotheti 102638U67319 Hs.9216 caspase 7, apoplosis-related5.73 cysteine pr 121501AA470687 Hs.104772 ESTs 5.73 124921893082 Hs.332635 ESTs 5.70 109850AI150548 Hs.23155 ESTs 5.70 120594AW136478 Hs.509d ring finger protein 5.70 1 126433AA325606 gb:EST28707 Cerebellum 5.70 ~ II Homo Sapiens c 100455AW888941 Hs.75789 N-mycdownstreamregulated5.69 106565NM_014892Hs.227602 KIAAi116protein 5.68 120912AA376690 Hs.167650 ESTs 5.68 127209AA305023 Hs.81964 SEC24 (S. cerevisiae) 5.68 related gene Tamil I 107606AF207989 Hs.330425 Homo Sapiens, Similar 5.67 S to G protein-coupl 106597A1091277 Hs.302634 fizzled (Drosophila) 5.66 homolog 8 102126AW950870 Hs.78961 protein phosphatase 5.65 1, regulatory (inhib 100064 AFFXcontrol-TrpnX-3 5.63 108758AA127395 Hs.222414 ESTs 5.63 20 101392NM 002507Hs.1827 nerve growth factor 5.61 receptor (TNFR super 102211BE314524 Hs.78776 putative transmembrane 5.60 protein 107427W26975 Hs.46736 hypothetical protein 5.60 135175M91463 Hs.95958 solute carrier family 5.60 2 (facilitated glu 111764A1420368 Hs.290259 ESTs, Weakly similar 5.58 to 138022 hypotheti 25 119405793865 Hs.91085 ESTs 5.58 126464A1990046 Hs.54780 transcription tertnition5.58 factor, R po 133865AB011155 Hs.170290 discs, large (Drosophila)5.50 homolog 5 123255AA830335 Hs.105273 ESTs 5.57 122861AA335721 Hs.119394 ESTs 5.56 112046AA383343 Hs.22116 CDC14 (cell division 5.55 cycle 14, S. cerevi 132906BE613337 Hs.234896 geminin 5.55 109001A1056548 Hs.72116 hypothetical protein 5.55 FLJ20992 similar to 115816BE042915 Hs.287588 Homo Sapiens cD FLJ136755.55 fis, clone PL

128401801865 Hs.268586 ESTs 5.53 35 129296A1051967 Hs.110122 ESTs 5.53 120314T10013 Hs.221040 HBS1 (S. cerevisiae)-like5.51 132815AI815189 Hs.57475 sex comb on midleg homolog5.50 113983W87415 Hs.55296 HLA-B associated transcript-15.50 105002AA224244 Hs.182704 ESTs, Moderately similar5.49 ~ to altertivel 40 132025AA011117 Hs.3745 milk fat globule-EGF 5.49 factor 8 protein 110732AW070838 Hs.174174 KIAA0601 protein 5.48 112891T03927 Hs.293147 ESTs, Moderately similar5.48 to A46010 X-tin 126758AI559444 Hs.293960 ESTs 5.48 129426AF077953 Hs.111323 Protein inhibitor of 5.47 activated STAT X

45 103217NM 001841Hs.73037 canbinoid receptor 2 5.46 (macrophage) 132261U80743 Hs.306094 irinucleotide repeat 5.45 containing 12 105586AA865118 Hs.191538 ESTs 5.43 109454AA232255 Hs.295232 ESTs, Moderately similar5.43 to A46010 X-tin 113063W15573 Hs.5027 ESTs, Weakly similar 5.43 to A47582 8-cell gr 134092AA218558 Ns.7905 sorting nexin 9 5.41 119316A1114630 Hs.208334 Homo Sapiens cD: FLJ218745.38 fis, clone H

108019A1017773 Hs.249159 adrenergic, alpha-2A-, 5.38 receptor 109421AW604652 Hs.332442 ESTs 5.38 111929AF027208 Hs.112360 prominin (mouse)-like 5.38 55 119718W69216 Hs.92848 ESTs 5.38 106154BE540255 Hs.6994 Homo Sapiens cD: FLJ220445.35 fis, clone H

108544W39433 Hs.23971 hypothetical protein 5.35 DKFZp547N043 119580AL079310 Hs.92260 high-mobility group 5.35 protein 2-like 1 126777AL157491 Hs.145211 Homo Sapiens m8; cD 5.35 DKFZp434K1111 (f 112944H18063 Hs.i3254 ESTs 5.34 103149NM 006201Hs.171834 PCTAIRE protein kise 5.34 132437AA152106 Hs.4859 cyclin L ania-6a 5.33 103860AW976877 Hs.38057 ESTs 5.33 104865T79340 Hs.22575 B-cell CLUlymphoma 6, 5.33 member 8 (zinc ft 65 129914NM 012421Hs.13321 rearranged L-myc fusion5.33 sequence 130309AF067804 Ns.15423 hypothetical protein 5.31 116312BE379794 Hs.65403 hypothetical protein 5.30 124191T96509 Hs.248543 ESTs, Moderately similar5.28 to S65657 alpha 125583AA195667 Hs.86022 ESTs 5.28 130591N59646 Hs.i69745 crumbs (Drosophila)homolog5.28 116355AA789133 Hs.88650 ESTs 5.26 115553AJ275986 Hs.71414 transcription factor 5.26 (SMIF gene) 122802AI687303 Hs.285529 G protein-ccupled receptor495.25 128495NM_005904Hs,fOQ602 MAD(mothersagainstdecapentaplegic,Dr5.24 117667U59305 Hs,44708 Ser-Thr protein kise 5.23 related to the my 127890AA294934 Hs.293902 ESTs, Weakly similar 5.22 to ISHUSS protein d 134843AA428520 Hs.90061 progesterone binding 5.21 protein 120968AA528283 Hs.292737 ESTs 5.21 102076BE299197 Hs.179665 cyclin-dependent lose 5.20 inhibitor 1A (p2 100934J03019 Hs.99913 adrenergic, beta-1-,receptor5.20 112667BE538516 Hs.15423 hypothetical protein 5.20 119304AW249266 Hs.98493 X-ray repair complementing5.20 defective rep 131868AW408296 Hs.33532 zinc finger protein 5.20 151 (pHZ-67) 105914AW245680Hs.9701 growth arrest and D-damage-inducible,5.18 102258NM 001546Hs.34853 inhibitor of D binding 5.18 4, domint neg 103850AA187101Hs.213194 hypothetical protein 5.18 112516T83909 gb:yd67f10.r1 Snares 5.18 fetal liver spleen 133640AW246428Hs.75355 ubiquiGn-conjugating 5.18 enzyme E2N (homolo 135180D90070 Hs.96 phorbol-12-myristate-13-acetate-induced5.18 135309AI564123Hs.42500 ADP-ribosylation factor-like5.18 134801S76825 Hs.89695 insulin receptor 5.17 133362AK001519Hs.719d CGI-74 protein 5.17 135206AB024703Hs.96334 ring finger protein 11 5.15 111480806453 Hs.19706 ESTs 5.15 118466N66741 gb:yz33g08.s1 Morton 5.15 Fetal Cochlea Homo 125757AI274906Hs.166835 ESTs, Highly similar 5.15 to 1814460A p53-ass 127140AI273507Hs.303966 ESTs 5.15 1 109223AW000714Hs.65818 ESTs 5.14 103656273497 Hs.247802 Human D sequence from 5.14 clone U240C2 on 133388AW245631Hs.182447 heterogeneous nuclear 5.12 ribonucleoprotein 100511M76676 Hs.116840 ESTs 5.10 101941S77583 gb:HERVK101HUMMTV reverse5.10 hanscriptase 109937A1084066Hs.20072 myosin regulatory light 5.10 chain interactin 122996AI4362i6Hs.191715 ESTs, Weakly similar 5.10 to ZN91 HUMAN ZINC

128242AA992626Hs.269755 ESTs, Moderately similar5.10 to ALU5_HUMAN A

112374NM 016323Hs.26663 cyclin-E binding protein5.10 1245068E273688Hs.182447 heterogeneous nuclear 5.10 ribonucleoprolein 104216AB002313Hs.3989 plexin 82 5.09 135051AI272141Hs.83484 SRY (sex determining 5.08 region Y)-box 4 131629245794 Hs.238809 ESTs 5.08 111722823924 Hs.23596 EST 5.07 107034AF257770Hs.20930 poly(rC)-binding protein5.06 110243H26683 gb:y114g03.s1 Snares 5.05 breast 2NbHBst Homo 125837AW968123Hs.333513 small inducible cylokine5.05 subfamily E, me 130300X58288 Hs.154151 protein tyrosine phosphatase,5.05 receptor t 103967AL120051Hs.14d700 ephrin-B1 5.04 112678A1418466Hs.33665 ESTs 5.03 3 124963F06600 Hs.101375 Homo Sapiens m8; cD DKFZp434H2055.03 5 (fr 131379AK001123Hs.26176 hypothetical protein 5.03 109451N32264 Hs.44330 ESTs 5.02 101396BE267931Hs.78996 proliferating cell nuclear5.02 antigen 131038W87778 Hs.169388 hypothetical protein 5.01 DKFZp761H2024 101208L25081 Hs.179735 ras homolog gene family,5.01 member C

104973NM 015310Hs.6763 KIAA0942 protein 4.99 103141X66113 Hs.75584 polymyosi6slscleroderma 4.96 autoantigen 2 ( 111260AB033035Hs.51965 KIAA1209 protein 4.98 128142T67162 Hs.135127 ESTs, Weakly similar 4.98 to unmed protein 113857AW243i58Hs.5297 DKFZP564A2416 protein 4.96 105292AF128542Hs.166846 polymerase (D directed),4.96 epsilon 114341AF270491Hs.28249 hepatocellularcarcinoma-associated4.95 anti 100615W32474 Hs.301746 RAP2A, member of RAS 4.95 oncogene family 103208AW411340Hs.31314 retinoblastoma-binding 4.95 protein 7 121121AA399371Hs.189095 similar to SALLt (sat 4.95 (Drosophila)-like 125321T86652 Hs.178294 ESTs 4.95 101145L13210 Hs.79339 lectin, galactoside-binding,4.95 soluble, 3 100551M73980 Hs.129053 Homo Sapiens NOTCH 1 4.93 (N1) m8, complete 126182AA721331Hs.293771 ESTs 4.93 127925AA805151Hs.3628 mitogen-activated protein4.93 kise kise 133969AA669112Hs.78 GA-binding protein transcription4.93 factor, 120873AA358015 gb:EST66864 Fetal lung 4.92 III Homo Sapiens 125219AI804331Hs.99423 ATP-dependent R helicase4.91 102790BE245277Hs.154196 E4Ftranscriptionfactorl 4.90 129486NM 005754Hs.220689 Ras-GTPase-activating 4.90 protein SH3-domain 130381L47345 Hs.155202 transcription elongation4.89 factor B (SIII) 132389AA310393Hs.190044 ESTs 4.88 100260D38491 Hs.322478 KIAA0117 protein 4.88 109585N59650 Hs.27252 ESTs 4.88 111603811529 Hs.20634 EST 4.88 120514AA258335 gb:zr59b02.s1 Snares 4.88 NhHMPu-S1 Homo sapi 130314NM 014674Hs.154332 KIAA0212 gene product 4.86 108958AF142482Hs.203846 TEA domain family member4.86 126603W86610 Hs.185736 ESTs 4.85 100406A1962060Hs.118397 AE-binding protein 1 4.85 116238AV660717Hs.47144 DKFZP586N0819 protein 4.84 105288N99673 Hs.3585 ESTs, Weakly similar 4.83 to AF1267431 DJ

118753AA346206Hs.50471 ESTs, Weakly similar d.82 to T14267 Xin prote 113070A8032977Hs.6298 KIAA1151 protein 4.81 107908AF087999Hs.42826 ESTs d.80 119678A1658666Hs.6106 R binding motif protein 4.80 100415D86970 Hs.75822 TGFB1-induced anti-apoptotic4.79 factor 1 128360F12374 gb:HSC39B101 normalized 4.78 infant brain cDN

133101AK000299Hs.180952 dyctin d (p62) 4.78 g0 103507AJ000512Hs.296323 serom/glucocorticoid 4.78 regulated kise 107666AA010611Hs.60418 EST 4.78 108030AI378523Hs.62011 ESTs 4.78 131479D86181 Hs.273 galactosylceramidase 4.78 (Krabbe disease) 133140AF1806B1Hs.6582 Rho guanine exchange 4.78 factor(GEF)12 134654AK001741Hs.8739 hypothetical protein 4.78 106288AB037742Hs.24336 KIAA1321 protein 4.76 101524NM 000448Hs.73958 recombition activating 4.75 gene 1 113095AA828380Hs.126733 ESTs 4.75 114924A1338053Hs.87329 HSPC072 protein 4.75 127543AK000787Hs.157392 Homo Sapiens cD FLJ207804.75 fis, clone CO

115866AW062629Hs.52081 KIAA0867 protein ~ 4.75 101382AU076772Hs.1279 complement component 4.74 1, r subcomponent 1 126509847400 Hs.23850 ESTs 4.74 127930AA809672Hs.123304 ESTs 4.73 127824A1911516Hs.127811 ESTs 4.73 110049H12449 Hs.31159 EST, Weakly similar to 4.73 ALUB-HUMAN !!!! A

127115H77859 Hs.65450 reticulon 4 4.73 15 104727N81203 Hs.20047 zinc finger protein, 4.72 subfamily 2A (FYVE

127532AJ003429 gb:AJ003429 Selected 4.71 chromosome 21 cD

127304AI741577Hs.99962 proteoglycan 2, bone 4.70 marrow (lure) kit 105409AW505076Hs.301855 DiGeorge syndrome critical4.70 region gene 8 114969AWi62998Hs.24684 KIAA1376 protein 4.70 20 115125AA193588Hs.85888 ESTs 4.70 118348AW408586Hs.91052 ESTs, Moderately similar4.70 to ALUS-HUMAN A

123130AA487200 gb:ab19f02.s1 Stratagene4.70 lung (937210) H

130881AA809875Hs.25933 ESTs 4.70 132074AA478486Hs.3852 KIAA0368 protein 4.70 25 106897AF039023Hs.167496 RAN binding protein 6 4.69 131121AA720865Hs.23136 ESTs 4.69 116046BE395293Hs.94491 hypothetical protein 4.68 112868AW388359Hs.10667 ESTs 4.68 116877AA708958Hs.168732 ESTs . 4.68 30 131241BE501914Hs.24654 Homo Sapiens cD FLJ116404.68 fis, clone HE

132027AF151020Hs.181444 hypothetical protein 4.68 133323BE336654Hs.70937 H3histonefamily,memberA 4.68 114269AA176769Hs.23450 mitochondria) ribosomal 4.67 protein S25 122713A1089443Hs.99436 ESTs 4.67 35 133571BE515037Hs.177556 melanoma antigen, family4.66 D,1 134453A1272141Hs.83484 SRY (sex determining 4.66 region Y)-box 4 115510BE299339Hs.72249 three-PDZcontaining protein4.66 similar to 115322L08895 Hs.78995 MADS boxtranscription 4.66 enhancerfactor2 129315NM 014563Hs.174038 spondyloepiphyseal dysplasia,4.65 late 40 104674AI935962Hs.26289 ESTs 4.65 106276AA625947Hs.25750 ESTs 4.65 108216AA524743Hs.44883 ESTs 4.65 120376AA227469 gb:zr18a07.s1 Stratagene4.65 NT2 neurol pr 121743AA397636 gb:zt79e09.r1 Soares 4.65 testis NHT Homo sap 45 128011AI347067Hs.124636 - 4.65 ESTs 123454AA868510Hs.112496 ESTs 4.64 103409NM_004454Hs.43697 ets variant gene 5 (ets-related4.64 molecule 120484AA253170Hs.96473 EST 4.63 127046AA321948Hs.293968 ESTs 4.63 50 133164AA001021Hs.6685 thyroid hormone receptor4.63 interactor 8 123184BE247767Hs.18166 KIAA0870 protein 4.62 106627AK000706Hs.15125 hypothetical protein 4.61 115475AB033085Hs.40193 hypothetical protein 4.61 119468AI911535Hs.6657 hypothetical protein 4.59 bK1048E9.5 55 133662BE409053Hs.299629 peroxisomal long-chain 4.58 acyl-coA thioeste 113941AA531016Hs.22399 hypothetical protein 4.58 131590846277 Hs.250638 Homo Sapiens m8 full 4.58 length insert cDN

128795AA531287Hs.105805 ESTs 4.58 116480C14088 Hs.169476 glyceraldehyde-3-phosphate4.58 dehydrogese 60 111713C75253 Hs.220950 ESTs 4.58 113721AF143885Hs.18190 EST 4.57 111657807364 Hs.268667 ESTs, Weakly similar 4.56 to ALU1 HUMAN ALU S

102009BE245149Hs.82643 protein tyrosine kise 4.55 135242AI583187Hs.9700 cyclin E1 4.55 65 127580BE548749Hs.148016 ESTs 4.55 109785A8011131Hs.12376 piccolo (presyptic cytomatrix4.53 protein) 109700F09609 gb:HSC33H092 normalized 4.53 infant brain cDN

124882AI698652Hs.10i539 ESTs 4.53 131765AW381270Hs.194110 hypothetical protein 4.53 70 115684NM_006577Hs.284284 ESTs, Highly similar 4.52 to beta-1,3-N-acety 102034AI903474Hs.230 fibromodulin 4.52 109776843665 Hs.12257 ESTs 4.50 1 1 816722 Hs.124246 ESTs 4.50 132993A8023154Hs.62264 KIAA0937 protein 4.49 75 129017AA115333Hs.107968 ESTs 4.49 132902A1936442Hs.59838 hypothetical protein 4.48 114814AB006622Hs.182536 KIAA0284 protein 4.48 120839AA348913 gb:EST554421ntant adrel 4.48 gland II Homo 101434AV650066Hs.1430 coagulation factor XI 4.48 (plasma thrombopla g0 102018003398 Hs.1524 tumor necrosis factor 4.48 (ligand) superfami 104619AA001635Hs.287414 transcriptiol intermediary4.48 factor 1 ga 106716AA931198Hs.238928 HT002 protein; hypertension-related4.48 calc 126020H79863 Ns.114243 ESTs 4.48 119899A1057404Hs.58698 ESTs 4.47 115582AW245047Hs.136164 cutaneous T-cell lymphoma-associated4.46 tum 125695W22529 Hs.30942 ephrin-82 4.46 105715BE621800Hs.29444 putative small membrane 4.45 protein NID67 117169887866 Hs.95120 ESTs, Weakly similar to 4.45 HZHU hemoglobin , 102757AW955454Hs.30942 ephdn-82 4.45 120637AA811804 gb:ob39a05.s1 NCI-CGAP-GCB14.45 Homo Sapiens 131579N62922 Hs.290B8 ESTs 4.45 135287082670 Hs.9786 zinc finger protein 275 4.45 112540869751 gb:yi40at0.s1 Soares placenta4.45 Nb2HP Homo 125724AL360190Hs.295978 Homo Sapiens m8 full length4.44 insert cDN

115498AA291070 gb:zs46a08.s1 NCI CGAP 4.43 GCB1 Homo Sapiens 102263029171 Hs.75852 casein kise 1, delta 4.43 124312H94647 Hs.102329 ESTs 4.43 112366AF035318Hs.12533 Homo Sapiens clone 23705 4.43 m8 sequence 115955AF263613Hs.44198 inUacellularmembrane-associatedcalciu4.43 103562NM 002702Hs.2815 POU domain, class 6, transcdpfion4.42 facto 100169AL037228Hs.82043 D123 gene product 4.40 108928AA143802Hs.71781 ESTs 4.40 125908AF265555Hs.250646 baculoviral IAP repeat-containing4.40 126996BE161065Hs.167531 methylcrotonoyl-Coenzyme 4.40 A carboxylase 2 129512T88B45 Hs.112200 ESTs, Weakly similar to d.40 134570066615 Hs.172280 SWIISNF related, matrix 4.d0 associated, acfi 135073W55956 Hs.94030 Homo Sapiens m8; cD DKFZp586E16244.40 (f 105011BE091926Hs.16244 mitofic spindle coiled-coil4.40 related prot 128793AB011125Hs.105749 KIAA0553 protein 4.40 107292BE166479Hs.4789 Homo sapiens serologically4.38 defined breas 126144H84455 Hs.40639 ESTs 4.38 130783X07282 Hs.171495 retinoic acid receptor, 4.3B
beta 30 135192083993 Hs.321709 purinergic receptor P2X, 4.38 ligand-gated 1o 100284D43767 Hs.66742 small inducible cytokine 4.37 subfamily A (Cy 117269N2i621 Hs.91142 KH-type splicing regulatory4.36 protein (FUS

104261AW248364Hs.5409 R polymerase I subunit 4.35 108609BE409857Hs.69499 hypotheficalprotein d.35 35 126319D81689 gb:HUM184E05B Human fetal4.35 brain (TFujiwa 127445AA906286Hs.193942 ESTs 4.35 130772BE270640Hs.19192 cyclin-dependentlose 2 4.35 134625AA977638Hs.184389 ESTs 4.35 135397L14922 Hs.i66563 replication factor C (activator4.35 1) 1 (14 40 128070AA886944Hs.303908 ESTs 4.35 135046AI494054Hs.93589 hypothetical protein DKFZp564B1162d.33 101881NM 004957Hs.754 folylpolyglutamate synthase4.33 129838AB007863Hs.185140 KIAA0403 protein 4.33 130974NM 003528Hs.2178 H2B histone family, member4.33 45 107763AA018220Hs.106730 chromosome 22 open reading4.32 frame 3 129818T71092 Hs.172572 hypothetical protein FLJ200934.31 129407AL137597Hs.11114 hypotheticalprotein dJ1181N3.14.30 110846BE277343Hs.297875 endoplasmic reticulum 4.30 chaperone SIL1, ho 111433801452 Hs.40193 hypothetical protein KIAA12594.30 50 114860AL157545Hs.42179 bromodomain and PHD fingerd.30 containing, 3 115853AW978561Hs.191548 ESTs 4.30 116165A1184751Hs.75874 pregncy-associated plasma4.30 protein A

126911AA428049Hs.1501 syndecan 2 (heparan sulfate4.30 proteoglycan 131230NM 005865Hs.274407 protease, serine,16 (thymus)4.30 55 100349D64110 Hs.77311 BTG family, member 3 4.29 100175BE258769Hs.32500 acetyl-Coenzyme A acyltransferase4.29 2 (mit 105335AW291165Hs.25447 ESTs 4.29 122507BE567620Hs.99210 ESTs 4.28 105397AA814807Hs.7395 hypothetical protein FLJ231824.28 133674AW851121Hs.75497 Homo Sapiens cD: FLJ221394.28 fis, clone H

102826NM 007274Ns.8679 cytosolic acyl coenzyme 4.28 A ihioester hydr 103272Ntv1_006680Hs.2838 malic enzyme 3, DP(+)-dependent,4.28 mitoc 111887838635 Hs.12328 KIAAi005 protein 4.28 120336N85785 Hs.181165 eukaryotic translation 4.28 elongation factor 65 133736D49958 Hs.75819 glycoprotein M6A 4.28 130356AF127577Hs.155017 nuclear receptor interacting4.27 protein 1 119830AW054922Hs.53478 Homo Sapiens cD FLJ12366 4.27 fis, clone MA

106758AB014564Hs.22616 KIAA0664 protein d.25 109709F09749 Hs.187405 ESTs 4.25 110463H52931 Hs.165067 ESTs 4.25 124472N52517 Hs.102670 EST 4.25 109770840322 Hs.248420 ESTs, Moderately similar 4.24 to A47582 B-cel 131487F13036 Hs.27373 Homo sapiens m8; cD DKFZp564017634.23 (f 107216D51069 Hs.211579 melanoma cell adhesion 4.23 molecule 75 123562AA177088Hs.190065 ESTs 4.23 125986W024i0 Hs.205555 ESTs 4.23 126221N20514 Hs.172965 ESTs 4.23 127092T26985 gb:NIBT065H01 R Infant 4.23 brain, LLNL array 132349AW975654Hs.181286 sedne protease inhibitor,4.23 Kazal type 1 118946N92834 gb:zb67f03.s1 Soares fetal4.22 lung-NbHLI9W

101531A1199711Hs.576 fucosidase, alpha-L- 1,Gssue4.21 105322T87179 Hs.16346 ESTs, Weakly similar to 4.21 104219AB00232 3 Hs.7720 dynein, cytoplasmic, heavy4.20 polypeptide 1 102825BE262386Hs.7137 clones 23667 and 23775 4.20 zinc finger prate 103571AI675749Hs.211608 nucleoporin 153kD 4.20 106942AA995351Hs.31314 retinoblastoma-binding 4.20 protein 7 112685887650 Hs.33439 ESTs, Weakly similar 4.20 to ALU1_HUMAN ALU S

123107AA225048Hs.104207 ESTs 4.20 132659275190 Hs.54481 low density lipoprotein 4.20 receptor-related 130084AI929377Hs.173724 creative kise, brain 4.19 114553BE219860Hs.22505 hypothefical protein 4.18 129628036945 Hs.1174 cyclin-dependent kise 4.18 inhibitor 2A (me 102266029725 Hs.3080 mitogen-activated protein4.18 kise 7 110637AI241470Hs.268982 ESTs 4.18 127520T51239 gb:yb20d12.s1 Stratagene4.18 fetal spleen (9 130322NM-014247Hs.154545 PDZ domain containing 4.17 guanine nucleofide 104768082319 Hs.11056 RALBP1 protein 4.17 1 123360AA532718Hs.178604 ESTs 4.17 S

133110AA808177Hs.65228 ESTs 4.16 130923H96115 Hs.21293 UDP-N-acteylglucosamine 4.16 pyrophosphorylas 109878BE620775Hs.4866 Homo sapiens cD FLJ143874.16 fis, clone HE

119265BE539706Hs.285363 ESTs 4.16 124214H58608 Hs.151323 ESTs 4.15 106193AA057478Hs.23272 ESTs 4.15 105169BE245294Hs.180789 S164 protein 4.15 132304AA610002Hs.44296 hypothefical protein 4.15 131600NM-004377Hs.29331 camiline palmitoyltransferase4.14 I, muscle 131365M93415 Hs.26014 activin A receptor, type4.14 II

121993AW297880Hs.98661 ESTs 4.14 110779A1391472Hs.12561 ESTs, Highly similar 4.13 to C212_HUMAN 28.3 126383AB032977Hs.6298 KIAA1151 protein 4.13 104446AF084555Hs.7351 cyclic AMP phosphoprotein,4.13 19 kD

131475AA992841Hs.27263 KIAA1458 protein 4.13 128933NM 002050Hs.334695 GATA-binding protein 4.12 113141AI493276Hs.9187 ESTs 4.11 134833L20965 Hs.89901 phosphodiesterase 4A, 4.11 CAMP-specific (dun 106461AI630759Hs.17481 Homo Sapiens clone 246064.10 m8 sequence 128056AI990131Hs.276973 potassium large conductance4.10 calcium-acli 114757AW970579Hs.291031 ESTs 4.10 134653A1765883Hs.87385 ESTs 4.09 100472D90084 Hs.1023 pyruvate dehydrogese 4.08 (lipoamide) alpha 103102X61177 Hs.68876 interleukin 5 receptor, 4.08 alpha 106779BE276013Hs.172364 Homo Sapiens m8 for FLJ000864.08 protein, 133615M62843 Hs.75236 ELAV (embryonic lethal, 4.08 abnormal vision, 130178020982 Hs.1516 insulin-like growth factor-binding4.07 prate 124659AI680737Hs.289068 Homo Sapiens cD FLJ119184.07 fis, clone HE

127861AW295020Hs.198529 ESTs 4.07 112129AB037715Hs.183639 hypothetical protein 4.07 100918AK001335Hs.31137 protein tyrosine phosphatase,4.06 receptor t 124677801073 gb:ye84c03.s1 Soaresfetalliverspleen4.05 102722F13271 Hs.79981 Human clone 23560 m8 4.05 sequence 1 1 AB037721Hs.173871 KIAA1300 protein 4.05 122506AA449120Hs.99209 ESTs 4.05 126392A1356294Hs.3280 caspase 6, apoptosis-related4.05 cysteine pr 130760AW379130Hs.18953 phosphodiesterase 9A 4.05 104220AB002324Hs.301094 KIAA0326 protein 4.05 112774895770 Hs.35455 ESTs 4.04 111128AW505364Hs.19074 lATS (large tumorsuppressor,4.04 Drosophila 113146BE151985Hs.5722 hypotheficalprotein FLJ233164.04 124940AF068846Hs.103804 heterogeneous nuclear 4.03 ribonucleoprotein 105498H68279 Hs.24937 transformer-2 alpha (htra-24.03 alpha) 112631882040 gb:yj06b06.s1 Scares 4.03 placenta Nb2HP Homo 118244N62516 Hs.48556 ESTs 4.03 118720N73515 gb:za49d07.s1 Soaresfetalliverspleend.03 129232898881 Hs.109655 sex comb on midleg (Drosophila)-like4.03 134192H01345 Hs.24139 Homo Sapiens cD: FLJ231374.03 fis, clone L

131893BE336886Hs.3416 adipose differentiafion-related4.02 protein 116793T77781 gb:yd20a11.s1 Soaresfetalliverspleen4.02 125674AL036166Hs.323378 coated vesicle membrane 4.01 protein 116640X89984 Hs.211563 B-cell CLLIlymphoma 7A 4.01 105057AA134233Hs.336942 Homo Sapiens cD: FLJ214884.00 fis, clone C

105158AW976357Hs.234545 hypothefical protein 4.00 116245A8033107Hs.42796 KIAA1281 protein 4.00 119946AA932283Hs.58925 ESTs 4.00 121975AA740679Hs.98631 ESTs 4.00 132037AA352702Hs.332541 Homo Sapiens, Similar 4.00 to RIKEN cD 2700 133669NM 006925Hs.166975 splicing factor, argininelserine-rich4.00 109468NM_015310Hs.6763 KIAA0942 protein 3.99 106829AW959893Hs.27099 hypothetical protein 3.99 FLJ23293 similar 1o 134682AW882645Hs.88044 sprouty (Drosophila) 3.98 homolog 1 (antagoni 105966AA142984Hs.5344 adaptor-related protein 3.98 complex 1, gamma 100448AF234887Hs.57652 cadhedn, EGF LAG seven-pass3.98 G-type rece 0 102589AU076728Hs.8867 cysteine-rich, angiogenic3.98 inducer, 61 104146AW880614Hs.146381 R binding mofif protein,3.98 X chromosome 111465AI968256Hs.15470 putafive ring zinc finger3.98 protein NY-REN

126499AK001779Hs.110445 CGI-97 protein 3.98 134388AW405434 Hs.82575 small nuclear ribonucleoprotein3.98 polypept 105564BE616694 Hs.28B042 hypotheticalprotein FLJ142993.g7 115206AW183695 Hs.186572 ESTs 3.96 103853AF272390 Hs.111782 myosin 5C 3.96 1 H58373 Hs.332938 hypothetical protein 3.96 0542 _ MGC5370 106797A1768801 Hs.169943 Homo Sapiens cD FLJ135693.96 fis, clone PL

130589AL110226 Hs.f6441 DKFZPd34N204protein 3.95 122786AI828638 Hs.99514 hypotheticalprotein FLJ205743.95 104518H20816 Hs.112423 Homo Sapiens m8; cD DKFZp5861f4203.95 130 (f 640 NM-004753Hs.17144 short-chain dehydrogeselreductase3.95 110847N30169 Hs.279807 ESTs, Weakly similar 3.95 to 2004399A chromos 116756AA46i045 Hs.50701 ESTs 3.95 122096AA431162 Hs.98690 ESTs 3.95 122160At769281 Hs.97d39 ESTs 3.95 930 AA740878 Hs.112982 ESTs 3.95 126280219417 gb:HS826B122 STRATAGENE 3.95 Human skeletal m 126547047732 Hs.84072 transmembrane 4 superfamily3.95 member 3 134757AA913267 Hs.211576 IL2-inducible T-cell 3.95 lose 117296AL133d27 Hs.42506 Homo Sapiens m8 full 3.95 112 length insert cDN

261 AL050297 Hs.300861 ESTs, Highly similar 3.95 to T08701 hypotheti 1 W39609 Hs.22003 solute camer family 6 3.94 t (neurotransmitle 131844AI419294 Hs.324342 ESTs 3.94 101607X60111 Hs.1244 CD9 antigen (p24) 3.94 121613AA416879 Hs.193195 ESTs, Weakly similar 3.93 to 2109260A B cell.

115815AW905328 Hs.180842 ribosomal protein L13 3.93 125684AW589427 Hs.158849 Homo Sapiens cD: FLJ216633.93 fis, clone C

126783AA083531 gb:zn09d10.s1 Stratagene3.93 hNT neuron (937 129201H18359 Hs.109390 ESTs 3.93 128954AA346839 Hs.209100 DKFZP434C171 protein 3.92 22939AA477141 gb:zu37g06.s1 Soares 3.92 ovary tumor NbHOT H

130348AB032957 Hs.210850 KIAA1131 protein 3 125847AW161885 Hs.249034 ESTs .
3,g1 120452AL022328 Hs.104335 hypothetical protein 3.91 IMAGE35103t7 123143AA487595 gb:aa95e02.s1 5tratagene3,g1 10 fetal reti 93 5729 H46612 Hs.293815 Homo sapiens HSPC285 3.91 m8, partial cds 106605AW772298 Hs.21103 Homo Sapiens m8; cD DKFZp564B0763.90 (fr 126714AF114491 Hs.137354 egf-like module containing,3.90 mucin-like, 121611M31669 Hs.1735 inhibin, beta B (activin3.90 AB beta polypep 120468AW967675 Hs.96487 ESTs, Highly similar 3.90 1 to S08228 ribosomal 0 AW878229 Hs.80642 sigl transducer and activator3,gg 356 of traps 133668L7796d Hs.271980 mitogen-activated protein3,8g kise 6 109114BE622787 Hs.84045 hypothetical protein 3.88 115134AW968073 Hs.i94331 ESTs,HighlysimilarfoA55713inosito!3,8g 107850AA022910 Hs.295446 ESTs, Moderately similar3.88 to 810024C cyto 130907AA322866 Hs.2it07 neuroligin 3.88 101879AA176374 Hs.243886 nuclear autoantigenic 3,gg sperm protein (his 104267AF043244 Hs.278439 nucleolar protein 3 (apoptosis3,gg repressor 112232BE253927 Hs.24983 hypothetical protein 3.8g from EUROIMAGE 2021 113248T63857 gb:yc16e01.s1 Stratagene3.88 1 lung (937210) H

14044BE327427 Hs.79953 ESTs 3.gg 115414AA662240 Hs.283099 AF15q14 protein 3.88 129598N30436 Hs.i 1556 Homo Sapiens cD FLJ125663.8g fis, clone NT

102134AL036967 Hs.2324 protamine 2 3.87 106310898185 Hs.17240 ESTs 3.87 116470At272141 Hs.83484 SRY (sex determining 3.86 region Y)-box 4 110947AW298410 Hs.21475 ESTs 3 115839BE300266 Hs.28935 transducin-like enhancer.
of split 1, hom 3,g5 103534AW970672 Hs.9247 protein kise, AMP-activated,3.85 alpha 1 c 105209A8023197 Hs.227743 KIAA0980 protein 3.85 08749AA127017 Hs.71052 ESTs 3.85 110565A1884970 Hs.4983 ESTs 3.85 110799At089660 Hs.32340f dpy-30-like protein 3.85 117068H91257 Hs.41391 EST 3.85 130956NM 001135Hs.2159 aggrecan 1 (chondroitin 3.85 1 sulfate proteogl 02273BE391815 Hs.75981 ubiquitin specific protease3 14 (tR-gua 85 112960AL110209 Hs.6770 LCAT-like lysophospholipase.

114414AW152166 Hs.i82113 ESTs .

109665AA249439 Hs.27027 hypothetical protein .
DKFZp762H1311 84 106208AK001674 Hs.22630 cofactorrequiredfor Spi .
1 transcdptio 3,g4 22311NM-014913Hs.131915 KIAA0863 protein 3 124271AW293223 Hs.8928 hypothetical protein .

106650AL049951 Hs.22370 Homo Sapiens m8; cD DKFZp56400122.
(f 3.83 112167N99591 Hs.255B7 ESTs, Weakly similar 3 to T00329 hypotheti 83 122354AL157579 Hs.153610 KIAA0751 gene product .
1 3.83 11 805296 gb:ye91e08.stSoaresfetalliverspleen3 62 g1 128109AW269421 Hs.128093 ESTs , 127003AW816515 Hs.173540 ATPase, Class V, type , 109210AA669722 Hs.272137 ESTs .

132543BE568452 Hs.510i protein regulatorofcytokinesisl.
1 3.80 06827AA457456 Hs.11408 hypothetical protein 3 124232H63391 Hs.339677 ESTs, Weakly similar .
(0138022 hypotheti 80 126039ALi37523 Hs.181102 p30 DBC protein .

128022AW195569 Iis.125906ESTs .
3.80 132005AA149707Hs.173091 ubiquitin-like 3 3.79 131392AA235153Hs.26320 TRABID protein 3.79 131775A8014548Hs.31921 KIAA0648 protein 3.79 126257N99638 gb:za39g11.r1 Soaresfetalliverspleen3.79 121950AA429515 gb:zw75c05.s1 Snares 3.79 testis_NHT Homo sap 116067AA454827Hs.293637 ESTs 3.78 104658AA360954Hs.27268 Homo sapiens cD: FlJ219333.78 fls, clone H

104493AW960427Hs.79059 Uansfortning growth factor,3.77 beta recepto 100163W44671 Hs.124 gene predicted from cD 3.77 with a complete 1 116223AF045458Hs.47061 unc-51 (C. elegans)-like3.77 ~ lose 1 120586ALD31778Hs.797 nuclear transcription 3.76 factor Y, alpha 128764AW024282Hs.104938 hypothetical protein 3.75 111574A1024145Hs.188526 ESTs 3.75 117396W20128 Hs.296039 ESTs 3.75 15 119052810889 gb:yf38d02.s1Soaresfetalliverspleen3.75 121806AA424313Hs.984D2 ESTs 3.75 122410AA446854Hs.271004 ESTs, Weakly similar 3.75 to 138022 hypothefl 126638AA649257Hs.188602 ESTs 3.75 127879AA768098Hs.189079 ESTs 3.75 121095AA320134Hs.196029 Homo Sapiens m8 for KIAA16573.75 protein, 103430BE564090Hs.20716 Uansiocase of inner mitochondria)3.74 membr 101230AW504300Hs.295605 mannosidase, alpha, class3.74 2A, member 2 100200H94688 Hs.173737 ras-related C3 botulinum3.73 toxin subsfrate 106913AI219346Hs.86178 M-phase phosphoprotein 3.73 25 110975H17012 Hs.14633 ESTs 3.73 117314N32498 Hs.42829 ESTs 3.73 118737AA199686 gb:zq75g09.r1 SUatagene 3.73 hNT neuron (937 124169BE079334Hs.271630 ESTs 3.73 124580N68420 Hs.107992 ESTs . 3.73 125747NM 002884Hs.865 RAP1A, member of RAS 3.73 oncogene family 124879873588 Hs.101533 ESTs 3.72 128527AA504583Hs.101047 Uanscripflon factor 3 3.72 (E2A immunoglobul 103644M13305 Hs.247787 opsin 1 (cone pigments),3.72 long-wave-sensi 106044N90344 Hs.i49436 kinesin family member 3.71 35 127867C18530 gb:C18530 Human placentacD3.71 (fFujiwara 133828T28472 Hs.7655 U2 small nuclear dbonucleoprotein3.71 auxil 107387D86983 Hs.118893 Melanoma associated gene3.71 104160AA455706Hs.44581 heat shack protein hsp70-related3.71 protein 106098BE278344Hs.7970 DKFZP434B027 protein 3.70 40 133691M85289 Hs.211573 heparan sulfate proteoglycan3.70 2 (pedecan 120717AA904681Hs.154434 ESTs, Weakly similar 3.70 to unknown [H.sapie 119263T15977 gb:182328 Infant brain, 3.70 Bento Snares Hom 102305AL043202Hs.90073 chromosome segregation 3.70 1 (yeast homology 106566BE298210 gb:601118016F1 NIH_MGC_i73.70 Homo Sapiens c 45 110708N33878 Hs.306117 KIAA0306 protein 3.70 114357841677 Hs.6107 Homo Sapiens cD FLJ148393.70 fls, clone OV

1 AW972872Hs.293736 ESTs 3.70 123034AL359571Hs.44054 ninein (GSK38 interacting3.70 protein) 126396T06298 Hs.153326 EST 3.70 132597Y11192 Hs.5299 aldehyde dehydrogese 3.70 5 family, member 105823AI559444Hs.293960 ESTs 3.70 102644T59816 Ns.173311 C18B11 homoiog (44.9kD) 3.70 133513AF136407Hs.1446 chromosome 6 open reading3.70 frame 5 116450AI654450Hs.47274 Homo Sapiens m8; cD DKFZp564B1763.69 (fr 55 104596AF067804Hs.15423 hypotheflcal protein 3.69 133579X75346 Hs.75074 mitogen-activated protein3.68 kise-activat 124556N29317 Hs.236463 Homo Sapiens m8; cD DKFZp586105213.66 (f 120534AI635113Hs.270366 ESTs, Weakly similar 3.68 to 178885 serinelth 10x1568E259039Hs.129953 Ewing sarcoma breakpoint3.68 region 1 134992AA464444Hs.5831 Ussue inhibitor of metalloproteise3.68 106730BE467313Hs.260707 ESTs 3.68 120680AA360240Hs.97019 EST 3.68 123731AA609839 gb:ae62f01.s1 SUatagenelung3.68 caroinoma 126973W46653 Hs.251928 nuclear pore complex 3.67 interacting protein 65 103646AW248439Hs.2340 junction plakoglobin 3.67 116333AF155827Hs.203963 hypothetical protein 3.67 120922AA481003Hs.97128 ESTs 3.67 127407AW089514Hs.279681 heterogeneous nuclear 3.67 ribonucleoprotein 106578AA836381Hs.315111 nuclear receptor co-repressorIHDAC33.67 comp 123000AI584156Hs.105640 Homo Sapiens, clone IMAGE:4139775,3.67 m8, 101464AA852431Hs.51299 DH dehydrogese (ubiquinone)flavopro3.67 101397M26380 Hs.180B78 lipoproteinlipase 3.67 131135NM 016569Hs.267182 TBX3-iso protein 3.66 106112AL117518Hs.3686 KIAA0978 protein 3.66 75 123974NM 015678Hs.3821 neurobeachin 3.66 127742AW293496Hs.180138 ESTs 3.66 112908BE281000Hs.3530 TLS-associated serine-arginine3.66 protein 2 131802AL137406Hs.296356 Homo Sapiens m8; cD DKFZp434Mi623.65 (fr 135162AI187925Hs.95667 F-box protein 30 3.65 124984BE313210Hs.223241 eukaryotic Uanslaflon 3.65 elongation factor 118844AL035364Hs.50891 hypothetical protein 3.65 125429A1023654Hs.114191 ESTs 3.65 125596825698 gb:yg44h11.r2 Snares 3.65 infant brain 1N18 H

125792AA496205Hs.193700 Homo Sapiens m8; cD DKFZp586103243.65 (f 126965AI470523Hs.139336 ATP-binding cassette, 3.65 sub-family C (CFTR

130776AF167706Hs.19280 cysteine-rich motor neuron3.65 131949AK000010Hs.258798 hypoihefical protein 3 116612C14904 Hs.45184 Homo Sapiens cD FLJ12284.
fis, clone MA 3.65 123749AA609949Hs.112790 EST 3.65 134203AA161219Hs.799 diphtheria toxin receptor3.64 (heparin-bindi 133605AL038165Hs.75187 translocase of outer 3.64 mi(ochondriai membr 109235AI38i800Hs.300684 calcitonin gene-related 3 peptide-receptor 64 1 125447AI582222Hs.128686 ESTs .
0 3.63 122942A1277829Hs.111862 KIAA0590 gene product 3.63 122748AA458822Hs.193815 ESTs 3.63 103840AW975861Hs.47367 KIAA1785 protein 3.63 105333AA234831Hs.246112 KIAA0788 protein 3 15 108807A1652236Hs.49376 hypothetical protein .
FLJ20644 3.63 114699AA127386 gb:zn90d09.r1 Stratagene3.63 lung carcinoma 126040228444 Hs.24119 Homo Sapiens m8; cD DKFZp586G22223.63 (f 131028AI879165Hs.2227 CCAAT/enhancer binding 3.63 protein (CIEBP), 131710NM 015368Hs.30985 pannexin 1 3 100164AW372032Hs.173714 MORF-related gene X .
3.62 120837BE149656Hs.306621 Homo Sapiens cD FLJ119633.62 fis, clone HE

131089242645 Hs.22870 Homo Sapiens m8 full 3.62 length insert cDN

126428AA412436Hs.301985 ESTs 3.62 129148AW501216Hs.108945 KIAA0515 protein 3.61 102337AI814663Hs.170133 forkhead box 01A (rhabdomyosarcoma)3.61 104520A1702384Hs.76925 hypotheficalprotein FLJ149813.60 112954AA928953Hs.6655 Homo Sapiens EST from 3.60 clone 208499, full 125197AF086270Hs.278554 heterochromafin-like 3.60 protein 1 128124A1i25748Hs.130194 ESTs 3 30 129553AW015763Hs.113065 ESTs .
3.60 123998AA203429Hs.79474 tyrosine 3-monooxygeseltryptophan3.60 5-mo 128835AK001731Hs.106390 Homo Sapiens m8; cD DKFZp586H09243.59 (f 129226BE222494Hs.180919 inhibitor of D binding 3.59 2, dominl neg 135131AI582743Hs.94953 Homo sapiens, Similar 3.59 35 to complement comp 128955AA775076Hs.185807 Homo Sapiens, Similar 3.58 to PR00478 protein 100225D28539 Hs.167185 glutamate receptor, metabotropic3.56 101572AA437199Hs.656 cell division cycle 25C 3.58 102277031099 Hs.158326 prostaglandin D2 receptor3.58 (DP) 103667280788 Hs.247815 H4 histone family, member3.58 112373AW963357Hs.7847 ESTs 3.58 119284AL041224Hs.65379 ESTs 3.58 125422AA903229Hs.153717 ESTs 3.58 126381M76665 Hs.275215 hydroxysteroid (11-beta)3.58 dehydrogese 1 129168AI132988Hs.109052 chromosome 14 open reading3.58 45 frame 2 123133AA487264Hs.154974 Homo sapiens m8; cD DKFZp667N0643.57 (fr 128789AW368576Hs.139851 caveolin 2 3.57 104172AA476418 gb:zx02a12.s1 Soares 3.57 total_fetus-Nb2HF8_ 134263AW973443Hs.8086 R (guanine-7-) methyltransferase3.57 101759M80244 Hs.184601 solute camerfamily 7 3 (cafionic amino 57 50 104942NM 016348Hs.10235 chromosome 5 open reading.
frame 4 3.56 123443BE244537Hs.i67382 triureticpeptidereceptorAlguanylate3.56 110707AI239832Hs.15617 ESTs, Weakly similar 3.55 to ALU4-HUMAN ALU S

106787AI492261Hs.32450 ESTs 3.55 112940AK001757Hs.281348 hypothetical protein 3.55 115301Ti 1832 Hs.127797 Homo sapiens cD FLJ113813.55 fis, clone HE

125978N66843 Hs.35608 ESTs 3.55 128002AI985897Hs.125293 ESTs 3.55 119847H81136 Hs.334604 Homo Sapiens m8 for KIAA18703.55 protein, 13,4595NM 002401Hs.29282 mitogen-activated protein3.55 60 lose kise 121309AA293834Hs.97312 ESTs 3.54 122679AA811286Hs.192837 ESTs, Weakly similar 3.54 to ALU5_HUMAN ALU S

106061AA565356Hs.13250 ESTs 3,54 127207AA377165Hs.44833 ESTs 3,54 129563AF119664Hs.27299 transcripfiol regulator 3.54 65 protein 105951848700 Hs.20733 Homo Sapiens cD: FLJ223563.53 fis, clone H

115643AA404276Hs.123253 hypothetical protein 3.53 130473011690 Hs.1572 faciogenital dysplasia 3.53 (Aarskog-Scott sy 104246AF016032Hs.201377 lysosomal 3.53 120562BE244580Hs.302267 hypothefical protein 3.53 01211 AA355357Hs.283429 SMC (mouse) homolog, 3.53 X chromosome 100774J05581 Hs.89603 mucin 1, iransmembrane 3.53 108407AA075519 gb:zm87h09.s1 SUatagene 3.53 ovarian cancer 113538AI554947Hs.15167 ESTs, Weakly similar 3.53 to S37482 finger pr 113876AI799751Hs.5635 ESTs 3 75 110731NM 014899Hs.188006 KIAA0878 protein .
3.52 125845AK001440Hs.131840 hypothetical protein 3.51 112945AW138458Hs.20787 Homo Sapiens cD: FLJ216863.51 fis, clone C

131686NM 012296Hs.30687 GRB2-associated binding 3.51 protein 2 125413AI887951Hs.74566 dihydropyrimidise-like 3.51 $0 3 129360AJ000534Hs.110708 sarcoglycan, epsilon 3.50 128819838007 Hs.77578 ubiquitin specific protease3.50 9, X chromos 101973041514 Hs.80120 UDP-N-acetyl-alpha-D-galactosamine:polyp3.50 103616NM_002647Hs.32971 phosphoinositide-3-kise,3.50 class 3 105535AI459519 Hs.297681serine (or cysteine) proteise3.50 inhibito 118767A1038653 Hs.50500 ESTs 3.50 126634AW361109 Hs.43627 SRY (sex determining region3.50 Y)-box 22 130851866282 Hs.20247 ESTs, Weakly similar to 3.50 S65657 alpha-1 G

134353AL138201 Hs.82120 nuclear receptor subfamily3.50 4, group A, m 111394AA412227 Hs.16131 hypothetical protein FLJ128763.50 102696BE540274 Hs.239 forkhead box M1 3.49 113037817268 Hs.259873axol transport of sypfic 3.49 vesicles 111028H59346 Hs.30151 ESTs, Weakly simitar to 3.49 1 1 138022 hypothefi 688 AI935413 Hs.30692 p21 (CDKN1A)-acfivated 3.49 3 kise 2 115613AW136951 Hs.173946hypothetical protein FLJ104863,qg 1f6975H81076 Ns.269001ESTs 3,qg 100210D26361 Hs.3104 KIAA0042geneproduct 3.48 110147H18700 Hs.268799ESTs 3.48 AA081395 Hs.42173 Homo Sapiens cD FLJ10366 3.48 00 fis, clone NT

119088839261 Hs.90790 Homo Sapiens cD: FLJ22930 3.48 fis, clone K

120347AA211068 Hs.120247nuclear fragile X mental 3.48 retardation pro 122702AI2200B9 Hs.99439 ESTs 3.48 125552H09701 Hs.278366ESTs, Weakly similar to 3.48 126 138022 hypotheG

461 AI381659 Hs.267086ESTs 3.48 128572AA933022 Hs.256583inferieukin enhancer binding3.48 factor 3, 9 118397BE139479 Hs.161492ESTs 3.47 127999AW978827 Hs.69851 nucleolar protein family 3.47 A, member 1 (HI

132066A1929392 Hs.181195DJ (Hsp40) homolog, subfamily3.47 1056 B, membe 93 BE250951 Hs.181368U5 snRNP-specific protein 3.47 (220 kD), orth 128874H06245 Hs.106801ESTs, Weakly similar to 3.46 PC4259 ferrifin 119984AA230228 Hs.59197 ESTs 3.46 104000A1146527 Hs.80475 polymerase (R) II (D directed)3.46 polyp 101488BE547216 Hs.181128ELKt, member of ETS oncogene3.46 1 family J05614 gb:Human proliferafing 3.46 045 cell nuclear anG

120149AA227609 Hs.94834 ESTs 3.46 107025AA825523 Hs.21255 ESTs, Weakly similar to 3.45 138022 hypotheti 101716AF050658 Hs.2563 tachykinin, precursor 1 3.45 (substance K, su 1D2899AI815559 Hs.75730 sigl recognifion parficle 3.45 3 1230 receptor ('d 75 AW293133 Hs.101340ESTs, Weakly similar to 3.45 A42442 integrin 124695AA594979 Hs.239307tyrosyl-tRsynthetase 3.45 127669N28989 Hs.22891 solute carrier family 7 3.45 (cationic amino 129793AW207000 Hs.126857Homo Sapiens cD FLJ12936 3,44 fis, clone NT

120095AA693774 Hs.59601 ESTs 3.qq 1 BE0922B5 Hs.29724 hypothetical protein FLJ131873.43 130542064675' Hs.179825RAN binding protein 2-like3.43 100488BE273749 Hs.752 FK506-binding protein 1A 3.43 (12kD) 115027AA743331 Hs.272572hemoglobin, alpha 2 3.43 119298NM 001241Hs.155478cyclin T2 3.43 126486A1065133 Hs.152316hypothetical protein PR009713.43 13(1021M24470 Hs.1435 guanosine monophosphate 3.43 reductase 127166AW954605 Hs.263395sema domain, transmembrane3.42 domain (TM), 114988AA251089 gb:zs04f05.s1 NCI-CGAP_GCBt3.42 Homo Sapiens 133817AW578716 Hs.7644 H1 histone family, member 3.41 5~ 2 133562M60721 Hs.74870 H2.0 (Drosophila)-like 3.41 homeo box 1 105610AA280072 Hs.99872 fetal Alzheimer antigen 3.41 129007AK00i521 Hs.107882hypothetical protein FLJ106593.41 100662AI368680 Hs.816 SRY (sex determining region3.41 Y)-box 2 120159860781 Hs.92927 putative 47 kDa protein 3.41 SJr1349 66 AWd02389 Hs.920 modulator recognition factor!3.41 100369D79988 Hs.115778KIAA0166 gene product 3.41 10426()AF008192 Hs.194283putative GR6 protein 3.40 10D134AA305746 Hs.49 macrophage scavengerreceptori3.40 116015AA338648 Hs.50334 testes development-related3.d0 251 T15753 Hs.65250 EST 3.40 127176BE387162 Hs.280858ESTs, Highly similar to 3.40 A35661 D excis 123422AA598484 gb:ae38f04.s1 Gessler Wilms3.39 tumor Homo s 123094AA761073 Hs.146847TRAF family member-associated3.39 NFKB acfiv 105289A8020638 Hs.103000KIAA0831 protein 3.39 219 N68836 Hs.19247 ESTs, Moderately similar 3.38 to ALUC HUMAN !

127963AI299013 Hs.87779 Homo Sapiens cD: FLJ23087 3.38 fis, clone L

109412BE543313 Hs.209473hypothetical protein FLJ105203.38 118794AW517051 Hs.118210ESTs 3.38 112040843286 gb:ygi7eit.sl Soares infant3.38 brain iNlB H

111180AI798851 Hs.283108hemoglobin, gamma G 3.38 117329AA524065 Hs.93670 Homo Sapiens cD: FLJ22664 3.38 fis, clone H

104371AI288696 Hs.194081ESTs, Weakly similar to 3.38 138022 hypothefi 109265AA195285 Hs.85982 ESTs 3.38 109557AW452405 Hs.6427 ESTs 3.38 20753AA3 Hs.230157ESTs 3.38 120970AA398118 Hs.97579 ESTs, Weakly similar to 3.38 A46010 X-linked 127094F13215 Hs.287849ESTs, Weakly similar to 3.38 T22074 hypothefi 127746AI239495 Hs.120i89ESTs 3.38 123553AI49429f Hs.11f977ESTs 3.37 130652M31669 Hs.1735 inhibin, beta B (acfivin 3.37 AB beta polypep 135101082275 Hs.94498 leukocyte immunoglobulin-like3.37 receptor, 121799AI885670 Hs.124027SELENOPHOSPHATE SYNTHETASE3.37 ; Human selen 112278241698 Hs.26039 Homo Sapiens cD FLJ13937 3.36 fis, clone Y7 113401AA610175 Hs.179647Homo Sapiens cD FLJ12195 3.36 fis, clone MA

109292AW975746 Hs.188662KIAA1702 protein 3.36 135026N92165 Hs.93231 ESTs 3.36 118210N49233 Hs.46914 ESTs, Weakly similar to 3.35 A46010 X-linked 123476AA384564 Hs.108829ESTs 3.35 111076N59129 Hs.20851 ESTs 3.35 111520AI985369 Hs.301134ESTs 3.35 133383BE313555 Hs.7252 KIAA1224 protein 3.35 103731AA070545 gb:zm70c03.ri Stratagene 3.35 1 neuroepithelium ~

110828AK002114 Hs.23495 hypoiheficalprotein FLJi12523.35 112520868654 Hs.30814 ESTs 3.35 115725AW899053 Hs.76917 F-box only protein 8 3.35 125867H13331 Hs.123721ESTs 3.35 127719A1242163 Hs.22670 chromodomain helicase 3.35 D binding protei 1 129863BE379765 Hs.129872sperm associated anfigen 3.35 130816M61877 Hs.1985 specUin, alpha, eryihrocytic3.35 1 (ellipto 130888AL044315 Hs.173094Homo Sapiens m8 for KIAA17503.35 protein, 133377AJ131245 Hs.7239 SEC24 (S. cerevisiae) 3.35 related gene Tamil 118986AF148713 Hs.125830bladdercanceroverexpressed3.35 protein 101723034304 gb:Human nonmuscle myosin3.34 heavy chain II

134693N70361 Hs.8854 Human transcripfion unit 3.34 PVT gene, exons 102856M26150 Hs.248177H3 histone family, member3.34 L

105593AA279341 Hs.174151aldehyde oxidase 1 3.34 134748L34059 Hs.8948d cadherin 4, type 1, R-cadherin3.34 (retil) 25 109149AA831179 Hs.400fi5hypothefical protein MGC48253.33 115026AA251972 Hs.188718ESTs 3.33 103546214244 Hs.75752 cytochrome c oxidase subunitVllb3.33 111189N67603 Hs.272130ESTs, Weakly similar to 3.33 S65824 reverse t 127076AI422951 Hs.146162ESTs 3 30 124949A1903210 Hs.336780tubulin, beta polypeptide.
3.33 111012A1077389 Hs.269818ESTs, Weakly similar to 3.33 113412AW628660 Hs.44131 KIAA0974 protein 3.33 116351AL133623 Hs.82501 similar to mouse Xm1 t 3.33 Dhm2 protein 121633AA417011 Hs.98175 EST 3 35 124591N69243 Hs.192974hypothetical protein FLJ12735.
3.33 130225AB021179 Hs.15299 HMBA-inducible 3.33 131945NM 002916Hs.35120 replication factor C (activator3.33 1) 4 (37 132561AK000631 Hs.52256 hypothetical protein FLJ206243.33 105726NM 012068Hs.9754 activating transcription 3 factor 5 32 101867M96132 gb:Human MHCclass It HLA-DR-beta-1*090i.
3.32 105004BE616023 Hs.25298 KIAA1813 protein 3.32 100288AL039103 Hs.153834pumilio (Drosophila) homolog3.32 118349N63786 Hs.94149 ESTs, Weakly similar 1o 3.32 ALU1_HUMAN ALU S

103352H09366 Hs.78853 uracil-D glycosylase 3.30 45 107436W27720 Hs.12450 protocadherin 9 3.30 109062AA160941 gb:zq40d12.s1 Stratagene 3.30 hNT neuron (937 110379AI300505 Hs.33130 Homo Sapiens cD: FLJ234863.30 fis, clone L

111221AB037782 Hs.15119 KIAA1361 protein 3.30 117903AA768283 Hs.47111 ESTs 3 123265AA491209 gb:aa47a08.s1 NCI_CGAP-GCBs.
Homosapiens 3.30 128226AI284940 Hs.289082GM2 ganglioside activator3.30 protein 111945840663 Hs.124944ESTs 3.30 126214AW748336 Hs.168052KIAA0421 protein 3.30 121073H46199 Hs.112184DKFZP586J0619 protein 3 55 102083T35901 Hs.75117 interleukin enhancer binding.
factor 2, 4 3.30 100992NM-007289Hs.1298 membrane metallo-endopepfidase3.30 (neutral 134021L13720 Hs.7850i growth arrest-specific 3.30 126452826867 .gb:yh52e01.s1 Soares 3.29 placenta Nb2HP Homo 7195 AI798425 Hs.42710 ESTs 3 , AK000452 Hs.10340 hypothefical protein FLJ20445.
127663 3.29 113677270200 Hs.246112KIAA0788 protein 3.28 132398AA876616 Hs.16979 ESTs, Weakly similar to 3.28 A43932 mucin 2 p 109533AL043979 Hs.259729KIAA0596 protein 3.28 102915X07820 Hs.2258 matrix mefailoproteise 3.28 10 (stromelysin 6Jr104348H05405 Hs.19221 hypothetical protein DKFZp566G14243.28 113047AI571940 Hs.7549 ESTs 3.28 113203AA743563 Ns.10305 ESTs 3.28 114503AL040600 Hs.188083ESTs 3.28 122100AA431220 Hs.410fi6pleckstrin homology domain-containing3.2fi f 123073AA485061 Hs.105652, 3.28 ESTs 130253A1078570 Hs.167473phosphoglucomutase 5 3.28 130365W56119 Hs.155103eukaryotic translation 3.28 initiation factor 130762D84371 Hs.1898 paraoxose 1 3.28 132360AW893660 Hs.46440 solute camer family 21 3.28 (organic anion 75 110763AI928445 Hs.92254 syplotagmin-like 2 3.27 103437AV655598 Hs.184211peptidase (mitochondria) 3.27 processing) bet 114840AA447591 Hs.87359 ESTs, Highly similar to 3.27 RB18_HUMAN RAS-R

106888AA020964 Hs.24734 oxysterol binding protein3.27 129896BE29S568 Hs.13225 UDP-GahbetaGlccbetal,4-galactosyll3.26 113459T80206 Hs.i4716 ESTs 3.26 134332D86962 Hs.81fi75growth factor receptor 3.26 bound protein i0 117048H89732 Hs.230113EST 3.26 109249AA194730 Hs.268189hypothetical protein FLJ204363.26 134663W73428 Hs.8750 uncharacterized bone 3.26 marrow protein BM04 114440AL046511Hs.106525 hypoiheticalprotein FLJ125673.25 102196BE266830Hs.75238 chromatin assembly factor3.25 1, subunit B ( 109581845584 Hs.23025 ESTs, Weakly similar 3.25 to ALUS HUMAN ALU S

120814AW867796Hs.96860 ESTs, Weakly similar 3.25 to 138022 hypotheG

122391AA446316Hs.191622 ESTs 3.25 122553AA451884Hs.190121 ESTs 3.25 124755838087 Hs.267690 KIAA1228 protein 3.25 130943020760 Hs.272429 calcium-sensing receptor3.25 (hypocalciuric 1 115185BE299677Hs.105461 hypothetical protein 3.25 ~ FLJ20357 114297AA149707Hs.173091 ubiqui6n-like 3 3.25 106657AW854339Hs.33476 hypothetical protein 3.25 124320H95749 Hs.102342 EST 3.25 124087HOB773 Hs.288590 Homo Sapiens cD FLJ114543.24 fis, clone HE

1 110705AB007902Hs.32168 KIAA0442 protein 3.24 106508A1205785Hs.30348 ESTs 3.24 112538AA908813 gb:og77hO6.s1 NCI CGAP_Ov83.24 Homo sapiens 100130NM 000304Hs.103724 peripheral myelin protein3.24 106017AA477956Hs.26268 ESTs -- 3.24 2~ 113921AW976530Hs.28355 hypothetical protein 3.23 121520AA412163Hs.164785 ESTs 3.23 129255A1961727Hs.109804 H1 histone family, member3.23 X

125069H81306 Hs.194485 ESTs 3.23 119863AA081218Hs.58608 Homo Sapiens cD FLJ142063.23 fis, clone NT

25 111273N70934 gb:za33fO6.s1 Soaresfetalliverspleen3.23 102971X16609 Hs.183805 ankyrin 1, erythrocytic 3.23 103937AA934063Hs.13836 ESTs, Weakly similar 3.23 to 138022 hypotheG

121770NM 015902Hs.278428 progestininduced protein3.23 128972AA528140Hs.107515 ESTs, Weakly similar 3.23 to T00329 hypotheti 132528T78736 Hs.50758 SMC4 (structural maintence3.23 of chromoso 134835L04569 Hs.89925 calcium channel, voltage-dependent,3.23 L ty 103158BE242587Hs.118651 hematopoietically expressed3.22 homeobox 118405AL117518Hs.3686 KIAA0978 protein 3.22 104631AA002064Hs.18920 ESTs 3.22 3 114253BE149866Hs.14831 Homo Sapiens, Similar 3.22 5 to zinc finger pro 134607AI675881Hs.86538 ESTs 3.22 135114AW340493Hs.175043 ancient conserved domain3.22 protein 4 120191BE407106Hs.65907 Homo Sapiens, clone IMAGE:3959816,3.22 m8, 105029A1122691Hs.13268 ESTs 3.21 128550AA418276Hs.170142 ESTs 3.21 119873A1660149Hs.44865 lysosomal 3.21 130115T47294 Hs.149923 X-box binding protein 3.21 133916AL039185Hs.77558 thyroid hormone receptor3.21 interactor 7 120259AW014786Hs.192742 hypothetical protein 3.21 45 110721H97678 Hs.31319 ESTs 3.21 130062AL049415Hs.278679 a disintegrin and metalloproteise3.21 doma 100265D38521 Hs.112396 KIAA0077 protein 3.20 100624AB001025Hs.9349 ryanodinereceptor3 3.20 122275AA437124Hs.187247 ESTs 3.20 127099AA347668 gb:EST54026 Fetal heart 3.20 II Homo Sapiens 134321BE538082Hs.8172 ESTs, Moderately similar3.20 to A46010 X-lin 132809AF036144Hs.5734 meningioma expressed 3.20 antigen 5 (hyaluron 101125AJ250562Hs.82749 transmembrane 4 superfamily3.20 member 2 128339AL121087Hs.296406 KIAA0685 gene product 3.19 5 117121H95044 Hs.32i386 EST 3.19 124760AW408586Hs.91052 ESTs, Moderately similar3.19 to ALU5_HUMAN A

132232AI522273Hs.42640 ESTs 3.19 125919W26713 Hs.256972 ESTs 3.19 123324A8018352Hs.105399 KIAA0809 protein 3.19 100157D14661 Hs.119 Wilms'tumourl-associating3.19 protein 101447M21305 gb:Human alpha satellite3.19 and satellite 3 124345NM 014487Hs.120766 nucleolarcysieine-rich 3.18 protein 122583NM 012447Hs.20132 stromal antigen 3 3.18 128961AL133014Hs.107387 CGI-20 protein 3.18 65 111321AI569766Hs.13205 ESTs ~ 3.18 134977AL044963Hs.306121 leukocyte receptorcluster(LRC)encoded3.18 131535N22120 Hs.75277 hypothetical protein 3.18 109950H08200 Hs.268770 ESTs, Weakly similar 3.18 to 2004399A chromos 129875AA181018Hs.13056 hypothe6calprotein FLJ139203.18 7~ 101654M60298 Hs.733 erythrocyte membrane 3.18 protein band 4.2 104732AL079294Hs.29952 Homo Sapiens m8 full 3.18 length insert cDN

106867AB037744Hs.34892 KIAA1323 protein 3.18 108301AA069728Hs.184582 ribosomal protein L24 3.18 118042AI432389Hs.161465 ESTs 3.18 7S 120900AA830712Hs.291931 ESTs 3.18 129312T97579 Hs.110334 ESTs, Weakly similar 3.18 to 178885 serinelth 116291AW410377Hs.41502 hypothetical protein 3.17 110672AW612890Hs.191178 ESTs 3.17 115665BE072425Hs.44579 hypothetical protein 3.17 127581AK000680Hs.266175 phosphoprotein associated3.17 with GEMS

129584AV656017Hs.184325 CGI-76 protein 3.16 108830AA131743Hs.193352 ESTs 3.16 124443A1857519Hs.302031 zinc finger protein, 3.16 subfamily 1A, 4 (Eo 106290AW961393 Hs.16364 hypothetical protein 3.16 122787AI209093 Hs.99512 ESTs 3.16 133112T15465 Hs.182231thyrotropin-releasing 3.16 hormone 116435AA186761 Hs.334812hypothetical protein 3.16 DKFZp586K0717 109121BE389387 Hs.49767 DH dehydrogese (ubiquinone)3.16 Fe-S pro 126721AW579621 Hs.125359Thy-1 cellsurface antigen3.15 102526AA203429 Hs.79474 tyrosine 3monooxygeseltryptophan3.15 5-mo 100512D13317 Hs.78915 GA-binding protein transcription3.15 factor, 105299AF098951 Hs.19d720ATP-binding cassette, 3.15 sub-family G (WHIT

1 117842AI984505 Hs.161121ESTs 3.15 ~

123049BE047680 Hs.211869dickkopf (Xenopus laevis)3.15 homolog 2 128639AW582962 Hs.102897CGI-47 protein 3.15 130343AB040914 Hs.278628KIAA1481 protein 3.15 115706AB004849 Hs.50748 chromosome 21 open reading3.15 frame 18 1 120673AW968634 Hs.105093ESTs 3.15 J~

132116AW960474 Hs.40289 ESTs 3.15 116217AU076474 Hs.123178translocase of inner 3.15 mitochondria) membr 104926BE298808 Hs.33363 DKFZP434N093 protein 3.14 105297NM 015905Hs.183858transcrtptiol intermediary3.14 factor 1 125343AI475495 Hs.304101ESTs, Weakly similar 3.14 to ALU7_HUMAN ALU S

115618H11695 Hs.322901disrupter of silencing 3.14 124893AA830185 Hs.269680ESTs 3.13 105461BE539071 Hs.69388 hypothetical protein 3.13 126165AI7418i6 Hs.125897ESTs 3.13 105212AA205334 Hs.324278Homo sapiens m8; cD DKFZp566M0633.13 (fr 101628M57506 Hs.72918 small inducible cytokine3.13 A1 (I-309, homo 107951AI300077 Hs.6i590 ESTs 3.13 109166AA219691 Hs.73625 RA86 interacting, kinesin-like3.13 (rabkines 117299N75768 gb:yw30b07.r1 Morton 3.13 Fetal Cochlea Homo 3 119694AA041350 Hs.57847 ESTs, Moderately similar3.13 ~ to ICE4 HUMAN C

124840856146 Hs.164515EST, Weakly similar to 3.13 127433AW979155 Hs.298275amino acid transporter 3.13 128337AI123529 Hs.166592ESTs 3.13 134053AW628686 Hs.78851 KIAA0217 protein 3.13 35 134475NM 014733Hs.83790 KIAA0305 gene product 3.13 128761BE300341 Hs.104925ectodermal-neural cortex3.12 (with BTB-like 124971T23800 Hs.151001hypothetical protein 3.12 128314T87479 Hs.291797ESTs 3.12 134695A8036829 Hs.178347SKIP for skeletal muscle3.12 and kidney enri 131333BE244603 Hs.25726 transposon-dertved Busterltransposase-I3.12 119781AJ278016 Hs.55565 ankyrin repeat domain 3.12 131824028838 Hs.32935 TATA box binding protein3.11 (TBP)-associate 124595AW194851 Hs.111801arsete resistance protein3.11 116115AL042355 Hs.70202 WD repeat domain 10 3.11 45 129415AI907084 Hs.111243MADS box transcription 3.11 enhancer factor 2 111552T97939 Hs.191185ESTs 3.10 134861NM Hs.171880polymerase (R) II (D 3.10 000937 directed) polyp 104971- Hs.15830 hypothetical protein 3.10 126536AA156151 gb:zo48cO6.r1 Stratagene3.10 endothelial ceI

128246AI990612 Hs.214818DMRT-like family C2 3.10 106412AA453734 Hs.10198 ESTs 3.10 107902AA026627 Hs.61358 ESTs 3.10 112495A1346487 Hs.28739 ESTs 3.09 131870NM 014874Hs.3363 KIAA0214 gene product 3.09 55 105301AW352357 Hs.7457 MAGEi protein 3.09 123670AI189844 Hs.112708ESTs, Moderately similar3.09 to ZN91 HUMAN Z

116474AW160774 Hs.159154tubulin, beta, 4 3.09 112064AL049390 Hs.22689 Homo sapiens m8; cD DKFZp586013183.09 (f 130525AA361850 Hs.322149Human clone 137308 m8, 3.08 partial cds 60 120398AL133649 Hs.110953retinoic acid induced 3.08 102735AF111106 Hs.3382 protein phosphatase 4, 3.08 regulatory subuni 124748R346i7 gb:yh85h12.s1 Soares 3.08 placenta Nb2HP Homo 120755AA312934 Hs.190745Homo Sapiens cD: FLJ213263.06 fis, clone C

118895BE304917 Hs.31097 hypothetical protein 3.08 65 107463AW952022 Hs.315164hypothetical protein 3.08 similar to actin re 114290851383 Hs.25793 ESTs 3.06 119005AL038511 Hs.125316ESTs, Weakly similar 3.08 to S33990 finger pr 125676BE612918 Hs.151973hypothetical protein 3.08 127766AA723659 Hs.290607EST 3.08 132693BE244200 Hs.55075 KIAA0410 gene product 3.07 106812BE251590 Hs.239370DKFZP7271051 protein 3.07 125654X96753 Hs.9004 chondroitin sulfate proteoglycan3.07 4 (mela 111836858394 Hs.25119 ESTs, Weakly similar 3.06 to YEXO-YEAST HYPOT

101682AF043045 Hs.81008 filamin B, beta (actin-binding3.06 protein-2 75 110004H104i3 Hs.268774ESTs 3.06 117591N64777 Hs.44656 ESTs 3.06 110737AA335609 Hs.7589 ESTs, Weakly similar 3.06 to A46010 X-linked 134337NIvL004922Hs.81964 SEC24 (S. cerevisiae) 3.06 related gene famil 132450AA100012 Hs.48827 hypothetical protein 3.06 go 125556A8033064 Hs.334806KIAA1238 protein 3.06 101811NM 002556Hs.24734 oxysterol binding protein3.06 131530AA574309 Hs.283402TCR eta 3.06 105049AB032945 Hs.172506myosin VB 3.06 126614AA701941 Hs.187555 ESTs 3.05 130960AF035621 Hs.21611 kinesin family member 3C 3.05 105503AW963624 Hs.31707 ESTs, Weakly similar to YEW4 YEAST HYPOT 3.05 107361072513 Hs.159486 Human RPL13-2 pseudogene m8, complete 3.05 7575 D81886 Hs.59908 ESTs 3.05 116999H84644 Hs.40707 EST 3.05 119554W38188 (NONE) 3.05 120934AA226198 gb:nc26a07.s1 NCI_CGAP-Prt Homo Sapiens 3.05 125805AI160594 Hs.166656 ESTs, Highly similar to S49460 1 12 glutamate 3.05 ~ 2 7 AA331156 gb:EST35034 Embryo, 6 week, 63 subtracted ( 3.05 128025T64877 Hs.108479 ESTs 3.05 131090A1143139 Hs.2288 visinin-like 1 3.05 112197NM 003655Hs.5637 ESTs 3.05 133492L40397 Hs.74137 transmembrane trafficking 1 1 protein 3.04 18485AA508515 Hs.291049 ESTs 3.pq 113893A1373741 Hs.593B4 hypothetical protein MGC3047 3.04 116911AW205577 Hs.308435 ESTs, Moderately similar to KIAA0745 pro 3.04 132833078525 Hs.57783 eukaryotic translation initiation factor 3.04 124724H20816 Hs.112423 Homo Sapiens m8; cD DKFZp58611420 1 (f 3.04 05894AI904740 Hs.25691 receptor (calcitonin) activity modifying 3.04 129991828386 Hs.179925 ESTs, Weakly similar to ALUB_HUMAN
ALU S 3.04 128714T85231 Hs.179661 tubulin, beta 5 3.04 134650076376 Hs.87247 harakiri, BCL2-interacting protein (coot 3.04 106851AI458623 gbak04g09.x1 NCI-CGAP_Lu24 25 1334 Homo Sapiens 3.04 45 AC005262 Hs.73797 guanine nucleotide binding protein (G pr 3.04 102561AU077228 Hs.77256 enhancerofzeste(Drosophila)homolog 2 3.04 127542AA703684 Hs.245474 ESTs, Moderately similar to ALUS-HUMAN A 3.03 113043AI628789 Hs.7483 ESTs 3.03 134710A1433797 Ns.8889 serine hydroxymethyltransferase 30 11 1 (solub 3.03 9245 AI815733 Hs.114360 transforming growth factor beta-stimulat 3.03 106391AW959538 Hs.321214 hypothetical protein DKFZp564D0478 3.03 114607AF041260 Hs.129057 breast carcinoma amplified sequence 1 3.03 116083AA455706 Hs.44581 heat shock protein hsp70-related protein 3.03 132079AI701457 Hs.38694 ESTs 3 35 103825A1571835 Hs.55468 .
ESTs 3.03 106438AI141031 Hs.21342 ESTs 3.03 124359N22508 Hs.139315 Homo Sapiens cD: FLJ21479 fis, clone C 3.03 126384AW090198 Hs.4779 KIAA1150 protein 3.03 127995AA970953 Hs.128709 ESTs 3.03 4~ 1279 8 AA837029 Hs.157463 ESTs 3.02 124417N34059 gb:yv28h09.s1 Snares fetal liver spleen 3.02 124357N22401 gb:yw37g07.s1 Morton Fetal Cochlea Homo 3.02 105437AF151076 Hs.25199 hypothetical protein 3.02 101158AW327723 Hs.76122 splicing factor, arginine/serine-rich 45 1 4 3.02 13897891601 Hs.4947 hypothetical protein FLJ22584 3.02 100159AA285268 Hs.23488 KIAA0107 gene product 3.02 106487A1697340 Hs.135265 Homo Sapiens clone FLB8436 PR02277 m8, 3.02 124977F04819 Hs.190452 KIAA0365 gene product 3.02 131631AA022569 Hs.29802 slit (Drosophila) homolog 50 1022 2 3.01 59 AL041219 Hs.82222 sema domain, immunoglobulin domain (1g), 3.01 104399AL022316 Hs.301947 kraken-like 3.01 116536BE218027 Hs.89969 ESTs 3.00 125889AA351978 Hs.4943 hepatocellularcarcinoma associated prat 3.00 102233AW163045 Hs.79334 nuclear factor, intedeukin 5 1 3 regulated 3.00 02628090322 Hs.27812 G protein-coupled receptor 23 3.00 112812H55977 Hs.35810 ESTs 3.00 114654AA101840 Hs.103679 ESTs 3.00 118555N68372 gb:za68c10.s1 Snares fetal-lung-NbHLI9W
3.00 120005W90105 Hs.94942 EST 3,00 59 AA421130 Hs.112640 EST 3.00 126134AL133033 Hs.4084 KIAA1025 protein 3,pp 126194H98755 Hs.302975 ESTs, Weakly similar to 2195 HUMAN ZINC 3.00 129778AK001676 Hs.12457 hypothetical protein FLJ10814 3.00 65 Table 3B:
Pkey: Unique Eos probeset identifier number CAT number Gene cluster number Accession: Genbank accession numbers 7o Pkey AT number Accession 104172273499 AA4764i8 AA393338 AA398747 AA476518 126426110687_1 AA125984 AA127189 AA065075 AA070377 AA100017 AA079891 103731112052 AA070545 AA13i490 AA131373 Jr 127263_ AA331156 AA331157 AA331155 127532353907 AJ003429 AJ003367 AA56d825 I 112516_ T83909 868586 ~ 1744223_1 11263117d6257 882040 870934 121481123001 AA41i931 AA411930 120934_ AA226198 AA226513 AA383773 106566120358_1 BE298210 A1672315 AW086489 BE298417 AA455921 AA902537 BE32712d R1d963 AA085210 AW274273 A1333584 121743274582_1 AA397636 AA421144 11d699135322 AA127386 815644 AA127404 25 106851_ A1458623 AA639708 AA485409 822065 AA485570 123731genbank-AA609639AA609839 11679374964_1 T77781 AW014157 D12d22 A1918246 AA452599 AA628d04 109700genbank F09609F09609 118466genbank N66741N667d1 111273genbank-N70934N70934 118555genbank N68372N68372 111462genbank 805296 5 genbank N73515 118737382979_1 AA199686 N73861 111826genbank 835975835975 120376genbank-AA227469AA227469 120809genbank AA346495 120839_ AA348913 genbank-AA348913 120873genbank-AA358015AA358015 115498genbanILAA291070AA291070 101045entrez J05614J05614 129969genbank N57818 45 108407_ AA0755i9 genbanILAA075519 122939genbanI~AA477141AA477141 117031genbank_H88353H88353 124298genbank H91679H91679 101447enfrez_M21305M21305 124357genbank N22401N22401 1017232603_1 034304 AA355800 M69181 AA375523 AA093590 AA365595 F07288 AAi 50346 H83264 T86770 N36366 AA337253 N84522 Ai143322 W74368 Ci 6356 AI129361 AI917986 AI582253 AI923898 AI640420 A1004136 Ai277797 016100 F09836 T71212 AW090781 A1055902 T1608d AW022915 016556 AW473979 124677genbank 801073801073 110243genbank H26683H26683 101867entrez M96132M96132 101941entrez-S77583S77583 119052149538_1 810889 810888 119263genbank-T15977T15977 112040genbank 843286843286 75 103657entrez 273677273677 119400genbanILT92767T92767 119554NOT_FOUND_enirez_W38188W38188 123130genbank_AA487200AA487200 123143genbank AAd87595AA487595 121950genbank-AAd29515AA429515 123265genbank_AA491209AA491209 114988genbank-AA251089AA251089 107794genbank_AA019255AA019255 IIS

123422 genbanI~AA598484 AA598484 109062 genbank-AAi6094i AA16094i S TABLE
4A: A80U71164 GENES
UPREGULATED
IN GLIOBLASTOMA

Pkey: Unique Eos probeset identifier number ExAccn: ExemptarAccessicn number, Genbank accession number UnigenelD:Unigene number Unigene Unigene gene title Title:
1 ~

R1: Ratio of brain tumor to body atlas R2: Rafio of brain tumor to normal brain Pkey ExAccnUnigenelDUnigene Title Ri R2 412719AW016610Hs.i29911ESTs 117.8 3.3 S

428321AI699994Hs.301347ESTs 108.9 3 455601A1368680Hs.816SRY (sex determining 107.5 .
region Y)-box 2 9.9 431917D16181Hs,2868peripheral myelin protein99.0 11 415817088967Hs.78867protein tyrosine phosphatase,72.0 .
receptor-i 11 449494AW237014Hs.288650aquapodn 4 60.0 .
4 2.2 39285AL133916Hs.298998ESTs 58.2 2.2 447072D61594Hs,17279iyrosylprotein sulfoUansferase54.2 7 456759BE259150Hs.i27792delta (Drosophilarlike53.5 .
3 2.5 427343AI880044Hs.176977protein kinase C binding49.6 2 protein 2 2 425088AA663372Hs.169395Homo Sapiens cDNA FLJ1201549.5 .
~S fis, clone HE 3.1 412959D87458Hs.75090KIAA0282 protein 46.3 3 447004AW296968Hs.157539ESTs 43.7 .
3.2 436878BE465204Hs.47448ESTs 39.8 10 433551AI985544Hs,289048ESTs 39.7 .
4.3 425842AI587490Hs.i59623NK-2 (Drosophila) homolog39.3 26.2 07034084540 gb:Human dystrobrevin 39.1 39.1 isoform DTN-3 (DTN

431725X65724Hs.2839Nome disease (pseudoglioma)38.4 3 453392023752Hs.32964SRY (sex determining 37.5 .
region Y)-box 11 22 447197836075 gb:yh88b01.s1 Soares 37.5 , placenta Nb2HP Homo 13 439415F05538Hs.12825ESTs 35.4 .
3 3.1 S

409395046745Hs.54435dystrobrevin, alpha 34.3 3 449539W80363Hs.58446ESTs 33.6 .

408562A1436323Hs.31141Homo Sapiens mRNA for 32.8 .
KIAA1568 protein, 5 431019NM-005249Hs.2714forkhead box G18 32.4 .

427540812014Hs.20976ESTs 32.1 .
40 2.0 425057AA826434Hs.96944ESTs 31.0 2 431941AK000106Hs.272227Homo Sapiens cDNA FLJ2009930.8 .
fis, clone CO 30.8 416829AB013805Hs.80220catenin (cadherin-associated30.4 2 protein), d 2 420807AA280627Hs.57846ESTs 30.4 , 444190AI878918Hs.10526cysteine and glycine-rich30.4 .
4S 4 protein 2 30.4 29 M85835Hs.12827ESTs 30.2 7 444471AB020684Hs.11217KIAA0877 protein 29.5 .
29.5 451678AA374181Hs.26799DKFZP564D0764 protein 28.8 3 439979AW600291Hs.6823hypotheficaiprotein 27,7 .

433800A1034361Hs.135150lung type-I cell membrane-associated27,1 .
S~ 4 gly 27,1 4 AL042201Hs.21273ESTs 26.9 26 411078AI222020Hs.182364ESTs, Weakly similar 26.0 .
to 25 kDa trypsin 26 t 0 407808AA663559Hs.289109dimethylarginine dimethylaminohydrolase25.8 .

416155AI807264Hs.205442ESTs, Weakly similar 25.5 .
to AF1176101 inner 25 421659NM Hs.106511protocadherin 17 25.0 .
SS 014459 3.3 430132AA204686Hs.234149hypothetical protein 24.7 24.7 433332AI367347Hs.127809ESTs 24.6 24 452744A1267652Hs.30504Homo Sapiens mRNA; 23.8 .
cDNA DKFZp434E082 23.8 (fr 419271N34901Hs.238532ESTs 23.6 5 447397BE247676Hs.18442E-1 enzyme 23.1 .
43 3.2 9039 A1656707Hs.48713ESTs 23.0 7 414175AI308876Hs.103849ESTs 22.2 .

451099852795Hs.25954interleukin 13 receptor,22.0 .
alpha 2 7 410102AW248508Hs.279727Homo Sapiens cDNA FLJ1403521.6 .
fis, clone HE 2 415910020350Hs.78913chemokine (GX3-C) receptor21.2 , 6S 1 3,0 451-068AW503398Hs.2i0047ESTs 21.0 4 454117BEd10100Hs.40368adaptor-related protein20.8 .
complex t, sigma 20 443850AW014723Ns.134719ESTs 20.4 .

418738AW388633Hs.6682ESTs 20.2 .

449433A1672096Hs.9012ESTs 19.9 .
4 16.6 357D6W31254Hs.7045GL004 protein 19.7 19 407192AA609200 gb:af12e02.s1 Soares 19.7 .
testis-NHT Homo sap 19 416892L24498Hs.80409growth arrest and DNA-damage-inducible,19.6 .

442562BE379584Hs.34789ESTs 19.4 .

439451AF086270Hs.278554heterochromatin-like 19.1 .
7S 4 protein 1 17.4 26320W47595Hs.169300transforming growth 18.7 5 factor, beta 2 4 412986X81120Hs.75110cannabinoid receptorl 18.6 .
(brain) 18 452106A1141031Hs.21342ESTs 18.6 .

431173AW971198Hs.294068ESTs 18.6 .

422503AA410506Hs.i H.sapiens mRNA for 18.5 .
4 18578ribosomal protein 18.5 19088AI538323Hs.77496small nuclear ribonucleoprotein18.5 18 polypept 5 443547AW271273Hs.23767Homo Sapiens cDNA FLJ 18.5 .
12666 fis, clone NT 5 451592AI805416Hs.213897ESTs 18.4 .

450313A1038989Hs.24809hypothetical protein 18.3 .
FLJ10826 18.3 422544AB018259Hs.118140KIAA0716 gene product 18.2 4.7 408096BE250162Hs.83765dihydrofotate reductase18.0 18.0 418027AB037807Hs.83293hypotheficalprolein 18.0 8.2 414117W88559Hs.1787proteolipid protein 18.0 18.0 (Pelizaeus-Meabache 429418AI381028Hs.99283ESTs 17.8 17.8 432527AW975028Hs.102754ESTs 17.7 4.2 447809AW207605Hs.164230ESTs, Highly similar 17.5 4.3 1o phosphodiesteras 419704AA429104Hs.45057ESTs 17.4 4.6 436476AA326108Hs.53631ESTs, Weakly similar 17.4 2.1 to enhancer-of-spli 1 445133AW157646Hs.153506ESTs, Weakly similar 17.3 18.8 ~ to AF1507551 micro 446659AI335361Hs.226376ESTs 17.2 2.6 409049A1423132Hs.146343ESTs 17.2 3.8 443672AA323362Hs.9667butyrobelaine (gamma),17.2 11.0 2-oxoglutarate d1 407748AL079409Hs.38176KIAA0606 protein; SCN 17.0 6.3 Circadian Oscillat 1 438527AI969251Hs.143237ESTs 16.9 16.9 417791AW965339Hs.ti1471ESTs 16.8 10.5 417355D13168Hs.82002endothelin receptor 16.4 16.4 type B

427897NM Hs.181060apelin; peptide ligand16.3 4.2 017413 for APJ receptor 419721NM Hs.288650aquaporin 4 16.2 4.4 427701AA411101Hs.221750ESTs 16.1 3.9 432435BE218886Hs.282070ESTs 16.1 5.7 426809BE313114Hs.29706ESTs 16.0 10.0 407881AW072003Hs.40968heparan sulfate (glucosamine}15.9 15.9 3-0-sulfot 400859 15.7 15.7 409731AA125985Hs.56145ihymosin, beta, idenfified15.6 15.6 in neuroblast 420092AA814043Hs.88045ESTs 15.6 5.4 449605AW138581Hs.198416ESTs 15.5 3.0 422365AF035537Hs.115521REV3 (yeast homology-like,15.3 4.6 catalytic sub 449611AI970394Hs.197075ESTs 15.2 15.2 30 414922D00723Hs.77631glycine cleavage system15.2 5.6 protein H (amino 405238 15.1 2.8 429007D80642 gb:HUM092E09B Human 15.0 3.5 fetal brain (TFujiwa 409638AW450420Hs.21335ESTs 14.9 7.1 445888AF070564Hs.13415Homo Sapiens clone 14.8 5.7 24571 mRNA sequence 35 416737AF154335Hs.79691LIM domain protein 14.7 4.2 429163AA884766 gb:am20a10.s1 Soares-NFLLT-GBC-S114.6 3.0 Homo s 436870AW204219Hs.43679ESTs ' 14.6 2.6 443181A1039201Hs.54548ESTs 14.6 3.5 436281AW411194Hs.120051ESTs 14.5 8.5 449448D60730Hs.57471ESTs 14.4 4.8 d22564AI148006Hs.222120ESTs 14.4 14.4 448243AW369771Hs.77496small nuclear dbonucleoprotein14.3 2.4 polypept 428748AW593206Hs.98785ESTs 1d.2 14.2 452576AB023177Hs.29900KIAA0960 protein 14.1 8.1 45 452461N78223Hs.108106transcription factor 14.1 12.8 449670F07693Hs.23869Homo Sapiens mRNA; 14.1 14.1 cDNA DKFZp434K2172 (f 436637AI783629Hs.26766ESTs 14.0 2.3 429597NM a disinlegrin and metalloproteinase13.9 13.9 003816 doma Hs.2442 419078M93119Hs.89584insulinoma-associated 13.9 2.9 410889X91662Hs.66744twist (Drosophila) 13.9 4.1 homolog (acrocephalos 452355N54926Hs.29202G protein-coupled receptor3413.9 13.9 421452A1925946Hs.104530fetal hypothetical 13.9 13.9 protein 430290AI734i10Hs.i36355ESTs 13.8 13.8 430387AW372884Hs.240770nuclear cap binding 13.6 13.6 protein subunit 2, 55 415875AA89d876Hs.5687protein phosphatase 13.5 13.5 1B (formerly 2C), ma 416795AI497778Hs.168053ESTs, Highly similar 13.5 13.5 to AF2279481 HBV p 422025BE348774Hs.122554ESTs 13.3 13.3 400992 13.3 5.5 413174AA723564Hs.191343ESTs 13.2 2.5 60 425187AW014486Hs.22509ESTs 13.1 8.2 456965AW131888Hs.172792ESTs, Weakly similar 13.1 2.7 to hypothetical pro 419852AW503756Hs.286184hypothefical protein 13.0 2.4 dJ551 D2.5 409327L41162Hs.53563collagen, type IX, 12.9 4.0 alpha 3 439519AA837118Hs.118366ESTs 12.9 7.6 65 436299AK000767Hs.5111hypothetical protein 12.7 3.1 446657AI335191Hs.260702ESTs, Moderately similar12.6 12.6 to ALU7-HUMAN A

423073BE252922Hs.123119MAD (mothers against 12.6 12.6 decapentaplegic, Dr 424278AK000723Hs.144517hypothetical protein 12.6 12.6 451996AW514021Hs.245510ESTs 12.6 7.0 70 400860 12.5 23.1 439579AF086400 gb:Homo Sapiens full 12.4 12.4 length insert cDNA

408312AF263613Hs.44198intracellular membrane-associated12.4 12.4 caiciu 419948A8041035Hs.93847NADPH oxidase 4 12.4 2.4 427304AA761526Hs.163853ESTs 12.3 12.3 75 419498AL036591Hs.20887hypothetical protein 12.2 12.2 428137AA421792Hs.170999ESTs 12.2 12.2 432683AW995441Hs.10475ESTs 12.2 2.0 408622AA056060Hs.202577Homo Sapiens cDNA FLJ 12.1 12.1 12166 fis, clone MA

453884AA355925Hs.36232KIAA0186 gene product 12.0 5.2 441440AI8079B1Hs.30495ESTs 12.0 3.6 414217AI309298Hs.279898Homo Sapiens cDNA: 12.0 62.7 FLJ23165 fis, clone L

410227A8009284Hs.61152exostoses (multiple)-like11.9 2.9 439444AI277652Hs.54578ESTs 11.9 16.5 433309AA807060Hs.126558ESTs 11.7 9.0 439170AA332365Hs.165539ESTs 11.6 9.7 417160N76497Hs.1787proteofipid protein 11.5 7.2 (Pelizaeus-Meabache 424668D83702Hs.151573cryptochrome 1 (photolyase-like)11.5 5.8 410611AW954134Hs.20924KIAA1628 protein 11.5 28.2 437124AA554458Hs.204200ESTs 11,5 11.5 418858AW961605Hs.21145Homo Sapiens cDNA: 11.3 11.3 FLJ22489 fis, clone H

423fi00A1633559Hs.29076Homo Sapiens cDNA: 11.3 2.8 FLJ21841 fis, clone H

429393AA383024Hs.201603ESTs, Highly similar 11.3 11.3 to hypothetical pro 1 431103M57399Hs.44pteiotrophin (heparin 11.3 3.4 ~ binding growth fat 452092BE245374Hs.27842hypotheficalprotein 11.3 11.7 431701AW935490Hs.14658ESTs 11.3 2.6 429399AA452244Hs.16727ESTs 11,2 2.2 408988AL119844Hs.49476Homo Sapiens clone 11.2 27.8 TUAB Cri-du-chat regi 442671At005668Hs.134779EST 11.1 11.1 402524 11'1 11'1 415558AA885143Hs.1257i9ESTs 11.1 11.1 422390AW450893Hs.121830ESTs, Weakly similar 11.0 8.8 to KIAA0924 protein 418475AI858732Hs.30443sentrinISUMO-specific 11.0 6.1 protease 458809AW972512Hs.20985sin3-associated polypepfide,11.0 5.6 30kD

410297AA148710Hs.159441ESTs 11.0 3.3 444017004840Hs.214neuro-ontological ventral11.0 11.0 antigen 1 437814A1088192Hs.135474ESTs, Weakly similar 10.9 3.3 to DDX9-HUMAN ATP-D

427194AA399018Hs.250835ESTs 10.8 8.0 25 432060AW971364 gb:EST383453 MADE resequences,10.8 10.0 MAGL Homo 453861A1026838Hs.30120ESTs 10.8 10.8 408829NM Hs.d8384heparan sulfate (glucosamine)10.6 3.3 006042 3-0-sulfot 416913AW934714 gb:RC1-DT0001-031299-011-all10.6 3.4 DT0001 Homo 418049AA211467Hs.190488hypotheficalprotein 10.6 10.6 413063AL035737Hs.75184chitinase 3-like 1 10.6 27.2 (cartilage glycoprote 425264AA353953Hs.20369ESTs, Weakly similar 10.5 2.0 to gonadotropin ind 434408A1031771Hs.132586ESTs 10.5 10.5 451697AW44977dHs.2572D8ESTs 10.5 6.2 436754A1061288Hs.133437ESTs, Moderately similar10.3 10.3 to gonadotropin 3 410298AI693821Hs.182185ESTs 10.3 2.9 S

412766BE544475Hs,54347ESTs 10.3 10.3 450689A1369275Hs.243010ESTs, Moderately similar10.3 10.3 to RTCO_HUMAN G

408331NM dual specificdy phosphatase10.3 4.5 Hs,44229 442007AA301116Hs.142838Homo Sapiens cDNA: 10.3 10.3 FLJ23444 fis, clone H

410386W26187Hs.3327Homo Sapiens cDNA: 10.2 2.1 FLJ22219 fis, clone H

440684AI253123Hs.127356ESTs, Highly similar 10.1 10.1 io NEST HUMAN NESTI

420892AW975076Hs.172589nuclear phosphoprotein10.0 10.0 similar to S. cer 419594AA013051Hs.91d17topoisomerase (DNA) 9.9 15.8 II binding protein 419972AL041465Hs.294038ESTs, Moderately similar9.7 23.2 to ALU2-HUMAN A

433730AK002135Hs.3542hypotheticalprotein 9.6 6.5 434851AA806164Hs.116502ESTs 9.5 6.5 436306AA805939Hs.117927ESTs 9.5 4.7 453331AI240665Hs.8895ESTs 9.2 5.8 414429851494Hs.71818ESTs 9.D 6.2 424998058515Hs.154138chitinase 3-like 2 8.9 18.1 446936H10207Hs.47314ESTs 8.9 3.6 410276A1554545Hs.68391ESTs 8.8 3.8 453857AL080235Hs.35861DKFZP586E1621 protein 8.8 3.8 448321NM adenomalous polyposis 8.8 2.0 005883 coli like Hs.20912 55 414783AW069569Hs.75839zinc finger protein 8.7 3.0 6 (CMPX1) 441079AW150697Hs.107di8ESTs 8.7 2.2 437517AI927675Ns.99858ribosomal protein L7a 8.6 4.5 409062AL157488Hs.50150Homo sapiens mRNA; 8.6 12.2 cDNA DKFZp564B182 (fr 420630AL13310iHs.99508Homo Sapiens mRNA; 8.6 10.4 cDNA DKFZp4340092i (f 409260AW242407Hs.18479ESTs 8.5 11.6 442343AA992480Hs.129874ESTs 8.4 4.6 416439AA180363Hs.118769ESTs 8.d 7.2 428054A1948688Hs.266619ESTs 8.2 9.2 421633AF121860Hs.tOfi2fi0sorfing nexin 10 8.2 2.6 6J~433285AW97594d ESTs 8.1 3.3 Hs.237396 433226AW503733 KIAA1488 protein 8.0 13.4 Hs.9414 424800AL035588Hs.153203MyoD family inhibitor 8.0 2.5 425681AB018297Hs.159i83KIAA0754 protein 7.9 4.8 445034AW293376 ESTs 7.9 3.7 Hs.160323 7~ 435020AW505076 7.6 6.4 Hs.301855 DiCteorge syndrome critical region gene 446985AL038704Hs,i56827 7.5 7.8 ESTs, Weakly similar to ALUi HUMAN
ALU
S

446619AU076643 secreted phosphoprotein7.5 3.9 Hs.313 1 (osteopontin, 418522AA605038 Homo sapiens cDNA: 7.5 2.2 Hs.7149 FLJ21950 fis, clone H

439864AI720078Hs.291997 7.A 6.9 ESTs 75 419723AL120193Hs.92614Homo Sapiens growth 7.4 3.5 differenfiation fact 447896AI436124Hs.294069 7.3 22.1 ESTs, Weakly similar to contains a 404210 7.3 40.8 436671AW137159 7.2 11.8 Hs.146151 ESTs 439231AW581935 7.2 2.5 Hs.141480 ESTs 8~'418030BE207573 neuromedin B 7.1 6.4 Hs.83321 459290NM inhibitor of DNA binding7.0 6.7 001546 4, dominant neg Hs.34853 423869BEd09301 7.0 4.9 Hs.134012 Ciq-relatedfactor 414825X06370Hs.77432epidermal growth factor6.9 6.4 receptor (avian 420D18056387Hs.94376proprotein convertase6.9 8.6 subfilisinlkexin t 428600AW863261Hs.15036ESTs,HighlysimilartoAF1613581HSPC06.9 7.7 438380T06430Hs.6194chondroitin sulfate 6.9 3.1 proleoglycan BEHABIb 402604 6.8 7.0 417022NM Hs.80905Ras association (RaIGDSIAF-6)6.8 2.5 014737 domain fam 405239089281Hs.11958oxidative 3 alpha 6.8 2.9 hydroxysteroid dehydro 433577AW007080Hs.8817ESTs 6.6 2.6 434629AA789081Hs.4029glioma-amplified sequence-d16.6 13.9 413886AW958264Hs.103832ESTs, Weakly similar 6.6 2.2 to TRHY_HUMAN TRICH

1 451460AI797550Hs.209652ESTs 6.5 13.7 ~

442145A1022650Hs.8117erbb2-interacting 6.5 15.6 protein ERBIN

437273AL137451Hs.120873ESTs, Highly similar 6.5 2.4 to hypothefical pro 418365AW014345Hs.16169DESTs 6.4 12.8 421684BE281591Hs.106768hypotheficalprotein 6.4 4.3 1 449458A1805078Hs.208261ESTs 6.4 2.3 426413AA377823 gb:EST90805 Synovial 6.3 13.2 sarcoma Homo sapien 426423NM Hs.169833single-stranded-DNA-binding6.3 10.9 012446 protein 417709D8i434Hs.82426KIAA0247 gene product6.3 23.3 448499BE613280Hs.250655prothymosin, alpha 6.2 2.9 (gene sequence 28) 20 444860AW118683Hs.154150ESTs 6.2 19.4 432715AA247152Hs.200483ESTs, Weakly similar 6.2 12.7 to KIAA1074 protein 444864AW965446Hs.46637ESTs, Weakly similar 6.2 4.1 to cDNA EST yk289g5 407792A1077715Hs.39384putafive secretedligand6.2 3.4 homologoustof 431962AL049385Hs.272251Homo Sapiens mRNA; 6.1 2.6 cDNA DKFZp586M1418 (f 25 424232AB015982Hs.143460protein kinase C, 6.1 14.6 nu 436443AW138211Hs.128746ESTs 6.1 2.8 433647AA603367Hs.222294ESTs 6.1 15.0 449961AW265634Hs.133100ESTs 6.1 3.4 448704AW080932Hs.249247heterogeneous nuclear6.1 6.1 protein similar to 408393AW015318Hs.23165ESTs 6.1 21.6 450693AW450461Hs.203965ESTs fi.i 2.2 407846AA426202Hs.40403CbpIp300-interacfingtransacfivalor,6.0 2.4 wit 445817NM Hs.13340histone acetyltransferase6.0 10.9 440650844692Hs.6640ESTs 6.0 2.1 417675A1808607Hs.3781similar to murine 6.0 2.4 leucine-rich repeat pr 411083N41340Hs.68318hypotheticalprotein 6.0 3.6 407910AA650274Hs.41296fibronectin leucine 6.0 6.0 rich transmembrane p 402855 6.0 2.6 445594AW058463Hs.12940zinc-fingers and homeoboxes6.0 11.6 40 418791AA935633Hs.194628ESTs 5.9 6.7 409262AK000631Hs.52256hypothetical protein 5.9 2.3 435677AA694142Hs.293726ESTs 5.9 11.8 430334A1824719Hs.47557ESTs 5.9 7.5 452834AI638627Hs.105685ESTs 5.9 2.6 45 427315AA179949Hs.175563Homo Sapiens mRNA; 5.8 3.1 cDNA DKFZp564N0763 (f 428250AW809208Hs.183297DKFZP566F2124 protein5.8 2.0 418506AA084248Hs.85339G protein-coupled 5.8 2.5 receptor 39 417115AW952792Hs.1066small nuclear ribonucleoprotein5.8 16.0 polypept 436758AW977167Hs.155272ESTs 5.8 3.6 446332AK001635Hs.14838hypothetical protein 5.7 5.1 423943AF163570Hs.135756polymerase (DNA-directed)5.7 11.1 kappa 428180A1129767Hs.182874Homo Sapiens cDNA: 5.6 7.1 FLJ21929 fis, clone H

424343AW956360Hs.4748ESTs,HighlysimilartoJN0902pituitary5.6 2.2 417318AW953937Hs.12891ESTs 5.6 25.0 55 423582BE000831Hs.23837Homo Sapiens cDNA 5.6 4.1 FLJ11812 fis, clone HE

427472AA522539Hs.131250transposon-derived 5.4 3.5 Busier3transposase-I

434701AA460479Hs.4096tGAA0742 protein 5.4 21.2 430147860704Hs.234434hairy/enhancer-of-split5.3 2.7 related with YRP

411019AW993097Hs.48617Homo Sapiens cDNA 5.3 4.1 FLJ12540 fis, clone NT

424939AK000059Hs.153881Homo sapiens NY-REN-625.3 Z.d antigen mRNA, par 424028AF055084Hs.153692KIAA0686 protein 5.3 2.7 444534AW271626Hs.42294ESTs 5.3 2.1 426171A1128606Hs.301454ESTs 5.2 3.8 431843AA516420Hs.183526ESTs 5.2 6.2 65 438204AI589645Hs.128690ESTs 5.2 5.8 424635AA420687Hs.115455Homo Sapiens cDNA 5.2 8.4 FLJ14259 fis, clone PL

436223AK001884Hs.23799ESTs 5.2 2.4 450649NM-001429 Human DNA sequence 5.2 15.3 Hs.297722 from clone RP1-85F18 441689AI123705Hs.106932ESTs 5.2 2.2 443392A1055821Hs.293420ESTs 5.1 3.3 416179819015Hs.79067MAD (mothers against 5.1 16.7 decapentaplegic, Dr 452167N75238Hs.13075Homo Sapiens cDNA: 5.1 18.7 FLJ23013 fis, clone L

4340D1AW950905Hs.3697serine (orcysteine) 5.0 2.4 proteinase inhibito 458435AI418718Hs.144121ESTs, Weakly similar 5.0 3.9 to dJ37E16.2 [H.sap 75 433586T85301 gb:yd78dO6.s1 Soaresfetalliverspleen5.0 2.8 452040AW973242Hs.293690ESTs 5.0 4.5 404029 5.0 d.3 421141AW1i7261Hs.125914ESTs 5.0 2.1 402605 4.9 4.2 435839AF249744Hs.25951Rho guanine nucleotide4.9 2.5 exchange factor ( 416404AA180138Hs.107924ESTs 4.9 2.4 435615Y15065Hs.4975potassium voltage-gated4.9 7.2 channel, KOT-lik 448425A1500359Hs.233401ESTs 4.9 4.9 445773H73456Hs.13299Homo Sapiens mRNA; 4.9 2.9 cDNA DKFZp761 M0111 (f 448451AW015994 gb:Ul-H-BIOp-abh-g-09-D-ULs14.9 2.2 NCI_CGAP_S

444838AV65168DHs.208558ESTs 4.8 6.7 452438BE514230Hs.29595JM4 protein 4.8 2.7 443898AW804296Hs.9950Sec61 gamma 4.8 7.2 452776AA194540Hs.13522ESTs d.8 3.4 426108AA622037Hs.166468programmed cell death4.8 16.7 416774A1005169Hs.28274Homo Sapiens cDNA: 4.8 3.2 FLJ22049 fis, clone H

427704AW971063Hs.292882ESTs 4.8 23.8 1 433568A1056872Hs.133386ESTs 4.8 12.8 ~

410108AA081659Hs.191098KIAA1d79 protein 4.7 2.1 433556W56321Hs.111460Homo Sapiens cDNA: 4.7 11,2 FLJ21715 fis, clone C

418962AA714835Hs.271863ESTs 4.7 2.2 404049 4.7 3.0 1 436222A1208737Hs.122810Homo sapiens cDNA d.7 3.3 S FLJ11489 fis, clone HE

425234AW152225Hs.165909ESTs 4.7 3.1 426490NtvL001621Hs.170087arylhydrocarbon receptor4.7 9.1 426514BE616633Hs.301122bone morphogenefic 4.7 2.7 protein 7 (osteogenic 428722U76456Hs.190787fissue inhibitor of 4.6 6.7 metalloproteinase 451989AF169797Hs.27413adaptor protein containing4.6 13.4 pH domain, PT

412490AW803564Hs.288850Homo Sapiens cDNA: 4.6 18.4 FLJ22528 fis, clone H

422488AI679968Hs.152060ESTs 4.6 7.7 428862NM Hs.2316SRY (sex-determining d.6 4.6 OD0346 region Y)-box 9 (ca 413724AA131466Hs.23767Homo Sapiens cDNA 4.5 11.9 FLJ12666 fis, clone NT

25 442495A1184717 gb:qd6db01.x1 Snares d.5 4.5 tesfis-NHT Homo sap 403549 d.5 11.6 456209W60633Hs.297792ESTs 4.5 5.1 421181NM Hs.184585LIM domain only 2 4.5 10.6 005574 (rhombofin-like 1) 439566AF086387 gb:HomosapiensfulllengthinsertcDNAd.4 2.6 3 446329NM Hs.14805solute cartier family4.4 17.2 0 Ot3272 21 (organic anion 446488AB037782Hs.15119KIAA1361 protein 4.4 8.4 426110NM Hs.166563replication factor 4.4 2.5 002913 C (activator 1) 1 (14 427413BE547647Hs.177781superoxide dismutase 4.4 14.3 2, milochondrial 424340AA339036Hs.7033ESTs 4.4 3.9 3 421552AF026692Hs.105700secreted frizzled-related4.3 31.1 protein 4 422033AW245805Hs.110903claudin 5 (Vansmembrane4.3 6.1 protein deleted 434476AW858520Hs.271825ESTs 4.3 4.5 420582BE047878Hs.99093Homo Sapiens chromosome4.3 3.6 19, cosmid 82837 419904AA974411Hs.18672ESTs 4.3 17.1 407939W05608 gb:za85e01.r1 Snares 4.3 ~ 9.0 fetal lung_NbHLI9W

425636AW955696Hs.94842ESTs 4.3 3.2 ~

426304AA374532Hs.297985ESTs 4.3 6.6 439653AW021103Hs.6631hypothefical protein 4.3 2.3 424723BE409813Hs.152337protein arginine N-meihyltransferase4.3 2.5 3(h 45 426064BE387014Hs.i661d6Homer, neuronal immediate4.2 4.1 early gene, 3 409509AL036923Hs.127006ESTs 4.2 16.4 424391BE55D112Hs.t12712ESTs 4.2 3.8 425248AW957442Hs.252766ESTs 4.2 11.1 418259AA215404Hs.137289ESTs 4.2 19.3 445525BE149866Hs.14831ESTs 4.2 3.1 414821M63835Hs.77424Fc fragment of IgG, 4.2 34.8 high affinity la, re 430935AW072916Hs.115654ESTs 4.2 3.0 442233AW967149Hs.28439ESTs, Weakly similar 4.2 2.4 to ORF2 (M.musculus 416959D28459Hs.80612ubiquitin-conjugating4.1 15.3 enzyme E2A (RAD6 h 55 437097N45312Hs.d6506ESTs 4.1 15.6 428189AA424030Hs.46627ESTs 4.1 3.6 434963AW974957Hs.288719Homo Sapiens cDNA 4.1 12.2 FLJ12142 fis, clone MA

425500AB011541Hs.158200EGF-like-domain, mulfiple4.1 2.8 d 435177A1018174Hs.42936ESTs 4.1 2.1 418357244718Hs.301010ESTs, Highly similar 4.1 4.1 to AF159851 1 Rho G

419086NM Hs.89591Kallmann syndrome 4.1 4.1 000216 1 sequence 436557W15573Hs.5027ESTs 4.0 2.1 425586F07396Hs.46751ESTs 4.0 2.2 423905AW579960Hs.135150lung type-I cell membrane-associated4.0 3.6 gly 437095D14661Hs.119Wilms' tumour 1-associating4.0 10.0 protein 425332AA633306Hs.127279ESTs 4.0 10.9 431556AF016028Hs.260039sarcospan(Kras oncogene-associated4.0 3.8 gene 427209H06509Hs.92423KIAA1566 protein 4.0 3.1 435468AW362803Hs.166271ESTs 4.0 2.2 416773AK000340Hs.79828hypotheficalprotein 4.0 2.6 440483A12D0836Hs.150386ESTs 4.0 2.5 444821AA053564Hs.12040STE20-like kinase 4.0 10.4 433873AWi56913Hs.150478ESTs, Weakly similar 4.0 2.3 to KIAA0987 protein 420028AB014680Hs.8786carbohydrate (chondroifin3.9 2.8 6lkeratan) sul 75 446706AW807631Hs,190488hypothefical protein 3.9 3.8 424530AI632083Hs.28511ESTs 3.9 2.2 446851AW007332Hs.16261Homo sapiens cDNA: 3.9 16.0 FLJ22063 fis, clone H

424720M89907Hs.152292SWIISNF related, matrix3.9 4.5 associated, acti 409456U34962Hs.54473cardiac-specific homeo3.9 8.0 box 420439AW270041Hs.193053eukaryotic translafion3.9 7.9 initiation factor 447340AW961327Hs.280833ESTs 3.9 2.1 430887N66801Hs.260287ESTs, Weakly similar 3.9 2.5 to ALU7 HUMAN ALU
S

409361NM sine oculis homeobox 3.9 4.6 405982 (Drosophila) homolo Hs.54416 426509M31166Hs.2050pentaxin-related gene,3.9 4.0 rapidly induced b 410079094362Hs.58589glycogenin 2 3.9 18.3 426818AA554827Hs.124841ESTs, Weakly similar 3.9 3.0 to ALUS HUMAN ALU
S

435232NM Hs.4854cycfin-dependent kinase3.8 4.D
001262 inhibitor 2C (p1 427228AA115770Hs.174051small nuclear ribonucleoprotein3.8 7.9 70kD pot 443801AW206942Hs.253594ESTs 3.8 3.4 450746D82673Hs.169921generalfranscdpfionfactorll,i,pseu3.8 2.2 443837A1984625Hs.9884spindle pole body 3.8 6.5 protein 435760AF231922Hs.213004chromosome 21 open 3.8 2.2 reading frame 62 1 426757AW205640Hs.158206ESTs 3.7 3.1 443101A1268936Hs.129872sperm surface protein3.7 2.4 440118AB040893Hs.6968KIAA1460 protein 3.7 3.5 410612AW502698Hs.118152ESTs 3.7 22.5 435869AF255910Hs.5d650vascular endothelial 3.7 4.2 juncfion-associated 1 433208AW002834Hs.24095ESTs 3.7 16.0 432357AA452506Hs.274412similar to yeast Upf3,3.7 2.6 variant A

413916N49813Hs.75615apclipoprotein GII 3.7 5.4 429766AA612710Hs.146140ESTs 3.7 3.2 437470. AL390147Hs.734742hypothetical protein 3.7 6.4 DKFZp547D065 438459T49300Hs.35304Homo Sapiens cDNA 3.7 10.7 FLJ13655 fis, clone PL

420361N92054Hs.206910ESTs 3.7 18.7 408819AW163483Hs.48320DKFZP56681346 protein3.7 8.8 411960877776Hs.18103ESTs 3.7 2.3 435923BE301930Hs.5010Homo Sapiens clone 3.7 2.2 24672 mRNA sequence 25 440145AW021433Hs.250863ESTs 3.7 3.8 453740AL120295 gb:DKFZp761M067-s1 3.6 3.0 761(synonym:hamy2) 440975AW499914Hs.7579hypothetical protein 3.6 2.0 443135AI376331Hs.156103ESTs 3.6 12.4 419687A1638859Hs.227699ESTs, Weakly similar 3.6 2.7 to Yhr217cp [S.cere 451029AA852097Hs.25829ras-related protein 3.6 2.9 414512AL044336Hs.6831golgi resident protein3.6 10.5 410853H04588Hs.30469ESTs 3.6 23.9 419900AI469960Hs.i70698ESTs 3.6 3.6 429673AA884407Hs.211595protein tyrosine phosphatase,3.6 7.5 non-recept 35 428290AI932995Hs.183475Homo Sapiens done 3.6 9.6 25061 mRNA sequence 444381BE387335Hs.283713ESTs, Weakly similar 3.6 4.9 to CA54_HUMAN COLIA

442104L20971Hs.188phosphodiesterase 3.6 2.1 4B, cAMP-specific (dun 441269AWOf5206Hs.178784ESTs 3.6 2.8 447961W32791Hs.170405ESTs 3.5 4.6 447735AA775268Hs.6127Homo sapiens cDNA: 3.5 2.1 FLJ23020 fis, clone L

437580AA761075Hs.293567ESTs 3.5 3.5 447710A1420523Hs.161282ESTs 3.5 3.5 436446AW016809Hs.i19021ESTs 3.5 2.2 448412AI219083Hs.42532ESTs, Moderately similar3.5 4.1 to ALUS
HUMAN A

409712AA167385Hs.13583_ 3.5 3,8 ESTs 404048 3.5 3.2 440516S42303Hs.161cadherin 2, type 1, 3.5 5.1 N-cadherin (neuronal 409342AU077058Hs.54089BRCAt associated RING3.5 10.6 domain 1 456508AA502764Hs.123469ESTs, Weakly similar 3.5 3,8 to AF2088551 BM-01 42610fAL049987Hs.i66361Homo Sapiens mRNA; 3.5 32.2 cDNA DKFZp564F112 (fr 436252AI539519Hs.120969Homo Sapiens cDNA 3.5 4.6 FLJ 11562 fis, clone HE

433854AA610649 gb:np95c03.s1 NCI-CGAP_Thyi3.5 3,5 Homo Sapiens 408495W68796Hs.237731ESTs 3.5 6,1 418801AA228366Hs.115122ESTs 3.5 5 55 422493AW474183Hs.233816ESTs 3.5 .
15.2 428141D50402Hs.182611solute carrier family3.5 2.4 11 (proton-coupled 414591AI888490Hs.55902ESTs 3.5 8.3 439627BE621702Hs.29076Homo Sapiens cDNA: 3.5 30.2 FLJ21841 fis, clone H

444969AI203334Hs.160628ESTs 3.5 3 435370A1964074Hs.225838ESTs 3.5 .
3.0 443228W24781Hs.293798ESTs 3.4 4.6 414612BE274552Hs.76578protein inhibitor 3.4 5.0 of activated STAT3 437410AW023340Hs.14880ESTs 3.4 2.7 444172BE147740Hs.104558ESTs 3.4 12 65 428484AF104032Hs.184601solute carrier family3.4 .
7 (cationic amino 2.8 437860AA333063Hs.279898Homo Sapiens cDNA: 3.4 4.0 FLJ23165 fis, clone L

428776AW016636Hs.i55647ESTs, Highly similar 3.4 2.5 to 8291441 [H.sapi 409493AA386192Hs.193482ESTs 3.4 3.4 d32559AW452948Hs.257631ESTs 3.4 6 451455AI937227Hs.8821liver-expressed antimicrobial3.4 .
pepfide 6.1 444153AK001610Hs.10414hypothetical protein 3.4 2.6 FLJi0748 422872BE326786Hs.187646ESTs 3.4 2.2 414761AU077228Hs.77256enhancerofzeste(Drosophila)homolog3.4 2.6 416131L03532Ns.79024heterogeneous nuclear3.4 9.5 ribonucleoprotein 75 408576NM H4 histone family, 3.4 3.4 003542 member G
Hs.46423 431770BE221880Hs.2685555'-3' exoribonuclease3.4 21.2 426030BE243933Hs.108642zinc finger protein 3.4 2.1 22 (KOX 15) 422573AW297985Hs.28777H2A histone family, 3.4 3.7 member L

436865AW880358Hs.190488hypothetical protein 3.4 7.6 442091AW770493Hs,195904guanine nucleotide 3.4 2.9 binding protein (G
pr d18699BE539639Hs.173030ESTs, Weakly similar 3.4 5.5 to ALUB HUMAN ALU
S

434577837316Hs.179769Homo Sapiens cDNA; 3.4 3.9 FLJ22487 fis, clone H

430314AA369601Hs.239138pre-B-cellcolony-enhancingfactor3.4 18.8 447279AA325308Hs.18016Homo sapiens mRNA; 3,3 3.0 cDNA DKFZp586H0324 (f 410020T86315Hs.728ribonuclease, RNase 3.3 5.8 A family, 2 (liver, 447272NM Hs.17969KIAA0663 gene product3.3 13.4 407656AW747986Hs.37443Homo sapiens mRNA; 3.3 2.3 cDNA DKFZp43482119 (f 435354AA678267Hs.117115ESTs 3,3 5.5 443884N20617Hs.226627leptin receptor 3.3 8.6 444984H15474Hs.12214Homo Sapiens clone 3.3 2.0 23716 mRNA sequence 431053540369Hs.249141Glutamatereceptorsubunit3.3 2.4 424682AW60d804Hs.i51717KIAA0437protein 3.3 13.7 1 457972AI419060Hs.47448ESTs 3.3 d.2 ~

424762AL119442Hs.1836B4eukaryotic translation3.3 3.2 initiation factor 438666AW014d93Hs.126727ESTs 3.3 10.8 447796AW953622Hs.223025RAB31, member RAS 3.3 4.2 oncogene family 426751W92744Hs.22664ESTs 3.3 2.6 15 436251BE515065Hs.5092nucleolar protein 3.3 3.9 (KKEID repeat) 452688AA721140Hs.d9930ESTs, Weakly similar 3.3 4.9 fo 834087 hypotheti ~

416359AL042210Hs.16d93hypothetical protein 3.3 4.2 DKFZp762N2316 424090X99699Hs.139262XIAP associated factor-13.3 2.9 434987AW97511dHs.293273ESTs 3.3 2.2 428642Ntv>_,014899Hs.188006KIAA0878 protein 3.3 5.7 420372AW960049Hs.293660ESTs, Weakly similar 3.3 5.5 to A496f8 probable 422224NM_013982Hs.113264neuregulin 2 3.2 3.0 432482L19267Hs.275924dystrophic myotonica-containing3.2 2.7 WD repea 439963AW247529Hs.6793platelet-activating 3.2 2.0 factor acetylhydrola 25 428418AI368826Hs.30654ESTs 3.2 2.4 416728A8024597Hs.79658casein kinase 1, epsilon3.2 2.8 416224NM Hs.79088reticulocalbin 2, 3.2 2.2 002902 EF-hand calcium bindin 429803W81489Hs.223025RAB31, member RAS 3.2 4.3 oncogene family 431387Ai878854Hs.252229v-maf musculoaponeurotic3.2 2.8 fibrosarcoma (a 404171 3.2 35,8 435575AF2f Hs.dd234triggering receptor 3.2 2.6 3457 expressed on myeloid 426421AW367884Hs.169832zinc finger protein 3.2 3.8 42 (myeloid-specific 445070NM Hs.258adenosine A3 receptor3.2 7.6 407047X65965 gb:H.sapiens SOD-2 3.2 82.0 gene for manganese su 3 446006NM Hs.13530deafness, aulosomal 3.2 2.2 004403 dominanl5 430890X54232Hs.2699glypican 1 3.2 4.3 439807AA376417Hs.173501Homo Sapiens mRNA 3.2 2.3 for FLJ00008 protein, 430412AW341754Hs.189305ESTs 3.2 2.0 442807AL049274Hs.8736Homo Sapiens mRNA; 3.2 2.7 cDNA DKFZp564H203 (fr 420253AI656055Hs.96200neighbor of A-kinase 3.2 2.9 anchoring protein 436042AF284422Hs.119178canon-chloride cotransporter-tnterac6n3.2 4.6 423422AC005175Hs.128425NY-REN-24 antigen 3.2 4.0 413020898736 gb:yr31h09.r1Soaresfetalliverspleen3.2 4.1 452877AI250789Hs.32478ESTs 3.2 4.0 45 418113A1272141Hs.83484SRY (sex determining 3.1 9.0 region Yj-box 4 421097AI280112Hs.125232Homo Sapiens cDNA 3.1 2.0 FLJ13266 fis, clone OV

450219AI826999Hs.224624ESTs 3.1 23.7 434256A1378817Hs.191847ESTs 3.1 3.4 421407T82331Hs.127453ESTs 3.1 3.9 451198AW964541Hs.11500Homo Sapiens cDNA: 3.1 3.9 FLJ21127 tis, clone C

-045664AW968638Hs.237691ESTs 3.1 7.9 411089AA456454Hs.118637Homo Sapiens cDNA 3.1 6.0 FLJ13365 fis, clone PL

458050AA834708 gb:od99d04.s1 NCI 3.1 4.4 CGAP_Ov2 Homo Sapiens 454140A8040888Hs.41793hypothetical protein 3.1 2.7 55 417270AA4296i5Hs.98593Homo sapiens cDNA: 3.1 2.d FLJ23233 fis, clone C

427951AI826125Ns.43546ESTs 3.1 2.3 443693AI3d4782Hs.9683protein-kinase, interferon-inducible3.1 7.2 dou 413367NM_006517Hs.75317solute carrier family3.1 Z6 16 (monocarboxylic 429402AF116571Hs.201671SRY (sex detemtining 3.1 6.5 region Y)-box 13 447752M73700Hs.347lactotransferdn 3.1 19.4 408949AF789011Hs.49i63putative ribonuclease3.1 3.7 III

418039806859Hs.f93172ESTs 3.1 3.8 447343AA256641Hs.236894ESTs, Highly similar 3.1 2.2 to LRP1 HUMAN LOW-D

424441X14850Hs.147097H2A histone family, 3.1 3.2 member X

65 435163AA668884Hs.19155ESTs 3.1 2.1 428712AW085131Hs.190452KIAA0365 gene product3.i 2.7 434542AA769310Hs.61260hypothetical protein 3.1 14.3 FLJ1316d 428147AW629965Hs.234983ESTs 3.1 2.7 415825Y18024Hs.78877inosilot f,d,5-trisphosphate3.1 2.5 3-kinase B

422170AI791949Hs.112432anti-Mullerian hormone3.1 8.1 448801N57423FIs.179898HSPC055 protein 3.0 2.0 4135-028E295928Hs.75424inhibitor of DNA binding3.0 18.3 1, dominant neg 431562AI884334Hs.11637ESTs 3.0 3.9 410274AA381807Hs.61762hypoxia-inducible 3.0 3.0 protein 2 75 458962NM purine-rich element 3.0 3.0 005859 binding protein A
Hs.25180 436277888520Hs.120917ESTs 3.0 2.7 453288AW583292Hs.274412similar to yeast Upf3,3.0 3.0 variant A

447471AF039B43Hs.18676sprouty (Drosophila) 3.0 4.1 homolog 2 442554AWd67376Hs.129640ESTs 3.0 4.7 441466AW673081Hs.54828ESTs 3.0 3.0 420297AI628272Hs.88323ESTs 3.0 8.i 445101T75202Hs.12314Homo Sapiens mRNA; 3.0 18.7 cDNA DKFZp586C1019 (f 453405AI567972Hs.d9919ESTs 3.0 9.6 434521NM_002267 karyophedn alpha 3 3.0 9.3 Hs.3886 (importin alpha 4) 447948AI620923Hs.46679ESTs 3.0 10.1 445756AA290690Hs.288493ESTs 3.0 3.5 413243AA769266Hs.193657ESTs 3.0 5.9 422845AA317841Hs.301838ESTs, Weakly similar 3.0 2.2 1o ALU1 HUMAN ALU
S

419409AW297631Hs.143792ESTs 3.0 2.1 446441AK001782Hs.15093hypothetical protein 3.0 2.1 427150BE616183Hs.173737ras-related C3 botulinum3.0 4.1 toxin substrate 421043BE379455Hs.89072ESTs 3.0 3.0 427239BE270447Hs.174070ubiquifin carrier protein3.0 4.1 433312AI241331Hs.131765ESTs 3.0 11.0 415102M31899Hs.77929excision repair cross-complementing3.0 6.0 rode 414702122005Hs.76932cell division cycle 3.0 3.3 428673AW601325Hs.274472high-mobility group 3.0 15.8 (nonhistone chromoso 422676D28481Hs.1570histamine receptor 3.0 2.1 451693BF220445HS.279635ESTs 3.0 2.3 412420AL035668Hs.73853bone morphogenefic 3.0 10.5 protein 2 424005AB033041Hs.137507KIAA1215 protein 3.0 3.9 440769BE561793 gb:601346642F1 NIH 3.0 5.1 MGC_8 Homo Sapiens cD

2~ 428832AA578229 gb:nl22b12.s1 NCI CGAP3.0 2.3 HSC1 Homo Sapiens 430293AI416988Hs.238272inositol 1,4,5-triphosphate3.0 6.3 receptor, ty 450883NM-001348Hs.25619death-associated protein3.0 5.6 kinase 3 407879AA045464Hs.6557ESTs 2,9 7.0 426167AF039023Hs.167496Homo Sapiens cDNA FLJ 2.9 2.6 11120 fis, clone PL

435281A8020699Hs.4864KIAA0892 protein 2.9 3.9 432339AW411259Hs.25945ESTs 2.9 2.9 440524871264Hs.16798ESTs 2.9 9.7 408083BE383668Hs.42484hypothetical protein 2.9 4.4 427729A8033100Hs.300646Homo Sapiens cDNA FLJ117442.9 3.1 fis, clone HE

3 422072AB016255Hs.111138I(fAA0712 gene product2.9 2.9 Q

435904AF261655Hs.89101,2-alpha-mannosidaselC2.9 3.6 440100HE382685Hs.158549ESTs 2.9 3.6 448356AL120837Hs.20993high-glucose-regulated2.9 13.9 protein 8 428005AW302245Hs.181390casein kinase 1, gamma2.9 3.7 403019AA834626Hs.6fi718RAD54(S.cerevisiae)-like2.9 5.8 419175AW270037Hs.179507KIAA0779 protein 2.9 2.3 433592NM_004642Hs.3436deleted in oral cancer2.9 2.3 (mouse, homology 413922AI535895Hs.221024ESTs 2.9 2.8 428593AW207440Hs.185973degenerative spertnatocyte2.9 3.3 (homolog Droso 441789D52059Hs.7972KIAA0871 protein 2.9 2.1 459107AA811881Hs.28505ubiquitin-conjugating 2.9 2.8 enzyme E2H (homolo 448560BE613183Hs.23213ESTs 2.9 3.0 425304AA463844Hs.31339fibroblastgrowthfactorll2.9 3.3 434846AW295389Hs.119768ESTs 2.9 5.1 d08146845621Hs.81057ESTs, Moderately similar2.9 5.1 to CL3BC [R.nor 446644NM Hs.15791transmembrane 7 superfamily2.9 2.8 003272 member 1 (up 446808AA703226Hs.16193Homo sapiens mRNA; 2.9 8.5 cDNA DKFZp586B211 (fr 433017Y15067Hs.279914zinc finger protein 2.9 2.2 429500X78565Hs.289114hexabrachion (tenascin2.9 4.5 C cytotactin) 444706AK000398Hs.11747hypothetical protein 2.9 3.6 407925BE002320Hs.287864Homo Sapiens cDNA FLJ140302.9 2.1 fis, clone HE

431730AF208856Hs.268122hypotheticalprotein 2.9 2.5 4471 AB014599Hs.17411KIAA0699 protein 2.8 2.1 453496AA442103Hs.33084solute carrier family 2.8 7.4 2 (facilitated glu 425227H84455Hs.40639ESTs 2.8 2.3 456534X91195Hs.100623phospholipase C, beta 2.8 76.2 3, neighbor pseudo 421465AK001020Hs.104627Homo Sapiens cDNA FLJ101582.8 6.1 fis, clone HE

409095AW337272Hs.293656ESTs 2.8 34.0 424066299348Hs.112461ESTs 2.8 2.1 432945AL043683Hs.271357ESTs, Weakly similar 2.8 11.9 to unnamed protein 414079H19i84Hs.205230ESTs 2.8 2.1 414359M62194Hs.75929cadherin 11, type 2, 2.8 3.9 OB~adherin (osteob 438890AA827756Hs.135049ESTs 2.8 4.9 430354AA954810Hs.239784human homolog of Drosophila2.8 5.2 Scribble 458367AA068470Hs.83135p53-responsive gene 2.8 4.4 412014AI620650Hs.43761ESTs 2.8 4.8 428727AF078847Hs.191356general transcription 2.8 6.7 factor IIH, polype 447942F12628Hs.155470zinc finger protein 2.8 2.2 38 (KOX 25) 426432AF001601Hs.169857paraoxonase 2 2.8 3.5 439189A1951185Hs.i44630nuclear receptor subfamily2.8 2.5 2, group F, m 446756AW028485Hs.26136ESTs 2.8 4.1 432148AW504912Hs.81907ESTs, Moderately similar2.8 2.6 to ALU4-HUMAN A

405649 2.8 3.8 414473BE302693 gb:ba74c02.y1 NIH-MGC_202.8 2.4 Homo Sapiens cD

75 443839AW139834Hs.143321ESTs 2.8 2.1 448804AW512213Hs.42500ADP-ribosylafion factor-like2.8 2.7 426625AL133415Hs.2064vimentin 2.8 25.0 417528H473i5Hs.27519ESTs 2.8 11.6 453657W23237Hs.296162ESTs 2.8 3.2 432714Y12059Hs.278675txomodomain-containing2.8 6.7 441072AW275480Hs.39504ESTs 2.7 2.7 441297AW403084Hs.7766ubiquitin-conjugating 2.7 2,2 enzyme E2E 1 (homo 4438498E566066Hs.9893ASB3 protein 2.7 3.0 408243Y00787Hs.624intedeukin 8 2.7 3.8 446243BE296396Hs.14512Homo Sapiens cDNA FLJ117612.7 3.3 fis, clone HE

432238AL133057Hs.274135Homo Sapiens mRNA; 2.7 3.0 cDNA DKFZp434K1815 (f 433944AL1175t8Hs.3686KIAA0978 protein 2.7 3.1 411400AA311919Hs.69851GAR1 protein 2.7 16.0 436840AW450376Hs.130803ESTs, Highly similar 2.7 4.1 to T00367 hypotheti 428281AA194554Hs.183434ATPase, H+transporfing,2.7 3.2 lysosomal (vacu 426340297989Hs.169370FYN oncogene related 2.7 2.0 to SRC, FGR, YES

408320AI725867Hs.20734ESTs 2.7 4.7 1 422363T55979Hs.115474replication factor 2.7 2.2 ~ C (activator 1) 3 (38 436440A1471862Hs.19fi008Homo Sapiens cDNA FLJ117232.7 4.7 fis, clone HE

408912A8011084Hs.48924KIAA0512 gene product 2.7 2.1 419304A1271326Hs.146101ESTs 2.7 3.4 415045AA321559Hs.38270Homo Sapiens cDNA: 2.7 2.3 FLJ20984 fis, clone C

15 441872BE567100Hs.154938hypothetical protein 2,7 2.3 422343AI628633 gbay77d05.x1 NC1_CGAP-Kidl12.7 2.5 Homo sapien 415539AI733881Hs.72472ESTs 2.7 2.7 443623BE089782Hs.9877hypothetical protein 2.7 4.7 419881AA329340Hs.44649ESTs 2.7 3.3 2O 429155BE242291Hs.197540hypoxia-inducible factor2.7 5.5 1, alpha subuni 431319AA873350 gb:oh64h02.s1 NCI-CLAP-Kids2.7 65.9 Homo Sapiens 430219X99209Hs.235887HMT1 (hnRNP meihyltransferase,2.7 3.1 S. cerevi 421016AA504583Hs.101047transcription iactor 2.7 5.2 3 (E2A immunogtobul 417259AW903838Hs.81800chondroitin sulfate 2.7 10.7 proteogiycan 2 (vers 25 431747AW979134Hs.1070Dhypothetical protein 2.7 2.9 408085N25929Hs.d2500ADP-ribosylation factor-like2.7 7.8 426218AF119043Hs.168005transcriptionalintermediary2.7 4.5 faciori ga 434845BE267057Hs.4200hypotheficalprotein 2.7 4.6 R32184_1 451644N23235Hs.30567ESTs 2.7 2.3 428408W74437Hs.i88757Homo Sapiens mRNA; 2.7 5.7 cDNA DKFZp564M113 (fr 446627AI973016Hs.15725hypotheficalprotein 2.7 2.9 450167AA446404Hs.24563NTF2-related export 2.7 9.9 protein 1 408821AL050385Hs.48332NIMA (never in mitosis2.7 2.1 gene a)-related k 452068W76412Hs.57877ESTs 2.7 2.1 3 431129AL137751Hs.263671Homo Sapiens mRNA; 2.7 6.2 cDNA DKFZp43410812 (f 429025AI399910Hs.4842ESTs 2.7 2.9 421114AW975051Hs.293156ESTs 2.7 8.8 428755D87454Hs.192966KIAA0265 protein 2.7 3.0 416391A1878927Hs.79284mesoderm specific transcript2.7 5.7 (mouse) hom 414283AW96001tHs.154993ESTs 2.7 5.9 425262D87119Hs.155418GS3955 protein 2.7 3.7 447726AL137638Hs.19368Homo Sapiens mRNA; 2.7 14,3 cDNA DKFZp434J065 (fr 424623AW963062Hs.165809ESTs 2.7 5.6 444772AW450800Hs.176859ESTs 2.7 2.7 45 428419049436Hs.286236eukaryotic translation2.7 4.6 initiation factor 441049W88920Hs.29341hypothetical protein 2.7 4.5 412758Y07818Hs.74566dihydropyrimidinase-like2.6 5.1 447720AL038765Hs.161304ESTs 2.6 3.2 419708AK000753Hs.92374hypothetical protein 2.6 3.0 445502AW379160Hs.12813DKFZP434J21d protein 2.6 5.0 437370AL359567Hs.161962Homo Sapiens mRNA; 2.6 2.9 cDNA DKFZp547D023 (fr 444147ABD02306Hs.10351KIAA0308 protein 2.6 6.8 433193AB040881Hs.32580Homo Sapiens cDNA FLJ131222.6 3.2 fis, clone NT

445439BE243084Hs.12719regulator of nonsense 2.6 3.9 transcripts 1 55 450309W61348Hs.4864KIAA0892protein 2.6 3.8 422092AB007883Hs.111373KIAA0423 protein 2.6 2.3 424118BE269041Hs.140452cargo selection protein2.6 5.5 (mannose 6 phosp 407618AW054922Hs.53478Homo Sapiens cDNA FLJ123662.6 2.9 fis, clone MA

446493AK001389Hs.15144hypothefical protein 2.6 3.2 DKFZp5640043 442878AI868648Hs.22315ESTs 2.6 4.7 448771BE315511Hs.296244SNARE protein 2.6 5.0 416611AA568308Hs.192789ESTs, Weakly similar 2.6 7.7 to ALU7 HUMAN ALU
S

409348AI401535Hs.146090ESTs 2.6 3.5 439349A1660898Hs.195602ESTs 2.6 3.2 65 428433AA521410Hs.41371ESTs 2.6 7.9 436565BE547674Hs.204169ESTs 2.6 3.0 438662AA223599Hs.6351cleavage and polyadenylation2.6 2.6 specific fa 429362T25833Hs.200478ubiquifin-conjugating 2.6 2.3 enzyme E2M (homolo 459035AW291109Hs.208787ESTs 2.6 2.6 451814AA847992Hs.137003ESTs 2.6 19.1 452331AA598509Hs.29117H.sapiens mRNA for 2.6 2.2 pur alpha extended 3' 438461AW075485Hs.286049phosphosedne aminotransferase2.6 2.1 424362AL137646Hs.146D01Homo sapiens mRNA; 2.6 4.9 cDNA DKFZp586F0824 (f 423699H41850Hs.131846PCAF associated factor2.6 3.7 65 alpha 75 441226BE563042Hs.118820ESTs 2.6 2.5 444940AK002148Hs.12151hypothetical protein 2.6 3.4 448731AI522273Hs.42640ESTs 2.6 3.2 424250AF0733i0Hs.143648insulin receptor substrate2.6 2.5 433468AA832055Hs.232217ESTs, Weakly similar 2.6 3.3 to ALUt_HUMAN ALU
S

$O 419925AA159850Hs.93765lipoma HMGIC fusion 2.6 4.6 partner 441364AW450466Hs.12fi830ESTs 2.6 2.6 425922AL157466Hs.162751Homo sapiens mRNA; 2.5 2.7 cDNA DKFZp761 E2423 (f 434974AA778711Hs.4310eukaryotic translation2.5 2.5 inifiation factor 408392028831Hs.44566KIAA1641 protein 2.5 25.4 432426AW973152Hs.31050ESTs 2.5 10.0 436623A1417073Hs.107265ESTs 2.5 2.1 452683A1089575Hs.9071progesterone membrane 2.5 2.6 binding protein 410582AW867197Hs.14562Homo Sapiens cDNA: 2.5 3.7 FLJ21616 fis, clone C

441328AI982794Hs.159473ESTs 2.5 9.2 453983H94997Hs.16450ESTs 2.5 26.1 438826826709Hs.10095hypothefical protein 2.5 2.3 from EUROIMAGE 1669 427899AA829286Hs.181062serum amyloid A1 2.5 20.3 1 427820BE222494Hs.180919inhibitor of DNA binding2.5 3.5 ~ 2, dominant neg 458933AI638429Hs.24763RAN binding protein 2.5 3.5 444871046386Hs.12102sorting nexin 3 2.5 2.3 411329AL360265Hs.69554hypothetical protein 2.5 2.9 424074AI902456Hs.210761ESTs 2.5 4.0 15 438988H30039Hs.107674ESTs 2.5 2.7 412836AA121384Hs.191446ESTs 2.5 5.7 430189A1298841Hs.135133ESTs, Weakly similar 2.5 3.0 to ORF YNL3ltk [S.c 432841M93425Hs.62protein tyrosine phosphatase,2.5 13.4 non-recept 416926H03i09Ns.108920NT018 protein 2.5 2.8 451429AA525993Hs.173699ESTs, Weakly similar 2.5 3.9 to ALU1 HUMAN ALU
S

416388AI417358Hs.73677ESTs 2.5 4.2 421561245399Hs.105779protein inhibitor of 2.5 7.5 activated STAT prot 436480AJ271643Hs.87469putafive acid-sensing 2.5 2.6 ion channel 416273AW57569tHs.79123KIAA0084protein 2.5 2.6 427149H94688Hs.173737ras-related C3 botulinum2.5 2.6 toxin subsfrate 453041AI680737Hs.289068franscripfion factor 2.5 2.2 446899NM Hs.16426podocalyxin-like 2.5 4.7 447301AW958124Hs.142442HP1-BP74 2.5 3.2 447769AW873704Hs.48764ESTs 2.5 2.4 447754AW073310Hs.163533Homo Sapiens cDNA FLJ141422.5 2.5 fis, clone MA

427087BE073913Hs.1735i5uncharacterized hypothalamus2.5 23.6 protein HTO

440903AI468079Hs.126623ESTs 2.5 2.3 432353NM Hs.274411SCAN domain-containing2.5 4.1 016558 t 408196ALD34548Hs.43627SRY (sex determining 2.5 2.5 region Y)-box 22 35 411373BE326276Hs.8861ESTs 2.5 3.9 452402AIi38530Ns.22216peroxisome proliferative2.5 2.4 activated recep 429998AI458063Hs.57841ESTs 2.5 2.6 421772224958Hs.108139zinc finger protein 2.5 3.7 442573H93366Hs.7567Homo sapiens cDNA: 2.5 2.1 FLJ21962 fis, clone H

40 444677ALi Hs.9242purine-rich element 2.5 3.4 10212 binding protein B

441887AW967865Hs.92145ESTs 2.5 3.3 451031AI360187Hs.4254ESTs 2.5 d.8 432450A1990739Hs.77868ORF 2.5 2.4 415860D56051Hs.78888diazepam binding inhibitor2.5 4.8 (GAGA recepto 45 439630AA313607Hs.58633Homo Sapiens cDNA: 2.4 2.3 FLJ22145 fis, clone H

428607AB002353Hs.186840KIAA0355 gene product 2.4 4.0 415402AA164687Hs.297889ESTs 2.4 2.5 446888AL030996Hs.16411hypothetical protein 2.4 2.2 439208AK000299Hs.180952dynactin p62 subunit 2.4 2.4 452900AA626794Hs.250655prothymosin,alpha(gene2.4 3.4 sequence 28) 408657AA782601Hs.173328protein phosphatase 2.4 3.6 2, regulatory subuni 439143AI359214Hs.179260ESTs 2.4 2.5 439867AA847510Hs.161292ESTs 2.4 9.3 408138AA535740Hs.301967Homo Sapiens mRNA; 2.4 5.6 cDNA DKFZp434M196 (fr 428386817298Hs.295923seven in absentia (Drosophila)2.4 4.2 homolog 1 417289D86962Hs.81875growth factor receptor-bound2.4 2.2 protein 10 405268 2.4 3.1 439734AC005D13Hs.149CAMP response element-binding2.4 3.6 protein CR

445378AV653564Hs.226946ESTs 2.4 2.4 454085D824i8Hs.29626ESTs, Weakly similar 2.4 22.0 to unknown [D.melan 427354T57896Hs.191095ESTs 2.4 3.6 452906BE207039Hs.75621serine (or cysteine) 2.4 2.2 proteinase inhibito 450065AL050107Hs.301558DKFZP58611419 protein 2.4 3.6 451091AA810932Hs.131899ESTs, Weakly similar 2.4 2.7 to coded for by C.

65 414839X63692Hs.77462DNA (cytosine-5-)-methyltransferase2.4 2.6 420303AA258282Hs.278436KIAA1474 protein 2.4 2.0 437068AA743643Hs.291427ESTs 2.4 2.6 417446AL118671Hs.82163monoamine oxidase B 2.4 4.4 421454AI660389Hs.286108chodonic somatomammotropin2.4 3.5 hormone 1 (p 7~ 434943AI929819Hs.320xeroderma pigmentosum,2.4 6.4 complementation g 446342BE298665Hs.14846Homo Sapiens mRNA; 2.4 3.0 cDNA DKFZp5640016 (fr 452847AKOQ0857Hs.30783hypothefical protein 2.4 2.1 422506820909Hs.117816soroin 2.4 2.2 405204 2.4 4.3 75 419441AW023731Hs.274368Homo Sapiens mRNA; 2.4 11.7 cDNA DKFZp58611524 (f 442293AW292634Hs.150358ESTs 2.4 2.1 451484AV648896Hs.26461hypothetical protein 2.4 2.0 438545AB032977Hs.6298KIAA1151 protein 2.4 2.1 442724AA355525Hs.159604cysteinyl-fRNAsynthetase2.4 2.8 405517 2.4 6.6 413622808950Hs.272044ESTs, Weakly similar 2.4 3.8 to ALUf HUMAN ALU
S

445679AI343868Hs.58800Homo Sapiens cDNA FLJ124882.4 2,3 fis, clone NT

408636BE294925Hs.46680CGI-l2 protein 2.4 8,7 409142AL136877Hs.50758chromosome-associated2.4 2.4 polypeptide C

422043AL133649Hs.110953Homo Sapiens mRNA; 2.4 2.1 cDNA DKFZp434A139 (fr 424687J05070Hs.151738matrix metalloproteinase2.4 2.6 9 (gelatinise B

442560AA365042Hs.228598ESTs 2.4 4.9 418126T91451Hs.86538ESTs 2.4 11.7 413313NM_002047Hs.75280glycyl-tRNA synthetase2.4 2.1 415167AA160784Hs.26410ESTs 2.4 4.4 440040BE219431Hs.300713ESTs 2.4 3.4 443595AF169312Hs.9613PPAR(gamma) angiopoiefin2.4 10.7 related protein 438977AA482026Hs.298625ESTs 2.4 2.8 452066AA772149Hs.16979ESTs 2.4 5.4 428500AI815395Hs.184641delta-6 fatty acid 2.4 2.2 desalurase 408503AW119059Hs.63163ESTs, Weakly similar 2.4 2.7 to UDP-GaINAc:polyp 433401AF039698Hs.284217serologically deftned2.4 4.8 colon cancer antig 412676NM_000165Hs.74471gapjuncfion protein, 2.4 2.2 alpha 1, 43kD (con 453753BE252983Hs.35086ubiquitin specific 2.d 2.8 protease 1 424050AA211218Hs.138381famesyltransferase, 2.4 3.9 CAAX box, alpha 440225BE295782Hs.159tumor necrosis factor2.4 76.7 receptor superfami 430512AF182294Hs.241578U6 snRNA-associated 2.4 12.3 Sm-like protein LSmB

415156X84908Hs.78060phosphorylase kinase,beta2.4 10.4 435975ALti8990Hs.41997alpha-1-Bglycoprotein2.4 7.7 429831AA564489Hs.137526ESTs 2.4 4.1 407373AA031576Hs.143812Homo Sapiens cDNA 2.4 3.3 FLJ12956 fis, clone NT

422221AA306649 gb:EST177656 Jurkat 2.4 3.8 T-cells VI Homo sapi 451351AW058261Hs.168213ESTs, Weakly similar 2.4 3.3 to ALU1 HUMAN ALU
S

410082AA081594Hs.158311Musashi (Drosophila) 2.4 2.5 homolog 1 430304AL122071Hs.238927Homo Sapiens mRNA; 2.4 6.5 cDNA DKFZp434H1235 (f 418863AL135743Hs.25566ESTs 2.4 5.2 448414BE391820Hs.21145Homo Sapiens cDNA: 2.4 3.7 FLJ22489 fis, clone H

428351AK001701Hs.183779Homo Sapiens cDNA 2.4 6.2 FLJ10590 fis, clone NT

425750AL050276Hs.159456zinc finger protein 2.4 5.1 426295AW367283Hs.75839zinc finger protein 2.4 113.6 6 (CMPX1) 408772W88532Hs.254562ESTs 2.4 12.3 426307F24978Hs.294084ESTs 2.4 4.0 3 405203 2.4 2.5 S

453537AA036755Hs.283681ESTs 2.4 3.6 431427AK000401Hs.252748Homo Sapiens cDNA 2.4 6.2 FLJ20394 fis, clone KA

458021AI885190Hs.156089ESTs, Weakly similar 2.4 4.3 to KSAA1339 protein 453928BE222198Hs.143851ESTs 2.4 2.6 446653AV660630Hs.87627disrupter of silencing2.3 9.7 441626AA281167Hs.111911ESTs 2.3 23.0 446138AW504182Hs.13999KIAA0700 protein 2.3 2.2 452568AA805634Hs.3337Uansmembrane 4 superfamily2.3 22.2 member 1 417665AW852858Hs.22862ESTs 2.3 8.0 45 420088AC006486Hs.298033Homo Sapiens cDNA: 2.3 5.1 FLJ22286 fis, clone H

421456AW579842Hs.104557hypothetical protein 2.3 2.5 412093BE242691Hs.14947ESTs 2.3 31.4 428172U09367Hs.182828zinc finger protein 2.3 4.9 136 (clone pHZ-20) 450447AF212223Hs.25010hypotheftcalprotein 2.3 2.3 436001AW903849Hs.173840HUEL(C4orf1)-interacfingprotein2.3 4.1 414786AI246482Hs.249989ESTs 2.3 2.1 459284AF155660Hs.34401mitochondrial solute 2.3 2.9 carrier 452701NM_005110Hs.30332giutamine-fructose-6-phosphate2.3 2.6 transamin 446320AF126245Hs.i4791acyl-Coenzyme A dehydrogenase2,3 3.9 family, me SS 446669AW972832Hs.29468ESTs 2.3 3.8 434616D79338Hs.239720CGR4-NOT transcription2.3 3.6 complex, subunit 452135A1492175Hs.301805ESTs 2.3 2.3 408696AW958157Hs.i6542ESTs 2.3 2.8 436176AL121422Hs.184013ESTs, Nighty similar 2.3 3.2 to unnamed protein 419713AW968058Hs.92381nudix (nucleoside 2.3 17.0 diphosphate linked mot 414197W44877Hs.55501ESTs 2.3 11.8 445270A1762154Hs.54982Homo Sapiens cDNA 2.3 4.2 FLJ14014 fis, clone HE

412247AF022375Hs.73793vascular endothelial 2.3 5.1 growth factor 426494AL119528Hs.170098KfAA0372geneproducl 2.3 4.4 65 405687 2.3 2.2 417410AF063020Hs.82110PC4 and SFRSi interacting2.3 2.0 protein 1 ~

450747Ai064821Hs.48306ESTs, Highly similar 2.3 3.8 to EWS_HUMAN RNA-BI

433680AI805366Hs.199945ESTs 2.3 6.7 420025AF184939Hs.94392LDL induced EC protein2.3 2.4 413407AI356293Hs.75339inositol polyphosphate2.3 3.1 phosphatase-like 452908A8001451Hs.30965neuronal Shc adaptor 2.3 3.0 homolog 424414AI361002Hs,94814Homo Sapiens cDNA 2.3 2.0 FLJ12168 fis, clone MA

435791AA243086Hs.25204chondroitin 4-0-sulfotransferase2.3 2.4 457635AV660976Hs.3569hypothetical protein 2.3 6.9 427985AI770170Hs.65583ESTs 2.3 2.3 445496AV654019Hs.i80402Homo Sapiens cDNA: 2.3 2.3 FLJ23506 fis, clone L

410310J02931Hs.62192coagulation factor 2.3 4.1 III (thromboplastin, 450368AU077158Hs.24930tubulin-specific chaperone2.3 3.5 a 444614844284Hs.2730heterogeneous nuclear2.3 2.6 ri6onucleoprotein 448607AL042506Hs.21599Homo Sapiens cDNA 2.3 2.8 FLJ10107 fis, clone HE

447975BE378418Hs.127240ESTs 2.3 2.2 429767AW793022Hs.218329hypoiheficalprotein 2.3 11.5 408877AA479033Hs.130315ESTs 2.3 2.3 448481W15284Hs.74832ESTs 2.3 3.3 452833BE559681Hs.30736KIAA0124 protein 2,3 2,g 421057T58283Hs.42679ESTs 2.3 11.0 408885C02741Ns.48712hypotheticalprotein 3 4 427615BE410107Hs.179817CGI-82 protein . .
2.3 2,3 448661AL049951Hs.22370Homo Sapiens mRNA; 2.3 6.3 cDNA DKFZp56400122 (f 430154AW583058Hs.234726serine (or cysteine) 2.3 34.6 proteinase inhibito 428494AA233439Hs.184634hypotheticalprotein 2.3 10.2 422987AW407887Hs.301772serine/threonine kinase2 3 11 (Peutz-Jegher 3 2 408216AA741038Hs.6670ESTs . .
2.3 3.3 407862BE548267Hs.50724Homo Sapiens cDNA FLJi09342.3 5.7 fis, clone OV

432215AU076609Hs.2934ribonucleotide reductase2.3 2.1 M1 polypeptide 410086AI268405Hs.13467Homo Sapiens BAC clone2.3 2,2 RPt 1-121A8 from 7 444853AW576245Hs.149740Homo Sapiens mRNA for 2 4 FLJ00028 protein 3 5 413284AU077055Hs.289107, . , baculoviral IAP repeat-containing2.3 4,8 445547D86181Hs.273galactosytceramidase 2.3 2.5 (Krabbe disease) 420258AA477514Hs.96247franslin-associated 2.3 3,5 factor X

437223C15105Hs.107884ESTs 2,3 2,7 437353AA749195Hs.143746ESTs 3 2 426224BE085860Hs.168075karyophedn (importin) . .
beta 2 2.3 36,1 402575223024Hs.138860Rho GTPase activating 2.3 3,1 protein 1 430712AW044647Hs.196284ESTs 2.3 2,4 452036NM Hs.2762isema domain, seven 2.3 2.4 003966 thrombospondin repeat.

425180000115Hs.155024B-cell CLUlymphoma 2.3 4.3 6 (zinc finger prote 441648H05734Hs.30559ESTs 2.3 2,1 424130AL050136Hs.140945Homo Sapiens mRNA; 2.3 2.9 cDNA DKFZp586L141 (fr 414682AL021154Hs.76884inhibitor of DNA binding2.3 12.2 3, dominant neg 423814AF105020Hs.132989putative protein 0-mannosyltransferase2.3 3.7 421641AI638184Hs.106334Homo Sapiens clone 2.3 2.3 42 23836 mRNA sequence 7 AA640987Hs.193767ESTs 2.3 10.2 442159AW163390Hs.8123chromobox homolog 3 2.3 4.4 (Drosophila HP1 gamm 412541BE009398Hs.74002nuclearreceptorcoacGvatorl2.3 2.4 447217BE465754Hs.17778neuropilin 2 2.3 3.0 452336AA960961Hs.29147hypothetical protein 3 4 423913NM_Oi6436Hs.301055hepatocellularcaroinoma-associatedanG. , 2.3 3.4 411737AW160339Hs.71791hypothetical protein 2.2 2,0 412276BE262621Hs.73798macrophage migration 2.2 2.d inhibitory factor ( 456974M12529Hs.169401apolipoprolein E 2,2 2,6 416033NM Hs.78979Golgi apparatus protein2 10 406739AI566709Hs.182426ribosomal protein S2 . .
2.2 115.3 448646AU077149Hs.21704transcription factor 2.2 4,2 12 (HTF4, helix-loo 437371AK000868Hs.5570hypothetical protein 2.2 3,6 451413AA448974Hs.26367PC3-96 protein 2.2 6.2 408665T88845Hs.112200ESTs, Weakly similar 2.2 3,2 to ALU7_HUMAN ALU
S

437548AI701596Ns.121592ESTs 2.2 3,0 452053A1750575Hs.173933nuclearfactorllA 2.2 3.3 428303AW974476Hs.183601regulator of G-protein2.2 3,4 signalling 16 441376H94227Hs.6592ESTs, Weakly similar 2,2 2,5 to salivary proline 413399BE091833 gb:IL2-BT0731-260400-076-F042.2 2.1 BT0731 Homo 448913AA194422Hs.22564myosin Vl 2.2 2.4 439053BE244588Hs.6456chaperonin containing 2.2 3,1 TCP1, subunit 2 (b 428065AI634046Hs.157313ESTs 2.2 3.5 425846AA102i74Hs.159629myosinIXB 2,2 7,1 426404AA377607Hs.273138ESTs 2 3 423464NM Hs.128856CSR1 protein . , 016240 2,2 2,1 436135D85390Hs.5057carboxypeptidase D 2.2 9.1 450476AL045285Hs.246849ESTs, Moderately similar2.2 2,5 to ALU6_HUMAN A

420798W93774Hs.99936keratin 10 (epidermolytic2.2 2.9 hyperkeratosis 433530BE349534Hs.281789ESTs 2 2 436297A1084582Hs.5105hypothetical protein . , FLJ10569 2.2 2.4 433058H86865Hs.280666Homo Sapiens chromosome2.2 2.3 19, cosmid 83218 435924AW029203Hs.191952ESTs 2.2 3.2 417125AW181998Hs.81248CUG friplet repeat, 2.2 ' RNA-binding protein 2.3 449338H73444Hs.394adrenomedullin 2,2 18.3 446065AA085191Hs.6949ESTs, Weakly similar 2.2 3.1 to T2D3_HUMAN TRANS

410668BE379794Hs.65403hypothetical protein 2.2 2,5 424992AW290893Hs.96918Homo Sapiens cDNA: 2.2 10.8 FLJ2i561 fis, clone C

437801AA613866Hs.5848Homo sapiens mRNA; 2.2 2.5 cDNA DKFZp564L222 (fr 412491W31589Hs.73957RABSA, member RAS oncogene2.2 2,4 446 family 392 AF142419Hs.15020homolog of mouse quaking2.2 3.4 01(I (KH domain 45050383591 Hs.25042Homo Sapiens mRNA full2.2 2,8 T length insert cDN

432476T94344 gb:ye31h10.s1 Stratagenelung(937210)2.2 2.6 H

424251AA677466Hs.143696coactivator-associated2.2 5.0 arginine methyltr 456619AV647917Hs.107153inhibitor of growth 2 2 family, member 1-lik 2 6 433411AI658666Hs.49994ESTs . .
2,2 2,1 424714A111d630Hs.208334Homo Sapiens cDNA: 2.2 2.7 FLJ2187d fis, clone N

416326AF186780Hs.79219RaIGDS-like gene; KIAA09592.2 2.2 protein 407696AI697340Hs.76549ATPase, Na+IK+transporting,2.2 6.5 alpha 1 pol 445939BE018658Hs.141003Homo Sapiens cDNA: 2.2 4.4 FLJ21691 tis, clone C

414765X07854Hs.77269guanine nucleotide 2.2 6.2 binding protein (G
pr 407136T64896Hs.287420Homo Sapiens cDNA FLJ115332.2 2.8 fis, clone HE ' 453665AA626250Hs.181165eukaryotic translation2.2 2.3 elongation factor 433608AW340005Hs.164485ESTs 2.2 2,1 447646BE619752Hs.66053ESTs, Weakly similar 2.2 4.1 to S22126 finger pr 433139AB029826Hs.476493-methylcrotonyl-CoA 2.2 11.7 carboxylase biofin-413433NM Hs.289068Uanscdptionfactor4 2.2 2.2 421535AB002359Hs.105478phosphoribosylformylglycinamidine2.2 2.2 synths 428591BE313029Hs.185807Homo Sapiens clone 2.2 4.8 24758 mRNA sequence 417248AA329449Hs.247302twisted gasUulafion 2.2 2.5 403966 2.2 5.2 437112AA744692Hs.166539ESTs 2.2 3.0 414799AI752416Hs.77326insulin-like growth 2.2 4.9 factor binding prote 1 431049AA846576Hs.103267hypothetical protein 2.2 4.4 ~ FLJ22548 similar to 422100Ai096988Hs.111554ADP-ribosylafion factor-like2.2 2.5 426543AV650198Hs.170311heterogeneous nuclear 2.2 2.4 ribonucleoprolein 423720AL044191Hs.23388Homo Sapiens cDNA: 2.2 4.2 FLJ21310 fis, clone C

443804AL135352Hs.255883ESTs 2.2 2.2 1 435080AI831760Hs.155111ESTs 2.2 2.5 452808AF244135Hs.30670hepatocellular carcinoma-associated2.2 7.1 anti 433934AW273261Hs.216292ESTs 2.2 2.1 432004BE018302Hs.2894placentalgrowthfactor,vascularendoth2.2 4.4 452518AA280722Hs.24758ESTs 2 3 20 409600AJ011679Hs.55099Homo Sapiens mRNA; . .
cDNA DKFZp586D2123 2.2 2.3 (f 448965AF092134Hs.22679CGI-24 protein 2.2 4.0 444954AW247076Hs.12163eukaryofic translation2.2 5.3 inifiation factor 458894AW292171Hs.23978scaffold attachment 2.2 2.5 factor B

402269 2,2 2 25 423798AF047033Hs.301617Homo Sapiens mRNA full2.2 .
length insert cDN 4.0 413836W92003Hs.70614ESTs 2.2 3.6 432231AA339977Hs.274127CLST 11240 protein 2.1 2.1 412204A1125507Hs.130829ESTs 2.1 3.0 4388D7AA848011Hs.124570ESTs, Weakly similar 2.1 2.2 to reverse Uanscri 404170 2.1 41.6 434858AW979012Hs.13d462ESTs 2.1 2,2 426982AA149707Hs.173091ubiquitin-like 3 2.1 2.1 421939BE169531Hs.109727TAKt-binding protein 2.1 26.5 2; KIAA0733 protein 442432BE093589Hs.38178Homo Sapiens cDNA: 2.1 3.7 FLJ23468 fis, clone H

35 424950AA602917Hs.156974ESTs 2.1 19.9 418123AA669830Hs.83530hypotheficalprotein 2.1 4.6 440467AK001519Hs.7194CGI-74 protein 2.1 5.3 437092AA744292Hs.181244major histocompatibility2.1 3.0 complex, class 421579NM Hs.105927stem cell growth factor,2.1 3.3 002975 lymphocyte secr 428953AA306610Hs.194676DKFZP434C013 protein 2.1 5.0 457313AF047002Hs.241520Uanscriptionalcoacfivator2.1 3.5 420570A1453665Hs.290870ESTs, Weakly similar 2.1 2.1 to 523650 retroviru 446918AL135125Hs.13913KIAAi577 protein 2.1 2.3 427567N24236Hs.179662nucteosome assembly 2.1 2.8 protein 1-like 1 45 446363AL117440Hs.301967Homo Sapiens mRNA; 2.1 4.0 cDNA DKFZp434M196 (fr 428482AI290352Hs.184592KIAA03d4 gene product 2.1 2.8 456559A1336273Hs.102548glucocorficoid rocepior2.1 2.3 DNA binding fact 442819BE622721Hs.301766ESTs, Weakly similar 2.1 27,1 to hypothefical pro 428808AA436007Hs.188780ESTs 2.1 5 414893AA215295Hs.77578ubiquifin specific 2.1 .
protease 9, X chromos 15.9 447023AA356764Hs.17i09integral membrane protein2.1 3.0 402250AV655272Hs.20252novel Ras family protein2.1 4.2 429952AF080158Hs.226573inhibitor of kappa 2,1 7.9 light polypeptide gen 420006H14429Hs.94300serologically defined 2.1 5.6 colon cancer antig 55 407316AA031663Hs.28802centaurin-alpha 2 protein2.1 4.4 417139M69043Hs.81328nuclear factor of kappa2.1 103.2 light polypeptid 414774X02419Hs.77274plasminogen activator,2.1 29.9 urokinase 430488D19589Hs.4220ESTs, Moderately similar2.1 2.1 to tetracycline 428680U69199Hs.90259ESTs, Weakly similar 2.1 2.5 to alpha 1 [H.sapie 448501AA332316Hs.4273hypothetical protein 2.1 2.0 422552N39729Hs.118243deoxyribonuclease II, 2.1 2.9 lysosomal 419476AW953030Hs.59425Homo Sapiens cDNA: 2.1 3.1 FLJ23323 fis, clone H

408681AW953853Hs.292833ESTs 2.1 3.9 417353AA375752Hs.76362general Uanscription 2.1 4.1 factor IIA, 2 (12k 65 422070AF149785Hs.111126pituitary tumor-transforming2.1 4.9 1 interacti 442711AF151073Hs.8645hypothelicalprotein 2,1 2.2 450139AK001838Hs.296323Homo Sapiens cDNA FLJ109762.1 7.4 fis, clone PL

452897BE066058Hs.269233ESTs 2.1 4.2 409147A1889208Hs.17283hypothetical protein 2.1 d.5 433028AI199144Hs.283737AD-017 protein 2.1 2.6 407831BE613377Hs.15580Homo Sapiens cDNA: 2.1 8.5 FLJ22276 fis, clone H

417871AA521368Hs.24252ESTs 2.1 2.9 428754A1521102Hs.301374ESTs, Moderately similar2.1 5.3 to ALU5_HUMAN A

430127AA2i9498Hs.233952proteasome (prosome, 2.1 4.3 macropain) subunit, 75 442622NM Hs.8546Notch (Orosophila) 2.1 8.5 000435 homolog 3 414242AA749230Hs.22666ESTs 2.1 2.8 433323AA805132Hs.30701ESTs 2.1 5.0 439022AA356599Hs.173904ESTs 2.1 6.4 443357AW016773Hs.75615apolipoprotein GII 2,1 2 449103T24968Hs.23038HSPC071 protein 2,1 , 2,7 427512AB018322Hs.179507KIAA0779 protein 2.1 20 426728NM Hs.171957Uiple functional domain2.1 2.9 007118 (PTPRF interact 440112AA099014Hs.231029ESTs 2.1 2.3 446920BE397649Hs.31257Homo Sapiens cDNA FLJ136342.1 4.8 fis, clone PL

428459D44650Hs.184411gene with multiple 2.1 2.9 splice variants near 432842AW674093Hs.279525hypothetical protein 2.1 2.3 438829AA826926Hs.204214ESTs 2 2 411442N25956Hs.101810Homo Sapiens cDNA FLJ14232. .
fis, clone NT 2.1 2.2 409423AI969783Hs.43071ESTs, Weakly similar 2.1 2.2 tc AF1519001 CGI-1 456804AI421645Hs.139851caveolin 2 2.1 15.2 434536H14486Hs.3903Cdc42 effector protein2.1 2.8 d; binder of Rho 447126AW150632Hs.62954ferrifin, heavy polypepfide2.1 25.0 1 442328AI952430Hs.265237ESTs 2.1 2.1 ~

444488AW192879Hs.184796ESTs, Weakly similar 2.1 2.9 to PET2_HUMAN OLIGO

438874H02780 gb:yj41a1 1.r1 Scares 2.1 10.6 placenta Nb2HP Homo 412805AW954569Hs.296287ESTs 2.1 4.6 446334052427Hs.14839polymerase (RNA) II 2.1 2.3 (DNA directed) polyp 1 427201AB037860Hs.173933nuclearfactorllA 2.1 5.1 436997AA741151Hs.137323ESTs 2.1 3.0 426369AF134157Hs.169487Kreisler (mouse) maf 2.1 2.3 related leucine zip 453613F06838Hs.14763ESTs .2.1 2,4 413276224725Hs.75260mitogen inducible 2 2.1 5.5 422050AA302741Hs.25786ESTs 2.1 4.0 424797AA622394Hs.153177ribosomal protein 828 2.1 2.1 437365AW965771Hs.91065hypothetical protein 2.1 3.0 DKFZp76182423 412482AI499930Hs.181043KIAA0788 protein 2.1 2.7 418662A1801098Hs.151500ESTs 2.1 2 25 404030 2.1 .
2.1 437802A1475995Hs.122910ESTs 2.1 3.8 441130A1160734Hs.283429SMC (mouse) homolog, 2.1 3.5 X chromosome 416084L16991Hs.79006deoxythymidylate kinase2.1 7.4 (thymidylate kin 409944BE297925Hs.57687four and a half LIM 2.1 6.3 domains 3 425421L11669Hs.157145tetracycline transporter-like2.1 7.1 protein 428399NM Hs.184167splicing factor, arginine/serine-rich2.1 2.7 421313NM Hs.103329KIAA0970 protein 2.1 2.6 445229BE276013Hs.172364Homo Sapiens mRNA for 2.1 4.7 FLJ00086 protein, 401001 2.1 14 3 425159NM Hs.154868carbamoyl-phosphate 2.1 , 5 004341 synthetase 2, aspart 7.2 438855AW946276Hs.6441tissue inhibitor of 2.1 4.9 metalloproteinase 433369249254Hs.3254mitochondrial ribosomal2.1 25.0 protein L23 433228F28212Hs.284247KIAA1491 protein 2.1 5.1 445392AA057478Hs.23272ESTs 2 2 433891AA613792 gb:no97h03.s1 NCI CGAP. .
Pr2 Homo Sapiens 2.0 2.5 432572AI660840Hs.191202ESTs, Weakly similar 2.0 2.9 to ALUE HUMAN !!!!

448474AI792014Hs.13809ESTs 2.0 12.1 427045H86504Hs.173328protein phosphatase 2.0 2.9 2, regulatory subuni 444916AB028956Hs.12144KIAA1033 protein 2.0 4.2 45 439177AW820275Hs.76611ESTs 2.0 3.3 423533NM Hs.129751interleukin 17 receptor2.0 5.0 430057AW450303Hs.2534bone morphogenefic 2.0 2.3 protein receptor, typ 424429063830Hs.146847TRAF family member-associated2.0 12.7 NFKB acfiv 428385AF112213Hs.184062putafive RabS-interacfing2.0 4.6 protein 50 458946AA009716Hs.42311ESTs 2.0 16.4 444816248633Hs.283742H.sapiens mRNA for 2.0 4.9 retrotransposon 426829AI761241Hs.301719ESTs 2.0 2.4 433619AW965275Hs.284288hqp0256 protein 2.0 4.4 421985AK001779Hs.110445CGI-97 protein 2.0 3.8 5 439895AB037773Hs.6762hypothetical protein 2.0 2.2 449188AW072939Hs.23200myotubularin related 2.0 2.2 protein 1 404820 2.0 2.7 425811AL039104Hs.159557karyopherin alpha 2 2.0 2.5 (RAG cohort 1, impor 422163AF027208Hs.297332Homo Sapiens cDNA: 2.0 3.7 F1J21471 fis, clone C

431172A1125639Hs.250666hairy (Drosophila)-homolog2.0 10.2 415200AL040328Hs.301912Homo Sapiens cDNA: 2.0 2.1 FLJ22920 fis, clone K

458176AI961519Hs.140309ESTs, Weakly similar 2.0 5.0 to KIAA0681 protein 407895844203Hs.265540HSPC042 protein 2.0 4.6 449616AI701457Hs.38694ESTs 2 2 422976AU076657Hs.1600sec61 homolog . .
2.0 5.7 430220BE378277Hs.152230ESTs 2.0 11.7 435446AA682305Hs.133268ESTs 2.0 4.2 431031AA830335Hs.105273ESTs 2.0 14.1 425233217861Hs.155218EIB~SkDa-associated 2.0 5 protein 5 6 426458D83032Hs.169984nucldar protein 2.0 .
5.9 421965AA301100 gb:EST14128 Testis 2,0 2.1 tumor Homo Sapiens cD

427128AW301984Hs.173685Homo Sapiens cDNA FLJ126192.0 6.3 fis, clone NT

449722BE280074Hs.23960cyclin B1 2.0 2.1 450816BE271927Hs.87385ESTs 2.0 2 75 453507AF083217Hs.33085WD repeat domain 3 2.0 .

13,1 422801AF125672Hs.287994nuclearreceptorco-repressor22.0 3.5 418178AA043951Hs.83715Sjogren syndrome antigen2.0 3.9 B (autoanfigen 417819AI253112Hs.133540ESTs 2.0 4.0 414787AL049332Hs.77311BTG family, member 2 4 447032AK000310Hs.17138hypothetical protein . .
FLJ20303 2.0 7.0 431742NM_016652Hs.268281CGI-201 protein 2.0 2,5 448431BE613061Hs.300697ESTs, Weakly similar 2.0 6.5 to CA13 HUMAN COLLA

456444AA884517Hs.31856ESTs, Weakly similar 2.0 2.5 to KIAA1453 protein 419178NM Hs.89657 TATA box binding protein2.0 6.0 006284(TBP)-associate 446437AW014360Hs.202119 ESTs, Weakly similar2.0 2.2 to A46010 X-linked 449910A1074585Hs.58440 ESTs 2.0 2.1 435963AF271212Hs.87627 disrupter of silencing2 421283AI760018Hs.205071 ESTs .
.
2.0 2.6 414482557498Hs.76252 endothelin receptor 2.0 2.4 type A

450960AB013897Hs.25722 Homo sapiens mRNA 2.0 2.1 for HKR1, parfial cds 438644AI126162Hs.129037 ESTs 2.0 2.1 458343A1004775Hs.205091 ESTs Weakly similar 2 to WW domain bindin 0 6 412574BE410731Hs.74050 follicular lymphoma .
variant translocafio .
2.0 12.4 458079AI796870Hs.54277 ESTs 2.0 3.8 450582AI339732Hs.13144 HSPC160 protein 2.0 2.8 409936AK001691Hs.57655 hypothefical protein 2.0 3.1 426865D63476Hs.172813 PAK-interacting exchange2 factor beta 0 3 446430AA3d6837Hs.15075 hypothefical protein .
DKFZp434E2216 .
2.0 2.0 Table 4B:

Pkey:Unique Eos probeset idenfifier number CAT cluster number number:
Gene Accession:Genbank accession numbers Pkey CAT Accession Number 429007_ AA443145 BF958169 AW904500 4291631238297_1AW974271 AA592975 AA447312 4320601235850_1AA525021 AW9.71364 AA570759 35 4079396003871AW118352AW1962i5W05608 4130201485885_1BE048113 898736 242904 1 81008686 AA578229 AAd81375 4324761237465_1AW973269 AA548913 T94344 AA834800 TABLE
4C:

Pkey:Uniqu e number corresponding to an Eos probeset 55 Ref: Sequence "Dunham, et al." refers source. to the publication entitled The "The DNA

digit numbers in this column are Genbank Identifier (GI) numbers.

sequence of human chromosome 22"
Dunham, et al.
(1999) Nature 402:489-495.

Strand:Indicates DNA
strand from which exons were predicted.

Nt-position:Indicates nucleotide positions of predicted exons.

60 Pkey Ref Strand Nt_posilion 4008599757499Minus 91888-92018,98131-98294,99474-99570 4052387249119Minus 51728-51836 4009928096828Plus 140390-140822 4008609757499Minus 151830-152104,152649-152744 65 4025249798518Minus 20529-21096 4042105006246Plus 169926-170121 4026049909420Plus 20393-20767 4028559662953Minus 59763-59909 4040297671252Plus 108716-111112 70 4026059909420Minus 47680-47973 4040493688074Minus 75765-78155 4035498081591Minus 137150-137362 4040483688074Minus 54421-56808 4041719930793Plus 173667-173783,176876-177055 75 4056494926908Minus 50032-50132,50624-50764 4052684156151Minus 24404-24521 4052047230116Plus 126569-126754 4055179454624Plus 114757-114877 4052037230116Plus 125295-125463 g0 4056876249668Minus 54787-54891,55844-55917 4039668568881Plus 158193-158277,160116-160290 4022693128156Minus 1168-1324,5492-5611,23445-23851 4041709930793Plus 168836-169248 404030 7671252 Plus 149362-151749 401001 7229886 Minus 113631-113762 404820 4678240 Plus 20475-21085 TABLE 5A: ABOU"T 43 GENES UPREGULATED IN GLIOBLASTOMA THAT ENCODE PREDICTED
MEMBRANE PROTEINS
Pkey: Unique Eos probeset identifier number ExAccn: Fxemplar Accession number, Genbank accession number UnigenelD: Unigene number 1 ~ Unigene Title: Unigene gene titre R1: Ratio of brain tumor to body atlas R2: Ratio of brain tumor to normal brain Pkey ExAccnUnigenelDUnigene title R1 R2 15 415817088967Hs.78867protein tyrosine phosphalase,72,0 11.3 receptor-t 447072D61594Hs.17279tyrosylprotein sulfotransferase54.2 7.1 451099852795Hs.25954interleukin 13 receptor,22.0 7.6 alpha 2 415910020350Hs.78913chemokine (GX3-C) receptor21.2 3.0 412986X81120Hs.75110cannabinoid receptorl(brain)18.6 18.6 417355D13168Hs.82002endothelin receptor 16.4 16.4 type B

419721NM_001650Hs.288650aquaporin 4 16.2 4.4 452355N54926Hs.29202G protein-coupled receptor13.9 13.9 410227AB009284Hs.61152exostoses (multiple)-like11.9 2.9 2 ~

419723AL120193Hs.92614Homo Sapiens growth 7.4 3.5 differentiation fact 25 414825X06370Hs.77432epidermal growth factor6.9 6.4 receptor (avian 443898AW804296Hs.9950Sec61 gamma 4.8 7.2 422033AW245805Hs.110903claudin 5 (transmembrane4.3 6.1 protein deleted 414821M63835Hs.77424Fc fragment of IgG, 4.2 34.8 . high affinity la, re 431556AF016028Hs.260039sarcospan(Kras oncogene-associated4.0 3.8 gene 3~ 435869AF255910Hs.54650vascular endothelial 3.7 4.2 junction-associated 440516S42303Hs.161cadherin 2, type 1, 3.5 5.1 N-cadherin (neuronal 428141D50402Hs.182611solute carrier family 3.5 2.4 11 (proton-coupled 428484AF104032Hs.164601solute carrier family 3.4 2.8 7 (cationic amino 431053S40369Hs.249141Glutamate receptorsubunit3.3 2.4 35 445070NM Hs.258adenosine A3 receptor 3.2 7.6 430890X54232Hs.2699glypican 1 3.2 4.3 423422AC005175Hs.128425NY-REN-24 antigen 3.2 4.0 413367NM Hs.75317solute carrier family 3.1 2.6 006517 i6 (monocarboxylic 447471AF039843Hs.18676sprouty (Drosophila) 3.0 4.1 homclog 2 427150BE616183Hs.173737ras-related C3 botulinum3.0 4.1 toxin substrate 422676D28481Hs.1570histamine receptor 3.0 2.1 Hi 430293AI416988Hs.238272inositol 1,4,5-triphosphate3.0 6.3 receptor, ty 453496AA442103Hs.33084solute carrier family 2.8 7.4 2 (facilitated glu 428281AA194554Hs.183434ATPase, H+transporting,2.7 3.2 lysosomal (vacu 45 417446AL118671Hs.82163monoamine oxidase B 2.4 4.4 412676NM Hs.74471gap junction protein, 2.4 2.2 000165 alpha 1, 43kD (con 440225BE295782Hs.159tumor necrosis factor 2.4 76.7 receptor superfami 450447AF212223Hs.25010hypothetical protein 2.3 2.3 410310J02931Hs.62192coagulation factor 2.3 4.1 III (thromboplastin, 452036NM Hs.27621sema domain, seven 2.3 2.4 003966 thrombospondin repeat 447217BE465754Hs.17778neuropilin 2 2.3 3.0 447023AA356764Hs.17109integral membrane protein2.1 3.0 422070AF149785Hs.111126pituitary tumor-transforming2.1 4.9 1 interacti 456804AI421645Hs.139851caveolin 2 2.1 15.2 55 430057AW450303Hs.2534bone morphogenetic 2.0 2.3 protein receptor, typ 422163AF027208Hs.297332Homo Sapiens cDNA: 2.0 3.7 FLJ21471 fis, clone C

414482S57498Hs.76252endothelin receptor 2.0 2.4 type A

C)O TABLE 6A: ABOUT 397 GENES DOWNREGULATED IN GLIOBLASTOMA
Pkey: Unique Eos probeset identifier number ExAccn: Exemplar Accession number, Genbank accession number UnigenelD: Unigene number Unigene Title: Unigene gene title 65 R1: Ratio of normal brain to body atlas R2: Ratio of normal brain to brain tumor Pkey ExAccnUnigenelDTitle R1 R2 439340A8032436Hs.6535brain-specific Na-dependent4.47 77.82 inorganic ph 7~ 424846AU077324Hs.1832neuropeptide Y 4.49 55.32 428874W32133Hs.194366transthyretin (prealbumin,7.06 45.64 amyloidosis 1 416836D54745Hs.80247cholecystokinin 9.45 44.59 401412c14p3_2958 exon 3.20 32.56 451835T63643Hs.209715ESTs, Weakly similar 3.21 28.93 to ALU7_HUMAN ALU
S

75 412768AW996044Hs.26239ESTs 3.16 28.12 415448T68645Hs.952solute carrier family 3.27 27.04 10 (sodiumlbile ac 411305BE241596Hs.69547myelin basic protein 13.80 25.92 438054AA776626Hs.62183ESTs 3.59 25.06 410837BE145698 gb:ILO-HT0205-231199-145-a073.05 24.43 HT0205 Homo 425121A1797511Hs.154679synaptotagmin 1 6.92 23.67 456763AJ271351Hs.128180B-cell translocation 3.29 23.32 gene 4 429656X05608Hs.211584neurofilament,lightpolypeptide8.03 22.56 (68kD) 451892A1821302Hs.167834ESTs 4.12 21.82 424922BE386547Hs.217112ESTs, Weakly similar 4.41 21 to Similarity to Ye 28 411666AF106564Hs.71346neurofilament3 (150kD 5.27 .
medium) 21 432247AA531287Hs.105805ESTs 3.25 .

436812AW298067 gb:Ul-H-BWD-ajp-g-09-0-ULs13.02 .
NCI_CGAP_Su 21.12 422234AF119818Hs.113287discs, large (Drosophila)3.38 20 homolog-associ 50 435708A1362949Hs.75169ESTs 8.79 .

423135N67655Hs.26411ESTs 6.82 .

440600AI807691Hs.126351ESTs 3.56 .

405230cNpt exon 3.31 .
l 4 7656 19.95 56915N55540Hs.78026ESTs, Weakly similar 3.14 19 to similar to ankyr 40 425130AA448208Hs.99163ESTs 3.53 .

416812H91010Hs.44940ESTs 3.54 .

454171AW854832 gb:OV2-CT0261-201099-011-f053.78 .
CT0261 Homo 19 457463AW877031Hs.272321Homo Sapiens cDNA FLJ125713.13 .

15 fis, clone NT 18.91 454589AW809699 gb:MR4-ST0124-241199-026-e124.10 18 5T0124 Homo 60 418104T05726Hs.177130ESTs 3.17 .

416357T82050Hs.268907ESTs 3.11 .

414683S78296Hs.76888internexin neuronal 5.55 .
intermediate filamen 18 447694AI420083Hs.170303ESTs 3.56 .
17.79 427627887582Hs.179915guanine nucleotide 4.63 17 binding protein (G 65 pr 428010AA806554Hs.185375ESTs 3.03 .

417159801761 gb:ye81f10.s1 Soaresfetalliverspleen3.23 .

436788AA766908Hs.259047ESTs 3.16 .

459349AW749381 gb:OV3-BT0381-170100-060-c023.26 .
25 4 BT0381 Homo 17.10 50214BE439763Hs.227571regulator of G-protein3.86 17 signalling 4 04 438068AI927209Hs.283089HMT1 (hnRNP methyllransferase,3.54 .
S. cerevi 16 437268AI754847Ns.227571regulator of G-protein5.63 .
signalling 4 16 435315AA700240Hs.165402ESTs 4.06 .

424240A8023i85Hs.143535calciumicalmodulin-dependent4.69 .
3 4 protein kin 15.92 ~

12446AI768015Hs.92127ESTs 5.44 15 449714A8033015Hs.23941KIAA1189 protein 4.59 .

435832AA425688Hs.41641Bruno (Drosophila) 4.63 .
-like 4, RNA binding 14 437397AA349847Hs.4221hypotheticalprotein 5.93 .
DKFZp761H039 14 435502L13266Hs.105glutamate receptor 3.29 .
35 ionotropic N-methyl 14.61 414187BE312141 gb:601145962F1 NIH_MGC-193.37 14 Homo Sapiens c 46 417868A1078534Hs.122592ESTs 7.57 .

428536Aii43139Hs.2288visinin-like 1 5.16 .

402125c18p3-155 exon 3.11 .

440503NM Hs.7235calcium channel, voltage-dependent,3.49 .
006539 gamm 13.92 419090T85201Hs.188468ESTs 3.25 13 437665AA765417Hs.292053ESTs 3.07 .

457113A1734016Hs.270508ESTs 3.50 .

424933AW999974Hs.5181proliferation-associated3.59 .
2G4, 38kD 13 443489A1073512Hs.133916ESTs 3.24 .
45 13.20 404289c6p3-5821 exon 3.99 13 406534ph2_4616 exon 3.89 .

423280AA324037 gb:EST26901 Cerebellum3.38 .
II Homo Sapiens c 13 455421AW937661Hs.288324Homo Sapiens cDNA FLJ132833.04 .
fis, clone OV 12 433725AF063559Hs.283919Homo Sapiens clone 3.71 .
H00117 PR00117 mRNA, 12.85 416660898905Hs.35992ESTs 3.92 12 407593AW044083Hs.237008ESTs 3.85 .

451734NM Hs.26944neurogranin (protein 7.41 .
006176 kinase C substrate, 12 410366AI267589Hs.25214hypotheticalprotein 7.89 .

405348cNp3-13716 exon 3.45 .
12.42 Jr 442338A1761976Hs.156080ESTs 3.69 12 424458M29273Hs.1780myelin associated glycoprotein4.72 .

4314D0AA504607 gb:aa63a02.s1 NCI-CGAP_GCB13.42 .
Homosapiens 12 417754813027Hs.268703ESTs 3.35 .

440184AB002297Hs.7022dedicator of cyto-kinesis6.15 .
6O 4 3 12.11 31339AA5D6294Hs.257266ESTs 3.50 11 4522658E501516Hs.114772ESTs 3.82 .

419297AA446040Hs.98640Homo Sapiens cDNA: 3.16 .
FLJ21069 fis, clone 11 424991AA775471Hs.241467ESTs 3.03 .

431988AC002302Hs.77202protein kinase C, beta3.78 .
65 4 1 11.62 50987AA017202Hs.32794ESTs 3.28 11 440607AA894559Hs.192097ESTs 3.11 .

454566AW807605 gb:MR4-ST0098-120100-001-b063.26 .
ST0098 Homo 11 442000H38671Hs.8071KIAA0735 gene product;3.44 .
synaptic vesicle 11 437948AA772920 gb:ae73c09.s1 Stratagene3.16 .
7O schizo brain Si 11.46 401081c11p3 exon 3.18 11 438919AW979114 gb:EST391224 MAGE resequences,4.16 .
MAGP Homo 11 454578AW809178 gb:MR4-ST0118-261099-012-c073.02 .
ST0118 Homo 11 422279H69644Hs.114231Gtype lectin-like receptor-23.35 .

453101AW952776Hs.94943ESTs 3.21 .
75 11.07 455836BE145795 gb:MRO-HT0208-101299-103-a123.61 10 HT0208 Homo 83 413324V00571Hs.75294corticotropin releasing3.72 .
hormone 10 412266N59006Hs.26133ESTs 3.80 .

436887AW953157Hs.193235ESTs 7.24 .

454968AW849046 gb:IL3-CT0214-150300-085-H063.05 .
80 CT0214 Homo 10.53 418162T11958 gb:A802R Heart Homo 3.07 10 Sapiens cDNA clone 50 A

425537A8007913Hs.158291KIAA()444 protein 3.07 .

436230AI248723Hs.17711ESTs 3.09 .

431169AW971240 gb:EST383329 MAGE resequences,3.02 .
MALL Homo 10.43 447359NM Hs.18268adenylate kinase 5 5.91 10.40 457187AA443927Hs.144360EST 3.30 10.39 407539X91103 gb:H.sapiens mRNA for 3.02 10.35 Hr44 protein.

452855817746Hs.84469ESTs 3.02 10.26 440352AI692322Hs.65373ESTs 3.03 10.20 456116228528Hs.1720046tin 3.11 10.17 458172BE007237 gb:PMO-BN0139-050500-003-g093.32 10.14 BN0139 Homo 445881AI263029Hs.210689ESTs 3.04 10.11 454059NM Hs.37048statherin 3.27 9.97 1 402624clpl exon 3.05 9.94 ~ 2660 441539AA937200Hs.192939ESTs 3.27 9.82 412172N76794 gb:yv45g07.r1 Soaresfetalliverspleen3.03 9.78 427942AA417856 gb:zv01d05.r1 NCI_CGAP_GCB14.09 9.73 Homo Sapiens d3686BE0418377 ESTs 3.25 9.73 Hs.120316 15 454688AW814472 gb:MR3-ST0203-010200-109-b063.41 9.73 ST0203 Homo 446122AI362790Ns.181801ESTs 3.40 9.71 420480AL137361Hs.98173hypothe6calprotein 3.03 9.56 433447U29195Hs.3281neuronal pentraxin 3.72 9.54 II

407178AA195651Hs.104106ESTs 3.89 9.47 415614F12926Hs.165998DKFZP564M2423 protein 3.06 9.45 450518BE245175Hs.270893ESTs 3.99 9.39 d55675BE065984 gb:RC3-BT0319-120200-014-a063.46 9.32 BT0319 Homo 456459AA253074Hs.146261ESTs 4.08 9.30 423420A1571364Hs.128382Homo Sapiens mRNA; 5.18 9.23 cDNA DKFZp76111224 (f 25 455644BE064521 gb:RC4-BT0311-250200-014-d023.02 9.20 BT0311 Homo 419800AA282392Hs.191525ESTs 3.28 9.16 430964Y10929Hs.248167zincfingerprotein 186(Kruppeltype)3.04 9.00 409716AL117454Hs.56027Homo Sapiens mRNA; 3.02 9.00 cDNA DKFZp586J 1717 (f 412962AW839578Hs.18i60Homo sapiens cDNA FLJ115503.33 8.99 fis, clone HE

30 445040AW444934Hs.195929ESTs, Weakly similar 3.50 8.9G
1o pre-serum amyloi 451496AW503407 gb:Ul-HF-BNO-akw-d-11-0-ULr13.17 8.94 NIH MGC_50 424617AA344151 gb:EST50059 Gall bladder3.25 8.91 I Homo Sapiens 441914AA971496Hs.128465ESTs 3.42 8.88 405320cNp3-12168 exon 3.30 8.84 35 449179A1633785Hs.196561ESTs 3.43 8.84 400335Y13187Hs.248066Homo Sapiens dmd gene,3.13 8.78 intron 11 454962AW847645 gb:ll3-CT0213-280100-056-A044.16 8.74 CT0213 Homo 407803AW081681Hs.269064ESTs 3.09 8.73 455260AW878317 gb:MR3-OT0007-260300-206-e093.78 8.70 OT0007 Homo 431096AA324358Hs.249227Homo Sapiens DNA, cosmid4.01 8.67 clones TN62 and 424481819453Hs.1787proteolipid protein 8.12 8.63 (Pelizaeus-Merzbache 407616AW054849Hs.246831ESTs, Weakly similar 3.08 8.53 to CIKG HUMAN VOLTA

434589AF147363 gb:Homo Sapiens full 3.26 8.51 length insertcDNA

439239A1031540Hs.235331ESTs 5.78 8.48 45 410926AW810708 gb:MR2-ST0129-051099-007-g073.34 8.47 ST0129 Homo 430004U27768Hs.227571regulator of G-protein4.26 8.45 signalling 4 409623AW449185 gb:Ul-H-BI3-akg-e-05-0-ULs13.32 8.43 NCI-CGAP Su 420156AW449258Hs.6187ESTs 3.40 8.38 411555AF113537Hs.70669HMP19 protein 5.85 8.34 408509AA497035Hs.110502ESTs 3.17 8.34 442368A1698577Hs.202481ESTs 3.02 8.33 457870AA732217Hs.294054ESTs 3.04 8.32 437254AA831258 gb:oc73f04.s1 NCI CGAP3.35 8.24 GCB1 Homo Sapiens 415508839236 gb:yc91d03.s1 Soaresinfantbrain3.07 8.22 55 409483U49379Hs.54506diacylglycerol kinase,3.31 8.20 epsilon (64kD) 435229AA676556Hs.269515ESTs, Moderately similar3.21 8.19 to ALUB HUMAN !

458120W21398Hs.54523ESTs, Weakly similar 3.22 8.17 to cytochrome P-d50 444613H29627Hs.79092ESTs 3.78 8.16 41.7050N39540Ns.108029ESTs 4.06 8.14 425607U09860Hs.158333protease, serine, 7 3.68 8.06 (enterokinase) 413263BE075131 gb:PM1-BT0585-110200-003-g033.40 8.04 BT0585 Hamo 424549A1873205Hs.183114Homo Sapiens cDNA FLJ142363.27 8.03 fis, clone NT

452689F33868Hs.284176transferrin 3.03 8.01 405476cNp3_19940 exon 3.28 8.00 65 403932c5p1 exon 3.58 7.99 407095AF011757Hs.105937RAGE binding protein 3.32 7.96 415967H11124 gb:ym14h07.s1 Soares 3.10 7.96 infant brain 1 NIB
H

417555H65366 gb:yr67c10.r1 Soaresfetalliverspleen3.05 7.95 448985AA324885Hs.22777carbonic anhydrase 5.30 7.79 XI

70 428689NM Hs.189810sulfotransferase-related3.87 7.74 014351 protein 424140248051Hs.141308myelin oligodendrocyte4.68 7.74 glycoprotein 441099AW339393Hs.126573ESTs 3.08 7.74 448589AF017090Hs.21554KIAA1107 protein 3.10 7.73 406112ph0 exon 3.22 7.70 75 458439AV647220Hs.282889ESTs, Weakly similar 3.22 7.69 to strong similarit 429859NM_007050Hs.225952protein tyrosine phosphatase,3.15 7.68 receptor t 412090AW955826Hs.12396ESTs, Weakly similar 3.01 7.67 to ALU6 HUMAN ALU
S

413547BE147440 gb:RC1-HT0229-080100-015-f093.01 7.66 HT0229 Homo 447772A1924558Hs.161399ESTs 3.04 7.63 411132AW819191 gb:CM1-ST0283-071299-061-d083.72 7.61 ST0283 Homo 425490NM_002248Hs.158173potassium intermediatelsmall3.15 7.60 conductance 454568BE141434 gb:MRO-HT0079-051099-002-d013.16 7.59 HT0079 Homo 439099AB037800Hs.6462kIAA1379 protein 3.d0 7.57 415669NM Hs.78589serine (orcysteine) 5.71 7.57 005025 proteinase inhibito 428175AI81077dHs.98376ESTs 3.04 7.55 413162BE068115 gb:CMi-BT0368-061299-060-g073.43 7.54 BT0368 Homo 451361AA053854Hs.235390Homo Sapiens mRNA; 3.11 7.53 cDNA DKFZp7618101 (fr 442527AF150289Hs.205d36ESTs 3.31 7.53 450407NM Hs.24969gamma-aminobutydc acid5.24 7.53 00081 (GABA) A recepto D

456966AI589569Hs.190082ESTs 3.13 7.47 441799AW292276Hs.127872ESTs 3.38 7.41 424185AA279752Hs.142570Homo Sapiens clone 3.16 7.40 24629 mRNA sequence 1 429783AA811987Hs.125779ESTs 3.13 7.38 ~

429268AA205386Hs.198481RAR-related orphan 3.48 7.38 receptor B

400708ciipl exon 3.33 7.35 402598BE314624Hs.3128polymerase (RNA) II 3.04 7.33 (DNA directed) polyp 455377AW905347 gb:OV2-NN1073-220400-159-f063.03 7.33 NN1073 Homo 1 435070AI821270Hs.116930ESTs 3.03 7.33 S

405427cNp3-17682 exon 3.03 7.25 455149AW861879 gb:CMO-CT0341-260100-160-h123.56 7.24 CT0341 Homo 402816clp3-2531 exon 3.13 7.21 422890243784Hs.787fsolute carrier family 3.40 7.15 3 25 (mitochondria) 20 422297AW961290Hs.155615ESTs 3.44 7.10 412686AW984068 gb:RCO-HN0006-160300-011-e063.91 7.09 HN0006 Homo 436383BE065178 gb:RCi-BT0314-020200-012-h013.09 7.09 BT0314 Homo 412290BE069037 gb:OV3-BT0379-161299-040-e123.04 7.08 BT0379 Homo 415486H12214Hs.13284ESTs 4.22 7.07 407728AW071502Hs.175931ESTs 3.05 7.06 448546813209Hs.21413solute carrier family 5.93 7.05 12, (potassium-chl 417275X63578Hs.818d9parvalbumin 4.08 7.04 418425A1871247Hs.6262ESTs 4.10 7.04 440558AA889574Hs.177511ESTs 3.28 7.04 3~ 411427AW846080 gb:MR3-CT0176-081099-002-b093.11 7.03 CT0176 Homo 422272AI452421Hs.77965Clk-associating RS-cyclophilin3.39 7.03 410816AW806175 gb:MRt-UM0108-130400-003-a063.30 7.02 UM0108 Homo 418375NM Hs.84389synaptosomal-associated9.93 7.01 003081 protein, 25kD

421627AI138551Hs.97318ESTs 3.10 7.01 35 447258BE047911 gbaz44a05.y1 NCI CGAP_Bm52Homosapien3.09 6.99 455547AW994078 gb:RC3-BN0036-090200-011-h023.35 6.98 BN0036 Homo 432209AW971278 gb:EST383367 MAGE resequences,3.49 6.92 MAGL Homo 404541c8p1 exon 4.62 6.89 451539AA059467Hs.218933ESTs 3.01 6.88 4~ 429954A1918130Hs.21374ESTs 3.82 6.87 411138AW819500 gb:RCS-ST0293-180100-012-C073.08 6.87 ST0293 Homo 447464AW444957Hs.201897ESTs, Weakly similar 3.33 6.85 to ALU4-HUMAN ALU
S

454713AW815111 gb:OV4-ST0212-091199-023-c093.16 6.84 ST0212 Homo 415734NM Hs.78748KIAA0237 gene product 5.00 6.84 45 429667AA456275Hs.44841ESTs 3.09 6.80 403008c21p3-2374 exon 3.04 6.78 446079T56522Hs.154030ESTs 3.11 6.75 441869NM Hs.8004huntingtin-associated 4.49 6.75 003947 protein interactin 437804AA828257Hs.124324ESTs 3.42 6.73 436454AA757615Hs.291509ESTs 3.01 6.72 416334H53139Hs.36271ESTs 3.12 6.70 455965BE167014 gb:CM2-HT0502-140200-088-4083.05 6.68 HT0502 Homo 445085A1569295Hs.179285ESTs 3.19 6.68 445611AW418497Hs.145583ESTs 3.61 6.68 55 437762T78028Hs.i54679synaptotagmin 1 7.21 6.68 416268H49111 gb:yo21c07.r1 5oares 3.02 6.67 adult brain N2b5H85 449766A1668690Hs.54773ESTs 3.25 6.64 443100A1033188 gb:ow94e08.s1 Soares 3.07 6.64 fetal liver-spleen 40.8070AW148852 gb:xf05d05.x1 NCI_CGAP_Bm353.12 6.60 Homo sapien 451602AW008846Hs.60857ESTs 3.05 6.59 441447AA934077Hs.126980ESTs 4.06 6.59 445078A1869975Hs.4775junctophilin 3 4.25 6.59 434501AF143878Hs.194152Homo Sapiens clone 3.25 6.58 IMAGE:115304 mRNA
seq 415960849020Hs.24974ESTs 3.34 6.58 65 403395c3p1 exon 3.59 6.57 403061c2p1 exon 3.06 6.56 419232A1382037Hs.87421ESTs 3.28 6.56 425984AW836277Hs.i65636hypothetical protein 6.50 6.56 DKFZp761C07121 403717c4p1_3133 exon 3.52 6.53 7~ 452178AW043576Hs.171929ESTs 3.38 6.53 455758815709Hs.284231Novel human gene mapping4.42 6.52 to chomosome 22 433858N69243Hs.192974Homo Sapiens cDNA FLJ127353.58 6.52 (is, clone NT

425440AA357518 gb:EST66256 LNCAP cells3.15 6.49 I Homo Sapiens c 419412AW161058Hs.90297synuclein, beta 5.60 6.47 75 423678AW963357Hs.7847ESTs 3.47 6.47 416625897839Hs.35758ESTs 3.10 6.46 451854T92536Hs.194096ESTs 3.28 6.46 406732AA487229Hs.2064vimentin 3.71 6.44 434619H43163Hs.32810ESTs 3.05 6.44 g0 413797BE167274Hs.5996ESTs 3.23 6.44 438612AW977980Hs.292129ESTs 3.39 6.42 412317AW991979 gb:RC1-BN0014-210100-012-f053.46 6.42 BN0014 Homo 422159N76767Hs.153406ESTs 3.03 6.41 429290AF203032Hs.198760neurofilament, heavy 3.46 6.35 polypepfide (200kD) 427334844789Hs.119486ESTs, Weakly similar 3.93 6.35 to transmembrane re 453839AL138417 gb:DKFZp434B1729-r1 3.06 6.34 434(synonym:htes3) d29096AB011106Hs.196012KIAA0534 protein 3.12 6.33 444609AW571659Hs.278081ESTs 3.30 6.33 419515S81944Hs.90791gamma-aminobutyric 3.11 6.33 acid (GABA) A recepto 418900BE207357Hs.301709ESTs 3.14 6.30 437979AA774318Hs.121708ESTs 3.25 6.29 410359838624Hs.106313ESTs 4.74 6.28 1 d15990876929Hs.29633ESTs 3.39 6.28 o 419392W28573 g6:51f10 Human retina 3.00 6.28 cDNA randomly prim 424312A8013452Hs.144931ATPase, aminophospholipid3.06 6.26 transporter (A

444762AI733700Hs.143883ESTs 3.09 6.25 447785AL041765Hs.161423ESTs 3.05 6.22 15 418199AA884555Hs.86603ESTs 3.55 6.22 440582AA993337Hs.129082ESTs 3.73 6.21 457766AL119470Hs.145631ESTs 3.69 6.21 426614AF036943Hs.172619KIAA1106 protein 4.71 6.21 412018BE148152 gb:RC4-HT0231-041199-012-b043.36 6.21 HT0231 Hamo 414699A1815523Hs.76930synuclein, alpha (non 3.68 6.19 A4 component of am 420127AA360399Hs.44811ESTs 3.54 6.18 418833AW974899Hs.292776ESTs 3.08 6.18 441265AA927180Hs.153261ESTs 3.21 6.17 413408851793Hs.21745ESTs 3.56 6.15 434512AW139932Hs.188941ESTs 3.56 6.15 422253W81526Hs.118329ESTs 5.04 6.10 439950AW937417Hs.293561ESTs 3.24 6.10 417210N99228Hs.49162ESTs 3.54 6.10 414306BE272198Hs.283869Human DNA sequence 3.35 6.10 from clone RPS-1013A2 411265AW834695 gb:RCO-LT0001-261199-031-D053.07 6.10 LT0001 Homo 412734AW993498 gb:RC2-BN0033-170300-019-b083.36 6.09 BN0033 Homo 425172AA447729Hs.12714ESTs 5.40 6.06 451759W23161Hs.32886ESTs 3.21 6.02 432154A1701523Hs.112577ESTs 3.50 6.02 35 401313c13p1435 exon 3.92 5.96 446951AI350575Hs.156730ESTs 3.20 5.95 440917AA909651Hs.160025ESTs 3.06 5.94 405961ph0_14521 exon 3.12 5.91 428737AA984728Hs.192760kinesin family member 3.05 5.90 417292N69197Hs.191361ESTs 3.62 5.89 448681AL109781Hs.21754Homo Sapiens mRNA full3.52 5.88 length insert cDN

452524AW136499Hs.29796Homo Sapiens mRNA; 3.07 5.88 cDNA DKFZp434D1319 (f 426575M74826Hs.170808glutamate decarboxylase4.08 5.87 2 (pancreatic is 423641AL137256Hs.130489Homo Sapiens mRNA; 3.28 5.87 cDNA DKFZp761 K0912 (f 45 420755AI699437Hs.165268ESTs 3.17 5.86 448116AW352276Hs.170700ESTs 3.28 5.86 412694AW984373 gb:PM3-HN0011-200300-001-f013.00 5.83 HN0011 Homo 437612AA827715Hs.105153Homo sapiens cDNA FLJ142303.09 5.82 fis, clone NT

411522AW850286 gb:IL3-CT0219-161199-031-H113.26 5.81 CT0219 Homo 50 456910BE185921Hs.98073ESTs 3.20 5.80 d39915AI521791Hs.252358ESTs 3.55 5.80 404403c8p1 exon 3.23 5.80 405332cNp3-13017 exon 3.51 5.78 411167AW820204 gb:OV2-ST0296-190100-029-c113.04 5.78 ST0296 Homo 55 416139H21109Hs.172853ESTs 3.63 5.77 434222AF119886Hs.283941Homo sapiens PR02591 3.65 5.77 mRNA, complete cds 415247F02431Hs.6581ESTs 3.08 5.75 446037A1076806Hs.282965ESTs 3.42 5.75 450478AW451709Hs.271200ESTs 3.80 5.72 60 446588AV659343Hs.282954ESTs 3.29 5.72 413118BE065939 gb:RC3-BT0319-100100-012-c113.03 5.72 BT0319 Homo 416946NM Hs.80545mitogen-activated protein3.91 5.72 012324 kinase 8 inter 454751AW819132 gb:RC3-ST0281-240400-015-c105T02813.06 5.72 Homo 457194H20669Hs.35406ESTs, Highly similar 3.54 5.71 to unnamed protein 65 438601AA811713Hs.163222ESTs 3.26 5.71 439032AA829487Hs.274412similarto yeast Upf3,variantA3.10 5.67 408940M585B3Hs.662cerebellin 1 precursor3.32 5.67 437700AA766060Hs.122848ESTs 3.23 5.66 416061845516Hs.26119ESTs 3.85 5.65 70 452861BE177663 gb:RC1-HT059&020300-011-h113.04 5.64 HT0598 Homo 430330AA476583Hs.132981ESTs 3.51 5.63 435312AJ243396Hs.4865voltage-gated sodium 5.67 5.62 channel beta-3 subu 400710c11p1_1297 exon 3.04 5.61 457130NM Hs.i83671lryptophan 2,3-dioxygenase3.31 5.60 75 434513AF143888Hs.18213Homo Sapiens clone 3.93 5.60 IMAGE:121736 mRNA
seq 434277X77748Hs.3786glutamate receptor, 3.67 5.58 metabotropic 3 440854AW4d4900Hs.246715ESTs 3.30 5.58 457086AA412591Hs.2046B5ESTs 3.37 5.57 431883AA731404Hs.105510ESTs 3.67 5.56 400758AA158742Hs.225084Homo Sapiens cDNA FLJ142803.43 5.55 fis, clone PL

455374AW904039 gb:CM3-NN1040-200400-156-d033.36 5.52 NN1040 Hamo 440750AW105131Hs.245405ESTs 3.10 5.50 451865H43737Hs.33186ESTs, Weakly similar 3.38 5.50 to unknown protein 453100AW806871Hs.224786ESTs 3.30 5.49 433940H05129Hs.7459cyclic AMP-regulated 3.24 5.49 phosphoprotein, 21 454935AW846075 gb:MR3-CT0176-081099-002-b023.26 5.48 CT0176 Homo 435447A1872932Hs.142442HP1-BP74 3 5 402953c20p3_3451 exon . .
3.28 5.47 456233AA203339 gb:zx56a01.r1 Soares 3.02 5.47 fetal_liver-spleen-407718AW070784Hs.243243EST 3.30 5.45 417429A1950629Hs.286237Homo sapiens cDNA FLJ13.31 5.38 1 841 tis, clone HE

446408AI797169Hs.208486ESTs 3 5 1 441792AW873635Hs.143962ESTs . .
~ 3.19 5.35 -050661AW952160Hs.32916ESTs 3.70 5.35 433932AW954599Hs.169330neuronal protein 6.78 5.33 427002AA524093Hs.23158ESTs 4.00 5.32 428741AA461386 gb:zx70hO6.r1 Soares 3 5 total 10 32 fetus Nb2HF8 1 446383T05816Hs.92511- . .
_ 3.39 5.30 _ EST

442988A1026130Hs.131683ESTs 3.07 5.29 426713A1655299Hs.130055ESTs 3.33 5.29 421294AA713486Hs.180291ESTs 3.44 5.28 406452ph2-21961 exon 3 5 423508AW604297Hs.129711hepatitis A virus cellular. .
receptor 1 3.26 5.27 442114BE217975Hs.157021ESTs 3.32 5.26 432508AI808915Hs.190201ESTs 3.46 5.26 425604094320Hs.158330neuropeptide Y receptorY53.26 5.23 417925826789Hs.23995ESTs 3 5 25 444448H66317Hs.143660ESTs . .
3.81 5.22 413024AF036268Hs.75149SH3-domain GR82-like 3.71 5.22 -037911AA848010Hs.124250ESTs . 3.11 5.18 435406F26698Hs.4884calciumlcalmodulin-dependent4.95 5.17 protein kin 407131898679 gb:yr31c03.s1Soaresfetalliverspleen3.30 5 435776AI537162Hs.263988ESTs 3.14 .
5.13 455532AW984828 gb:RC1-HN0015-120400-021-h113.14 5.13 HN0015 Homo -057352AA489099 gb:aa56h09.s1 NCI-CGAP_GCB13.48 5.12 Homosapiens 428670AA43i682Hs.134832ESTs 3.17 5.12 445962A1268410Hs.201386ESTs 3 5 3 418153813696Hs.112830ESTs . .
5 3.16 5.10 440565AW103823Hs.131586ESTs 3.08 5.10 431446AW294929Hs.255369Homo Sapiens cDNA FLJ102653.42 5.09 fis, clone HE

456036BE536554Hs.75839zinc finger protein 3.21 5.09 6 (CMPXi ) 420883AI735488Hs.111436ESTs 3 5 455528AW984757 gb:RC1-HN0015-040400-011-g10. .
HN0015 Homo 3.35 5.08 408442859608Hs.21435ESTs 3.10 5.07 446093A1346849Hs.145896ESTs 3.30 5.06 403489c3p1 exon 3.43 5.05 405278cNp3_1070 exon 3 5 45 412804H18857Hs.22547ESTs . .
3.63 5.03 458407W90022Hs.186809ESTs, Highly similar 3.52 5.03 to LECT2 precursor 407367AA130773 gb:zo13dOt.r1 5tratagene3.51 5.02 colon (937204) 439108AW163034Hs.6467synaptogydn 3 5.63 5.01 445335A1220339Hs.166775ESTs 3 01 435404A1240661Hs.124995ESTs . .
3.99 5.00 TABLE 6B:
Pkey: Unique Eos probeset identifier number CAT number: Gene cluster number 55 Accession: Genbank accession numbers Pkey CAT Accession Number 454566164604_1AW807605 AW807690 AW807677 AW807752 AW807673 AW807900 7o AW807819 AW807769 AW807685 AW807603 AW807763 AW807612 AW807688 AW807847 AW807957 AW807674 AW807602 AW8076i7 437948330397_1AA772920 D59870 D61151 AI591331 BF960996 75 454578_ BE150647 AW971143 AW809224 AW809221 BF753820 AW809220 4558361518824BE145800 BE145921 8E145873 BEi45871 BE145930 BE145797 4549681085677_1AW848279 AW849039 AW847956 AW8d7957 AW8d9046 AW848698 455675 1490763_1 BE065984 BE066085 BE065942 BE065955 455644 1489561_1 BE064521 BE064441 BE064426 BE064285 BE064286 455260 231032 1 BE161805 AW8783i7 BE161759 BF8700328F869588 1 ~ 437254 1239876 1 AW976161 AA831258 AA765857 AA747712 AI784019 415508 1874742_1 845579 F10822 839236 413263 1497122_1 BE075132 BE075131 BE075130 D60395 BF688035 417555 1978200 1 AA203678 AL597143 Hfi5366 411132 1070974_1 AW819177 AW819242 AW819191 AW819175 AW819252 AW819244 413162 1492355 1 BE068104 BE068096 BE068198 BE0681i5 BE068102 BE068154 455377 154707_1 BF947516 AW905291 BF947512 BF952606 BF952706 BF952525 BF952524 BF952619 BF947500 BF952fi08 BF952523 BF952532 BF952344 455149 1099453 1 AW861879 AW861948 AW858447 AW861873 AW858418 AW8fi1871 412686 1243154_1 AW984068 AW984077 AW984072 447258 1485710 1 BE6i7316 BE047911 AA984167 3~ 455547 1245954 1 AW994078 BE176183 454713 10678891 AW815111AW815094AW8152i8 419392 215562_2 W28573 W27418 411265 1074383_1 AW834695 AW834717 AW834714 AW984366 AW98d3d8 AW984391 AW984373 AW984372 AW984353 AW984362 411522 1089092 1 BE143505 BF374i94 BF374190 AW850286 455374 1161013 1 AW904029 AW904030 AW904039 AW90d031 AW904032 AW90d046 AW8d6095 AW846076 BF333979 BF333978 AW846092 55 455532 1243692_1 AW984828 AW984787 AW984806 AW984817 AW984826 AW98d822 455528 1243660_1 AW984734 AW984757 AW984797 AW984745 C)O TABLE 60:
Pkey: Unique number corresponding to an Eos probeset Ref: Sequence source. The 7 digit numbers in this column are Genbank Identifier (GI) numbers. "Dunham, et al." refers to the publication entitled "The DNA
sequence of human chromosome 22" Dunham, et al. (1999) Nature 402:489-495.
Strand: Indicates DNA sUand from which exons were predicted.
N~position: Indicates nucleotide positions of predicted exons.
Pkey Ref Strand Nt_position 401412 7940103 Minus 43347-45776 405230 7249032 Minus 97493-97682 7~ 402125 4033680 Plus 172732-172868 404289 2769644 Plus 15049-15286,30267-30457 406534 7711477 Plus 40463-40586,41191-41336,41856-41986,4300 405348 2914717 Minus 43310-43462 401081 3478647 Plus 105163-105305 7J~ 402624 7885063 Minus 31308-31439 405320 3478667 Minus 118511-118926,119175-119331 405476 2121229 Plus 69890-70883 403932 7454203 Minus 8142-8753 406112 9133145 Plus 61863-62028 g o 400708 7249204 Plus 118115-119445 405427 7243901 Minus 6509-6729 402616 6723302 Minus 25104-25291 404541 8318559 Plus 103456-103664 N ,F v. ~
4'' ~...~ ~~~~N'~~ ~~ i~f'""t~~n~ R;"'d :'' h:..~
~y~T~'.."~''~~'"'''~';~.~,6~~i~,~~~~~~~~'~~~'~~..~:(~

403008 6070396 Plus 94608-94785,95096.95233 403395 9438353 Minus 144947-145075 S 403061 8954192 Plus 142875.143008 ~,y' 403717 7259747 Minus 79166-79758 .~
401313 9212516 Minus 190842-191090 .

405961 8190197 Plus 45132 45254 404403 7272157 Minus 72053-72238 405332 3169141 Minus 70483-71207 400710 7249204 Plus 156753-157120 1 402953 9408724 Minus 122603-122743 O

406452 9588380 Minus 76322-76427 403489 7331314 Minus 38897 39212 405278 6139075 Minus 3863-3965,4823-4891,5439-5529.8043-6170 15 _ TABLE 7A: EXTENDED GUOBLASTOMA SEOUENCES~
This table includes sequence infarmafion for 21 ONA and protein sequences DNA sequence 1 (SEQ ID N0:367t Gene name: Protein tyrosine phosphatase, receptor-type, 2 polypeptide 1 0 Unigene number: Hs.78867 Probeset Accession #: M93426 Nucleic Acid Accession #: NM 002851 Coding sequence: 148-7092 O CGGCGAGGGG CCGCAGACCG TCTGGAA_ATG CGAATCCTAA300 ? ACTACAGACA ACAGAGAAAA 480 CAAGTAAATG TGAATCTTAA GAAACTTAAA TTTCAGGGTT780 - _ CfGACAAGTA TTACATTTAC 1680 ACAGTTAGCA TCTCTGAAAG CCAG'FTGGCT GTTTTTTGTG1860 TCTGGTTATG TCATGCTGAT GGACTAC1'TA CAAAACAATT1980 , AACCAGTCAC TAAATTAGCC 3360 AACTTGTCGG GGACTGCAGA ATCCTTAAAT ACAGTTTCTA
TAACAGAATA TGAGGAGGAG
AGTTTATTGA CCAGTTTCAA GCTTGATACT GGAGCTGAAG
ATTCTTCAGG CTCCAGTCCC
GCAACTTCTG CTATCCCATT CATCTCTGAG AACATATCCC
AAGGGTATAT ATTTTCCTCC
GAAAACCCAG AGACAATAAC ATATGATGTC CTTATACCAG
AATCTGCTAG AAATGCTTCC
GAAGATTCAA CTTCATCAGG TTCAGAAGAA TCACTAAAGG
ATCCTTCTAT GGAGGGAAAT
GTGTGGTTTC CTAGCTCTAC AGACATAACA GCACAGCCCG
ATGTTGGATC AGGCAGAGAG
AGCTTTCTCC AGACTAATTA CACTGAGATA CGTGTTGATG
AATCTGAGAA GACAACCAAG
TCCTTTTCTG CAGGCCCAGT GATGTCACAG GGTCCCTCAG
TTACAGATCT GGAAATGCCA
CATTATTCTA CCTTTGCCTA CTTCCCAACT GAGGTAACAC
CTCATGCTTT TACCCCATCC
TCCAGACAAC AGGATTTGGT CTCCACGGTC AACGTGGTAT
ACTCGCAGAC AACCCAACCG
GTATACAATG GTGAGACACC TCTTCAACCT TCCTACAGTA
GTGAAGTCTT TCCTCTAGTC
ACCCCTTTGT TGCTTGACAA TCAGATCCTC AACACTACCC
CTGCTGCTTC AAGTAGTGAT
TCGGCCTTGC ATGCTACGCC TGTATTTCCC AGTGTCGATG
TGTCATTTGA ATCCATCCTG
TCTTCCTATG ATGGTGCACC TTTGCTTCCA TTTTCCTCTG
CTTCCTTCAG TAGTGAATTG
TTTCGCCATC TGCATACAGT TTCTCAAATC CTTCCACAAG
TTACTTCAGC TACCGAGAGT
GATAAGGTGC CCTTGCATGC TTCTCTGCCA GTGGCTGGGG
GTGATTTGCT ATTAGAGCCC
AGCCTTGCTC AGTATTCTGA TGTGCTGTCC ACTACTCATG
CTGCTTCAGA GACGCTGGAA
TTTGGTAGTG AATCTGGTGT TCTTTATAAA ACGCTTATGT
TTTCTCAAGT TGAACCACCC
AGCAGTGATG CCATGATGCA TGCACGTTCT TCAGGGCCTG
AACCTTCTTA TGCtTTGTCT
GATAATGAGG GCTCCCAACA CATCTTCACT GTTTCTTACA
GTTGTGCAAT ACCTGTGCAT
GATTCTGTGG GTGTAACTTA TCAGGGTTCC TTATTTAGCG
GCCCTAGCCA TATACCAATA
CCTAAGTCTT CGTTAATAAC CCCAACTGCA TCATTACTGC
AGCCTACTCA TGCCCTCTCT
GGTGATGGGG AATGGTCTGG AGCCTCTTCT GATAGTGAAT
TTCTTTTACC TGACACAGAT
GGGCTGACAG CCCTTAACAT TTCTTCACCT GTTTCTGTAG
CTGAATTTAC ATATACAACA
TCTGTGTTTG GTGATGATAA TAAGGCGCTT TCTAAAAGTG
AAATAATATA TGGAAATGAG
ACTGAACTGC AAATTCCTTC TTTCAATGAG ATGGTTTACC
CTTCTGAAAG CACAGTCATG
CCCAACATGT ATGATAATGT AAATAAGTTG AATGCGTCTT
TACAAGAAAC CTGTGTTTCC
ATTTCTAGCA CCAAGGGCAT GTTTCCAGGG TCCCTTGCTC
ATACCACCAC TAAGGTTTTT
GATCATGAGA TTAGTCAAGT TCCAGAAAAT AACTTTTCAG
TTCAACCTAC ACATACTGTC
TCTCAAGCAT CTr,GTGACAC TTCGCTTAAA CCTGTGCTTA
GTGCAAACTC AGAGCCAGCA

.;-: : ..~ ~' 1.','.
;<:;d CA 02459219 2004-03-17 . . . ' a~ l ~ ~:

t~"~ 'L.. ~it .'' ~ 1~'~:'h ~.;~'~t~ : ~'~'"~'' J'~a5)'i rrr~..i~-~~

- ".~'~~.y='~.;~:
~:a':~ ~;..:

.. .
TCCTCTGACC CTGCTTCTAG TGAAATGTTA TCTCCTTCAA366V' CTCAGCTCTT ATTTTATGAG

CCTTTCAGGC TTCTGATGTT

t ATCCAATATT GGTTGAAACC

CCCAAAGTTG ATAAAATTAG TTCTACAATG TTGCATCTCA3840 , S TTGTATCAAA TTCTGCTTCA

ATGTGTCGCC TACTTCTCAT

ATGCACTCTG CTTCACTTCA AGGTTTGACC ATTTCCTA,TG3960 CAAGTGAGAA ATATGAACCA

CTTTGTACAG TAATGATGAG

CCCCAAAAGG AAGGCATGTA

CACfAATAAA TAAGCTTATA

1 O CATTCCGATG AAATTTTAAC CTCC'ACCAAA AGTTCTGTTA4200 CTGGTAAGGT ATTTGCTGGT

ATTCTGTTCC TATAGGAAAT

"- GGGCATGTTG CCATTACAGC TGTTTCTCCC CACAGAGATG4320 GTTCTGTAAC GTCAACAAAG

GTGCCAAATC TGATGCCGGT

CATCCTATAG AGAATCACAG

TTATGGATCA GAATAATCCA

GAGTCACAAG TGTATCCTCA

CTGGTAGTGC TCTGCTTCCT

n CTCAGCCCTG AATCTAAAGC ATGGGCAGTT CTGACAAGTG4800 ATGAAGAAAG TGGATCAGGG

CAGATTTCAG TTTTGCAGAC

ACfAATGAAA AAGATGCTGA TGGGATCCTG GCAGCAGGTG4920 ACTCAGAAAT AACTCCTGGA

CAGAAGTGTT CCACGTTTCA

r~ GAGGCAGAGG CCAGTAATAG TAGCCATGAG TCTCGTATTG5040 ' " GTCTAGCTGA GGGGTTGGAA
S

CCCTGACTTT TATCTGTCTA

TCCAGACTGC ACACTTTTAC

_ TTAGAGGACA GTACATCCCC TAGAGTTATA TCCACACCTC5220 CAACACCTAT CTTTCCAATT

AGCATGTTGC AGATTTACAT

AGTTTTACCA GGAAGTGCAG

ACCACCCAGA CAACAAGCAC

GGGTTAAGCT AGCACAGCTT

GCi'GAAAAGG ATGGCAAACT GACTGATTAT ATCAATGCCA5520 ATTATGTTGA TGGCTACAAC

t AGACCAAAAG CTTATATTGC TGCCCAAGGC CCACTGAAAT5580 CCACAGCTGA AGATTTCTGG

l AGAATGATAT GGGAACATAA TGTGGAAGTT ATTGTCATGA5640 TAACAAACCT CGTGGAGAAA

GTGAGGAGTA CGGGAACTTT

CTGTGAGGAA TTTTACTCTA

CCAGTGGACG TGTGGTCACA

AGTACTCCCT GCCAGTGCTG

TGGGGCCTGT TGTCGTCCAC

4O TGCAGTGCTG GAGTTGGAAG AACAG,GCACA TATATTGTGC6000 TAGACAGTAT GTTGCAGCAG

AACACATCCG TTCACAAAGA

ATGATACACT GGTTGAGGCC

ATGCCTATGT TAATGCACTC

AATTCCAGCT CCTGAGCCAG

GCATTTCATC CCTGAGTGGA

ATTACCAGAG CAATGAATTC

TCTGGAGGAT GATATGGGAC

ACATGGCAGA AGATGAATTT

S O GTTTACrGGC CAAATAAAGA TGAGCCTATA AATTGTGAGA6600 GCTTTAAGGT rACTCTTATG

TAATTCAGGA CTTTATCTTA

TTCAGTGTCC TAAATGGCCA

AATCCRGATA GCCCCATTAG TAAAACT2TT GAACTTATAA6780, GTGTTATAAA AGAAGAAGCT

GAGGAGTGAC GGCAGGAACT

AAAATTCCGT GGATGTTTAC

TTGCTGACAT TGAGCAGTAT

GGCAGGAAGA GAATCCATCC

ATATAGCTGA GAGCTTAGAG

~r TCTTTAGTTT AACACAGAAA GGGGTGGGGG GACTCACATC~TGAGCATTGT7140 ~ TT,TCCTCTT,C, ~

SO TTGATTTCCC AfiCACCTGAC 7200 CTAAAATTAG GCAGGAAAAT CAGTCTAGTT CTGTTATCTG

AGTAACTTTC ATGACATAGG ATTCTGCCGC CAAATTTATA?260 TCATTAACAA TGTGTGCCTT

ATGATTGAAT TTTACAGTAT

TTAACAGAAA ATTTCAATTT

ATAGAGGTTA GCiAATTCCAA ACTACAGAAA ATGTTTGTTT7440 TTAGTGTCAA ATTTTTAGCT

6S GTATTTGTAG CAATTATCAG GTTTGCTAGA AATATAACTT7500 , TTAATACAGT AGCCTGTAAA

CAGTATTCAC GTAAAGTAGA

CATGGACCAA ATTTATATTT

ATAATTGTAG ATTTTTATAT TTTACTACTG AGTCAAGTTT7680 , TCTAGTTCTG TGTAATTGTT

TAGTTTAATG ACGTAGTTCA TTAGCTGGTC TTACTCfACC7740' AGTTTTCTGA CA11~TG' . TGTTACCTAA GTCATTAACT TTGTTTCAGC ATGTAATTTTr.~~a4 ~ AACTTfiTGTCi'~ft'A(z'A~ ~
/O

"
ATACCTTCAT TTTGAAAGAA GTTTTTATGA GAATAACACC
TTACCAAArsA T1'GT~.C~AT'~79~'0~

GCCA~A14AA AAAAAAAHAA

AAAAAAAAHA ApAAAAlfAAp A

7S Protein seguence 1 (SEQ ID N0:368) Gene name: Protein tyrosine phosphatase, tide 1 receptor-type, Z polypep Tlnigene number: Ha.7886?

Protein Accession )#: NP_002842 Signal sequence: 1-20 ' g0 Pfam domain: Garb anhydrase L3B-300]

Transmembrane domains: 1639-1661 Cellular Localization: plasma membrane ,; ,'',., t~,..;;,. ~
A.

, , ' ~
'~
~
a~
, .

.
.
' '~y ~<

TGALNQKNWG KKYPTCNSPK

TVEINLTNDY RVSGGVSEMV

DRFSSFEEAV KGKGKLRALS

ILFEVGTEEN LDFKAIIDGV ESVSRFGKQA ALDpFILLNL240 !.
S LPNSTDKYYI YNGSLTSPPC

TDTVDWIVFK DTVSISESQL AVFCEVLTMQ QSGYVMLMDy300 LQNNFREQQY KFSRQVFSSY

TGKEEIHEAV CSSEPENVQA DPENYTSLLV TWERPRVVYb~ 360 TMIEKFAVLY QQLDGEDQTK

SDQLIVDMPT DNPELDLFPE

ISTTTHYNRI GTKYNEAKTN

I QTVTELPPHT VEGTSASLND
O

TGAEDSSGSS PATSAIPFIS

ESLKDPSMEG NVWFPSSTDI

QGPSVTDLEM PHYSTFAYFP

PSYSSEVFPL VTPLLLDNQI

I PFSSASFSSS LFRHLHTVSQ
S

STTHAASETL EFGSESGVLY

KTLMFSQVEP PSSDAMldHAR SSGPEPSYAL SDNEGSQHIF960 TVSYSSAIPV HDSVGVTYQG

SDSEFLLPDT DGLTALNISS

EMVYPSESTV MPNMYDNVNK

.~ LNASLQETSV SISSTKGMFP GSLAHTTTKV FDHEISQVPE1140 GO NNFSVQPTHT VSQASGDTSL

LLQPSFQASD VDTLLKTVLP

VPVFDVSPTS HMHSASLQGL

NQAHPPKGRH VFATPVLSID

VSTDHSVPIG NGHVAITAVS

.~ PHRDGSVTST KLLFPSXATS ELSHSAKSDA GLVGGGEDGD1440 '' GS TDDDGDDDDD RDSDGLSIHK

EEDNRVTSVS SDSQTGMDRS

TSENSEVFHV SfiAEASNSSH

WRKCFQTAHF YLEDSTSPRV

3 ETLKBFYQfiV QSCTVDLGIT
O

YINANYVDGY NRPKAYIAAQ

GPLKSTAEDF WRMIWEHNVE VIVMITNLVE KGRkKCDQYW1860 PADGSEEYGN FLVTQKSVQV

MGVPEYSLPV LTFVRKAAYA

FGFLKHIRSQ RNYLVQTEEQ

. KLEKQFQLLS QSNIQQSDYS

S

AALKQCNREK NRTSSIIPVE RSRVGISSLS GEGTDYINAS2100 ' YIMGYYQSNE FIITQHPLLH

INCESFKVTL MAEEHKCLSN

_ RPGVFADIEQ YQFLYKVILS

DNA SEQUENCE 2 (SEQ ID N0:369) Gene name: tyrosylprotein sulfotransferase Unigene number: Hs.110903 Probeset Accession #: D61594 Nucleic Acid Accession #: NM 003596 Coding sequence: 82-1194 TGAGCAAAAT ATCTGTTTAA

O AGAACTTACT ATTGGCAT(':

ATGCCATGGA ATGCCATCAC

CAAGGACCAC TGTGAGAACT

GGCCTGGACC TCAAAGCCAA CAAAACCfTT GCCTATCACA300 AAGATATGCC TTTAATATTT

S CCATGCTGGA CGCACATCCT
S G
C

ATTCGCT GTGGAGAGGA AACCAGGGTC ATTCCCCGAA
TCCTGGCCCT GAAGCAGATG

CTGGTGTTAC TGATGAAGTG

TTAAGCATGG GGAGCCAGCC

TAACTTACCT TTCTAGGTTA

ATTT

GCTATAGGGA CTGTTTGACA

TGGAGGTTGG TTATAAAAAG

AACGGTGGAT GAGAACACTC

ACCATGAAGA GATGATTGGG

GTCA

CGCCAGATGT TTTACAAGAC

ACCCATATGC CAACCCACCT

AACTACGGAA AACCTGATCC CAAAATTATT GAAAACACTC1140 '7~';~' ~
GAAGGGTCTA TAAGGGAGAA , ' CTGACTTTCT TAAAGAAAAA CCACAGACTG AGCAAGTGGA
GTAGCAGAAC

.~ CAGGAGCCTC TTCCATACAT GAGGAAAGAT TGCTGCCTTT1260 O TCAGCAGAAG GGAAATTCCT

ACCTTGGCTG CGCCGCCTGT

CGCACAGCTT TGGGCCTCGT

TTCATGCACA GCCCTGCAGT

TCTTGTTCTC TTTTCTTACA

~7 TTATGACGTT TGTTTTCAAG GAGAGGGTTT AAAAATGGGA1560 S TCCTGTAAGC AGACTTGGGC
AGTCTCC
TT

TGAAATAGGT TGTCTGTACA TGTTCTAATG TTTTGTAGAA
CACGTGTGCC

TGTTT TG TATTGATGTG AATAATATTA AATATCCTAA x680 TTATTTAATT CATTGTATTG
~

A GTTGGGAAAT TACCATTATA CATTTACAAC CTAATGACTT
TTGTATTTTA

'TTTTTCAAAA TAAAAGCTTT CAATGTGA

00 Protein sequence 2 (SEQ ID N0:370) Gene name: tyrosylprotein sulfotransferase Unigene number: Hs.110903 Protein Accession #: NP

_ Signal sequence: 1-21 . ::,., , ' ' y ~ r a..~

' ~. i ~:dt I~;,d~ li'~~: .~'' ~' lidi: '~"~~~st";'iE~r '.~~~~.1~~ ,~i.,~x;;, 't~ ~h j r. s( . ;E, s ~w _: , ~ ., ~ k r_. ~ ~f~~:~~~s~
'42 '~ .X.. ~.
Transmembrane domains: none found Cellular Localization: plasma membrane S MVGKLKQNLL LACLVIS$VT VFYLGQHAME CHHRIEERSQ PVKLESTRTT VRTGLDLKAN 60 KEKPQTEQVE
DNA sequence 3 (SEQ ID N0:371) Gene name: interleukxn 13 receptor, alpha , Unigene number: Hs.25954 Probeset Accession #: 852795 Nucleic Acid ACCession #: NNI_000640 ; ' s C
di o ng sequence:

GTGTGCCTGT CGGCGGGGAG

TCGTTTGGTT GGCTATCGGA

TGCTTATATA CCTTTCTGAT AAGCACAACA TTTGGCTGTA180 , CTTCATCTTC AGACACCGAG

ZS CCGGATACTT AGGTTATCTC

AGGAATGCAC AGTGGAATAT

CCATCATTAC TAAGAATCTA

CGAAGATACA CACGCTTTTA

GGGCAGAAAC TACTTATTGG

TACTTGTTGA TACCAATTAC

AACTTGTTTT ACfGGTATGA GGGCTTGGAT CATGCATTAC660 AGTGTGTTGA TTACATCAAG

GCTGATGGAC AAAATATAGG ATGCAGATTT CCCTATTTGG720 ' AGGCATCAGA CTATAAAGAT

TCAGATCCAG TTATTTCACT

GACCTATTCC AGCAAGGTGT

TGGTGACTGC TACAGTTGAA

AATTATGCfT TGTAGTAAGA

GTGAGTGGAG TGATAAACAA

~I GTTTCTGGCT ACCATTTGGT
O

TTCATCTTAA TATTAGTTAT ATxTGT)1ACC GGTCTGCTTT1200 TGCGTAAGCC AAACACCTAC

TTTCCATATC AAGAGACATG

TATGAGTCTC AATAAACTGA

AAAAAAAAAA AAAAA?1AAAA

Protein seguence 3 (SEQ ID N0:372) Gene name: xnterleukin 13 receptor, alpha Unxgene number: Hs.25954 n Probeset Accession #: 852795 .
S

V Protein Accession # NP_000631 Signal sequence: 1-23 FN3 domain: 155-322 Tranemembrane domains: 340-362 Cellular Localization: plasma membrane VDPGYLGYLY LQWQPPLSLD

IEAKIHTLLP WQCTNGSEVQ

IGVLLDTNYN LFYWYEGLDH

KpIRSSYPTF QLQNIVKPLP

PVYLTFTRES SCEIKLKWSI PLGPIPARCF DYEIEIRE'DD300 TTLVTATVEN ETYTLKTTNE

LLRFWLPFGF ILILVIFVTG

LLLRKPNTYP KMIPEFFCDT

6S DNA sequence 4 (SEQ ID N0:373) Gene name: chemokine (C-X3-C) receptor 1 Unigene number: Hs.78913 Probeset Accession #: U20350 ~~ Nucleicyd Accession #: NNI_001337 7~ '~~
' ~
Codmg ~
ence: 46-1113 .

, ' 1 11 21 31 41 S1 ~ CAGATC CAGATTCCCT TTGCAGTCCA CGCCAGGCCT 60 TCACC
ATGGA TCAGTTCCCT
C~

_ 120 ,CAGTGA CAGAAAACTT TGAGTACGAT GATTTGGCfG
AGGCCTGTTA TATTGGGGAC

CCGTCATCTT TGCCATTGGC

GCAAGAAGCC CAAGAGTGTC

TGTTTGTAGC CACTTTGCCC

ATGCCATGTG CAAATTCACT

p ACCGCCTTCT TCTTCATCGG CTTTTTTGGA AGCATATTCT420 ~ O TCATCACCGT CATCAGCATT

.,~j~sGATAGGTACC TGGCCATCGT CCTGGCCGCC AACTCCATGA480 ACAACCGGAC CGTGCAGCAT

TGGTGGCAGC ACCCCAGTTC

ACCCCGAGGT CCTTCAGGAA

GCTTCCTACTCCCCCTGCTC

TTTCCTGCAA GAACCACAAG

.~ .~~...

x .. ...~.. , I ~ ~.. ,~ 1(~ . ~~ v ~" I. 1 1 r .: ~ ~ M.,(I ~n(~ (]"n, e' h 1 '~i , i)~. .~~~~' .~IS !SIt ~.k_,~"f~-:'I,.

W ' ~'1~~' TGTTTTTCCT CTTCTGGACA

ATGACTTCTT TCCCAGTTGT

AGACGGTTGC ATTTAGCCAT

S AGTTCAGAAG ATACCTTTAC

CAGTCCACGT TGATTTCTCC

GCAGCAATTT TACTTACCAC

CCCAAAGCCT TGTGTGTACA

AAGATTTTTG TTGTTATTTC

I CCCTAGAGTG TTGTTGAGAA
O

GAATGACAAA GAGTAGACAT

TTCTCTTACT GCAAATGTCA TCAGAACTTT TTGGTTTGCA1380 _ GATGACAAAA ATTCAACTCA

TTGTGGCACA AGCAAAAAGG

GTGTCTGAGC CCTCAAAGTG AGGGGAACCA GGGCCTGAGC, CAAGCTA

1 Protein sequence 4 (SEQ ID N0:374) S

Gene name: chemokxne (C-X3-C) receptor Unigene number: Hs.78913 Protein Accession #: NP_001328 Signal sequence: 1-44 ' pfam domain: 7tm 1 [48-2931 Cellular Localization: plasma membrane ZS IFAIGLVGNL LWFALTNSK

MCKFTTAFFF IGPFGSIFFI

AAPQFMFTKQ KENECLGDYP

CKNHKKAKAI KLILLWIVF

VAFSHCCLNP LIYAFAGEKF

RRYLYHLYGK CLAVLCGRSV HVDFSSSESQ RSRHGSVLSS
NFTYHTSDGD ALLLL

DNA sequence 5 (SEQ ID N0:375) , Gene name: cannabinoid receptor 1 (brain) Unigene number: Hs.75110 ' Probeset Accession #: 412986 S

Nucleic Acid Accession #: NM_001840 Coding sequence: 92-1510 1 11 21 31 41 51 _ ,~ TCGGCTTATT TGTTTTCCCT CCTGTTAGGA TTGCCCCCTG60 ' TGGGTCAGTT TCTCAGTCAT
O

t TTTGAGCTCA GCCTAATCAA AGAC~T~AGGT TA_TGAAGTCG120 ATCCTAGATG GCCTTGCAGA

GGCTCAAATG ACATTCAGTA

TTCCCACAGA AATTCCCTTT

GCGGGAGACA ACCCCCAGCT

~ AGTCCCAGCA GACCAGGTGA ACATTACAGA ATTTTACAAC360 S AAGTCTCTCT CGTCCTTCAA

't GGAGAATGAG GAGAACATCC AGTGTGGGGA GAACTTCATG420 GACATAGAGT GTTTCATGGT

CTCACGCTGG GCACCTTCAC

TCCCGCAGCCTCCGCTGCAG

GCCTTCCTAC CACTTCATCG GCAGCCTGGC GGTGGCAGAC.CTCCTGGGGA600 GTGTCATTTT

SO GATAGCCGCA ACGTGTTTCT

GTGGGCAGCC TGTTCCTCAC

TATAAGAGGA TTGTCACCAG

GCCATTGTGA TCGCCGTGCT

TGCTCAGACA TTTTCCCACA

S AGCGTACTGC TTCTGTTCAT
S

CACGCCGTCC GCATGATTCA

GATGGGAAGG TACAGGTGAC

ACCCTGGTCC TGATCCTGGT

GTGTATGATG TCTTTGGGAA

CTGCGACACG CTTTCCGGAG

CATGTTTCCC TCTTGTGAAG GCACfGCGCA GCCTCTGGAT1360 AACAGCATGG GGGACTCGGA

CTGCCTGCAC AAACACGCAA ACAATGCAGC CAGTGTTCAC1440 .
AGGGCCGCAG AAAGCTGCAT

TCCACAGACA CGTCTGCCGA

GGCTCTG_TGA GCCTGATGGC TCCCTGGCAG CACAGGAAAA1560 ~

TTAACTTTAC CATGCTCAAT

ATGTTTCCAT AGTTTAGGTA

TGTTGTTTAA GTGACTGAAC

GCTACACAAT TGGAAGTCTA

TTTTACAAGT TATAGTACTA

ATCAGTGTTT ATGTGCTATT

ATGAGAACAA TGGACAAGCA

TGCCCATGAT ATAACTTTAG

~S AAATAAACCT TAATATTTCT TCCCAAAAAA AAAAA
' Protein sequence 5 (SEQ i0 N0:376) Gene name: cannabinoid receptor 1 (brain) Unigene number: Hs.75110 Protein Accession #: NP 001831 $O

Signal sequence: none found Pfam domain: 7tm 1 [133-397]

Transmembrane domains: 121-143, 156-178, 8, 344-366, 195-217, 237-259, 276-29 378-400 Cellular Localization: plasma membrane . . . 142 .r, ..1.r .

CA 02459219 2004-03-17 t,v.
,. .
..
I

LGYFPQKFPL TSFRGSPFQB

NFMDIECPMV LNPSQQLAIA

VADLLGSVIF VYSFIDFHVF
S
SF
KLGGVT
S

HRKDSRNVFL F 24Qt ' A y ~~
TASVG
LFLT AIDRYISIHR PLAYKRIVTR PKAWAFCLM

WTIAIVIAVL PLLGWNCEKL QSVCSDIFPH IDETYLMFWI a GVTSVLLLFI VYAYMYILWK 300' LAKTLVLILV VLIICWGPLL

SKDLRHAFRS MFPSCEGTAQ

O PLDNSMGDSD CLHKHANNAA SVHRAAESCI KSTVKIAKVT
MSVSTDTSAE AL

DNA sequence 6 (SEQ ID N0:377) Gene name: endothelia receptor type B

Unigene number: He.82002 Probeset Accession #: D13168 1 Nucleic Acid Accession #: NM_000115 S

Coding sequence: 238-1566 TGGATCCTGA GAGCACTCCC

TGTGTGGCAG GCCCCCGTGG

CTTGGAGTCT GGACATCTGA

CTGGAGCAGG TAGCAGC_ATG

TGGTTCTTGC CTGCGGCCTG

GGGCCACTCC GCTTTTGCAA

CCAAGGGTTC CAACGCCAGT

ACAGGACGGC AGGATCTCCG

AGATCAAGGA GACTTTCAAA

GGATCATCGG GAACTCCACA

O GTCCCAATAT CTTGATCGCC

.J AGCTTGGCTC TGGGAGACCT GCTGCACATC GTCATTGACA720 TCCCTATCAA TGTCTACAAG

CTGCTGGCAG AGGACTGGCC ATTTGGAGCT GAGF~TGTGTA780 AGCTGGTGCC TTTCATACAG

TGAGTATTGA CAGATATCGA

CAAAATGGAC AGCAGTAGAA

S

GCTTGCTTCA TCCCGTTCAG

GGTGGCTGTT CAGTTTCTAT

TAATGACCTG TGAAATGTTG

_ TAAAGCAGAG ACGGGAAGTG

~ GCCAAAACCG TCTTTTGCCT GGTCCTTGTC TTTGCCCTCT1260 AGCAGGATTC TGAAGCTCAC TCTTTA,TAAT CAGAATGATC1320 CCAATAGATG TGAACTTTTG

ACTGCTTTAA GTCATGCTTA

AGGAAAAGCA GTCGTGCTTA

CCAGTAATAA ATACAGCTCA

~ TCT_TGAAAGA AGAACTATTC ACTGTATTTC ATTTTCTTTA1620 't5TATTGGACCG AAGTCATTAA

GTATTTGCAC AGCACACTAT

TATGACATTT TATGAGCTGT

TCGTCGTGAA AGCACTTAAT

SO CAGGATATTC ACACAACACT

TAAAAAGAGA TTTATTTTTA

.AATCAATGGG ACTCTGATAT AAAGGAAGAA TAAGTCACTG1980 TAAAACAGAA CTTTTAAATG

AACAACTTTT CAATTAATAT

GAGCAGTTTA GTTGTTGCAT

AACAGAAAGA GCAAGGCTGT

AGCATTCTGC AATATGTAAC

TGTGCCAGCT GAATTTAAAA

TCAGTTAAGA TCAAACCTCA

TTTTTTGAAT CTGTCATTCA

ATTATTAAAA TCTTCTTTTT

TAAATACTTA CCTACATACA

TAGCTTTACG ATGGAGAGAT

AGTGTCCACA TGACAAAGGG

GTTTCTAGCA TATGTATAAT

GTACATTTAA CAGCTACCTG

6S TAAAGCTTAT TACTAATTTT TGTATTATTT TTGTAAATAG2820 , CCAATAGAAA AGTTTGCTTG

TGAGACCGTA AGAACCTCTT

AAAGTGCCTT AGGATAGCTT

AAGAGAGAGG AAATGAGGTG

CCTAACGTTC GTCATTGCCT

AACACAGTGC AATGTTCTCA

CGGTCTTAAA ATATGCCCAA

TTGGAAATAA GCTAGTAATG

AAAACCCAAC AATGTGGCCA

ATTCfATTTA TAAATCACCC

~7 ACAAACTTGT TGTTTAATTT CATCCCAATC ACTTTTTCAG3420 /S AGGCCTGTTA TCATAGAAGT

ATATTTTCAC AGTTTATTAA

CCATGTACTG AATTTTTACA

CTAATTATCT TGCCAAATTT

AAAATTGCAT TCAGTGGCTT

AAGTAAGAAA CAATTATAAT

CGTTCAACTT CAAAACATGT

TATTGTTAAC ATGGATGTTA

CCTTATTATC CACTGCTAAT

CATATGGCCA AAGGAATACA

;:

y p;_:
:K
v l~q,g ' .

~, .~!. ~,. ~,7~. '~ ,u 1~ _ 1~
k .,.... : ~~hnl~vlW r ~~.,~'~ fyl~'t~~y ~ ' 1 .~" ~ ~ ~~:vE:~a~~;.:r,~ ~';,y v''~ ~~.' ~~~ ~j~
~'~di i'('.u:x~;'~ f~ ,:'~
' f , ~
. .~
i ~
~~~~.~~' . ~, j Lt'CJ~ thi AAAGTGTAAT ATAACAATGT

GTGGCTATAG TTACTGATTT

TAACAACTAC CTTATTTTTC

S TAAAAGAAAT ATAAATGTGA

AAGTATGAAG TTATTCAATT

AAAATGCCAC ATTTCTGGTC TCTGGG

Protein sequence 6 (SEQ ID N0:378) Gene name: endothelia receptor type B

O

Unigene number: He.82002 Protein Accession #: NP 000106 Signal sequence: 1-27 Pfam domain: 7tm l [118-386]

Transmembrane domains: 100-122, 13B-160, 1 173-195, 221-243, 277-299, 325-347, 358-380 S

Cellular Localization: plasma membrane QTAEIMTPPT KTLWPKGSNA

ZO KYINTWSCL VFVLGIIGNS

KLLAEDWPFG AEMCKLVPFI

EIVLIWWSV VLAVPEAIGP

YFCLPLAITA FFYTLMTCEM

LSRILKLTLY NQNDPNRCEL

r~ LSFLLVLDYI GINMASLNSC INPIALYLVS KRFKNCFKSC420 GS LCCWCQSFEE KQSLEEKQSC
S SS

LKFKANDHGY DNFRSSNKY

DNA sequence 7 (SEQ ID N0:379) Gene name: G protein-coupled receptor 34 Unigene number: He.29202 O

Probeset Accession #: N54926 Nucleic Acid Accession #: AF0396B6 Codlng sequence: 79-1224 S CATTTAGCAC TTTCACTTTT

TGATCTCCAC AGAAGACA_AT GAGAAGTCAT ACCATAACAA120 TGACGACAAC TTCAGTCAGC

ATCATAGCGA CCAACCGCCA

_ TGGATGAAAA ATTGCTATCT

~

~1CCGT AAAAGAAATT CCATTCAAAT TTATCTAGTT

CTTTCCGAAT CATGTATCAT

AGGTTGTGGG AACACTGTTT

TCAGTTTGGA TCGCfATATA

CTATGATTAT TTTAACACTT

GAGATAAGCA TAACGCAAAA

GGCTAATTTT CTTACTAATA

TTTCTAAAAG GAGGTCAAAA.

SO CCTTTATTGT ACTTATCATT f ATCATGCC TTTCG
TTC
T
T GTTTTGTTCC C
C
TCTAC

TTACTATA 0~
T ~
ATT ' AT ~
~~A ' ~

AATGTATCAT CTTGCTACTG GAAAGAAATT GTTCACAAAAlb~
CCAATGAGAT b i CIAAi~C; 6~ '~,. r w !:

TCCTGATGTC CAGTAACATT

GTGAACCAAG TAGGAGTGAA

S CATCTGTGGC AGTGAAAATA
S

CAGTCTAGTT CTAAAAGTAC T_TGAGGTAAA CATACTAAAA1260 TGAATTATAT AATGCAGCCT

CTAGCATTTA CAAAACTCAG

ATCTCAAAGC TCTGCTTGTA TTTGTGATAT TTCATTTGCT
TAACTGTAAA CCAT

Protein sequence 7 (SEQ ID N0:380) x r . ,, ,;~.;.,.j~S
~
t,, Gene name: G protein-coupled receptor 34 ~;
~ , Unigene number: He.29202 "' Protein Accession #: AAD50531 Signal sequence: none found Pfam domain: 7tm 1 [71-327]

~S Tranamembrane domains: 90-112, 126-148, 171-193, 217-239, 263-285 Cellular Localization: plasma membrane LLLIFCLPFR IMYHINQNKW

QQRKAITTKQ SIYVCCIVWM

VALGGFLTMI ILTLKXGGHN STMCFHYRDK HNAKGEAIFN240 .
FILVVMFWLI FLLIILSYIK

PYHAFRFIYI SSQLNVSSCY

WKEIVHKTNE IMLVLSSFNS C'LDPVMYFLM SSNIRKIMCQ360 LLFRRFQGEP SRSESTSEFK

' DNA SEQUENCE B (9EQ ID N0:381) Gene name: exostoses (multiple)-like 2 Unigene number: Hs.61152 $O Nucleic Acid Accession #: NM_001439 Coding sequence: 288-1280 ' 1 11 21 31 41 51 TAATGGAGAA GGATAGATGC

144 .

- '; S f;

<"'_r:.:'z'.~ . .

It~'~ u::i -;f '. ' '' ~,. i~'~:a~ i~:a'~ ' u~~.n , ~r~~:r-.
~N
',r~,, ~
~
.
...~
~c ' tt,.~ W

GAGACGCCCC TTCCGTTTTA

TGCAATCTAC TGCACTCGAG

AAGTGAGCCT GCTTCTGTCA

S CAACACAATG AGGTGTTGCC

w ~ ACATCTGCAA ACTTCCTGGG AGAGTAATGG GGATTCGAGT360 GCTTCGATTA TGTTTGGTGG

AGTGTTAAAG

GGGCAAGTCC ACCATGGACT

CCTTTACTCT CATAATGCAG ACGTACAACA GAACAGATCT540 , CTTATTGAAA CTTTTAAATC

TATCCGTGTG ATCTTCAAAC

TCCTGAACTG GAAACCAATG

AGACC2TGTT TTTGCfTTCT

TCCTAGAAAG CACGTCTCTA

CAATAGCAAA TATCTTGAAT

TATTTCAGAG GCAACCTGCA GCTGTCCATG CTTTGATAGA1020, TGATACTCAA AACTGTGATG

GACTTCAGGG ATATTTGTGA

TGGCTATTCT GGAATGTGGC

r~ ATCGAGCTGA GCACGCTCTG CAGAGGTCTT ATTGTATAAA1200 ' TAAGCTTGTT AATATCTATG
" ~O

. ATAGCATGCC CTTAAGATAC TCCAACATTA TGATTTCCCA1260 GTTTGGTTTT CCATATGCCA

AACCTGAAAA CTGCTTGGCA

ATCATGAATT TTATCTACTC

GGATATAAAA TTCACATTAC

.~ TTTTGAAAGC CAAGAAGTTG GTCTTATCCA GTTAGGTCTT1500 S CTTATGAAGA GTTTTCATCC

...G AGGGATATAA CTCCTTGGTC AGTGATTTTA TTGTTTACAT1560 CCTGAGACTG TTCTACAGTT

CTGTTTCTAG GATCAGAAAC

TGTTTTAATT TGAAACCTGA

TGTAAGAAGA GAATAGTCTC

? AGTCACATAT GAAGAGGAAA ATTTGCAGCT GCCAGTGCTT1800 O TCCfTGTGGC CCTGCCAACC

TAACCATCCA TGCfTTTATT

GCTGAAGAAC GTCTAGTTGT

ACAATATACC CTGTATTTCT

AGATTCGGGT AGTGCATTTT

GAACTGGCAG AAGTTAAAAC

TCTTCTGGAT ACTAAAAAGT

AAAGATCCAA GGAACTATTC

AAGAACCCAG TCATAACAGA

' ATTAGCGTCT GTGTTTCACC CATTGTCTGT GTTTAGTCCT2460 TGTTCACCAC TAAGGCAAGG

CTCCTTTCCC TCTTATTCCT

AAAATTGCAA AGCTGTGAGA

. . ATATTAAAAT AATCATGGCT AATGTTCCAA TAATGAGGTC2640 TTTGTGCATT TAGTTCCGCA

TAATGTCAGT TATCTGTTTT

GTCCAATATT GGTAGTACTT TTTTGCCrCT TATGATTCCT2820 CTAGCAGATA AATAAAAGAA

ACTTTTGCCA TCC

Protein sequence 8 (SEQ ID N0:382) SO

Gene name: exoetoses (multiple)-like 2 Unigene number: He.61152 Protein Accession #: NP_001430 Signal sequence: 1-38 Transmembrane domains: none found S
S

Cellular Localization: plasma membrane PSVKEDKMLM LRREIKSQGK

,C STMDSFTLIM QTYNRTDLLL KLLNHYQAVP NLHKVIVVWN120 O NIGEKAPDEL WNSLGPHPIP

v VIFKQQTANR MRNRLQVFPE LETNAVLMVD DDTLISTPDL180 VFAFSVWQQF PDQIVGFVPR

KYLELFQRQP AAVHALIDDT

QNCDDIAMNF IIAKHIGKTS GIFVKPVNMD NLEKETNSGY300 ' ''~' "

VDSMPLR YSNIMISQFG FPYANYKRKI

6S DNA SEQUENCE 9 ISEQ ID N0:383) ' Gene name: Homo sapiens growth differentiation' factor 1 (GDF1) Un3.Q~e number: Hs.92614 Probeset Accession #: AL120193 Nucleic Acid Accession #: NM

70 , Coding se ezyce: 73-1125 ' 1 ~~.i~w 21 . 31 41 51 CAGGCGACGG GCACGGCGGG

CGAGCGGG~~6 GTATGGCGGC GGCGGGGCCC GCGGCGGGGC120 CGACGGGGCC CGAGCCCATG

7S CCCiAGCTFI'CG CGCAGCTAGT GCAGCGCGGC TGGGGCAGCG180 CGCTGGC~(ic GGCGCGGGGC

TGCACGGACT GCGGCTGGGG GC'fGGCGCGT CGCGGCCTGG240 CTGAGCACGCGCACCTGGCG

GGACCGCGCT GC~CTCCGCG

GCCTCCAGCC CAGAGATGCC

SO TGGGCAGC'PG GAGCTACAGT

ACCCACCATC TGTCTTCTAC

CCGCCTACCT GCTCCAGGGA

ACACCfGGCG CAAGGACTCG

TCGTCTCCTC CTACGCCTTC

CGGTACCACA ATGTGGGCAT CCTTGTGCTC TTCCfGCACG720 ATATCAGTGA CGTGCAGCTT

<:

. .
.. ..~ ~. ~.....~~r.

~~~~:.
- ,..

GCTCCTACCA TCGGCTGCAT

-._ GCCTTGGCAG CAGACTTGGG CTGCCTCAGC TTCGGCTTCA840 GCTGGTTCTG GTTCCGCCTC

GCAGTCTGCG CACGGTGCCT

TGCTCACCCT TATGAACCTC

TGACAGGCCA GGTGCACGAG

GCCTGAAGCC CAGCAAAGCC

TCTGAACCCC TCGGCCCCGC

TCCCCGTCCT TGGCCGCCCC

CTCCCCTGGG ACCCCGCCCC

CCTGCCCCTC CGGGGACACC

CCTGCGCACT GTCTGGTCAT

CGGCCACCAC GTCCTCCTCC

TCCTGGCCCT GCTGCfGCCC TCGCTGCCCC TGACCCGCGC1500 CCCCGTGCCC CCAGGCCCAG

CCAGG(iTGCC CCCAGGCTCC

GGACCCCCAG GAGACCAGGT

GTGCCACGTG GAGGAGCTGG

TGCGCCCACC CGGGCCTCGG

CGTCTTCGAC CTGTCGGCTG

' TGGAACCCGC TGAGCGCCCG AGCCGGGCCC GCCTGGAGGT1860 GCGTTTCGCG GCGGCGGCGG

~0 CGGCAGCCCC GGAGGGCGGC TGGGAGCTGA GCGTGGCGCA1920 AGCGGGCCAG GGCGCGGGCG

CGTGGGGCCG CCAGTGCGCG

GCCGCGCAGC CTCCGCCTGG

CCtGGCCGAG GCCTCGCTGC

ZS CCGGCCGCGG CGCGACGCCG

GCGGCGGCTG TACGTGAGCT

CGGCTTCCTG GCCAACTACT

CGGGGGGCCG CCGGCGCTCA

ACCACGCTGT GCfGCGCGCG CTCATGCACG CGGCCGCCCC2400 GGGAGCCGCC GACCTGCCCT

TGGTGCTGCG GCAGTATGAG GACATGGTGG TGGACGAGTG
CGGCTGCCGC TAACCCGGGG

Protein sequence 9 (S&Q ID N0:384) Gene name: Homo sapiens growth differentiation factor 1 (GDF1) Unigene number: Hs.92614 3 S Protein Accession #: NP 067090 Signal sequence: none found Transmembrane domalris: 106-128, 148-169, 184-206, 244-266, 285-307 Cellular Localization: plasma membrane FGTDYPFFHD PPSVFYDWTP GMAVPRDIAA AYLLQGSFYG HSIYATLY1~ TWRKDSVVML 180 4S DLGCLSFGFS WFWFRLYWFP LKVLYATSHC SLRTVPDIPF YFFFNALLLL LTLDffILYWFL 300 YIVAPAAKVL TGQVHELKDL REYDTAEAQS LKPSKAEKPL RNGLVKDKRF
DNA SEQUENCE 10 (SEQ ID N0:385) Gene name: epidermal growth factor receptorleukemia (avian erythroblastic SO Unigene number: Hs.77432 Nucleic Acid Accession #= NM_005228 Coding sequence: 187-3819 S CGCCGCCCAG ACCGGACGAC

GCCAACGCCA CAACCACCGC

CGGAGCGAGC TCTTCGGGGA

TGGCGCTGGT GGCTGCGCTC

AAGGCACGAG TAACAAGCTC

AGAGGATGTT CAATAACTGT

GGAATTATGA TCTTTCCTTC

CCCTCAACAC AGTGGAGCGA

ACTACGAAAA TTCCTATGCC

TTAGCAGTCf TATCTAACTA TGATGCAAAT AAAACCGGAC600 TGAAGGAGCT GCCCATGAGA

ACAACCCTGC CCTGTGCAAC

TTCTCAGCAA CATGTCGATG

CAAGCTGTCC CAATGGGAGC

AAATCATCTG TGCCCAGCAG

TGCTCCGGGC GCTGCCGTGG CAAGTCCCCC AGTGAC'fGGT900 GCCACAACCA GTGTGCTGCA

GCAAATTCCG AGACGAAGCC

CCACCACGTA CCAGATGGAT

TGAAGAAGTG TCCCCGTAAT

GGGCCGACAG CTATGAGATG

CTTGCCGCAA AGTGTGTAAC

ATGCTACGAA,TATTAAACAC
~

TTCAAAAACT GCACCTCCAT CAGTGGCGAT CTCCACATCC
TGCCGGTGGC

TGGATATTCT GAAAACCGTA

AAAACAGGAC GGACCTCCAT

AACATGGTCA GTTTTCTCTT

CCCTCAAGGA GATAAGTGAT

CAAATACAAT AAACTGGAAA

GCAACAGAGG TGAAAACAGC

CCGAGGGCTG CTGGGGCCCG

GCAGGGAATG CGTGGACAAG

,..~., , . ~~,~ .r~'..'~' ~.~~' ~"f' .. ~3~~n '~ A:r~'' ~"ie~~. Y"t. ..li.i~ ~~~~ T I
~

TGCAAGCTTC TGGAGGGTGA GCCAAGGGAG TTTGTGGAGA~''6 CAGGACGGGG ACCAGACAAC

TCAAGACCTG CCCGGCAGGA

ACGCCGGCCA TGTGTGCCAC

GTCTTGAAGG CTGTCCAACG

GGGCCCTCCT GTTGCTGCTG

ACATCGTTCG GAAGCGCACG

TTACACCCAG TGGAGAAGCT

TCAAAAAGAT CAAAGTGCTG

CTCCGAAAGC CAACAAGGAA

CCCACGTGTG CCGCCTGCFG

TCATGCCCTT CGGCTGCCTC

AGTACCTGCT CAACTGGTGT

S GCTTGGTGCA CCGCGACCTG

AGATCACAGA TTTTGGGCTG

AAGGAGGCAA AGTGCCTATC

CCCACCAGAG TGATGTCTGG

CCAAGCCATA TGACGGAATC

GCCTCCCTCA GCCACCCATA , , TGATAGACGC AGATAGTCGC ' CCCGAGACCC CCAGCGCTAC

CTACAGACTC CAACTTCTAC

ATGCCGACGA GTACCTCATC

CTCCCCTCCT GAGCTCTCTG

GAAATGGGCT GCAAAGCTGT

ACCCCACAGG CGCCTTGACT

ACATAAACCA GTCCGTTCCC

ATCAGCCTCT GAACCCCGCG

CAGTGGGCAA CCCCGAGTAT

ACAGCCCTGC CCACTGGGCC

ACCAGCAGGA CTTCTTTCCC

CTGAAAATGC AGAATACCTA

CACGGAGGAT AGTATGAGCC

J AGCAGGTCCT CCATCCCAAC
S

TGCAACGTTT ACACCGACTA

~t GCCAGGAAGT ACTTCCACCT CGGGCACATT TTGGGAAGTT4020 GCATTCCTTT GTCTTCAAAC

CCCTTTGAGC AGAAATTTAT

TTCAATGGGC TCTTCCAACA

TCCAGGCCCA ACTGTGAGCA

_ CAGTGGTTCT GCTTCAAGGC

GCCCCAGCAG GCCGGATCGG

TCTGTCCCTT CCTGGGCAAA

TGTAAAAATG TCCCCACGGT ' GCGTTAGACT GACTTG2tTG

GTCTTGCTGT CATGAAATCA

GCCCACATTG GATTCATCAG

TAAGGATAAC ACCGCTTTTG

AATGCATCAG GTCCTTTGGG

GCATAGATCA GAAGACTACA AAAATGAAGC TGCTCfGAAA4860 TCTCCCTTAG CCATCACCCC

TTTCTCCTTT TACTTCACTT

CAGCTGCCCC CAAACCCCCT' CATCTATTCA AGCAGTTACA

S GTAGCATTAT GAGTAGTGTG

AATGCTTTCA CAACATTTGC

TCTCTACAAT TGGAAGATTG

TGTGTGCCCT GTAACCTGAC

~ TGGTTAACAG CAGTCCTTTG TAAACAGTGT TTTAAACTCT5340 O CCTAGTCAAT ATCCACCCCA

l) TCCAATTTAT CAAGGAAGAA ATGGTTCAGA AAATATTTTC5400 AGCCTACAGT TATGTTCAGT

TTTTTGACTC CCAGATCAGT

GTCTCAATGA AAATAAAACT

ATATTCATTT CC

VS Protein sequence 10 (SEQ ID N0:386]

Gene name: epidermal growth factor receptorleukemia (avian erythroblaatic Unigene number: Hs.77432 Protein Accession #: NP_005219 Signal sequence: 1-27 .
70 Pfam domain: Recep L domain (57-190, 372-492]

Tranamembrane domains: 646-668 1 11 . 21 31 41 51 LGTFEDHFLS LQRMFNtICEV

LENLQIIRGN MYYENSYALA

SIQWRDIVSS DFLSNMSNll7F

GRCRGKSPSD CCHNQCAAGC

PEGKYSFGAT CVKKCPRNYV

VTDHGSCVRA CGADSYEMEE DGVRKCKKCB GPCRKVC~1GI360 GIGEFKDSLS INATNIKHFK

ITGFLLIQAW PENRTDLHAF

VIISGNKNLC YANTINWKKL

RDCVSCRNVS RGRECVDKCK

QCAHYIDGPH CVKTCPAGVM

PKIPSIATGM VGALLLLLW

.. ~..I~,~ ', ' ~..,i~ ~,"I. Is "(i ; ...-,..~ :H::~ :).::~ y,~'"w..'a d-'~
~(. ~ r, n, y ....p ~ '(' ~'~
~~a... .~'' H' ALGIGLFMRR RHIVRKRTLR RLLQERELVE PLTPSGEApN QALLRILKET EFKKIKVLGS 720 GAFGTVYKGL WIPEGEKVKI PVAIKELREA TSPKANKEIL DEAYVMASVD NPHVCRLLGi x.780 CLTSTVQLIT QLMPFGCLLD YVRfiHKDNIG SQYLLNWCVQ IAICGMNSCLED RRLVHRDLAA 840 FRELIIEFSK MARDPQRYLV IQGDERMHLP SPTDSNFYRA LNmEEDMDDV VDADEYLIPQ 1020 SIDDTFLPVp EYINQSVPKR PAGSVQNPVY HNQPLNPApS RDPHYQDPHS TAVGNPEYLN 1140 DNA sequence 11 (SEQ ID N0:387) Gene name: claudin 5 (transmembrane protein deleted in velocardiofacial syndrome) 1 LTnigene number: Hs-110903 S

1 Probeset Accession #: AW245805 Nucleic Acid Accession #: NM

_ Coding sequence: 121-777 w ~

G a.
AGGGGACTGG GGCCAAGAGC CGGGAGCGC ,~:
~
~
.
x ~
~
w TGCGCGTCTC GCCTCTAGCC

GCCTGGTGGG CTGGGGGGGT

.~ CTGATCCTGG CGTGCGGGCT GCCCATGTGG CAGGTGACCG240 GS CCTTCCTGGA CCACAACATC

GCGTGGPGCA GAGCACCGGG

GCACCGAGGT GCAGGCGGCG

CGCTCTTCGT GACCCTGGCG

AGGCGCGTGT GGCCCTCACG

TGTCGCAGAA GTACGAGCTG

TCATGGTAGG CGGCTGCGTC

TCAGCTTCCC CGTGAAGTAC

AGAAGAACTA CGTCTGAGGG

S

CGCGCAGGCT CCTCGGAACG

GCCTGCGCCC GCAGCTGACC

TTCTCCTGCC ACTAGCCCGG CCC'TGCCCTT AACAGACGGA1020 ATGAAGTTTC CTTTTCTGTG

_ GGATTTCGCT TCCCCTCCAA

GACGCTGGGC; GTCTTGGCTG CTGCCTTACT TCCCAGAGGC1140 TCCTGCTGAC TTCGGAGGGG

GCTGGTCTTT ACTCCATCGG

CCGGTCTCAC TCCAGCATCT

CGGGAGTGGG AAGGCTAAGA

ATCTGCTTAG

4S Protein sequence 1l (SEQ ID N0:388) Gene name: claudin 5 (transmembrane proteinfacial syndrome) deleted in velocardio Unigene number: Hs.110903 Protein Accession #: NP_003268 Signal sequence: none found S
O

Pfam domain: PMP22 Claudin [4-181) Transmembzane domains: 5-27, 74-96, 123-145, ' Cellular Localization: plasma membrane S VTAQTTWKGL WMSCWQSTG

GAQCTTCVAP GPAKARVALT

GAALYIGWAA TALLMVGGCL

LCCGAWCTG RPDLSFPVKY SAPRRPTATG DYDKKNYV

v0 DNA sequence 12 (SEQ ID N0:389) Gene name: vascular endothelial junction-associated molecule Unigene number: Hs.54650 Probeset Accession #: AA410345 < Nucleic Acid Accession #: AF255910 S

V Coding sequence: 241-1137 .

1 11 21 31 ' 41' "' ~ 51 ..

ACCCGCCTCT TGGCAGCCAG

TTCAAGGGCC CCCGGCCTCC

CCGGCTGCCG CCCCGGGAAG

ATGGCGAGGA GGAGCCGCCA CCGCCTCCTC CTGC:GGTGC300 TGCGCTACCT- GGTGGTCGCC

ACCAACAGGT AGTCACAGCA

TAGA
G
A

GT
G
AGAAACTGGG TCGGAGTGTC TCCTTTGTCT ACTATCAACA
GACTCTTCAA

TCCGGATCAA AAATGTGACA

CATCTGAGCA AGGCCAAAAC

CAGCAGTTCC ATCATGTGAA

p GTACCCTCTT CTGCTCTGAG TGGAACTGTG GTAGAGCTAC720 O GATGTCAAGA CAAAGAAGGG

GTTTGCTAGA AAATCCCAGA

CAAAAACTGG AACTCTGCAA

GTGAAGCCCG CAATTCTGTT

ATCTCAACAT AAGTGGCATC

ATAGCAGCCG TAGTAGTTGT GGCC'fTAGTG ATTTCCGTTT1020 GTGGCCTTGG TGTATGCTAT

;-..i-~.
-- " CA 02459219 2004-03-17 y.4~j~.. ~~ ~(~~ _ '~ ~, 3 fytt ~~', ~T y'k ~,. ~ ~' ~,' f'~f~~. t a.. , i~ '~ 7ev~~.~t.

AAAGCCACGA CAATGAGTGA AAATGATTTC AAGCACACAA AATCCTTTAT AATT_TAAAGA 1140 GTAATGTCAA AAAAAAA
Protein 6equence 12 (SEQ ID N0:390) 1 O Gene name: vascular endothelial junction-associated molecule Unxgene number: Hs.54650 Protein Accession #: AAF81223 Signal sequence: 1-22 Igc2 domain: 41-116, 146-221 1 S Transmembrane domains: 239-261 Cellular Localization: plasma membrane VEYQEAILAC KTPKKTVSSR

RSDAGKYRCE VSAPSEQGQN

NPAPEYTWFK DGIRLLENPR

GYRRCPGKRM QVDDLNISGI

IAAVWVALV ISVCGLGVCY AQRKGYFSKE TSFQKSNSSS
KATTMSENDF KHTKSFII

2S DNA sequence 13 (SEQ ID N0:391) Gene name: solute carrier family 11 (proton-coupled divalent metal ion Unxgene number: Hs.182611 Probeset Accession #: D50402 Nucleic Acxd Accession #: NM 000578 30 Coding sequence: 1-1653 '; ATGACAGGTG ACAAGGGTCC CCAAAGGCTA AGCGGGTCCA60 GCTATGGTTC CATCTCCAGC

? CCGACCAGCC CGACCAGCCC AGGGCCACAG CAAGCACGTC120 GAGAAGATCC CCATCCCAGA CACAAAACCG GGCACCTTCA
GGCTGCGGAA GCTATGGGCC

ACCCAGGAAA CATCGAGTCA

GGGTGCTGCT CTGGGCCACC

GCGTGGTGAC AGGCAAGGAC

GCACCGTCCT CTGGCTGACC

TCGGCACGGC CATTGCATTC

TCCTCATCAC CATCGTGGAC

AGCTGGAAGC TTTTTTTGGA

CrCCTTATAA CCATTATGGC CTTGACCTTT GGCTATGAGT660 ATGTGGTGGC GCGTCCTGAG

CGGGCTGCGG CCACCCCGAG

CCCACAACAT CTACCTGCAC

GAGTCGACAT CAGAGAAGCC

TCTCCTTTAT CATCAACCTC

CCAAGCAGGC TGCGTTCAAC

TCCCCATGAA CAACGCCACC

GCCTGTTCGG CCCCGCGGCC

GCTCCACCAT GACGGGCACC

TACGCGGGAC AGTTCGTGAT GGAGGGCTTC CrGAGGCTGC1200 GGTGGTCAAG CTTCGCCCGT

TCGTGGCTGT CTTCCGGGAC

TGCAGAGCCT GCTGCTCCCG

CCCTCATGCA GGAGTTTGCC

TGCTAGTCTG CACCATCAAC

CTGCCTACTT CGGCCTTGCA

TGGTCTGGAC CTGTTGCCTT

ACTTCCTGTA TGGGCTCCTT
GACC A
AAAGGGGA GACCTCrGGC TAG
A

GAAG
G
C

Protein sequence 13 (SEQ ID N0:392) Gene name: solute carrier family 11 (Proton-coupledion transporters), member divalent metal 1 Unigene number: Ha.182611 t Protein Accession #: NP_000569 VS

Signal sequence: none found ' Pfam domain: Nramp [78-4631 Transmembrane domains: 58-80, 88-110, 159-181, 195-217, 284-306, 349-379, 394-416, 432-454, 468-490, 501-523 Cellular Localization: plasma membrane ~7 1 1l 21 31 41 51 /O

EKIPIPDTKP GTFRLRKLWA

VLGLLCQRLA ARLGVVTGKD

NLLSAGRIPL WGGVLITIVD

~7 TFFFLFLDNY GLRKLEAFFG LLITIMALTF GYfiYWARPE240 /S QGALLRGLFL PSCPGCGHPE

NMYFLIEATI ALSVSFIINL

VAVDIYQGGV ILGCLFGPAA

VLLTRSCAIL PTVLVAVFRD

NGLLNKWTS SIMVLVCTIN

AHGATFLAHS SHHHFLYGLL

EEDHKGETSG

DNA sequence 14 (SEQ ID N0:393) , Gene name: solute carrier family 7 (cationic amino acid transporter, y+

'1t~ x. ~n?~~'f.1 k. n'1, 7T %~.

~i~ y=." .,,'i., ' "~~' ~~.~y(t ~~. ~~ .f~~yt ~;k .. _~
~ II '~ ;~,~ -E ~';~L'~
r ~

, . '~
;; , ~
~ .~
,,~,.
F ., .;

Unigene number: Hs.1846D1 Probeset Accession #: AP104032 Nucleic Acid Accession #: NM_003486 Coding sequence: 53-1576 S

1 1l 21 31 41 51 GGTGCGCAGA GC_ATGGCGGG

GAGGAGAAGG AAGAGGCGCG

GCCATCATCG TGGGGACCAT

AAGGAGGCAG GCTCGCCGGG

ATCGTGGGCG CGCTCTGCTA

TACGCCTACA TGCTGGAGGT

I S CTGCTCATCA TCCGGCCTTC

CTCAAGCCGC TCTTCCCCAC

CTGTGCGTGC TGCTGCTCAC

CAGGATGCCT TTGCCGCCGC

GTCCAGATCG GAAAGGGTGA

~ TGTGTCCAAT CTAGATCCCA AGTTCTCATT TGAAGGCACC780 O AAAGTGGATG TGGGGAACAT

TGGAATTACT TGAATTTCGT

GCCATCATCA TCTCCCTGCC

TTCACCACCC TGTCCACCGA

AACTATCACC TGGGCGTCAT

~ GTCCTGGATC ATCCCCGTCT TCGTGGGCCT GTCCTGCTTT.GGCTCCGTCA1080 S ATGGGTCCCT

GGCCACCTGC CCTCCATCCf CfCCATGATC CACCCACAGC TCCTCACCCC CGTGCCGTCC1200 CTCGTGTTCA CGTGTGTGAT

ATCAACTTCT TCAGCTTGTT

CAACTGGCTC TGCGTGGCCC TGGCCATCAT CGGCATGATC1320 r TGGCTGCGCC ACAGAAAGCC

.~ TGAGCTTGAG CGGCCCATCA AGGTGAACCT GGCCCTGCCT1380 . GTGTTCTTCA TCCTGGCCTG
O

GAGTGTGGCA TCGGCTTCAC

CATCATCCTC AGCGGGCTGC CCGTCTACTT CTTC1:GGGTC1500 TGGTGGAAAA ACAAGCCCAA

CAGAAGCTCA TGCAGGTGGT

, CCCCCAGGAG ACATAGCCAG GAGGCCGAGT GGCTGCCGGA
GGAGCATGC

~3 S Protein sequence 14 (SEQ ID N0:394) Gene name: solute carrier family 7 (cationic ammo acid transporter, y+

Unigene number: Hs.184601 Protein Accession #: NP_003477 - -A Pfam domain: as permeases [46-481) s O

1' Tranemembrane domains: 52-74, 82-104, 120-142,200-222, 275-297, 145-167, 169-191, 237-259, 323-345, 371-393, 398-419, 430-452, 455-476 Cellular Localization: plasma membrane GEGVTLQRNI TLLNGVAIIV

LCYAELGTTI SKSGGDYAYM

FPTCPVpEEA AKLVACLCVL

KGDVSNLDPK FSFEGTKLDV

S O SLPIVTLVYV LTNLAYFTTL

GSLFTSSRLF FVGSREGHLP

SFFNWLCVAL AIIGMIWLRH

GFTIILSGLP VYFFGVWWKN

KPKWLLQGIF STTVLCQKLM QWPQET

S S DNA sequence 15 (SEQ ID N0:395) Gene name: Glutamate receptor subunit Unigene number: Hs.249141 Nucleic Acid Accession #: 540369 Coding sequence: 1-2943 _ATGCCGGCTG AGCTGCTGCT GCTGCTGATT GTTGCCTTCG60 CCAGCCCCAG CTGCCAGGTG

CAGTGTGTGG CCGCGGTGAG

g CGTCTGGCCT TGGCCTTGGC CCGGGAGCAG ATCAACGGGA180 TCATCGAGGT CCCAGCCAAG

'~~ GCCCGAGTGG AAGTAGACAT CTTTGAGCTG CAGCGGGACA240 , GCCAGTACGA GACCACGGAC

TTGGGCCCTC CTCTAGCCCA

AGATCCCCCA CATCAAGGTG

CGTCTGTCAG CCTGTACCCC

AGTCCTTCAA CTACCCCTCG

TGGAGGAACT GGTGCGTGGC

ACGACAGCCG GGACCCCACA

' CCACTGCTCA AGGAGATCCG TGATGACAAG GTGTCCACCA660 TCATCATCGA CGCCAACGCC

GAATGACCTC AGCGTTTTAC

ACCCCTTCTA CCCfGAGTTT

CCAGCACCTA CCTGGGCCCT

TGGTGAGCGC TGTCCGAGAG

GTACATCGGC CAACATTTGG

, AGTATGATGG.:GCTGACCGGG

$O CGGGTCGAGT TCAACAGCAA AGGGCAGAGA ACCAACTACA1140 CCCTGCC;CAT CCTAGAAAAG

ACCGCACCCT GGCCATGAAT

ACAAGACCCT GGTGGTCACA

TCCAGGGCCT GTCGGGGAAC

TGGCCGAGCT GCTGCCGTTC

, . .,,. ~' S F,... ~. ~. . . .., ; . . _ - , . . .. :. ' . . _. _.,.,. , .s_,~
,.:,.
'_ t _:
,',_..

~ ~no ..~.. J' . 1" ~....' ~~.~ .t.~ ..~
~ y ~x~. ~.~~
~~ r ;t 1l- ~ ~
w.
~
~
w.Jt ' ~
Rr '~r~
.
~

_ . ' U~ ~ _ _ CCGTACCGCC TGCGGTTGGT GGAGGATGGG CTGTACGGGG1440 CGCCCGAGCC CAACGGCTCC

ACCTGGCTGT GGCCGCCTTC

AGCCCTTTAT GACCCTGGGG

S GCTACTTCTC CTTCCTGGAC

ACCTGGCTGT CAGCTGCGTC

CTGTTTCTGG CTGCCAGGCT GAGCCCCTAT GAGTGGTATA'ACCCACACCC1740 ATGCCTGCGG

ACAGCCTGTG GTTTCCCGTG

CGCTGTCCAC GCGCTGTGTC

I O CCTACACGGC CAACCTGGCC

CGGCCGATGA CCTGGCAGAT

CCATGACCTT CTTCCAGAAT

AGTCGAAGCA GCCCAGCGTG

ACTCCCGCTA CGCCTTCCTG

I S GCAACCfCAC CCAGATCGGG

TGGGCTCCCC GTTCCGGGAT

_ GAGATCACAC TGGCCATCCT GCAGGTTCAG GAGAACAACC2340 GGCTGGAGAT CCTGAAGCGC

ATCGAGCTAA AGGTTTGGGC

ATGGAGAACA TTGGTGGCAT T'TTTATCGTG CTCATCTGTG2460 GCCTCATCAT TGCTGTCTTC

_... GTGGCGGTCA TGGAATTCAT ATGGTCCACA CGGAGGTCAG2520 CTGAGTCCGA GGAGGTGTCG

CTTGCCGCAA GACGTCGCGT

- ' TCCCGCCGGC GCCGACGCCC GGGCGGCCCG AGCCGGGCCC2640 TGCTGTCACT GCGCGCGGTC

GCGCGGGCGG GGATGCGGGC

GGCCCCCCAG CGGAGCCCGA

AGGAGTGCCG GCGCATCCAG

~7 GCGCTGCGGG CCTCGGGGGC CGGCGCGCCT CCGCGTGGCC2880 GS TGGGCGTCCC CGCCGAAGCC

GGGAGCTGGC GGAGCACGAG

T GA

Protein sequence 15 (SEQ ID N0:396) 30 Gene name. Glutamate receptor subunit Unigene number: Hs.249141 Protein Accession #: AAB22591 !. Signal sequence: 1-27 t Pam domain: ANP receptor [343-400];PHPe domain (416-785, 799-838]

~3S Transmembrane domains: 297-3i9, 544-566, 624-646, 803-825 Cellular Localization: plasma membrane 1 11 21 31 , 41 S1 RLALALAREQ INGIIEVPAK

,~ ARVEVDIFEL QRDSQYETTD TMCQILPKGV VSVLGPSSSP120 'tO ASASTVSHIC GEKEIPHIKV

ASLICAKAEC LLRL$fiLVRG

SISHLILRKA SELGMTSAFY

VRSLNMSWRE NCEASTYLGP

ALSAALMFDA VHVWSAVRE LNRSQEIGVK PLALZ'SANIW360 PHGTSLMNYL RMVEYDGLTG

~ RVEFNSKGQR TNYTLRILSK SRQGHREIGV WYSNRTLAMN420 't5 ATTLDINLSQ TLANKTLVVT

i 980 TILENPYVMR RPNFQGLSGN ERFEGFCVDM LRELAELLPF
PYRLRLVEDG LYGAPEPNGS

ISILYRVHMG RKPGYFSFLD

ARPHILENQY TLGNSLWFPV

GGFMQQGSEI MPRALSTRCV SGVWWAFTLI IISSYTANLA' AFLTVQRMEV PV$SADDLAD 660 FVKSTEEGIA AVLNSRYAFL

EITLAILQLQ ENNRLEILKR

KWWfiGGRCPK EEDHRAKGLG MENIGGIFIV LICGLIIAVP840 VAVMEFZWST RRSAESSEVS

REMRLSNGKL YSAGAGGDAG

ALRA$GAGAP PRGLGVPAEA

S S TSPPRPRFGP AGPRELAEHE

DNA sequence 16 (SEQ ID N0:397) Gene name: adenosine A3 receptor '' Unigene number: Hs.258 ~ Probeset Accession #: NM_000677 Nucleic Acid Accession #: NM_000677 Coding sequence: 768-1724 AGCGTCAACT CGTGCAAGAA

CrTAGCAGGA ATAGTTCTGG CTAAGGTTAG GAGGCTGCCA120 CCAAAGTCTC TTTTTTGTTC

TGCTAAGCTG GCAGAAAGAT

GCACTGTCCT CTGGTCCCTG

TCTATGCCAC TCATGGCTCC

CTGTACTTCC TCTTGGCCCA

TGATGGAACT CAAAAAGCCA

AACTAAGAGC AGCAGCACTT

AAACTTGAGG ATGTGCGGTG

CATAAAGGGG CTGGAAGTGA CCCACCfGTG ATGAGCCCTT600 TCTAAGGAGA AGGGTTTCCA

GGGAATTTTA GACTGTCACT

CCACTGGCCC TACAGACGGA

AGGCAAG_ATG CCCAACAACA

GGAAATTTTC ATTGGACTCT

GCTGAACCCC AGCCTGCAGA

CATTGCTGTT GGGGTGCTGG

CCACTTCTAC AGCTGCCTTT

CATGTCCTTG'CTGGCCATCG

CAAGAGGGTC ACCACTCACA

ATTCCTGGTG GGATTGACCC

r_ 151 ° ~ ~'°~ , :r ,~~
~y.,.l~I~~~f/~i.~!~r~i~lr 4, ,.. .

CA 02459219 2004-03-17 '' f( .~ S~. j; .,.~ . ~ ;'' i~ l~ ~,:.'1: ' ~...t~' Ic~~:' ;f:~,~'f:j :I~
t '~"t '9-~.
.1f, .
~..~.1~
t s r ....y y , .
H

_. .. ., _ _:~. ~
z ~y ~~ a'~, i.. ;"",..:

.
Vi CAGAAATGTC ACCTTCCTTT

ATACTTCAGC TTCCTCACCT

TGACATCTTT TACATCATTC

S AGGTGCATTT TATGGACGGG

AGTTCAAGAC GGCTAAGTCC TTGTTTCTGG TTCTTTTCTT1500s~
GTTTGCTCfG TCATGGCTGC

GGTACCACAG CTTGTGCTGT

CCCTATCGTC TATGCCTATA

AAATAAAGAA GTTCAAGGAA ACCTACC'TTT TGATCCTCAA1680 AGCCTGTGTG GTCTGCCATC

1 G_TAGTTATCC ATCAGAGATG

CTTGAGGGCC TGTATGCCTG

TGGGAGCATC TCCAGTGCTC

CTTCATTTTT CCTTTGTCCT

AACGTATTAT TGATATTATT

I GCCTGAAGGG TGCCTAGTTG
S

ACTTACTGAC AAAAGGCTCT AGTTGGGCTG AArATGTGTG2100 TGGTGGTGAC TCATTTCCAT

GCCTAGAAGA TGTTGGGAAC

AGAAGAAATA AACTGAGTTT AAGGGGGACT TAAAC'TGCTG2220 AATTCACCTG TGGATGTTTT

TGAGTAAATA AAAGCTAATA G

20 Protein sequence 16 (SEQ ID N0:398) Gene name: adenosine A3 receptor Unigene number: Hs.258 Protein Accession #: NP_000668 Signal sequence: none found 2S Pfam domain: 7tm 1 [29-282]
Transmembrane domains: 12-34, 50-72, 86-108, 120-150, 179-201, 229-251 Cellular Localization: plasma membrane VGVLVMPLAI WSLGITIHF YSCLFMTCLL LIFTtIASIMS LLAIAVDRYL RVKLTVRYKR 120 LSWLPLSIIN CIIYFNGEVP QLVLYMGILL SHANStR~INPI VYAYKIKKFK ETYLLILKAC 30D

DNA sequence 17 tSEQ ID N0:399) Gene name: glypican 1 - -Unigene number: Hs.2699 n Probeset Accession #: X542'32 Nucleic Acid Accession #: NM 002081 Coding sequence: 222-1898 1 1l 21 31 41 51 CCCGCGCCGC CGCCGCCGCC

GGACCGCGAG CC'GCGCGCGC

CGGGACCTTG GCTCTGCCCT TCGCGGGCGG GAACTGCGCA180 ;"a ~ /t!*v~%
GGACCCGGCC AGGATCCGAG

AGAGGCGCGG GCGGGTGGCC GGGGGCGCCG CCGGCCCCGC240 ~;l~y }~,t"
CATGGAGCTC CGGGCCCGAG

GCTGGTGGCT GCTATGTGCG GCCGCAGCGC TGGTCGCCTG300 , CGCCCGCGGG GACCCGGCCA

AGCCAAGGGC TTCAGCCTGA

GATCTGTCCC CAGGGCTACA

CAGCCATGCC GAGCTGGAGA

TGCCACCCAG CTGCGCAGCT

TCGATGACCA CTTCCAGCAC CTGG'TGAACG ACTCGGAGCG600, GACGCTGCAG GCCACCTTCC

S CTTCCGGGAC CTGTACTCAG

GGAGACGCTG GCCGAGTTCT

CCAGCTGCTG CTGCCTGATG

GCCCTTCGGG GAGGCCCCGA

TCGCTCCTTT GTGCAGGGCC

CCCCCTGGGC CCGGAGTGCT

GGGAGTCCCC GGCGCCAGGC

TGCCAACCAG GCCGACCTGG

CACCGACAAG TTCTGGGGTA

GCTGGCGGAG GCCATCAACG

6 CCCTCCAGGA CAACAGGGAC ACGCTCACGG CCAAGGTCAT1260 .
S CCAGGGCTGC GGGAACCCCA

CCGGGGCAAG CTGGCCCCGC

TGAAGCCAAG GCCCAGCTCC

GTGCAGTGAG AAGATGGCCC

CAGAGGCCGG TACCTCCCCG

CGAGGTGGAG GTGGACATCA

GAAGATCATG ACCAACCGGC

CGCCAGTGAC GACGGCAGCG

CCGGAAGGTC AGCAGGAAGA

CCTGTCAGAG CAGGAAGGAC

CCTCCTGCCC CTCCTCCTCT

TCCTGGCCCT TACAGTAGCC AGGCCCCGGT GGCGG_TAACT1920 GCCCCAAGGC CCCAGGGACA

ATATTTAATT CACCTCAGCC

GAGCAGGGGC AGGCGCAGAG

TTAATTTTGT ATGAGGTCCT

O TCAGGGACCT CAGGGGCACC

CAGAAGCAGC CCCTCGAGGC

CGAGCCTGTG CCTTCCTCCC

CGCCTCCTCC CACTGGGACT CCCAGCAGAG CCCACCAGCC..2340 AGCCCTGGCC CACCCCCCAG;

ATCCAGGGTC TGGCA~AGCC

.__. 1S2 ~ .

.~,. ;,'j", ., ij . ,, .,. ~, ~, ~;;~' " ~~::;: 'i;:' :.'L~u ~~;
~'-ig 7 y , ~,,~n ~ ~~, ~ :i ~~~~~~~
t~

~-~E'%' ~
~
"
"~
"

>.-~., -,..
.
~ ~>::.

CAGAGCCCGG CCCCACCTCC

CTGCGCCCfT GAGGGGCCCC AGCGTCTGCA GGGTGACGCC2520 TGAGACAGCA CCACTGCTGA

GGCCCfCCAT GCGCAGATGA

AGCTGGGCCC AAAGGCCCAG

ACACAGGGCT CACAGGGCAG

TGAGGAGCAG CCAGGACCCG

CCTGCTCCCA TCCTCACCCA GATCAGGAAC CAGGGCC'TCC2820 CTGTTCACGG TGACACAGGT

GATGCTGGTG GCTGGTGAGA

CCAGCCAGCT GCACTGCAGG

1 GCACGGGGAC CrGGATAGTT AAGGGCTTTT CCAAACATGC3000 O ATCCATTTAC TGACACTTCC

CTTCGGAGGC CCGCAGGGCC

ATCAGGGCCC TGCCCCAGGC

GTGGCCCTGG GGAGGGGTGG

GGAGGGTCTG GGGGCAGCTG

S TTTGCTTTTC ATCACCGTCC

CATGGCTTGT TCTCTGGAAC

GCAAGTCCAC CCCATAATAA

GATGCCGGGC GCCAGGACAG

CAGACCCCAC CCTACGCTCA

AGTGGCCAAG CCTGCTGTGT

GTGACGTGTG TTCTTTTGAG

TCCTTGTATG AATAAAAGGC TGGAAACCTA AA

Protein sequence 17 (SEQ ID NO:400) 2S Gene name: glypican 1 Unigene number: Ha.2699 Protein Acceeaion #: NP_002072 Signal sequence: none found Pfam domain: Glypican protein (2-490]

30 Transmembrane domains: none found Cellular Localization: plasma membrane MELRARGWWL LCAAAALVAC ARGDPASKSR SCGEVRQIYG~AKGFSLSDVP60 QAEISGEHLR

y3 ICPQGYTCCT SEMEENLANR SHAELETALR DSSRVLQAML120 S ATQLRSEDDH FQHLLNDSER

ETLAEFWARL LERLFKQLHP

RSFVQGLGVA SDVVRKVAQV

ANQADLDAEW RNLLDSMVLI

QGCGNPKVNP QGPGPEEKRR

CSEIfMALSTA SDDRCWNGMA

KIMTNRLRSA YNGNDVDPQD

ASDDGSGSGS

DNA sequence 1B (SEQ ID N0:401) 4S Gene name: NY-RSN-24 antigen Unigene number: Ha.128425 Nucleic Acid Accession #: AP155102 Coding sequence: 27-908 -l SO I
, I
I
I ~

GATCCAGCAG AGCCTGGACG

GCACGAGCTG CCACTGGACG

GCTCTCGCGC CAGCAGCTCC

CTTCCGGCGG GCCAAGGAGG

ACTCACCGGC AAGGCCTACC

CAACCGCGTG CACACGGGCT

CAACCCACCG CCCAAGATCG

CGACAAGCGC TCCACGCCCG

CATCCTGCGC TTCACGCGGG

AGTGGGAATA CTCGCACCGC

TGTGCTTTCA CTTCAAGCGC

AGGAGGGCCG AGGGCCACAC

TTGTTCTTCA GCATCCGACG

GACCCCCAGA GGGCCACCCA

CCAGACACCC CGCCTCATCT

ATCTTTTGTT
GGAAAT

_ 1020 CTCATGGAAT TGGCCTATTG GCAAGATCGC ATGTTTTTTT
AATAAACGTT GTATTTTAGA

ATAAAA

O Protein sequence 18 (SEQ ID N0:402) Gene name: NY-REN-24 antigen Unigene number: Hs.128425 Protein Accession #: AAD4286B

Signal sequence: none found 7S Transmembrane domains: none found Cellular Localization: plasma membrane HVLEPDEDLQ RLQLSRQQLQ

gO TGDASESAE DIFFRRAItEG MGQDEAQFSV EMPLTGKAYL120 WADKYRPRKP RFFNRVHTGF

PLSAVTALGN GRPGGPRATR

LTSHQPQTTH SPSQTPRLIW

;f ;:w .(....: ...~.. . ' ;~..t~ ~.'.'~4 n YY i ~;~ ; ;:ws~ :1: ~~k :! r ; _t;
", 'F~rv -9 F ' r 1. ~ t $
l i w ~d~
DNA sequence Z9 iSEQ ID N0:403) Gene name: tumor necrosis factor receptor auperfamily, member 1A

Unigene number: Hs.159 Probeset Accession #: BE295782 S

Nucleic Acid Accession #: NM_001065 Coding sequence: 256-1623 .

1 1l 21 31 41 51 CTCAGTCCAG AGAATTCTGA

O AGGCCGTGAT CTCTATGCCC

GTCCTGGACA GACCGAGTCC

CCAAATGGGG GAGTGAGAGG

CCATAGCTGT CTGGC_ATGGG CCTCTCCACC GTGCCTGACC300 TGCTGCTGCC GCTGGTGCTC

GACTGGTCCC TCACCTAGGG

S ATATCCACCC TCAAAATAAT

ACAATGACTG TCCAGGCCCG

TCACCGCfTC AGAAAACCAC

TGGGTCAGGT GGAGATCTCT

AGAACCAGTA CCGGCATTAT

ZO TGGAGTGAAA ACCTTTTCCA GTGCTTCAAT TGCAGCCfCT720 GCCTCAATGG GACCGTGCAC

ATGCAGGTTT CTTTCTAAGA

TGGAGTGCAC GAAGTTGTGC

GCACCACAGT GCTGTTGCCC

TCATTGGTTT AATGTATCGC

.~ TACCAACGGT GGAAGTCCAA GCTCTACTCC ATTGTTTGTG1020 LS GGAAATCGAC ACCTGAAAAA

CAAACCCAAG CTTCAGTCCC

CCAGTTCCAC CTTCACCTCC

CTCCCCGCAG AGAGGTGGCA

TCGCCTCCGA CCCCATCCCC

3O AACCCCC~TC AGAAGTGGGA GGACAGCGCC CACAAGCCAC1320 AGAGCCTAGA CACTGATGAC

TGCGCTGGAA GGAATTCGTG

AGCTGCAGAA CGGGCGCTGC

GGCGCACGCC GCGGCGCGAG

ACCTGCTGGG CTGCCTGGAG

S CCGCGCCCAG TCTTCTCAGA

CGAGATCGCC TTCCAACCCC

_ 1740 ACTTTTTTCT GGAAAGGAGG GGTCCTGCAG GGGCAAGCAG
GAGCTAGCAG CCGCCTACTT

TGCGCGCCGC CGACAGTCAG

CCTGAGTGGG TGGTTTGCGA

TCACCAGCAA GGCTGCTCGG

AGCAGTTTTT TTTGTTTTTG

TTTTGTTTTG TTTTGTTTTT AAATCAATCA TGTTACACrA2040 ATAGAAACTT GGCACTCCTG

CTAAGGCAGG GGCGAGCACG

ATACACTAAA ATTCTGAAGT

Protein sequence 19 (SEQ ID N0:404) Gene name: tumor necrosis factor member receptor superfamily, 1A

Unigene number: Ha.159 SO Protein Accession #: NP 001056 Signal sequence: 1-29 TNFR domain: 44-81, 84-125, 127-166, Tranamembrane domains: 211-234 Cellular Localization: plasma membrane S

MGLSTVPDLL LPLVLLELLV GIYPSGVIGL HPQNNSICCT

KCHKGTYLYN DCPGPGQDTD CRECESGSFT QVEISSCTVD

RDTVCGCRKN QYRHYWSENL FQCFNCSLCL GFFLRENECV

SKLYSIVCGK STPEKEGELE GTTTKPLAPN STFTSSSTYT

PGDCPNFAAP RREVAPPYQG ADPILATALA LDTDDPATLY

AVVENVPPLR WKEFVRRLGL SDHEIDRLEL TPRREATLEL

LGRVLRDMDL LGCLEDIEEA LCGPAALPPA
PSLLR

SS

DNA sequence 20 (SEQ ID N0:405) Gene name: prominin (mouse)-like Unigene number: Ha.112360 Probeset Accession #: 840057 .~ Nucleic Acid Accession #: NM 006017 /O

Coding sequence: 38-2635 CCAAGTTCTA CCTCATGTTT GGAGGATCTT TCGGCTCCCT

TCCTAAGGCT TGGAATTATG AATTGCCTGC ACTCCCATAA

AGCTGGACCC ATTGGCATTC TCTTTGAACT TGGTACAGCC

GCGTGATTTC CCAGAAGATA CTTTGAGAAA AATCCAAAAT

TGATTATGAC AAGCCAGAAA CTGTAATCTT ATGAAGCAGG

S GATTATTCTA TGCTGTGTCC TGGGGCTGCT TGGTGGGGTA
O GTTTATTATT CTGATGCCTC .420 TTTCTTTTGT ATGTGTCGTT GCTGTAACAA AGCGACAGAA

GGAAAATGGG CCCTTCCTGA GGAAATGCTT TTTGTATAAT

AATAAGCATT GGCATCTTCT ATGGTTTTGT CCCGGATCAA

AAGGAGTCGG AAACTGGCAG ATAGCAATTT TGAATGAAAC

._ ., .,~ ~w. ' , " i:; .i~ ~'xi ;~ _. :' ~' . '~ s:~ ' ~:~.~:Iw~"'s: '. j~ F ~t ( ';t . .".,z , »,~ '~
,.

ACCAAGGACA AGGCGTTCAC

CTTGACCGAC TGAGACCCAA

GCGATCAAGG AGACCAAAGA

CAACAAAGTA CACAGCTTAG

CTCAATGACC CTCTGTGCTT

TCTCTAAGCC AGCTGAATAG

CTTGACAACG TTAATAACGT

CAATCCCTTA ATGATATACC

ATCAAAAGGG TCTTGAATTC

O ATTCAGGATA TACTCTCAGC

AGAAATTTAC CTACATTGGA

TGCTCTCTGC TGACCCTCAT

GGCTATGACA GGCATGCCAC

TTCCTCATGG TTGGAGTTGG

S GTTCTTACCT TTGTCTTTGG

AAGGAATTAT TCCGGGTTTT

CTCTCTGGGA AGCTATTTAA

GACTGCAAAA AAAATAGAGG

AGTGAACATC TCAACATTAA

ZO TGAGCATACT GGAAGCATAA GCAGTGAATT GGAAAGTCfG1860 AAGGTAAATC TTAATATCTT

GCTGCTTGTG GAATAGACAG

CCCGCAGGAG TGAATCTTTT

CCCCCAGGAA ATTTGAGGAA

CAGCAACGAG TCCTTCCTAT

CTTCAACGCA CAGGGAATGG

TTTGCTCAGA ACTTCATCAC

TATGGGAGAA CAATAATAGG

AGTGAGAAAG TGGCATCGTG

TTTGTGTGTA GCTACATTAT

O ACTGTATTTT TACTTCCGGC

TCTAATTTTT GCGGTAAAAC TGGCTAAGTA CTATCyTCGA2520 ATGGATTCGG AGGACGTGTA

GGTAATAATG GTTATCATAA

CCATCACAAC ATTGATAGCT

~ AAGGATCACA GATTTTTGGT

CGCCAGTGGC AACGTAGTGA

GTAGTGCTTT AAGAATGAAC

TGACTCCCTC CCTTCCfGTC

GACACTACAA CATATGGGGT

AATGTGATGG CTAGATTCTA

p ACATATTGCC ATGTGTGGAG TGTGCT,GAAC ACACACCAGT3060 TTACAGGAAA GATGCATTTT

GTTTTTTAAA CAAATGAGTA

TGACTTCfTG GTGCTGTTGA

ATATTCTTCA CGCAGAGATT

TTGGAAATGG CATGCAAAAG

p CCATCATAGA GAAACGTGCG TAACTCCATC TGACAAATTC3360 'tSAAAAGAGAGA GAGAGATCTT

ACAGATGCCA ATTACGGTGT

AATTGGAGTG CAGCTAACAT

ATGAGAAGAT CCTGTCACAA

TTGGTCCCTA AATTTGCATG

O GTTGGATCTG TCATTATCAA

GTTGATGTAA TGGAATTCCA

CAGTTCTGAT TCATTTGAAT

AAAAAGGAAC TTGGC

S Protein sequence 20 (SEQ ID N0:406) S

Gene name: prominin (mouse)-like 1 Unigene number: Hs.112360 Protein Accession #: NP 006008 Signal sequence: 1-21 ' n Transmembrane domains: 105-127, 157-179, 6 6V 438-460, 482-504, 784-80 Cellular Localization: plasma membrane YETQDSHKAG PIGILFELVH

KIVYYEAGII LCCVLGLLFI

SLLVICIIIS IGIFYGPVAN

TTKDKAFTDL NSINSVLGGG

HQQSTQLSSS LTSVKTSLRS

ELDDTVNNVLR TDLDGLVQQG

PIQDILSAFS VYVNNTESYI

CGYDRHATPT TRGCV$NTGG

SKELFRVLDT PYLLNEDWEY

ISEHLNINEH TGSISSELES

SPAGVNLLSF AYDLEAKANS

ILQRTGNGLL ERVTRILASL

ISEKVASCKP VATALDTAVD

RMDSEDVYDD VETIPMKNME

NGNNGYHKDH VYGIHNPVMT SPSQH

DNA sequence 21 (SEQ ID N0:907) '~"' '' ,, Gene name: G protein-coupled receptor 39 '' .

Unigene number: Hs.85339 Nucleic Acid Accession #: NM,-,001508 Coding sequence: 1-1362 . . ,'.'": . .~ ' , , , , ..., r ,~ t "' y ". ~. y r ~~
;~:.:~ ~~~f.-..~" J,,. ~j~ ~;'s t~,.iT p::.~ ''~ d' ~.~:.~~~.!..; f''s' ~t(' ~' ,t .i~' ~ .,.~ $ .s ..~ . ~~ ~~ ~ v~o~:~~~~~
1 11 21 31 41 S1 ' TCATTGATCA CAGTCATGTC
A

_ 120 CCCGAGTTTG AGGTGGCCAC CTGGATCAAA ATCACCCTTA
TTCTGGTGTA CCTGATCATC

TCACCCAGGT GCTGCAGAAG

TCATCTGGAA TCCCCTGACC

TCTTCGAGGC CTGCAGCTAC

ACATCGCCAT GTGTCACCCC

1 TTCAGGTACA AGGCfGTGTC GGGACCTTGC CAGGTGAAGC480 O TGCTGATTGG CTTCGTCZ'GG

TGGGTACTGA GTACCCCCTG

CCAGCACCCG CCACCACGAG

CCAGCCGCTG GACCGTGTTC

TCCTGCTCTC CGTAGCCTTC

AGGGCTCGCT GGCCGGGGGC

GCAGGACCGC CAGGAGGCAG

TATGCTGGAT GCCCAACCAG

GGACGAGGTC CTACTTCCGG

ACCTCAGCTC GGTCATCAAC

TGTTCGTGCA GGTGCTGTGC

TGCGCGTACA TGCGCACTCC

TCGCGTCCCG GCGCCAGTCC

AGAGCGAGGC CGAGCCCCAG

ACTCAGGCGC GAAACCAGCC

S AATTCTGCTG CAGAGAATGG TTTTCAGGAG CATGAAGTTT
GA

Protein sequence 21 [SEQ ID N0:408) Gene name: G protein-coupled receptor 39 Unigene number: Hs.85339 3 Protein Accession #: NM_001508, NP 001409 O

Signal sequence: none found Pfam domains: 7tm 1 [72-172, 224-344]

Transmembrane domains: 32-54, 68-90, 111-133, i81-173, 221-243, 280-301, 320-342 Cellular Localization: plasma membrane 3S 1 11 21 31 41 Sl FVMGLLGNSA TIRVTQVLQK

TSSYTLSCKL HTFLFEACSY

ATLLHVLTLS FERYIAICHP FRYKAVSGPC QVKLLIGFVW180 , VTSALVALPL LPAMGTEYPL

,~ VNVPSHRGLT CNRSSTRHHE QPETSNMSIC TNLSSRWTVF240 QSSIFGAFW YLVVLLSVAF

TIIFLRLIVV TLAVCWMPNQ

IRRIMAAAKP K<mWTR.SYFR AYMILLPFSE TPFYLSSVIN360 PLLYTVSSQQ FRRVPVQVLC

SARRTEKIFL STFQSEAEPQ

SICSQSLSLES LEPNSGAKPA NSAAENGFQE HEV

ADULT TISSUES
Table 8A lists about 126D genes up-regulated in gfioblastoma compared to normal adult 8ssues. These were selected from 59680 prottesets on the AffymeUixIEos Hu03 GeneChtp array such that the raLo of'average' glioblastoma to'average' normal adult tissues was greater than or equal lo 2.5. The 'average" gho6tastoma level was set to the 75th peroenhle S O amongst various glioblastoma tumors. The'average' normal adult tissue level was set to the 851h peroen8le amongst i(ano~s non-malignant tissues. 1n order to remove gene specfic background levels of non-speGfic hybridizafion, the IDOi percentile value amongst the non-malignant tissues was subtracted from both the numerator and the denominator before the rafio was evaluated.
Pkey Unique Eos probeset identifier number ExAccn: Fxemplar Accession number, Genbank accession number , . ~ , w S S UnigenelD: Umgene number Umgene TiBe: Unigene gene U8e R1: Rafio of 75th peroenbte tumor to 85th percenfile normal body tissue Pkey E.xAccnUnigenelDUnigene TtBe Ri 60 431917D16181Hs.2868peripheral myelin proteinT5.2 427343AI880044Hs protein kinase C binding74 176977protein 2 6 455601AI368680Hs SRY (sex determining 74,2 816 region Yrbox 2 428321AI699994Hs.2868penpheral myelin protein716 412719. Hs.129911ESTs 70.7 6S 449494AW237014Hs.315369Homo Sapiens cDNA: FLJ2307566.3 fis, clone L

415817U88967Hs.70867protein tyrosine phosphatase,643 receptor t 413472BE242870Ns.75379solute cartier family 60.1 1 (filial high affi 456759BE259150Hs.127792delta (Drasophila)hke 52.3 435147AL133731Hs Homo Sapiens mRNA; cDNA46 4774 DKFZp761 C1712 (f 7 7O 425842AI587490Hs NK-2 (Drosophila) homolog401 412733AA984472Hs.74554KIAAODBD protein 39.0 418375NNL003081Hs,B4389synaptosomal-associated38.7 protein, 25kD

453392U23752Hs.32964SRY (sex detertnming 37.2 region Y)-box 11 423849AL157425Hs.133315Homo Sapiens mRtJA, 36.8 cDtVA DKFZp761J1324 (f 7S 413333M74028Hs fibro6last growth factor32 75297 1 {acidic) 8 416829A8013805Hs.80220catenm {cadherinassocialed31.8 protein), d 431941AK000106Hs Hamo Sapiens cDNA FLJ20099318 272227fis, clone CO

436878BE465204Hs.47448ESTs 31.4 426325D28114Hs.169309myelin-associated ollgodendrocyle30.9 basic O 425057AA826434Hs.1619achaete~scute complex ~.4 (Drosaphila) homol 446711AFi69692Hs,1245Dprotocadherin 9 30.2 439415F05538Hs,12825ESTs 28.3 430838N46664Hs hypothe8cal protein 169395FWt2015 429466M85835Hs.12827ESTs 25.9 447004AW296968Hs.157539ESTs 25.3 424581M62062Hs.150917catenin (cadherin-associated24.8 protein), a 452744AI267652Hs.30504Homo Sapiens mRNA; 24.8 cDNA DKFZp434E082 (fr 441285NM-002374Hs.167microtubuie-associated24.3 protein 2 453642AI370936Hs.34074dipep6dylpeptidase 24.3 VI

424140248051Hs.141308myelin oligodendrocyte24.2 glycoprotein 450133AW969769Hs.105201ESTs 24.2 408562A1436323Hs.31141Homo Sapiens mRNA for 23.3 KIAA1568 protein, 1 448672A1955511Hs.225106ESTs 22.7 435708A1362949Hs.75169ESTs 22.0 407034U84540 gb:Human dystrobrevin 21.9 isoform DTN-3 (DTN

407168845175Hs.117183ESTs 21.7 431019NM Hs.2714forkhead box G1B 21.5 1 409049_ Hs.146343ESTs 21.4 433896AW294729Hs.274461ESTs 21.1 445041T64183Hs.282982solute carver 21.0 418738AW388633Hs.6682solute carrier family 20.4 7, (cationic amino 444378841339Hs.12569ESTs 20 20411305BE241596Hs.69547myelin basic protein .
19.g 437414AW894071Hs.48448hypothetical protein 19.8 DKFZp547C176 441016AW138653Hs.25845ESTs 19.6 440435AL042201Hs.21273transcription factor 18.5 NYDsplO

438209AL120659Hs.6111aryl-hydrocarbon receptor18.4 nuclear iransl 25452461N78223Hs.108106transcriptionfactor 18.1 409395U46745Hs.54435dystrobrevin, alpha 18.1 417183852089Hs.172717ESTs 18.0 409638AW450420Hs.21335ESTs 18.0 -028392H10233Hs.2265secretory granule,neuroendocrine18.0 protei 449611A1970394Hs.197075ESTs 17.0 446692244514Hs.156829Homo Sapiens mRNA for 16.9 KIAA1763 protein, 425088AA663372Hs.169395hypothetical protein 16.9 444471AB020684Hs.11217KIAA0877 protein 16.8 421659NM_014459Hs.106511protocadherin 17 16.7 35431725X65724Hs.2839Nome disease (pseudoglioma)16.6 429276AF056085Hs.198612G protein-coupled receptor16.6 416892L24498Hs.80409growth arrest and DNA-damage-inducibte,16.5 -041440AI807981Hs.30495ESTs 15.7 449433AI672096Hs.9012ESTs, Weakly similar 15.7 to 526650 DNA-bindi 421264AL039123Hs.103042microtubule-associated15.5 protein 1 B

415910U20350Hs.78913chemokine (GX3-C) receptor15.3 413597AW302885Hs.117183ESTs 15.1 424945A1221919Hs.173438hypothetical protein 14.9 447414D82343Hs.18551neuroblastoma (nerve 14.9 tissue) protein 45426269H15302Hs.168950Homo Sapiens mRNA; 14.8 cDNA DKFZp566A1046 (f 416857AA188775Hs.292453ESTs 14.7 419721NM Hs.288650aquaporin 4 14.6 411078A1222020Hs.182364CocoaCrisp 14.4 453924849295Hs.24886ESTs 14 409389AB007979Hs.301281Homo Sapiens mRNA, .
chromosome 1 specific 14.3 430130AL137311Hs.234074Homo Sapiens mRNA; 14.1 cDNA DKFZp761G02121 ( 410909AW898161Hs.53112ESTs, Moderately similar14.0 to ALUB_HUMAN A

412266N59006Hs.26133ESTs 14.0 412986X81120Hs.75110cannabinoid receptor 14.0 1 (brain) 55424790AL119344Hs.13326ESTs, Weakly similar 14.0 to 2004399A chromos 439239A1031540Hs.235331ESTs 14.0 441497851064Hs.23172ESTs 14.0 445495BE622641Hs.38489ESTs, Weakly similar 14.0 to 138022 hypotheti 41,4245BE148072Hs.75850WAS protein family, 13.7 member 1 60429900AA460421Hs.30875ESTs 13.6 448595AB014544Hs.21572KIAA0644 gene product 13.6 449605AW138581Hs.198416ESTs 13.6 452526W38537Hs.280740hypothetical protein 13.6 420547AF155140Hs.98738gonadotropin-regulated13.3 testicular RNA he 65441350AB020690Hs.7782paraneoplastic antigen13.3 420077AW512260Hs.87767ESTs 13.2 424120T80579Hs.290270ESTs 13.2 456965AW13i888Hs.172792ESTs, Weakly similar 13.2 to hypothetical pro 423361AW170055Hs.47628ESTs 13 428409AW117207Hs.98523ESTs .
12.9 417160N76497Hs.1787proteolipid protein 12.6 1 (Pelizaeus-Meabac 451621AI879148Hs.26770fatty acid binding 12.5 protein 7, brain 411379AI816344Hs.12554ESTs, Weakly similar 12.5 to NPL4_HUMAN NUCLE

436954AA740151Hs.130425ESTs 12 75430691C14187Hs.103538ESTs .
12.4 433551A1985544Hs.12450protocadherin 9 12,4 422544AB018259Hs.1181d0KIAA0716 gene product 12.2 427540812014Hs.20976ESTs , 12.1 435624AF218942Hs.24889formin 2 12 g 415849820529Hs.6806ESTs , 0 12,1 428845AL157579Hs.153610KIAA0751 gene product il.g 442671A1005668Hs.134779EST 11.9 444396T65213Hs.4257ESTs 11.8 452752AW044058Hs.33578KIAA0820 protein 11.8 425523AB007948Hs.158244KIAA0479 protein 11.8 416072AL110370Hs.79000growth associated protein11.7 440184AB002297Hs.7022dedicator of cyto-kinesis11 428976AL037824Hs.194695ras homolog gene family,.
member I 11.6 444783AK001468Hs.62180aniflin (Drosophila 11.6 Scraps homology, act 448299AA497044Hs.20887hypothetical protein 11.6 414214D49958Hs.75819glycoprotein M6A 11.5 428982NM-005097Hs.194704leucine-rich, glicma 11.5 inactivated 1 l0405238 11,4 420362079734Hs.97206huntingiin interacting11.4 protein 1 422980N46569Hs.76722CCAAT/enhancer binding11.4 protein (CIEBP), 424918813982Hs.169309myelin-associated oligodendrocyte11.4 basic 434277X77748Hs.3786glutamate receptor, 11.4 metabotropic 3 15451952AL120173Hs.301663ESTs 11.3 408829Ntvt_006042Hs.48384heparan sulfate (glucosamine)11.3 3-0-sulfot 424278AK000723Hs.144517hypothetical protein 11.3 429418AI381028Hs.118769ESTs 11.3 429918AW873986Hs.119383ESTs 11 443912837257Hs.184780ESTs .
11.3 448743AB032962Hs.21896KIAA1136 protein 11.3 420092AA814043Hs.88045ESTs 11.2 408081AW451597Hs.167409ESTs 11,2 411642NM Hs.71132neuroligin 1 10.9 415170844386Hs.164578ESTs 10.9 426320W47595Hs.169300transforming growth 10.8 factor, beta 2 450568AL050078Hs.25159Homo Sapiens cDNA FLJ1078410.8 fis, clone NT

425799T08133Hs.182906Homo Sapiens mRNA for 10.8 KIAA1872 protein, 423853AB011537Hs.133466slit (Drosophila) homolog1D.7 30400293N51002Hs.306480Homo Sapiens mRNA; 10.7 cDNA DKFZp761E2112 (f 447773AI423930Hs.36790ESTs, Weakly similar 10.7 to putative p150 (H

448321NM Hs.20912adenomatous polyposis 10.5 005883 coli like 448533AL119710Hs.21365nucleosome assembly 10.5 protein 1-like 3 440684A1253123Hs.127356ESTs, Highly similar 10.3 to S21424 nestin (H

3 444017004840Hs.214neuro-oncological ventral10.3 antigen 1 438380T06430Hs.6194chondroitin sulfate 10.3 proteoglycan BEHAB/b 440471AA886146Hs.307944ESTs 10.2 413063AL035737Hs.75184chitinase 3-like 1 10.1 (cartilage glycoprote 439978BE139460Hs.124673Homo Sapiens cDNA FLJ 10 11477 fis clone HE 1 448902Zd5998Hs.22543Homo Sapiens mRNA; .
cDNA DKFZp76111912 10.1 (f 424932814070Hs.315369Homo Sapiens cDNA: 9.9 FLJ23075 fis, clone L

431721AB032996Hs.268044KIAA1170 protein 9.9 419088A1538323Hs.52620integrin, beta 8 9.8 420602AF060877Hs.99236rogulator of G-protein8 signalling 20 9 45436511AA721252Hs.291502ESTs .
9.8 414696AF002020Hs.76918Niemann-Pick disease, 9.7 type C1 449539W80363Hs.58446ESTs g.7 412959D87458Hs.75090KIAA0282 protein 9.6 412811H06382Hs.21400ESTs 9 50449300A1656959Hs.222165ESTs .
9.6 426344H41821Hs.322469transcdptional activator9.5 of the c-fos p 419271N34901Hs.238532ESTs 9.5 419078M93119Hs.89584insulinoma-associated 9.4 451516AI800515Hs.12024ESTs 9 55422656AI870435Hs.1569LIM homecbox protein .
2 9.3 449318AW236021Hs.78531Homo Sapiens, Similar 9.3 to RIKEN cDNA 5730 414175AI308876Hs.103849hypotheticalprotein 9.3 DKFZp761D112 415279F04237Hs.1447glial fibdllary acidic9.2 protein 428784Y12851Hs.193470purinergic receptor 2 P2X, ligand-gated 9 io 429903AL134197Hs.93597cyclin-dependent kinase.
5, regulatory su 9.2 424641A8001106Hs.15i413glia maturation factor,9.1 beta 417435NM Hs.82129carbonic anhydrase 9.1 005181 III, muscle specific 449448D60730Hs.57471ESTs 9.1 408508A1806109Hs.135736KIAA1580 protein 9 452785AL359942Hs.296434erythroid differentiation.
and denucleati 9.0 448986H42169Hs.18653hypothetical protein 8.9 447072D61594Hs.17279tyrosylprotein sulfotransferase8.9 433800A1034361Hs.135150lung type-I cell membrane-associated8.9 gly 408926AF217525Hs.49002Down syndrome cell B
adhesion molecule 8 449625NM Hs.23796adz (odd Oz/ten-m, .
014253 Drosophila) homolog 8.8 400292AA250737Hs.72472ESTs 8,7 417404NM Hs.82101pleckstrin homology-like8.7 007350 domain, family 420345AW295230Hs.25231ESTs 8,7 429927NM Hs.2522adenylate cyclase 8 8 001115 (brain) 7 75437528N59646Hs.169745crumbs (Drosophila) .
homolog 1 8,7 440152AB002376Hs.7006KIAA0378 protein g,7 451099852795Hs.25954intedeukin 13 receptor,8.6 alpha 2 400780 g,6 434891AA814309Hs.123583ESTs 6 go449277AA001064Hs.172976ESTs .
8,6 415709AA649850Hs.278558ESTs 8.5 439947ABOD6627Hs.6788astrotactin 8.5 447197836075 gb:yh88b01.si Scares 8.5 placenta Nb2HP Homo 433042AW193534Hs.281895Homo Sapiens cDNA FLJ116608.4 fis, clone HE

416370N90470Hs.203697ES1's, Weakly similar 8.4 to 138022 hypotheti 452786861362Hs.106642ESTs, Weakly similar 8.4 to T09052 hypotheti 415796887548Hs.78854ATPase, Na+/K+bansporfing,8.3 beta 2 poly 426271AF026547Hs.169047chondroitin sulfate 8.3 protecglycan 3 (near 408947AL080093Hs.49117Homo Sapiens mRNA; 8.3 cDNA DKFZp564N1662 (f 419863AW952691Hs.93485Homo Sapiens mRNA; 8.3 cDNA DKFZp761 D191 (fr 433447029195Hs.3281neuronal pentraxin 8.3 II

431467N71831Hs.256398Homo Sapiens mRNA; 8.3 cDNA DKFZp434E0528 (f 1 409327L41162Hs.53563collagen, type IX, 8.3 ~ alpha 3 414300AI304870Hs.188680ESTs 8.2 407728AW071502Hs.175931ESTs 8.2 422798892347Hs.34574ESTs, Weakly similar 8.2 to ALUt HUMAN ALU
S

419704AA429104Hs.45057ESTs 8.2 15 429007D80642 gb:HUM092E09B Human 8.1 fetal brain (TFujiwa 442710A1015631Hs.23210ESTs 8.1 425048H05468Hs.i64502ESTs 8.1 429149AW193360Hs.197962ESTs, Weakly similar 8.0 io 138022 hypothe6 445740T78281Hs.13226Homo sapiens clone 8.0 25181 mRNA sequence 418771AA807881Hs.25329ESTs 7.9 422728AW937826Hs.103262ESTs, Weakly similar 7.9 to ZN91 HUMAN ZINC

425984AW836277Hs.165636hypolhefical protein 7.9 DKFZp761 C07121 448408AA322866Hs.21i07neuroligin 7.9 455364H72176Hs.4273hypothetical protein 7.9 25 446619AUD76643Hs.313secreted phosphoprotein7.9 1 (osteoponfin, 435501AW051819Hs.129908KIAA0591 protein 7.8 , 423600AI633559Hs.310359ESTs 7.8 450625AW970107 gb:EST382188 MAGE resequences,7.8 MAGK Homo 415314N88802Hs.5422glycoprotein M6B 7.7 30 420036860336Hs.52792Homo Sapiens mRNA; 7.7 cDNA DKFZp58611823 (f 427687AW003867Hs.1570histamine receptor 7.7 449328AI962493Hs.197647ESTs 7.7 419249X14767Hs.89768gamma-aminobutyric 7.7 acid (GAGA) A recepto 407896D76435Hs.41154Zic family member 1 7.7 (odd-paired Drosophi 35 419103240229Hs.96423hypothetical protein 7.6 438779NM-003787Hs.6414nucleolar protein 4 7.6 433532AW975367 gb:EST387475 MAGE resequences,7.6 MAGN Homo 448555AI536697Hs.159863ESTs 7.5 439662H97552Hs.269060ESTs 7.5 40 448543AW897741Hs.21380Homo Sapiens mRNA; 7.5 cDNA DKFZp586P1124 (f 410099AA081630Hs.169387KIAA0036 gene product 7.5 431592869016Hs.213194hypothetical protein 7.4 409731AA125985Hs.56145thymosin, beta, idenfified7.4 in neuroblast 405819 7.4 45 407886AW969688Hs.100826ESTs 7.4 437416AL359605Hs.283851Homo Sapiens mRNA; 7.4 cDNA DKFZp547G036 (fr 437698861837Hs.7990ESTs, Moderately similar7.4 to 184505 calci 408604D51408Hs.21925ESTs 7.4 418506AA084248Hs.85339G protein-coupled receptor7.3 447499AW262580Hs.147674protocadherin beta 7.3 454036AA374756Hs.93560Homo Sapiens mRNA for 7.3 KIAA1771 protein, 409746NM Hs.56294RAB33A, member RAS 7.2 004794 oncogene family 410037A8020725Hs.58009KIAA0918 protein 7.2 419318AW969742Hs.291005ESTs 7.2 424051AL110203Hs.13B411Homo Sapiens mRNA; 7.2 5 cDNA DKFZp586J 1922 (f 442026AI243749Hs.8074brain-specific angiogenesis7.2 inhibitor 3 448243AW369771Hs.52620integrin, beta 8 7.2 436281AW411194Hs.85195myeloid leukemia factor7.2 426429X73114Hs.169849myosin-binding protein7.2 C, slow-type 407182AA312551Hs.230157ESTs 7.1 415293849462Hs.106541ESTs 7.1 422764AI767727Hs.47522ESTs 7.1 451592AI805416Hs.213897ESTs 7.1 429469M64590Hs.27glycine dehydrogenase(decarboxylafing;7.0 65 415734NM Hs.78748KIAA0237 gene product 7.0 434149243829Hs.19574hypothetical protein 7.0 436726AA324975Hs.128993ESTs, Weakly similar 7.0 to T00079 hypotheti 417632820655lis.5422glycoprotein M6B 7.0 422421AA325138Hs.235873hypotheficalprotein 6.9 70 435267N23797Hs.110114ESTs 6.9 437117AL049256Hs.122593ESTs 6.9 445523230118Hs.293788ESTs, Moderately similar6.9 to unnamed prot 445900AF070526Hs.13429Homo Sapiens clone 6.9 24787 mRNA sequence 445745A8007924Hs.13245KIAA0455 gene product 6.9 75 424085NM Hs.139226replicafion factor 6.9 002914 C (activator 1) 2 (40 428588F12101Hs.185701Homo Sapiens mRNA full6.8 length insert cDN

421723AA620400Hs.300717sodium channel, voltage-gated,6.8 type III, 447342A1i99268Hs.19322Homo Sapiens, Similar 6.7 to RIKEN cDNA 2010 443297A1049864Hs.133029ESTs 6.7 go 443992AW022228Hs.322922ESTs 6.7 453096AW294631Hs.11325ESTs 6.7 453857AL080235Hs.35861DKFZP586E1621 protein 6.7 443761AI525743Hs.160603ESTs 6.6 429609AF002246Hs.210863cell adhesion molecule6.6 with homology to 435056AW023337Hs.5422glycoprotein M6B 6.5 453431AF094754Hs.32973glycine receptor, beta6.5 444190AI878918Hs.10526cysteine and glycine-rich6.5 protein 2 418110843523Hs.217754hypotheticalprotein 6.5 413988M81883Hs.324784glutamate decarboxylase6.5 1 (brain, 67kD) 420805L10333Hs.99947. reticulon 1 6.4 429125AA446854Hs.271004ESTs, Weakly similar 6.4 to 138022 hypotheti 435256AF193766Hs.13872cytokine-like protein 6.4 407866AW088232Hs.89506paired box gene 6 (aniddia,6.3 keratitis) 440700AW952281Hs.296184guanine nucleotide 6.3 binding protein (G
pr 427701AA411101Hs.243886nuclear autoantigenic 6.3 sperm protein (his 422949AA319435 gb:EST21657 Adrenal 6.2 gland tumor Homo sap 445102AW204610Hs.22270ESTs 6.2 452401NM Hs.29352tumor necrosis factor,6.2 007115 alpha-induced pro 435538AB011540Hs.4930low density lipoprotein6.2 receptor-related 410102AW248508Hs.279727Homo Sapiens cDNA FLJ140356.2 fis, clone HE

416871H98716 gb:yx13d08.s1 Soares 6.1 melanocyte 2NbHM Ho 416702AA186428Hs.85591ESTs 6 419347C15944Hs.90005superiorcervical ganglia,.
neural specifi 6.1 424997AL138167Hs.96920ESTs 6.1 438660U95740Hs.6349Homo Sapiens, clone 6.1 IMAGE:3010666, mRNA, 453649Y07494Hs.34114ATPase, Na+IK+transporting,6.1 alpha 2 (+) 449444AW818436Hs.23590solute carrier family 6.1 16 (monocarboxylic 414117W88559Hs.1787proteolipid protein 6.0 1 (Pelizaeus-Meabac 425517AF121179 gb:AF121179 Homo Sapiens6.0 liver (Chang L-427457AW779105Hs.164682ESTs 6.0 437034AA742643 gb:ny91c01.s1 NCI_CGAP-GCB16.0 Homo Sapiens 444170AW613879Hs.102408ESTs 6.0 457183H91882Hs.118569Dvl-binding protein 6.0 IDAX (inhibition of 448999AF179274Hs.22791transmembrane protein 6.0 with EGF-like and 454048H05626Hs.6921ESTs 6.0 439772AL365406Hs.10268Homo Sapiens mRNA full5.9 length insert cDN

448944AB014605Hs.22599atrophin-1 interacting5.9 protein 1; activi 410011AB020641Hs.57856' PFTAIRE protein kinase5.9 415486H12214Hs.13284ESTs, Weakly similar 5.9 to 2109260A B cell 438993AA828995 gb:od77b08.s1 NCI-CGAP_Ov25.9 Homo Sapiens 447350AI375572Hs.172634ESTs 5.9 451783842554Hs.210862T-box, brain, t 5 447101N72185Hs.44189ESTs .
5.9 440492839127Hs.21433hypothetical protein 5.9 DKFZp547J036 440274824595Hs.7122scrapie responsive 5.9 protein 1 438461AW075485Hs.286049phosphosedne aminotransferase5.9 418064BE387287Hs.83384S100 calcium-binding 5.8 protein, beta (neur 437036AI571514Hs.133022ESTs 5.7 412225AW902042 gb:OVO-NN1022-170400-193-c025.7 NN1022 Homo 426342AF093419Hs.169378multiple PDZ domain 5.7 protein 444218AF070641Hs.10684Homo Sapiens clone 5.7 24421 mRNA sequence 445828F05802Hs.81907ESTs 5 447198D61523Hs.283435ESTs .
5.7 427897NM Hs.303084apelin; peptide ligand5.7 017413 for APJ receptor 448499BE613280Hs.77550hypothetical protein 5.7 443672AA323362Hs.9667butyrobetaine (gamma),5.6 2-oxoglutarate dl 412155838167Hs.12449Homo Sapiens transmembrane5.6 protein HTMP1 435718806569Hs.269534'ESTs 5.6 449340AW235786Hs.195359hypothetical protein 5.6 424481819453Hs.1787proteolipid protein 5.6 1 (Pelizaeus-Meabac 451996AW514021Hs.245510ESTs 5.6 422411AW749443Hs.22511ESTs 5 438328AI492261Hs.32450ESTs .
5.6 433244AB040943Hs.271285KIAA1510 protein 5.6 435191815912Hs.4817Homo Sapiens clone 5.5 24461 mRNA sequence 418677S83308Hs.87224SRY (sex determining 5.5 region Y)-box 5 400859 5.5 413625AW451103Hs.71371ESTs 5.5 421863AI952677Hs.108972Homo Sapiens mRNA; 5.5 cDNA DKFZp434P228 (fr 434933891095Hs.4276KIAA1701 protein 5.5 438702A1879064Hs.54618ESTs 5.5 452055AI377431Hs.141693hypothetical protein 5.5 430979AI479755Hs.129010ESTs 5.5 412709AL022327Hs.74518KIAA0027 protein 5.5 439920H05430Hs.288433neurotrimin 5.5 424343AW956360Hs.4748adenylate cyclase activating5.d polypeptide 407846AA426202Hs.40403Cbp/p300-interacting 4 transactivator 5 wit 419235AW470411Hs.288433, .
neurotrimin 5.4 4180308E207573Hs.83321neuromedin B 5.4 410330AW023630Hs.46786ESTs 5.4 410781A1375672Hs.165028ESTs 5.4 420658AW965215Hs.336656ESTs 5 g0 421308AA687322Hs.192843leucine zipper protein.
FKSG14 5.4 443740856434Hs.21062ESTs 5.4 426457AW894667Hs.169965chimerin (chimaerin) 5.4 450375AA009647Hs.8850a disintegdn and metalloproteinase5.4 doma 412494AL133900Hs.792ADP-ribosylation factor5.4 domain protein 1 426600NM Hs.171014VGF nerve growth factor5.4 003378 inducible 424432A8037821Hs.146858protocadhedn 10 5.4 429250H56585Hs.198308lryptophan rich basic 5.4 protein 443785AW449952Hs.190125basic-helix-loop-helix-PAS5.4 protein 436282891913Hs.272104ESTs, Moderately similar5.4 to ALU1 HUMAN A

404584 5.3 430091AB032958Hs.233023KIAA1132 protein 5.3 439845AL355743Hs.56663Homo Sapiens EST from 5.3 clone 41214, full 1 424001W67883Hs.137476paternally expressed 5.3 ~ 10 425073W39609Hs.22003solute carrier family 5.3 6 (neurotransmitte 426625T78300Hs.300642serologically defined 5.3 colon cancer antig 428137AA421792Hs.170999ESTs 5.3 428679AA43t765 gb:zw80c03.s1 Soares 5.3 iestis_NHT Homo sap 1 438176AW138970Hs.122113ESTs 5.3 440138A8033023Hs.318127hypotheticalprotein 5.3 451018AW965599Hs.247324mitochondrial ribosomal5.3 protein 514 416340N31772Hs.79226fasciculation and elongation5.3 protein zet 435244N77221Hs.187824ESTs 5.3 446035NM Hs.135655am68-like phosphotyrosine5.3 006558 protein, T-ST

424624AB032947Hs.151301Ca21-dependent activator5.3 protein for sec 407748AL079409Hs.38176KIAA0606 protein; SCN 5.3 Circadian Oscillat 430437AI768801Hs.169943Homo Sapiens cDNA FLJ 5.3 13569 fis, clone PL

414825X06370Hs.77432epidermal growth factor5.2 receptor (avian 25 453941039817Hs.36820Bloom syndrome 5.2 424998058515Hs.154138chitinase 3-like 2 5.2 423419855336Hs.23539ESTs 5.2 424922BE386547Hs.217112hypothetical protein 5.2 447359NM Hs.18268adenylate kinase 5 5.2 3 406206AF041853Hs.43670kinesin family member 5.2 421013M62397Hs.1345mutated in colorectal 5.2 cancers 429443AB028967Hs.202687potassium voltage-gated5.2 channel, Shal-re 434367A8020700Hs.3830KIAA0893 protein 5.2 444861846789Hs.76118ubiquitin carboxyl-terminal5.2 esterase L1 35 446142AI754693Hs.145968ESTs 5.2 448816A8033052Hs.22151KIAA1226 protein 5.2 451050AW937420Hs.69662ESTs 5.2 451106BE382701Hs.25960v-myc avian myelocytomatosis5.2 viral relal 439285AL133916Hs.172572hypothetical protein 5.2 416737AF154335Hs.79691LIM domain protein 5.2 424800AL035588Hs.153203MyoD family inhibitor 5.2 443695AW204099Hs.337720ESTs, Weakly similar 5.2 to AF1267801 retin 415257F03016Hs.27513ESTs 5.2 433929A1375499Hs.27379ESTs 5.1 45 415651A1207162Hs.3815stathmin-like-protein 5.1 451027AW519204Hs.40808ESTs 5.1 409172299399Hs.118145ESTs 5.1 423343AA324643Hs.246106ESTs 5.1 429172AA447417Hs.285491ESTs 5.1 437268AI754847Hs.227571regulator of G-protein5.1 signalling 4 451270AW341392Hs.235795ESTs 5.1 452904AL157581Hs.30957Homo Sapiens mRNA; 5.1 cDNA DKFZp434E0626 (f 420560AW207748Hs.59115ESTs 5.1 418097845137Hs.21868ESTs 5.1 S 442910A1365130Hs.11307ESTs, Weakly similar 5.1 5 to T19326 hypotheti 434849AW292765Hs.8053ESTs 5.1 413554AA319146Hs.75426secretograninll(chromogranin5.1 C) 414217A1309298Hs.279898Homo Sapiens cDNA: 5.1 FLJ23165 tis, clone L

41.2068572043Hs.73133metallothionein 3 (growth5.0 inhibitory fac 6~ 413627BE182082Hs.246973ESTs 5.0 418661NM Hs.i E2F transcription factor5.0 422438AA445925Hs.270896ESTs, Moderately similar5.0 to 2195 HUMAN Z

423728AW891294Hs.132136solute tarter family 5.0 4, sodium bicarbon 431431AL096711Hs.252953Human DNA sequence 5.0 from clone RP3-403A15 65 435087AW975241Hs.23567ESTs 5.0 452097A8002364Hs.27916a disintegrin-like 5.0 and metalloprotease ( 410434AF051152Hs.63668toll-like receptor 4.9 408692AL040127Hs.34074dipeptidylpeptidaseVl 4.9 407808AA663559Hs.279789histone deacetylase 4.9 7~ 418940H17739Hs.288513Human DNA sequence 4.9 from clone RP5-899C14 425977815138Hs.165570Homo Sapiens clone 4.9 25052 mRNA sequence 426814AF036943Hs.172619myelin transcription 4.9 factor 1-like 447112H17800Hs.7154ESTs 4.9 449574F05048Hs.175373ESTs 4.9 75 453652AW009640Hs.28368ESTs, Moderately similar4.9 to S65657 alpha 423869BE409301Hs.134012C1q-relatedtactor 4.9 413248T64858Hs.21433hypothetical protein 4.9 DKFZp547J036 449176A1633545Hs.198072ESTs 4.9 448451AW015994 gb:Ul-H-BIOp-abh-g-09-0-ULs14.8 NCI_CGAP_S

402604 4.8 436039AW023323Hs.121070ESTs 4.8 448769N66037Hs.38173ESTs 4.8 423678AW963357Hs.7847ESTs 4.8 439451AF086270Hs.278554heterochromatin-like 4.8 protein 1 425870813406Hs.56782ESTs 4.8 408777U71204Hs.47626Ric (Drosophila)-like,4.8 expressed in neur 413409AI638418Hs.78580DEADIH (Asp-Glu-Ala-AspIHis)4.8 box polypep 413623AA825721Hs.246973ESTs 4.8 417246AI760098Hs.21411ESTs 4.8 420900AL045633Hs.44269ESTs 4.8 424153AA451737Hs.141496MAGE-like 2 4.8 443539A1076182Hs.134074ESTs, Moderately similar4.8 to ALU6_HUMAN A

1 448750U95020Hs.21903calcium channel, voltage-dependent,4.8 o beta 454030AW021429Hs.231980ESTs 4.8 424458M29273Hs.1780myelin associated 4.8 glycoprotein 444119841231Hs.184261ESTs, Weakly similar 4.8 to T26686 hypothe6 407792A1077715Hs.39384putative secreted 4.8 ligand homologous to f 1 431462AW583672Hs.256311granin-like neuroendocrine4.7 S peptide precu 431103M57399Hs.44pleiotrophin (heparin4.7 binding growth fac 429956AI374651Hs.22542ESTs 4.7 435060A1422719Hs.233349ESTs, Weakly similar 4.7 to fork head like p 436203BE384982Hs.5076Homo sapiens cDNA: 4.7 FLJ22128 fis, clone H

20 4484758E613134Hs.247474hypothetical protein 4.7 FLJ2i032 422222A1699372Hs.193247hypotheticalprotein 4.7 DKFZp434A171 431733AW298410Hs.21475ESTs 4.7 449353AA001220Hs.271369ESTs 4.7 452022AW072330Hs.293875ESTs 4.7 25 454269AI961060Hs.129908KIAA0591 protein d.7 404541 4.7 428189AA424030Hs.46627ESTs 4.7 409125817268Hs.259673axonal transport of 4.7 synaptic vesicles 458435AI418718Hs.144121ESTs, Weakly similar 4.6 to T46916 hypothefi 425745U44060Hs.14427Homo Sapiens cDNA: 4.6 FLJ21800 fis, clone H

413492D87470Hs.75400KIAA0280 protein 4.6 419629AB020695Hs.91662KIAA0888 protein 4.6 407638AJ4D4672Hs.334483hypolhefical protein 4.6 436140W87355Hs.269587ESTs 4.6 35 439169AI912122Hs.41095ESTs 4.6 443150A1034467Hs.34650ESTs 4.6 451073AI758905Hs.206063ESTs 4.6 451659BE379761Hs.14248ESTs 4.6 452106AI141031Hs.21342ESTs 4.6 40 451407AA131376Hs.326401fibroblast growth 4.6 factor 12B

448765815337Hs.21958Homo Sapiens mRNA; 4.6 cDNA DKFZp547D086 (fr 430147860704Hs.234434hairylenhancer-of-split4.6 related with YRP

437204AL110216Hs.12285ESTs, Weakly similar 4.6 to 155214 salivary 431117AF003522Hs.250500delta (Drosophila)-like4.5 45 422175N79885Hs.6382ESTs, Highly similar 4.5 to T00391 hypotheti 407889834556Hs.30800ESTs, Weakly similar 4.5 to S65657 alpha-1 G

419343AA456245Hs.85603down-regulated by 4.5 Ctnnbl, a 421790AW896201Hs.22654sodium channel, voltage-gated,4.5 type I, a 429399AA452244Hs.16727ESTs 4.5 450149AW969781Hs.132863Zic family member 4.5 0 2 (odd-paired Drosophi 453118AW195849Hs.252757ESTs 4.5 443455A8001025Hs.9349ryanodine receptor 4.4 442613A1004002Hs.130522Kv channel-interacting4.4 protein 1 429643AA455889Hs.167279FYVE-finger-containing4.4 Rab5 effector pro 5 416209AA236776Hs.79078MAD2 (mitotic arrest 4.4 5 deficient, yeast, h 418845AA852985Hs.89232chromobox homolog 4.4 5 (Drosophila HP1 alph 435202AI971313Hs.170204KIAA0551 protein 4.4 437496AA452378Hs.170144Homo Sapiens mRNA; 4.4 cDNA DKFZp547J125 (fr 451254AI571016Hs.172967ESTs 4.4 439039A1656707Hs.48713ESTs 4.4 439979AW600291Hs.6823hypothetical protein 4.4 441607NM Hs.7912neuronal cell adhesion4.4 005010 molecule 424983AI742434Hs.169911ESTs 4.4 410611AW954134Hs.20924KIAA1628 protein 4.4 65 402605 4.4 409248AB033035Hs.51965KIAA1209 protein 4.4 442222A1061301Hs.i64773ESTs 4.4 454027840192Hs.21527Human DNA sequence 4.4 from clone G51-115M3 454293H49739Hs.134013ESTs, Moderately similar4.4 to HK61_HUMAN H

7~ 442632AW206560Hs.253569ESTs 4.4 407304AA565832 gb:nj32b03.s1 NCI_CGAP_AA14.4 Homo Sapiens 423279AW959861Hs.290943ESTs 4.3 427194AA399018Hs.250835ESTs 4.3 419723AL120193Hs.92614longevity assurance 4.3 (LAG1, S. cerevisiae 75 445810AW265700Hs.155660ESTs 4.3 409734BE161664Hs.56155hypothetical protein 4.3 410389AW954049Hs.8177ESTs, Weakly similar 4.3 to PIHUB6 salivary 411571AA122393Hs.70811hypotheficalprotein 4.3 433024AA573847Hs.26549KIAA1708 protein 4.3 453202AW085781Hs.26270hypothefical protein 4.3 425264AA353953Hs.20369ESTs, Weakly similar 4.3 to gonadotropin ind 416427BE244050Hs.79307RacICdc42 guanine 4.3 exchangefactor(GEF) 431789H19500Hs.269222mitogen-activated 4.3 protein kinase 4 444600841398Hs.6996ESTs 4.3 454042H22570Hs.172572hypothetical protein 4.3 441899AI372588Hs.8022TU3A protein 4.3 425256BE297611Hs.155392collapsin response 4.3 mediator protein 1 410358AW975168Hs.13337ESTs, Weakly similar 4.2 to unnamed protein 430291AV660345Hs.23B126CGI-49 protein 4.2 433597AA70B205Hs.100343ESTs 4.2 444127N63620Hs.13281ESTs 4.2 448507AL133109Hs.21333Homo Sapiens mRNA; d.2 cDNA DKFZp566N1047 (f 413589AW452631Hs.313803ESTs, Highly similar 4.2 to AF1578331 noncl 408577H50572Hs.19515ESTs, Highly similar 4.2 to NRG3-HUMAN PRO-N

409719AI769160Hs.108681Homo Sapiens brain 4.2 tumor associated prot 428536A1i43139Hs.2288visinin-like 1 4.2 429118H20669Hs.35406ESTs, Highly similar 4.2 to unnamed protein 432865AI753709Hs.152484ESTs, Weakly similar 4.2 to 138022 hypotheG

447138AI439112Hs.93828ESTs, Weakly similar 4.2 to 2109260A B cell 450648AI703366Hs.26766ESTs 4.2 451459A1797515Hs.270560ESTs, Moderately similar4.2 to ALU7-HUMAN A

421686A8011156Hs.106794KIAA0584 protein 4.2 452776AA194540Hs.13522ESTs, Weakly similar 4.2 to 138022 hypolhefi 436421A1678031Hs.122813ESTs, Weakly similar 4.2 to ZN22 HUMAN ZINC

423858AL137326Hs.133483Homo Sapiens mRNA; 4.2 cDNA DKFZp434B0650 (f 434001AW950905Hs.3697serine (or cysteine) 4.2 proteinase inhibito 437380AL359577Hs.112198Homo Sapiens mRNA; 4.2 cDNA DKFZp547M073 (fr 432328AI572739Hs.1954716-phosphofructo-2-kinaselfructose-2,6-bi4.1 439607BE540565Hs.159460ESTs 4.1 424028AF055084Hs.153692Homo Sapiens cDNA FLJ143544.1 fis, clone Y7 446936H70207Hs.d7314ESTs 4.1 424240A8023185Hs.143535calciumlcalmodulin-dependent4.1 protein kin 3~ 412446AI7680i5Hs.92127ESTs 4.1 409953AA332277Hs.57691cadherin 18, type 2 4.1 416220N49776Hs.170994hypotheficalprotein 4.1 419683AA248897Hs.48784ESTs 4.1 426071AW138057Hs.163835ESTs 4.1 428743AL080060Hs.301549Homo Sapiens mRNA; d.1 cDNA DKFZp564H172 (fr 432809AA565509Hs.131703ESTs 4.1 440105AA694010Hs.6932Homo sapiens clone 4.1 23809 mRNA sequence 452039AI922988Hs.172510ESTs 4.1 425905AB032959Hs.318584novel C3HC4 type Zinc 4.1 finger (ring finge 457561AA331517Hs.286055chimerin (chimaerin) 4.1 429038AL023513Hs.194766seizure related gene 4.1 6 (mouse)-like 433932AW954599Hs.169330neuronal protein 4.1 436637AI783629Hs.26766ESTs 4.1 439231AW581935Hs.141480Homo Sapiens mRNA; 4.1 cDNA DKFZp434N079 (fr 450530NM Hs.25121cytochrome P450, subfamily4.1 006668 46 (cholester 407721Y12735Hs.38018dual-specificity tyrosine-(Y)-phosphoryl4.1 407881AW072003Hs.40968heparan sulfate (glucosamine)4.1 3-0-sulfot 410486AW235094Hs.69233zinc finger protein 4.0 413916N49813Hs.75615apolipoprotein GII 4.0 438703A1803373Hs.31599ESTs 4.0 424726AK001007Hs.138760Homo sapiens cDNA FLJ101454.0 fis, clone HE

405771 4.0 418841NM Hs.89137low density lipoprotein-related4.0 002332 protefi 421764AI6B1535Hs.148135serinellhreonine kinase4.0 424176AL137273Hs.142307hypothetical protein 4.0 425773N21279Hs.237749ESTs 4.0 427304AA761526Hs.163853ESTs 4.0 428882AA436915Hs.131748ESTs, Moderately similar4.0 to ALU7_HUMAN A

452834AI638627Hs.105685KIAA1688 protein 4.0 453745AA952989Hs.63908hypothefical protein 4.0 405239089281Hs.11958oxidative 3 alpha hydroxysteroid4.0 dehydro 413801M62246Hs.35406ESTs, Highly similar 4.D
to unnamed protein 429698AI6B5086Hs.26339ESTs, Weakly similar 4.0 to 521348 probable 435854AJ278120Hs.4996putative ankyrin-repeat4.0 containing prote 439199840373Hs.26299ESTs 4.0 439450851613Hs.125304ESTs 4.0 446782A1653048Hs.144006ESTs 4.0 419687A1638859Hs.227699ESTs, Weakly similar 3.9 to T2D3_HUMAN TRANS

402408 3.9 7~ 453362H14988Hs.107375ESTs 3.9 414219W20010Hs.75823ALL1-fused gene from 3.9 chromosome 1q 420578AA813546Hs.99034GTP-binding protein 3.9 Rho7 425010T16837Hs.4241ESTs 3.9 444230H95537Hs.146067ESTs 3.9 441736AW292779Hs.169799ESTs 3.9 418951F07809Hs.89506paired box gene 6 (aniridia,3.9 keratitis) 406311 3.9 408460AA054726Hs.285574ESTs 3.9 410658AW105231Hs.192035ESTs 3.9 414699A1815523Hs.76930synuclein, alpha (non 3.9 A4 component of am 418849AW474547Hs.53565Homo Sapiens PIG-M 3.9 mRNA for mannosyltran 429477AI275514Hs.6658ESTs 3.9 433766AA609234Hs.1i2669ESTs 3.9 436190AK001059 gb:Homo Sapiens cDNA 3.9 ' FLJ10197 fis, clone 447891841754Hs.6496ESTs 3.9 450221AA328102Hs.24641cytoskeleton associated3.9 protein 2 404283 3~9 453919AW959912Hs.7076KIAA1705 protein 3.9 429656X05608Hs.211584neurofilament, light 3.9 polypeptide (68kD) 412754AW160375Hs.74565amyloid beta (A4) 3.9 precursor-like protein 445314AIfi89948Hs.65489Homo Sapiens cDNA: 3.9 FLJ21517 fis, clone C

435652N32388Hs.334370uncharacterized hypothalamus3.9 protein HBE

1 407378AA299264Hs.57776ESTs, Moderately similar3.9 ~ to 138022 hypot 438054AA776626Hs.62183ESTs 3.9 436420AA443966Hs.31595ESTs 3.9 445133AW157646Hs.153506ESTs 3.9 432590AI609273Hs.110783ESTs 3.9 15 453331AI240665Hs.8895ESTs 3.9 410227AB009284Hs.61152exostoses (multiple)-like3.8 424635AA420687Hs.i Homo sapiens cDNA 3.8 15455FLJ14259 fis, clone PL

451489NM Hs.26468amyloid beta (A4) 3.8 005503 precursor protein-bind 447247AW369351Hs.287955Homo Sapiens cDNA 3.8 FLJ13090 fis, clone NT

448302AI480208Hs.182906Homo Sapiens mRNA 3.8 for KIAA1872 protein, 415669NM-005025Hs.78589serine (or cysleine) 3.8 proteinase inhibito 417355D13168Hs.82002endothelin receptor 3.8 type B

446727AB011095Hs.16032KIAA0523 protein 3.8 424340AA339036Hs.7033ESTs 3.8 25 423346A1267677Hs.127416synaptojanin 1 3.8 412788AA120960Hs.198416ESTs 3.8 404593 3.8 416856N27833Hs.269028ESTs, Weakly similar 3.8 to 138022 hypothe6 429896AA460367Hs.224223ESTs, Moderately similar3.8 to 138022 hypot 439619AW975998Hs.58595ESTs, Weakly similar 3.8 to 138022 hypotheti 439634W79377Hs.167microtubule-associated3.8 protein 2 440322AA879430 gb:oj91dO8.s1 Soares_NFL-T-GBC_Si3.8 Homos 447761AF061573Hs.19492protocadherin 8 3.8 452453AI902519 gb:OV-BT009-101198-0513.8 BT009 Homo sapien 35 439671AW162840Hs.6641kinesinfamilymemberSC3.8 447937AL109716Hs.20034Homo Sapiens mRNA 3.8 full length insert cDN

459278AW294659Hs.34054Homo Sapiens cDNA: 3.8 FLJ22488 fis, clone H

447028AI973128Hs.167257brain link protein-1 3.8 449458AI805078Hs.208261ESTs 3.8 4~ 445888AF070564Hs.13415Homo Sapiens clone 3.8 24571 mRNA sequence 407385AA610150Hs.272072ESTs, Weakly similar 3.8 to 138022 hypotheti 428841AI418430Hs.104935ESTs 3.8 430643AW970065Hs.287425MEGF10 protein 3.8 422263AA307639Hs.129908KIAA0591 protein 3.8 45 451625856793Hs.106576alanine-glyoxylate 3.8 aminotransferase 2-li 439236BE160952Hs.247117ESTs, Moderately similar3.8 to ALUF-HUMAN !

441928AI370188Hs.211454ESTs 3.8 441797AI936933Hs.214635ESTs 3.7 414922D00723Hs.77631glycine cleavage system3.7 protein H (amino 425588F07396Hs.46751ESTs 3.7 437007AA741300Hs.202599ESTs, Weakly similar 3.7 to 138022 hypotheti 435793A8037734Hs.4993KIAA1313 protein 3.7 443682AI383061Hs.47248ESTs,HighlysimilartosimilartoCdcl43.7 425741AF052152Hs.159412Homo Sapiens clone 3.7 24628 mRNA sequence 418211BE244746Hs.247474hypotheticalprotein 3.7 440080AW051597Hs.143707ESTs 3.7 452898AA814497Hs.78792ESTs 3.7 435575AF213457Hs.44234triggering receptor 3.7 expressed on myeloid 409234AI879419Hs.2720fiESTs 3.7 420489AA815089Hs.193513ESTs 3.7 426890AA393167Ns.41294ESTs 3.7 438849W28948Hs.10762ESTs 3.7 441869NM Hs.8004huntingtin-associated3.7 003947 protein interactin 448796AA147829Hs.301431endothelial zinc finger3.7 protein induced 65 459318NM gb:Homo sapiens adenomatosis3.7 000038 polyposis c 459518AI937419Hs.294069Homo Sapiens cDNA 3.7 FLJ 13384 fis, clone PL

434444AI765276Hs.101257hypothetical protein 3.7 421183AL135740Hs.102447TSG22-like 3.7 410555U92649Hs.64311a disintegrin and 3.7 metalloproteinase doma 70 421637AF035290Hs.106300Homo Sapiens clone 3.7 23556 mRNA sequence 418522AA605038Hs.7149Homo Sapiens cDNA: 3.7 FLJ21950 fis, clone H

420807AA280627Hs.57846ESTs 3.7 449961AW265634Hs.133100ESTs 3.7 422634Ntv>_016010Hs.118821CGI-62 protein 3.7 75 421030AW161357Hs.101174microtubule-associated3.7 protein tau 427099A8032953Hs.173560odd Ozlten-m homolog 3.7 2 (Drosophila, mous 452355N54926Hs.29202G protein~coupled 3.7 receptor 34 440483AI200836Hs.150386ESTs 3.7 429597NM Hs.2442a disintegrin and 3.7 003816 metalloproteinase doma 423756AA828125 gb:od71 a09.s1 NCI-CGAP-Ov23.6 Homo sapiens 425187AW014486Hs.22509ESTs 3.6 434859BE255080Hs.299315collapsin response 3.6 mediator protein-5;
C

413199M62843Hs.75236SLAV (embryonic lethal,3.6 abnormal vision, 445729H21066Hs.13223Homo Sapiens mRNA 3.6 full length insert cDN

416120H46739 gb:yo14h02.s1 Snares 3.6 adult brain N2b5HB5 429239AA448419Hs.45209ESTs 3.6 419086NM Hs.89591Kallmann syndrome 3.6 000216 1 sequence 446659AI335361Hs.226376ESTs 3.6 426757AW205640Hs.158206ESTs 3.6 418819AA228776Hs.191721ESTs ~ 3.6 458332A1000341Hs.220491ESTs 3.6 408826AF216077Hs.48376Homo Sapiens clone 3.6 HB-2 mRNA sequence 1 410343AA084273Hs.76561ESTs, Weakly similar 3.6 ~ 1c S47072 finger pr 410507AA355288Hs.40834transifional epithelia3.6 response protein 422977AA631498 gb:np83h04.s1 NCI 3.6 CGAP Thy1 Homosapiens 425305AA363025Hs.155572Human clone 23801 3.6 mRNA sequence 428002AA418703 gb:zv98c03.s1 Soares_NhHMPu3.6 S1 Homo sapi 15 428505AL035461Hs.2281chromogranin B (secretogranin3.6 1) 430530AA480870Hs.47660ESTs 3.6 4311425A1913146Hs.318725CGI-72 protein 3.6 438078A1016377Hs.131693ESTs 3.6 442927A1024347Hs.131519ESTs 3.6 446242N66336Hs.7360ESTs 3.6 448831AL080123Hs.22182zinc finger protein 3.6 23 (KOX 16) 450474AW872844Hs.201919ESTs 3.6 452198A1097560Hs.61210ESTs, Weakly similar 3.6 to 138022 hypotheti 455800822479Hs.167073Homo Sapiens cDNA 3.6 FLJ13047 fis, clone NT

25 436443AW138211Hs.128746ESTs 3.6 426514BE616633Hs.170195bone morphogenetic 3.6 protein 7 (osteogenic 456038AA203285Hs.294141ESTs, Weakly similar 3.6 to alternatively sp d08902AW014869Hs.5510ESTs 3.6 442950AI500417Hs.46764ESTs 3.6 423905AW579960Hs.135150lung type-I cell membrane-associated3.6 gly 425478A8007953Hs.268840ESTs 3.6 453884AA355925Hs.36232KIAA0186 gene product3.6 404721 3.6 408453A1369838Hs.45i27chondroitin sulfate 3.6 proteoglycan 5 (neur 3 440553AA889416Hs.295362Homo Sapiens cDNA 3.5 FLJ14459 fis, clone HE

446372A80206d4Hs.14945long fatty acyl-CoA 3.5 synthetase 2 gene 413999N46124Hs.34460ESTs 3.5 421458NM_003654Hs.104576carbohydrate (keratan3.5 sulfate Gal-6) sul 425017AL119305Hs.288405ESTs 3.5 435958H98180Hs.117975ESTs 3.5 415101845531Hs.144534ESTs 3.5 451320AW118072Hs.89981diacylglycerol kinase,3.5 zeta (104kD) 430290AI734110Hs.136355ESTs 3.5 416836D54745Hs.80247cholecystokinin 3.5 45 414821M63835Hs.77424Fc fragment of IgG, 3.5 high affinity la, re 419412AW161058Hs.90297synuclein, beta 3.5 437860AA333063Hs.279898Homo Sapiens cDNA: 3.5 FLJ23165 fis, clone L

452689F33868Hs.284176transferrin 3.5 416661AA634543Hs.79440IGF-II mRNA-binding 3.5 protein 3 427491843279Hs.22574ESTs, Weakly similar 3.5 to 138022 hypothefi 428037N47474Hs.89230potassium intermedialelsmall3.5 conductance 444584A1i68422 gb:ok30e11.x1 Snares 3.5 NSF_F8 9W_OT-PA_P_S

408296AL117452Hs.44155DKFZP586Gi517 protein3.5 453775NM Hs.35120replication factor 3.5 002916 C (activator 1) 4 (37 55 412659AW753865Hs.74376olfactomedin related 3.5 ER localized protei 429077AB028983Hs.2352adenylate cyclase 3.5 2 (brain) 436887AW953157Hs.193235hypothetical protein 3.5 DKFZp547D155 450784AW246803Hs.d7289ESTs 3.5 446827AW451243Hs.157069ESTs 3.5 436434N50465Hs.92927putative 47 kDa protein3.5 412777AI335773Hs.270123ESTs 3.5 436476AA326108Hs.33829bHLH protein DEC2 3.5 408601047928Hs.86122protein A 3.4 429401AW296102Hs.99272ESTs, Weakly similar 3.4 to 532567 A4 protei 65 448425AI500359Hs.233401ESTs 3.4 418727AA227609Hs.94834ESTs 3.4 451729AW160725Hs.312469ESTs 3.4 435910A1084152Hs.21782ESTs, Weakly similar 3.d 1c ALU7_HUMAN ALU
S

434577837316Hs.179769Homo Sapiens cDNA: 3.4 FLJ22487 fis, clone H

414598A1094221Hs.135150lung type-I cell membrane-associated3.4 gly 439627BE621702Hs.29076hypothefical protein 3.4 413293AL047483Hs.302498 3.4 GTP-binding protein homologous to Saccha 423992AW898292Hs.137206 3.4 Homo Sapiens mRNA;
cDNA
DKFZp564H1663 (f 426249F05422Hs.168352 3.4 nucleoporin-like protein 75 426968007616Hs.173034 3.4 amphiphysin (Sfiff-Mann syndrome with br 430388AA356923Hs.240770 3.4 nuclear cap binding protein subunit 2, 435061AI651474Hs.i63944 3.4 ESTs 452291AFOi Hs.28853CDC7 (cell division 3.4 5592 cycle 7, S. cerevisi 449714AB033015Hs.23941KIAA1189 protein 3.4 443392A1055821Hs.293420 3.4 ESTs 410082AA081594Hs.158311 3.4 Musashi (Drosophila) homolog 445337NM fibroneclin leucine 3.4 013280 rich transmembrane Hs.12523 p 408493BE206854Hs.46039phosphoglycerate mutase3.4 2(muscle) 432731831178Hs.287820fibronectin 1 3.4 448758A80183i1Hs.21917KIAA0768protein 3.4 432613AW081698Hs.80712KIAA0202 protein 3.4 434164AW207019Hs.148135serinelthreonine kinase3.4 425294AF033827Hs.155553HNK-1 sulfotransferase3.4 410108AA081659Hs.318775OSBP-related protein 3.4 406815AA833930Hs.288036iRNA isopentenylpyrophosphate3.d transferas 402855 3.3 422170A1791949Hs.112432anG-Mulledan hormone 3.3 445034AW293376Hs.143659ESTs 3.3 424378W28020Hs.167988neural cell adhesion 3.3 molecule 1 423611AB011163Hs.129908KIAA0591 protein 3.3 435593888872Hs.4964DKFZP586J1624 protein 3.3 404819 3.3 436607AW661783Hs.211061ESTs 3.3 427315AA179949Hs.175563Homo Sapiens mRNA; 3.3 cDNA DKFZp564N0763 (f 452693179153Hs.48589zinc finger protein 3.3 454996AW850180 gb:IL3-CT0219-271099-022-C093.3 CT0219 Homo 406927M26460 gb:Homo Sapiens (clone3.3 104) refinoblasto 409045AA635062Hs.50094Homo Sapiens mRNA; 3.3 cDNA DKFZp43400515 (f 415238837780Hs.21422ESTs 3.3 417845AL117461Hs.82719Homo sapiens mRNA; 3.3 cDNA DKFZp586F1822 (f 421192AA833718Hs.204529KIAA1806 protein 3.3 426695AW118191Hs.112729ESTs 3.3 438885A1886558Hs.184987ESTs 3.3 451762AF222980Hs.26985disrupted in schizophrenia3.3 452103842764Hs.33965dESTs, Weakly similar 3.3 to 138022 hypotheti 453590AF150278Hs.33578KIAA0820 protein 3.3 453616NM Hs.33846dynein, axonemal, light3.3 003462 intermediate pol 457285A1038858Hs.130522Kvchannel-interacting 3.3 protein 1 436045AB037723Hs.5028DKFZP56400423 protein 3.3 437470AL390147Hs.134742hypotheficalprotein 3.3 DKFZp547D065 448520AB002367Hs.21355doublecortin and CaM 3.3 kinase-like 1 436480AJ271643Hs.87469putative acid-sensing 3.3 ion channel 432656NM Hs.3076MHC class II transactivator3.3 443898AW804296Hs.9950Sec61 gamma 3.3 423582BE000831Hs.23837Homo Sapiens cDNA FLJ118123.3 fis, clone HE

445953AI612775Hs.145710ESTs 3.3 427940AA417812Hs.38775ESTs 3.3 4~ 414683S78296Hs.76888hypothefical protein 3.3 428484AF104032Hs.184601salute carrier family 3.3 7 (cationic amino 420649AI866964Hs.124704ESTs, Moderately similar3.3 to S65657 alpha 419498AL036591Hs.20887hypothetical protein 3.3 457579A8030816Hs.36761HRAS-like suppresser 3.3 436556AI364997Hs.7572ESTs 3.2 424369887622Hs.26714KIAA1831 protein . 3.2 457065AI476318Hs.192480ESTs 3.2 440210AW674562Hs.125296ESTs 3.2 444513AL120214Hs.7117glutamate receptor, 3.2 ionotropic, AMPA 1 434353AA630863Hs.131375ESTs, Moderately similar3.2 to ALUB HUMAN !

414430AI346201Hs.76118ubiquitin carboxyl-terminal3.2 esterase Li 439924AI985897Hs.125293ESTs 3.2 411505AF155659Hs.70565molybdenum cofactor 3.2 synthesis 2 423175W27595Hs.18653hypothetical protein 3.2 415115AA214228Hs.127751hypothefical protein 3.2 407878D87468Hs.40888activity-regulated 3.2 cytoskeleton-associat 410274AA381807Hs.61762hypoxia-inducible protein3.2 437762178028Hs.154679synaptotagmin I 3.2 4$8944AA302517Hs.92732KIAA1444 protein 3.2 6~ 450313A1038989Hs.332633Bardet-Biedlsyndroine 3.2 409459D86407Hs.54481low density lipoprotein3.2 receptor-related 410953AW811766Hs.334858hypothetical protein 3.2 418527AA450386Hs.7149Homo Sapiens cDNA: 3.2 FLJ21950 fis, clone H

420061AW510776Hs.94958tubulin tyrosine ligase-like3.2 429496AA453800Hs.192793ESTs 3.2 430099AW194988Hs.20537hypothefical protein 3.2 434928AW015595Hs.4267Homo Sapiens clones 3.2 24714 and 24715 mRNA

435532AW291488Hs.117305Homo Sapiens, clone 3.2 IMAGE:3682908, mRNA

438306AW188266Hs.163645ESTs 3.2 439274AF086092Hs.48372ESTs 3.2 440847AA907511Hs.130178ESTs 3.2 447750A1422234Hs.143434contactin 1 3.2 455350AW901809 gb:OVO-NN1020-170400-195-h023.2 NN1020 Homo 430890X54232Hs.2699glypican 1 3.2 420568F09247Hs.247735protocadhedn alpha 3.2 410768AF038185Hs.66187Homo Sapiens clone 3.2 23700 mRNA sequence 427450AB014526Hs.178121KIAA0626 gene product 3.2 430456AA314998Hs.241503hypotheficalprotein 3.2 430181AF065314Hs.234785cyclic nucleotide gated3.2 channel alpha 3 418512AW498974Hs.89981diacylglycerol kinase,3.2 zeta (104kD) 419912AF249745Hs.6066Rho guanine nucleotide3.2 exchange factor ( 450689AI369275Hs.243010Homo Sapiens cDNA FLJ144453.2 fis, clone HE

424899AL119387Hs.119062'ESTs 3.2 436277888520Hs.120917ESTs 3.2 451455A1937227Hs.8821hepcidin anfimicrobial3.2 peptide 445078AI869975Hs.4775junctaphilin 3 3.2 447746AW015920Hs.16i359ESTs 3 435458F11872Hs.4892Homo Sapiens clone .
24841 mRNA sequence 3.2 427729A8033100Hs.300646KIAA protein (similar 3.2 to mouse paladin) 417417F05745Hs.89512ATPase, Ca++Uansporting,3.1 plasma membra 438810AW897846Hs.6421hypothetical protein 3.1 DKFZp761 N09121 439570T79925Hs.269165ESTs, Weakly similar 3.1 to ALUt HUMAN ALU
S

1~432527AW975028Hs.102754ESTs 3,1 416801X98834Hs.79971sat (Drosophila)-like 3.1 421988AW450481Hs.161333ESTs 3.1 426509M31166Hs.2050pentaxin-rotated gene,3.1 rapidly induced b 408786AA773187Hs.294027ESTs 3 1 433494AB029396Hs.3353beta-1,3-glucuronylUansferase.
1(glucur 3.1 412723AA648459Ns.335951hypothetical protein 3.1 d18329AW247430Hs.84152cystathionine-betasynthase3.1 439456A1752409Hs.109314hypothetical protein 3.1 428832AA578229Hs.324239ESTs, Moderately similar3 to ZN91 HUMAN Z 1 ZO452780BE171598Hs.13522ESTs, Weakly similar .
to 138022 hypothefi 3.1 438192AI859065Hs.337620Homo Sapiens AFG3L1 3.1 isoform 1 mRNA, part 424939AK000059Hs.153881Homo Sapiens NY-REN-623.1 anfigen mRNA, par 403053858624Hs.2186eukaryofic translation3.1 elongation factor ~ 1 ~J'407864AF069291Hs.40539chromosome 8 open reading.
frame 1 3.1 410181A1468210Hs.261285pleiotropic regulator 3.1 1 (PRLt, Arabidops 4188528E537037Hs.273294hypotheficalprotein 3.1 449101AA205847Hs.23016G protein-coupled receptor3.1 453240A196956dHs.166254hypothetical protein 3.1 DKFZp5661133 30440486BE243513Hs.7212hypothetical protein 3.1 408096BE250162Hs.83765dihydrofolate reductase3.1 439864AI720078Hs.291997ESTs, Weakly similar 3.1 to A47582 B-cell gr 414706AW340125Hs.76989KIAA0097 gene product 3.1 436315BE390513Hs.27935hypothetical protein 3.1 35426855AL117427Hs.172778Homo Sapiens mRNA; 3.1 cDNA DKFZp566P013 (fr 425683ABD378i3Hs.159200hypothetical protein 3.1 DKFZp762K222 410126BE169274Hs.169387KIAA0036 gene product 3.1 d35312AJ243396Hs.4865voltage-gated sodium 3.1 channelbeta-3 subu 425491AA883316Hs.255221ESTs 1 456273AF154B46Hs.1148zincfingerprotein .
3.1 412140AA219691Hs.73625RAB6 interacting, kinesin-like3.1 (rabkines 445255NM Hs.12477synaptosomal-associated3.1 014841 protein, 91 kDa 432154AI701523Hs.112577ESTs 3.f 453128AW026516Hs.31791acylphosphatase 2, 3 muscle type 1 45438458AW975186 gb:EST387294 MAGE rosequences,.
MAGN Homo 3.i 448616AF035621Hs.21611kinesin family member 3.0 429281AA830856Hs.29808Homo sapiens cDNA: ~
FLJ21122 fis, clone 3.0 C

443906AA348031Hs.7913ESTs 3.0 417318AW953937Hs.12891ESTs 0 50452619AW298597Hs.61884Homo sapiens, clone .
IMAGE:4298026, mRNA, 3.0 444153AK001610Hs.10414hypothetical protein 3.0 408790AW580227Hs.47860neurotrophic Tyrosine 3.0 kinase, receptor, 426327W03242Hs.44898Homo Sapiens clone 3.0 TCCCTA00151 mRNA sequ 451468AW503398Hs.293663ESTs, Moderately similar3.0 to 138022 hypot 422758AF152329Hs.284180protocadherin gamma 3.0 subfamily C, 3 421633AF121860Hs.106260sorting nexin 10 3.0 428361NM Hs.183858lranscriptional intermediary3.0 015905 factor 1 416932L34059Hs.89484cadherin 4, type 1, 3.0 R-cadherin (refinal) 416805F13271Hs.79981Human clone 23560 mRNA3.D
sequence 419518U79289Hs.90798Human clone 23695 mRNA3.0 sequence 422709AA315331Hs.153485ESTs 3.0 423135N67655Hs.26411ESTs 3.0 424901211933Hs.182505POU domain, class 3, 3.0 transcripfion facto 426617W58006Hs.266258endonuclease G-like 3.0 427386AW836261Hs.337717ESTs 3.0 429859NNt,.,007050Hs.225952protein tyrosine phosphatase,3.0 receptor t 435071D60683Hs.35495ESTs 3.0 435092AL137310Hs.4749Homo Sapiens mRNA; 3.D
cDNA DKFZp761 E13121 ( 436211AK001581Hs.334828hypotheficalprotein 3.0 FLJ10719; KIAA1794 436936AL134451Hs.197478ESTs 3.0 445855BE247129Hs.145569ESTs 3.0 452294A187i925Hs.117895ESTs,ModeratelysimilartoA47582B-cel3.0 433980AA137152Hs.286049phosphoserine aminotransferase3.0 430228AW950939Hs.6382ESTs, Highly similar 3.0 to T00391 hypothefi 75451026AA013218Hs.157492cer-d4 (mouse) homolog3.0 435232NM Hs.4854cyclin-dependent kinase3.0 001262 inhibitor 2C (p1 439566AF086387 gb:Homo Sapiens full 3.0 length insert cDNA

425782U66468Hs.159525cell growth regulatory3.0 with EF-hand doma 416586D44643Hs.14144secreted modular calcium-binding3.0 protein 416874H98752Hs.42568ESTs 3.0 410386W26187Hs.3327Homo sapiens cDNA: 3.0 FLJ22219 fis, clone H

411411AA345241Hs.55950ESTs, Weakly similar 3,0 to KIAA1330 protein 424066299348Hs.11246iESTs, Weakly similar 3.0 to 138022 hypo(heti 404048 3.0 429163AA884766 gb:am20a10.s1 Soares 3.0 NFL_T-GBC_S1 Homos 454117BE410100Hs.40368adaptor-related protein3.0 complex 1, sigma 418196AI745649Hs.26549KIAA1708 protein 3.0 434131AI858275Hs.143659ESTs 3.0 441255806350Hs.171635ESTs 2.9 453900AW003582Hs.226414ESTs, Weakly similar 2.9 to ALU8_HUMAN ALU
S

453905NM Hs.36566LIM domain kinase 1 2.9 416602NM Hs.79389net (chicken)-like 2.9 1 431173AW971198Hs.294068ESTs 2.9 ~

425599AW366745Hs.214140ESTs, Weakly similar 2.9 to ALU1 HUMAN ALU
S

436401A1087958Hs.29088ESTs 2.9 422960AW890487Hs.63984cadherin 13, H-cadherin2.9 (heart) 451558NM Hs.26630ATP-binding cassette, 2.9 001089 sub-family A (ABCs 15 412490AW803564Hs.288850Homo sapiens cDNA: 2.9 FLJ22528 fis, clone H

433149BE257672Hs.42949hypothetical protein 2.9 434811AW971205Hs.114280ESTs 2.9 425897AA935315Hs.48965Homo Sapiens cDNA: 2.9 FLJ21693 fis, clone C

452092BE245374Hs.27842hypothefical protein 2.9 453496AA442103Hs.33084solute carrier family 2.9 2 (facilitated glu 411124AW196937Hs.53929ESTs, Weakly similar 2.9 to ALUB HUMAN !!1l 419227BE537383Hs.89739cholinergic receptor, 2.9 nicotinic, beta po 427651AW405731Hs.18498Homo Sapiens cDNA FLJ122772.9 fis, clone MA

441707842637Hs.21963hypothetical protein 2.9 DKFZp761B0514 25 435741AI240668Hs.113099ESTs 2.9 437273AL137451Hs.120873ESTs, Highly similar 2.9 to T46266 hypotheti 422939AW394055Hs.98427ESTs, Weakly similar 2.9 to 138022 hypothefi 439376AA883521Hs.222064ESTs 2.9 439935S75105Hs.301676glutamate receptor, 2.9 ionotropic, kainate 30 437267AW511443Hs.258110ESTs 2.9 453740AL120295Hs.311809ESTs, Moderately similar2.9 to PC4259 fern 400250 2.9 400992 2.9 408814N62499Hs.176227hypothetical protein 2.9 3 411849AW964970Hs.18861ESTs, Moderately similar2.9 to KIAA1276 pro 414853U31116Hs.77501sarcoglycan, beta (43kD2.9 dystrophin-assoc 423751AW235633Hs.46525ESTs 2.9 42691DAA470023Hs.190089ESTs,ModeratelysimilartoALU12.9 HUMANA

450203AF097994Hs.301528L-kynureninelalpha-aminoadipate2.9 aminoUa 40 459311840192Hs.21527Human DNA sequence 2.9 from clone GSi-115M3 425304AA463844Hs.31339fibroblast growth factor2.9 428500AI815395Hs.184641fatty acid desaturase 2.9 421641AI638184Hs.106334Homo sapiens clone 2.9 23836 mRNA sequence 421141AW117261Hs.125914ESTs 2.9 45 407870AB032990Hs.40719hypothetical protein 2.9 456723243902Hs.4748adenylate cyclase activafing2.9 polypeptide 436456AW292677Hs.248122G protein-coupled receptor2.9 421483NM Hs.104717hypothetical protein 2.9 412190816180Hs.274461ESTs 2.9 SO 446131NM Hs.290phospholipase A2, group2.9 441668A1611973Hs.127525ESTs 2.9 437387A1198874Hs.28847AD026 protein 2.9 423420AI571364Hs.128382Homo sapiens mRNA; 2.9 cDNA DKFZp76111224 (f 427958AA418000Hs.98280potassium intermediate/small2.9 conductance 55 429084AJ001443Hs.195614splicing factor 3b, 2.9 subunit 3,130kD

447067842098Hs.21964ESTs 2.9 430887N66801Hs.260287KIAA1B41 protein 2.9 441824AB007871Hs.7977KIAA0411 gene product 2.9 42 AA335635Hs.96917ESTs 2.9 6O , W01556Hs.238797ESTs, Moderately similar2.9 408739 to 138022 hypot 447422BE618703Hs.98258orthopedic (Drosphila)2.9 homolog 435615Y15065Hs.4975potassium voltage-gated2,9 channel, KOT-lik 446997AA383439Hs.16758Seir-1 protein 2.9 433573AF234887Hs.57652cadherin, EGF tAG seven-pass2.9 G-type rece 65 408447AK002089Hs.45080Homo Sapiens cDNA FLJ 2.9 11227 fis, clone PL

419586A1088485Hs.144759ESTs, Weakly similar 2.8 to 138022 hypotheti 417022NM Hs.80905Ras associafion (RaIGDSIAF-6)2.8 014737 domain fam 408432AW195262 gb:xn67b05.x1 NCI-CGAP-CML12.8 Homo sapiens 420320AB002361Hs.96633KIAA0363 protein 2.8 7O 425241AA324624Hs.155247aldolase C, fructose-bisphosphate2.8 428670AA431682Hs.134832ESTs 2.8 424415NM Hs.146580enolase 2, (gamma, 2.8 001975 neuronal) 409185AW961601Hs.252406hypothetical protein 2.8 FLJ12296 similar to 411555AFi Hs.70669HMP19 protein 2.8 75 426847S78723Hs.2986235-hydroxytryptamine 2.8 (serotonin) receptor 458809AW9725i2Hs.20985sin3-associated polypeptide,2.8 30kD

420071AB028985Hs.94806ATP-binding cassette, 2.8 sub-family A (ABCs 424572M19650Hs.1507412',3'-cyclic nucleotide2.8 3' phosphodieste 444670H58373Hs.332938hypothetical protein 2.8 411089AA456454Hs.183418cell division cycle 2.8 2-like 1 (PITSLRE
pr 416111AA033813Hs.79018chromatin assembly 2.8 factor 1, subunilA
( 440637AW900115Ns.7309Homo Sapiens clone 2.8 23741 mRNA sequence 408554AA836381Hs.315111-nuclear receptor co-repressor/HDAC32.8 comp 403056856624Hs.2186eukaryotic translation2.8 elongation factor 423449AI497900Hs.33067ESTs 2.8 424188AW954552Hs.142634zinc finger protein 2.8 429006AA443143Hs.50929hypothetical protein 2.8 434981AW182577Hs.293077ESTs 2.8 437435AA249439Hs.27027hypotheticalprotein 2.8 DKFZp762H1311 442748A1016713Hs.135787ESTs 2.8 443312N52025Hs.46616ESTs 2.8 450940A1744943Hs.143209ESTs, Weakly similar 2.8 to 138022 hypotheti 1 452738AL133800Hs.7086hypothetical protein 2.8 ~ MGC12435 409182AA064970Hs.118145ESTs 2.8 439793AA018825Hs.7934Kroppel-like factor 2.8 4 (gut) 432683AW995441Hs.10475ESTs 2.8 434269AK001991Hs.3781similar to marine leucine-rich2.8 repeat pr 15 429500X78565Hs.289114hexabrachion (tenascin2.8 C, cytotactin) 433290820077Hs.302185Homo Sapiens clone 2.8 23618 mRNA sequence 434276AF123659Hs.93605leucine zipper, putative2.8 tumor suppresso 435977AL138079Hs.5012brain-specific membrane-anchored2.8 protein 430294A1538226Hs.32976guanine nucleotide 2.8 binding protein 4 20 425168896366 gb:yq37d04.s1 Soaresfetalliverspleen2.8 428180AI129767Hs.182874guanine nucleotide 2.8 binding protein (G
pr 409348AI401535Hs.146090ESTs 2.8 409887AL137534Hs.56876Homo Sapiens mRNA; 2.8 cDNA DKFZp434H1419 (f 457211AW972565Hs.32399ESTs, Weakly similar 2.8 to S51797 vasodilat 430039BE253012Hs.153400ESTs, Weakly similar 2.8 to ALUt HUMAN ALU
S

417642BE302665Hs.105461hypotheticalprotein 2.8 419169AW851980Hs.262346ESTs, Weakly similar 2.8 to 572482 hypotheti 434008AA740878Hs.112982ESTs 2.8 446776AW293417Hs.156455ESTs 2.8 408838A1669535Hs.40369ESTs 2.8 422565BE259035Hs.118400singed (Drosophila)-like2.8 (sea urohin fas 447397BE247676Hs.18442E-tenzyme 2.8 412530AA766268Hs.266273hypothetical protein 2.8 424330AW073953Hs.333396Homo Sapiens cDNA FLJ135962.8 fis, clone PL

35 446377AW014022Hs.170953ESTs 2.8 458924BE242158Hs.24427DKFZP56601646 protein 2.8 447710AI420523Hs.328241ESTs 2.8 404049 2.8 416913AW934714 gb:RCi-DT0001-031299-011-all2.8 DT0001 Homo 40 426400M78361Hs.i69743Homo Sapiens clone 2.8 25121 neuronal olfact 413264W26456Hs.i34757hypothetical protein 2.8 458997AW937420Hs.69662ESTs 2.7 422864AA318323 gb:EST20390 Retina 2.7 II Homo Sapiens cDNA

430526AF181862Hs.242407G protein-coupled receptor,2.7 family C, gr 452023A8032999Hs.27566KIAA1173 protein 2.7 432022AL162042Hs.272348Homo sapiens mRNA; 2.7 cDNA DKFZp761 L1212 (f 452438BE514230Hs.29595JM4 protein 2.7 435408H07897Hs.4302ESTs, Weakly similar 2.7 to T29299 hypotheG

418791AA935633Hs.194628ESTs 2.7 438821AA826425Hs.291829ESTs 2.7 423464NM Hs.128856CSR1 protein 2.7 442091AW770493Hs.182874guanine nucleotide 2.7 binding protein (G
pr 442242AV647908Hs.90424Homo Sapiens cDNA: 2.7 FLJ23285 fis, clone H

412436AA665089 gb:nu76d01.s1 NCI CGAP_AIv12.7 Homosapiens 432821BE170702Hs.279005solute carrier family 2.7 5 21 (organic anion 416404AA180138Hs.107924ESTs 2.7 441364AW450466Hs.126830ESTs, Weakly similar 2.7 to YD38 YEAST HYPOT

450202AW969756Hs.34145ESTs, Weakly similar 2.7 ' to 849647 GTP-bindi 428304AA374532Hs.124673Homo Sapiens cDNA FLJ 2.7 11477 fis, clone HE

60 428722U76456Hs.190787tissue inhibitor of 2.7 metalloproteinase 449701AW952323Hs.129908KIAA0591 protein 2.7 420372AW960049Hs.293660Homo Sapiens, clone 2.7 IMAGE:3535476, mRNA, 410318AA084050Hs.269259ESTs, Weakly similar 2.7 to S23650 retroviro 414603858394Hs.25119ESTs, Weakly similar 2.7 to YEXO_YEAST HYPOT

65 416096H18577Hs.88974cytochrome 1r245, beta2.7 polypeptide (chro 420896AW149342Hs.24444Homo Sapiens cDNA: 2.7 FLJ22165 tis, clone H

424856AA347746Hs.9521ESTs, Weakly similar 2.7 to ZN43_HUMAN ZINC

436304AA339622Hs.108887ESTs 2.7 441027A1911412Hs.126444ESTs 2.7 7~ 452545N31940Hs.14434ESTs, Weakly similar 2.7 to 138022 hypotheG

454201A8023191Hs.44131KIAA0974 protein 2.7 448560BE613183Hs.23213ESTs 2.7 426807AA385315Hs.156682ESTs 2.7 425825A1929508Hs.159590lymphocyte antigen 2.7 6 complex, locus H

75 440351AF030933Hs.7179RAD1 (S. pombe) homolog2.7 425390A1092634Hs.156114protein tyrosine phosphatase,non-recept2.7 427624AA406245Hs.24895ESTs 2.7 426413AA377823 gb:EST90805 Synovial 2.7 sarcoma Homo sapien 422491AA338548Hs.117546neuronatin 2.7 424560AA158727Hs.150555protein predicted by 2.7 clone 23733 432415T16971Hs.289014ESTs, Weakly similar 2.7 to A43932 mucin 2 p 414865AA157155Hs.274414hypotheticalprotein 2.7 415827H17462Hs.23079ESTs 2.7 445568H00918Hs.2687d4KIAA1796 protein 2.7 433315896754Hs.239706GRB2-associated binding 2.7 protein 1 428862NM Hs.2316SRY (sex determining 2.7 000346 region Y)-box 9 (ca 447959AI452784Hs.270270ESTs, Weakly similar 2.7 to 2109260A B cell 426420BE383808Hs.322430NDRG family, member 4 2.7 436899AA764852Hs.291567ESTs 2.7 444100AA383343Hs.22116CDC14 (cell division 2.7 cycle 14, S. cerevi 426501AW043782Hs.293616ESTs 2.7 449092091641Hs.22985alpha2,8-sialyltransferase2.7 1 427311AB020672Hs.175411KIAA0865 protein 2.7 ~

453313BE005771Hs.153746hypothetical protein 2.7 404029 2.7 416289W26333Hs.337438ESTs 2.7 439108AW163034Hs.6467synaptogyrin 3 2.6 ' I 418746AI955289Hs.300759ribosomal protein L36 2.6 S

412046Y07847Hs.73088RAS-related on chromsome2.6 435040AI932350Hs.152825ESTs 2.6 453083087223Hs.31622contactin associated 2.6 protein 1 428167AA770021Hs.16332ESTs 2.6 20 420028A8014680Hs.8786carbohydrate (N-acetylglucosamine-6-0)2.6 s 443715AI583187Hs.9700cyclin E1 2.6 421247BE391727Hs.102910generalUanscdpGonfactorIIH,polype2.6 424687J05070Hs.15173Bmatrix metalloproteinase2.6 9 (gelatinase B

415056AB004662Hs.77867adenosine A1 receptor 2.6 25 451697AW449774Hs.296380POM (POM121 rat homology2.6 and ZP3 fusion 433701AW445023Hs.15155ESTs 2.6 457358AI479755Hs.129010ESTs 2.6 430347Ntv>_002039Hs.239706GRB2-associated binding 2.6 protein 1 418027AB037807Hs.83293hypotheticalprotein 2.6 440491835252Hs.24944ESTs, Weakly similar 2.6 to 2109260A B cell 425171AW732240Hs.16365ESTs 26 459335AW298545Hs.250726EST 2.6 425402A1215881Hs.24970ESTs, Weakly similar 2.6 to 834323 GTP-bindi 453169A8037815Hs.32156KIAA1394 protein 2.6 35 433647AA603367Hs.222294ESTs 2.6 450414AI907735Hs.21446KIAAi716 protein 2.6 446233A1282028Hs.25205ESTs 2.6 415446F08898Hs.66075ESTs 2.6 445873AA250970Hs.251946poly(A)-binding protein,2.6 cytoplasmic 1-I

413012D83777Hs.75137KIAA0193 gene product 2.6 428671BE297851Hs.189482zinc finger protein 179 2.6 427158AA935603Hs.i66231ESTs 2.6 408988AL119844Hs.49476Homo Sapiens clone TUAB 2.6 Cri-du-chat regi 459516A1049662Hs.246858EST 2.6 45 402693 2.6 408039AA131424Hs.50340ESTs 2.6 422896AW961489Hs.154116ESTs 2.6 423130AW897586Hs.21213ESTs 2.6 438796W67821Hs.109590genethonin 1 2.6 50 439871888518Hs.46736hypothetical protein 2.6 440192AA872282Hs.190596ESTs 2.6 419708AK000753Hs.92374hypothetical protein 2.6 449436AA860329Hs.279307hypothetical protein 2.6 DKFZp43412117 436870AW204219Hs.155560calnexin 2.6 55 448424AW009892Hs.31924ESTs 2.6 401324 2.6 414136AP,812434Hs.119023SMC2 (structural maintenance2.6 of chromoso 433943AA992805Hs.44865lymphoid enhancer-binding2.6 factor 1 428001H97428Hs.219907ESTs, Moderately similar2.6 Lo Transforming 429139F09092Hs.66087ESTs 2.6 423073BE252922Hs.1231MAD (mothers against 2.6 t decapentaplegic, Dr 448966AW372914Hs.86149phosphoinosilol 3-phosphate-binding2.6 prot 444001A1095087Hs.152299ESTs, Moderately similar2.6 to S65657 alpha 412049N53437Hs.18268adenylate kinase 5 2.6 65 441783BE313412Hs.7961Homo Sapiens clone 250122.6 mRNA sequence 425287888249Hs.155524peanut (Drosophila)-like2.6 432149AW614326Hs.i ESTs, Weakly similar 2.6 57022to T34549 probable 452234AW084176Hs.223296ESTs, Weakly similar 2.6 to 138022 hypotheti 453478AF083898Hs.33021neuro-ontological ventral2.6 antigen 2 7~ 418962AA714835Hs.271863ESTs 2.6 418858AW961605Hs.21145hypothetical protein 2.6 RG083M05.2 443257AI334040Hs.11614HSPC065 protein 2.6 428748AW593206Hs.98785Ksp37 protein 2.6 444984H15474Hs.132898fatty acid desaturase 2.6 75 433404T32982Hs.102720ESTs ~ 2.6 434779AF153815Hs.50151potassium inwardly-rectifying2.6 channel, s 420582BE047878Hs.99093Homo Sapiens chromosome 2.6 19, cosmid 82837 452856AF034799Hs.30881protein tyrosine phosphatase,2.6 receptor t 436440AI471862Hs.196008Homo Sapiens cDNA FLJ117232.6 fis, clone HE

438527AI969251Hs.115325RAB7, member RAS oncogene2.6 family-like 1 433216AF217412Hs.47320neuroligin 3 2.6 435380AA679001Hs.i92221ESTs 2.6 428966AF059214Hs.194687cholestero125-hydroxylase2.6 439653AW021103Hs.6631hypothetical protein 2.6 419304AI271326Hs.146101ESTs, Weakly similar 2.6 to T45070 protein k 422991H10940Hs.48965Homo Sapiens cDNA: 2.6 FLJ21693 fis, clone C

448548813209Hs.21413salute carrier family 2.6 12, (potassium-chl 435370AI964074Hs.225838ESTs 2.6 408875NM Hs.48604DKFZP434B168 protein 2.5 457005AJ007421Hs.i72597sat (Drosophila)-like 2.5 430154AW583058Hs.234726serine (orcysteine) 2.5 proteinase inhibito 438549BE386801Hs.21858trinucieofide repeat 2.5 containing 3 1 427951AI826125Hs.43546ESTs 2.5 ~

411800N39342Hs.103042microtubule-associated2.5 protein 1B

457683AI821877Hs.140002ESTs, Moderately similar2.5 to ALU7 HUMAN A

451422AB002336Hs.26395erythrocyte membrane 2.5 protein band 4.1-li 430713AA351647Hs.2642eukaryotic franslation2.5 elongafion factor 1 428826AL048842Hs.194019attracfin 2.5 428963AW382682Hs.258208Homo Sapiens, clone 2.5 MGC:15606, mRNA, com 428141D50402Hs.182611solute carrier family 2.5 11 (proton-coupled 429550AW293055Hs.119357ESTs 2.5 438662AA223599Hs.6351cleavage and polyadenylafion2.5 specific fa 20 435760AF231922Hs.213004chromosome 21 open 2.5 reading frame 62 427513AI476318Hs.192480ESTs 2.5 430061AB037817Hs.230188KIAA1396 protein 2.5 435923BE301930Hs.5010Homo Sapiens clone 2.5 24672 mRNA sequence 417123BE326521Hs.159450ESTs 2.5 25 439699AF086534Hs.187561ESTs, Moderately similar2.5 to ALU1 HUMAN A

412980AI815750Hs.20977hypothetical protein 2.5 MGC3129 similar to 427209H06509Hs.92423KIAA1566 protein 2.5 424327AA431707Hs.31209ESTs 2.5 436340842246Hs.21606ESTs 2.5 450650T65617Hs.101257hypothefical protein 2.5 439444AI277652Hs.54578ESTs, Weakly similar 2.5 to 138022 hypotheti 400777 2.5 439478AF049460Hs.6574deformed epidermal 2.5 autoregulatory factor 450407NM Hs.24969gamma-aminobutyric 2.5 000810 acid (GAGA) A recepto 35 450385AI631024Hs.2494Bsynuclein, alpha inleracGng2.5 protein (sy 432558897268Hs.177269ESTs 2.5 400860 2.5 410361BE391804Hs.62661guanylate binding protein2.5 1, interferon-416063BE047699Hs.93454ESTs 2.5 40 414998NM Hs.77729oxidised low density 2.5 002543 lipoprotein (lectin 452823AB012124Hs.30696transcription factor-like2.5 5 (basic helix 417791AW965339Hs.111471ESTs 2.5 418079840058Hs.6911ESTs 2.5 408495W68796Hs.237731ESTs 2.5 45 442104L20971Hs.188phosphodiesterase 4B, 2.5 cAMP-specific (dun 437370AL359567Hs.161962Homo Sapiens mRNA; 2.5 cDNA DKFZp547D023 (fr 429803W81489Hs.223025RAB31, member RAS oncogene2.5 family 424959NM Hs.153937activated p21cdc42Hs 2.5 005781 kinase 427413BE547647Hs.177781hypothetical protein 2.5 408955BE315170Hs.8087NAG-5 protein 2.5 415261T40928Hs.8346ESTs 2.5 415716N59294Hs.179662nucleosome assembly 2.5 protein 1-like 1 417873BE266659Hs.293659Homo Sapiens, Similar 2.5 to RIKEN cDNA A430 418388872332Hs.29258Homo Sapiens cDNA FLJ113642.5 fis, clone HE

55 421002AF116030Hs.100932transcription factor 2.5 423244AL039379Hs.209602ESTs, Weakly similar 2.5 to ubiquitous TPR
m 423553AA405635Hs.96854ESTs, Weakly similar 2.5 to DYLX_HUMAN CYTOP

427961AW293165Hs.143134ESTs 2.5 428301AW628666Hs.98440ESTs, Weakly similar 2.5 to 138022 hypoihe6 0 428508BE252383Hs.184668SB8131 protein 2.5 428858AA436760 gb:zv67d11.r1 5oares 2.5 total-fetus Nb2HF8-428943AW086180Hs.37636ESTs, Weakly similar 2.5 to KIAA1392 protein 432427AL037630Hs.6638Homo Sapiens cDNA FLJ 2.5 11602 fis, clone HE

435347AW014873Hs.116963ESTs 2.5 65 437949U78519Hs.41654ESTs, Weakly similar 2.5 to A46010 X-linked 438208AL041224Hs.65379ESTs 2.5 440286U29589Hs.7138cholinergic receptor, 2.5 muscarinic 3 441523AW514263Hs.301771ESTs, Weakly similar 2.5 to ALUF HUMAN !!!!

441805AA285136Hs.301914neuronal specific franscription2.5 factor D

7~ 442337AI371029Hs.129257ESTs, Weakly similar 2.5 to TC17_HUMAN TRANS

442789AW904361Hs.131191ESTs, Weakly similar 2.5 to ALU7_HUMAN ALU
S

445556AI910241Hs.128B7actin-related protein 2.5 3-beta 449066AI628357Hs.208037ESTs 2.5 459583A1907673 gb:IL-BT152-080399-0042.5 BT152 Homo sapien ,75 TABLEB:

Pkey:Unique Eos probeset idenfifier number CAT
number:
Gene cluster number Accession: n numbers Genbank accessio o Pkey CAT
Number Accession 4122251284108_1AW902042N77591 416120 1571266_1 H46739 H51513 H19779 AAi 90449 AW513465 BE161006 BE162499 AI934069 AA570223 AA574389 AA582438 AI7453d6 AW964510 AA319642 1 ~ 425168 247552_1 896366 AL133929 AA351636 H78818 AA477084 228957 H80194 1 S 428858 296453_1 AA436760 AW237453 BE327d96 N47347 N56967 438458 457837_1 AW975186 AA807807 D29548 AW901807 AW90i798 TABLE BC:
Pkey: Unique number corresponding to an Eos probeset 35 Ref: Sequence source. The 7 digit numbers in this column are Genbank Identifier (GI) numbers. "Dunham, et al." refers to the publication entitled "The DNA
sequence of human chromosome 22" Dunham, et al. (1999) Nature 402:489-495.
Strand: Indicates DNA strand from which exons were predicted.
Nt-position: Indicates nucleotide positions of predicted exons.
Pkey Ref Strand Nt-position 400777 8131663 Plus 70745-71121 400780 8131663 Minus 118372-118619 400859 9757499 Minus 91888-92018,98131-96294,99474-99570 400860 9757499 Minus 151830-152104,152649-152744 45 400992 8096828 Plus 140390-140822 401324 9863791 Plus 234057-234174 402408 9796239 Minus 110326-110491 402604 9909420 Plus 20393-20767 402605 9909420 Minus 47680-47973 402693 8569863 Minus 82366-82515 402855 9662953 Minus 59763-59909 404029 7671252 Plus 108716-111112 404048 3688074 Minus 54421-56808 404049 3688074 Minus 75765-78155 5 404283 2276311 Minus 99460-99564 404299 5738652 Minus 3826-4025 404541 8318559 Plus 103456-103664 404584 9857511 Plus 138651-139153 404593 9944086 Minus 74922-75788 404721 9856648 Minus 173763-174294 404819 4678240 Plus 16223-16319,16427-16513,16736-16859,16941-17075,17170-17287,17389-17529,18261-18357,18443-18578 405238 7249119 Minus 51728-51836 405771 7018349 Plus 91191-91254,91510-91589 405819 4007557 Plus 2830-2967 65 406311 9211559 Minus 137114-139033 TABLE 9A:ABOUT 1202 GENES UP-REGULATED IN GLIOBLASTOMA COMPARED TO NORMAL
ADULT CENTRAL NERVOUS SYSTEM (CNS) Table 9A lists about 1202 genes up-regulated in glioblastoma compared to normal adult central nervous system (CNS). These were selected from 59680 probesets on the 7~ AffymetrixlEos Hu03 GeneChip array such that the ratio of"average"
glioblastoma to "average" normal adult CNS tissues was greater than or equal to 2Ø The "average"
glioblastoma level was set to the 75th percentile amongst various glioblastoma tumors. The "average" normal adult CNS tissue level was set to the 95th percentile amongst various non-malignant tissues. In order to remove gene-specific background levels of non-specific hybridization, the 10th percentile value amongst various non-malignant tissues was subtracted from both the numerator and the denominator before the ratio was evaluated.
Pkey: Unique Eos prabeset identifier number 75 ExAccn: Exemplar Accession number, Genbank accession number UnigenelD: Unigene number Unigene Title: Unigene gene title R1: Ratio of 75th percentile tumor to 95th percentile normal adult nervous system tissue Pkey ExAccn UnigenelD UnigeneTitle Rt 452461 N78223 Hs.108106 transcription factor 20.1 436895 AF037335 Hs.5338 carbonic anhydrase XII 15.2 453941 U39817 Hs.36820 ~ Bloom syndrome 14.2 443247BE614387Hs.333893c-MyctargetJP01 12.4 428330L22524Hs.2256matrix metalloproteinase12.0 7 (matrilysin, 447342AI199268Hs.19322Homo Sapiens, Similar 11.7 to RIKEN cDNA 2010 422163AF027208Hs.112360prominin (mouse)-like 11.4 439451AF086270Hs.278554heterochromatin-like 11.2 protein 1 424800AL035588Hs.153203MyoD family inhibitor 10.2 416111AA033813Hs.79018chromatin assembly 10.0 factor 1, subunit A ( 444190AI878918Hs.10526cysteine and glycine-rich9.9 protein 2 412140AA219691Hs.73625RAB6 interacting, kinesin-like9.9 (rabkines 1 449340AW235786Hs.195359hypothetical protein 9.8 ~ MGC10954 409731AA125985Hs.56145thymosin, beta, identified9.4 in neuroblast 439978BE139460Hs.124673Homo Sapiens cDNA FLJ114778.9 fis, clone HE

411411AA345241Hs.55950ESTs, Weakly similar 8.9 to KIAA1330 protein 456516BE172704Hs.222746KIAA1610 protein 8.2 1 420092AA814043Hs.88045ESTs 7.9 422631BE218919Hs.118793hypothetical protein 7.9 453392U23752Hs.32964SRY (sex determining 7.9 region Y)-box 11 438527AI969251Hs.115325RAB7, member RAS oncogene7.9 family-like 1 427581NM Hs.179703KIAA0129 gene product 7.8 418661NM Hs.1189E2F transcripfion factor7.8 440684Ai253123Hs.127356ESTs, Highly similar 7.8 to S21424 nesfin [H

429643AA455889Hs.167279FYVE-finger-containing7.7 RabS effector pro 409638AW450420Hs.21335ESTs 7.5 444665BE613126Hs.47783B aggressive lymphoma 7.5 gene 25 456759BE259150Hs.127792delta (Drosophila)-like7.5 412777AI335773Hs.270123ESTs 7.4 436607AW661783Hs.211061ESTs 7.3 432058AW665996Hs.130729ESTs, Weakly similar 7.3 to ALU1 HUMAN ALU
S

417061AI675944Hs.188691Homo Sapiens cDNA FLJ120337.3 fis, clone HE

3 428976AL037824Hs.194695ras homolog gene family,7.2 0 member I

433244A8040943Hs.271285KIAA1510 protein 7.1 436726AA324975Hs.128993ESTs, Weakly similar 7.1 to T00079 hypotheti 408432AW195262 gb:xn67b05.x1 NCI CGAP-CMLt7.1 Homo Sapiens 434164AW207019Hs.148135sedne/threonine kinase7.0 35 445673AA250970Hs.251946poly(A)-binding protein,7.0 cyloplasmic 1-I

439726AW449893Hs.293707ESTs, Weakly similar 7.0 to 138598 zinc fang 432656NM Hs.3076MHC class II transacfivator6.8 431117AF003522Hs.250500delta (Drosophila)-like6.8 453387AI990741Hs.252809ESTs 6.8 418821AA436002Hs.183161ESTs 6.6 437034AA742643 gb:ny91c01.s1 NCI-CGAP-GCB16.6 Homosapiens 411252AB018549Hs.69328MD-2 protein 6.5 424687J05070Hs.151738matrix metalloproteinase6.4 9 (gelatinase 8 452953AI932884Hs.271741ESTs, Weakly similar 6.3 to A46010 X-linked 45 433532AW975367 gb:EST387475 MAGE resequences,6.3 MAGN Homo 420311AW445044Hs.38207Human DNA sequence 6.3 from clone RP4-530115 418097845137Hs.21868ESTs 6.2 407304AA565832 gb:nj32b03.s1 NCI CGAP_AA16.2 Homo Sapiens 435256AF193766Hs.13872cylokine-like protein 6.1 449446D60730Hs.57471ESTs 6.1 403790 6.0 425517AF121179 gb:AF121179 Homo Sapiens6.0 liver (Chang L-420674NM Hs.1327butyrylcholinesterase 6.0 435542AA687376Hs.269533ESTs 5.9 55 418216AA662240Hs.283099AF15q14 protein 5.8 439086AF085947 gb:Homo sapiens full 5.8 length insert cDNA

408037AW271720Hs.42233hypothefical protein 5.7 412225AW902042 gb:OVO-NN1022-170400-193-c025.7 NN1022 Homo 436109AA922153Hs.132760hypothetical protein 5.7 435005U80743Hs.306094tdnucleotide repeat 5.7 containing 12 429149AW193360Hs.197962ESTs, Weakly similar 5.7 to 136022 hypothe6 418113AI272141Hs.83484SRY (sex determining 5.6 region Y)-box 4 405558 5.6 442432BE093589Hs.38178hypoiheficalprotein 5.6 65 442547AA306997Hs.217484ESTs, Weakly similar 5.6 to ALU1 HUMAN ALU
S

413063AL035737Hs.75184chitinase &like 1 (cartilage5.5 glycoprote 420560AW207748Hs.59115ESTs 5.5 408096BE250162Hs.83765dihydrofolatereduclase5.5 443539A1076182Hs.134074ESTs, Moderately similar5.4 to ALU6 HUMAN A

7~ 426318AA375125Hs.147112Homo Sapiens cDNA: 5.4 FLJ22322 fis, clone H

429115AA446728Hs.289020Homo Sapiens cDNA FLJ140985.3 fis, clone MA

453900AW003582Hs.226414ESTs, Weakly similar 5.3 to ALUB HUMAN ALU
S

444168AW379879 gb:RC1-HT025&081199-011-f015.3 HT0256 Homo 432789D26361Hs.3104KIAA0042 gene product 5.3 75 437036A1571514Hs.133022ESTs 5.2 421247BE391727Hs.102910general transcription 5.2 factor IIH, polyps 441523AW514263Hs.301771ESTs, Weakly similar 5.2 to ALUF-HUMAN !!!!

451106BE382701Hs.25960v-myc avian myelocytomatosis5.1 viral relat 457211AW972565Hs.32399ESTs, Weakly similar 5.1 to S51797 vasodilat 454157AW162906Hs.312481ESTs, Weakly similar 5.1 to S66668 hydrogen 423343AA324643Hs.246106ESTs 5.1 425292NIvL005824Hs.15554537 kDa leucine-rich 5.1 repeat (L88) protein 406679AA070786 gb:zm66b07.ri Siratagene5.1 neuroepithelium 442671A1005668Hs.134779EST 5.1 433001AF217513Hs.279905clone H00310 PR00310p15.0 418819AA228776Hs.191721ESTs 5.0 432946060899Hs.279854mannosidase alpha, 4 class 2B, member 9 420730NM Hs.99890polymerase (DNA directed),.
002691 delta 1, cata 4.9 441217AI922183Hs.2132d6ESTs 4,g 453385AW296101Hs.252806ESTs 4,8 418203X54942Hs.83758CDC28 protein kinase 4.7 450813AI739625Hs.203376ESTs 4 1 444006BE395085Hs.10086type I transmembrane , ~ protein Fnl4 4.7 412530AA766268Hs.266273hypotheGcalprotein 4.7 431070AW40816dHs.249184iranscdp6on factor 4.7 19 (8C1) 429786AL080232Hs.220696Homo sapiens mRNA; 4.7 cDNA DKFZp586A061 (fr 1 457065AI476318Hs.192480ESTs .
4.6 436190AK001059 gb:Homo Sapiens cDNA 4.6 FLJ10197 fis, clone 400859 4.6 435267N23797Hs.110114ESTs 4.6 443454A1057494Hs.133421ESTs 4 452811AA937079Hs.118983hypotheticalprotein .
FLJ12150 4.5 437267AW5114d3Hs.256110ESTs 4.5 435020AW505076Hs.301855DiGeorge syndrome 4.5 critical region gene 454269AI961060Hs.129908KIAA0591 protein 4.5 422106D84239Hs.111732Fc fragment of IgG 4 binding protein 5 25 422765AW409701Hs.1578baculoviral IAP repeat-containing.
5 (sur 4.5 456534X91195Hs.100623phospholipase C,beta 4.5 3,neighborpseudo 423756AA828125 gb:od71a09.s1 NCI_CGAP_Ov24.5 Homo Sapiens 417308H60720Hs.81892KIAA0101 gene product4.5 422170A1791949Hs.112432anti-Mullerian hormone4 429500X78565Hs.289114hexabrachion(tenascin.
C,cytotactin) 4.4 406568AF088886Hs.11590cathepsin F 4,4 426812AF105365Hs.172613solute camer family 4.4 12 (potassiumichlo 4.4 432865AI753709Hs.152484ESTs, Weakly similar 4.4 to 138022 hypotheti 35 413625AW451103Hs.71371ESTs 4.4 436098820597Hs.9739glycerol-3-phosphate 4.4 dehydrogenase 1 (so 418333W92113 gb:zh48e01.r1 Soares 4.4 fetal liver_spleen 416933BE561850Hs.80506small nuclear dbonucleoprotein4.d polypept 438192AI859065Hs.337620Homo Sapiens AFG3L1 4 isoform 1 mRNA 3 part 4~ 457374AA493662 , .
gb:nhO5d12.s1 NCI_CGAP4.3 Thy1 Homo Sapiens 433159AB035898Hs.150587kinesin-like protein 4.3 444386BE065183 gb:RC1-BT0314-020200-012-c044.3 BT0314 Homo 453202AW065781Hs.26270hypothetical protein 4.3 441020W79283Hs.35962ESTs 3 45 414733BE514535Hs.77171minichromosome maintenance.
deficient (S. 4.3 407902ALi Hs.41181Homo Sapiens mRNA; d.3 17474 cDNA DKFZp727C191 (fr 4.3 451659BE37976iHs.i4248ESTs 4.3 418845AA852985Hs.89232chromobox homolog 4 5 (Drosophila HP1 2 alph 433323AA805132Hs.30701ESTs .
d,2 439811AA135332Hs.71608ESTs 4,2 415406T26510 gb:AB282F8R Infant 4.2 brain, LLNL array of 436282891913Hs.272104ESTs, Moderately similar4.1 to ALU1_HUMAN A

441269AW015206Hs.178784ESTs 1 55 418727AA227609Hs.94834ESTs .
4.1 433006BE242758Hs.190223ESTs, Moderately similar4.1 to T29285 hypot 436480AJ271643Hs.87469putative acid-sensing4.i ion channel 430786AAd86144Hs.31293ESTs 4.1 445372N36417Hs.144928ESTs 4 6Q 410555092649Hs.6431a disintegdn and metalloproteinase.
1 doma 4.0 457465AW301344Hs.122908DNA replication factor4.0 422094AF129535Hs.272027F-box only protein 4.0 442029AW956698Hs.14456neuralprecursorcellexpressed,develop4.0 459321AW044477Hs.299538ESTs 4 65 421308AA687322Hs.192843leucine zipper protein.
FKSG14 4.0 420567AK000812Hs.98874similar to proline-rich4.0 protein 48 447004AW296968Hs.157539ESTs 4.0 448295AI381911Hs.334859KIAA1814 protein 3.g 439699AF086534Hs.187561ESTs, Moderately similar3 to ALU1 HUMAN A 9 440704M69241Hs.162insulin-like growth .
factor binding prote 3.9 453096AW294631Hs.11325ESTs 3,g 457026AA397620Hs.48692ESTs 3,g 3.9 450375AA009647Hs.8850a disintegrin and 3.9 75 metalloproteinase doma 430132AA204686Hs.234149hypothetical protein 3.9 437718AI927288Hs.196779ESTs 3,g 438490AW593272Hs.301299ESTs 3,g 429919AA460692Hs.2789d5hypotheticalprotein 3.g 413604851767 gb:yg73g11.r1 Soares 3.9 infant brain 1NIB
H

425599AW366745Hs.214140ESTs, Weakly similar 3.9 to ALUt HUMAN ALU
S

448796AA147829Hs.301431endothelial zinc finger3,9 protein induced 449300AI656959Hs.222165ESTs 3.8 452203X57522Hs.158164transporter 1, ATP-binding3.8 cassette, sub 425769072513Hs.159486Human RPL13-2 pseudogene3.8 mRNA, complete 404295 3.8 410361BE391804Hs.62661guanylate binding protein3.8 1, interferon-428728NM Hs.191381hypothetical protein 3.8 409142AL136877Hs.50758SMC4 (structural maintenance3.8 of chromoso 430172AA468591Hs.161889ESTs 3.8 447499AW262580Hs.147674protocadherin beta 3.8 3.8 437236AW137817Hs.244353ESTs 3.7 418883BE387036Hs.1211acid phosphatase 5, 3.7 tarfrate resistant 444143AW747996Hs.160999ESTs, Moderately similar3.7 to A56194 throm 425529NM Hs.158282KIAA0040 gene product 3.7 425502898895Hs.125823ESTs 3.7 419741007019Hs.93002ubiquilin carrier protein3.7 NN~ E2-C

402424. 3.7 429469M64590Hs.27 glycine dehydrogenase(decarboxylating;3.7 434072H70854Hs.283059Homo Sapiens PR01082 3.7 mRNA, complete cds 414872082010Hs.77513COX10 (yeast) homolog,3.7 cytochrome c oxid 426071AW138057Hs.163835ESTs 3.7 419078M93119Hs.89584insulinoma-associated 3.7 428037N47474Hs.89230potassium intermediatelsmall3.7 conductance 416547H62914Hs.268946ESTs, Weakly similar 3.7 to PC4259 femitin 436899AA764852Hs.291567ESTs 3.6 436722AW975977 gb:EST388086 MACE rosequences,3.6 MAGN Homo 440652AI216751Hs.143977ESTs 3.6 428450NM Hs.184339KIAA0175 gene product 3.6 452103842764Hs.339654ESTs, Weakly similar 3.6 to 138022 hypotheti 409048H59990Hs.37699ESTs 3.6 439546AF088056 gb:Homo Sapiens full 3.6 length insert cDNA

443544A1076315Hs.16359ESTs 3.6 418478038945Hs.1174cyclin-dependent kinase3.6 inhibitor 2A (me 435889AI249107Hs.269901ESTs 3.6 420301AA767526Hs.22030paired box gene 5 (B-cell3.6 lineage specif 438078A1016377Hs.131693ESTs 3.6 3 408420NM Hs.44766retinitis pigmentosa 3.6 S 006915 2 (X-linked recessi 416871H98716 gb:yx13d08.s1 Soares 3.5 melanocyte 2NbHM Ho 424085002914Hs.139226replication factor 3.5 Ntu> C (activator 1) 2 (40 446291_. Hs.i4623interferon, gamma-inducible3.5 8E397753 protein 30 432281AK001239Hs.274263hypotheticalprotein 3.5 436123AA057484Hs.35406ESTs, Highly similar 3.5 to unnamed protein 411256AW834039 gb:OVO-TT0010-091199-053-e093.5 TT0010 Homo 419239AA468183Hs.184598Homo Sapiens cDNA: 3.5 FLJ23241 fis, clone C

435065BE064391 gb:RC4-8T0310-110300-015-b083.5 BT0310 Homo 435532AW291488Hs.117305Homo Sapiens, clone 3.5 IMAGE:3682908, mRNA

45 447101N72185Hs.44189ESTs 3.5 410530M25809Hs.64173ATPase, H+transporfing,3.5 lysosomal (vacu 422156N34524 gb:yy56d10.s1 Soares_multiple3.5 sclerosis_ 453616003462Hs.33846dynein, axonemal, light3.5 NM intermediate pot 439743_ Hs.283858Homo Sapiens mRNA full3.5 AL389956 length insert cDN

453884AA355925Hs.36232KIAA0186 gene product 3.5 424954NM Hs.1846tumor protein p53 (Li-Fraumeni3.5 000546 syndrome) 420721AA927802Hs.159471ZAP3 protein 3.5 426764AA732524Hs.15146dESTs, Weakly similar 3.4 to ALUC HUMAN !Ill 420649AI866964Hs.124704ESTs, Moderately similar3.4 to S65657 alpha 5 448831AL080123Hs.22182zinc finger protein 3.4 5 23 (KOX 16) 444371BE540274Hs.239forkhead box M1 3.4 402604 3.4 442407AW469584Hs.32353mitogen-activated protein3.4 kinase kinase 41 AI304870Hs.188680 3.4 4300 ESTs , H58373Hs.332938 3.4 444670 hypothetical protein 414550BE379808 gb:601159567T1 NIH_MGC-533.4 Homo Sapiens c 452211AI985513Hs.233420 3.4 ESTs 414416AW409985Hs.76084hypothetical protein 3.4 449961AW265634Hs.133100 3.4 ESTs 65 413257BE075035 gb:PM3-BT0584-260300-002-g053.4 BT0584 Homo 453857AL080235Hs.35861DKFZP586E1621 protein 3.4 417404NM plecksUin homology-like3.4 007350 domain, iamily Hs.82101 422846BE513934Hs.1583neutrophil cytosolic 3.4 factor 1 (47kD, chr 446189H85224Hs.21d013 3.4 ESTs 70 437385AA757055Hs.164060 3.4 ESTs 453652AW009640Hs.28368ESTs, Moderately similar3.4 to S65657 alpha 408298AI745325Hs.271923 3.4 Homo Sapiens cDNA:

tis, clone K

455778BE088746 gb:CM2-BT0693-210300.123-d093.3 BT0693 Homo 417546H65569Hs.18845ESTs 3.3 75 412471M63193Hs.73946endothelial cell growth3.3 factor 1 (platel 454631AW811324 gb:IL3-ST0141-131099-017-A023.3 ST0141 Homo 454294AB000734Hs.50640 3.3 JAK
binding protein 457131AC002310Hs.301463 3.3 Human Chromosome BAC
clone 410102AW248508 3.3 Hs.279727 Homo Sapiens cDNA

fis, clone HE

0 449676AW380579 3.3 Hs.209657 ESTs 436211AK001581Hs.334828 3.3 hypotheticalprotein FLJ10719;

453746 gb:DKFZp761H119-rt 3.3 AL120611 761 (synonym:hamy2) 452799 Hs.213786 3.3 A1948829 ESTs 435380AA679001Hs.192221ESTs 3.3 426746J03626Hs.2057uddine monophosphate 3.3 synthetase(orotat 453362H14988Hs.107375ESTs 3.3 456473A1202788Hs.25682Homo Sapiens mRNA for 3.3 KIAA1863 protein, 416426AA180256Hs.210473Homo Sapiens cDNA FLJ148723.3 tis, clone PL

445777AI580371Hs.145384ESTs 3.3 423757AL049337Hs.132571Homo Sapiens mRNA; 3.3 cDNA DKFZp564P016 (fr 431941AK000106Hs.272227Homo Sapiens cDNA FLJ200993.3 tis, clone CO

404299 3.3 1 404108 3.3 ~

425189H16622 gb:ym26c07.r1 Soares 3.3 infant brain iNIB
N

449318AW236021Hs.78531Homo Sapiens, Similar 3.3 to RIKEN cDNA 5730 d50193AI916071Hs.15607Homo Sapiens Fanconi 3.2 anemia complementat 427725U66839Hs.180533mitogen-activated protein3.2 kinase kinase 15 424051AL110203Hs.138411Homo Sapiens mRNA; 3.2 cDNA DKFZp586J1922 (f 418968NM Hs.89538cholesteryl ester transfer3.2 000078 protein, plas 449248M33782Hs.23391Homo Sapiens, Similar 3.2 to transcription f 439416W58294Hs.56254ESTs 3.2 401596AA172106Hs.110950Rag C protein 3.2 408380AF123050Hs.44532diubiquitin 3.2 450325AI935962Hs.26289ESTs 3.2 428730AA625947Hs.25750ESTs 3.2 457536AA305233Hs.278712eukaryotic translation3.2 initiation factor 426836N41720Hs.172684vesicle-associated 3.2 membrane protein 8 (e 25 442710A1015631Hs.23210ESTs 3.2 435232NM-001262Hs.4854cyclin-dependent kinase3.2 inhibitor 2C (pi 430970A1018210Hs.144083ESTs 3.2 416192NM Hs.998peroxisome proliferative3.2 005036 activated recep 446676H09380Hs.3D0965ESTs 3.2 451459A1797515Hs.270560ESTs, Moderately similar3.2 to ALU7_HUMAN A

407603AW955705Hs.62604Homo Sapiens, clone 3.2 IMAGE:4299322, mRNA, 413840AI301558Hs.146381RNA binding motif protein,3.2 X chromosome 448751BE551203Hs.201792ESTs 3.2 432593AW301003Hs.51483ESTs, Weakly similar 3.2 to hypothetical pro 35 458786AI457098Hs.280848ESTs 3.2 455909BE156417Hs.278798ESTs 3.2 419311AA689591 gb:nv66a12.s1 NCI CGAP_GCB13.2 Homo Sapiens 439710AF086543 gb:Homo Sapiens full 3.2 length insert cDNA

434559AF147315 gb:Homo Sapiens full 3.1 length insert cDNA

40 455800822479Hs.167073Homo Sapiens cDNA FLJ130473.1 fis, clone NT

d36703AW880614Hs.146381RNA binding motif protein,3.1 X chromosome 414799AI752416Hs.77326insulin-like growth 3.1 factor binding prate 437860AA333063Hs.279898Homo Sapiens cDNA: 3.1 FLJ23165 fis, clone L

434182W20309Hs.118520G-protein gamma-12 3.1 subunit 45 417900BE250127Hs.82906CDC20 (cell division 3.1 cycle 20, S. cerevi 434769AA648884Hs.134278Homo Sapiens cDNA FLJ126763.1 tis, clone NT

414825X06370Hs.77432epidermal growth factor3.1 receptor (avian 426413AA377823 gb:EST90805 Synovial 3.1 sarcoma Homo sapien 447959AI452784Hs.270270ESTs, Weakly similar 3.1 to 2109260A B cell 404589 3.1 421764AI681535Hs.148135serine/threonine kinase3.1 419986AI345455Hs.78915GA-binding protein 3.1 Uanscription factor, 416941BE000150Hs.48778niban protein 3.1 414761AU077228Hs.77256enhancer of zeste (Drosophila)3.1 homolog 2 55 449611AI970394Hs.197075ESTs 3.1 434746AA648368Hs.295368ESTs 3.1 434274AAti28539Hs.116252ESTs, Moderately similar3.1 to ALUt HUMAN A

427899AA829286Hs.332053serum amyloid A1 3.1 417642BE302665Hs.105461hypothetical protein 3.1 452472AW957300Hs.294142ESTs, Weakly similar 3.1 to C55663 oligodend 446131NM Hs.290phospholipase A2, group3.1 440052AI633744Hs.195648ESTs, Weakly similar 3.1 to 138022 hypotheti 426531AA381071 gb:EST94100 Activated 3.1 T-cells XII Homo s 422158L10343Hs.112341protease inhibitor 3.1 3, skin-derived (SKAL

65 aos2s7 3.1 447039AV661798Hs.2829i5ESTs 3.1 404802 3.1 406927M26460 gb:Homo Sapiens (clone3.1 104) retinoblasto 419314AW971924Hs.87280ESTs 3.0 435894A1076667Hs.188011ESTs 3.0 432140AK000404Hs.272688hypothetical protein 3.0 443426AF098158Hs.9329chromosome 20 open 3.0 reading frame 1 425202AW962282Hs.152049ESTs, Weakly similar 3.0 to 138022 hypotheti 407047X65965 gb:H.sapiens SOD-2 3.0 gene for manganese su 75 418241M26682Hs.1149LIM domain only 1 (rhombotin3.0 1) 446599297832Hs.15476differentially expressed3.0 in FDCP (mouse 412950BE018581Hs.245342hypotheticalprotein 3.0 428670AA431682Hs.134832ESTs 3.0 446975BE246446Hs.i6695ubiquitin-activating 3.0 enzyme E1-like 437756AA767537Hs.197096ESTs 3.0 416084L16991Hs.79006deoxythymidylate kinase3.0 (thymidylate kin 402374AL135225Hs.301865dopachrome tautomerase3.0 (dopachrome delta 443885H91806Hs.15284ESTs 3.0 434008 Hs.112982 ESTs 3.0 452568AA805634Hs.300870 Homo Sapiens mRNA;3.0 cDNA DKFZp547M072 (fr 414239AI288330Hs.182330 ESTs 3.0 421013M62397Hs.1345 mutated in colorectal3.0 cancers 424635AA420687Hs.115455 Homo Sapiens cDNA 3.0 FLJ14259 fis, clone PL

410276AI554545Hs.68301 ESTs 3.0 433865N29862Hs.44104 ESTs 3.0 406028 3.0 401626 3.0 1 415949H10562Hs.21691 ESTs 3.0 ~

418583AA604379Hs.86211 hypothetical protein3.0 417933X02308Hs.82962 thymidylate synthetase3.0 434577837316Hs.179769 Homo Sapiens cDNA:3.0 FLJ22487 fis, clone H

430437AI768801Hs.169943 Homo Sapiens cDNA 3.0 FLJ13569 fis, clone PL

15 427940AA417812Hs.38775 ESTs 2~9 456060C14904Hs.45184 Homo Sapiens cDNA 2.9 FLJ12284 fis, clone MA

421988AW450481Hs.161333 ESTs 2.9 448775AB025237Hs.388 nudix (nucleoside 2.9 diphosphate linked mot 438598AI805943Hs.326067 hypotheficalprotein2~9 MGC5i78 429612AF062649Hs.252587 pituitary tumor-Uansforming2.9 451189AA016019Hs.d0905 ESTs 2~9 401558 2'9 426207BE390657Hs.30026 HSPC182 protein 2~9 404721 2'9 401384 2'9 417288AI984792Hs.108812 hypothetical protein2~9 427648AI376722Hs.180062 proteasome (prosome,2.9 macropain) subunit, 435928H64345Hs.183961 ESTs 2~9 431740N75450Hs.183412 ESTs, Moderately 2.9 similar to AF116721 67 428242H55709Hs.2250 leukemia inhibitory 2.9 factor (cholinergic 439972AI348100Hs.124662 ESTs 2~9 433112AA973801Hs.144553 ESTs, Weakly similar2.9 to unnamed protein 423751AW235633Hs.46525 ESTs 2~9 406748AW339106Hs.217493 annexin A2 2~9 3 422154T79045Hs.126927 ESTs 2.9 405588 2'9 440911AA909536Hs.143562 ESTs 2~9 412420AL035668Hs.73853 bone morphogenetic 2~9 protein 2 445043AW014413Hs.196066 ESTs 2~9 410114AW590540Hs.271280 ESTs 2.9 419217AA504571gb:aa60e12.r1 NCI_CGAP GCBs 2.9 Homo Sapiens 415849820529Hs.6806 ESTs 2~9 448140AF146761Hs.20450 BCM-like membrane 2.9 protein precursor 453331AI240665Hs.8895 ESTs 2~9 45 432065AA401039Hs.2903 protein phosphatase 2.9 4 (formerly X), cata 438380T06430Hs.6194 chondroitin sulfate 2.9 proteoglycan BEHABIb 454377AA076811gb:7B03C12 Chromosome 7 Fetal2.9 Brain cDNA

421491H99999Hs.42736 ESTs 2~9 452291AF015592Hs.28853 CDC7 (cell division2.8 cycle 7, S. cerevisi 415446F08898Hs.66075 ESTs 2.8 439518W76326gb:zd60d04.r1 Soares fetal_heart_NbHH19W2.8 427221L15409Hs.174007 von Hippel-Lindau 2.8 syndrome 422493AW474183Hs.250173 hypothetical protein2.8 419451AI907117Hs.90535 syntaxin binding 2.8 protein 2 55 448789BE539108Hs.22051 hypothetical protein2.8 424126AA335635Hs.96917 ESTs 2.8 458695AV660159Hs.282284 ESTs, Weakly similar2.8 to 138022 hypotheti 418973AA233056Hs.191518 ESTs 2.8 440471AA886146Hs.307944 ESTs 2.8 ()~421016AA504583Hs.101047 transcription factor2.8 3 (E2A immunoglobul 433647AA603367Hs.222294 ESTs 2.8 415817U88967Hs.78867 protein tyrosine 2.8 phosphatase, receptor-t 421723AA620400Hs.300717 sodium channel, 2.8 voltage-gated, type III, 434964AI638850Hs.130746 ESTs 2.8 432022AL162042Hs.272348 Homo Sapiens mRNA;2.8 cDNA DKFZp761L1212 (f 400517AF242388Hs.149585 lengsin 2.8 433023AW864793Hs.87409 thrombospondin 1 2.8 448734BE614070Hs.326416 Homo sapiens mRNA;2.8 cDNA DKFZp564H1916 (f 406736AI254733Hs.182426 ribosomal protein 2.8 409207AW373564Hs.194637 BANP homolog, SMAR12.8 homolog 440196N72847Hs.125221 ESTs 2.8 403961 2.8 425193AW965689Hs.22509 ESTs 2.8 425268A1807883Hs.180059 Homo Sapiens cDNA 2.8 FLJ20653 fis, clone KA

75 440483AI200836Hs.150386 ESTs 2.8 412391AW947710gb:RCO-MT0004-130300-011-e072.8 MT0004 Homo 448769N66037Hs.38173 ESTs 2.8 411632AW854829gb:OV2-CT0261-201099-011-f012.8 CT0261 Homo 438221AI798853Hs.122224 ESTs, Weakly similar2.8 to ALU5_HUMAN ALU S

457578AA578027gb:n120hOt.s1 NCI CGAP HSCi 2.8 Homo Sapiens 455510AA422029Hs.143640 ESTs, Weakly similar2.8 to hyperpclanzatio 447769AW873704Hs.320831 Homo Sapiens cDNA 2.8 FLJ14597 fis, clone NT

427701AA411101Hs.243886 nuclear autoantigenic2.8 sperm protein (his 433800A1034361Hs.135150lung type-I cell membrane-associated2.8 gly 439662H97552Hs.269060ESTs 2.8 425694U51333Hs.159237hexokinase 3 (white 2.8 cell) 414747U30872Hs.77204centromere protein 2.8 F (3501400kD, mitosin 414598A1094221Hs.135150lung type-t cell membrane-associated2.8 gly 447752M73700Hs.105938lactotransfertin 2.8 408761AA057264Hs.238936ESTs, Weakly similar 2.8 to (detline not ava 453350AI917771Hs.61790hypothetical protein 2~7 456629AW891965Hs.279789histone deacetylase 2~7 1 439538AA837323Hs.164047ESTs 2.7 ~

458814A1498957Hs.170861ESTs, Weakly similar 2.7 to 2195-HUMAN ZINC

456029BE255990Hs.218329hypothetical protein 2~7 451129BE072881 gb:RC2-BT0548-200300-012-e092.7 BT0548 Homo 456412AW749617Hs.280776tankyrase, TRF1-interacting2.7 ankyrin-vela 1 453536AA137000Hs.62578ESTs 2.7 S

438378AW974529Hs.86434hypothetical protein 2~7 425745U44060Hs.14427Homo Sapiens cDNA: 2.7 FLJ21800 fts, clone H

446322N23033Hs.15581dESTs 2.7 451592A1805416Hs.213897ESTs ~7 429466M85835Hs.12827ESTs 2.7 429747M87507Hs.2490caspase 1, apoptosis-related2.7 cysteine pr 455514AW983871 gb:RC1-HN0003-220300-021-h072.7 HN0003 Homo 414732AW410976Hs.77152minichromosome maintenance2.7 deficient (S.

444207AI565004Hs.79572cathepsin D (lysosomal2.7 aspartyl protease 427421AA402414Hs.3059coatomer protein complex,2.7 subunit beta 449655A1021987Hs.59970ESTs 2.7 422648D86983Hs.118893Melanoma associated 2.7 gene 428494AA233439Hs.184634hypothetical protein 2.7 406895X60648Hs.172550polypyrimidine tract 2.7 binding protein (he 453255AA278167Hs.19215Homo Sapiens, clone 2.7 IMAGE:3605822, mRNA

427348NM Hs.177258PR00650 protein 2.7 435370AI964074Hs.225838ESTs 2.7 407862BE548267Hs.50724Homo Sapiens cDNA 2.7 FLJ10934 fis, clone OV

411874AA096106Hs.20403ESTs 2.7 421192AA833718Hs.204529KtAA1806 protein 2~7 435899W89093Hs.189914ESTs 2.7 414603858394Hs.25119ESTs, Weakly similar 2.7 to YEXO-YEAST HYPOT

453462AL037291Hs.236605ESTs, Moderately similar2.7 to ALU4-HUMAN A

436554AI985810Hs.301173ESTs 2.7 427528AU077143Hs.179565minichromosome maintenance2.7 deficient (S.

403881 2.7 431779AW971178Hs.268571apolipoprotein GI 2.7 448275BE514434Hs.20830kinesin-like 2 2.7 45 446839BE091926Hs.16244mitotic spindle coiled-coif2.7 related prot 411927BE274009Hs.772glycogen synthase 2.7 1 (muscle) 404756 2.7 447072D61594Hs.17279iyrosylprotein sulfotransferase2.7 422176H80977 gb:yu89a11.s1 Soares 2.7 fetal liver spleen 439627BE621702Hs,29076hypothetical protein 2.7 436532AA721522 gb:nv54h12.r1 NCI 2.7 CGAP_Ew1 Homosapiens 412833AW960547Hs.298262ribosomal protein 2.7 457245AI745498Hs.204579ESTs 2.7 446861A1696519Hs.14427Homo Sapiens cDNA: 2.7 FLJ21800 fis, clone H

55 453263891778Hs.99369ESTs 2.7 459385BE380047 gb:601159362F2 NIH_MGC-532.7 Homo Sapiens c 438764AA824524Hs.336452ESTs 2.7 429285AI971081Hs.20432ESTs, Weakly similar 2.7 to 138022 hypotheli 424853BE549737Hs.132967Human EST clone 1228872.7 mariner transposo 60 430037BE409649Hs.227789mitogen-activated 2.7 protein kinase-activat 449892N73608Hs.50309ESTs 2.7 454201AB023191Hs.d4131KIAA0974 protein 2.7 452279AA286844Hs.61260hypothetical protein 2.7 427954J03060Hs.247551metaxin 1 2.7 65 400371U80740 2.7 452449AW068658Hs.209d3ESTs 2.7 431114AA492400Hs.291015ESTs 2,7 417088M54915Hs.81170pim-1 oncogene 2.7 447674BE270640Hs.19192cyctin-dependent kinase2.7 70 403680 2.7 454679AW813110 gb:CM4-ST0189-051099-021-fi052.7 ST0189 Homo 411968AI207410Hs.69280Homo Sapiens, clone 2.6 IMAGE:3636299, mRNA, 422240860594Hs.29002KIAA1706 protein 2.6 424368AB037766Hs.146085 2.6 protein 405808 2.6 419700AF084935Hs.92357galactokinase 1 2.6 435972W95088Hs.114198 2~6 ESTs 453568S70782Hs.557adrenergic, alpha-1D-,2.6 roceptor 443725AW245680Hs.9701growth arrest and 2.6 DNA-damage-inducible, 444156AW500059Hs.86437ESTs, Highly similar 2.6 to AF2191401 gastr 428209AA424197Hs.98947ESTs, Weakly similar 2.6 to S33496 trypsin [

437640AA76d893Hs.272155 2.6 ESTs, Weakly similar to hypothe6 453948AI970797Hs.64859ESTs 2.6 17$

415402AA164687Hs.177576mannosyl (alpha-1,3-)-glycoprotein2.6 beta-425397J04088Hs.156346topoisomerase (DNA) 26 II alpha (170kD) 418228AA962181Hs.111219ESTs,ModeratelysimilartoALU12.6 401324 2.6 425234AW152225Hs.165909ESTs, Weakly similar 2-6 to 138022 hypotheti 443210AI692649Hs.9451hypothetical protein 2.6 457244AA581385Hs.162473ESTs, Weakly similar 2.6 to 138022 hypolheti 417144AA382104Hs.8i337lectin, galactoside-binding,2.6 soluble, 9 433933AI754389Hs.133494Homo Sapiens clone 2.6 TCCCIA00164 mRNA sequ 1 437437AA226869Hs.16520hypothetical protein 2.6 ~ DKFZp762L0311 434206AW136973Hs.288516ESTs, Weakly similar 26 to S89890 mitogen t 400992 2.6 455530AW984744 gb:RC1-HN0015-040400-011-d032.6 HN0015 Homo 436139AA765786Hs.120936ESTs 2.6 1 448330AL036449Hs.207163ESTs 2.6 412942AL120344Hs.75074mitogen-activated protein2.6 kinase-activat 432753NM Hs.336938Homo Sapiens PR00593 2.6 014075 mRNA, complete cds 433430AI863735Hs.186755ESTs 2.6 -036693AW973223Hs.303197B-cell CLLIIymphoma 2.6 429482AF076974Hs.203952transformationltranscription2.6 domain-also 432715AA247152Hs.200483ESTs, Weakly similar 2.6 to KIAA1074 protein 414217AI309298Hs.279898Homo Sapiens cDNA: 2.6 FLJ23165 tis, clone L

434165AA971328Hs.95361myosin VIIA (Usher 2.6 syndrome 18 (autosoma 414835AA156720Hs.185342ESTs 2.6 25 424489T48851Hs.149250D-siglec precursor, 2.6 436496AA281959Hs.5210glia maturation factor,2.6 gamma 403797 2.6 434573AW372340Hs.159717ESTs 2.6 418841NM Hs.89137low density lipoprotein-related2.6 002332 protein 415785882419Hs.23603ESTs, Moderately similar2.6 to ALUB-HUMAN A

450608AA010365Hs.193229ESTs 2.6 425304AA463844Hs.31339tibroblast growth factor2.6 432268BE311856Hs.2742303'-phosphoadenosine 2.6 5'-phosphosulfate sy d10507AA355288Hs.40834transitional epithelia2.6 response protein 35 d27343Ai880044Hs.176977protein kinase C binding2.6 protein 2 420917AW135716Hs.117330ESTs 2.6 414399L47345Hs.155202transcription elongation2.6 factor B (SIII) 446089AI860021Hs.270651ESTs, Moderately similar2.6 to A47582 B-cel 440829AF136407Hs.7446chromosome 6 open reading2.6 frame 5 406475AA315514Hs.47986hypothetical protein 2.6 450946AA374569Hs.i ESTs, Moderately similar2.6 27698to 2109260A B c 421462AF016495Hs.104624aquaporin 9 2.6 434846AW295389Hs.119768ESTs 2.6 422887AI751848Hs.492i5ESTs 2.6 45 417435NM Hs.82129carbonic anhydrase 2.6 005181 III, muscle specific 437389AL359587Hs.271586hypothetical protein 2.5 DKFZp762M115 408981AW500797Hs.49427Gem-interacting protein2.5 432180Y18418Hs.272822RuvB (E colt homology-like2.5 418079840058Hs.6911ESTs 2.5 437820AA769062Hs.323836ESTs, Weakly similar 2.5 to alternatively sp 439685AW956781Hs.293937ESTs, Weakly similar 2.5 to FXD2_HUMAN FORKH

425681AB018297Hs.i59183KIAA0754 protein 2.5 435177A1018174Hs.42936ESTs 2.5 437323AA371145Hs.226627leptin receptor 2.5 55 422114AW194851Hs.111801arsenate resistance 2.5 protein ARS2 448478A1523218Hs.203456ESTs 2.5 426623AA382826Hs.132793ESTs 2.5 448764A1568607Hs.182112ESTs 2.5 458385A1051489Hs.246214ESTs 2.5 403726N28939Hs.13434Homo Sapiens clone 2.5 24418 mRNA sequence 444888AI651039Hs.148559ESTs 2.5 456179H75490Hs.271930ESTs 2.5 424840D79987Hs.153479extra spindle poles, 2.5 S. cerevisiae, homo 406273NM Hs.83920peptidylglycine alpha-amidating2.5 000919 monooxyg 65 418054NM Hs.83354lysyl oxidase-like 2.5 445936BE543594Hs.61478hypothetical protein 2.5 454967AW848276 gb:IL3-CT0214-150200.074-E062.5 CT0214 Homo 442303AA989289Hs.129169ESTs 2.5 456583AF179897Hs.104105Meis (mouse) homolog 2.5 7~ 434263N34895Hs.44648ESTs 2.5 416692L24498Hs.80409growth arrest and DNA-damage-inducible,2.5 424528AW073971Hs.238954ESTs, Weakly similar 2.5 to KIAA1204 protein 406038Y14443Hs.88219zinc finger protein 2.5 413495Y12395Hs.315177interferon-related 2.5 developmental regulat 5 423098AA321980Hs.204682ESTs 2.5 410817A1262789Hs.93659protein disulfide isomerase2.5 related prot 439841AF038961Hs.6710mannose-P-dolichol 2.5 utilization defect 453828AW970960Hs.293B21ESTs 25 445034AW293376Hs.143659ESTs 2.5 o ~ BE407797Hs.23794checkpoint with forkhead2.5 449620 and ring finger 406876AI382286Hs.180842ribosomal protein L13 2.5 412370AW946614 gb:RC2-ET0021-280400-011-c052.5 ET0021 Homo 423642AW452650Hs.157148hypothetical protein 2.5 430357AW976789Hs.165607ESTs 2.5 414853U31116Hs.77501sarcoglycan, beta (43k02.5 dystrophin-assoc 416097BE387371Hs.i hypothetical protein 2.5 428619AK002140Hs.187378hypothetical protein 2.5 413976BE295452Hs.75655procollagen-proline, 2.5 2-oxoglutarate 4-di 445223AW291553Hs.254983ESTs 2.5 423926X03833Hs.1722intedeukin 1, alpha 2.5 410165BE560228Hs.71869apoptosis-associated 2.5 speck-like protein 406474 2.5 1 433908AW298141Hs.157975ESTs 2.5 ~

439755AW748482Hs.77873B7 homolog 3 2.5 437528N59646Hs.169745crumbs (Drosophila) 2.5 homolog 1 420734AW972872Hs.293736ESTs 2.5 415346243108 gb:HSC13E071 normalized2.5 infant brain cDN

I 419337AW291112Hs.209978ESTs 2.5 S

444606809478Hs.18041ESTs 2.5 430061A8037817Hs.230188KIAA1396 protein 2.5 413407AI356293Hs.75339inositol polyphosphate2.5 phosphatase-like 411965BE467339Hs.280115ESTs 2.5 409278AA346683Hs.52763anaphase-promoting 2.5 complex subunit 7 403142 2.5 401714 2.5 425081X74794Hs.154443minichromosome maintenance2.5 deficient (S.

416505H66470Hs.16004ESTs 2.5 431518AA743462Hs.165337ESTs 2.5 448623BE613468Hs.107515ESTs, Weakly similar 2.5 to T00329 hypothe6 428301AW628666Hs.98440ESTs, Weakly similar 2.5 to 138022 hypotheti 404366 2.5 449733874546Hs.29438Homo Sapiens cDNA FLJ120942.5 fis, clone HE

459583AI907673 gb:IL-BT152-080399-0042.5 BT152 Homo sapien 402856AW939659 gb:RCO-DT0076-110100-031-c092.5 DT0076 Homo 420751J03019Hs.99913adrenergic, beta-1-, 2.4 receptor ~

d36805AA731533Hs.270751ESTs 2.4 420285AA256124Hs.293878ESTs, Moderately similar2.4 to ZN91 HUMAN Z

35 453496AA442103Hs.33084solute carrier family 2.4 2 (facilitated glu 453853AL040600Hs.188083ESTs 2.4 407909AW103986 gb:xd63e06.x1 NCI CGAP_Ov232.d Homo Sapiens 454630BE142075 gb:CM3-HT0137-170999-012-f022.4 HT0137 Homc 451026AA013218Hs.157492cer-d4 (mouse) homolog2,4 420779L12398Hs.99922dopaminereceptor D4 2.4 438322AA804170Hs.221349ESTs 2.4 455908BE156306 gb:OVO-HT0367-150200-114-h042.4 HT0367 Homo 419625U91616Hs.91640nuclear factor of kappa2.4 light polypeptid 440773AA352702Hs.332541Homo Sapiens, Similar 2.4 to RIKEN cDNA 2700 45 450823T81223Hs.22011complement-c1q tumor 2.4 necrosis Factor-rel 447247AW369351Hs.287955Homo Sapiens cDNA FLJ130902.4 fis, clone NT

429109AL008637Hs.196352neutrophil cytosolic 2.4 factor 4 (40k0) 451802AI817711Hs.209374ESTs 2.4 419417892491Hs.39429ESTs 2.4 407094AF000574Hs.22405leukocyte immunoglobulin-like2.4 receptor, 423567BE252949Hs.69331hypothetical protein 2.4 427501AI369280Hs.131743ESTs 2.4 451773242044Hs.26996KIAA1278 protein 2.4 436845AA732297Hs.113928ESTs 2.4 431584AW296121Hs.266263Homo Sapiens cDNA FLJ 2.4 5 14115 fis, clone MA

440614AA781530Hs.127236hypothetical protein 2.4 423721AF176911Hs.132004cardiotrophin-like 2.4 cytokine; neurotrophi 452125BE312642Hs.28077GDP-mannose pyrophosphorylase2.4 B

41508AW997938Hs.90786ATP-binding cassette, 2.4 sub-family C (CFTR

453446BE299996 gb:600944574F1 NIH_MGC-172.4 Homo Sapiens c 419792AA250890Hs.190037ESTs 2.4 452786861362Hs.106642ESTs, Weakly similar 2.4 to T09052 hypotheti 410447AW816134 gb:MR3-ST0220-290100-016-e042.4 5T0220 Homo 438662AA223599Hs.6351cleavage and polyadenylation2.4 specific fa 65 402408 2.4 443950NM Hs.9999epithelial membrane 2.4 001425 protein 3 414625AA335738Hs.76686glutathione peroxidase2.4 403048 2.4 432088AA525454 gb:ni85c09.s1 NCI CGAP_Pr202.4 Homo Sapiens 70 431692AL021331Hs.267749unc93 (C.elegans) homolog2.4 A

455023AW850907 gb:IL3-CT0220-310100-065-H112.4 CT0220 Homo 426249F05422Hs.i68352nucleoporin-like protein2.4 446795AI797713Hs.156471ESTs 2.4 414774X02419Hs.77274plasminogen activator,2.4 urokinase 75 414252AA346483Hs.126191ESTs 2.4 417918AA209205Hs.i63754hypothetical proteinFLJ126062.4 427550BE242818Hs.179606nuclear RNA helicase, 2.4 DECD variant of DE

404020 2.4 407846AA426202Hs.40403CbpIp300-interacting 2.4 transactivator, wit 417222AI525424Hs.42053hypothetical protein , MGC23B3 . 2.4 443639BE269042Hs.9661proteasome (prosome, 2.4 macropain) subunit, 452706AW449390Hs.257150ESTs, Moderately similar2.4 to SUR1 HUMAN S

401676 2,4 Ig~

428882AA436915Hs.131748ESTs, Moderately similar2.4 to ALU7_HUMAN A

436277888520Hs.120917ESTs ~ 2.4 426271AF026547Hs.169047chondroitin sulfate 2.4 proteoglycan 3 (neur 405353 2.4 409193AA131483 gb:zo08e05.r1 Stratagene2.4 neuroepithelium 431431AL096711Hs.252953Human DNA sequence 2.4 from clone RP3-403A15 407889834556Hs.30800ESTs, Weakly similar 2.4 to S65657 alpha-1 G

453335AW857376Hs.169238fucosyltransferase 2.4 3 (galactoside 3(4)-L

450621AW297288Hs.55918hypothetical protein 2.4 419652AL157485Hs.91973hypothetical protein 2.d 421151BE174431Hs.63386ESTs 2.4 437846AA773866Hs.244569esophagus cancer-related2.4 gene-2 420681AA847602Hs.106510ESTs, Moderately similar2.4 to ALU2-HUMAN A

405288 2.4 1 453527849570Hs.180236ESTs ' 2.4 429875A1091815 gb:qa58b06.s1 Scares-NhHMPu_Si2.4 Homosapi 436360AI962796Hs.136754ESTs 2.4 418592X99226Hs.284153Fanconi anemia, complementation2.4 group A

419991AJ000098Hs.94210eyes absent (Drosophila)2.4 homolog 1 449539W80363Hs.58446ESTs 2.4 419870AW403911Hs.266175phosphoprotein associated2.4 with GEMS

404584 2,4 454276AW294996Hs.255374ESTs 2.4 423746AW361817Hs.132370NADPH oxidase 1 2.4 25 415558AA885143Hs.125719ESTs 2.4 428141D50402Hs.182611solute carver family 2.4 11 (proton-coupled 406953L36847 gb:Human (clone p17190)rearrangediduro2.4 444471A8020684Hs.11217KIAA0877 protein 2.4 451031A1360187Hs.4254ESTs 2.4 30 455302AW997641 gb:RC6-BN0052-170200-011-DO62.4 BN0052 Homo 449063AI627352Hs.236547Homo Sapiens, clone 2.4 IMAGE:2905978, mRNA, 401048 2.4 434420AA688278Hs.194864hypothetical protein 2.4 425848BE242709Hs.159637valyl-tRNAsynthetase2 2.4 35 449086AI628357Hs.208037ESTs 2.4 415238837780Hs.21d22ESTs 2.4 448337AW206453Hs.3782ESTs 2.4 416991N36389Hs.141296KIAA0226 gene product 2.3 412600L28824Hs.74101spleen tyrosine kinase2.3 418385AW590613Hs.301040Homo Sapiens, clone 2.3 IMAGE:3357127, mRNA, 440769BE561793Hs.21446KIAA1716 protein 2.3 450437X13956Hs.24998hypothetical protein 2.3 412035N78559Hs.293629hypothetical protein 2.3 406739AI566709Hs.182426ribosomal protein S2 2.3 418506AA084248Hs.85339G protein-coupled receptor392.3 410286A1739159Hs.61898DKFZP586N2124 protein 2.3 443740856434Hs.21062ESTs 2.3 405605 2,3 416913AW934714 gb:RCi-DT0001-031299-011-all2.3 DT0001 Homo 426509M31166Hs.2050pentaxin-related gene,2.3 rapidly induced b 445828F05802Hs.81907ESTs 2.3 457195A8011099Hs.196647KIAA0527 protein 2.3 420372AW960049Hs.293660Homo Sapiens, clone 2.3 IMAGE:3535476, mRNA, 423198M81933Hs.1634cell division cycle 2.3 55 457730AW753613 gb:RC1-CT0268-060100-013-e012.3 CT0268 Homo 412014AI620650Hs.43761ESTs, Weakly similar 2.3 to A46010 X-linked 447131NM Hs.17466retinoic acid receptor2.3 004585 responder (tazaro 446288AW189209Hs.149708ESTs 2.3 436954AA740151Hs.130425ESTs 2 411658AW855598 gb:CM1-CT0278-031199-032-e06.
CT0278 Homo 2.3 404240 2,3 456094H95091 gb:yw57a09.r1 5oares_placenta2.3 Bto9weeks_ 416951AA190926Hs.190785ESTs, Moderately similar2.3 to S65657 alpha 406737AI356586 gb:qy15h09.x1 NCI 2.3 CGAP
Brn23 Homo sapien 65 458453A1097452Hs.135095_ 2.3 _ ESTs 452330AI879127Hs.191979KIAA1733 protein 2.3 408523AW833259Hs.314287ESTs 2.3 455470AW947992 gb:PMO-MT0011-240300-001-c092.3 MT0011 Homo 436323817697Hs.1d0963ESTs, Weakly similar 2.3 to 138022 hypotheti 450000AI952797Hs.10888hypothetical protein 2.3 416171H23896Hs.125790leucine-rich repeat-containing2.3 419134T89863Hs.221771ESTs 2.3 445933AV655733Hs.293860spinster-like protein 2.3 422089AA523172Hs.103135ESTs, Weakly similar 2.3 to SFR4 HUMAN SPLIC

75 449911AI262106Hs.12653_ 2.3 ESTs 417079U65590Hs.81134interleukin 1 receptor2.3 antagonist 411742AW247593Hs.71819eukaryotic translation2.3 initiation factor 435615Y15065Hs.4975potassium voltage-gated2.3 channel, KOT-lik 423491AA191765Hs.129673eukaryolic translation2.3 initiation factor 8~ 407182AA312551Hs.230157ESTs 2.3 411448AA178955Hs.271439ESTs, Weakly similar 2.3 to 138022 hypothe6 438644A1126162Hs.129037ESTs 2.3 432691U29725Hs.3080mitogen-activated protein2.3 kinase 7 452198A1097560Hs.61210ESTs, Weakly similar 2.3 to 138022 hypothefi 4i AA151647Hs.68877cytochrome b-245, alpha2.3 1125 polypepfide 404054 2.3 430458AA479300Hs.225706ESTs, Weakly similar 2.3 to 138022 hypothefi 440210AW674562Hs.125296ESTs 2.3 446727ABOt Hs.16032KIAA0523 protein 2.3 453775NM Ns.35120replication factor 2.3 002916 C (acfivator 1) 4 (37 438379N23018Hs.i71391Gterminal binding protein2.3 449919AI674685Hs.200141ESTs 2.3 1 415293849462Hs.106541ESTs 2.3 ~

441126NM Hs.323715methionine adenosylUansterase2.3 000429 I, alpha 408203AA053137Hs.42390nasopharyngeal carcinoma2.3 suscepfibility 434941AW073202Hs.334825Homo Sapiens cDNA FWi47522.3 fis, clone NT

450748AI733093Hs.130016ESTs 2.3 1 404185 2.3 418327U70370Hs.84i36paired-like homeodomain2.3 transcription (a 451370AI791929Hs.300782ESTs 2.3 400034 2.3 407723AW071161Hs.252873ESTs 2.3 2O 431320AW969474Hs.183070ESTs 2.3 429271AF039850Hs.198515dead ringer (Drosophila)-like2.3 t 453707AW003879Hs.126522Homo Sapiens, clone 2.3 MGC:16722, mRNA, com 419225U70073 gb:HSU70073 Human Homo2.3 Sapiens cDNA clon 444656AI277924Hs.145199ESTs 2.3 25 405741 2.3 400917 2.3 432567AA736777Hs.293770ESTs 2.3 437949U78519Hs.4i654ESTs, Weakly similar 2.3 to A46010 X-linked 450514AC005785Hs.25059A kinase (PRKA) anchor2.3 protein 8 30 418400BE243026Hs.301989KIAA0246 protein 2.3 444019BE173977Hs.10098putative nucleolar 2.3 RNA helicase 406326 2.3 412077N51107Hs.47199ESTs, Weakly similar 2.3 to F1J00004 protein 427647W19744Hs.i80059Homo Sapiens cDNA FLJ206532.3 fis, clone KA

35 414528AA148950Hs.lB$836ESTs 2.3 414854BE546797Hs.51483ESTs, Weakly similar 2.3 to hypothetical pro 420352BE258835 gb:6011 17374F1 NIH 2.3 MGC_16 Homo Sapiens c 439467AW29227Hs.158365ESTs 2.3 402627 2.3 4O 451711AK000461Hs.26890cat eye syndrome chromosome2.3 region, cand 424308AW975531Hs.154443minichromosome maintenance2.3 deficient (S.

423869BE409301Hs.134012C1q-related factor 2.3 405915 2.3 431503NM Hs.258576claudin 12 2.3 45 423306W88562Hs.108198ESTs 2.3 443232AF16t52tHs.908tphenylalanyl-tRNASynthetasebeta-subuni2.3 433064D79991Hs.30002SH3-containing protein2.3 SH3GLB2; KIAAt848 434437AI9t2566Hs.187813ESTs 2.3 436191BE407866Hs.170253hypotheficalprotein 2.3 SO 420006H14429Hs.94300serologically defined 2.3 colon cancer anfig 447942Ft2628Hs.334786hypotheficalprotein 2.3 403166 2.3 422119AI277829Hs.111862KIAA0590 gene product 2.3 403751 2.3 55 426451AI908165Hs.169946GATA-binding protein 2.3 427413BE547647Hs.t77781hypothetical protein 2.3 MGC56t8 409091AW970386Hs.269423ESTs 2.3 440491835252Hs.24944ESTs, Weakly similar 2.3 to 2109260A B cell 427722AKOOOi23Hs.180479hypothetical protein 2.3 6O 405747 2.3 438210AA780519Hs.311601EST 2.3 404652 2.3 423524AF055989Hs.129738potassium voltage-gated2.2 channel, Shaw-re 426793X89887Hs.172350HIR (histone cell cycle2.2 regulafion defer 65 444424AI654684Hs.196377ESTs 2.2 434031BE384165Hs.23723pseudouridylate synthase2.2 427650AW501245Hs.252259ribosomal protein S3 2.2 435220D50030Hs.104HGF activator 2.2 438279AA805166Hs.154762HIV-1 rev binding protein2.2 7O 424668D83702Hs.i5t573cryptochrome 1 (photolyase-like)2.2 429961BE246829Hs.226770DKFZP566C0424 protein 2.2 442065A183t229Hs.128417hypotheficalprotein 2.2 415198AW009480Hs.943natural killer cell 2.2 transcript 4 420536AL117455Hs.275438histone deacetylase 2.2 75 411263BE297802Hs.69360kinesin-like 6 (mitotic2.2 cenUomere-assoc 443753AW367578Hs.134749ESTs 2.2 423243AA351938Hs.23964sin3-associated polypeptide,2.2 lBkD

446572AV659t51Hs.282961ESTs 2.2 4t AF022375Hs.73793vascular endothelial 2.2 2247 growth (actor $O 421040AA715026Hs.135280ESTs 2.2 426212571824Hs.167988neural cell adhesion 2,2 molecule 1 455584BE007420 gb:PM3-BN0142-200300-001-c042.2 BN0142 Honro 406851AA609784Hs.180255major histocompafibility2.2 complex, class 444153AK001610Hs.10414hypothetical protein 2.2 419575043431Hs.91175topoisomerase (DNA) 2.2 III alpha 418672L44284Hs.159743ESTs 2.2 456261AA210718Hs.104157ESTs. Weakly similar 2.2 to KIAA0694 protein 415737AAi67626Hs.118743ESTs 2.2 447554A1391598Hs.36119ESTs, Weakly similar 2.2 to ALU1 HUMAN ALU
S

405159 2.2 442177AW661820Hs.211413ESTs 2.2 446139H77395Hs.39749ESTs 2.2 10458339AW976853Hs.i72843ESTs 2.2 401876 2.2 439566AF086387 gb:Homo Sapiens full 2.2 length insert cDNA

425079H09963Hs.2257vitronecfin (serum 2.2 spreading factor, som 441837AA361743Hs.179881core-binding factor, 2.2 beta subunit 1 430644AB015419Hs.247710preproprolacfin.releasing2.2 s pepfide 431474AL133990Hs.190642ESTs 2.2 407739NM Hs.38070Lymphoid nuclear protein2.2 002285 related to AF4 424244AV647184Hs.143601hypolhefical protein 2.2 hCLA-iso 438057AW294544Hs.125785ESTs, Weakly Similar 2.2 to CORB MOUSE CORNI

20412715NM Hs.74519primase, polypepfide 2.2 000947 2A (58kD) 422365AF035537Hs.115521REV3 (yeast homology-like,2.2 catalytic sub 404170 2.2 406902M32074 gb:Human refinoic acid2.2 receptor gamma 2 437902AA770599Hs.144055ESTs 2.2 25401012 z.2 446502AI302654Hs.208024ESTs 2.2 442554AW467376Hs.129640ESTs 2.2 443021AA368546Hs.8904Ig superfamily protein2.2 421141AW117261Hs.125914ESTs 2.2 30443070BE388662Hs.8984Homo Sapiens chromosome2.2 446566H95741Hs.17914membrane-spanning 4~omains,2.2 subfamily A

427695888483Hs.172862ESTs 2.2 426503AA380153 gb:EST93093 Skin tumor2.2 I Homo Sapiens cD

431468AW248431Hs.256526nuclear prelamin A 2.2 recognifion factor 35416185AW975861Hs.47367KIAA1785protein 2.2 437319BE410958Hs.56406Homo Sapiens cDNA FLJ 2.2 13549 fis, clone PL

402064 2.2 413335AI613318Hs.48442ESTs 2.2 408212AA297567Hs.43728hypothetical protein 2.2 40aosls9 z.2 451099852795Hs.25954interleukin 13 receptor,2.2 alpha 2 407335AA631047Hs.158761Homo Sapiens cDNA FLJ 2.2 13054 fis, clone NT

409715W42591Hs.23892ESTs 2.2 431921N46466Hs.58879ESTs 2.2 45443823BE089782Hs.9877hypothetical protein 2.2 432458AI968598Hs.78768malignant cell expression-enhanced2.2 gene!

419726050330Hs.1274bone rtrorphagenelic 2.2 protein 1 423178A1033140Hs.124983Homo Sapiens mRNA; 2.2 cDNA DKFZp564C142 (fr 451089AA903705Hs.4190Homo Sapiens cDNA: 2.2 FLJ23269 fis, clone C

SO415216AI825905Hs.193211Homo Sapiens cDNA FLJ114212.2 fis, clone HE

442242AV647908Hs.90424Homo Sapiens cDNA: 2.2 FLJ23285 fis, clone H

441830AA383104Hs.42954hypotheficalprotein 2.2 DKFZp564D0372 406660X65371Hs.172550polypyrimidine tract 2.2 binding protein (he 443378AW392550Hs.9280proteasome (prosome, 2.2 macropain) subunil, 432558897268Hs.177269ESTs 2.2 408146845621Hs.81057hypothetical protein 2.2 419865NM Hs.93502Ut-snRNP binding protein2.2 007020 homolog (70kD) 439444AI277652Hs.54578ESTs, Weakly similar 2.2 to 138022 hypotheti 438407AI457122Hs.129673eukaryotic Uanslafion 2.2 initiafion factor 60450184W31096Hs.237617Homo Sapiens, clone 2.2 IMAGE:3447394, mRNA, 409130BE076601Hs.75658phosphorylase,glycogen;brain2.2 428844AW972635Hs.301904hypolhefical protein 2.2 429489AF008203Hs.204039aristaless-like homeobox2.2 433042AW193534Hs.281895Homo Sapiens cDNA FLJ116602.2 fis, clone HE

65440658H29142Hs.143032ESTs, Weakly similar 2.2 to neuronal thread 408204AA454501Hs.43666protein tyrosine phosphatase2.2 type IVA, m 427498NM Hs.178728methyl-CpG binding 2.2 003926 domain protein 3 408006H57654Hs.303345ESTs, Weakly similar 2.2 to 138022 hypolhefi 445703AV654845Hs.27glycine dehydrogenase 2.2 (decarboxylafing;

70431446AW294929Hs.255369Homo Sapiens cDNA FLJ 2.2 10265 fis, clone HE

456660AA909249Hs.112282solute comer family 2.2 30 (zinc transport 433099NM Hs.3187nuclear transcripfion 2.2 002504 factor, X-box bind 415857AA866115Hs.127797Homo Sapiens cDNA FW 2.2 11381 fis, clone HE

415245N59650Hs.27252ESTs 2.2 75443657814973 gb:yf42t10.s1 Scares 2.2 fetal liver spleen 402521AW501216Hs.108945KIAA0515 protein 2.2 414819BE177320Hs.156148hypothetical protein 2.2 446530AV658909Hs.282642ESTs 2.2 415797A1291896Hs.72800ESTs 2.2 80414812X72755Hs.77367rtronokine induced 2.2 by gamma interferon 453028A8006532Hs.31442Recd protein-like 4 2.2 412133083460Hs.73614solute carver family 2.2 31 (copper Vanspo 407881AW072003Hs.40968heparan sulfate (glucosamine)2.2 3-0-sulfot 437033AW248364Hs.5409RNA polymerase I subunit2.2 422732AA577455Hs.24937transformer-2 alpha 2.2 (htra-2 alpha) 416388AI417358Hs.73677ESTs 2.2 452849AF044924Hs.30792hook2 protein 2.2 446615BE513202Hs.15589PPAR binding protein 2.2 428361NM Hs.183858transcriptional intermediary2.2 015905 factor 1 446279AA490770Hs.182382ESTs 2.2 422938NM_001809Hs.1594centromere protein 2.2 A (l7kD) 403969 2.2 1 410423AW402432Hs.63489protein tyrosine phosphatase,2.2 ~ non-recept 429736AF125304Hs.212680tumor necrosis factor2.2 rerxptor superfami 447091AW089648Hs.157779ESTs, Weakly similar 2.2 to CA17-HUMAN COLLA

422017NM Hs.110776STAT induced STAT 2.2 003877 inhibitor-2 426728NM Hs.171957hiple functional domain2.2 007118 (PTPRF interact 15 438726A8033103Hs.6385KIAA1277 protein 2.2 453315BE544203Hs.24831ESTs 2.2 423244AL039379Hs.209602ESTs, Weakly similar 2.2 to ubiquitous TPR
m 433610AA806822Hs.112547ESTs 2.2 429451BE409861Hs.202833heme oxygenase (decycling)2.2 417980832235 gb:yh67f08.r1 Soares 2.2 placenta Nb2HP Homo 4pt~7 2.2 414406BE297904 gb:601177814F1 NIH 2.2 MGC_17 Homo Sapiens c 401827 2.2 446913AA430650Hs.i6529transmembrane 4 superfamily2.2 member (tetr 25 452294AI871925Hs.117895ESTs, Moderately similar2.2 to A47582 B-cel 404084 2.2 456786AK002084Hs.132851hypothetical protein 2.2 435031AI632091Hs.116877ESTs 2.2 442609AL020996Hs.8518selenoprotein N 2.1 439732AW629604Hs.167641hypothetical protein 2.1 from EUROIMAGE 1703 421506BE302796Hs.105097thymidine kinase 1, 2.1 soluble 439253AF086064Hs.332252ESTs 2.1 409669AW177551Hs.220255hypothetical protein 2.1 429574BE268321Hs.208912hypothetical protein 2.1 35 437470AL390147Hs.134742hypothetical protein 2.1 DKFZp547D065 408945AW015089Hs.4964DKFZP586J1624 protein2.1 447687A1627947Hs.150186hypotheticalprotein 2.1 DKFZp566K1946 459584A1910884Hs.207898ESTs 2.1 439130AA306090Hs.124707ESTs 2.1 4~ 428180A1129767Hs.182874guanine nucleotide 2.1 binding protein (G
pr 442028AI239437Hs.48945ESTs 2.1 430968AW972830 gb:EST384925 MAGE 2.1 resequences, MAGL
Homo 443609AV650231Hs.282941ESTs, Highly similar 2.1 to A Chain A, Human 417164AA338283Hs.81361heterogeneous nuclear2.1 ribonucleoprotein 45 444534AW271626Hs.42294ESTs 2.1 438391AI262248Hs.25027ESTs 2.1 442003AW297497Hs.201891ESTs 2.1 456278BE300369Hs.289038hypothetical protein 2.1 416976BE243985Hs.80680major vault protein 2.1 417810D28419Hs.82609hydroxymethylbilane 2.1 synthase 445242BE156478Hs.21108ESTs, Weakly similar 2.1 to ALU1 HUMAN ALU
S

452712AW838616 gb:RCS-LT0054-140200-013-D012.1 LT0054 Homo 434926BE543269Hs.50252mitochondrial ribosomal2.1 protein L32 421564AB007864Hs.105850KIAA0404 protein 2.1 55 424927AW973666Hs.153850hypothetical protein 2.1.
C321D2.4 432742AA564453Hs.162339ESTs 2.1 435958H98180Hs.117975ESTs 2.1 421531AA713505Hs.291769ESTs 2.1 410431BE261320Hs.158196transcriptional adaptor2.1 3 (ADA3, yeast h ()O420503AI570943Hs.337546ESTs 2.1 448127A1478416Hs.282883ESTs, Weakly similar 2.1 to ALU1 HUMAN ALU
S

452897BE066058Hs.269233ESTs, Moderately similar2.1 to 178885 serin 447112H17800Hs.7154ESTs 2.1 406577 2.1 65 437162AW005505Hs.5464thyroid hormone receptor2.1 coactivating pr 451460AI797550Hs.209652ESTs 2.1 447402H5452CHs.18490hypotheticalprotein 2.1 435828AA700705Hs.13852ESTs 2.1 436396A1683487Hs.152213wingless-type MMTV 2.1 integration site fami 420582BE047878Hs.99093Homo Sapiens chromosome2.1 19, cosmid 82637 452020AA722012Hs.255757ESTs, Weakly similar 2.1 to AT2A HUMAN POTEN

415586245481 gb:HSC20E041 normalized2.1 infant brain cDN

452620AA436504Hs.119286ESTs 2.1 4570668E244613Hs.158272ESTs, Weakly similar 2.1 to CA13 MOUSE COLLA

75 435472AW972330Hs.283022triggering receptor 2.1 expressed on myeloid 431741AA514783Hs.191701ESTs 2.1 446840AW294828Hs.209203ESTs 2.1 440818AI147060Hs.146726ESTs 2.1 410174AA306007Hs.59461DKFZP434C245 protein 2.1 80 400822 2.1 412760AW379030Hs.41324ESTs 2.1 410653BE383768Hs.6523895 kDa retinoblastoma2.1 protein binding pr 426925NM_tH11196Hs.315689Homo Sapiens cDNA: 2.1 FLJ22373 fis, clone H

424242AA337476Hs.293984hypothefiral protein 2.1 452560BE077084Hs.336432ESTs 2.1 456437A1924228Hs.115185ESTs, Moderately similar2.1 to PC4259 ferti 458922BE501831Hs.282053ESTs 2.1 439231AW581935Hs.141480Homo Sapiens mRNA; 2.1 cDNA DKFZp434N079 (fr 419488AA316241Hs.90691nucleophosmin/nucleoplasmin2.1 411829AW865749 gb:OV3-SN0021-100500-185~c032.1 SN0021 Homo 457192AL135682Hs.22452Homo Sapiens mRNA 2.1 for KIAA1737 protein, 422128AW881145 gb:OVO-OT0033010400-182-a072.1 OT0033 Homo 1 452571W31518Hs.34665ESTs 2.1 ~

423699H41850Hs.131846PCAF associated factor2.1 65 alpha 406610 2.1 453638AW814996 gb:MR1-ST0206-170400-024-h092.1 ST0206 Homo 418856AA362858 gb:EST72900 Ovary 2.1 II Homo Sapiens cDNA

I 437623D63880Hs.5719chromosome condensation-related2.1 S SMGasso 410908AA121686Hs.10592ESTs 2.1 420221N25991Hs.43725ESTs 2.1 424739AA346108Hs.221610ESTs 2.1 425398AL049689Hs.156369hypothetical protein 2.1 similar to lenascin 424901111933Hs.182505POU domain, class 2.1 3, transcripfion facto 411096U80034Hs.68583mitochondrial intermediate2.1 pepfidase 415635F13168 gb:HSC3JF101 normalized2.1 infant brain cDN

418181U37012Hs.83727cleavage and polyadenylafion2.1 specific fa 407103AA424881Hs.256301hypothefical protein 2.1 25 454389AW752571 gb:IL3-CT02t3-170100-055-F022.1 CT0213 Homo 400021 2.1 439228N51700 gb:yy72d01.s1 Soares_mulGple_sclerosis-2.1 456505AA504595Hs.111418ESTs 2.1 405258 2.1 444645AI184564Hs.101654ESTs 2.1 430246A1269069Hs.109268hypothefical protein 2.1 458687AW024815Hs.170088GLUT4 enhancer factor2.1 403857 2.1 400258 2.1 35 422221AA306649Hs.169370FYN oncogene related 2.1 to SRC, FGR YES

441054AA913591Hs.126480ESTs 2.1 452700AI859390Hs.288940five-span Vansmembrane2.1 protein M83 454606AW809752 gb:MR4-ST0124-181299-020-b062.1 ST0124 Homo 448954A8014564Hs.22616KIAA0664 protein 2.1 443148A1034357Hs.211194ESTs, Weakly similar 2.
to ALUB HUMAN ALU t S

453486AL039201Hs.173554ubiquinol-cytochrome 2.1 c reduclase core pr 437695AA769202Hs.192142ESTs 2.1 425449X52056Hs.157441spleen focus forming 2.1 virus (SFFV) prow 447270AC002551Hs.331general transcripfion2.1 factor IIIC, polyp 45 435677AA694142Hs.293726ESTs, Weakly similar 2.1 to TSGA RAT TESTIS

436382AW977063Hs.250181ESTs 2.1 435837AI689210Hs.187276Homo Sapiens cDNA 2.1 FLJ11431 fis, clone HE

458287AA987556Hs.12867ESTs 2.1 423794BE551781Hs.231895ESTs 2.1 408049AW076098Hs.74316desmoplakin (DPI, 2.1 DPII) 402721 2.1 451999AW176401Hs.27424DEADIH (Asp-Glu-Ala-AspIHis)2.1 box polypep 417541AI992191Hs.180040hypotheficat protein 2.1 414857AW402389Hs.920modulator recognifion2.1 factor I

435760AF231922Hs.213004chromosome 21 open 2.1 5 reading frame 62 428086AL110193Hs.224137hypotheticalprotein 2.1 447853A1434204Hs.164285ESTs, Weakly similar 2.
to AFG1 YEAST AFG1 t 419034NM_002110Hs.89555hemopoiefic cell kinase2.1 431019NM Hs.2714forkhead box G18 2.1 ()~421064AI245432Hs.101382turtror necrosis (actor,2.1 alpha-induced pro 416435AI431301Hs.179703KIAA0129 gene product2.1 437014AA808757Hs.222531ESTs, Weakly similar 2.1 to S59501 intertero 459369T83080 gb:yd40e03.r1 Soares 2.1 fetal liver spleen 402239 2.1 65 412280AW205116Hs.272814hypothefical protein 2.1 DKFZp434E1723 426012AA367507Hs.75874pregnancy-associated 2.1 plasma protein A

438885AI886558Hs.184987ESTs 2.1 426076AW962714 gb:EST374787 MAGE 2.1 resequences, MAGG
Homo 404561 2.1 442932AA457211Hs.8858bromodomain adjacent 2.1 to zinc finger doma 408175W29089Hs.19066hypothefical protein 2.1 DKFZp66702416 423867AA331886 gb:EST35757 Embryo, 2.1 8 week I Homo sapien 458604W37944Hs.4007Sarcolemmat-associated2.1 protein 409650T08490Hs.288969HSCARG protein 2.1 75 401729 2.1 433675AW977653Hs.75319ribonucleotide reductase2.1 M2 polypepfide 456741W37608Hs.184492ESTs 2.1 417037BE083936Hs.80976anfigen idenfified 2.1 by monoclonal anfitx~d 415079843179Hs.22895hypothefical protein 2.1 439262AA832333Hs.333045ESTs 2.1 403108 2.1 436718AW015227Hs.289053hypothetical protein 2.1 440696AI762757Hs.187660putative RabS GDP/GTP2.1 exchange factor ho Igs 409745AA077391 gb:7B14E12 Chromosome2.1 7 Fetal Brain cDNA

453485BE620712Hs.33026hypotheficalprotein 2.1 418177N44967Hs.5663ESTs 2.1 457292A1921270Hs.334882hypotheficalprotein 2.1 454434AA083558Hs.261286ESTs 2.1 406085 2.1 424441X14850Hs.147097H2A histone family, 2.1 member X

422726011690Hs.1572faciogenital dysplasia2.1 (Aarskog-Scott sy 424576BE154142Hs.96833ESTs 2.1 423660AL045228Hs.130831Homo Sapiens mRNA; 2.1 cDNA DKFZp434L137 (fr 403509AF231919Hs.18759KIAA0539 gene product2.1 441940AW298115Hs.128152ESTs 2.1 439190AW978693Hs.293811ESTs 2.1 417791AW965339Hs.i11471ESTs 2.1 1 423701AA329856Hs.143022ESTs 2.1 427239BE270447Hs.174070ubiquitin cartier 2.1 protein 459642BE243103 gb:TCAAP2E0949 PediaUic2.1 acute myelogeno 450385AI631024Hs.24948synuclein, alpha interacfing2.1 protein (sy 425159NM Hs.154868carbartroyl-phosphate2.1 004341 synthetase 2, aspart 425591AW294734Hs.279727Homo Sapiens cDNA 2.1 FLJ14035 fis, clone HE

445101T75202Hs. Homo Sapiens mRNA; 2.1 1 cDNA DKFZp586C1019 2314 (f 412811H06382Hs.21400ESTs 2.1 426369AF134157Hs.169487Kreisler (mouse) maf-related2.1 leucine zip 435924AW029203Hs.191952ESTs 2.1 418388872332Hs.29258Homo Sapiens cDNA 2.1 FLJ11364 fis, clone HE

452235AL039743Hs.28514testes development-related2.1 452313Y00486Hs.28914adenine phosphorlbosyltransterase2.1 450704H85157Hs.40696_ 2.1 ESTs 427539AA405205Hs.97960ESTs, Weakly similar 2.
to T51146 ring-box t 4o2oz6 2.1 405362 2.1 414718H95348Hs.107987ESTs 2.1 433424868252Hs.163566ESTs 2.1 444875A1200759Hs.44737ESTs 2.0 3 449523NM Hs.54443chemokine (GC motif) 2.0 S 000579 receptor 5 456072H54381 gb:yq89a03.s1 Soares 2.0 fetal liver spleen 436331AI239495Hs.120189ESTs 2.0 448418243704Hs.21192Homo sapiens clone 2.0 25155 mRNA sequence 447250AI878909Hs.17883protein phosphatase 2.0 1G (formerly 2C), ma 448192843915Hs.4958ESTs 2.0 448966AW372914Hs.86149phosphoinositol 3-phosphate-binding2.0 prot 408605AF025374Hs.46465T-cell, immune regulator2.0 410790AW803357 gb:IL2-UM0079-090300-050-A082.0 UM0079 Homo 436872X15624 gb:Human H1 RNA 2.0 432238AL133057Hs.274135Homo Sapiens mRNA; 2.0 cONA DKFZp434K1815 (f 446307T50083Hs.9094ESTs 2.0 436588AA759233Hs.126506ESTs 2.0 452487AW207659Hs.6630Homo Sapiens cDNA 2.0 FLJ13329 fis, clone OV

430420AW140027Hs.26373Homo Sapiens cDNA: 2.0 FLJ23449 fis, clone H

432036AF224266Hs.272373interleukin 20 2.0 414460L00727Hs.898dystrophic myotonica-protein2.0 kinase 433507AI817336Hs.191791ESTs 2.0 427964AA418082Hs.98286ESTs, Weakly similar 2.0 to T20655 hypotheti 443108W86975Hs.203707ESTs 2.0 434504A1887341Hs.121590hypothetical protein 2.0 454310AW818390Hs.175613homolog of Xenopus 2.0 Gaspin 443566AI290284Hs.159872ESTs 2.0 449722BE280074Hs.23960cyclin B1 2.0 452682AA456193Hs.9071progesterone membrane2.0 binding protein 412362AW945484Hs.184252ESTs, Weakly similar 2.0 to ALUB HUMAN ALU
S

429341X73874Hs.2393phosphorylase kinase,2.0 alpha 1 (muscle) 435863AF255346Hs.62919Jun dimerlzation protein2.0 p2ISNFT

400774858624Hs.2186eukaryo6c translation2.0 elongation factor 453944AW975369Hs.292570Homo Sapiens, clone 2.0 IMAGE:3502107, mRNA, 419227BE537383Hs.89739chotinergic receptor,2.0 nicotinic, beta po 448529T26460Hs.22550ESTs 2.0 443206AB011420Hs.9075serlnetthreonine kinase2.0 17a (apoplosis-i 439360AA448488Hs.336629rlbasomal protein 2.0 436660AI658870Hs.184513ESTs 2.0 449030A1365582Hs.57100Homo Sapiens mRNA 2.0 for FW00016 protein, 411048AK001742Hs.67991hypothetical protein 2.0 DKFZp434G0522 406624AF052762 gb:Homo Sapiens clone2.0 csneg8-1 immunoglo 450666T99968Hs.18799ESTs, Weakly similar 2.0 to 138022 hypotheti 4461438E245342Hs.306079sec61 homolog 2.0 437698861837Hs.7990ESTs, Moderately similar2.0 to 184505 catci 426607AA382330Hs.124223ESTs 2.0 449246AW411209Hs.23363hypothefical protein 2.0 422564AI148006Hs.222120ESTs 2.0 432682A1376400Hs.159588ESTs 2.0 422140BE295918Hs.i mutS (E. coli) homolog2.0 408215BE614290Hs.43812syntaxin 10 2.0 417129A1381800Hs.300684calcitonin gene-related2.0 peptide-receptor 442772AW503680Hs.5957Homo Sapiens clone 2.0 24416 mRNA sequence 434928AWOi Hs.4267Homo Sapiens clones 2.0 5595 24714 and 24715 mRNA

411380AW84t619 gb:RCi-CN0017-120200-012-b09CN00172.0 Homo 430603AA148164Hs.247280HBV associated factor 2.0 425905AB032959Hs.318584novel C3HC4 type Zinc 2.0 finger (ring finge 401 2.0 t 412939AW411491Hs.2186eukaryofic Uanslation 2.0 elongafion (actor 448740BE250632Hs.8026sestrin 2 2.0 454390A80207t3Hs.56966KIAA0906 protein 2.0 415012NM Hs.77793c-sro tyrosine kinase 2.0 1 410407X66839Hs.63287carbonic anhydraselX 2.0 ~

403478 2.0 456485AI393037Hs.97871Homo Sapiens, clone 2.0 IMAGE:3845253, mRNA, 430294AI538226Hs.32976guanine nucleotide 2.0 binding protein 4 411669BE612676Hs.303isUomal cell-derived 2.0 16 factor 2-like 1 15451944AW4452t8Hs.210876ESTs 2.0 436395AJ227900 gb:Homo Sapiens partial2.0 mRNA; ID EE2-168 456457AA252905Hs.194477E3 ubiquifin ligase 2.0 449123050920Hs.23t06KIAA0130 gene product 2.0 409214AW405967Hs.333388Homo Sapiens, clone 2.0 IMAGE:3957135, mRNA, 437619AW351491Hs.334853hypothefical protein 2.0 453348BE272318Hs.8595hypothetical protein 2.0 424382AA35i898Hs.23539ESTs 2.0 447079AA280057Hs.105280ESTs, Weakly similar 2.0 to dJ~3K23.2 [H.sa 449501AI652924Hs.231942ESTs 2.0 25422893X98411Hs.121555myosin IF 2.0 412125Yl7t Hs.73393eyes absent (Drosophila)2.0 14 homotog 4 434845BE267057Hs.325321hypotheficalprotein 2.0 410422AL042014Hs.334698Homo Sapiens, clone 2.0 MGC:15203, mRNA, com 430255AK000703Hs.323822Homo Sapiens mRNA for 2.0 KIAA1551 protein, 451656BE327088Hs.212752ESTs 2.0 442068BE3t2873Hs.314932ESTs 2.0 446646AW197626Hs.271901ESTs. Moderately similar2.0 to S08686 finge 442690A1014727Hs.160047ESTs, Weakly similar 2.0 to 828096 line-1 pr 454277AW295069Hs.31743ESTs, Weakly similar 2.0 to 1157 HUMAN ZINC

3 426910AA470023Hs.190089ESTs, Moderately similar2.0 S to ALUt HUMAN A

402798 2.0 404554 2.0 TABLE 9B:
Pkey: Unique Eos probeset identifier number CAT number: Gene cluster number Accession: Genbank accession numbers Pkey CAT Number Accession 45 407909 1025254 1 AW103986 BEi56395 BE156391 BE156190 BE156184 BE156388 409193 110747 1 AA131483 AA065t56 AA076448 410447 1203929_1 AW816134 BE063456 AW748795 BE150839 411380 1242343_1 AW84t6t9AW851958AW851851AW851985 411632 1252361 t AW854829 AW854805 AW854841 AW854825 AW854822 AW854830 4i 1658 1252987 1 AW855598 AW855608 BE148763 BEt48764 AW855645 AW855615 AW855596 AW855610 AW85560t AW855605 55 411829 1260309 1 AW865749 BE1794t9 BE179492 4t 2370 1291952 1 AW946614 AW946622 AW946663 AW946667 AW946615 AW946619 412391 12926251 AW9477t0AW947698AW947697AW947713 ()~ 413604 1379715 1 851767 8E152515 244834 H23397 414550 1460990_-1 BE379808 415346 1534581 t 243108 F06295 813085 415635 1540853_1 F13168 821289 T77628 416871 1626761 1 H987t6 N90792 N24283 416913 163001 1 AW934714 BE161007 BEt62500AW749902 AW749864 BE162498 BE161005 AA190449 AW5t3465 BE16t006 BE162499 417980 1712954_1 832235 832247 832219 418333 173_2 W92113 AA702794 BE0443t6 W9t984 AA679375 T94184 AA679335 BE503t26 AI887846 AW502624 W81697 W8t696 AA447817 AA447667 F13631 AW268271 AA055366 AW629027 AA677404 AA83i6t8 AI124782 AA889402 419311 183793 1 AA689591 AW974261 AA236240 A1077451 AA63t399 AW974262 422128 211994 t AW881145 AA490718 M85637 AA304575 T06067 AA33199i 422156 212379_1 N34524 AA305071 AW954803 AA502335 AI433430 AI203597 AW026670 423867 232732_1 AA331886 AW962659 AW962655 T89841 1g7 1 ~ 433532 368950 1 AW975367 AA598607 AA742735 1 S 436532 421802 t AA721522 AW975443 T93070 436872 42851 -i X15624 439086 46852_1 AF085947 H70981 H78989 453638 975649_1 AW814996 AL047199 AW850979 453746 979731_1 AL120611 BE006190 BE006189 454630 1227352_1 BE142075 BE142148 BE142189 AW816249 BEi42147 BE142002 454679 1228929_1 AW813110 AW813113 455470 1292849_1 AW947992 AW947967 AW947950 AW947957 AW947953 AW947973 455530 1322298_1 AW984744 AW984759 455778 1364506_1 BE088746 BE088802 BE088755 BE088876 BE088947 BE088881 55 457730 393905_1 AW753613 AW753857 BE150374 BE150693 BE150394 AA808851 TABLE 9C:
Pkey: Unique number corresponding to an Eos probeset Ref: Sequence source. The 7 digit numbers in this column are Genbank Idenfifier (GI) numbers. 'Dunham, et al.' refers to the publication enfified 'The DNA
sequence of human chromosome 22' Dunham, et al. (1999) Nature 402:489-495.
Strand: Indicates DNA strand from which exons were predicted.
Nt_position: Indicates nucleofide positions of predicted exons.
Pkey Ref Slrand N<_posilion 400822 7465000 Plus 186223-186402,186878-187275 65 400859 9757499 Minus 91888-92018,98131-98294,99474-99570 400917 7283186 Minus 173258-173631 400992 8096828 Plus 140390-140822 401012 7230838 Minus 736-1137 401048 7232177 Plus 132430-132761 401125 8570296 Minus 126863-126984 401324 9863791 Plus 234057-234174 401384 6850939 Minus 58360-58545 401558 7139678 Plus 103510-104090 401626 8575943 Minus 238100-238432 75 401676 9965536 Plus 3891-4691 401714 6715702 Plus 96484-96681 401729 8134856 Minus 90651-90878 401827 2262095 Plus 94725-94860,98452-98660 401876 8099107 Plus 9591396641 402028 7139781 Plus 88749-89237 402064 8117294 Plus 100159-100350.10(1445-100912 402239 7690131 Plus 38175-38304,42133-42266 402408 9796239 Minus 110326-110491 Igg 402424 9796344 Minus 64925-65073 402516 9798099 Minus 195342-195511 402604 9909420 Plus 20393-20767 402627 9931216 Plus 12136-12272,16487-16628,17654-17798,18494-18621,18933-19089,20669-20790,21134-21298,22866-22973,23686-23820,26626-26895,29279-29469 402721 8969253 Minus 144428-144715 402798 3355547 Plus 23596-23867 402856 9801288 Minus 90119-90411 403048 4210991 Plus 44275-44592,49656-49955 1 ~ 403108 8980955 Plus 93253-93667 403142 9444521 Plus 89286-90131 403166 9838127 Minus 67762-67940.6869568856,70394-70507 403478 9958258 Plus 116458-116564 403680 7331517 Minus 157184-157415 I 5 403751 7229815 Minus 158794-160929 403790 8084957 Minus 87826-87947,8983590002 403797 8099896 Minus 123065-125008 403857 7708910 Minus 2524-3408 403881 7710245 Minus 107250-107685,108924-109213 403961 7596976 Minus 110393-110603 403969 8569909 Plus 31237-31375,3240532506 404020 8655966 Minus 174449-174663 404054 3548785 Plus 66713-69175 404084 9944055 Plus 2795-2969 25 404108 8247074 Minus 63603-64942 404170 9930793 Plus 168836-169248 404185 4572584 Minus 129171-129327 404240 5002624 Minus 116132-116407,116653-116922 404295 9856663 Minus 75747-75947 404299 5738652 Minus 3826-4025 404366 9964977 Plus 96589-96801 404554 7243881 Plus 42637-42839 404561 9795980 Minus 69039-70100 404584 9857511 Plus 138651-139153 404569 9931665 Minus 32824-32985 404642 9796810 Plus 102999-103145 404652 9796969 Minus 108172-108296 404721 9856648 Minus 173763-174294 404756 7706327 Plus 82849-83627 404802 4581357 Minus 30093-30600 404984 6939882 Plus 87221-87505 405159 9966252 Plus 79659-79804 405258 7329310 Plus 129930-130076 405288 6139075 Minus 126268-126436 45 405353 2811095 Plus 118525-118892 405362 2337862 Minus 105008-105142,105980-106091,140445-140556,142519-142641 405558 1621110 Plus 4502-4644,5983-6083 405588 5002511 Plus 46180-46366 405605 5836195 Minus 117070-117270 S 0 405701 4263751 Plus 93243-93364 405741 9966947 Minus 156747-156875,156936-157208 405747 8469069 Minus 153933-154060 405771 7018349 Plus 91191-91254,91510-91589 405808 9929207 Plus 109758-111166 5 405684 6758747 Plus 62383-62583 405915 7712162 Minus 43717-43859 406028 8312303 Minus 177469-177829 406085 9123888 Plus 18665-18843 406169 6684220 Minus 12620-14251 406267 7528342 Minus 2570-2731 406326 9212385 Plus 84508-84655 406347 9255981 Plus 90900-91091 406474 9795567 Plus 52758-53211 406577 7711730 Plus 11377-11509 65 406610 8312226 Plus 13096-13334 TABLE 10A: ABOUT 582 GENES SIGNIFICANTLY DOWN-REGULATED IN GLIOBLASTOMA
COMPARED TO NORMAL ADULT CNS TISSUES
Table 10A lists about 582 genes significantly down-regulated in glioblastoma compared to normal adult CNS tissues. These were selected from 59680 probesets on the AffymeUixIEos Hu03 GeneChip array such that the ratio of'average' normal CNS
to'average' glioblastoma was greater than or equal to 3. The'average' normal CNS level was set to the 75th percentile amongst various normal CNS tissues. The'average' glioblastoma level was set to the 85th percentile amongst various tumor samples. In order to remove gene-specific background Levels of non-specific hybridization, the 10th percentile value amongst various non-malignant tissues was subtracted from both the numerator and the denominator before the ratio was evaluated.
Pkey: Unique Eos probeset identifier number 75 E%ACCn: Exemplar Accession number, Genbank accession number UnigenelD: Unigene number Unigene Title: Unigene gene title R1: Ratio of 75th percentile normal central nervous system tissue to 85th percentile tumor 80 Pkey EXACCn UnigenelD Unigene Title Ri 453655 AW960427 Hs.79059 transforming growth factor, beta recepto 136.7 417275 X63578 Hs.295449 parvalbumin 29.0 430829 AW451999 Hs.194024 ESTs 25.7 410657AF063228Hs.65248dynein,cytoplasmic.intertnediate22.6 polype 419954D14720Hs.93883myelin protein zero 21.2 (Charcot-Marie-Tooth 459247N46243Hs.t ESTs, Highly similar 18.5 10373to T42626 secreted 416133NM Hs.89512ATPase, Ca+transporting,15.5 001683 plasma membra 416018AW138239Hs.78977proprotein convertase 15.2 subtilisinlkexin t 417167AW206437Hs.4290ESTs 14.8 433940H05129Hs.7459cyclic AMP-regulated 13.4 phosphoprotein, 21 413324V00571Hs.75294corticotropin releasing13.1 hormone 439830AA846666Hs.151489ESTs, Weakly similar 12.6 to XE7_HUMAN PROTEI

408068AW148652Hs.167398ESTs 12.6 412636NM Hs.74316desmoplakin (DPI, DPII)12.5 429096A8011106Hs.196012KIAA0534 protein 12.2 412636AA910199Hs.203838ESTs 12.2 423690AA329648Hs.23804ESTs, Weakly similar 12.1 to PN0099 son3 prot 456844AI264155Hs.152981CDP-0iacylglycerol 11.9 synthase (phosphafida 418318U47732Hs.84072transmembrane 4 superfamily10.9 member 3 442593839804Hs.31961ESTs 10.8 446353A1290919Hs.i53661ESTs 10.4 420290AW977318Hs.194480ESTs 10.3 414220BE298094 gb:601118231Fi NIH_MGC_i710.3 Homo Sapiens c 414290AI568801Hs.71721ESTs 10.2 426365AA376667Hs.10263RNA binding motif protein10.0 414937838698Hs.12382ESTs 10.0 419643F06066Hs.91791chromosome 11 open 9.5 reading frame 25 407173T64349 gb:yc10dO8.s1 Stratagene9.5 lung (937210) H

412454855745Hs.167330ESTs 9.5 439366AF100143Hs.6540fibroblast growth (actor9.4 415315Ft2240Hs.250655prothymosin, alpha 9.3 (gene sequence 28) 441790AW294909Hs.132208ESTs 9.2 448117H49129Hs.172982ESTs 9.1 400661 9.0 433558AA833757Hs.201769ESTs, Weakly similar 9.0 to T24435 hypotheG

412453820205Hs.167330ESTs 9.0 408920AL120071Hs.48998fibronectin leucine 8.9 rich transmembrane p 409031AA376836Hs.76728ESTs 8.7 428106BE620016Hs.182470PTD010 protein 8.3 446544AI631932Hs.7047ESTs, Weakly similar 8.2 to Unknown [H.sapie 423479NM Hs.129208death-associated protein8.2 014326 kinase 2 439480AL038511Hs.125316ESTs, Weakly similar 8.2 to S33990 finger pr 418036237976Hs.83337latent transforming 8.0 growth factor beta b 456490U83171Hs.97203small inducible cytokine8.0 subfamily A (Cy 410200AA082557Hs.101915Stargardt disease 3 8.0 (autosomal dominant) 414602AW630088Hs.76550Homo Sapiens mRNA; 8.0 cDNA DKFZp564B1264 (f 408428NM Hs.44896DnaJ (Hsp40) homolog, 7.9 014787 subfamily B, membe 437073AI885608Hs.94122ESTs 7.9 408434AW195317Hs.107716hypothetical protein 7.9 438150AA037534Hs.79059transforming growth 7.9 factor, beta recepto 440209H05049Hs.22269neurexin 3 7.8 408119W26213Hs.101672ESTs, Weakly similar 7.8 to T00331 hypothefi 417421AL138201Hs.82120nuclear receptor subfamily7.8 4, group A, m 410587AA370706Hs.86412chromosome 9 open reading7.8 frame 5 429611AI889077Hs.211388Homo Sapiens BAC clone7.7 CTB-60N22 from 7q 405800 7.7 421750AK000768Hs.107872hypothetrcal protein 7.7 426356BE536836Hs.98682hypothetical protein 7.7 423440825234Hs.143434contactin 1 7.7 445148AI214510Hs.146304ESTs 7.6 416294D86980Hs.79170KIAA0227 protein 7.6 424087N69333Hs.143434contacfin 1 7.6 437479861866Hs.101277ESTs 7.5 405071 7.5 421224AW402154Hs.125812ESTs 7.4 442025AW887434Hs.11810CDA11 protein 7.4 459476BE185844 gb:ILS-HT0731-110500-087-c087.2 HT0731 Homo 430573AA744550Hs.136345ESTs 7.1 401836 7.1 448958AB020651Hs.22653KIAA0844 protein 7.1 430152AB001325Hs.234642aquaporin 3 7.1 419474AW968619Hs.155849ESTs 7.1 401780 7.1 446052AA358760 gb:EST67699 Fetal lung7.0 II Homo Sapiens c 423605AF047826Hs.129887cadherin l9,type 2 7.0 433098AW190593Hs.151143ESTs 7.0 449511AI436187Hs.296261guanine nucleotide 6.9 binding protein (G
pr 451285AW137912Hs.227583Homo Sapiens chromosome6.8 X map Xp11.23 L-428414AL049980Hs.184216DKFZP564C152 protein 6.8 419273BE271180Hs.293490ESTs, Weakly similar 6.8 to 138022 hypothefi 443155854485Hs.23772ESTs 6.8 450561849674Hs.25909ESTs 6.8 g0 433068NM Hs.288215sialyltransterase 6.8 440729AA904739Hs.128204ESTs 6.8 448426BE018315Hs.280776tankyrase, TRF1-interacting6.7 ankyrin-rela 423589AA328082Hs.209569ESTs 6.6 415681AI379882Hs.72630ESTs 6.5 413510F13044 gb:HSC3HH101 normalized6.4 infant brain cDN

427992Y15014Hs.181353UDP-Gal:betaGIcNAC 6.4 beta 1,3-galactosyitr 453344BE349075Hs.44571ESTs 6.4 450642839773Hs.7130copine IV 6.4 432251AW972983Hs.232165polycythemia rubra 6.4 vera 1: cell surface 429322086984Hs.199243KIAA0231 protein 6.4 444927AW016637Hs.199425ESTs 6.4 447482A8033059Hs.18705KIAA1233 protein 6.4 1 400332S66407Hs.248032FLT4 6.3 ~

440703AL137663Hs.7378Homo Sapiens mRNA; 6.3 cDNA DKFZp434G227 (fr 446129AW244073Hs.t45946ESTs 6.3 454076AW204712Hs.61957ESTs 6.3 ~

425526AA359933 gb:EST69040 Fetal lung6.3 II Homo Sapiens c 15421913AI934365Hs.109439osteoglycin (osteoinducfive6.3 factor, mime 434273AA913143Hs.26303ESTs 6.2 408480A1350337Hs.164568filuoblast grovrth 6.2 factor 7 (keratinocyte 451301AI769514Hs.209890EST 6.2 430754AW862610Hs.157068ESTs 6.2 438356AA805530Hs.48527ESTs 6.2 422743BE304678Hs.119598ribosomal protein L3 6.2 453355AW295374Hs.31412Homo Sapiens cDNA FLJ114226.2 fis, clone HE

426388AW081394Hs.97103ESTs 6.2 452502A1904296 gb:PM-BT046-220199-286_16.t BT046 Homo sapi 2 402546 6.1 457534A1761307Hs.232226ESTs 6.1 408165AL137573Hs.43143Homo Sapiens mRNA; 6.1 cDNA DKFZp564A2463 (f 404958 6.1 432501BE546532Hs.25682Homo Sapiens mRNA for 6.1 KIAA1863 protein, 442979AW440782Hs.174743ESTs 6.1 422262AL022315Hs.113987lecfin, galactoside-binding,6.0 soluble, 2 408713NM Hs.47042ectonucleoside triphosphate6.0 001248 diphosphohyd 454065BE394588 gb:601311808Fi NIH 6.0 MGC 44 Homo Sapiens c 430004027768Hs.227571regulator of G-protein5.9 signalling 4 354o1sz1 s.s 425087862424Hs.126059ESTs 5.9 446298AF187813Hs.i4637kidney-and liver-specific5.9 gene 417761813727Hs.21435ESTs 5.9 424806AA382523Hs.105689MSTP031 protein 5.9 441695T12411Hs.183745hypothetical protein 5.9 457483AB034694Hs.272558endomucin-1 5.9 417175844558Hs.94002ESTs 5.8 437483AL390174 gb:Homo sapiens mRNA; 5.8 cDNA DKFZp547J184 436427AI344378Hs.143399ESTs 5.8 45411939A1365585Hs.146246ESTs 5.8 459053A1807052Hs.210361ESTs 5.7 411052AW814950 gb:MR1-ST0206-130400-023-d065.7 ST0206 Homo 431063298949Hs.326843hypothetical protein 5.7 bk125H2.1 450382AA397658Hs.60257Homo Sapiens cDNA FLJ135985.7 fis, clone PL

408478NM Hs.45740gamma-aminobutyric 5.7 000806 acid (GAGA) A recepto 442676AI733585Hs.130897ESTs 5.7 446443AV659082Hs.134228ESTs 5.7 400865 5.7 459080AW192083Hs.290855ESTs 5.6 5 407952AI215902Hs.88845ESTs, Highly similar 5.6 5 to T50835 hypothefi 431984AL080239Hs.272284Human DNA sequence 5.6 from clone GS1-256022 425705AF007833Hs.159265kruppel-related zinc 5.6 finger protein hcKr 442238AW135374Hs.270949ESTs, Moderately similar5.6 to F41925 hypot 422994AW891802Hs.296276ESTs 5.6 60457148AF091035Hs.184627KIAA0118 protein 5.6 428356AL046991Hs.10338ESTs 5.6 415927AL120168Hs.78919Kell blood group precursor5.5 (Mcleod pheno 402092 5.5 440526AI832243Hs.211471ESTs 5.5 65444409A1792140Hs.49265ESTs 5.5 417877A1025829Hs.86320ESTs 5.4 458238AW071521Hs.333541beta-amyloid binding 5.4 protein precursor 430702056979Hs.250651H factor 1 (complement)5.4 456189H91010Hs.44940ESTs 5.4 427424AA402453Hs.113011ESTs 5.4 437354AA749215Hs.291886ESTs 5.4 455617BE078070 gb:CM1-BT0614-160300-149-f025.4 BT0614 Homo 429290AF203032Hs.198760neurofilament, heavy 5.3 polypeptide (200kD) 427861AA813185Hs.98183ESTs 5.3 75408556049516Hs.463625-hydroxytryptamine 5.3 (serolonin) receptor 444209AI753134Hs.146494ESTs 5.3 422831802504Hs.332943ESTs 5.3 403180 5.3 418026BE379727Hs.83213fatty acid binding 5.3 protein 4, adipocyle 430339W28608Hs.239625integral membrane protein5.2 431596T34708Hs.272927Sec23 (S. cerevisiae) 5.2 homolog A

431930AB035301Hs.272211cadherin 7, type 2 5.2 437403AI208149Hs.121196ESTs 5.2 438285AA782845Hs.22790ESTs 5.2 439901N73885Hs.124169ESTs 5.2 438507AA809052Hs.211275ESTs 5.2 449222AW293984Hs.197621ESTs 5.2 402834AK001507Hs.306084Homo Sapiens clone 5.2 FLB6914 PR01821 mRNA, 419042T81429Hs.221065ESTs 5.2 436777AA731199Hs.293130ESTs 5.2 445071A1280246Hs.149504ESTs 5.1 408016AW136827Hs.256096ESTs S.i 1 412047AA934589Hs.49696ESTs 5.1 436953AW959074Hs.23648Homo Sapiens cDNA FLJ 5.1 13097 fis, clone NT

436773AW078629Hs.82110PC4 and SFRSi interacting5.1 protein 1 409263AA069573Hs.50319ESTs 5.1 453830AA534296Hs.20953ESTs 5.1 1 459580AA022888Hs.176065ESTs 5.1 417616807728Hs.268668ESTs 5.1 423457F08208Hs.283844similar to rat fricarboxylate5.1 carrier-li 441535AL135735Hs.7885phosphafidylinositol 5.0 binding clathrin as 416490AF090116Hs.79348regulator of Gprotein 5.0 signalling 7 417284N62889Hs.107242Homo Sapiens cDNA FLJ129655.0 fis, clone NT

447135T58148 gb:yb98gO6.s1 Stratagene5.0 lung (937210) H

448605AL109678Hs.21597Homo Sapiens mRNA full5.0 length insert cDN

442240AI791883Hs.292719ESTs 4.9 459399BE407712Hs.i53998crealine kinase, mitochondria)4.9 1 (ubiqui 25427972AA864870Hs.181304putative gene product 4.9 432944AA570687Hs.38512ESTs 4.9 440198BE560093 gb:601345159F1 NIH_MGC_84.9 Homo Sapiens cD

444047A1097452Hs.135095ESTs 4.9 416040AW819158Hs.289044Homo Sapiens cDNA FLJt20484.9 fis, clone HE

444922AI921750Hs.144871Homo Sapiens cDNA FLJ 4.8 13752 fis, clone PL

436670AI690021Hs.201536ESTs 4.8 448072A1459306Hs.24908ESTs 4.8 408936AL138043Hs.293549ESTs 4.8 412622AW664708Hs.171959ESTs 4.8 3 414943D80647Hs.124193ESTs 4.8 S

429254H10133Hs.91846hypothetical protein 4.8 DKFZp761C121 453567AI742835Hs.33368hypotheficalprotein 4.8 407906AA369665Hs.41185Homo Sapiens mRNA; 4.8 cDNA DKFZp56401262 (f 441028AI333660Hs.17558Homo Sapiens cDNA FLJ 4.7 14446 fis, clone HE

405130 4.7 455225AW996689 gb:OV3-BN0046-150400-151-g094.7 BN0046 Hamo 446218AV657159 gb:AV657159 GLC Homo 4.7 Sapiens cDNA clone 443347A1052543Hs.133244melanoma-derived leucine4.7 zipper, extra-n 402176 4.7 45416577BE063207Hs.79381grancalcin 4.7 436221AK001781Hs.296543Homo Sapiens cDNA FLJ109194.7 fis, clone OV

420480AL137361Hs.98173hypotheficalprotein 4.7 400800Y10262Hs.46925eyes absent (Drosophila)4.6 homotog 3 435161AF124150Hs.272091ESTs 4.6 404793 4.6 430895U66581Hs.248121G protein-coupled receptor4.6 438571AW020775Hs.56022ESTs 4.6 445924AI264671Hs.164166ESTs 4,6 444585AW170015Hs.6594ESTs 4.6 55421044AF061871Hs.311736Human DNA sequence 4.6 from clone RP1-238D15 418274AI458587Hs.128677Human DNA sequence 4.6 from clone RP1-50024 425475W56339Hs.107057ESTs 4.6 434311BE543469Hs.266263Homo sapiens cDNA FLJ141154.5 fis, clone MA

414272AI651603Hs.46988ESTs 4.5 445235A1564022Hs.138207ESTs 4.5 414327BE408145Hs.185254ESTs, Weakly similar 4.5 to T24435 hypotheti 414630BE410857 gb:601301 177F1 NIH 4.5 MGC 21 Homo Sapiens c 414456H74314 gb:yu56e10.r1 Soares 4.5 fetal liver spleen 401024 4.5 65414699A1815523Hs.76930synuclein, alpha (non 4.5 A4 component of am 423449AI497900Hs.33067ESTS 4.5 405138 4.5 413544BE147225 gb:PM2-HT0225-031299-003-f114.5 HT0225 Homo 453880AI803166Hs.28462ESTs, Weakly similar 4.5 to 138022 hypothefi 433521T66087Hs.112482Homo Sapiens unknown 4.4 mRNA sequence 441184AA922009Hs.150269ESTs 4.4 429876A8028977Hs.225974KIAA1054 protein 4.4 445481AW661846Hs.148836ESTs 4.4 452340NM_002202Hs.505ISL1 transcription 4.4 factor, LIMlhomeodoma 75404769 4.4 444331AW193342Hs.24144ESTs 4.4 429726AW628326Hs.27151ESTs 4.4 449093AB035356Hs.22998neurexin 1 4.4 451959AA056203Hs.27337hypothetical protein 4.4 415716N59294Hs.179662nucleosome assembly 4.4 protein 1-like 1 417888823053 gb:yh31a05.r1 Soares 4.4 placenta Nb2HP Homo 419656AB002314Hs.92025KIAA0316 gene product 4.4 425864U5(i420Hs.159903olfactory receptor, 4.4 family 5, subfamily 435078AW518888Hs.40937ESTs 4.4 413493BE144444 gb:MRO-HT0168-141199-002-1094.3 HT0168 Homo 432712AB016247Hs.288031sterol-CS-desaturase 4.3 (fungal ERG3, delta 459650825754Hs.301185ESTs 4.3 404828 4.3 423782AI472209Hs.323117ESTs 4.3 426867AA460967Hs.22668ESTs 4.3 426802AA385182Hs.46699ESTs 4.3 457353X65633Hs.248144melanocortin 2 receptor4.3 (adrenocorficotr 1 412112BE180342 gb:RC3HT0622-130400-012-a074.3 ~ HT0622 Homo 401522N47812Hs.306198CGI-35 protein 4.3 419055A1365384Hs.11571Homo Sapiens cDNA FLJ115704.3 fis, clone HE

410171H07892Hs.12431ESTs 4.3 419564U08989Hs.91139solute carrier family 4.3 1 (neuronaUepithe I 458789AL157468Hs.325825Homo Sapiens cDNA FW208484.3 S fis, clone AD

455040AW852286 gb:OVO-CT0225-10040187-0OS4.3 CT0225 Homo 438533AI440266Hs.170673ESTs, Weakly similar 4.3 to T24832 hypothefi 459005AA447679Hs.144558ESTs, Weakly similar 4.2 to ALU1 HUMAN ALU
S

418489U76421Hs.85302adenosine deaminase, 4.2 RNA-specific, 81 (h 433389AF038171 gb:Homo Sapiens clone 4.2 23671 mRNA sequenc 454356AW390363Hs.11522hypothefical protein 4.2 from Xq28 442339BE299668Hs.227591ESTs, Weakly similar 4.2 to 1901303A Leu zip 421249AA285362 gb:HTH277 HTCDL1 Homo 4.2 Sapiens cDNA 5'13' 443998AI620661Hs.296276ESTs 4.2 25 452197AW023595Hs.232048ESTs 4.2 451117AA015752Hs.205173ESTs 4.2 404501AW247252Hs.75514nucleoside phosphorylase4.2 410378823324Hs.41693DnaJ (Hsp40) homolog, 4.2 subfamily B, membe 422528AB011182Hs.118087KIAA0610 protein 4.2 3~ 440323AA970614Hs.127992ESTs 4.1 425767AF054176Hs.159483chromosome 1 open reading4.1 frame 7 434460AA478486Hs.3852KIAA0368 protein 4.1 410362H0481 Hs.93164proprolein convertase 4.1 t subtilisinlkexin t 413121T96090Hs.142678ESTs 4.1 3 409403AA668224Hs.6634Homo Sapiens cDNA: 4.1 FLJ22547 fis, clone H

450235AA007512Hs.17538ESTs 4.1 449754H00820Hs.30977ESTs, Weakly similar 4.1 to 834087 hypothefi 421813BE048255 gb:1z49b05.y1 NCI CGAP_Bm524.1 Homo sapien 408496AI683802Hs.136182ESTs 4.1 430261AA305127Hs.237225hypothetical protein 4.1 434101AA625205Hs.259599KIAA1622 protein 4.1 451837T92157Hs.16970ESTs 4.1 411772BE170301 gb:OV4-HT0536-040500-193_f054.1 HT0536 Homo 437630A1252782Hs.153026SWAP-70 protein 4.1 45 430212AA469153 gb:nc67f04.s1 NCI_CGAP_Pr14.0 Homo Sapiens 400216 4.0 429830AI537278Hs.225841DKFZP434D193 protein 4.0 453165574727Hs.32042aspartoacylase (aminoacylase4.0 2, Canavan 418047837633Hs.4847ESTs 4.0 405354 4.0 427931AW206512Hs.186996ESTs 4.0 428775AA434579Hs.i43691ESTs 4.0 449422AA001373Hs.59821ESTs 4.0 453864AW021407Hs.21068hypothetical protein 4.0 5 456407AW968614 gb:EST380690 MAGE resequences,4.0 5 MAGJ Homo 441869NM Hs.8004hunfingfin-associated 4.0 003947 protein interacfin 420784T65158Hs.102399ESTs, Moderately similar4.0 to S65657 alpha 425195AA352026Hs.94319VPS10 domain receptor 4.0 protein 429628H09604Hs.13268ESTs 4.0 410087F12079Hs.332579ESTs 4.0 409840AW502122 gb:Ul-HF-BROp-ajr~-08-0-ULr14.0 NIH_MGC_5 452854AA437061Hs.14060prokineficin 1 precursor4.0 419910AA662913Hs.190173ESTs, Weakly similar 4.0 to A46010 X-linked 427443AA402713Hs.97872ESTs 4.0 65 414990C17758Hs.221652Homo Sapiens cDNA FLJ143233.9 fis, clone PL

412678AA115575Hs.114914ESTs 3.9 405629 3.9 420299A1056871Hs.15276ESTs 3.9 453098225935Hs.86379ESTs 3.9 435752AF230801 gb:Homo Sapiens growth3.9 hormone receptor 441005141305Hs.303172Homo Sapiens mRNA; 3.9 cDNA DKFZp547G133 (fr 414516AI307802Hs.135560ESTs, Weakly similar 3.9 to T43458 hypotheti 442257AW503B31Hs.323370Human EST clone 25267 3.9 mariner lransposon 422563BE299342Hs.19348hypothetical protein 3.9 75 406697M21388Hs.123017Human unproducfively 3.9 rearranged Ig mu-ch 443850AW014723Hs.334612ESTs 3.9 412677AW029608H5.17384ESTs 3.9 422788AL717352Hs.120828Human ONA sequence 3.9 from clone RPS-876810 405377 3.9 414376BE393856Hs.66915ESTs. Weakly similar 3.9 to 16.7Kd protein ~

453341AI758912Hs.296341adenylyl cyclase-associated3.9 protein 2 431960AW24182tHs.301927c6.lA 3.9 416854H40164Hs.80296Purkinje cell protein 3.9 427264AA400117Hs.125747ESTs 3.9 422746NM Hs.119651glypican 3 3.9 452346BE243534 gb:TCBAP1D0885 Pediatric3.9 pre-B cell acut 414666NM Hs.76828glypican 5 3.8 418217AI910647Hs.13442ESTs 3.8 419118AA234223Hs.139204ESTs 3.8 445017A1205493Hs.176860ESTs 3.8 405867 3.8 4227608E409561 gb:601299865F1 NIH 3.8 21 Homo Sapiens c MGC

453863X02544Hs.572_ 3.8 _ orosomucoid 1 457821H47166Hs.124322ESTs, Weakly similar 3.8 to A47582 Bell gr 457330A8013818Hs.247220peroxisome biogenesis 3.8 factor 10 435600AL047034Hs.119747ESTs 3.8 456083U46922Hs.77252fragile histidine triad3.8 gene I 413341H78472Hs.i91325ESTs, Weakly similar 3.8 S to 718967 hypotheti 449057A8037784Hs.22941KIAA1363 protein 3.8 421835F06504Hs.27384ESTs. Moderately similar3.8 to ALU4_HUMAN A

414764AW013887Hs.72047ESTs 3.8 404391 3.7 433629813140Hs.13359ESTs 3.7 424738A1963740Hs.46826ESTs 3.7 401315 3.7 407706AA191085Hs.26612ESTs, Moderately similar3.7 to S23650 retro 440530AA888646Hs.174187ESTs 3.7 25 433930AA620338Hs.273781ESTs 3.7 409662AW452320Hs.279726ESTs 3.7 437268AI754847Hs.227571regulator of G-protein3.7 signalling 4 445668AI248205Hs.153244ESTs 3.7 408593819566Hs.197617ESTs 3.7 3 417091AA193283Hs.291990ESTs 3.7 448556AW885606H5.5064ESTs 3.7 423135N67655Hs.26411ESTs 3.7 400135 3.7 459150BE155356 gb:PMt-HT0350-160300-009-d063.7 HT0350 Homo 35 457221AW383197Hs.218260ESTs 3.7 451660AI807927Hs.249601ESTs 3,7 401600BE247275Hs.151787U5 snRNP-specific protein,3.7 116 kD

446818AI342668Hs.279765ESTs 3.7 447795AW295151Hs.i63612ESTs 3.7 4~ 427562856424Hs.26534ESTs 3.6 412258AA376768Hs.324841hypothetical protein 3.6 454339AW381980 gb:OV4-HT0316-091199-028-d053.6 HT0316 Homo 439274AF086092Hs.48372ESTs 3.6 452381H23329Hs.290880ESTs, Weakly similar 3.6 to ALU1 HUMAN ALU S

45 422897AA679784Hs.4290_ 3.6 ESTs 429656X05608Hs.211584neurofilamenL light 3.6 polypeptide (68kD) 421908AW935200Hs.285814sprouly (Drosophila) 3.6 homolog 4 407978AW385129Hs.41717phosphodiesterase 1A, 3.6 calmodulin-depende 426452AW614271Hs.121647ESTs, Highly similar 3.6 to AC006014 8 simil 400685 3.6 417154AI674701Hs.21388ESTs 3.6 447176242549Hs.160893ESTs 3.6 423893AL031709Hs.134846Human DNA sequence 3.6 from clone 316612 on 449231BE410360Hs.298573KIAA1720 protein 3.6 5 411607AW853498 gb:RCt-CT0252-170200-025-h023.6 5 CT0252 Homo 405977 3.6 441470BE503874Hs.301986ESTs 3.6 423568NM Hs.129818growth arrest-specfic 3.6 441235AI884586Hs.135570Homo Sapiens cDNA: 3.6 FLJ21268 fis, clone C

60 450236AW162998Hs.24684KIAA1376 protein 3.6 425364AF052150Hs.155959Homo Sapiens clone 3.6 24533 mRNA sequence 426775AA384564Hs.108829ESTs 3.6 414831M31158Hs.77439protein kinase, CAMP-dependent,3.6 regulato 416876AW501916Hs.i17897ESTs 3.6 65 400878 3.6 425153AW023193Hs.27046ESTs 3.6 432222AI204995 gb:an03c03.x1 SUatagene3.5 schizo brain St 415047F13142 gb:HSC3JD031 normalized3.5 infant brain cDN

401532 3.5 446495D60923Hs.153460ESTs 3.5 431325AW026751Hs.5794ESTs, Weakly similar 3.5 to 2109260A B cell 445898AF070623Hs.13423Homo Sapiens clone 3.5 24468 mRNA sequence 455901BE155527 gb:PM1-HT0350-190400-013-b083.5 HT0350 Homo 416421AA134006Hs.79306eukaryolic translation3.5 initiation factor 7 455697BE067952 gb:CMO-870365-061299-122-g093.5 5 870365 Homo 405678 3.5 418207C14685Hs.34772ESTs . 3.5 425383D83407Hs.156007Down syndrome critical3.5 region gene 1-lik 417027AA192306Hs.23926Uiadin 3.5 408367AK~1178Hs.44424homolog of rat orphan 3.5 transporter v7-3 417702809935Hs.191146ESTs 3.5 445687W80382Hs.149297ESTs 3.5 408776AA057365Hs.63356ESTs, Weakly similar 3.5 (0138022 hypolheti 413164BE068494 gb:MRi-BT0371-050500-009-a123.5 BT0371 Homo 414593BE386764 gb:601273249F1 NIH 3.5 MGC 20 Homo Sapiens c 453220A8033089Hs.32452Homo Sapiens mRNA 3.5 for KIAA1263 protein, 415621AI648602Hs.55468ESTs 3.5 454437A1248173Hs.191460hypolheficalprotein 3.5 446066A1343931Hs.149383ESTs 3.5 423374AB037770H5.127656KIAA1349 protein 3.5 419347C15944Hs.90005superioroervical ganglia,3.5 neural specifi 418516NM Hs.85701phosphoinosifide-&kinase.3.5 006218 catalytic, al 1 451776W45679Hs.169854hypothefical protein 3.5 ~ SP192 432305M62402Hs.274313insulin-like growth 3.5 factor binding prole 456995T89832Hs.170278ESTs 3.5 403323 3.5 425022M95724Hs.154207centromere protein 3.5 15 439394AA149250Hs.56105ESTs 3.4 433803AI823593Hs.27688ESTs 3.4 450715A1266484Hs.31570ESTs, Weakly similar 3.4 to KIAA1324 protein 411474AW84842 7 gb:IL3-CT0214-150200-07SH103.d CT0214 Homo 415076NM Hs.77890guanylate cyGase 1, 3.4 000857 soluble, beta 3 20 423826020325Hs.1707cocaine-and amphetamine-regulated3.4 Uans 459495BE544158 gb:601076707F1 NIH_MGC_123.4 Homo Sapiens c 427173BE255017Hs.97540ESTs 3.4 408112AW451982Hs.248613ESTs 3.4 446092N33522Hs.145894ESTs 3.4 25 416868A1656856Hs.292597ESTs 3.4 458234BE551408Hs.127196ESTs 3.4 419555AA244416 gb:nc07d11.s1 NCI 3.4 CGAP Pr1 Homosapiens 414314BE312991 gb:601150275F1 NIH 3.4 MGC_19 Homo Sapiens c 400425AY004252Hs.287385PR domain containing 3.4 30 414366BE549143 gb:601076456F1 NIH_MGC_i23.4 Homo Sapiens c 434053AW445136HS.134946ESTs 3.4 449997A1683052Hs.201577KIAA1829 protein 3.4 433461A1636047Hs.197623ESTs 3.4 428006AA418743Hs.98306KIAA1862 protein 3.4 3 424695058331Hs.151899sarcoglycan, delta 3.4 (35kD dystrophin-asso 443294AI733625Hs.133053ESTs 3.4 428212AW444451Hs.134812ESTs 3.4 457673AA551569Hs.272034hypothetical protein 3.4 446390AA233393Hs.14992hypothefical protein 3.3 FLJt1151 428536AI143139Hs.2288visinin-like 1 3.3 426597AA382250Hs.145601ESTs 3.3 410366A1267589Hs.302689hypothe6calprotein 3.3 458258AW406546H5.127971ESTs 3.3 401738 3.3 45 409038T97490Hs.50002small inducible cytokine3.3 subfamily A (Cy 425785T27017Hs.159528Homo Sapiens clone 3.3 24400 mRNA sequence 433328AW298159Hs.23644ESTs, Weakly similar 3.3 to S65824 reverse t 414541BE293116Hs.76392aldehyde dehydrogenase3.3 1 family, member 434998AW975157Hs.26037ESTs 3.3 456359AI967991Hs.93574homeo box D3 3.3 426527NM Hs.170238sodium channel, voltage-gated,3.3 001037 type I, b 454267AA437199Hs.656cell division cycle 3.3 400302N48056Hs.1915folate hydrolase (prostate-specific3.3 memb 434077AF116659Hs.321151Homo Sapiens PR01412 3.3 mRNA, complete cds S 436602AI793222Hs.166817ESTs 3.3 449204AB000099Hs.23251Down syndrome critical3.3 region gene 4 417935853697Hs.170044ESTs 3.3 423310AA325225Hs.124023Homo Sapiens cDNA 3.3 FLJ14218 fis, clone NT

436624T64297Hs.5241fatty acid binding 3.3 protein 1, liver ()~453406AI192987Hs.61784hypothefical protein 3.3 FLJ1445t 420164AW339037Hs.24908ESTs 3.3 447826AW779317Hs.258556ESTs 3.3 419875AA853410Hs.93557proenkephalin 3.3 444612AW138111Hs.22902ESTs 3.3 65 416504BE159718Hs.85335Homo Sapiens mRNA; 3.2 cDNA DKFZp564D1462 (f 415242845986Hs.295014ESTs 3.2 418188AW139413Hs.151880ESTs 3.2 430355NM Hs.239818phosphoinosifide-3-kinase,3.2 006219 catalyfic, be 421640AW966652 gb:EST378726 MAGE 3.2 resequences, MAGI
Homo 70 432359AA076049Hs.274415Homo Sapiens cDNA 3.2 FLJ 10229 fis, clone HE

408806AW847814Hs.289005Homo Sapiens cDNA: 3.2 FLJ21532 fis, clone C

400409AF153341Hs.283954Homo Sapiens winged 3.2 helix/forkhead Uans 446015T30968Hs.13531hypotheficatprotein 3.2 425495AA358454Hs.78026ESTs, Weakly similar 3.2 to similar to ankyr 75 403092 3.2 452971A1873878Hs.91789ESTs 3.2 454186BE141030 gb:MRO-HT0067-201099-002-h113.2 HT0067 Homo 401485 3.2 401949 3.2 457452AW972675 gb:EST384766 MAGE 3.2 resequences. MAGL
Homo 454100AI693231Hs.126043chromosome 21 open 3.2 reading frame 51 448440AA173467Hs.62402p211Cdc42/Rac1-activated3.2 kinase 1 (yeast 421200AA284811Hs.264433ESTs 3.2 430142NM Hs.234392platelet-activating 3.2 000437 (actor acetylhydrola 433197AB040889Hs.281022KIAAi456 protein 3.2 443509AV645470 gb:AV645470 GLC Homo 3.2 Sapiens cDNA clone 440827AI733110Hs.t28t28ESTs 3.2 432799NM Hs.278960alpha-1,4-N-acetylglucosaminylVansferas3.2 409257AW370362 gb:RC1-BT0255-181099-012-d073.2 BT0255 Homo 459235BE246010Hs.271468Homo Sapiens mRNA for 3.2 FLJ00038 protein, 416789AA223439Hs.79933cyclin I 3.2 429809AL162010Hs.223603Homo Sapiens mRNA; 3.2 cDNA DKFZp761 D09121 ( 1 420156AW449258Hs.6t87ESTs 3.2 ~

455577BE006341 gb:RC2-BNOt27-240300-011-b053.2 8N0127 Homo 400617AFi51064Hs.36069hypotheticalprotein 3.2 437129AL049327Hs.302057Homo sapiens mRNA; 3.2 cDNA DKFZp564E016 (fr 451820AW05B357Hs.337353ESTs 3.2 15 457535AA609685Hs.278672membrane component, 3.2 chromosome t1, surfa 419956ALt37939Hs.40096ESTs 3.1 456235AA203637 gb:zx58bi2.ri Soaves 3.i fetal_liver_spleen_ 423930AA332697Hs.42721ESTs 3.1 403796 3.1 414085AA1140t6Hs.75746aldehyde dehydrogenase3.1 1 family, member 445886AI793176Hs.145596ESTs 3.1 414401A1760159Hs.124833ESTs 3.1 441573BE563966Hs.6529ESTs, Weakly similar 3.1 to 178885 serinefth 450725R7t389Hs.175951ESTs 3.1 2 458805A1282933Hs.23294hypotheUCalprotein 3.1 417868Al078534Hs.122592ESTs 3.1 458391A1792628Hs.133273ESTs 3.1 423346A1267677Hs.t27416synaptojanin 1 3.1 454486AW857077 gb:RC1-CT0302-140300-016-f043.1 CT0302 Homo 408341AW182952Hs.249957ESTs 3.1 410669AW805749Hs.318885superoxide dismutase 3.1 2, mitochondria) 404907 3.1 434910AI333863Hs.215474ESTs, Moderately similar3.i to altemativel 436990AI149729Hs.120557ESTs 3.1 3 441921A1733376Hs.164478hypothetical protein 3.
S FLJ21939 similar to t 454673AW8i2807 gb:RC3-ST0186-070100-Ot6~043.1 ST0186 Homo 429470AI878901Hs.203862guanine nucleotide 3.1 binding protein (G
pr 404345AA730407Hs.159156protocadherin 11 3.1 408217AI433201Hs.279860tumor protein, translationally-conVolle3.1 417313AA195602 gb:zr32(09.r1 Soaves 3.1 NhHMPu_St Homosapi 427322AK002017Hs.176227hypotheticalprotein 3.1 411003AA181018Hs.13056hypothetical protein 3.1 425339AA936330Hs.198113ESTs 3.i 426716NM Hs.171921sema domain, immunoglobulin3.1 006379 domain (1g), 45 449078AK001256Hs.22975KIAA1576 protein 3.1 429608U49250Hs.210862T-box,brain,l 3.1 442308AA989402Hs.111fibroblast growth factor3.1 9 (glia-activat 428465AW970976Hs.293653ESTs 3.1 411666AF106564Hs.71346neurofilament 3 (150kD3.1 medium) 447965AW292577Hs.94445ESTs 3.t 413918AW015898Hs.71245ESTs 3.1 419682H13139Hs.922B2paired-like homeodomain3.1 Uanscription fa 425810AI923627Hs.31903ESTs 3.i 427865AA4t6931Hs.126065ESTs 3.1 55 429060AW139t55Hs.194995hypothetical protein 3.1 DKFZp43400320 430708U78308Hs.278485olfactory receptor, 3.1 family 1, subfamily 448084AI467800Hs.271000ESTs. Weakly 'similar 3.1 to 138022 hypothe6 454506AW847346 gb:RCO-CT0205-240999-021~0t3.1 CT0205 Homo 414629AA345824Hs.76688carboxylesterase 1(monocytelmacrophage3.0 422963M79141Hs.13234ESTs 3.0 417696BE24t624Hs.82401CD69 antigen (p60, 3.0 early Tcell activati 448175BE296174Hs.225160hypothetical protein 3.0 FlJ 13102 414686BE409757Hs.23189ESTs, Moderately similar3.0 to TBB2-HUMAN T

458360A1027207Hs.132253ESTs 3.0 65 451829AW964081Hs.247377ESTs 3.0 445179AI949743Hs.224768ESTs 3.0 433090A1720050Hs.145362immortalization-upregulated3.0 protein 432018AA524447Hs.152377ESTs 3.0 407988N47760Hs.285107hypolheticalprolein 3.0 405911 3.0 418808A1821836Hs.t0359ESTs 3.0 431900AW972048Hs.192534ESTs 3.0 452893HtBOi7Hs.22869ESTs, Moderately similar3.0 to KIAA1395 pro 423952AW877787Hs.136t02KIAA0853protein 3.0 75 412000AW576555Hs.15780ATP-binding cassette, 3.0 sub-family A (ABC1 405793 3.0 410711AB002316Hs.65746KIAA0318 protein 3.0 411279AW884776 gb:OV4-OT0067-010300-121-d013.0 OT0067 Homo 423957AW978309Hs.136235Homo Sapiens cDNA FLJ135423.0 fis, clone PL

427071AA397958Hs.192719ESTs 3.0 434961AW974956 gb:EST387061 MAGE resequences,3.0 MAGN Homo TABLE 10B:

Pkey: Unique Eos probeset identifier number CAT number: Gene cluster number Accession: Genbank accession numbers J Pkey CAT Number Accession 409257 1112994_1 AW370362AW809101 409840 1156071 1 AW502122 AW502125 AW50t663 AW501720 411052 1230374 1 AWBt4950 898513 H69459 BE176242 H54583 411474 1247047_2 AW848427 AW848890 AW848159 AW848118 AW848634 AW848285 4t 1607 1251251 1 AW853498 AW853442 AW853590 AW853433 AW853592 412112 1277883_1 BE180342 BE180347 AW90t900 BE180222 BE180218 BE180226 BEt80413 BE180416 AW901899 BE180228 AW901897 BE180224 AW901898 BE180223 BE180219 BE180346 BE180343 8E180418 BE180225 BE180221 BE18034t AW90t894 BE180217 BE180227AW90189i BE180345 413164 1351422_1 BE068494 BE068414 BE068332 BE068347 BE068706 BE068623 BE068390 BE068419 BE068393 BE068447 BE068675 BE0683i1 BE068540 BE068301 2S 413493 13735551 BEt444448E144430 413510 1374377_1 F13044 T77009 BE145525 BE145493 413544 1375671 1 BE147225 BE147205 BEi47234 414456 1447655_1 H74314 BE299593 414630 1468083 t BE410857 BE390605 415047 1517450 1 F13t42 242926 F06135 F06147 H08517 D51360 T75341 417888 1706092 t 823053 879884 876271 421813 207654 t BE048255 AA313083 AA298419 430212 314437 t AA469153 AI718503 AA469225 S ~ 443509 57199 t AV645470 T84636 T82805 S S 452502 919733_1 A1904296 BE007223 830687 454065 998401 1 BE394588 AWOZ4754 BE183166 BE183t67 BE141030BE14t474BEt41467BE141753BE141024BE14t761AW177583AW177579AW177582AW17758 BEi41477 BE141520 BEi41456 BE141492 BE141028 BE141775 BE141489 BE141751 AW177599 BE141750AW177597 BE14t512 BE141460 BE141749 AWi 77598 454339 1122972 1 AW381980 BE152244 BEi52235 BEt52238 BE152232 454673 12286691 AW8t2807AW812815AW812802 455040 1250028 t AW852286 AW851934 AW852096 AW852274 455617 1346117 t BE078070 BE06t030 BE077927 455901 1381569 1 BE155527 BE155503 BE155188 BEt55126 70 456235 168686 t AA203637 AA832266 H67452 456407 184986_1 AW968614 AA2d3209 AA281411 7S TABLE 10C:
Pkey: Unique number corresponding to an Eos probeset Ref: Sequence source. The 7 digit numbers in this column are Genbank Identifier (GI) numbers. 'Dunham, et al.' refers to the publication entitled 'The DNA
sequence of human chromosome 22' Dunham, et al. (1999) Nature 402:489-495.
Strand: Indicates ONA strand from which exons were predicted.
Nt~osifion: Indicates nucleotide posifions of predicted exons.
Pkey Ref SVand Nt~osifion 400661 8118474 Plus 84912-85187 4006858118768Minus72969-73050,73713-73600 4008651945037Minus44482-45526 4008789864757Plus 31493-32842 4010248117489Plus 60551-60802 4013159212516Minus198960-199619 4014857341723Plus 68009-68209,68841-69077 4015217705251Plus 9127-9234 4015327798785Plus 124414-124950,125050-125418 4017382982169Minus41547-41757 1 4017807249190Minus28397-28617,28920-29045,29135-29296,29411-29567,29705-29787,30224-30573 ~

4018367534063Plus 71981-72084 4019493492889Plus 160728-161660 4020927249154Minus107533-108094 4021767543687Minus10-750 1 4025467637348Plus 24673-25170 4030928954241Plus 174720-175016,175104-175406,175508-175813 4031807523976Minus63603-63759 4033238348082Minus120366-120845 4037968099896Minus75073-77664 4043913135305Minus26030-26173,27852-27997 4047698099713Minus175801-176823 4047937232206Minus61087-61590 4048286580415Minus26291-27253 4049077331453Minus102880-103828 Z 4049587407941Minus2731-0531 4050717708797Minus111f5-11552 4051308516045Plus 15023r150449 4051388576241Plus 90303-90516 4053542642452Plus 52213-53089 4053775649375Plus 216656-216848 4056294508116Minus101678-101866 4056784079670Plus 151821-152027 4057931405887Minus89197-89453 4058002791346Plus 19271-19813 3 4058676758731Minus74553-75173 4059116758795Plus 101008-101643 4059778247789Minus135548-136177 4O TABLE 11A: ABOUT 533 CNS-ENRICHED GENES SIGNIFICANTLY DOWN-REGULATED IN
GLIOBLASTOMA COMPARED TO NORMAL ADULT CNS TISSUES
Table 11A lists about 533 CNS-enriched genes significantly down-regulated in glioblastoma compared to normal adult CNS tissues. These were selected from 59680 probesets on the AtTymetrixlEos Hu03 GeneChip array such that the ratio of 'average' normal CNS to'average' glioblastoma was greater than or equal to 2. The'average' normal CNS level was set to the 75th percentile amongst various normal CNS tissues. The'average' glioblastoma level was set to the BSth percentile artwngst various tumor samples. To enrich for CNS
45 specific genes, the ratio of'average' CNS to'average' non-CNS normal adult tissues was calculated to be greater than or equal to 2. The'average' CNS
level was set to the BSth percentile amongst vrious CNS tissues. The'average' normal non-CNS adult tissue level was set to fhe 85th percentile amongst various non-CNS normal tissues. In order to remove gene-specific background levels of non-specific hybridization, the 10th percentile value amongst various non-malignant tissues was subtracted from both the numerator and the denominator before the ratios were evaluated.
Pkey: Unique Eos probesel identifier number ExAccn: ExempIarACCession number, Genbank accession number UnigenelD: Unigene number Unigene Title: Unigene gene title Rt: Ratio of 75th percentile normal central nervous system tissue to 85th percentile tumor R2: Ratio of 85th percentile central nervous system tissue to 85th percentile normal body tissue 55 Pkey ExAccnUnigenelDUnigeneTitle R1 R2 417275X63578Hs.295449parvalbumin 29.0 30.0 430829AW451999Hs.194024ESTs 25.7 6.2 410657AF063228Hs.65248dynein, cytoplasmic, 22.6 25.8 intermediate polype 419954014720Hs.93883myelin protein zero 21 30 (Charcot-Marie-Tooth 2 3 416133NM Hs.89512ATPase, Ca++transporting,. .
001683 plasma membra 15.5 16.8 416018AW138239Hs,78977proprotein convertase 15.2 18.0 subtilisinlkexin t 417167AW206437Hs,4290ESTs 14.8 17.7 433940H05129Hs.7459cyclic AMP-regulated 13.4 18.1 phosphoprotein, 21 413324V00571Hs.75294crorticotropin releasing13.1 18.0 65 hormone 439830AA846666Hs.t51489ESTs, Weakly similar 12.6 16.5 to XE7_HUMAN PROTEI

408068AW148652Hs.167398ESTs 12.6 16.9 429096AB011106Hs.196012KIAA0534 protein 12.2 21.1 412638AA910199Hs.203838ESTs 12.2 16.0 442593839804Hs.31961ESTs 10 15 446353A1290919Hs.153661ESTs . .
10.4 13.2 426365AA376667Hs.10283RNA binding motif protein10.0 5.9 BB

414937838698Hs.12382ESTs 10.0 10.8 419643F06066Hs.91791chromosome t t open 9.5 10.9 reading frame 25 412454855745Hs.167330ESTs 9 14 75 439366AF100143Hs.6540fibrobtast growth factor. .
13 9.4 12.3 441790AW294909Hs.132208ESTs 9.2 3.2 448117H49129Hs.t72982ESTs 9.1 12.8 433558AA833757Hs.201769ESTs, Weakly similar 9.0 14.7 to T24435 hypotheti 412453820205Hs.167330ESTs 9 7 8~ 408920AL120071Hs.48998fibronectin leucine . .
rich transmembrane 8.9 17.3 p 409031AA376836Hs.76728ESTs g,7 g.6 446544AI631932Hs.7047ESTs, Weakly similar 8.2 20.0 to Unknown [H.sapie 439480AL038511Hs.125316ESTs. Weakly similar 8.2 8.3 to 533990 finger pr 410200AA082557Hs.101915Stargardt disease 3 8.0 8.9 (autosomal dominant) 408428NM Hs.44896DnaJ (Hsp40) homolog, 7.9 9.6 014787 subfamily 8, membe 437073AI885608Hs.94122ESTs 7.9 11.3 408434AW195317Hs.107716hypothetical protein 7.9 16.4 440209H05049Hs.22269neurexin 3 7.8 34.3 408119W26213Hs.101672ESTs, Weakly similar 7.8 9.0 to T00331 hypothefi 429611AI889077HS.211388Homo Sapiens BAC clone7.7 5.0 CTB-60N22 from 7q 423440825234Hs.143434contactin 1 7.7 9.9 445148AI214510Hs.146304ESTs 7.6 9.1 416294D86980Hs.79170KIAA0227 protein 7.6 7.6 424087N69333Hs.143434contacfin 1 7.6 10.3 437479861866Hs.101277ESTs 7.5 9.3 430573AA744550Hs.136345ESTs 7.1 2.8 448958A8020651Hs.22653KIAA0844 protein 7.1 10.4 419474AW968619Hs.155849ESTs 7.1 3.0 423605AF047826Hs.129887cadherin 19, type 2 7.0 6.9 433D98AW190593Hs.151143ESTs 7.0 9.2 449511AI436187Hs.296261guanine nucleofide 6.9 3.1 binding protein (G
pr 428414AL049980Hs.i84216DKFZP564C152protein 6.8 5.0 443155854485Hs.23772ESTs 6.8 3.5 450561849674Hs.25909ESTs 6.8 8.1 433068NM Hs.288215sialyllransferase 6.8 2.0 423589AA328082Hs.209569ESTs 6.6 10.5 415681A1379882Hs.72630ESTs 6.5 9.0 z5413510F13044 gb:HSC3HH1D1 normalized6.4 7.1 infant brain cDN

427992Y15014Hs.181353UDP-Gal:belaGIcNAc 6.4 9.5 beta t,3-galactosyltr 450642839773Hs.7130copine IV 6.4 5.7 429322D86984Hs.199243KIAA0231 protein 6.4 8.2 447482AB033059Hs.18705KIAA1233 protein 6.4 2.3 446129AW244073Hs.145946ESTs 6.3 8.3 421913A1934365Hs.109439osteoglycin (osteoinductive6.3 2.1 (actor, mime 434273AA913143Hs.26303ESTs 6.2 10.3 408480A1350337Hs.164568fibroblast growth factor6.2 3.5 7 (kerafinocyte 451301AI769514Hs.209890EST 6.2 12.4 35438356AA805530Hs.48527ESTs 6.2 8.1 426388AW081394Hs.97103ESTs 6.2 8.6 452502AI904296- gb:PM-BT046-220199-2866.1 2.8 1 BT046 Homo sapi 408165AL137573Hs.43143Homo sapiens mRNA; 6.1 6.3 cDNA DKFZp564A2463 (( 442979AW440782Hs.174743ESTs 6.1 6.3 40408713NM Hs.47042ectonucleoside biphosphate6.0 3.8 001248 diphosphohyd 430004U27768Hs.227571regulator of Gprotein 5.9 21.4 signalling 4 425087862424Hs.126059ESTs 5.9 8.1 441695T12411Hs.183745hypothetical protein 5.9 3.1 417175844558Hs.94002ESTs 5.8 12.5 45437483AL390174 gb:Homo Sapiens mRNA; 5.8 2.2 cDNA DKFZp547J184 436427A1344378Hs.i43399ESTs 5.8 13.8 450382AA397658Hs.60257Homo Sapiens cDNA FLJ 5.7 4.4 13598 fis, clone PL

408478NM Hs.45740gamma-aminobutyric 5.7 12.5 000806 acid (GAGA) A recepto 442676AI733585Hs.130897ESTs 5.7 6.8 446443AV659082Hs.134228ESTs 5.7 6.4 459080AW192083Hs.290855ESTs 5.6 15.6 431984AL080239Hs.272284Human DNA sequence 5.6 8.2 from clone GSi-256022 428356AL046991Hs.10338ESTs 5.6 6.2 417877A1025829Hs.86320ESTs 5.4 4.9 429290AF203032Hs.198760neurofilamenl, heavy 5.3 13.1 S polypeptide (200kD) 408556U49516Hs.463625-hydroxytryptamine 5.3 6.6 (serotonin) receptor 431930AB035301Hs.272211cadherin 7, type 2 5.2 6.0 438285AA782845Hs.22790ESTs 5.2 7.3 439901N73885Hs.124169ESTs 5.2 2.7 449222AW293984Hs.197621ESTs 5.2 8.1 408016AWi36827Hs.256096ESTs 5.1 2.5 436953AW959074Hs.23648Homo Sapiens cDNA FLJ130975.1 3.0 fis, clone NT

436773AW078629Hs.82110PC4 and SFRSt interacting5.1 7.3 protein 1 409263AA069573Hs.50319ESTs 5.1 12.9 453830AA534296Hs.20953ESTs 5.1 3.4 441535AL135735Hs.7885phosphafidylinositol 5.0 4.8 binding clathrin as 416490AF090116Hs.79348regulator of G-protein5.0 20.1 signalling 7 417284N62889Hs.107242Homo Sapiens cDNA FLJ129655.0 3.9 fis, clone NT

448605AL109678Hs.21597Homo Sapiens mRNA full5.0 6.1 length insert cDN

442240AI791883Hs.292719ESTs 4.9 6.7 427972AA864870Hs.181304putative gene product 4.9 5.2 416040AW819158Hs.289044Homo Sapiens cDNA FLJ 4.9 2.8 12048 fis, clone HE

444922AI921750Hs.144871Homo Sapiens cDNA FLJ137524.8 3.7 fis, clone PL

408936AL138043Hs.293549ESTs 4.8 6.6 75414943D80647Hs.124193ESTs 4.8 3.1 429254H10133Hs.91846hypotheficalprotein 4.8 2.3 DKFZp761C121 407906AA369665Hs.41185Homo Sapiens mRNA; 4.8 9.1 cDNA DKFZp56401262 (f 416577BE063207Hs.79381grancalcin 4.7 2.2 420480AL137361Hs.98173hypothetical protein 4.7 2.8 404793 4.6 2.2 430895U66581Hs.248121G protein-coupled receptor4.6 7.4 438571AW020775Hs.56022ESTs 4.6 5.4 444585AW170015Hs.6594ESTs 4.6 6.0 414272AI651603Hs.46988ESTs 4.5 2.2 414699A1815523Hs.76930synuclein, alpha (non 4.5 30.9 A4 component of am 423449AI497900Hs.33067ESTs 4.5 20.8 433521T66087Hs.112482Homo Sapiens unknown 4.4 2.0 mRNA sequence 429876A8028977Hs.225974KIAA1054 protein 4.4 19.2 429726AW628326Hs.27151ESTs 4.4 10.2 449093AB035356Hs.22998neurexin 1 4.4 9.4 415716N59294Hs.179662nucleosome assembly 4.4 15.1 protein 1-like 1 419656A8002314Hs.92025KIAA0316 gene product 4.4 8.2 425864U56420Hs.159903olfactory receptor, 4.4 2.4 family 5, subfamily 435078AW518888Hs.40937ESTs 4.4 5.7 432712A8016247Hs.28803tsterol-CS-desalurase 4.3 5.9 (fungal ERG3, delta 426867AA460967Hs.22668ESTs 4.3 6.0 412112BE180342 gb:RC3-HT0622-130400-012-a074.3 3.2 HT0622 Homo 410171H07892Hs.1243tESTs 4.3 5.3 442339BE299668Hs.227591ESTs, Weakly similar 4.2 5.0 to 1901303A Leu zip 421249AA285362 gb:HTH277 HTCDLi Homo 4.2 3.5 Sapiens cDNA 5'!3' 422528AB011182Hs.118087KIAA0610 protein 4.2 3.9 434460AA478486Hs.3852KIAA0368 protein 4.1 8.3 410362H04811Hs.93164proprotein convertase 4.1 7.0 subGlisinlkexin t 449754H00820Hs.30977ESTs, Weakly similar 4.1 3.9 to 834087 hypotheti 408496AI683802Hs.136182ESTs 4.1 4.7 434101AA625205Hs.259599KIAA1622 protein 4.1 6.3 430212AA469153 gb:nc67f04.s1 NCI_CGAP4.0 2.5 Pr1 Homosapiens 453165S74727Hs.32042aspartoacylase (aminoacylase4.0 7.4 2, Canavan 456407AW968614 gb:EST380690 MAGE msequences,4.0 5.1 MAGJ Homo 441869NM Hs.8004huntingtin-associated 4.0 32.3 003947 protein interactin 429628H09604Hs.13268ESTs 4.0 4.5 410087F12079Hs.332579ESTs 4.0 6.9 419910AA662913Hs.190173ESTs, Weakly similar 4.0 2.6 to A46010 X-linked 441005241305Hs.303172Homo Sapiens mRNA; 3.9 21.7 cDNA DKFZp547G133 (fr 412677AW029608Hs.17384ESTs 3.9 2.2 453341AI758912Hs.29634tadenylyl cyclase-associated3.9 7.2 , protein 2 416854H40164Hs.80296Purkinje cell protein 3.9 2.2 414666NM Hs.76828glypican5 3.8 6.2 418217AI910647Hs.13442ESTs 3.8 3.2 421855F06504Hs.27384ESTs, Moderately similar3.8 2.2 to ALU4_HUMAN A

414764AW013887Hs.72047ESTs 3.8 10.7 433629813140Hs.13359ESTs 3.7 2.7 424738A1963740Hs.46826ESTs 3.7 2.1 407706AA191085Hs.26612ESTs, Moderately similar3.7 5.3 to S23650 reUO

437268AI754847Hs.227571regulator of Gprolein 3.7 53.7 signalling 4 423135N67655Hs.26411ESTs 3.7 21.7 446818AI342668Hs.279765ESTs 3.7 2.6 427562856424Hs.26534ESTs 3.6 3.6 439274AF086092Hs.48372ESTs 3.6 34.5 452381H23329Hs.290880ESTs, Weakly similar 3.6 6.0 to ALU1 HUMAN ALU
S

422897AA679784Hs.4290ESTs 3.6 5.1 429656X05608Hs.211584neurofilament, light 3.6 24.6 polypeptide (68kD}

417154AI674701Hs.21388ESTs 3.6 5.8 447176242549Hs.160893ESTs 3.6 6.4 405977 3.6 3.9 423568NM Hs.129818growth arrest-specific3.6 2.5 441235AI884586Hs.135570Homo sapiens cDNA: 3.6 5.4 FLJ21268 fis, clone C

SS 426775AA384564Hs.108829ESTs 3.6 3.4 414831M31158Hs.77439protein kinase, CAMP-dependent,3.6 2.8 regulato 425153AW023193Hs.27046ESTs 3.6 4.9 446495D60923Hs.1534b0ESTs 3.5 9.8 445898AF070623Hs.13423Homo Sapiens clone 3.5 16.6 24468 mRNA sequence 416421AA134006Hs.79306eukaryotic Uanslation 3.5 5.0 initiation factor 418207C14685Hs.34772ESTs 3.5 16.0 425383D83407Hs.156007Down syndrome critical3.5 6.2 region gene t-lik 417027AA192306Hs.23926Uiadin 3.5 2.5 408367AK001178Hs.44424homolog of rat orphan 3.5 5.3 Uansporter v7-3 408776AA057365Hs.63356ESTs, Weakly similar 3.5 5.5 to 138022 hypotheti 453220AB033089Hs.32452Homo Sapiens mRNA for 3.5 23.6 KIAA1263 protein, 419347C15944Hs.90005superiorcervical ganglia,3.5 42.3 neural specifi 433803AI823593Hs.27688ESTs 3.4 3.6 450715A1266484Hs.31570ESTs, Weakly similar 3.4 4.1 to KIAA1324 protein 415076NM Hs.77890guanylate cyclase t, 3.4 9.8 000857 soluble, beta 3 423826U20325Hs.1707cocaine- and amphetamine-regulated3.4 4.7 traps 427173BE255017Hs.97540ESTs 3.4 2.4 446092N33522Hs.145894ESTs 3.4 3.5 416868A1656856Hs.292597ESTs 3.4 4.5 458234BE551408Hs.127196ESTs 3.4 4.5 434053AW445136Hs.134946ESTs 3.4 3.9 428536AI143139Hs.2288visinin-like 1 3.3 42.3 410366AI267589Hs.302689hypotheticalprotein 3.3 14.4 425785T27017Hs.159528Homo Sapiens clone 3.3 4.6 24400 mRNA sequence g0 434998AW975157Hs.26037ESTs 3.3 4.7 456359AI967991Hs.93574homeo box D3 3.3 4.4 426527NM Hs.170238sodium channel, voltage-gated,3.3 5.2 001037 type I, b 400302N48056Hs.1915folate hydrolase (prostate-specific3.3 9.0 memb 419875AA853410Hs.93557proenkephalin 3.3 3.6 444612AW138111Hs.22902ESTs 3.3 3.0 415242845986Hs.295014ESTs 3.2 2.2 421640AW966652 gb:EST378726 MAGE resequences,3.2 3.8 MAGI Homo 408806AW847814Hs.289005Homo Sapiens cDNA: 3.2 2.4 FLJ21532 fis, clone C

446015T30968Hs.13531hypothetical protein 3.2 3.2 425495AA358454Hs.78026ESTs, Weakly similar 3.2 2.2 to similar to ankyr 403092 3.2 2.9 452971AI873878Hs.91789ESTs 3.2 4.5 454100A1693231Hs.126043chromosome 21 open 3.2 2.7 reading frame 5t 448440AA173467Hs.62402p211Cdc42IRaci-acfivated3.2 2.8 kinase 1 (yeast 421200AA284811Hs.264433ESTs 3.2 2.7 440827AI733110Hs.128128ESTs 3.2 2.1 429809AL162010Hs.223603Homo Sapiens mRNA; 3.2 4.3 cDNA DKFZp761009121 ( 420156AW449258Hs.6187ESTs 3.2 19.0 457535AA609685Hs.278672membrane component 3.2 2.0 chromosome 11, surfs 419956ALi37939Hs.40096ESTs 3.1 8.7 423930AA332697Hs.42721ESTs 3.1 2.7 417868A1078534Hs.122592ESTs 3.1 12.6 423346AI267677Hs.127416synaplojanin 1 3.1 12.0 441921AI733376Hs.164478hypothefical protein 3. t 4.3 FU21939 similar to 429470AI878901Hs.203862guanine nucleofide 3.1 5.3 binding protein (G
pr 408217AI433201Hs.279860turtar protein, Uanslafionallycontrolle3.1 7.1 427322AK002017Hs.176227hypothetical protein 3,1 6.3 449078AK001256Hs.22975KIAA1576 protein 3.1 30.1 429608049250Hs.210862T-box, brain, t 3. t 2.2 442308AA989402Hs.111fibroblast growth factor3.1 3.0 9 (glia-acfivat 411666AF106564Hs.71346neurofilament 3 (150kD3.1 10.9 medium) 427865AA416931Hs.126065ESTs 3.t 7.5 430708078308Hs.278485olfactory receptor, 3.1 3.4 family 1, subfamily 451829AW964081Hs.247377ESTs 3.0 6.2 405911 3.0 2.4 418808AI821836Hs.10359ESTs 3.0 6.2 452893H180t7Hs.22869ESTs. Moderately similar3.0 5.1 to KIAA1395 pro 423952AW877787Hs.f36102KIAA0853protein 3.0 2.1 412000AW576555Hs.15780ATP-binding cassette, 3.0 2.1 sub-family A (ABCt 405793 3.0 2.7 410711A8002316Hs.65746KIAA0318 protein 3.0 14.3 427071AA397958Hs.192719ESTs 3.0 2.1 453534NM Hs.33187KIAA0748 gene product 3.0 14.5 413903AA496493Hs.23136ESTs 3.0 2.2 426866002330Hs.172816neuregulin t 3.0 11.3 434945A8033065Hs.4280KIAA1239 protein 3.0 3.5 412639AW961284Hs.296235ESTs 2.9 4.9 453590AF150278Hs.33578KIAA0820 protein 2.9 33.1 414502AL133721Hs.224680ESTs 2.9 2.3 434367AB020700Hs.3830KIAA0893 protein 2.9 23.1 425121A1797511Hs.154679synaptotagminl 2.9 8.1 412494AL133900Hs.792ADP-ribosylafion factor2.9 20.8 domain protein 1 401213 2.9 3.2 401028AW673312Hs.50848hypothefical protein 2.9 3.4 415191AA190381Hs.120810ESTs 2.9 3.0 449275AW450848Hs.205457periaxin 2.9 5.6 419863AW952691Hs.93485Homo Sapiens mRNA; 2.9 35.0 cDNA DKFZp761 D191 (fr 411421BE272110Hs.21177ESTs 2.9 2.0 430865A1073424Hs.5232HSPC125 protein 2.9 11.4 437486AW952089Hs.5636RAB6A, member RAS oncogene2.9 2.2 family 442357AI458586Hs.135706ESTs 2.9 6.0 408274817315 gb:yg12g11.r1SoaresinfantbrainlNIBH2.9 2.2 444185AW298350Hs.66020ESTs 2.8 5.0 420173AA256151Hs.22999ESTs 2.8 5.1 428358AA993222Hs.101915Stargardt disease 3 2.8 7.0 (aulosomal dominant) 447252890916Hs.12449Homo Sapiens Uansmembrane2.8 4.4 protein HTMPt 440260AI972867Hs.7130copinelV 2.8 10.6 417084H08370Hs.33067ESTs 2.8 8.4 438257AW474419Hs.224794ESTs 2.8 2.8 441934T23939Hs.7344ESTs 2.8 6.2 447885F11528Hs.303172Homo Sapiens mRNA; 2.8 3.5 cDNA DKFZp547G133 (fr 423552AF107028Hs.129783sodium channel, voltage-gated,2.8 3.4 type II, 450940AI744943Hs.143209ESTs, Weakly similar 2.8 14.4 to 138022 hypotheti 410011AB020641Hs.57856PFTAIRE protein kinase2.8 21.7 445887AI263105Hs.145597ESTs 2.8 5.1 425494N55540Hs.78026ESTs. Weakly similar 2.8 2.4 to similar to ankyr 438202AW169287Hs.22588ESTs 2.8 11.9 436199838946Hs.127951hypothetical protein 2.8 6.0 434826AF155661Hs.22265pyruvate dehydrogenase2.8 2.4 phosphatase 415462852692Hs.12698ESTs 2.8 3.4 418070NM Hs.83407glutamate receptor, 2.8 4.5 000844 metabotropic 7 432149AW614326Hs.157022ESTs, Weakly similar 2.8 9.5 to T34549 probable g0 430371D87466Hs.240112KIAA0276 protein 2.B 7.0 437357AL359559Hs.331666Homo Sapiens mRNA; 2.7 2.5 cDNA DKFZp76202215 (f 415838844336Hs.7093ESTs 2.7 3.6 438675AA813725Hs.213568ESTs 2.7 2.5 419558AW953679 gb:EST365749 MAGE resequences,2.7 3.1 MAGC Homo 446318AI949389Hs.18067ESTs 2.7 4.1 445183A8007877Hs.12385KIAA0417 gene product 2.7 5.3 457012841480Hs.127630ESTs 2.7 19.0 431988AC002302Hs.77202protein kinase C, beta2.7 7.2 430223NM Hs.235935nephroblastoma overexpressed2.7 2.8 002514 gene 447932AA837474Hs.20021vesicle-associated 2.7 3.8 membrane protein 1 (s 450214BE439763Hs.227571regulator of G-protein2.7 6.9 signalling 4 434731AA648049Hs.1215i8ESTs 2.7 5.0 428839A1767756Hs.82302Homo Sapiens cDNA FU148142.7 5.2 fis, clone NT

407709AA456135Hs.23023ESTs 2.7 2.5 422420U03398Hs.1524tumor necrosis factor 2.7 3.3 (Iigand) superfami 443305A1050693Hs.133318ESTs 2.7 5.9 435648H24347Hs.27524ESTs 2.7 15.0 I 418407AL044818Hs.84928nuclear transcription 2.7 2.7 S factor Y, beta 436771AW975687Hs.292979ESTs 2.7 6.0 428689NM Hs.189810sulfortranferase family2.7 4.8 014351 4A, member 1 440503NM Hs.7235calcium channel, voltage-dependent,2.7 4.4 006539 gamm 441006AW605267Hs.7627CGI-60 protein 2.7 3.1 410330AW023630Hs.46786ESTs 2.6 29.5 434398AA121098Hs.3838serum-inducible kinase2.6 2.6 438831BE263273Hs.6439synapsin II 2.6 7.8 4166 298492Hs.6975PR01073protein 2.6 3.4 412643AW971239Hs.293982ESTs 2.6 2.2 430456AA314998Hs.241503hypotheficalprotein 2.6 17.9 416498U33632Hs.79351potassium channel, 2.6 2.9 subfamily K, member 401421 2.6 2.0 419530X98330Hs.90821ryanodine receptor 2.6 4.2 2 (cardi~) 441817AW969706Hs.293332ESTs 2.6 3.8 439203AA448930Hs.8453KIAA1587 protein 2.6 4.2 426054U12431Hs.166109ELAV (embryonic lethal,2.6 5.1 abnormal vision, 444583AW994403Hs.100861hypothetical protein 2.6 3.7 417919AI928203Hs.86379ESTs 2.6 3.0 434293NM Ns.3796EphB6 2.6 3.2 431716D89053Hs.2680f2fatty-acid-CoenzymeAligase,long-chain2.6 6.4 443037AW500305Hs.299166syntaxin 7 2.6 2.2 440736D56919Hs.265848myomegalin 2.6 7.1 404648 2.6 3.0 429995AA463571 gb:zx72e09.r1 Soares 2.6 3.5 total fetus Nb2HF8_ 436508AW604381Hs.i21121ESTs, Weakly similar 2.6 3.9 to S00755 pleckstri 441190H09073Hs.25046ESTs 2.6 3.1 432278AL137506Hs.274256hypothetical protein 2.6 2.9 442731AI868167Hs.131044ESTs 2.6 4.1 416836D54745Hs.80247cholecystokinin 2.6 14.9 449071NM Hs.22960breast carcinoma amplified2.5 2.4 005872 sequence 2 436321AA709133Hs.180144ESTs 2.5 2.8 439693AI741816Hs.125897ESTs 2.5 3.6 443212AW269515Hs.102500hypothefical protein 2.5 2.8 423981AL122104Hs.136664Homo Sapiens mRNA; 2.5 3.8 cDNA DKFZp434A1627 (f 407868NM Hs.40637proline-rich Gla (Gcarboxyglutamic2.5 3.1 000950 acid 443992AW02222Hs.322922ESTs 2.5 27.9 444124843097Hs.6818ESTs 2.5 5.3 411379AI816344Hs.12554ESTs, Weakly similar 2.5 38.0 to NPL4 HUMAN NUCLE

440474AI207936Hs.7195gamma-aminobutyric 2.5 3.8 acid (GABA) A recepto 446277AI284218Hs.159204ESTs 2.5 2.2 410111AI620206Hs.189647ESTs 2.5 3.5 445162AB011131Hs.12376piccolo (presynapfic 2.5 4.8 cytomaUix protein) 410718AI920783Hs.191435ESTs 2.5 4.5 417201T60432Hs.269084ESTs, Moderately similar2.5 2.9 to AF0979941 L

420274AW968000Hs.143389ESTs, Weakly similar 2.5 2.8 to T14318 ubiquifin 433496AF064254Hs.49765VLCS-H1 protein 2.5 4.7 437331AL353933Hs.21710hypothetical protein 2.5 3.3 DKFZp761G0313 437368AI471969Hs.182606ESTs 2.5 3.0 441985BE047625Hs.169815ESTs 2.5 3.6 410025BE220489Hs.113592ESTs, Moderately similar2.5 9.2 to 154374 gene 414680AA743331Hs.272572hemoglobin, alpha 2 2.5 3.6 429956AI374651Hs.22542ESTs 2.5 23.9 429028AA443439Hs.48797ESTs 2.5 2.8 438109A1076621Hs.71367ESTs, Moderately similar2.5 3.1 to ALU7 HUMAN A

439780AL109688 ~b:Homo Sapiens mRNA 2.5 2.3 full length insert 440888N45600Hs.326880ESTs 2.5 3.9 445246A1217713Hs.147586ESTs 2.5 2.6 440152A8002376Hs.7006KIAA0378 protein 2.4 23.6 432740AF061034Hs.278898tumor necrosis factor 2.4 2.1 alpha-inducible ce 415122D60708Hs.22245ESTs 2.4 3.9 432298AL118812Hs.274293Homo Sapiens mRNA; 2.4 9.8 cDNA DKFZp76161111 (f 437948AA772920Hs.303527ESTs 2.4 9.8 421360AA297012Hs.103839erythrocyte membrane 2.4 2.8 protein band 4.1-li 427115AW972853Hs.112237ESTs 2.4 2.2 452074BE299035Hs.27747G proteincoupled receptor2.4 10.0 37 (endotheli 436639Di4838Hs.111fibroblast growth factor2.4 3.5 9 (glia-acfival 434520AA205273Hs.177011hypotheficalprotein 2.4 3.1 411529AA430348Hs.317596Homo Sapiens cDNA FLJ 2.4 3.0 12927 fis, clone NT

442272AA988302Hs.129172ESTs 2.4 2.1 422927AW247388Hs.301423calcium binding protein2.4 2.7 1 (calbrain) 444647Ht4718Hs.11506Human clone 23589 mRNA2.4 2.8 sequence 415827H17462Hs.23079ESTs 2.4 15.0 451397AA017432Hs.84529ESTs, Weakly similar 2.4 3.9 to 1202_HUMAN ZINC

445200AA084460Hs.12409somatostafin 2.4 3.7 451062AL110125Hs.25910Homo Sapiens mRNA; 2.4 2.4 cDNA DKFZp564C1416 (t 420328Y19062Hs.96870staufen (Drosophila, 2.4 4.3 RNA-binding protein 432122AA526514 gb:ni60t02.s1 NCI_CGAP2.4 4.3 Ov2 Homo Sapiens 1 444125AI124882Hs.118121ESTs 2.4 3.5 430538AB032435Hs.242821differenfiafion-associated2.4 10.8 Na-dependent 457519X69438Hs.3052early growth response 2.4 2.4 409371851736Hs.12381ESTs 2.4 2.1 456303AA224872Hs.115088ESTs 2.4 3.2 I 440105AA694010Hs.6932Homo Sapiens clone 2.4 23.4 S 23809 mRNA sequence 400979 2.4 4.1 435296849685Hs.24980ESTs 2.4 6.5 408950AA707814Hs.14945long fatty aryl-CoA 2.4 18.5 synthetase 2 gene 452032BE244005Hs.27610refinoic acid-and interferon-inducible2.4 2.2 20 432098AF252297Hs.91546cytochrome P450 refinoid2.4 2.7 metabolizing pr 408974AW015458Hs.297017ESTs 2.4 2.5 412177123091Hs.73734glycoprolein V (platelet)2.4 2.8 413153N94205 gb:za27a08.r1 Soares 2.4 2.5 fetal liver spleen 417583AA668782Hs.191284ESTs, Weakly similar 2.4 2.6 to ALU1 HUMAN ALU
S

25 452034F12234Hs.75893ankydn 3, node of Ranvier2.3 3.0 (ankyrin G) 424940AA985308Hs.194327ESTs 2.3 6.3 431706A1816086Hs.296341adenylyl cyclase-associated2.3 4.1 protein 2 419125AA642452Hs.130881Bell CLLllymphoma 11A 2.3 2.9 (zinc finger pro 423641ALi37256Hs.130489ATPase, aminophospholipid2.3 8.7 transporter-li 30 436407T88803Hs.271507ESTs, Weakly similar 2.3 3.2 to TIM HUMAN PROBAB

448681AL109781Hs.21754Homo Sapiens mRNA full2.3 5.2 length insert cDN

415669NM Hs.78589serine (or cysteine) 2.3 54.7 005025 proteinase inhibito 410765AI694972Hs.66180nucleosome assembly 2.3 9.1 protein 1-like 2 422386AF105374Hs.115830heparan sulfate (glucosamine)2.3 5.0 3-0-sulfot 35 414828AA156651 gb:z105hO5.r1 Soares_pregnanl2.3 2.4 uferus_NbH

445556AI910241Hs.12887actin-related protein 2.3 8.5 3-beta 426968U07616Hs.173034amphiphysin (Stiff-Mann2.3 26.3 syndrome with br 444562AA186715Hs.336429RIKEN cDNA 9130422N19 2.3 2.5 gene 423420AI571364Hs.128382Homo Sapiens mRNA; 2.3 7.6 cDNA DKFZp76111224 (f 40 439450851613Hs.125304ESTs 2.3 26.3 427127AW802282Hs.22265pyruvate dehydrogenase2.3 2.2 phosphatase 447179AW015633Hs.157299ESTs 2.3 3.8 414711Af310440Hs.288735Homo Sapiens cDNA FLJ135222.3 2.3 fis, clone PL

433449AW772282 gb:hn71b05.x1 NCI CGAP2.3 3.8 Kidl1 Homosapien 45 414320U13616Hs.75893ankyrin 3, node of 2.3 2.5 Ranvier (ankyrin G) 416778M16505Hs.79876steroid suttatase (microsomal),2.3 7.8 arylsulf 425130AA448208Hs.99163ESTs 2.3 4.1 456664AW963354Hs.334409metallothionein 1G 2.3 2.5 438283AI458931Hs.37282ESTs 2.3 4.2 50 417455AW007066Hs.18949ESTs, Weakly similar 2.3 3.0 to CA2B HUMAN COLLA

412100AW892731 gb:CMO-NN0005-100300-279-c022.3 3.7 NN0005 Homo 448981AI968719Hs.195387ESTs 2.3 3.2 416101824854Hs.268806ESTs 2.3 6.5 439731A1953135Hs.45140hypotheficalprotein 2.3 17.8 55 415734NM Hs.78748KIAA0237 gene product 2.3 40.1 424596AB020639Hs.151017estrogen-related receptor2.3 2.9 gamma 420230AL034344Hs.284186forkhead box C1 2.3 2.4 451559AL119980Hs.20935hypotheficalprotein 2.3 5.7 DKFZp7610221 404835 2.3 2.1 60 456765A1497900Hs.33067ESTs 2.3 4.1 455517AW984068 gb:RCO-HN0006-160300-011-e062.3 2.4 HN0006 Homo 408206AF041853Hs.43670kinesin family member 2.2 18.5 411770NM Hs.71992heat shock protein 2.2 3.9 014278 (hsp110 family) 430105X70297Hs.2540cholinergic receptor, 2.2 2.6 nicotinic, alpha p 65 458694F12832Hs.13298ESTs 2.2 4.9 415091AL044872Hs.779103-hydroxy-3-methylglutaryl-Coenzyme2.2 4.4 A sy 439642W81441Hs.153967ESTs 2.2 2.4 450138AW152104Hs.200879ESTs 2.2 4.9 454222BE144344Hs.7589ESTs, Weakly similar 2.2 3.7 to A46010 X-linked 70 405326 2.2 2.7 431342AW971018Hs.21659ESTs 2.2 5.2 453101AW952776Hs.94943ESTs 2.2 3.3 408897N50204Hs.283709lipopolysaccharide 2.2 2.8 specific response-7 p 451398AI793124Hs.144479ESTs 2.2 4.6 75 438208AL041224Hs.65379ESTs 2.2 10.4 408449NM Hs.166161dynamin 1 2.2 6.1 414130AI670831Hs.71592Homo Sapiens cDNA: 2.2 3.1 FLJ21893 fis, clone H

445016U79716Hs.i2246reelin 2.2 3.9 424375AF070547Hs.146312Homo Sapiens clone 2.2 2.3 24820 mRNA sequence g0 424645NM Hs.151449KIAA0535 gene product 2.2 11.7 409729D51315Hs.106289ESTs 2.2 4.9 432809AA565509Hs.131703ESTs 2.2 19.9 422890243784Hs.75893ankyrin 3, node of 2.2 10.4 Ranvier (ankyrin G) 428532AFi57326Hs.184786TBP-interacting protein2.2 6.5 413074A1871368Hs.8417hypothetical protein 2.2 3.4 DKFZp761M0423 414442AA156238Hs.32501ESTs 2.2 3.2 452768AW069459Hs.61539ESTs 2.2 2.0 450440AB024334Hs.25~1tyrosine 3-monooxygenaseltryptophan2.2 3.2 5-mo 426281AK000987Hs.169111oxidation rosistance 2.2 2.3 428411AW291464Hs.10338ESTs 2.2 2.3 413787AI352558Hs.75544tyrosine 3-monaoxygenase/tryptophan2.2 3.1 Smo 451734NM Hs.26944neurogranin (protein 2.2 8.5 006176 kinase C substrate, 439108AW163034Hs.6467synaptogyrin 3 2.2 7.9 405385 2.2 2.4 447285A1371849Hs.200696ATPase, Class VI, type2.2 2.2 452667187219Hs.13219ESTs 2.2 3.1 422234AF119818Hs.113287discs, large (Drosophila)2.1 8.3 homolog-associ 1 410339AI916499Hs.298258ESTs 2.1 3.2 413231D87461Hs.75244BCL2-like 2 2.1 4.5 447104Rt9085Hs.210706Homo Sapiens cDNA FLJ131822.1 2.2 fis, clone NT

451952AL120173Hs.301663ESTs 2.1 36.5 415841245637Hs.7093ESTs 2.1 2.4 441086A1928489Hs.213490ESTs, Weakly similar 2.1 2.2 to N33 HUMAN N33 PR

450407NM Hs.24969gamma-aminobutyric 2.1 6.6 000810 acid (GAGA) A recepto 427627887582Hs.179915guanine nucleotide 2.1 5.3 binding protein (G
pr 449712856545Hs.6100ESTs 2.1 4.5 409660AW452065Hs.258905ESTs 2.1 2.1 430434AL049548Hs.241420Homo Sapiens mRNA for 2.1 5.4 KIAA1756 protein, 434138AA625804 gb:zu86h01.s1 Soares_testis_NHT2.1 3.0 Homo sap 448610NM Hs.21602net (chicken)-like 2.1 4.8 418948AI217097 gb:qd43h07.x1 Soares 2.1 2.9 fetal_hearLNbHHI9W

414876AW950925Hs.924crystallin, mu 2.1 3.4 440426AI159800Hs.7181Homo Sapiens cDNA FLJ136632.1 3.7 fis, clone PL

451249AA016227Hs.27280ESTs 2.1 4.1 451475119093Hs.26450KIAA0725 protein 2.1 2.1 448743AB032962Hs.21896KIAA1136 protein 2.1 29.7 430814U89336Hs.247993NG5 protein 2.1 2.7 426990AL044315Hs.173094Homo Sapiens mRNA for 2.1 2.3 KIAA1750 protein, 426642AW068223Hs.171581ubiquifin Gterminal 2.1 4.5 hydrolase UCH37 427335AA448542Hs.251677G antigen 7B 2.1 2.2 459089F13036Hs.27373Homo Sapiens mRNA; 2. t 2.3 cDNA DKFZp56401763 (f 435832AA425688Hs.41641Bruno (Drosophila) 2.1 5.9 -like 4, RNA binding 446383105816Hs.92511ESTs 2.1 2.9 412768AW996044Hs.26239Human DNA sequence 2.1 2.1 from clone RP11-03882 453976BE463830Hs.163714ESTs 2.1 4.2 415111839039Hs.328455EST 2.1 3.3 452238F01811Hs.187931ESTs 2.1 4.9 445279841900Hs.22245ESTs 2.1 9.8 448799AI937094Hs.179080ESTs ~ 2.1 3.1 418338NM Hs.84154neuronal pentraxin 2.1 8.3 445725AK000956Hs.13209hypothetical protein 2.1 5.4 443537D13305Hs.203cholecystakinin B receptor2.1 4.1 454066X00356Hs.37058catcitoninlcalcilonin-related2.1 6.4 polypeptid 429954AI918130Hs.21374ESTs 2.1 7.2 415292H29016Hs.200576ESTs 2.1 3.9 423563834734Hs.75209protein kinase (cAMP~ependent,2.1 3.1 catalyti 424906AI566086Hs.153716Homo Sapiens mRNA for 2.1 4.7 Hmob33 protein, 3' 459309AA040620Hs.5672hypothetical protein 2.1 2.2 439340AB032436Hs.6535brain-specific Na-dependent2.1 4.7 inorganic ph 402598BE314624Hs.3128polymerase (RNA) II 2.1 5.4 (DNA directed) polyp 435406F26698Hs.4884calciuMcalmodulin-dependent2.1 6.6 protein kin 448792842550Hs.12826ESTs 2.1 4.1 449500AW956345Hs.12926ESTs 2.1 2.4 441134W29092Hs.7678cellular retinoic acid-binding2.1 5.8 protein 1 433361AW469373Hs.300141ribosomal protein L39 2.1 2.7 452946X95425Hs.31092EphAS 2.1 5.0 426167AF039023Hs.167496RAN binding protein 2.0 2.2 453666AW015681Hs.135229ESTs, Weakly similar 2.0 3.1 to A2BP_HUMAN ATAXI

424632AB014523Hs.151406KIAA0623 gene product 2.0 3.5 448589AF017090Hs.21554KIAA1107 protein 2.0 4.1 430416AC005531Hs.57806Homo Sapiens PAC clone2.0 2.3 RP4-701016 from 7 445627AW818475Hs.7363ESTs 2.0 2.1 417092H97508Hs.181165eukaryotic translation2.0 2.5 elongation factor 453653AW505554Hs.144559ESTs 2.0 4.7 435850AF250847Hs.283514mitochondria) ceramidase2.0 3.7 435086AW975243Hs.122596ESTs 2.0 2.1 423191D61506Hs.8417hypothetical protein 2.0 2.1 DKFZp761M0423 411562AL050201Hs.70769hypothefical protein 2.0 2.8 DKFZp586E1923 431645AF078849Hs.266483dynein light chain-A 2.0 2.5 429834AI929645Hs.225936synapsin I 2.0 3.6 439607BE540565Hs.159460ESTs 2.0 17.5 408033AW138045Hs.242256ESTs 2.0 4.0 430317AB020645Hs.239189glutaminase 2.0 2.7 419631AW188117Hs.303154popeye protein 3 2.0 2.6 432660A1288430Hs.64004ESTs 2.0 2.3 454048H05626Hs.6921ESTs 2.0 15.9 426917AA913814 Hs.172854 DKFZP586B0923 protein3.1 2.0 423246AL119114 Hs.77196 spectrin, alpha, non-erylhnxyfic2.9 1 (alp 2.0 415989AI267700 Hs.317584 ESTs 2.0 4.8 420276AA290938 Hs.190561 ESTs, Highly similar 5.1 to SORL_HUMAN SORTI 2.0 424983AI742434 Hs.169911 ESTs 2.0 15.9 446296AA985662 Hs.63131 Homo Sapiens cDNA FLJ 2.7 13155 fis, clone NT 2.0 450006AI241555 Hs.60171 ESTs 2.0 3.5 TABLE:
ltB

1 Pkey:Unique Eos probeset identifier number O

CAT
number:
Gene cluster number Accession:Genbank accession numbers Pkey CAT Number Accession I 408274104999 1 Ri 7315 243964 AA053547 S

_ BE180341 AW901894 456407184986_1 AW968614 AA243209 AA281411 TABLE
11C:

Pkey:Unique number corresponding to an Eos probesel 40 Ref: Sequence souroe. The 7 digit numbers et al.' refers to in this column are Genbank Identifier the publication (GI) numbers. 'Dunham, enfitled 'The DNA

sequence of human chromosome 22" Dunham, et al. (1999) Nature 402:489-495.

Strand:Indicates DNA strand from which exons were predicted.

Nt~osifion:
Indicates nucleofide posifions of predicted exons.

45 Pkey Ref Strand Nl_position 4009798072554 Plus 160842-161028 4012139858408 Plus 98243-98380,98489-98619 4014217452889 Minus 142291-142461 4030928954241 Plus 174720-175016,175104-175406,175508-175813 50 4046489796894 Minus 115334-116020 4047937232206 Minus 61087-61590 4048356970743 Plus 85462-85684,88139-88287,90338-91018,94827-94990 4053264375975 Plus 10633-10709,30805-30893,38078-38253.55112-55327,57718-57818,66696-66841 4053856552772 Plus 48332-48454 5 4057931405887 Minus 89197-89453 4059116758795 Plus 101008-101643 4059778247789 Minus 135548-136177 6O TABLE 12A: ABOUT 678 GENES UP-REGULATED IN LOWER GRADE GLIOBLASTOMA
COMPARED TO NORMAL CENTRAL NERVOUS SYSTEM
a a fists a u1 genes up-regu a a m ower gra a g io astoma compar to morma centra nervous sys em ese were se ecte om 80 probesets on the AffymetrixlEos Hu03 GeneChip array such that the ratio of 'average" LGG
to'average' CNS fissues was greater than or equal to 2.5. The "averse' LGG
level was set to the 85°' percentile amongst various LGG tumors. The'average' normal CNS fissue level was set to the 85'" percenfile amongst various CNS tissues. In order to remove gene-specific background levels of non-specific hybridization, the 10"' percentile value amongst various non-malignant fissues was subtracted from both the numerator and the denominator before 6$ the ratio was evaluated.
Pkey: Unique Eos probesel idenfifier number ExAccn: Exemplar Accession number, Genbank accession number UnigenelD: Unigene number Unigene Title: Unigene gene Gtle 70 Rt: Ratio of LOWER GRADE GLIOBIASTOMA to normal CNS
Pkey ExAan UnigenelDUnigene TiBe R1 412420 AL035668Hs.73853bone morphogenetic 20.3 protein 2 424800 AL035588Hs.153203MyoD family inhibitor19.5 75 453392U23752Hs.32964SRY (sex determining 18.5 region Y)-box 11 402604 Target Exon 16.9 444190 A1878918Hs.10526cysteine and glycine-richi5.0 protein 2 409638 AW450420Hs.21335ESTs 14.0 443731 A1083928Hs.145418ESTs 14.0 g0 456759BE259150Hs.127792delta (Drosophila)-like13.6 447342 AI199268Hs.19322Homo Sapiens, Similar12.2 to RIKEN cDNA 2010 433001 AF217513Hs.279905clone H00310 PR00310p110.3 427019 AA001732Hs.173233hypothefical protein 9.5 425187AW014486Hs.22509ESTs 9.0 440210AW674562Hs.125296ESTs 8.8 448769N66037Hs.38173ESTs 8.4 437034AA742643 gb:ny9lcOt.s1 NCI_CGAP_GC818.2 Homosapiens 449539W80363Hs.58446ESTs 8.1 417061AI675944Hs.188691Homo Sapiens cDNA 8.0 FLJ12033 fis, clone HE

435020AW505076Hs.301855DiGeorge syndrome 7,8 crifical region gene B

414217AI309298Hs.279898Homo Sapiens cDNA: 7.7 FLJ23165 fis, clone L

449300AI656959Hs.346514ESTs 7.6 449969AW295142Hs.180187Homo Sapiens cDNA 7.5 FLJ14337 fis, clone PL

452372AI885742Hs.228474ESTs 7.2 410102AW248508Hs.279727ESTs: homologue of 7.2 PEM-3 [Ciona savignyi 417308H60720Hs.81892KIAA0101 gene product7.2 447004AW296968Hs.157539ESTs 7.1 1 418113AI272141Hs.83484SRY (sex determining 7.1 S region Y)-box 4 424635AA420687Hs.115455Homo Sapiens cDNA 7.1 FLJ14259 fis, clone PL

406478 Target Exon 7.1 428728NM Hs.191381hypothefical protein 6.9 414761AU077228Hs.77256enhancer of zeste 6.9 (Drosophila) homolog 428037N47474Hs.89230potassium intertnediatelsmall6.7 conductance 423343AA324643Hs.246106ESTs 6.7 418097845137Hs.21868ESTs 6.7 431553X78075Hs.2799cartilage linking 6.6 protein 1 412326807566Hs.73817small inducible cytokine6.6 A3 (homologous 425397J04088Hs.156346topoisomerase (DNA) 6.4 II alpha (170kD) 419169AW851980Hs.262346ESTs, Weakly similar 6.4 to S72482 hypothe6 431117AF003522Hs.250500delta (Drosophila)-like6.4 445908813580Hs.13436Homo Sapiens clone 6.3 24425 mRNA sequence 402855 NM 001839':Homo Sapiens6.2 calponin 3, acid 424009F11690 gb:HSC30D041 normalized6.2 infant brain cDN

400419AF084545 Target 6.2 446584053445Hs.15432downregulated in ovarian6.0 cancer 1 414020NM Hs.75703small inducible cytokine6.0 002984 A4 (homologous 426140AF131798Hs.343768Homo Sapiens clone 5.9 25119 mRNA sequence 427144X95097Hs.2126vasoacfive intesfinal5.9 pepfide receptor 416658003272Hs.79432fibrillin 2 (congenital5.8 contracturat ara 405238 Target Exon 5.7 421977W94197Hs.110165ribosomal protein 5.7 L26 homolog 405348 07001664:gi~12698061~dbj~BA821849.1~5.6 (AB

428795845503Hs.97469ESTs, Highly similar 5.4 to A39769 N-acetyll 422672X12784Hs.i collagen, type IV, 5.3 19129 alpha 1 403349NM ephrin-B3 5.3 453941039817Hs.36820Bloom syndrome 5.2 429139F09092Hs.66087ESTs 5.2 454860AW835767 gb:OV4-LT0016-240200-110-b085.2 LT0016 Homo 452279AA286844Hs.61260hypothetical protein 5.1 418030BE207573Hs.83321neuromedin B 5.1 429469M64590Hs.27 glycine dehydrogenase5.1 (decarboxylafing;

450639AI703186Hs.277174ESTs 5.1 412811H06382 ESTs 5.1 442832AW206560Hs.253569ESTs 5.1 436608AA628980 down syndrome critical5.1 region protein DS

408161AW952912Hs.300383hypothetical protein 5.1 443744A1084326Hs.271548ESTs, Weakly similar 5.1 to 178885 serinetth 447497AW167254Hs.205722ESTs 5.0 450811AI739486Hs.245497ESTs 5.0 433244AB040943Hs.271285KIAA1510 protein 4.9 438458AW975186 gb:EST387294 MAGE 4.9 resequences, MAGN
Homo 438456AA913381Hs.20594ESTs 4.9 411048AK001742Hs.67991hypolheficalprotein 4.9 DKFZp434G0522 456304A1820973 gb:nc21c02.y5 NCI 4.9 CGAP Pr1 Homo Sapiens 442547AA306997Hs.217484ESTs, Weakly similar 4.9 to ALU1 HUMAN ALU
S

419991AJ000098Hs.94210eyes absent (Drosophila)4.8 homolog 1 402274 019000498':gij4567179jgbjAAD23607.1jAC004.8 420092AA814043Hs.88045ESTs 4.8 436282891913Hs.272104ESTs, Moderately similar4.8 to ALU1 HUMAN A

430809AI791150Hs.262009ESTs, Moderately similar4.8 to 138022 hypot 455104BE064863 gb:RC1-BT0313110300-015-f064.8 BT0313 Homo 403961 TargetExon 4.8 424954NM Hs.1846tumor protein p53 4.8 000546 (Li-Fraumeni syndrome) 414825X06370Hs.77432epidermal growth factor4.8 receptor (avian 447891841754Hs.6496ESTs 4.7 423529T87318Hs.120411ESTs 4.7 422737M26939Hs.119571collagen, type III, 4.7 alpha 1 (Ehters-Danl 7 428722076456Hs.190787fissue inhibitor of 4.6 S metalloproteinase 437698861837Hs.7990ESTs. Moderately similar4.6 to 184505 calci 403481 Target Exon 4.6 426075AW513691Hs.270149ESTs, Weakly similar 4.6 to 2109260A B cell 422170AI791949Hs.112432anti-Mullerian homwne4.6 g0 416379N38857Hs.203933ESTs 4.6 406481 Target Exon 4.5 456052BE311901Hs.28935gb:601142614F1 NIH 4.5 MGC 14 Homo Sapiens c 423178A1033140Hs.124983Homo Sapiens mRNA; 4.5 cDNA DKFZp564C142 (fr 411642NM Hs.71132neuroligin 1 4.5 428282N34905Hs.44653Homo Sapiens cDNA: 4.5 FW22669 fis, clone H

432625AI243596Hs.94830ESTs, Moderately similar4.5 to T03094 A-kin 452994AW962597Hs.31305KIAA1547 protein 4.5 449961AW265634Hs.133100ESTs 4.4 401454 NM 014226':Horta Sapiens4.4 renal tumor anti 406395 Target Exon 4.4 432281AK001239Hs.274263hypothetical protein 4.4 453792ALi34539Hs.254129KIAA1678 4.4 415131D61119 gb:HUM158C11B Gontech4.4 human fetal brain 437695AA769202Hs.192142ESTs 4.4 422081AW136820Hs.196011ESTs 4.4 437748AF234882Hs.5814suppression of tumorigenicity4.3 433323AA805132Hs.i59142ESTs 4.3 I 420352BE258835 gb:601117374F1 NIH 4.3 S MGC 16 Homo Sapiens c 444218AF070641Hs.10684Homo Sapiens clone 4.3 24421 mRNA sequence 441035AI694309Hs.126458ESTs 4.3 443836BE221613Hs.140553ESTs 4.3 425292NM Hs.15554537 kDa leucine-rich 4.3 005824 repeal (L88) protein 450166AA429504 ESTs 4.3 429149AW193360Hs.197962ESTs, Weakly similar 4.2 to 138022 hypothefi 422798892347Hs.34574ESTs. Weakly similar 4.2 to ALUt HUMAN ALU
S

451254AI571016Hs.172967ESTs 4.2 409189AA125984 gb:zn27hO6.ri SUatagene4.2 neuroepithelium 445118AI208762Hs.345572ESTs 4.2 444326A1939357Hs.270710ESTs 4.2 456060C14904Hs.45184Homo Sapiens cDNA 4.2 F1J12284 fis, clone MA

404120 C500053T:gi~3298595~gb~AAC41376.1~4.2 (AFO

436899AA764852Hs.291567ESTs 4.1 407624AW157431Hs.248941ESTs 4.1 453361AA035197Hs.107375ESTs 4.1 447439AA313565Hs.145020ESTs, Weakly similar 4.1 to KIAA1205 protein 438372AI140189Hs.123191ESTs 4.1 438624AA889055Hs.123468ESTs 4.1 422493AW474183Hs.250173hypothetical protein 4.1 406672AI760903 gb:wi09h08.x1 NCI 4.1 CGAP_CLL1 Horrro Sapiens 425295AA431366Hs.37251ESTs 4.1 425849AJ000512Hs.296323seromlglucocorficoid 4.1 regulated kinase 434206AW136973Hs.180479ESTs, Weakly similar 4.0 to 569890 mitogen i 420602AF060877Hs.99236regulator of G-protein4.0 signalling 20 400645 Target Exon 4.0 456306AA225313Hs.222886ESTs, Weakly similar 4.0 to TRHY_HUMAN TRICH

419326W94915Hs.42419ESTs 4.0 414948C15240Hs.182155ESTs 4.0 423198M81933Hs.1634cell division cycle 4.0 411537BE073250 gb:MRO-BT055i-060300-102-e054.0 BT0551 Homo 421637AF035290Hs.106300Homo Sapiens clone 3.9 23556 mRNA sequence 439231AW581935Hs.141480Homo Sapiens mRNA; 3.9 cDNA DKFZp434N079 (fr 429433AA452899Hs.213586ESTs. Weakly similar 3.9 to KIAA1353 protein 424186AI536021Hs.288706Homo Sapiens cDNA 3.9 FLJ10281 fis, clone HE

449932AI675444Hs.263024ESTs 3.9 434072H70854Hs.283059Homo Sapiens PR01082 3.9 mRNA, complete cds 434784AA649051Hs.164007ESTs 3.9 425146AW954627 gb:EST366697 MAGE 3.9 resequences, MAGC
Homo 428538AA446440Hs.98643ESTs 3.9 443318A1051603Hs.i33141ESTs 3.9 416857AA188775Hs.292453ESTs 3.9 411688AW953440 gb:EST365510 MAGE 3.9 resequences, MAGB
Homo 447343AA256641Hs.236894ESTs, Highly similar 3.9 to S02392 alpha-2-m 425905AB032959Hs.318584novel C3HC4 type Zinc3.8 finger (ring finge 403696 C4001100':gi~5852342~gbIAAD54015.1~3.8 (AFO

415884H22966Hs.13471ESTs 3.8 432646AW753310 gb:RC3CT0254-031099-012-c053.8 CT0254 Homo 447057AI423407Hs.157697ESTs 3.8 400814 Target Exon 3.8 441329AI203575Hs.46821hypothefical protein 3.8 416664H72780Hs.20289ESTs 3.8 426044AA502490Hs.170290ESTs 3.8 455646BE064420 gb:RC4-BT0311-241199-012-c083.8 BT0311 Homo 419043T19167Hs.89566els variant gene 1 3.8 445075AI651827Hs.344767ESTs 3.8 45721AW972565Hs.32399ESTS, Weakly similar 3.8 1 to 551797 vasodilat 420004AW975532Hs.164039ESTs, Moderately similar3.8 to 138022 hypot 428060AA420616Hs.249483ESTs 3.7 7 416427BE244050Hs.79307RaGCdc42 guanine exchangefactor(GEF)3.7 453038AW292415Hs.20509HBV pX associated 3.7 protein-8 404584 Target Exon 3.7 447143AW292408Hs.152290ESTs, Highly similar 3.7 to JC2463 vasoacfiv 453438AI469935Hs.22792ESTs 3.7 g0 429643AA455889Hs.167279FYVE-finger.containing3.7 RabS effector pro 458072AI890347Hs.271923Homo Sapiens cDNA: 3.7 FLJ22785 fis, clone K

459660M79082 ESTs 3.7 432188A1362952Hs.2928solute comer family 3.7 7 (cafionic amino 430744AA485229Hs.105649ESTs 3.7 454392BE260893Hs.236131homeodomain-interacting3.7 protein kinase 2 454457AW753456 gb:OV2-CT0261-261099-011-dti3.7 CT0261 Homo 435095AA021160Hs.4750hypothetical protein 3.7 OKFZp564K0822 438206AA780385Hs.187885ESTs 3.7 418967NM Hs.89535bactericidaUpermeability-increasing3.7 001725 pro 427809M26380Hs.180878lipoprotein lipase 3.7 427722AK000123Hs.180479hypotheticalprotein 3.7 413986243567 gb:HSC1FC021 normalized3.7 infant brain clNl 438898AI819863Hs.106243ESTs 3.7 418483W26076Hs.221847ESTs 3.7 415849820529Hs.6806ESTs 3.6 438380Tt)<430Hs.6194chondroitin sulfate 3.6 proteoglycan BEHABIb 440296D30829Hs.180610splicing factor prolinelglutamine3.6 rich ( 1 438025AW501360Hs.258910ESTs 3.6 S

458970AW246119Hs.25300phosphatidylinositol 3.6 4-kinase type II

448002Y15227Hs.20149deleted in lymphocytic3.6 leukemia, 1 432058AW665996Hs.130729ESTs, Weakly similar 3.6 to ALU1 HUMAN ALU
S

409557BE182896Hs.211193ESTs 3.6 418049AA211467Hs.190488Homo Sapiens, Similar 3.6 to nuclear kx;aliz 425331AW962i28 gb:EST374201 MAGE resequences,3.6 MAGG Homo 424051AL110203Hs.138411Homo Sapiens mRNA; 3.6 cDNA DKFZp586J 1922 (f 404185 Target lion 3.6 427517AA644142Hs.7107ESTs, Weakly similar 3.6 to ALU7 HUMAN ALU
S

421094AW978202Hs.289064hypothetical protein 3.6 440388AI693520Hs.223000ESTs 3.6 415934NM Hs.992phospholipase A2, group3.6 000928 IB (pancreas) 408292AW178363 gb:RC3-HT0105-010999-002-HO63.6 HT0105 Homo 442432BE093589Hs.38178hypothetical protein 3.6 451826AA020741Hs.171611ESTs 3.6 427375AL035460Hs.177536metallocarboxypeplidase3.6 419485AA489023Hs.99807ESTs, Weakly similar 3.6 to unnamed protein 416370N90470Hs.203697ESTs, Weakly similar 3.6 to 138022 hypotheti 418400BE243026Hs.301989KIAA0246 protein 3.6 3 436674AA725002Hs.272018low molecular mass 3.5 5 ubiquinone-binding pr 407013035637 gb:Human nebulin mRNA,3.5 partial cds 403108 ENSP00000241415':Hypothetical3.5 67.7 kDa p 422564AI148006Hs.222120ESTs 3.5 450297AW901347Hs.38592hypothetical protein 3.5 436338W92147Hs.118394ESTs 3.5 447458A1741082Hs.158961ESTs 3.5 457364AW971037 gb:EST383123 MAGE resequences,3.5 MAGK Homo 458814AI498957Hs.170861ESTs, Weakly similar 3.5 to 1195_HUMAN ZINC

441701AW339828Hs.127497ESTs 3.5 405558 Target Exon 3.5 452682AA456193Hs.9071progesterone membrane 3.5 binding protein 434589AF147363 gb:HomosapiensfulllengthinsertcDNA3.5 443282T47764Hs.132917ESTs 3.5 405183 NM 016358':Homo Sapiens3.5 Iroquois homeobo 410064X53416Hs.195464tilamin A, alpha (actin-binding3.5 protein-425234AW152225Hs.165909ESTs, Weakly similar 3.5 to 138022 hypotheti 404272 Target Exon 3.5 428808AA436007Hs.188780ESTs 3.5 447444AK000318Hs.18616hypothetical protein 3.5 450475AW805634Hs.205015ESTs 3.4 454451AW846706 gb:OV3-CT0192-211099-008-g023.4 CT0192 Homo 400379NM Homo Sapiens ovarian 3.4 018432 cancer related prot 440948AW188311Hs.128619ESTs 3.4 449611A1970394Hs.197075ESTs 3.4 445666859960Hs.282386ESTs 3.4 445828F05802Hs.81907ESTs 3.4 437528N59646Hs.169745crumbs (Drosophila) 3.4 homolog 1 442927A1024347Hs.131519ESTs 3.4 451130A1762250Hs.345554ESTs 3.4 454765AW819629 gb:RCSST0293-140200-014-H053.4 ST0293 Homo 459200Y09306Hs.30148homeodomain-interacting3.4 protein kinase 3 433791AA719352Hs.112718ESTs 3.4 444911006117Hs.250xanthene dehydrogenase3.4 4397538E262233Hs.7423hypothetical protein 3.4 from EUROIMAGE 2168 440933AI208217Hs.142879ESTs 3.4 447726AL137638Hs.19368matrilin 2 3.4 403849 Target Exon 3.4 422418AK001383Hs.116385hypothetical protein 3.3 439533W76021 gb:zd64c04.r1 Soares 3.3 fetal heart NbHHI9W

416422H60457 ESTs, Moderately similar3.3 to ZN91 HUMAN Z

441668AI611973Hs.136313ESTs 3.3 432890NM Hs.279751sialic acid binding 3.3 014442 Ig-like lectin 8 412135AW895309 gb:OV4-NN0038-300300-155-e073.3 NN0038 Homo 417130AW276858Hs.81256S100 calcium-binding 3.3 protein A4 (calcium 447854AW138454Hs.11594ESTs 3.3 448048BE281291Hs.170408ESTs, Moderately similar3.3 to A47582 B-cel 404632 NM 022490:Homo Sapiens3.3 hypothetical prot 411565AW851728 gb:MR2-CT0222-011199-007-d063.3 CT0222 Honro 436267AW450938Hs.t801i5ESTs 3.3 426625T78300Hs.300642serologically defined 3.3 colon cancer anfig 401272 C9000559':gi~12314195~emb~CA899338.t~3.3 (A

433128AB021923Hs.23367EST-YDi protein 3.3 401702 NM 001171':Homo Sapiens3.3 ATP-binding toss 454363AW816274Hs.250154hypothetical protein 3.3 440332AI218517Hs.188051ESTs 3.3 454177AW807321 gb:MR4-ST0062-240300-003g053.3 ST0062 Homo 423784AK000039Hs.132826Homo Sapiens cDNA FLJ149133.3 fis, clone PL

440688AW404591Hs.147440ESTs, Weakly similar 3.3 to Z192_HUMAN ZINC

410267AW978005Hs.t2600N~thylmaleimide-sensifivefactorattach3.3 455778BE088746 gb:CM2-BT0693-210300-123-4093.3 BT0693 Homo 430183BE010038 gb:PM3-BN0176-100400-001043.2 BN0176 Homo 451597AW295250Hs.207536ESTs 3.2 I 451446AI826288Hs.171637hypothefical protein 3.2 421353AW292857Hs.255130ESTs 3.2 4427t0A1015631Hs.23210ESTs 3.2 420560AW207748Hs.59115ESTs 3.2 417404NM Hs.82101plecksUin homology-like3.2 007350 domain, family 437834AA769294Hs.283854gb:nz36g03.s1 NCI CGAP3.2 GCB1 Homo Sapiens 430694AA81~24Hs.30936ESTs, Weakly similar 3.2 to H2BH HUMAN HISTO

412021AW885592 gb:RC4-OT007i-090300-011-g113.2 OT0071 Homo 443431A1056847Hs.20654ESTs 3.2 445774A1254165Hs.339968ESTs 3.2 413335A1613318Hs.48442ESTs 3.2 450692H50603Hs.94037hypothefical protein 3.2 411671BE049094 ESTs 3.2 404592 NM 022739':Homo Sapiens3.2 E3 ubiquifin lig 402747 Target Exon 3.2 428600AW863261Hs.242413hypothefical protein 3.2 DKFZp434K1421 420300AA258245Hs.127573Homo Sapiens FKSG41 3.2 (FKSG41 ) mRNA, compl 445347AF035318Hs.12533Homo Sapiens clone 3.2 23705 mRNA sequence 458438AI141520Hs.t51464ESTs, Weakly similar 3.2 to ALUC_HUMAN !!!!

442314AI311854Hs.129220ESTs 3.2 436291BE568452Hs.344037protein regulatorofcytokinesisl3.2 413249AF167160Hs.75251DEADIH (Asp-Glu-Ala-AspIHis)3.2 box binding 448789BE539108Hs.22051hypothetical protein 3.2 403291 Target Exon 3,2 436210AI825420Hs.197824ESTs 3.2 418079840056Hs.691tESTs 3.2 413951AW051200Hs.75640natriuretic pepfide 3.2 precursor A

435828AA700705Hs.13852ESTs 3.2 437722AW292947Hs.122872ESTs, Weakly similar 3.2 to JU0033 hypotheti 451418BE387790Hs.26369hypothefical protein 3,2 405046 C3000978:gi~9280045~dbj~8AB01579.1~3.1 (A80 444315807860Hs.20039ESTs 3.1 453096AW294631Hs.11325ESTs 3.1 433835AI806185 gb:wf26at0.x1 Scares 3.1 NFL T GBC Si Homo s 430608845584Hs.23025ESTs, Weakly similar 3.1 to ALUS_HUMAN ALU
S

453324W26592Hs.232089ESTs 3.1 414884854418Hs.183745hypothetical protein 3.1 446862AV660697Hs.282700ESTs 3.1 427241AA399988Hs.112087Human DNA sequence 3.1 from clone RP11-530N1 416486H8t336Hs.37560ESTs 3.1 429940W25215 gb:zb87a09.rt Scares 3.1 senescent_fibroblas 430535AW968485 gb:EST380561 MAGE resequences,3.1 MAGJ Homo 439544W26354Hs.28891hypothefical protein 3.1 FLJ11360; artemis p 437083AW082597Hs.244862ESTs 3.t 435677AA694142Hs.293726ESTs, Weakly similar 3.1 to TSGA RAT TESTIS

458810BE407125Hs.231510ESTs 3.1 443484A1091458Hs.134559ESTs 3.1 427581NM Hs.179703KIAA0129 gene product 3.1 444016AA448154 gb:zw82h09.r1 Scares 3.1 tesfis-NHT Homo sap 423337NM_004655Hs.127337axin 2 (conducfin, 3.1 axil) 403288 C100173T:gi~751 t20i~pirp279043.1 hypothe 450125AA005418Hs.158186ESTs 3.1 438138898299Hs.177502ESTs 3.1 436222A1208737Hs.122810Homo Sapiens cDNA FLJ114893.1 fis, clone HE

443433844743Hs.301667ESTs 3.1 443725AW245680Hs.9701growth arrest and DNA~amage-inducible,3.t 432044AW972727 gb:EST384819 MAGE resequences,3.1 MAGL Homo 405760 Target Exon 3.1 423789AK002084Hs.132851hypolhefical protein 3.1 411605AW006831Hs.t77530ESTs 3.1 417893AA290605Hs.190002ESTs 3.1 449246AW411209Hs.23363hypothetical protein 3.1 429528AI985303Hs.99361ESTs 3.1 456645AF227156Hs.110t03RNA polymerise I transcripfion3.1 factor RR

412490AW803564Hs.288850Homo Sapiens cDNA: 3.1 FLJ22528 fis, clone H

g0 421679AI475110Hs.203933ESTs 3.1 434503T96231Hs.17762ESTs 3.1 450756A1733488Hs.144062ESTs 3.t 415293849462Hs.106541ESTs 3.0 DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

Claims (19)

WHAT IS CLAIMED IS:

1. A method for determining the presence or absence of a pathological cell in a patient, said method comprising detecting a nucleic acid comprising a sequence at least 80% identical to a sequence as described in Tables 2A-68 in a biological sample from said patient, thereby determining the presence or absence of said pathological cell.

2. The method of Claim 1 wherein:
a) said pathology is described in Table 1, including a cancer; and/or b) said biological sample comprises isolated nucleic acids.

3. The method of Claim 1, wherein said biological sample is tissue from an organ which is affected by said pathology of Table 1, including a cancer.

4. The method of Claim 2, wherein said nucleic acids are mRNA.

5. The method of Claim 2:
further comprising a step of amplifying nucleic acids before said step of detecting said nucleic acid; or where said detecting is of a protein encoded by said nucleic acid.

6. The method of Claim 1, wherein said nucleic acid comprises a sequence as described in Tables 2A-68.

7. The method of Claim 2, wherein:
said detecting step is carried out by:
i) using a labeled nucleic acid probe;
ii) utilizing a biochip comprising a sequence at least 80% identical to a sequence as described in Tables 2A-68; or iii) detecting a polypeptide encoded by said nucleic acid; or said patient is:
i) undergoing a therapeutic regimen to treat said pathology of Table 1; or ii) is suspected of having said pathology or cancer.

8. As isolated nucleic acid molecule comprising a sequence as described in Tables 2A-68.

9. The nucleic acid molecule of Claim 8, which is labeled.

10. An expression vector comprising the nucleic acid of Claim 8.

11. A host cell comprising the expression vector of Claim 10.

12. An isolated polypeptide which is encoded by a nucleic acid molecule comprising a sequence as described in Tables 2A-68.

13. An antibody that specifically binds a polypeptide of Claim 12.

14. The antibody of Claim 13:
a) conjugated to an effector component;
b) conjugated to a detectable label, including a fluorescent label, a radioisotope, or a cytotoxic chemical;
c) which is an antibody fragment; or d) which is a humanized antibody.

15. A method for specifically targeting a compound to a pathological cell in a patient, said method comprising administering to said patient an antibody of Claim 13, thereby providing said targetting.

16. A method for determining the presence or absence of a pathological cell in a patient, said method comprising contacting a biological sample with an antibody of Claim 13.

17. The method of Claim 16, wherein:
a) said antibody is conjugated to:
i) an effector component; or ii) a fluorescent label; or b) said biological sample is a blood, serum, urine, or stool sample.

18. A method for identifying a compound that modulates a pathology-associated polypeptide, said method comprising the steps of:

a) contacting said compound with a pathology-associated polypeptide, said polypeptide encoded by a polynucleotide that selectively hybridizes to a sequence at least 80% identical to a sequence as described in Tables 2A-68; and b) determining the functional effect of said compound upon said polypeptide.

19. A drug screening assay comprising the steps of:
a) administering a test compound to a mammal having a pathology of Table 1 or a cell isolated therefrom; and b) comparing the level of gene expression of a polynucleotide that selectively hybridizes to a sequence at least 80% identical to a sequence as described in Tables 2A-68 in a treated cell or mammal with the level of gene expression of said polynucleotide in a control cell or mammal, wherein a test compound that modulates said level of expression of the polynucleotide is a candidate for the treatment of said pathology.