CA2305711A1 - Assays for nuclear receptor ligands using fret - Google Patents
Assays for nuclear receptor ligands using fret Download PDFInfo
- Publication number
- CA2305711A1 CA2305711A1 CA002305711A CA2305711A CA2305711A1 CA 2305711 A1 CA2305711 A1 CA 2305711A1 CA 002305711 A CA002305711 A CA 002305711A CA 2305711 A CA2305711 A CA 2305711A CA 2305711 A1 CA2305711 A1 CA 2305711A1
- Authority
- CA
- Canada
- Prior art keywords
- nuclear receptor
- binding domain
- ligand binding
- ppar
- cbp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/475—Growth factors; Growth regulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
- G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6875—Nucleoproteins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70567—Nuclear receptors, e.g. retinoic acid receptor [RAR], RXR, nuclear orphan receptors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Peptides Or Proteins (AREA)
Abstract
Provided is a method of identifying agonists and antagonists of nuclear receptors that comprises measuring agonist-dependent fluorescence resonance energy transfer (FRET) between a fluorescently labeled nuclear receptor or ligand binding domain and fluorescently labeled CREB-binding protein (CBP), p300, other nuclear co-activator, or binding portion thereof. The method is simple, rapid, and inexpensive. Nuclear receptors and nuclear receptor co-activators labeled with fluorescent reagents for use in the above-described method are also provided.
Description
TITLE OF THE INVENTION
ASSAYS FOR NUCLEAR RECEPTOR LIGANDS USING FRET
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 60/061,385, filed 10/7/97, the contents of which are incorporated herein by reference in their entirety.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
This invention relates to methods of identifying novel agonists and antagonists of nuclear receptors utilizing the agonist-dependent interaction of such receptors with CREB-binding protein (CBP) or other nuclear receptor co-activators in which this interaction is detected by fluorescence resonance energy transfer.
BACKGROUND OF THE INVENTION
Nuclear receptors are a superfamily of ligand-activated transcription factors that bind as homodimers or heterodimers to their cognate DNA elements in gene promoters. The superfamily, with more than 150 members, can be divided into subfamilies (e.g. the steroid, retinoid, thyroid hormone, and peroxisome proliferator-activated [PPAR] subfamilies). Each subfamily may consist of several members which are encoded by individual genes (e.g. PPARa, PPAR~y, and PPARB). In addition, alternative mRNA splicing can result in more than one isoform of these genes as in the case of specific PPARs (e.g.
PPAR~y1 and PPAR~y2). The nuclear receptor superfamily is involved in a wide variety of physiological functions in mammalian cells: e.g., differentiation, proliferation, and metabolic homeostasis. Dysfunction or altered expression of specific nuclear receptors has been found to be involved in disease pathogenesis.
The PPAR subfamily of nuclear receptors consists of three members: PPARa, PPARy, and PPARB. PPARa is highly expressed in S liver and kidney. Activation of PPARa by peroxisome proliferators (including hypolipidimic reagents such as fibrates) or medium and long-chain fatty acids is responsible for the induction of acyl-CoA
oxidase and hydratase-dehydrogenase (enzymes required for peroxisomal ~i-oxidation), as well as cytochrome P450 4A6 (an enzyme required for fatty acid w-hydroxylase). Thus, PPARa has an important role in the regulation of lipid metabolism and is part of the mechanism through which hypolipidimic compounds such as fibrates exert their effects. PPARY is predominantly expressed in adipose tissue. Recently, a prostaglandin J2 metabolite, 15-Deoxy-D12,14-prostaglandin J2, has been identified as a potential physiological ligand of PPAR~y. Both 15-Deoxy-D12,14-prostaglandin J2 treatment of preadipocytes or retroviral expression of PPAR~y2 in fibroblasts induced adipocyte differentiation, demonstrating the role of PPAR~y in adipocyte differentiation and lipid storage. The demonstration that anti-diabetic and lipid-lowering insulin sensitizing compounds known as thiazolidinediones are high affinity ligands for PPARy suggests a broad therapeutic role for PPAR~y ligands in the treatment of diabetes and disorders associated with insulin resistance (e.g. obesity and cardiovascular disease).
Nuclear receptor proteins contain a central DNA binding domain (DBD) and a COOH-terminal ligand binding domain (LBD). The DBD is composed of two highly conserved zinc fingers .that target the receptor to specific promoter/enhancer DNA sequences known as hormone response elements (HREs). The LBD is about 200-300 amino acids in length and is less well conserved than the DBD. There are at least three functions for the LBD: dimerization, ligand binding, and transactivation. The transactivation function can be viewed as a molecular switch between a transcriptionally inactive and a transcriptionally active state of the receptor. Binding of a ligand which is an agonist flips the switch from the inactive state to the active state.
The COON-terminal portion of the LBD contains an activation function domain (AF2)~ that is required for the switch.
ASSAYS FOR NUCLEAR RECEPTOR LIGANDS USING FRET
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 60/061,385, filed 10/7/97, the contents of which are incorporated herein by reference in their entirety.
STATEMENT REGARDING FEDERALLY-SPONSORED R&D
Not applicable.
REFERENCE TO MICROFICHE APPENDIX
Not applicable.
FIELD OF THE INVENTION
This invention relates to methods of identifying novel agonists and antagonists of nuclear receptors utilizing the agonist-dependent interaction of such receptors with CREB-binding protein (CBP) or other nuclear receptor co-activators in which this interaction is detected by fluorescence resonance energy transfer.
BACKGROUND OF THE INVENTION
Nuclear receptors are a superfamily of ligand-activated transcription factors that bind as homodimers or heterodimers to their cognate DNA elements in gene promoters. The superfamily, with more than 150 members, can be divided into subfamilies (e.g. the steroid, retinoid, thyroid hormone, and peroxisome proliferator-activated [PPAR] subfamilies). Each subfamily may consist of several members which are encoded by individual genes (e.g. PPARa, PPAR~y, and PPARB). In addition, alternative mRNA splicing can result in more than one isoform of these genes as in the case of specific PPARs (e.g.
PPAR~y1 and PPAR~y2). The nuclear receptor superfamily is involved in a wide variety of physiological functions in mammalian cells: e.g., differentiation, proliferation, and metabolic homeostasis. Dysfunction or altered expression of specific nuclear receptors has been found to be involved in disease pathogenesis.
The PPAR subfamily of nuclear receptors consists of three members: PPARa, PPARy, and PPARB. PPARa is highly expressed in S liver and kidney. Activation of PPARa by peroxisome proliferators (including hypolipidimic reagents such as fibrates) or medium and long-chain fatty acids is responsible for the induction of acyl-CoA
oxidase and hydratase-dehydrogenase (enzymes required for peroxisomal ~i-oxidation), as well as cytochrome P450 4A6 (an enzyme required for fatty acid w-hydroxylase). Thus, PPARa has an important role in the regulation of lipid metabolism and is part of the mechanism through which hypolipidimic compounds such as fibrates exert their effects. PPARY is predominantly expressed in adipose tissue. Recently, a prostaglandin J2 metabolite, 15-Deoxy-D12,14-prostaglandin J2, has been identified as a potential physiological ligand of PPAR~y. Both 15-Deoxy-D12,14-prostaglandin J2 treatment of preadipocytes or retroviral expression of PPAR~y2 in fibroblasts induced adipocyte differentiation, demonstrating the role of PPAR~y in adipocyte differentiation and lipid storage. The demonstration that anti-diabetic and lipid-lowering insulin sensitizing compounds known as thiazolidinediones are high affinity ligands for PPARy suggests a broad therapeutic role for PPAR~y ligands in the treatment of diabetes and disorders associated with insulin resistance (e.g. obesity and cardiovascular disease).
Nuclear receptor proteins contain a central DNA binding domain (DBD) and a COOH-terminal ligand binding domain (LBD). The DBD is composed of two highly conserved zinc fingers .that target the receptor to specific promoter/enhancer DNA sequences known as hormone response elements (HREs). The LBD is about 200-300 amino acids in length and is less well conserved than the DBD. There are at least three functions for the LBD: dimerization, ligand binding, and transactivation. The transactivation function can be viewed as a molecular switch between a transcriptionally inactive and a transcriptionally active state of the receptor. Binding of a ligand which is an agonist flips the switch from the inactive state to the active state.
The COON-terminal portion of the LBD contains an activation function domain (AF2)~ that is required for the switch.
The ligand-induced nuclear receptor molecular switch is mediated through interactions with members of a family of nuclear receptor co-activators (e.g., CBP/p300, SRC-1/NcoA-1, TIF2/GRIP-1/NcoA-2, and p/CIP). Upon binding of agonist to its cognate receptor LBD, a conformational change in the receptor protein creates a co-activator binding surface and results in recruitment of co-activator(s) to the receptor and subsequent transcriptional activation. The binding of antagonist ligands to nuclear receptors will not induce the required conformational change and prevents recruitment of co-activator and subsequent induction of transcription. The co-activators CREB-binding protein (CBP) and p300 are two closely related proteins that were originally discovered by virtue of their ability to interact with the transcription factor CREB. These two proteins share extensive amino acid sequence homology. CBP can form a bridge between nuclear receptors and the basic transcriptional machinery (Kamei et al., 1996, Cell 85:403-414; Chakravarti et al., 1996, Nature 383:99-103; Hanstein et al., 1996, Proc. Natl. Acad. Sci. USA 93:11540-11545; Heery et al., 1997, Nature 387:733-736). CBP also contains intrinsic histone acetyltransferase activity which could result in local chromatin rearrangement and further activation of transcription. Ligand- and AF2-dependent interaction between certain nuclear receptors and CBP
has been demonstrated in in vitro pull down assays and far-western assays. This interaction is both necessary and sufficient for the transcriptional activation that is mediated by these nuclear receptors.
Thus, an AF2 mutant of the estrogen receptor (ER) which abolishes the transcriptonal function of the receptor is incapable of interacting with CBP.
The N-terrmini of CBP and p300 have been shown to interact with the ligand-binding domains of some nuclear receptors (Kamei et al., 1996, Cell 85:403-414, hereinafter "Kamei"). Kamei was able to demonstrate direct interaction of CBP and p300 with nuclear receptors by several different methods:
(1) Kamei produced GST fusion proteins of the first 100 amino acids of the N-terminus of CBP. These fusion proteins were run out on a polyacrylamide gel, transferred to a membrane, and the membrane was exposed to 32P-labeled ligand-binding domains of _g_ nuclear receptors. In the presence of ligand, a specific binding interaction between the CBP and nuclear receptor fragments was detected in that the 32P-labeled ligand-binding domains were observed to bind to the bands on the membrane containing the GST-CBP fusion proteins.
(2) Kamei also utilized the yeast two-hybrid system. The ligand-binding domain of the nuclear receptor fused to the DNA-binding domain of the LexA protein was used as bait. The amino terminal domain of CBP fused to the gal4 transactivation domain was used as prey. In the presence of ligand, a specific binding interaction (occurring in viuo, i.e., within the yeast) was observed between the CBP and nuclear receptor fragments.
has been demonstrated in in vitro pull down assays and far-western assays. This interaction is both necessary and sufficient for the transcriptional activation that is mediated by these nuclear receptors.
Thus, an AF2 mutant of the estrogen receptor (ER) which abolishes the transcriptonal function of the receptor is incapable of interacting with CBP.
The N-terrmini of CBP and p300 have been shown to interact with the ligand-binding domains of some nuclear receptors (Kamei et al., 1996, Cell 85:403-414, hereinafter "Kamei"). Kamei was able to demonstrate direct interaction of CBP and p300 with nuclear receptors by several different methods:
(1) Kamei produced GST fusion proteins of the first 100 amino acids of the N-terminus of CBP. These fusion proteins were run out on a polyacrylamide gel, transferred to a membrane, and the membrane was exposed to 32P-labeled ligand-binding domains of _g_ nuclear receptors. In the presence of ligand, a specific binding interaction between the CBP and nuclear receptor fragments was detected in that the 32P-labeled ligand-binding domains were observed to bind to the bands on the membrane containing the GST-CBP fusion proteins.
(2) Kamei also utilized the yeast two-hybrid system. The ligand-binding domain of the nuclear receptor fused to the DNA-binding domain of the LexA protein was used as bait. The amino terminal domain of CBP fused to the gal4 transactivation domain was used as prey. In the presence of ligand, a specific binding interaction (occurring in viuo, i.e., within the yeast) was observed between the CBP and nuclear receptor fragments.
(3) Kamei observed ligand-induced binding between CBP
and nuclear receptors via a gel-shift assay. This assay is based on the observation that, in the presence of ligand, nuclear receptors will bind to oligonucleotides containing their target recognition sequence. Such binding results in the formation of a nuclear receptor-ligand-oligonucleotide complex having a higher molecular weight than the oligonucleotide alone. This difference in molecular weight is detected via a shift in position of the 32P-labeled oligonucleotide when it is run out on a polyacrylamide gel. Kamei found that a fragment of CBP (the N-terminal 100 amino acids) was capable of binding to the nuclear receptor-ligand-oligonucleotide complex and shifting the complex's position on the gel to an even higher molecular weight.
and nuclear receptors via a gel-shift assay. This assay is based on the observation that, in the presence of ligand, nuclear receptors will bind to oligonucleotides containing their target recognition sequence. Such binding results in the formation of a nuclear receptor-ligand-oligonucleotide complex having a higher molecular weight than the oligonucleotide alone. This difference in molecular weight is detected via a shift in position of the 32P-labeled oligonucleotide when it is run out on a polyacrylamide gel. Kamei found that a fragment of CBP (the N-terminal 100 amino acids) was capable of binding to the nuclear receptor-ligand-oligonucleotide complex and shifting the complex's position on the gel to an even higher molecular weight.
(4) Kamei was able to co-immunoprecipitate CBP using antibodies to nuclear receptors in extracts from a variety of cells in the presence of ligand.
(5) By the use of transcriptional activation assays, Kamei was able to demonstrate that nuclear receptors and CBP interact in a functional manner. Such transcriptional activation assays can indicate that two proteins are involved in a pathway that results in transcriptional activation but these assays do not prove that the interaction between the proteins is one of direct binding.
By the above-described methods, Kamei was able to demonstrate specific binding interactions between CBP and the retinoic acid receptor (RAR), glucocorticoid receptor (GR), thyroid hormone receptor (T3R), and retinoid X receptor (RXR). Kamei also demonstrated specific binding between the N-terminus of p300 and RAR. However, Kamei did not demonstrate specific binding between CBP, p300, or any other nuclear receptor co-activators and PPARs.
What is striking about the methods used by Kamei is their extremely laborious and time consuming nature. Such methods involve, among other things, the construction of fusion proteins, the preparation of 32P-labeled proteins, the construction of specialized expression vectors for the yeast two-hybrid assay and the transcriptional activation assays, the running of many gels, and the raising of antibodies. Most of these assays take days to carry out and preparing the reagents needed to carry them out may take weeks. Because of the complicated reagents that are involved in these assays and the time needed to prepare and run the assays, these assays tend to be costly.
Investigators other than Kamei who have studied the interaction between nuclear receptors and CBP have also been forced to rely on such cumbersome methods (see, e.g., Chakravarti et al., 1996, Nature 383:99-103; Hanstein et al., 1996, Proc. Natl. Acad. Sci. USA 93:11540-11545;
Heery et al., 1997, Nature 387:733-736).
Kamei did not use the above-described methods to identify novel agonists or antagonists of nuclear receptors. The focus of Kamei was not on agonists or antagonists, but rather on the interaction between nuclear receptors and CBP. Although modifying the methods of Kamei to identify agonists or antagonists might be possible, such methods would suffer from serious disadvantages. This is because, as discussed above, all of the assays employed by Kamei to study the interaction of CBP and p300 with nuclear receptors are very laborious, slow, and costly. Given the therapeutic importance of steroid hormones such as estrogen, cortisol, progesterone, and other nuclear receptor agonists such as thyroid hormone and antidiabetic thiazolidinedione compounds, the need for improved high-throughput screening assays to identify potential pharmaceutical compounds affecting nuclear receptors is clear. Historically, therapeutically useful nuclear receptor ligand compounds were identified by screening animal models, an approach which is even more labor intensive and time consuming than the methods used by Kamei. Also, approaches such as those used by Kamei are ill-suited for the identification of antagonists of nuclear receptors. It is now widely appreciated that antagonists of nuclear receptors can be valuable therapeutic agents. Examples of such therapeutically useful antagonists are tamoxifene, raloxifene, and RU-486.
What is needed is a high throughput, time and labor-saving, non-radioactive, inexpensive, and very reliable assay for the identification and characterization of both agonists and antagonists of nuclear receptors. Such an assay is provided by the present invention.
SUMMARY OF THE INVENTION
The present invention provides novel methods of identifying agonists and antagonists of nuclear receptors. The methods take advantage of the agonist-dependent binding of nuclear receptors and CBP, p300, or other nuclear receptor co-activators. In the absence of agonist, binding between the nuclear receptor and CBP, p300, or other nuclear receptor co-activators does not occur. If agonist is present, however, such binding occurs and can be detected by fluorescence resonance energy transfer (FRET) between a fluorescently-labeled nuclear receptor and fluorescently-labeled CBP, p300, or other nuclear receptor co-activator. Antagonists can be identified by virtue of their ability to prevent or disrupt the agonist-induced interaction of nuclear receptors and CBP, p300, or other nuclear receptor co-activators. In contrast to prior art methods of identifying agonists and antagonists of nuclear receptors, the methods of the present invention, are simple, rapid, and less costly.
The present invention provides a nuclear receptor or ligand binding domain thereof labeled with a fluorescent reagent for use in the above-described methods of identifying agonists and antagonists of nuclear receptors. The present invention also provides CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a fluorescent reagent.
By the above-described methods, Kamei was able to demonstrate specific binding interactions between CBP and the retinoic acid receptor (RAR), glucocorticoid receptor (GR), thyroid hormone receptor (T3R), and retinoid X receptor (RXR). Kamei also demonstrated specific binding between the N-terminus of p300 and RAR. However, Kamei did not demonstrate specific binding between CBP, p300, or any other nuclear receptor co-activators and PPARs.
What is striking about the methods used by Kamei is their extremely laborious and time consuming nature. Such methods involve, among other things, the construction of fusion proteins, the preparation of 32P-labeled proteins, the construction of specialized expression vectors for the yeast two-hybrid assay and the transcriptional activation assays, the running of many gels, and the raising of antibodies. Most of these assays take days to carry out and preparing the reagents needed to carry them out may take weeks. Because of the complicated reagents that are involved in these assays and the time needed to prepare and run the assays, these assays tend to be costly.
Investigators other than Kamei who have studied the interaction between nuclear receptors and CBP have also been forced to rely on such cumbersome methods (see, e.g., Chakravarti et al., 1996, Nature 383:99-103; Hanstein et al., 1996, Proc. Natl. Acad. Sci. USA 93:11540-11545;
Heery et al., 1997, Nature 387:733-736).
Kamei did not use the above-described methods to identify novel agonists or antagonists of nuclear receptors. The focus of Kamei was not on agonists or antagonists, but rather on the interaction between nuclear receptors and CBP. Although modifying the methods of Kamei to identify agonists or antagonists might be possible, such methods would suffer from serious disadvantages. This is because, as discussed above, all of the assays employed by Kamei to study the interaction of CBP and p300 with nuclear receptors are very laborious, slow, and costly. Given the therapeutic importance of steroid hormones such as estrogen, cortisol, progesterone, and other nuclear receptor agonists such as thyroid hormone and antidiabetic thiazolidinedione compounds, the need for improved high-throughput screening assays to identify potential pharmaceutical compounds affecting nuclear receptors is clear. Historically, therapeutically useful nuclear receptor ligand compounds were identified by screening animal models, an approach which is even more labor intensive and time consuming than the methods used by Kamei. Also, approaches such as those used by Kamei are ill-suited for the identification of antagonists of nuclear receptors. It is now widely appreciated that antagonists of nuclear receptors can be valuable therapeutic agents. Examples of such therapeutically useful antagonists are tamoxifene, raloxifene, and RU-486.
What is needed is a high throughput, time and labor-saving, non-radioactive, inexpensive, and very reliable assay for the identification and characterization of both agonists and antagonists of nuclear receptors. Such an assay is provided by the present invention.
SUMMARY OF THE INVENTION
The present invention provides novel methods of identifying agonists and antagonists of nuclear receptors. The methods take advantage of the agonist-dependent binding of nuclear receptors and CBP, p300, or other nuclear receptor co-activators. In the absence of agonist, binding between the nuclear receptor and CBP, p300, or other nuclear receptor co-activators does not occur. If agonist is present, however, such binding occurs and can be detected by fluorescence resonance energy transfer (FRET) between a fluorescently-labeled nuclear receptor and fluorescently-labeled CBP, p300, or other nuclear receptor co-activator. Antagonists can be identified by virtue of their ability to prevent or disrupt the agonist-induced interaction of nuclear receptors and CBP, p300, or other nuclear receptor co-activators. In contrast to prior art methods of identifying agonists and antagonists of nuclear receptors, the methods of the present invention, are simple, rapid, and less costly.
The present invention provides a nuclear receptor or ligand binding domain thereof labeled with a fluorescent reagent for use in the above-described methods of identifying agonists and antagonists of nuclear receptors. The present invention also provides CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a fluorescent reagent.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 illustrates a method of fluorescently labelling a protein or polypeptide with Europium cryptate (Eu3+K).
S Figure 2 illustrates the format for experiments 1 and 2 of Table 1.
Figure 3 illustrates the format for experiment 3 of Table 1.
Figure 4 illustrates the format for experiment 4 of Table 1.
Figure 5 shows the results of studies using the methods of the present invention with four known PPARY agonists. --o-- = AD5075;
--O-- = Fioglitazone; --X -- = Troglitazone; --0-- = BRL49653.
Figure 6 shows a measurement of the binding constant for the interaction between hCBP and PPAR~yILBD.
Figure 7A shows the amino acid sequence of human CBP
(SEQ.ID.NO.:1).
Figure 7B shows the nucleotide sequence of a cDNA
encoding human CBP (SEQ.ID.N0.:2). The open reading frame is at positions 76-1290.
Figure 8A shows the amino acid sequence of human PPARa (SEQ.ID.N0.:3).
Figure 8B shows the nucleotide sequence of a cDNA
encoding human PPARa (SEG.~.ID.N0.:4). The open reading frame is at positions 217-1623.
Figure 9A shows the amino acid sequence of human PPAR~yl (SEQ.ID.N0.:5).
Figure 9B shows the nucleotide sequence of a cDNA
encoding human PPAR~y1 (SEfa.ID.N0.:6). The open reading frame is at positions I73-1609.
Figure l0A shows the amino acid sequence of human PPARB (SEQ.ID.N0.:7).
Figure lOB-C shows the nucleotide sequence of a cDNA
encoding human PPARB (SEQ.ID.N0.:8). The open reading frame is at positions 338-1663.
_7-DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention:
- an "agonist" is a substance that binds to nuclear receptors in such a way that a specific binding interaction between the nuclear receptor and CBP or other nuclear receptor co-activator can occur.
- an "antagonist" is a substance that is capable of preventing or disrupting the agonist-induced specific binding interaction between a nuclear receptor and CBP, p300, or another nuclear receptor co-activator.
- a "ligand" of a nuclear receptor is an agonist or an antagonist of the nuclear receptor.
- a "specific binding interaction," "specific binding," and the like, refers to binding between a nuclear receptor and CBP, p300, or other nuclear receptor co-activator which results in the occurrence of fluorescence resonance energy transfer between a fluorescent reagent bound to the nuclear receptor and a fluorescent reagent bound to CBP, p300, or other nuclear receptor co-activator.
With respect to CBP, p300, or other nuclear receptor co-activators, a "binding portion" is that portion of CBP, p300, or other nuclear receptor co-activators that is sufficient for specific binding interactions with nuclear receptors.
With respect to nuclear receptors, a "ligand binding domain" is that portion of a nuclear receptor that is sufficient to bind an agonist or antagonist of the nuclear receptor.
The present invention provides a high throughput, time and labor-saving, non-radioactive, inexpensive, and very reliable assay for the identification and characterization of both agonists and antagonists of nuclear receptors. In a general embodiment, the present invention provides methods of identifying agonists and antagonists for any nuclear receptor for which CBP, p300, or another nuclear receptor binding protein is a co-activator. Such agonists and antagonists are identified by virtue of their ability to induce or prevent binding between the ligand binding domain of a nuclear receptor and CBP, p300, or other nuclear receptor co-activator. The interaction between the nuclear receptor and CBP, p300, or other nuclear receptor co-activator is monitored by observing the occurrence of fluorescence resonance energy _ g-transfer (FRET) between two fluorescent reagents. One fluorescent reagent is bound to the nuclear receptor; the other fluorescent reagent is bound to CBP, p300, or other nuclear receptor co-activator. The binding of fluorescent reagent to nuclear receptor, CBP, p300, or other nuclear receptor co-activator can be by a covalent linkage or a non-covalent linkage.
The present invention makes use of fluorescence resonance energy transfer (FRET). FRET is a process in which energy is transferred from an excited donor fluorescent reagent to an acceptor fluorescent reagent by means of intermolecular long-range dipole-dipole coupling. FRET typically occurs over distances of about lOb to 100 and requires that the emission spectrum of the donor reagent and the absorbance spectrum of the acceptor reagent overlap adequately and that the quantum yield of the donor and the absorption coe~cient of the acceptor be su~ciently high. In addition, the transition dipoles of the donor and acceptor fluorescent reagents must be properly oriented relative to one another. For a review of FRET and its applications to biological systems, see Clegg, 1995, Current Opinions in Biotechnology 6:103-110.
The present invention makes use of a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent. The second fluorescent reagent comprises a fluorophore capable of undergoing energy transfer by either (a) donating excited state energy to the first fluorescent reagent, or (b) accepting excited state energy from the first fluorescent reagent. In other words, according to the present invention, either the first or the second fluorescent reagents can be the donor or the acceptor during FRET.
The first and second fluorescent reagents are spectropscopically complementary to each other. This means that their spectral characteristics are such that excited state energy transfer can occur between them. FRET is highly sensitive to the distance between the first and second fluorescent reagents. For example, FRET varies inversely with the sixth power of the distance between the first and second fluorescent reagents. In the absence of agonist, the first fluorescent reagent, bound to the nuclear receptor or ligand binding domain thereof, will not be near the second fluorescent reagent, bound to CBP, p300, or other nuclear receptor co-activator, or binding portion thereof. Thus, no FRET, or very little FRET, will be observed. In the presence of agonist, however, interaction between the nuclear receptor and CBP, p300, or other nuclear receptor co-activator will occur, thus bringing close together the first and the second fluorescent reagents, allowing FRET to occur and be observed.
Accordingly, the present invention provides a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, will occur; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In particular embodiments, the nuclear receptor is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D
receptors, and "orphan nuclear receptors" such as LXR, FXR, etc.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is a ligand binding domain of a nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof comprises an AF-2 site of a nuclear receptor.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length PPAR. In another embodiment, the nuclear receptor or ligand binding domain thereof is the ligand binding domain of a PPAR. In a further embodiment, the PPAR is selected from the group consisting of PPARa, PPARyl, PPARy2, and PPARB. In a further embodiment, the ligand binding domain of the PPAR contains amino acid residues 176-478 of human PPARyl.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 143-462 of human RARa.
In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 122-410 of rat T3Ral. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 227-463 of mouse RXRy. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 251-595 of human ER.
In a particluar embodiment, the above-described methods utilize full-length CBP, either mouse or human. In other embodiments, the methods utilize amino acid residues 1-113 of human CBP. In another embodiment, the methods utilize amino acid residues 1-453 of human CBP.
The conditions under which the methods described above are carried out are conditions that are typically used in the art for the study of protein-protein interactions: e.g., physiological pH; salt conditions such as those represented by such commonly used buffers as PBS; a temperature of about 4°C to about 55°C. The presence of commonly used non-ionic detergents, e.g., NP-40~, sarcosyl, Triton X-100~, is optional. When europium cryptates are used as fluorescent reagents, reactions should contain KF at a concentration of at least 200 mM.
Heery et al., 1997, Nature 387:733-736 showed that interactions between nuclear receptors and a variety of nuclear receptor co-activators are mediated by a short amino acid sequence in the nuclear receptor co-activators having the amino acid sequence LXXLL, where L
is leucine and X represents any amino acid. Accordingly, the present invention can be practiced with a binding portion of a nuclear receptor co-activator, provided that the binding portion contains the amino acid sequence LXXLL. Therefore, the present invention includes a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a binding portion of a nuclear receptor co-activator, where the binding portion contains the amino acid sequence LXXLL, and where the binding portion is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the binding portion of the nuclear receptor co-activator will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In a particular embodiment, the nuclear receptor co-activator is selected from the group consisting of human RIP-140, human SRC-1, mouse TIF-2, human or mouse CBP, human or mouse p300, mouse TIF-1, and human TRIP proteins.
In a particular embodiment, the nuclear receptor co-activator is human RIP-140 and the binding portion includes a contiguous stretch of amino acids of human RIP-140 selected from the group consisting of positions 20-29,132-139,184-192, 266-273, 379-387, 496-506, 712-719, 818-825, 935-944, and 935-942.
In another embodiment, the nuclear receptor co-activator is human SRC-1 and the binding portion includes a contiguous stretch of amino acids of human SRC-1 selected from the group consisting of positions 45-53, 632-640, 689-696, ?48-755, and 1434-1441.
In another embodiment, the nuclear receptor co-activator is mouse TIF-2 and the binding portion includes a contiguous stretch of amino acids of mouse TIF-2 selected from the group consisting of:
positions 640-650, 689-699, and 744-754.
In another embodiment, the nuclear receptor co-activator is human or mouse CBP and the binding portion includes a contiguous stretch of amino acids of human or mouse CBP selected from the group consisting of positions 68-78 and 356-366.
In another embodiment, the nuclear receptor co-activator is human or mouse p300 and the binding portion includes a contiguous stretch of amino acids of human or mouse p300 selected from the group consisting of positions 80-90 and 341-351.
In another embodiment, the nuclear receptor co-activator is mouse TIF-1 and the binding portion includes a contiguous stretch of amino acids of mouse TIF-1 containing positions ?22-732.
In another embodiment, the nuclear receptor co-activator is human TRIP2 and the binding portion includes a contiguous stretch of amino acids of human TRIP2 containing positions 23-33.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS containing positions 97-107.
In another embodiment, the nuclear receptor co-activator is human TRIP4 and the binding portion includes a contiguous stretch of amino acids of human TRIP4 containing positions 36-46.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS containing positions 26-36.
In another embodiment, the nuclear receptor co-activator is human TRIP8 and the binding portion includes a contiguous stretch of amino acids of human TRIP8 containing positions 36-46.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS selected from the group consisting of positions 73-83, 256-266 and 288-298.
For amino acid sequences of nuclear receptor co-activators, see Yao et al., 1996, Proc. Natl. Acad. Sci. USA 93:10626-10631 (SRC-1);
O~ate et al., 1995, Science 270:1354-1357 (SRC-1); Cavaill~s et al., 1995, EMBO J. 14:3741-3751 (RIP-140); Voegel et al., 1996, EMBO J. 15:101-108 (TIF-2); Kwok et al., 1994, Nature 370:223-226 (CBP); Arias et al., 1994, Nature 370:226-229 (CBP); Eckner et al., 1994, Genes Dev. 8:869-884 (p300); Le Douarin et al., 1995, EMBO J. 14:2020-2033 (TIF-1); Lee et al., 1995, Nature 3?4:91-94 (TRIP proteins).
The particular embodiments of the present invention described above are all particular embodiments of a more general S method that is also part of the present invention. That general method is a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a polypeptide containing the amino acid sequence LXXLL where the polypeptide is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the polypeptide will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In a particular embodiment, the amino acid sequence LXXLL is present in an a helical portion of the polypeptide. In another embodiment, the amino acid sequence LXXLL is present in an a helical portion of the polypeptide and the leucines form a hydrophobic face.
The present invention provides methods for identifying antagonists of a nuclear receptor. Such methods are based on the ability of the antagonist to prevent the occurrence of agonist-induced binding between a nuclear receptor and CBP, p300, or other nuclear receptor co-activator, or to disrupt such binding after it has occurred. Thus, the present invention provides a method for identifying antagonists of nuclear receptors that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent;
(c) an agonist of the nuclear receptor; and (d) a substance suspected of being an antagonist of the nuclear receptor;
under conditions such that, in the absence of the substance, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof will occur; and (e) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents when the substance is present and measuring FRET between the first and second fluorescent reagents when the substance is absent;
where the a decrease in FRET when the substance is present indicates that the substance is an antagonist of the nuclear receptor.
In particular embodiments, the nuclear receptor is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D
receptors, and "orphan nuclear receptors" such as LXR, FXR, etc.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is a ligand binding domain of a nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is an AF-2 site of a nuclear receptor.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length PPAR. In another embodiment, the nuclear receptor or ligand binding domain thereof is the ligand binding domain of a PPAR. In a further embodiment, the PPAR is selected from the group consisting of PPAR,a, PPAR,~y, and PPAR8. In a further embodiment, the ligand binding domain of the PPAR contains amino acid residues 176-47$ of human PPAR,Yl.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 143-462 of human RAR,a.
In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 122-410 of rat T3Ral. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 227-463 of mouse RxR,~. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 251-595 of human ER.
In a particular embodiment, the above-described methods utilize full-length CBP, either mouse or human. In other embodiments, the methods utilize amino acid residues 1-113 of human CBP. In another embodiment, the methods utilize amino acid residues 1-453 of human CBP.:
The conditions under which the methods described above are carried out are conditions that are typically used in the art for the study of protein-protein interactions: e.g., physiological pH; salt conditions such as those represented by such commonly used buffers as PBS; a temperature of about 4°C to about 55°C. The presence of commonly used non-ionic detergents, e.g., NP-400, sarcosyl, Triton X
1000, is optional. When europium cryptates are used as fluorescent reagents, reactions should contain KF at a concentration of at least 200 mM.
In principle, one could measure FRET by monitoring either (a) a decrease in the emission of the donor fluorescent reagent following stimulation at the donor's absorption wavelength and/or (b) an increase in the emission of the acceptor reagent following stimulation at the donor's absorption wavelength. In practice, FRET is most effectively measured by emission ratioing. Emission ratioing monitors the change in the ratio of emission by the acceptor over emission by the donor. An increase in this ratio signifies that energy is being transferred from donor to acceptor and thus that FRET is occurring. Emission ratioing can be measured by employing a laser-scanning confocal microscope.
Emission ratioing is preferably done by splitting the emitted light from a sample with a dichroic mirror and measuring two wavelength bands (corresponding to the donor and the acceptor emission wavelengths) simultaneously with two detectors. Alternatively, the emitted light can be sampled consecutively at each wavelength (by using appropriate filters) with a single detector. In any case, these and other methods of 3 S measuring FRET are well known in the art.
Although a variety of donor and acceptor fluorescent reagents can be used in the practice of the present invention, preferred embodiments of the present invention make use of cryptates of fluorescent reagents as donor reagents. Inclusion of a substrate into the intramolecular cavity of a macropolycyclic ligand results in the formation of a cryptate. The macropolycyclic ligand shields the substrate from interaction with solvent and other solute molecules. If the substrate is a fluororescent reagent, formation of a cryptate may result in markedly different spectroscopic characteristics for the reagent as compared to the spectroscopic characteristics of the free reagent.
The present invention includes the use of europium (Eunl) or terbium (Tbul) cryptates as donor fluorescent reagents. Such Eu~ or Tbnl cryptates, as well as methods for their formation, are well known in the art. For example, see Alpha et al., 1987, Angew. Chem. Int. Ed.
Engl. 26:266-267; Mathis, 1995, Clin. Chem. 41:1391-1397. A europium cryptate is formed by the inclusion of a europium ion into the intramolecular cavity of a macropolycyclic ligand which contains bipyridine groups as light absorbers. When europium cryptates are present in solution together with fluoride ions, a total shielding of the europium cryptate fluorescence is occurs. The molecular structure of a europium cryptate is shown below.
NH NH
O=C, .C=O
~=N N=C
Europium cryptates can be conjugated to proteins by the use of well-known heterobifunctional reagents (see, e.g., International Patent Application WO 89/05813; Prat et al., 1991, Anal. Biochem.
195:283-289; Lopez et al., 1993, Clin. Chem. 39:196-201 ).
The present invention includes the use of XL665 as the acceptor fluorescent reagent. XL665 is a crosslinked derivative of allophycocyanin (APC). APC is a porphyrin containing protein which is derived from the light harvesting system of algae (Kronick, 1986, M.
Immunol. Meth. 92:1-13). XL665 has an absorption maximum at =620 nm and an emission maximum at 665 nm. In some embodiments of the invention, XL665 is labeled with streptavidin in order to eil'ect the binding of the streptavidin-labled XL665 to a biotin-labeled substance, e.g. , CBP or the ligand binding domain of a nuclear receptor.
Streptavidin labeling of XL655 and biotin labeling of CBP, or the ligand binding domain of a nuclear receptor, can be performed by well known methods.
In a preferred embodiment of the invention, XL665 as the acceptor fluorescent reagent is combined with Europium cryptate (Eu3+K) as the donor fluorescent reagent. Europium cryptate (Eu3+K) has a large Stokes shift, absorbing light at 337 nm and emitting at 620 nm. Thus, the emission maximum of Europium cryptate (Eu3+K) overlaps the absorption maximum of XL665. Europium cryptate (Eu3+K) has a large temporal shift; the time between absorption and emission of a photon is about 1 millisecond. This is advantageous because most background fluorescence signals in biological samples are short-lived. Thus the use of a fluorescent reagent such as europium cryptate, with a long fluorescent lifetime, permits time-resolved detection resulting in the reduction of background interference.
The spectral and temporal properties of europium cryptate (Eu3+K) result in essentially no fluorescence background and thus assays using this fluorescent reagent can be carried out in a "mix and read" mode, greatly facilitating its use as a high throughput screening tool. For the embodiment using Europium cryptate (Eu3+K) and XL665, the measuring instrument irradiates the sample at 337 nm and measures the fluorescence output at two wavelengths, 620 nm (B counts, europium fluorescence) and 665 nm (A counts, XL665 fluorescence).
The extent of flurorescent resonance energy transfer is measured as the ratio between these two values. Typically this ratio is multiplied by 10,000 to give whole numbers.
Other FRET donor-acceptor pairs are suitable for the practice of the present invention. For example, the following donor-acceptor pairs can be used: dansyl/fluorescein; fluorescein/rhodamine;
tryptophan/aminocoumarin.
The present invention provides a nuclear receptor or ligand binding domain thereof labeled with a fluorescent reagent for use in the above-described methods of identifying agonists and antagonists of nuclear receptors. The present invention also provides CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a fluorescent reagent.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is selected from the group consisting of PPARa, PPARy, PPAR8, a ligand binding domain of PPARa, PPAR~y, or PPARB, and amino acid residues 176-478 of human PPAR71 and the fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
In a particular embodiment, CBP, p300, or other nuclear receptor co-activator is labeled with a fluorescent reagent selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
The following non-limiting examples are presented to better illustrate the invention.
To test whether human CBP can interact with PPARs in an agonist-dependent manner, we cloned the human cDNA fragments encoding the NH2-terminal 1-113 amino acids (hCBPl-113) and 1-453 amino acids (hCBPl-453) of human CBP by the polymerase chain reaction (PCR). The DNA and amino acid sequences of human CBP are disclosed in Borrow et al., 1996, Nature Genet. 14:33-41 and in GenBank, accession no. U47741.
The primers used for hCBPl-113 were:
5'-ACTCGGATCCAAGCCATGGCTGAGAACTTGCTGGACGG-3' (SEQ.ID.N0.:9) and 5'-CACAAAGCTTAGGCCATGTTAGCACTGTTCGG-3' (SEQ.ID.NO.:
10).
These primers were expected to amplify a 0.9 kb DNA fragment.
The primers for hCBPl-453 were:
5'-ACTCGGATCCAAGCCATGGCTGAGAACTTGCTGGACGG-3' (SEQ.ID.N0.:9) and 5'CTCAGTCGACTTATTGAATTCCACTAGCTGGAGATCC-3' (SEQ.ID.NO.:11).
These primers were expected to amplify a 1.5 kb DNA fragment..
The template for the PCR reaction was a human fetal brain cDNA library (Stratagene, Catalogue #IS 937227). Of course, any human cDNA library from a tissue expressing CBP could have been used. The PCR amplified 0.9 kb and 1.5 kp DNA fragments which were digested with restriction endonucleases and ligated into pBluescript II
vector. DNA sequencing analysis confirmed that the amplified fragments were identical to the corresponding published nucleic acid sequences of human CBP.
Based on the publicly available sequences for human CBP
cited above, other primers could be readily identified and prepared by those skilled in the art in order to amplify and clone other portions of cDNA encoding human CBP from appropriate cDNA libraries. Once such portions of human CBP are produced, they could be used in the methods of the present invention in a manner similar to that described herein for hCBPl-113 and hCBPl-453. The amino acid sequence of human CBP is shown in Figure 7A; the nucleic acid sequence of the cDNA encoding human CBP is shown in Figure 7B.
To express the polypeptides encoded by the PCR fragments, vectors encoding fusion proteins of the polypeptides and glutathione S-transferase (GST) were constructed and expressed in E. coli. The PCR
fragments were subcloned into the expression vector pGEX (Pharmacia Biotech) to generate pGEXhCBPl-113 and pGEXhCBPl-453.
_ 2p _ pGEXhCBPl-113 and pGEXhCBPI-453 were transfected into the DHSa strain of E. coli (GIBCO BRL) and the bacteria hosting either pGEXhCBPl-113 or pGEXhCBPl-453 were cultured in LB medium (GIBCO BRL) to a density of OD6pp = 0.7-1.0 and induced for overexpression of the GST-CBP fusion proteins by addition of IPTG
(isopropylthio-~3-galactoside) to a final concentration of 0.2 mM. The IPTG induced cultures were further grown at room temperature for 2-5 hrs. The cells were harvested by centrifugation for 10 min at 5000g. The cell pellet was used for GST-CBP fusion protein purification by following the procedure from Pharmacia Biotech using Glutathione Sepharose beads. hCBPI-113 and hCBPl-453 proteins were generated by cleaving the corresponding GST fusion proteins with thrombin. SDS-polyacrylamide gel electrophoresis analysis showed that the preparation from pGEXhCBPl-113 gave two polypeptide bands, with apparent molecular weight of 12 kd and 10 kd. The 12 kd band is the expected size of hCBPl-113 and the 10 kd band is most likely a premature translational termination product. The preparation from pGEXhCBPI-450 gave a single band with the expected size, 50 kd.
cDNAs encoding full-length PPARa and PPAR~yl were subcloned into pGEX vectors for the production of GST-PPARa and GST-PPARyl fusion proteins in E.coli. PPAR~yI was cloned from a human fat cell cDNA library (see Elbrecht et al., 1996, Biochem. Biophys. Res.
Comm. 224:431-437). A cDNA encoding the human PPARYl ligand binding domain (PPARyILBD; amino acids 176-478 of PPAR~yl) was subcloned from a modified pSGS vector as a Xho I (site located in the N-terminus of the LBD)/ Xba I (site located in the pSG5 vector) fragment.
The Xba I site was blunt-ended with T4 DNA polymerase. The 1.1 kb fragment containing the LBD was purified from an agarose gel and ligated into pGEX-KG (see Guan & Dixon, 1991, Anal. Biochem. 192:262-267) that had been digested with Xho I and Hind III (the Hind III site had been blunt-ended with T4 DNA polymerase). This construct was used for the production of GST-hPPARyILBD and hPPARyILBD (the ligand binding domain cleaved free of GST). The overexpression and purification of PPARa, PPAR~yl, and PPAR~yILBD were as described above for CBP.
The DNA and amino acid sequences of human PPARa are disclosed in Schmidt et al., 1992, Mol. Endocrinol. 6:1634-1641 and in GenBank, accession no. L07592. See Fieure 8A and 8B.
The DNA and amino acid sequences of human PPARyl are disclosed in Greene et al., 1995, Gene Expr. 4:281-299; Qi et al., 1995, Mol.
Cell. Biol. 15:1817-1825; Elbrecht et al.,1996, Biochem. Biophys. Res.
Comm. 224:431-437; and in GenBank, accession no. L40904. See Figure 9A and 9B. Human PPARy2 contains the same amino acid sequence as human PPARyl except for an amino terminal addition of 24 amino acids (see Elbrecht et al., 1996, Biochem. Biophys. Res. Comm. 224:431-437).
Thus, the amino acid sequence of the ligand binding domain of human PPARy2 is the same as the amino acid sequence of the ligand binding domain of human PPARyl, although the numbering of the amino acids differs (176-478 for human PPARyl and 200-502 for human PPARy2).
The DNA and amino acid sequences of human PPARB are disclosed in Sher et al., 1993, Biochemistry 32:5598-5604 and in GenBank, accession no. L02932. See Figure l0A-C.
Interaction between PPARs and hCBP fra n s Experiments were first conducted using hCBPl-113 and hPPARyILBD. Purified hPPARyILBD was biotinylated with Sulfo-NHS-LC-Biotin (PIERCE) to a biotin:hPPARyILBD ratio of 3:1 according to the procedure provided by PIERCE. Purified hCBPl-113 was directly labeled with europium cryptate (Eu3+K) by the method illustrated in Figure 1.
Biotin-labeled hPPARyILBD, Eu3+K-labeled hCBPl-113, and streptavidin-labeled XL665 (SA-XL665; from PACKARD) were incubated together in the presence or absence of 1 ~,M of known PPARy agonist (BRL49653 or AD5075).
Thus, this experimental format made use of the fluorescent reagent pair europium cryptate (Eu3+K), which acted as donor, and XL665, which acted as acceptor. hCBPl-113 was directly labeled with europium cryptate (Eu3+K); hPPARyILBD was indirectly labeled with XL665 by means of a biotin-streptavidin link. The emission maximum of europium cryptate (Eu3+K) overlaps with the absorption maximum of XL665. Therefore, when europium cryptate (Eu3+K) and XL665 are in close proximity, and the sample is illuminated with light at 337 nm (the absorption maximum of europium cryptate (Eu3+K)), FRET can occur between europium cryptate (Eu3+K) and XL665. This FRET manifests itself as increased emission at 665 nm by XL665. Figure 2 shows a schematic of the format used in this experiment (experiment 1 of Table 1). When agoniat is bound to hPPAR~yILBD, a specific interaction occurs between hPPAR~yILBD and hCBPl-113, thus bringing europium cryptate (Eu3+K) and XL665 into close enough proximity for FRET to occur. In the absence of agonist, no interaction occurs between hPPAR~yILBD and hCBPl-113 and thus europium cryptate (Eu3+K) and XL665 are not brought into close proximity and no FRET occurs. When FRET occurs, the amount of light given off by the sample at the emission maximum of XL665 (665 nm) is increased relative to the amount of light given off by the sample at the emission maximum of europium cryptate {Eu3+K) (620 nm). Therefore, measuring the ratio of emission at 665 nm to 620 nm in the presence and the absence of a substance suspected of being an agonist allows for the determination of whether that substance actually is an agonist. If the substance is an agoniat, an increase in the ratio of emission at 665 nm to 620 nm in the presence of the substance will be ob served.
Reactions were carried out in microtiter plates. Reaction conditions were: appropriate volume (total 250 ~1) of the reaction buffer (either PBS or HEPES, see below, containing 500 mM KF, 0.1% bovine serum albumin, BSA) was added to each well, followed by addition of ligands (BRL49653 or AD5075 at a final concentration of 1 ~,M and 0.1%
dimethylaulfoxide (DMSO) or vehicle control (0.1% DMSO), Eu3+K
labeled hCBP (100 nM), biotin-hPPAR~yILBD (100 nM), and streptavidin-labeled XL665 (100 nM) to appropriate wells. After mixing, 200 ~.1 of reaction mixture was transferred to a new well. The plate was either directly measured for fluorescence resonance energy transfer (FRET) or covered with sealing tape (PACKARD) to avoid evaporation and incubated at room temperature for up to 24 hrs before measuring FRET.
The results of this experiment and others described below yielded ratio values as follows:
Table 1 Experiment Buffer Emission ratioEmission ratio with AD5075 with vehicle 2 HEPES + 0.05% 967 617 3 HEPES + 0.05% 1078 536 4 HEPES + 0.05% 1883 487 CHAPS
Experiment 1 of Table 1 was carried out using PBS ( 13? mM
NaCl, 2.7 mM KCl, 4.3 mM Na2HP04, 1.4 mM KH~04, pH 7.4). The greater emission ratio observed in the presence of AD5075 demonstrated that a specific interaction between hCBPl-113 and hPPARyILBD
occurred in the presence of the agonist AD5075. Although it was clear that FRET was occurring, the signal-noise ratio was small. In experiment 2 of Table 1, HEPES buffer (N-2-hydroxyethylpiperazine-N'-2-ethane sulfonic acid, 100 mM, pH 7.0) containing 0.05% NP40 (Nonidet P-40) was used instead of PBS and an improved signal-noise ratio was obtained.
In order to get an even better signal-noise ratio, the above-described format was modified slightly for experiment 3. In experiment 3, SA-XL665 {500 nM), biotin-labeled hPPARyILBD (100 nM), GST-hCBPl-113, and Eu3+K labeled anti-GST antibody (2.5 ~.l) were incubated in the presence or absence of AD5075 (1 ~t.M) in HEPES buffer containing 0.05% NP40. A two-fold signal- noise ratio was obtained. Figure 3 shows a schematic of the format used in experiment 3.
The anti-GST antibody was a goat antibody to GST from Pharmacia (catalogue number 27-4577-O1) that was labeled with Eu3+K
according to the procedure summarized below.
- Make up @ 10 mg/mL in H20.
Need 42.2 ug (4.2 pL, 96.6 nmol) for 49.0 ~tg Eu3+
Reagent O
O
N.O N
Na03S ~ O
Eus* NH2 O
FW = 436.4 -Resuspended Qa -FW = 1465 2.9 Equiv SULFO-SMCC, 2.5 mg/mL in 10% Use 49.0 pg 20 mM Pi buffer, 10% DMF
DMF/PBS (19.6 pL, 33.4 nmol) RT, 30 minutes _~r_ O
O
Eu~* H \
N
O
equiv. Eu3+
complex 1 ) Add Eu reagent O 2) [Pr] 4.2 mg/mL.
Onight at 4°C.
~ti-csT Ant~t~ay. N ~ S. S N~
f cat # 27-as77-of ~ H I Lower pH: Add 12 pL of 1 M NaPi, pH 7Ø
pH drops to 7.18.
350 pM TCEP
(35 mM stock is 10.0 mg/mL- PBS, pH
Figure 1 illustrates a method of fluorescently labelling a protein or polypeptide with Europium cryptate (Eu3+K).
S Figure 2 illustrates the format for experiments 1 and 2 of Table 1.
Figure 3 illustrates the format for experiment 3 of Table 1.
Figure 4 illustrates the format for experiment 4 of Table 1.
Figure 5 shows the results of studies using the methods of the present invention with four known PPARY agonists. --o-- = AD5075;
--O-- = Fioglitazone; --X -- = Troglitazone; --0-- = BRL49653.
Figure 6 shows a measurement of the binding constant for the interaction between hCBP and PPAR~yILBD.
Figure 7A shows the amino acid sequence of human CBP
(SEQ.ID.NO.:1).
Figure 7B shows the nucleotide sequence of a cDNA
encoding human CBP (SEQ.ID.N0.:2). The open reading frame is at positions 76-1290.
Figure 8A shows the amino acid sequence of human PPARa (SEQ.ID.N0.:3).
Figure 8B shows the nucleotide sequence of a cDNA
encoding human PPARa (SEG.~.ID.N0.:4). The open reading frame is at positions 217-1623.
Figure 9A shows the amino acid sequence of human PPAR~yl (SEQ.ID.N0.:5).
Figure 9B shows the nucleotide sequence of a cDNA
encoding human PPAR~y1 (SEfa.ID.N0.:6). The open reading frame is at positions I73-1609.
Figure l0A shows the amino acid sequence of human PPARB (SEQ.ID.N0.:7).
Figure lOB-C shows the nucleotide sequence of a cDNA
encoding human PPARB (SEQ.ID.N0.:8). The open reading frame is at positions 338-1663.
_7-DETAILED DESCRIPTION OF THE INVENTION
For the purposes of this invention:
- an "agonist" is a substance that binds to nuclear receptors in such a way that a specific binding interaction between the nuclear receptor and CBP or other nuclear receptor co-activator can occur.
- an "antagonist" is a substance that is capable of preventing or disrupting the agonist-induced specific binding interaction between a nuclear receptor and CBP, p300, or another nuclear receptor co-activator.
- a "ligand" of a nuclear receptor is an agonist or an antagonist of the nuclear receptor.
- a "specific binding interaction," "specific binding," and the like, refers to binding between a nuclear receptor and CBP, p300, or other nuclear receptor co-activator which results in the occurrence of fluorescence resonance energy transfer between a fluorescent reagent bound to the nuclear receptor and a fluorescent reagent bound to CBP, p300, or other nuclear receptor co-activator.
With respect to CBP, p300, or other nuclear receptor co-activators, a "binding portion" is that portion of CBP, p300, or other nuclear receptor co-activators that is sufficient for specific binding interactions with nuclear receptors.
With respect to nuclear receptors, a "ligand binding domain" is that portion of a nuclear receptor that is sufficient to bind an agonist or antagonist of the nuclear receptor.
The present invention provides a high throughput, time and labor-saving, non-radioactive, inexpensive, and very reliable assay for the identification and characterization of both agonists and antagonists of nuclear receptors. In a general embodiment, the present invention provides methods of identifying agonists and antagonists for any nuclear receptor for which CBP, p300, or another nuclear receptor binding protein is a co-activator. Such agonists and antagonists are identified by virtue of their ability to induce or prevent binding between the ligand binding domain of a nuclear receptor and CBP, p300, or other nuclear receptor co-activator. The interaction between the nuclear receptor and CBP, p300, or other nuclear receptor co-activator is monitored by observing the occurrence of fluorescence resonance energy _ g-transfer (FRET) between two fluorescent reagents. One fluorescent reagent is bound to the nuclear receptor; the other fluorescent reagent is bound to CBP, p300, or other nuclear receptor co-activator. The binding of fluorescent reagent to nuclear receptor, CBP, p300, or other nuclear receptor co-activator can be by a covalent linkage or a non-covalent linkage.
The present invention makes use of fluorescence resonance energy transfer (FRET). FRET is a process in which energy is transferred from an excited donor fluorescent reagent to an acceptor fluorescent reagent by means of intermolecular long-range dipole-dipole coupling. FRET typically occurs over distances of about lOb to 100 and requires that the emission spectrum of the donor reagent and the absorbance spectrum of the acceptor reagent overlap adequately and that the quantum yield of the donor and the absorption coe~cient of the acceptor be su~ciently high. In addition, the transition dipoles of the donor and acceptor fluorescent reagents must be properly oriented relative to one another. For a review of FRET and its applications to biological systems, see Clegg, 1995, Current Opinions in Biotechnology 6:103-110.
The present invention makes use of a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent. The second fluorescent reagent comprises a fluorophore capable of undergoing energy transfer by either (a) donating excited state energy to the first fluorescent reagent, or (b) accepting excited state energy from the first fluorescent reagent. In other words, according to the present invention, either the first or the second fluorescent reagents can be the donor or the acceptor during FRET.
The first and second fluorescent reagents are spectropscopically complementary to each other. This means that their spectral characteristics are such that excited state energy transfer can occur between them. FRET is highly sensitive to the distance between the first and second fluorescent reagents. For example, FRET varies inversely with the sixth power of the distance between the first and second fluorescent reagents. In the absence of agonist, the first fluorescent reagent, bound to the nuclear receptor or ligand binding domain thereof, will not be near the second fluorescent reagent, bound to CBP, p300, or other nuclear receptor co-activator, or binding portion thereof. Thus, no FRET, or very little FRET, will be observed. In the presence of agonist, however, interaction between the nuclear receptor and CBP, p300, or other nuclear receptor co-activator will occur, thus bringing close together the first and the second fluorescent reagents, allowing FRET to occur and be observed.
Accordingly, the present invention provides a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, will occur; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In particular embodiments, the nuclear receptor is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D
receptors, and "orphan nuclear receptors" such as LXR, FXR, etc.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is a ligand binding domain of a nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof comprises an AF-2 site of a nuclear receptor.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length PPAR. In another embodiment, the nuclear receptor or ligand binding domain thereof is the ligand binding domain of a PPAR. In a further embodiment, the PPAR is selected from the group consisting of PPARa, PPARyl, PPARy2, and PPARB. In a further embodiment, the ligand binding domain of the PPAR contains amino acid residues 176-478 of human PPARyl.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 143-462 of human RARa.
In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 122-410 of rat T3Ral. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 227-463 of mouse RXRy. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 251-595 of human ER.
In a particluar embodiment, the above-described methods utilize full-length CBP, either mouse or human. In other embodiments, the methods utilize amino acid residues 1-113 of human CBP. In another embodiment, the methods utilize amino acid residues 1-453 of human CBP.
The conditions under which the methods described above are carried out are conditions that are typically used in the art for the study of protein-protein interactions: e.g., physiological pH; salt conditions such as those represented by such commonly used buffers as PBS; a temperature of about 4°C to about 55°C. The presence of commonly used non-ionic detergents, e.g., NP-40~, sarcosyl, Triton X-100~, is optional. When europium cryptates are used as fluorescent reagents, reactions should contain KF at a concentration of at least 200 mM.
Heery et al., 1997, Nature 387:733-736 showed that interactions between nuclear receptors and a variety of nuclear receptor co-activators are mediated by a short amino acid sequence in the nuclear receptor co-activators having the amino acid sequence LXXLL, where L
is leucine and X represents any amino acid. Accordingly, the present invention can be practiced with a binding portion of a nuclear receptor co-activator, provided that the binding portion contains the amino acid sequence LXXLL. Therefore, the present invention includes a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a binding portion of a nuclear receptor co-activator, where the binding portion contains the amino acid sequence LXXLL, and where the binding portion is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the binding portion of the nuclear receptor co-activator will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In a particular embodiment, the nuclear receptor co-activator is selected from the group consisting of human RIP-140, human SRC-1, mouse TIF-2, human or mouse CBP, human or mouse p300, mouse TIF-1, and human TRIP proteins.
In a particular embodiment, the nuclear receptor co-activator is human RIP-140 and the binding portion includes a contiguous stretch of amino acids of human RIP-140 selected from the group consisting of positions 20-29,132-139,184-192, 266-273, 379-387, 496-506, 712-719, 818-825, 935-944, and 935-942.
In another embodiment, the nuclear receptor co-activator is human SRC-1 and the binding portion includes a contiguous stretch of amino acids of human SRC-1 selected from the group consisting of positions 45-53, 632-640, 689-696, ?48-755, and 1434-1441.
In another embodiment, the nuclear receptor co-activator is mouse TIF-2 and the binding portion includes a contiguous stretch of amino acids of mouse TIF-2 selected from the group consisting of:
positions 640-650, 689-699, and 744-754.
In another embodiment, the nuclear receptor co-activator is human or mouse CBP and the binding portion includes a contiguous stretch of amino acids of human or mouse CBP selected from the group consisting of positions 68-78 and 356-366.
In another embodiment, the nuclear receptor co-activator is human or mouse p300 and the binding portion includes a contiguous stretch of amino acids of human or mouse p300 selected from the group consisting of positions 80-90 and 341-351.
In another embodiment, the nuclear receptor co-activator is mouse TIF-1 and the binding portion includes a contiguous stretch of amino acids of mouse TIF-1 containing positions ?22-732.
In another embodiment, the nuclear receptor co-activator is human TRIP2 and the binding portion includes a contiguous stretch of amino acids of human TRIP2 containing positions 23-33.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS containing positions 97-107.
In another embodiment, the nuclear receptor co-activator is human TRIP4 and the binding portion includes a contiguous stretch of amino acids of human TRIP4 containing positions 36-46.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS containing positions 26-36.
In another embodiment, the nuclear receptor co-activator is human TRIP8 and the binding portion includes a contiguous stretch of amino acids of human TRIP8 containing positions 36-46.
In another embodiment, the nuclear receptor co-activator is human TRIPS and the binding portion includes a contiguous stretch of amino acids of human TRIPS selected from the group consisting of positions 73-83, 256-266 and 288-298.
For amino acid sequences of nuclear receptor co-activators, see Yao et al., 1996, Proc. Natl. Acad. Sci. USA 93:10626-10631 (SRC-1);
O~ate et al., 1995, Science 270:1354-1357 (SRC-1); Cavaill~s et al., 1995, EMBO J. 14:3741-3751 (RIP-140); Voegel et al., 1996, EMBO J. 15:101-108 (TIF-2); Kwok et al., 1994, Nature 370:223-226 (CBP); Arias et al., 1994, Nature 370:226-229 (CBP); Eckner et al., 1994, Genes Dev. 8:869-884 (p300); Le Douarin et al., 1995, EMBO J. 14:2020-2033 (TIF-1); Lee et al., 1995, Nature 3?4:91-94 (TRIP proteins).
The particular embodiments of the present invention described above are all particular embodiments of a more general S method that is also part of the present invention. That general method is a method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a polypeptide containing the amino acid sequence LXXLL where the polypeptide is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the polypeptide will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
In a particular embodiment, the amino acid sequence LXXLL is present in an a helical portion of the polypeptide. In another embodiment, the amino acid sequence LXXLL is present in an a helical portion of the polypeptide and the leucines form a hydrophobic face.
The present invention provides methods for identifying antagonists of a nuclear receptor. Such methods are based on the ability of the antagonist to prevent the occurrence of agonist-induced binding between a nuclear receptor and CBP, p300, or other nuclear receptor co-activator, or to disrupt such binding after it has occurred. Thus, the present invention provides a method for identifying antagonists of nuclear receptors that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent;
(c) an agonist of the nuclear receptor; and (d) a substance suspected of being an antagonist of the nuclear receptor;
under conditions such that, in the absence of the substance, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof will occur; and (e) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents when the substance is present and measuring FRET between the first and second fluorescent reagents when the substance is absent;
where the a decrease in FRET when the substance is present indicates that the substance is an antagonist of the nuclear receptor.
In particular embodiments, the nuclear receptor is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D
receptors, and "orphan nuclear receptors" such as LXR, FXR, etc.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is a ligand binding domain of a nuclear receptor. In another embodiment, the nuclear receptor or ligand binding domain thereof is an AF-2 site of a nuclear receptor.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is a full-length PPAR. In another embodiment, the nuclear receptor or ligand binding domain thereof is the ligand binding domain of a PPAR. In a further embodiment, the PPAR is selected from the group consisting of PPAR,a, PPAR,~y, and PPAR8. In a further embodiment, the ligand binding domain of the PPAR contains amino acid residues 176-47$ of human PPAR,Yl.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 143-462 of human RAR,a.
In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 122-410 of rat T3Ral. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 227-463 of mouse RxR,~. In another embodiment, the nuclear receptor or ligand binding domain thereof contains amino acids 251-595 of human ER.
In a particular embodiment, the above-described methods utilize full-length CBP, either mouse or human. In other embodiments, the methods utilize amino acid residues 1-113 of human CBP. In another embodiment, the methods utilize amino acid residues 1-453 of human CBP.:
The conditions under which the methods described above are carried out are conditions that are typically used in the art for the study of protein-protein interactions: e.g., physiological pH; salt conditions such as those represented by such commonly used buffers as PBS; a temperature of about 4°C to about 55°C. The presence of commonly used non-ionic detergents, e.g., NP-400, sarcosyl, Triton X
1000, is optional. When europium cryptates are used as fluorescent reagents, reactions should contain KF at a concentration of at least 200 mM.
In principle, one could measure FRET by monitoring either (a) a decrease in the emission of the donor fluorescent reagent following stimulation at the donor's absorption wavelength and/or (b) an increase in the emission of the acceptor reagent following stimulation at the donor's absorption wavelength. In practice, FRET is most effectively measured by emission ratioing. Emission ratioing monitors the change in the ratio of emission by the acceptor over emission by the donor. An increase in this ratio signifies that energy is being transferred from donor to acceptor and thus that FRET is occurring. Emission ratioing can be measured by employing a laser-scanning confocal microscope.
Emission ratioing is preferably done by splitting the emitted light from a sample with a dichroic mirror and measuring two wavelength bands (corresponding to the donor and the acceptor emission wavelengths) simultaneously with two detectors. Alternatively, the emitted light can be sampled consecutively at each wavelength (by using appropriate filters) with a single detector. In any case, these and other methods of 3 S measuring FRET are well known in the art.
Although a variety of donor and acceptor fluorescent reagents can be used in the practice of the present invention, preferred embodiments of the present invention make use of cryptates of fluorescent reagents as donor reagents. Inclusion of a substrate into the intramolecular cavity of a macropolycyclic ligand results in the formation of a cryptate. The macropolycyclic ligand shields the substrate from interaction with solvent and other solute molecules. If the substrate is a fluororescent reagent, formation of a cryptate may result in markedly different spectroscopic characteristics for the reagent as compared to the spectroscopic characteristics of the free reagent.
The present invention includes the use of europium (Eunl) or terbium (Tbul) cryptates as donor fluorescent reagents. Such Eu~ or Tbnl cryptates, as well as methods for their formation, are well known in the art. For example, see Alpha et al., 1987, Angew. Chem. Int. Ed.
Engl. 26:266-267; Mathis, 1995, Clin. Chem. 41:1391-1397. A europium cryptate is formed by the inclusion of a europium ion into the intramolecular cavity of a macropolycyclic ligand which contains bipyridine groups as light absorbers. When europium cryptates are present in solution together with fluoride ions, a total shielding of the europium cryptate fluorescence is occurs. The molecular structure of a europium cryptate is shown below.
NH NH
O=C, .C=O
~=N N=C
Europium cryptates can be conjugated to proteins by the use of well-known heterobifunctional reagents (see, e.g., International Patent Application WO 89/05813; Prat et al., 1991, Anal. Biochem.
195:283-289; Lopez et al., 1993, Clin. Chem. 39:196-201 ).
The present invention includes the use of XL665 as the acceptor fluorescent reagent. XL665 is a crosslinked derivative of allophycocyanin (APC). APC is a porphyrin containing protein which is derived from the light harvesting system of algae (Kronick, 1986, M.
Immunol. Meth. 92:1-13). XL665 has an absorption maximum at =620 nm and an emission maximum at 665 nm. In some embodiments of the invention, XL665 is labeled with streptavidin in order to eil'ect the binding of the streptavidin-labled XL665 to a biotin-labeled substance, e.g. , CBP or the ligand binding domain of a nuclear receptor.
Streptavidin labeling of XL655 and biotin labeling of CBP, or the ligand binding domain of a nuclear receptor, can be performed by well known methods.
In a preferred embodiment of the invention, XL665 as the acceptor fluorescent reagent is combined with Europium cryptate (Eu3+K) as the donor fluorescent reagent. Europium cryptate (Eu3+K) has a large Stokes shift, absorbing light at 337 nm and emitting at 620 nm. Thus, the emission maximum of Europium cryptate (Eu3+K) overlaps the absorption maximum of XL665. Europium cryptate (Eu3+K) has a large temporal shift; the time between absorption and emission of a photon is about 1 millisecond. This is advantageous because most background fluorescence signals in biological samples are short-lived. Thus the use of a fluorescent reagent such as europium cryptate, with a long fluorescent lifetime, permits time-resolved detection resulting in the reduction of background interference.
The spectral and temporal properties of europium cryptate (Eu3+K) result in essentially no fluorescence background and thus assays using this fluorescent reagent can be carried out in a "mix and read" mode, greatly facilitating its use as a high throughput screening tool. For the embodiment using Europium cryptate (Eu3+K) and XL665, the measuring instrument irradiates the sample at 337 nm and measures the fluorescence output at two wavelengths, 620 nm (B counts, europium fluorescence) and 665 nm (A counts, XL665 fluorescence).
The extent of flurorescent resonance energy transfer is measured as the ratio between these two values. Typically this ratio is multiplied by 10,000 to give whole numbers.
Other FRET donor-acceptor pairs are suitable for the practice of the present invention. For example, the following donor-acceptor pairs can be used: dansyl/fluorescein; fluorescein/rhodamine;
tryptophan/aminocoumarin.
The present invention provides a nuclear receptor or ligand binding domain thereof labeled with a fluorescent reagent for use in the above-described methods of identifying agonists and antagonists of nuclear receptors. The present invention also provides CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a fluorescent reagent.
In a particular embodiment, the nuclear receptor or ligand binding domain thereof is selected from the group consisting of PPARa, PPARy, PPAR8, a ligand binding domain of PPARa, PPAR~y, or PPARB, and amino acid residues 176-478 of human PPAR71 and the fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
In a particular embodiment, CBP, p300, or other nuclear receptor co-activator is labeled with a fluorescent reagent selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
The following non-limiting examples are presented to better illustrate the invention.
To test whether human CBP can interact with PPARs in an agonist-dependent manner, we cloned the human cDNA fragments encoding the NH2-terminal 1-113 amino acids (hCBPl-113) and 1-453 amino acids (hCBPl-453) of human CBP by the polymerase chain reaction (PCR). The DNA and amino acid sequences of human CBP are disclosed in Borrow et al., 1996, Nature Genet. 14:33-41 and in GenBank, accession no. U47741.
The primers used for hCBPl-113 were:
5'-ACTCGGATCCAAGCCATGGCTGAGAACTTGCTGGACGG-3' (SEQ.ID.N0.:9) and 5'-CACAAAGCTTAGGCCATGTTAGCACTGTTCGG-3' (SEQ.ID.NO.:
10).
These primers were expected to amplify a 0.9 kb DNA fragment.
The primers for hCBPl-453 were:
5'-ACTCGGATCCAAGCCATGGCTGAGAACTTGCTGGACGG-3' (SEQ.ID.N0.:9) and 5'CTCAGTCGACTTATTGAATTCCACTAGCTGGAGATCC-3' (SEQ.ID.NO.:11).
These primers were expected to amplify a 1.5 kb DNA fragment..
The template for the PCR reaction was a human fetal brain cDNA library (Stratagene, Catalogue #IS 937227). Of course, any human cDNA library from a tissue expressing CBP could have been used. The PCR amplified 0.9 kb and 1.5 kp DNA fragments which were digested with restriction endonucleases and ligated into pBluescript II
vector. DNA sequencing analysis confirmed that the amplified fragments were identical to the corresponding published nucleic acid sequences of human CBP.
Based on the publicly available sequences for human CBP
cited above, other primers could be readily identified and prepared by those skilled in the art in order to amplify and clone other portions of cDNA encoding human CBP from appropriate cDNA libraries. Once such portions of human CBP are produced, they could be used in the methods of the present invention in a manner similar to that described herein for hCBPl-113 and hCBPl-453. The amino acid sequence of human CBP is shown in Figure 7A; the nucleic acid sequence of the cDNA encoding human CBP is shown in Figure 7B.
To express the polypeptides encoded by the PCR fragments, vectors encoding fusion proteins of the polypeptides and glutathione S-transferase (GST) were constructed and expressed in E. coli. The PCR
fragments were subcloned into the expression vector pGEX (Pharmacia Biotech) to generate pGEXhCBPl-113 and pGEXhCBPl-453.
_ 2p _ pGEXhCBPl-113 and pGEXhCBPI-453 were transfected into the DHSa strain of E. coli (GIBCO BRL) and the bacteria hosting either pGEXhCBPl-113 or pGEXhCBPl-453 were cultured in LB medium (GIBCO BRL) to a density of OD6pp = 0.7-1.0 and induced for overexpression of the GST-CBP fusion proteins by addition of IPTG
(isopropylthio-~3-galactoside) to a final concentration of 0.2 mM. The IPTG induced cultures were further grown at room temperature for 2-5 hrs. The cells were harvested by centrifugation for 10 min at 5000g. The cell pellet was used for GST-CBP fusion protein purification by following the procedure from Pharmacia Biotech using Glutathione Sepharose beads. hCBPI-113 and hCBPl-453 proteins were generated by cleaving the corresponding GST fusion proteins with thrombin. SDS-polyacrylamide gel electrophoresis analysis showed that the preparation from pGEXhCBPl-113 gave two polypeptide bands, with apparent molecular weight of 12 kd and 10 kd. The 12 kd band is the expected size of hCBPl-113 and the 10 kd band is most likely a premature translational termination product. The preparation from pGEXhCBPI-450 gave a single band with the expected size, 50 kd.
cDNAs encoding full-length PPARa and PPAR~yl were subcloned into pGEX vectors for the production of GST-PPARa and GST-PPARyl fusion proteins in E.coli. PPAR~yI was cloned from a human fat cell cDNA library (see Elbrecht et al., 1996, Biochem. Biophys. Res.
Comm. 224:431-437). A cDNA encoding the human PPARYl ligand binding domain (PPARyILBD; amino acids 176-478 of PPAR~yl) was subcloned from a modified pSGS vector as a Xho I (site located in the N-terminus of the LBD)/ Xba I (site located in the pSG5 vector) fragment.
The Xba I site was blunt-ended with T4 DNA polymerase. The 1.1 kb fragment containing the LBD was purified from an agarose gel and ligated into pGEX-KG (see Guan & Dixon, 1991, Anal. Biochem. 192:262-267) that had been digested with Xho I and Hind III (the Hind III site had been blunt-ended with T4 DNA polymerase). This construct was used for the production of GST-hPPARyILBD and hPPARyILBD (the ligand binding domain cleaved free of GST). The overexpression and purification of PPARa, PPAR~yl, and PPAR~yILBD were as described above for CBP.
The DNA and amino acid sequences of human PPARa are disclosed in Schmidt et al., 1992, Mol. Endocrinol. 6:1634-1641 and in GenBank, accession no. L07592. See Fieure 8A and 8B.
The DNA and amino acid sequences of human PPARyl are disclosed in Greene et al., 1995, Gene Expr. 4:281-299; Qi et al., 1995, Mol.
Cell. Biol. 15:1817-1825; Elbrecht et al.,1996, Biochem. Biophys. Res.
Comm. 224:431-437; and in GenBank, accession no. L40904. See Figure 9A and 9B. Human PPARy2 contains the same amino acid sequence as human PPARyl except for an amino terminal addition of 24 amino acids (see Elbrecht et al., 1996, Biochem. Biophys. Res. Comm. 224:431-437).
Thus, the amino acid sequence of the ligand binding domain of human PPARy2 is the same as the amino acid sequence of the ligand binding domain of human PPARyl, although the numbering of the amino acids differs (176-478 for human PPARyl and 200-502 for human PPARy2).
The DNA and amino acid sequences of human PPARB are disclosed in Sher et al., 1993, Biochemistry 32:5598-5604 and in GenBank, accession no. L02932. See Figure l0A-C.
Interaction between PPARs and hCBP fra n s Experiments were first conducted using hCBPl-113 and hPPARyILBD. Purified hPPARyILBD was biotinylated with Sulfo-NHS-LC-Biotin (PIERCE) to a biotin:hPPARyILBD ratio of 3:1 according to the procedure provided by PIERCE. Purified hCBPl-113 was directly labeled with europium cryptate (Eu3+K) by the method illustrated in Figure 1.
Biotin-labeled hPPARyILBD, Eu3+K-labeled hCBPl-113, and streptavidin-labeled XL665 (SA-XL665; from PACKARD) were incubated together in the presence or absence of 1 ~,M of known PPARy agonist (BRL49653 or AD5075).
Thus, this experimental format made use of the fluorescent reagent pair europium cryptate (Eu3+K), which acted as donor, and XL665, which acted as acceptor. hCBPl-113 was directly labeled with europium cryptate (Eu3+K); hPPARyILBD was indirectly labeled with XL665 by means of a biotin-streptavidin link. The emission maximum of europium cryptate (Eu3+K) overlaps with the absorption maximum of XL665. Therefore, when europium cryptate (Eu3+K) and XL665 are in close proximity, and the sample is illuminated with light at 337 nm (the absorption maximum of europium cryptate (Eu3+K)), FRET can occur between europium cryptate (Eu3+K) and XL665. This FRET manifests itself as increased emission at 665 nm by XL665. Figure 2 shows a schematic of the format used in this experiment (experiment 1 of Table 1). When agoniat is bound to hPPAR~yILBD, a specific interaction occurs between hPPAR~yILBD and hCBPl-113, thus bringing europium cryptate (Eu3+K) and XL665 into close enough proximity for FRET to occur. In the absence of agonist, no interaction occurs between hPPAR~yILBD and hCBPl-113 and thus europium cryptate (Eu3+K) and XL665 are not brought into close proximity and no FRET occurs. When FRET occurs, the amount of light given off by the sample at the emission maximum of XL665 (665 nm) is increased relative to the amount of light given off by the sample at the emission maximum of europium cryptate {Eu3+K) (620 nm). Therefore, measuring the ratio of emission at 665 nm to 620 nm in the presence and the absence of a substance suspected of being an agonist allows for the determination of whether that substance actually is an agonist. If the substance is an agoniat, an increase in the ratio of emission at 665 nm to 620 nm in the presence of the substance will be ob served.
Reactions were carried out in microtiter plates. Reaction conditions were: appropriate volume (total 250 ~1) of the reaction buffer (either PBS or HEPES, see below, containing 500 mM KF, 0.1% bovine serum albumin, BSA) was added to each well, followed by addition of ligands (BRL49653 or AD5075 at a final concentration of 1 ~,M and 0.1%
dimethylaulfoxide (DMSO) or vehicle control (0.1% DMSO), Eu3+K
labeled hCBP (100 nM), biotin-hPPAR~yILBD (100 nM), and streptavidin-labeled XL665 (100 nM) to appropriate wells. After mixing, 200 ~.1 of reaction mixture was transferred to a new well. The plate was either directly measured for fluorescence resonance energy transfer (FRET) or covered with sealing tape (PACKARD) to avoid evaporation and incubated at room temperature for up to 24 hrs before measuring FRET.
The results of this experiment and others described below yielded ratio values as follows:
Table 1 Experiment Buffer Emission ratioEmission ratio with AD5075 with vehicle 2 HEPES + 0.05% 967 617 3 HEPES + 0.05% 1078 536 4 HEPES + 0.05% 1883 487 CHAPS
Experiment 1 of Table 1 was carried out using PBS ( 13? mM
NaCl, 2.7 mM KCl, 4.3 mM Na2HP04, 1.4 mM KH~04, pH 7.4). The greater emission ratio observed in the presence of AD5075 demonstrated that a specific interaction between hCBPl-113 and hPPARyILBD
occurred in the presence of the agonist AD5075. Although it was clear that FRET was occurring, the signal-noise ratio was small. In experiment 2 of Table 1, HEPES buffer (N-2-hydroxyethylpiperazine-N'-2-ethane sulfonic acid, 100 mM, pH 7.0) containing 0.05% NP40 (Nonidet P-40) was used instead of PBS and an improved signal-noise ratio was obtained.
In order to get an even better signal-noise ratio, the above-described format was modified slightly for experiment 3. In experiment 3, SA-XL665 {500 nM), biotin-labeled hPPARyILBD (100 nM), GST-hCBPl-113, and Eu3+K labeled anti-GST antibody (2.5 ~.l) were incubated in the presence or absence of AD5075 (1 ~t.M) in HEPES buffer containing 0.05% NP40. A two-fold signal- noise ratio was obtained. Figure 3 shows a schematic of the format used in experiment 3.
The anti-GST antibody was a goat antibody to GST from Pharmacia (catalogue number 27-4577-O1) that was labeled with Eu3+K
according to the procedure summarized below.
- Make up @ 10 mg/mL in H20.
Need 42.2 ug (4.2 pL, 96.6 nmol) for 49.0 ~tg Eu3+
Reagent O
O
N.O N
Na03S ~ O
Eus* NH2 O
FW = 436.4 -Resuspended Qa -FW = 1465 2.9 Equiv SULFO-SMCC, 2.5 mg/mL in 10% Use 49.0 pg 20 mM Pi buffer, 10% DMF
DMF/PBS (19.6 pL, 33.4 nmol) RT, 30 minutes _~r_ O
O
Eu~* H \
N
O
equiv. Eu3+
complex 1 ) Add Eu reagent O 2) [Pr] 4.2 mg/mL.
Onight at 4°C.
~ti-csT Ant~t~ay. N ~ S. S N~
f cat # 27-as77-of ~ H I Lower pH: Add 12 pL of 1 M NaPi, pH 7Ø
pH drops to 7.18.
350 pM TCEP
(35 mM stock is 10.0 mg/mL- PBS, pH
7.0), 2.4 pL, min rt then 15 min 4°C
O
S O
N S' ~ ~N
~t~-csT ~t~i~ay, N H
Cat # 27-4577-01 2 (>
O
From Pharmacia, 5.0 mg/mL, 5.0 Equiv SPDP, FW =312, Dissolve FW = 150 kD Use 200 pL (1 mg, RT, 5 hours @ 1.00 mg/mL in EtOH.
6.66 nmol) exchange into 10 mM Add 10.4 pL (5 equiv., Borate, 350 mM NaCI, 10% Gly, 10.4 pH 8.5 with BioSpin-30 rotei~n.~ 33.4 nmol) to P
To further improve the signal to noise ratio, a series of experiments were conducted. Experiment 4 of Table 1 exemplifies 5 results obtained from those efforts. cDNA encoding a longer fragment of hCBP was cloned and expressed to get hCBPl-453. hCBPl-453 was biotinylated. Biotin-labeled hCBPl-453 (25 nM), SA-XL665 (100 nM), GST-hPPAR~yILBD (1 nM), and Eu3+K-labeled anti-GST antibody (2 nM) were mixed together in the presence or absence of 1 ~,M AD5075. The 10 detergent was changed from 0.05% NP40 to 0.5% CHAPS (3-~[3-cholamidopropyl]dimethyl-ammoniol}-1-propanesulfonate). A three- to four-fold signal-noise ratio was obtained. Figure 4 shows the strategy used for experiment 4 and similar experiments.
The correlation between results from the above-described assays and previously reported results from in aitro binding and transcriptional activation assays of selected antidiabetic insulin sensitizers that are known to be PPARy agonists (Elbrecht et al., 1996, Biochem Biophys Res Comm 224:431-437} was analyzed by titrating those known PPARy agonists in the assays described above and comparing ECSOs so obtained with previously described values for potency in binding or transcriptional activation assays for the known agoniats. The results are shown in Figure 5. From Figure 5, the following ECSps can be derived:
AD5075 = 8 nM
BRL49653 = 53 nM
Troglitazone = 646 nM
Pioglitazone = 890 nM.
These ECSOs generated in the above-described assays are in close agreement with those generated by in vitro binding and transcriptional activation studies (Elbrecht et al., 1996, Biochem Biophys Res Comm 224:431-437).
The above-described assay can also be used to characterize the interaction between nuclear receptors with co-activators as, e.g., by determining the binding constant for that interaction. Figure 6 shows an example of such an application. Saturating amounts of PPARy agonist (10 ~.M BRL49653) were used. Increasing concentrations of non-biotinylated hCBPl-453 were used to titrate away biotin-hCBP-PPAR~yILBD complex and decrease the fluorescence energy transfer. A
Kd of 300 nM for the interaction between hCBPl-453 and PPAR~yILBD
can be derived from the results illustrated in Figure 6 and this Kd (300 nM) is a measurement ofthe affinity between CBP and PPAR~y.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.
_ 2g _ SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Merck & Co., Inc.
(ii) TITLE OF INVENTION: ASSAYS FOR NUCLEAR RECEPTOR
AGONISTS AND ANTAGONISTS USING FLUORESCENCE RESONANCE
ENERGY TRANSFER
(iii) NUMBER OF SEQUENCES: 11 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Merck & Co., Inc.
(B) STREET: P.O. Box 2000, 126 E. Lincoln Ave.
(C) CITY: Rahway (D) STATE: NJ
(E) COUNTRY: USA
(F) ZIP: 07065-0900 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COMPUTER: IBM Compatible (C) OPERATING SYSTEM: Windows (D) SOFTWARE: FastSEQ for Windows Version 2.Ob (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Coppola, Joseph A
(B) REGISTRATION NUMBER: 38,413 (C) REFERENCE/DOCKET NUMBER: 20017PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 732-594-6734 (B) TELEFAX: 732-594-4720 (C) TELEX:
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 405 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear -1_ (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
Met Ala Glu Asn Leu Leu Asp Gly Pro Pro Asn Pro Lys Arg Ala Lys Leu Ser Ser Pro Gly Phe Ser Ala Asn Asp Ser Thr Asp Phe Gly Ser Leu Phe Asp Leu Glu Asn Asp Leu Pro Asp Glu Leu Ile Pro Asn Gly Gly Glu Leu Gly Leu Leu Asn Ser Gly Asn Leu Val Pro Asp Ala Ala Ser Lys His Lys Gln Leu Ser Glu Leu Leu Arg Gly Gly Ser Gly Ser 65 70 75 g0 Ser Ile Asn Pro Gly Ile Gly Asn Val Ser Ala Ser Ser Pro Val Gln Gln Gly Leu Gly Gly Gln Ala Gln Gly Gln Pro Asn Ser Ala Asn Met Ala Ser Leu Ser Ala Met Gly Lys Ser Pro Leu Ser Gln Gly Asp Ser Ser Ala Pro Ser Leu Pro Lys Gln Ala Ala Ser Thr Ser Gly Pro Thr Pro Ala Ala Ser Gln Ala Leu Asn Pro Gln Ala Gln Lys Gln Val Gly Leu Ala Thr Ser Ser Pro Ala Thr Ser Gln Thr Gly Pro Gly Ile Cys Met Asn Ala Asn Phe Asn Gln Thr His Pro Gly Leu Leu Asn Ser Asn Ser Gly His Ser Leu Ile Asn Gln Ala Ser Gln Gly Gln Ala Gln VaI
Met Asn Gly Ser Leu Gly Ala Ala Gly Arg Gly Arg Gly Ala Gly Met Pro Tyr Pro Thr Pro Ala Met Gln Gly Ala Ser Ser Ser Val Leu Ala Glu Thr Leu Thr Gln Val Ser Pro Gln Met Thr Gly His Ala Gly Leu Asn Thr Ala Gln Ala Gly Gly Met Ala Lys Met Gly Ile Thr Gly Asn Thr Ser Pro Phe Gly Gln Pro Phe Ser Gln Ala Gly Gly Gln Pro Met Gly Ala Thr Gly Val Asn Pro Gln Leu Ala Ser Lys Gln Ser Met Val Asn Ser Leu Pro Thr Phe Pro Thr Asp Ile Lys Asn Thr Ser Val Thr Asn Val Pro Asn Met Ser Gln Met Gln Thr Ser Val Gly Ile Val Pro Thr Gln Ala Ile Ala Thr Gly Pro Thr Ala Asp Pro Glu Lys Arg Lys Leu Ile Gln Gln Gln Leu Val Leu Leu Leu His Ala His Lys Cys Gln Arg Arg Glu Gln Ala Asn Gly Glu Val Arg Ala Cys Ser Leu Pro His Cys Arg Thr Met Lys Asn Val Leu Asn His Met Thr His Cys Gln Ala Gly Lys Ala Cys Gln WO 99!18124 PCT/US98/21049 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1290 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
GGCCCTCGCC
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 468 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Val Asp Thr Glu Ser Pro Leu Cys Pro Leu Ser Pro Leu Glu Ala Gly Asp Leu Glu Ser Pro Leu Ser Glu Glu Phe Leu Gln Glu Met Gly Asn Ile Gln Glu Ile Ser Gln Ser Ile Gly Glu Asp Ser Ser Gly Ser Phe Gly Phe Thr Glu Tyr Gln Tyr Leu Gly Ser Cys Pro Gly Ser Asp Gly Ser Val Ile Thr Asp Thr Leu Ser Pro Ala Ser Ser Pro Ser Ser Val Thr Tyr Pro Val Val Pro Gly Ser Val Asp Glu Ser Pro Ser Gly 85 90 g5 Ala Leu Asn Ile Glu Cys Arg Ile Cys Gly Asp Lys Ala Ser Gly Tyr His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Leu Lys Leu Val Tyr Asp Lys Cys Asp Arg Ser Cys Lys Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys Arg Phe His Lys 145 _ 150 155 160 Cys Leu Ser Val Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Met Pro Arg Ser Glu Lys Ala Lys Leu Lys Ala Glu Ile Leu Thr Cys Glu His Asp Ile Glu Asp Ser Glu Thr Ala Asp Leu Lys Ser Leu Ala Lys Arg Ile Tyr Glu Ala Tyr Leu Lys Asn Phe Asn Met Asn Lys Val Lys Ala Arg Val Ile Leu Ser Gly Lys Ala Ser Asn Asn Pro Pro Phe Val Ile His Asp Met Glu Thr Leu Cys Met Ala Glu Lys Thr Leu Val Ala Lys Leu Val Ala Asn Gly Ile Gln Asn Lys Glu Val Glu Val Arg Ile Phe His Cys Cys Gln Cys Thr Ser Val Glu Thr Val Thr Glu Leu Thr Glu Phe Ala Lys Ala Ile Pro Ala Phe Ala Asn Leu Asp Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val Tyr Glu Ala Ile Phe Ala Met Leu Ser Ser Val Met Asn Lys Asp Gly Met Leu Val Ala Tyr Gly Asn Gly Phe Ile Thr Arg Glu Phe Leu Lys Ser Leu Arg Lys Pro Phe Cys Asp Ile Met Glu Pro Lys Phe Asp Phe Ala Met Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Ile Ser Leu Phe Val Ala Ala Ile Ile Cys Cys Gly Asp Arg Pro Gly Leu Leu Asn Val Gly His Ile Glu Lys Met Gln Glu Gly Ile Val His Val Leu Arg Leu His Leu Gln Ser Asn His Pro Asp Asp Ile Phe Leu Phe Pro Lys Leu Leu Gln Lys Met Ala Asp Leu Arg Gln Leu Val Thr Glu His Ala Gln Leu Val Gln Ile Ile Lys Lys Thr Glu Ser Asp Ala Ala Leu His Pro Leu Leu Gln Glu Ile Tyr Arg Asp Met Tyr (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1854 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
GTGGCAAGAC
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 478 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
Met Thr Met Val Asp Thr Glu Ile Ala Phe Trp Pro Thr Asn Phe Gly Ile Ser Ser Val Asp Leu Ser Val Met Glu Asp His Ser His Ser Phe Asp Ile Lys Pro Phe Thr Thr Val Asp Phe Ser Ser Ile Ser Thr Pro His Tyr Glu Asp Ile Pro Phe Thr Arg Thr Asp Pro Val Val Ala Asp Tyr Lys Tyr Asp Leu Lys Leu Gln Glu Tyr Gln Ser Ala Ile Lys Val 65 70 75 g0 Glu Pro Ala Ser Pro Pro Tyr Tyr Ser Glu Lys Thr Gln Leu Tyr Asn Lys Pro His Glu Glu Pro Ser Asn Ser Leu Met Ala Ile Glu Cys Arg Val Cys Gly Asp Lys Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Leu Lys Leu Ile Tyr Asp Arg Cys Asp Leu Asn Cys Arg Ile His Lys Lys Ser Arg Asn Lys Cys Gln Tyr Cys Arg Phe Gln Lys Cys Leu Ala Val Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Ile Ala Gln Ala Glu Lys Glu Lys Leu Leu Ala Glu Ile Ser Ser Asp Ile Asp Gln Leu Asn Pro Glu Ser Ala Asp Leu Arg Gln Ala Leu Ala Lys His Leu Tyr Asp Ser Tyr Ile Lys Ser Phe Pro Leu Thr Lys Ala Lys Ala Arg Ala Ile Leu Thr Gly Lys Thr Thr Asp Lys Ser Pro Phe Val Ile Tyr Asp Met Asn Ser Leu Met Met Gly Glu Asp Lys ile Lys Phe Lys His Ile Thr Pro Leu Gln Glu Gln Ser Lys Glu Val Ala Ile Arg Ile Phe Gln Gly Cys Gln Phe Arg Ser Val Glu Ala Val Gln Glu Ile Thr Glu Tyr Ala Lys Ser Ile Pro Gly Phe Val Asn Leu Asp Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu Ile Ile Tyr Thr Met Leu Ala Ser Leu Met Asn Lys Asp Gly Val Leu Ile Ser Glu Gly Gln Gly Phe Met Thr Arg Glu Phe Leu Lys Ser Leu Arg Lys Pro Phe Gly Asp Phe Met Glu Pro Lys Phe Glu Phe Ala Val Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Ile Phe Ile Ala Val Ile Ile Leu Ser Gly Asp Arg Pro Gly Leu Leu Asn Val Lys Pro Ile Glu Asp Ile Gln Asp Asn Leu Leu Gln Ala Leu Glu Leu Gln Leu Lys Leu Asn His Pro Glu Ser Ser Gln Leu Phe Ala Lys Leu Leu Gln Lys Met Thr Asp Leu Arg Gln Ile Val Thr Glu His Val Gln Leu Leu Gln Val Ile Lys Lys Thr Glu Thr Asp Met -s-Ser Leu His Pro Leu Leu Gln Glu Ile Tyr Lys Asp Leu Tyr (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1811 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
GTCTTGTCGG
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 441 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
Met Glu Gln Pro Gln Glu Glu Ala Pro Glu Val Arg Glu Glu Glu Glu Lys Glu Glu Val Ala Glu Ala Glu Gly Ala Pro Glu Leu Asn Gly Gly Pro Gln His Ala Leu Pro Ser Ser Ser Tyr Thr Asp Leu Ser Arg Ser Ser Ser Pro Pro Ser Leu Leu Asp Gln Leu Gln Met Gly Cys Asp Gly Ala Ser Cys Gly Ser Leu Asn Met Glu Cys Arg Val Cys Gly Asp Lys Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Met Lys Leu Glu Tyr Glu Lys Cys Glu Arg Ser Cys Lys Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys Arg Phe Gln Lys Cys Leu Ala Leu Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Met Pro Glu Ala Glu Lys Arg Lys Leu Val Ala Gly Leu Thr Ala Asn Glu Gly Ser Gln Tyr Asn Pro Gln Val Ala Asp Leu Lys Ala Phe Ser Lys His Ile Tyr Asn Ala Tyr Leu Lys Asn Phe Asn Met Thr Lys Lys Lys Ala Arg Ser Ile Leu Thr Gly Lys Ala Ser His Thr Ala Pro Phe Val Ile His Asp Ile Glu Thr Leu Trp Gln Ala Glu Lys Gly Leu Val Trp Lys Gln Leu Val Asn Gly Leu Pro Pro Tyr Lys Glu Ile Ser Val His Val Phe Tyr Arg Cys Gln Cys Thr Thr Val Glu Thr Val Arg Glu Leu Thr Glu Phe Ala Lys Ser Ile Pro Ser Phe Ser Ser Leu Phe Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu Ala Ile Phe Ala Met Leu Ala Ser Ile Val Asn Lys Asp Gly Leu Leu Val Ala Asn Gly Ser Gly Phe Val Thr Arg Glu Phe Leu Arg Ser Leu Arg Lys Pro Phe Ser Asp Ile Ile Glu Pro Lys Phe Glu Phe Ala Val Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Leu Phe Ile Ala Ala Ile Ile Leu Cys Gly Asp Arg Pro Gly Leu Met Asn Val Pro Arg Val Glu Ala Ile Gln Asp Thr Ile Leu Arg Ala Leu Glu Phe His Leu Gln Ala Asn His Pro Asp Ala Gln Tyr Leu Phe Pro Lys Leu Leu Gln Lys Met Ala Asp Leu Arg Gln Leu Val Thr Glu His Ala Gln Met _8_ Met Gln Arg Ile Lys Lys Thr Glu Thr Glu Thr Ser Leu His Pro Leu Leu Gln Glu Ile Tyr Lys Asp Met Tyr (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3301 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
GACGGCGGCG GGACAGTGTT
GGTTGGCCCG
ATGGGAACCACCCTGTAGAGGTCCATCTGCGfiTCAGACCCAGACGATGCCAGAGCTATGA 300 AAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAG.CCAGCCACAC 960 CTTTACCTGC
GAGGGGCCTG
CAGGTCCTGG
CCTGTTCATT
TCAGCCCAGC
GGGACCAGTC
CCTCAGAGCA
AGGCCTGCAG
TTCAAGCCCA
ACTCTGGGTG
GGATTCTTCC
GGCTATGAAG
CCTGCCCCCA
CAAAATTGAA
GTGTACACAG
GCCGCGAATT
C
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
ACTCGGATCC AAGCCATGGC TGAGAACTTG CTGGACGG 3g (2) INFORMATION FOR SEQ ID N0:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:10:
(2) INFORMATION FOR SEQ ID N0:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
-1~-(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
CTCAGTCGAC TTATTGAATT CCACTAGCTG GAGATCC
O
S O
N S' ~ ~N
~t~-csT ~t~i~ay, N H
Cat # 27-4577-01 2 (>
O
From Pharmacia, 5.0 mg/mL, 5.0 Equiv SPDP, FW =312, Dissolve FW = 150 kD Use 200 pL (1 mg, RT, 5 hours @ 1.00 mg/mL in EtOH.
6.66 nmol) exchange into 10 mM Add 10.4 pL (5 equiv., Borate, 350 mM NaCI, 10% Gly, 10.4 pH 8.5 with BioSpin-30 rotei~n.~ 33.4 nmol) to P
To further improve the signal to noise ratio, a series of experiments were conducted. Experiment 4 of Table 1 exemplifies 5 results obtained from those efforts. cDNA encoding a longer fragment of hCBP was cloned and expressed to get hCBPl-453. hCBPl-453 was biotinylated. Biotin-labeled hCBPl-453 (25 nM), SA-XL665 (100 nM), GST-hPPAR~yILBD (1 nM), and Eu3+K-labeled anti-GST antibody (2 nM) were mixed together in the presence or absence of 1 ~,M AD5075. The 10 detergent was changed from 0.05% NP40 to 0.5% CHAPS (3-~[3-cholamidopropyl]dimethyl-ammoniol}-1-propanesulfonate). A three- to four-fold signal-noise ratio was obtained. Figure 4 shows the strategy used for experiment 4 and similar experiments.
The correlation between results from the above-described assays and previously reported results from in aitro binding and transcriptional activation assays of selected antidiabetic insulin sensitizers that are known to be PPARy agonists (Elbrecht et al., 1996, Biochem Biophys Res Comm 224:431-437} was analyzed by titrating those known PPARy agonists in the assays described above and comparing ECSOs so obtained with previously described values for potency in binding or transcriptional activation assays for the known agoniats. The results are shown in Figure 5. From Figure 5, the following ECSps can be derived:
AD5075 = 8 nM
BRL49653 = 53 nM
Troglitazone = 646 nM
Pioglitazone = 890 nM.
These ECSOs generated in the above-described assays are in close agreement with those generated by in vitro binding and transcriptional activation studies (Elbrecht et al., 1996, Biochem Biophys Res Comm 224:431-437).
The above-described assay can also be used to characterize the interaction between nuclear receptors with co-activators as, e.g., by determining the binding constant for that interaction. Figure 6 shows an example of such an application. Saturating amounts of PPARy agonist (10 ~.M BRL49653) were used. Increasing concentrations of non-biotinylated hCBPl-453 were used to titrate away biotin-hCBP-PPAR~yILBD complex and decrease the fluorescence energy transfer. A
Kd of 300 nM for the interaction between hCBPl-453 and PPAR~yILBD
can be derived from the results illustrated in Figure 6 and this Kd (300 nM) is a measurement ofthe affinity between CBP and PPAR~y.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.
_ 2g _ SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Merck & Co., Inc.
(ii) TITLE OF INVENTION: ASSAYS FOR NUCLEAR RECEPTOR
AGONISTS AND ANTAGONISTS USING FLUORESCENCE RESONANCE
ENERGY TRANSFER
(iii) NUMBER OF SEQUENCES: 11 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Merck & Co., Inc.
(B) STREET: P.O. Box 2000, 126 E. Lincoln Ave.
(C) CITY: Rahway (D) STATE: NJ
(E) COUNTRY: USA
(F) ZIP: 07065-0900 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Diskette (B) COMPUTER: IBM Compatible (C) OPERATING SYSTEM: Windows (D) SOFTWARE: FastSEQ for Windows Version 2.Ob (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Coppola, Joseph A
(B) REGISTRATION NUMBER: 38,413 (C) REFERENCE/DOCKET NUMBER: 20017PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 732-594-6734 (B) TELEFAX: 732-594-4720 (C) TELEX:
(2) INFORMATION FOR SEQ ID N0:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 405 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear -1_ (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
Met Ala Glu Asn Leu Leu Asp Gly Pro Pro Asn Pro Lys Arg Ala Lys Leu Ser Ser Pro Gly Phe Ser Ala Asn Asp Ser Thr Asp Phe Gly Ser Leu Phe Asp Leu Glu Asn Asp Leu Pro Asp Glu Leu Ile Pro Asn Gly Gly Glu Leu Gly Leu Leu Asn Ser Gly Asn Leu Val Pro Asp Ala Ala Ser Lys His Lys Gln Leu Ser Glu Leu Leu Arg Gly Gly Ser Gly Ser 65 70 75 g0 Ser Ile Asn Pro Gly Ile Gly Asn Val Ser Ala Ser Ser Pro Val Gln Gln Gly Leu Gly Gly Gln Ala Gln Gly Gln Pro Asn Ser Ala Asn Met Ala Ser Leu Ser Ala Met Gly Lys Ser Pro Leu Ser Gln Gly Asp Ser Ser Ala Pro Ser Leu Pro Lys Gln Ala Ala Ser Thr Ser Gly Pro Thr Pro Ala Ala Ser Gln Ala Leu Asn Pro Gln Ala Gln Lys Gln Val Gly Leu Ala Thr Ser Ser Pro Ala Thr Ser Gln Thr Gly Pro Gly Ile Cys Met Asn Ala Asn Phe Asn Gln Thr His Pro Gly Leu Leu Asn Ser Asn Ser Gly His Ser Leu Ile Asn Gln Ala Ser Gln Gly Gln Ala Gln VaI
Met Asn Gly Ser Leu Gly Ala Ala Gly Arg Gly Arg Gly Ala Gly Met Pro Tyr Pro Thr Pro Ala Met Gln Gly Ala Ser Ser Ser Val Leu Ala Glu Thr Leu Thr Gln Val Ser Pro Gln Met Thr Gly His Ala Gly Leu Asn Thr Ala Gln Ala Gly Gly Met Ala Lys Met Gly Ile Thr Gly Asn Thr Ser Pro Phe Gly Gln Pro Phe Ser Gln Ala Gly Gly Gln Pro Met Gly Ala Thr Gly Val Asn Pro Gln Leu Ala Ser Lys Gln Ser Met Val Asn Ser Leu Pro Thr Phe Pro Thr Asp Ile Lys Asn Thr Ser Val Thr Asn Val Pro Asn Met Ser Gln Met Gln Thr Ser Val Gly Ile Val Pro Thr Gln Ala Ile Ala Thr Gly Pro Thr Ala Asp Pro Glu Lys Arg Lys Leu Ile Gln Gln Gln Leu Val Leu Leu Leu His Ala His Lys Cys Gln Arg Arg Glu Gln Ala Asn Gly Glu Val Arg Ala Cys Ser Leu Pro His Cys Arg Thr Met Lys Asn Val Leu Asn His Met Thr His Cys Gln Ala Gly Lys Ala Cys Gln WO 99!18124 PCT/US98/21049 (2) INFORMATION FOR SEQ ID N0:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1290 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
GGCCCTCGCC
(2) INFORMATION FOR SEQ ID N0:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 468 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:3:
Met Val Asp Thr Glu Ser Pro Leu Cys Pro Leu Ser Pro Leu Glu Ala Gly Asp Leu Glu Ser Pro Leu Ser Glu Glu Phe Leu Gln Glu Met Gly Asn Ile Gln Glu Ile Ser Gln Ser Ile Gly Glu Asp Ser Ser Gly Ser Phe Gly Phe Thr Glu Tyr Gln Tyr Leu Gly Ser Cys Pro Gly Ser Asp Gly Ser Val Ile Thr Asp Thr Leu Ser Pro Ala Ser Ser Pro Ser Ser Val Thr Tyr Pro Val Val Pro Gly Ser Val Asp Glu Ser Pro Ser Gly 85 90 g5 Ala Leu Asn Ile Glu Cys Arg Ile Cys Gly Asp Lys Ala Ser Gly Tyr His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Leu Lys Leu Val Tyr Asp Lys Cys Asp Arg Ser Cys Lys Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys Arg Phe His Lys 145 _ 150 155 160 Cys Leu Ser Val Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Met Pro Arg Ser Glu Lys Ala Lys Leu Lys Ala Glu Ile Leu Thr Cys Glu His Asp Ile Glu Asp Ser Glu Thr Ala Asp Leu Lys Ser Leu Ala Lys Arg Ile Tyr Glu Ala Tyr Leu Lys Asn Phe Asn Met Asn Lys Val Lys Ala Arg Val Ile Leu Ser Gly Lys Ala Ser Asn Asn Pro Pro Phe Val Ile His Asp Met Glu Thr Leu Cys Met Ala Glu Lys Thr Leu Val Ala Lys Leu Val Ala Asn Gly Ile Gln Asn Lys Glu Val Glu Val Arg Ile Phe His Cys Cys Gln Cys Thr Ser Val Glu Thr Val Thr Glu Leu Thr Glu Phe Ala Lys Ala Ile Pro Ala Phe Ala Asn Leu Asp Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val Tyr Glu Ala Ile Phe Ala Met Leu Ser Ser Val Met Asn Lys Asp Gly Met Leu Val Ala Tyr Gly Asn Gly Phe Ile Thr Arg Glu Phe Leu Lys Ser Leu Arg Lys Pro Phe Cys Asp Ile Met Glu Pro Lys Phe Asp Phe Ala Met Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Ile Ser Leu Phe Val Ala Ala Ile Ile Cys Cys Gly Asp Arg Pro Gly Leu Leu Asn Val Gly His Ile Glu Lys Met Gln Glu Gly Ile Val His Val Leu Arg Leu His Leu Gln Ser Asn His Pro Asp Asp Ile Phe Leu Phe Pro Lys Leu Leu Gln Lys Met Ala Asp Leu Arg Gln Leu Val Thr Glu His Ala Gln Leu Val Gln Ile Ile Lys Lys Thr Glu Ser Asp Ala Ala Leu His Pro Leu Leu Gln Glu Ile Tyr Arg Asp Met Tyr (2) INFORMATION FOR SEQ ID N0:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1854 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:
GTGGCAAGAC
(2) INFORMATION FOR SEQ ID N0:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 478 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:5:
Met Thr Met Val Asp Thr Glu Ile Ala Phe Trp Pro Thr Asn Phe Gly Ile Ser Ser Val Asp Leu Ser Val Met Glu Asp His Ser His Ser Phe Asp Ile Lys Pro Phe Thr Thr Val Asp Phe Ser Ser Ile Ser Thr Pro His Tyr Glu Asp Ile Pro Phe Thr Arg Thr Asp Pro Val Val Ala Asp Tyr Lys Tyr Asp Leu Lys Leu Gln Glu Tyr Gln Ser Ala Ile Lys Val 65 70 75 g0 Glu Pro Ala Ser Pro Pro Tyr Tyr Ser Glu Lys Thr Gln Leu Tyr Asn Lys Pro His Glu Glu Pro Ser Asn Ser Leu Met Ala Ile Glu Cys Arg Val Cys Gly Asp Lys Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Leu Lys Leu Ile Tyr Asp Arg Cys Asp Leu Asn Cys Arg Ile His Lys Lys Ser Arg Asn Lys Cys Gln Tyr Cys Arg Phe Gln Lys Cys Leu Ala Val Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Ile Ala Gln Ala Glu Lys Glu Lys Leu Leu Ala Glu Ile Ser Ser Asp Ile Asp Gln Leu Asn Pro Glu Ser Ala Asp Leu Arg Gln Ala Leu Ala Lys His Leu Tyr Asp Ser Tyr Ile Lys Ser Phe Pro Leu Thr Lys Ala Lys Ala Arg Ala Ile Leu Thr Gly Lys Thr Thr Asp Lys Ser Pro Phe Val Ile Tyr Asp Met Asn Ser Leu Met Met Gly Glu Asp Lys ile Lys Phe Lys His Ile Thr Pro Leu Gln Glu Gln Ser Lys Glu Val Ala Ile Arg Ile Phe Gln Gly Cys Gln Phe Arg Ser Val Glu Ala Val Gln Glu Ile Thr Glu Tyr Ala Lys Ser Ile Pro Gly Phe Val Asn Leu Asp Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu Ile Ile Tyr Thr Met Leu Ala Ser Leu Met Asn Lys Asp Gly Val Leu Ile Ser Glu Gly Gln Gly Phe Met Thr Arg Glu Phe Leu Lys Ser Leu Arg Lys Pro Phe Gly Asp Phe Met Glu Pro Lys Phe Glu Phe Ala Val Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Ile Phe Ile Ala Val Ile Ile Leu Ser Gly Asp Arg Pro Gly Leu Leu Asn Val Lys Pro Ile Glu Asp Ile Gln Asp Asn Leu Leu Gln Ala Leu Glu Leu Gln Leu Lys Leu Asn His Pro Glu Ser Ser Gln Leu Phe Ala Lys Leu Leu Gln Lys Met Thr Asp Leu Arg Gln Ile Val Thr Glu His Val Gln Leu Leu Gln Val Ile Lys Lys Thr Glu Thr Asp Met -s-Ser Leu His Pro Leu Leu Gln Glu Ile Tyr Lys Asp Leu Tyr (2) INFORMATION FOR SEQ ID N0:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 1811 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:6:
GTCTTGTCGG
(2) INFORMATION FOR SEQ ID N0:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 441 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:7:
Met Glu Gln Pro Gln Glu Glu Ala Pro Glu Val Arg Glu Glu Glu Glu Lys Glu Glu Val Ala Glu Ala Glu Gly Ala Pro Glu Leu Asn Gly Gly Pro Gln His Ala Leu Pro Ser Ser Ser Tyr Thr Asp Leu Ser Arg Ser Ser Ser Pro Pro Ser Leu Leu Asp Gln Leu Gln Met Gly Cys Asp Gly Ala Ser Cys Gly Ser Leu Asn Met Glu Cys Arg Val Cys Gly Asp Lys Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Thr Ile Arg Met Lys Leu Glu Tyr Glu Lys Cys Glu Arg Ser Cys Lys Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys Arg Phe Gln Lys Cys Leu Ala Leu Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Met Pro Glu Ala Glu Lys Arg Lys Leu Val Ala Gly Leu Thr Ala Asn Glu Gly Ser Gln Tyr Asn Pro Gln Val Ala Asp Leu Lys Ala Phe Ser Lys His Ile Tyr Asn Ala Tyr Leu Lys Asn Phe Asn Met Thr Lys Lys Lys Ala Arg Ser Ile Leu Thr Gly Lys Ala Ser His Thr Ala Pro Phe Val Ile His Asp Ile Glu Thr Leu Trp Gln Ala Glu Lys Gly Leu Val Trp Lys Gln Leu Val Asn Gly Leu Pro Pro Tyr Lys Glu Ile Ser Val His Val Phe Tyr Arg Cys Gln Cys Thr Thr Val Glu Thr Val Arg Glu Leu Thr Glu Phe Ala Lys Ser Ile Pro Ser Phe Ser Ser Leu Phe Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu Ala Ile Phe Ala Met Leu Ala Ser Ile Val Asn Lys Asp Gly Leu Leu Val Ala Asn Gly Ser Gly Phe Val Thr Arg Glu Phe Leu Arg Ser Leu Arg Lys Pro Phe Ser Asp Ile Ile Glu Pro Lys Phe Glu Phe Ala Val Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Leu Phe Ile Ala Ala Ile Ile Leu Cys Gly Asp Arg Pro Gly Leu Met Asn Val Pro Arg Val Glu Ala Ile Gln Asp Thr Ile Leu Arg Ala Leu Glu Phe His Leu Gln Ala Asn His Pro Asp Ala Gln Tyr Leu Phe Pro Lys Leu Leu Gln Lys Met Ala Asp Leu Arg Gln Leu Val Thr Glu His Ala Gln Met _8_ Met Gln Arg Ile Lys Lys Thr Glu Thr Glu Thr Ser Leu His Pro Leu Leu Gln Glu Ile Tyr Lys Asp Met Tyr (2) INFORMATION FOR SEQ ID N0:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3301 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:8:
GACGGCGGCG GGACAGTGTT
GGTTGGCCCG
ATGGGAACCACCCTGTAGAGGTCCATCTGCGfiTCAGACCCAGACGATGCCAGAGCTATGA 300 AAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAG.CCAGCCACAC 960 CTTTACCTGC
GAGGGGCCTG
CAGGTCCTGG
CCTGTTCATT
TCAGCCCAGC
GGGACCAGTC
CCTCAGAGCA
AGGCCTGCAG
TTCAAGCCCA
ACTCTGGGTG
GGATTCTTCC
GGCTATGAAG
CCTGCCCCCA
CAAAATTGAA
GTGTACACAG
GCCGCGAATT
C
(2) INFORMATION FOR SEQ ID N0:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:9:
ACTCGGATCC AAGCCATGGC TGAGAACTTG CTGGACGG 3g (2) INFORMATION FOR SEQ ID N0:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0:10:
(2) INFORMATION FOR SEQ ID N0:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
-1~-(xi) SEQUENCE DESCRIPTION: SEQ ID N0:11:
CTCAGTCGAC TTATTGAATT CCACTAGCTG GAGATCC
Claims (27)
1. A method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, will occur; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, will occur; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
2. The method of claim 1 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D receptors, LXR, and FXR.
3. The method of claim 1 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of a full-length nuclear receptor, a ligand binding domain of a nuclear receptor, and an AF-2 site of a nuclear receptor.
4. The method of claim 1 where the nuclear receptor or ligand binding domain thereof comprises an AF-2 site of a nuclear receptor.
5. The method of claim 1 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of a full-length PPAR, a ligand binding domain of a PPAR, and amino acid residues 176-478 of human PPAR.gamma.1.
6. The method of claim 1 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of PPAR.alpha., PPAR.gamma.1, PPAR.gamma.2, and PPAR.delta..
7. The method of claim 1 where the nuclear receptor or ligand binding domain thereof comprises a ligand binding domain selected from the group consisting of amino acids 143=462 of human RAR.alpha., amino acids 122-410 of rat T3R.alpha.1, amino acids 227-463 of mouse RXR.gamma., and amino acids 251-595 of human ER.
8. The method of claim 1 where CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof is selected from the group consisting of full-length human CBP, full-length mouse CBP, amino acid residues 1-113 of human CBP, and amino acid residues 1-453 of human CBP.
9. The method of claim 1 where the first fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
10. The method of claim 1 where the second fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
11. A method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a binding portion of a nuclear receptor co-activator, where the binding portion contains the amino acid sequence LXXLL, and where the binding portion is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the binding portion of the nuclear receptor co-activator will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a binding portion of a nuclear receptor co-activator, where the binding portion contains the amino acid sequence LXXLL, and where the binding portion is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the binding portion of the nuclear receptor co-activator will take place; and (d) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
12. The method of claim 11 where the binding portion of a nuclear receptor co-activator is selected from the group consisting of human RIP-140, human SRC-1, mouse TIF-2, human or mouse CBP, human or mouse p300, mouse TIF-1, and human TRIP proteins.
13. A method of identifying an agonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a polypeptide containing the amino acid sequence LXXLL where the polypeptide is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the polypeptide will take place; and (d) measuring fluorescent resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) a polypeptide containing the amino acid sequence LXXLL where the polypeptide is labeled with a second fluorescent reagent; and (c) a substance suspected of being an agonist of the nuclear receptor;
under conditions such that, if the substance is an agonist of the nuclear receptor, binding between the nuclear receptor or ligand binding domain thereof and the polypeptide will take place; and (d) measuring fluorescent resonance energy transfer (FRET) between the first and second fluorescent reagents;
where the occurrence of FRET indicates that the substance is an agonist of the nuclear receptor.
14. A method for identifying an antagonist of a nuclear receptor that comprises providing:
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent;
(c) an agonist of the nuclear receptor; and (d) a substance suspected of being an antagonist of the nuclear receptor;
under conditions such that, in the absence of the substance, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof will occur; and (e) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents when the substance is present and measuring FRET between the first and second fluorescent reagents when the substance is absent;
where the a decrease in FRET when the substance is present indicates that the substance is an antagonist of the nuclear receptor.
(a) a nuclear receptor or ligand binding domain thereof labeled with a first fluorescent reagent;
(b) CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a second fluorescent reagent;
(c) an agonist of the nuclear receptor; and (d) a substance suspected of being an antagonist of the nuclear receptor;
under conditions such that, in the absence of the substance, binding between the nuclear receptor or ligand binding domain thereof and CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof will occur; and (e) measuring fluorescence resonance energy transfer (FRET) between the first and second fluorescent reagents when the substance is present and measuring FRET between the first and second fluorescent reagents when the substance is absent;
where the a decrease in FRET when the substance is present indicates that the substance is an antagonist of the nuclear receptor.
15. The method of claim 14 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of steroid receptors, thyroid hormone receptors, retinoic acid receptors, peroxisome proliferator-activated receptors, retinoid X receptors, glucocorticoid receptors, vitamin D receptors, LXR, and FXR.
16. The method of claim 14 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of a full-length nuclear receptor, a ligand binding domain of a nuclear receptor, and an AF-2 site of a nuclear receptor.
17. The method of claim 14 where the nuclear receptor or ligand binding domain thereof comprises an AF-2 site of a nuclear receptor.
18. The method of claim 14 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of a full-length PPAR, a ligand binding domain of a PPAR, and amino acid residues 176-478 of human PPAR.gamma.1.
19. The method of claim 14 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of PPAR.alpha., PPAR.gamma.1, PPAR.gamma.2, and PPAR.delta..
20. The method of claim 14 where the nuclear receptor or ligand binding domain thereof comprises a ligand binding domain selected from the group consisting of amino acids 143-462 of human RAR.alpha., amino acids 122-410 of rat T3R.alpha.1, amino acids 227-463 of mouse RXR.gamma., and amino acids 251-595 of human ER.
21. The method of claim 14 where CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof is selected from the group consisting of full-length CBP, amino acid residues 1-113 of human CBP, and amino acid residues 1-453 of human CBP.
22. The method of claim 14 where the first fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
23. The method of claim 14 where the second fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
24. A nuclear receptor or ligand binding domain thereof labeled with a fluorescent reagent.
25. The nuclear receptor or ligand binding domain thereof of claim 24 where the nuclear receptor or ligand binding domain thereof is selected from the group consisting of PPAR.alpha., PPAR.gamma.1, PPAR.gamma.2, PPAR.delta., a ligand binding domain of PPAR.alpha., PPAR.gamma.1, PPAR.gamma.2, or PPAR.delta., and amino acid residues 176-478 of human PPAR.gamma.1 and the fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
26. CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, labeled with a fluorescent reagent.
27. The CBP, p300, or other nuclear receptor co-activator, or a binding portion thereof, of claim 26 where the fluorescent reagent is selected from the group consisting of XL665 and Europium cryptate (Eu3+K).
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US6138597P | 1997-10-07 | 1997-10-07 | |
US60/061,385 | 1997-10-07 | ||
PCT/US1998/021049 WO1999018124A1 (en) | 1997-10-07 | 1998-10-06 | Assays for nuclear receptor ligands using fret |
Publications (1)
Publication Number | Publication Date |
---|---|
CA2305711A1 true CA2305711A1 (en) | 1999-04-15 |
Family
ID=22035450
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CA002305711A Abandoned CA2305711A1 (en) | 1997-10-07 | 1998-10-06 | Assays for nuclear receptor ligands using fret |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1021462A4 (en) |
JP (1) | JP2001519525A (en) |
CA (1) | CA2305711A1 (en) |
WO (1) | WO1999018124A1 (en) |
Families Citing this family (20)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2002528721A (en) * | 1998-10-23 | 2002-09-03 | グラクソ グループ リミテッド | Assays for nuclear receptor ligands |
DE69940958D1 (en) | 1998-12-23 | 2009-07-16 | Glaxo Group Ltd | DETERMINATION METHOD FOR LIGANDS OF NUCLEAR RECEPTORS |
WO2001020326A2 (en) * | 1999-09-13 | 2001-03-22 | Equitech Laboratories, Inc. | Materials and methods for the determination of an analyte |
WO2001040805A1 (en) * | 1999-11-30 | 2001-06-07 | Akzo Nobel N.V. | Steroid compounds for steroid receptor binding assays |
AU2001250898A1 (en) * | 2000-03-17 | 2001-10-03 | The Salk Institute For Biological Studies | Compositions associated with complex formation |
US7198924B2 (en) | 2000-12-11 | 2007-04-03 | Invitrogen Corporation | Methods and compositions for synthesis of nucleic acid molecules using multiple recognition sites |
US6924311B2 (en) | 2001-10-17 | 2005-08-02 | X-Ceptor Therapeutics, Inc. | Methods for affecting various diseases utilizing LXR compounds |
EP1310799B1 (en) | 2001-11-07 | 2005-12-21 | Schering AG | In vitro screening for ligands of the estrogen receptor |
JP2006504079A (en) * | 2002-07-24 | 2006-02-02 | ジョンソン アンド ジョンソン ファーマシューティカル リサーチ アンド ディベロップメント リミテッド ライアビリティ カンパニー | Ligand identification method |
CN1735808A (en) * | 2002-11-07 | 2006-02-15 | 鹿特丹伊拉兹马斯大学 | FRET probes and methods for detecting interacting molecules |
JP4803976B2 (en) * | 2003-07-09 | 2011-10-26 | 独立行政法人科学技術振興機構 | Molecular sensor for intracellular IP3 measurement |
AU2004268647B2 (en) * | 2003-08-28 | 2010-07-01 | Choongwae Pharma Corporation | Modulation of beta-catenin/TCF activated transcription |
US8304189B2 (en) | 2003-12-01 | 2012-11-06 | Life Technologies Corporation | Nucleic acid molecules containing recombination sites and methods of using the same |
US20080286260A1 (en) * | 2004-03-26 | 2008-11-20 | Bayer Healthcare Ag | Diagnostic and Therapeutics for Diseases Associated with Peroxisome Proliferative Activated Receptor Alpha (Ppara) |
KR100704011B1 (en) | 2005-02-16 | 2007-04-04 | 한국과학기술원 | Detection method for specific biomolecular interactions using FRET between metal nanoparticle and quantum dot |
EP1907564B1 (en) * | 2005-06-28 | 2013-10-23 | Daiichi Sankyo Company, Limited | Lxr ligand testing method |
JP5264421B2 (en) | 2007-11-22 | 2013-08-14 | 富士フイルム株式会社 | Test substance measuring carrier and method for producing the same |
WO2009141926A1 (en) * | 2008-05-23 | 2009-11-26 | 国立大学法人東京大学 | Method for acquisition of compound capable of acting on glucose metabolism/lipid metabolism |
EP4306659A3 (en) | 2014-04-14 | 2024-03-27 | Yissum Research and Development Company of the Hebrew University of Jerusalem Ltd. | A method and kit for determining the tissue or cell origin of dna |
EP3464644A4 (en) * | 2016-06-07 | 2020-07-15 | The Regents of The University of California | Cell-free dna methylation patterns for disease and condition analysis |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB9608143D0 (en) * | 1996-04-19 | 1996-06-26 | Ver Nl Kanker Inst | Assay |
WO1998056806A1 (en) * | 1997-06-12 | 1998-12-17 | The Regents Of The University Of California | A TRANSCRIPTION FACTOR COACTIVATOR PROTEIN, p/CIP |
WO1999041608A2 (en) * | 1998-02-12 | 1999-08-19 | Prolifix Limited | Interaction between cyclin d1 and steroid receptor co-activators |
-
1998
- 1998-10-06 EP EP98956094A patent/EP1021462A4/en not_active Withdrawn
- 1998-10-06 CA CA002305711A patent/CA2305711A1/en not_active Abandoned
- 1998-10-06 WO PCT/US1998/021049 patent/WO1999018124A1/en active Application Filing
- 1998-10-06 JP JP2000514931A patent/JP2001519525A/en active Pending
Also Published As
Publication number | Publication date |
---|---|
WO1999018124A1 (en) | 1999-04-15 |
EP1021462A4 (en) | 2005-04-13 |
EP1021462A1 (en) | 2000-07-26 |
JP2001519525A (en) | 2001-10-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CA2305711A1 (en) | Assays for nuclear receptor ligands using fret | |
McFedries et al. | Methods for the elucidation of protein-small molecule interactions | |
Georget et al. | Trafficking of the androgen receptor in living cells with fused green fluorescent protein–androgen receptor | |
US6689574B1 (en) | Assays for nuclear receptor agonists and antagonists using fluorescence resonance energy transfer | |
KR20090083925A (en) | Detection system and uses therefor | |
JP4324474B2 (en) | Novel cell-based assay for G protein-coupled receptor-mediated activity | |
Vollmer et al. | Subcellular compartmentalization of activation and desensitization of responses mediated by NK2 neurokinin receptors | |
US7604959B2 (en) | Cell-based assays employing voltage and calcium dyes | |
Gidon et al. | Studying the regulation of endosomal cAMP production in GPCR signaling | |
Fay et al. | Purification of functional CB1 and analysis by site-directed fluorescence labeling methods | |
Crouch et al. | New strategies in drug discovery for GPCRs: high throughput detection of cellular ERK phosphorylation | |
US6579686B2 (en) | Constitutive androstane receptor | |
EP1876446B1 (en) | Method for detection of substance bound to nuclear receptor | |
US20060110732A1 (en) | Method for the identification of ligands | |
US20030039980A1 (en) | Assays for determination of functional binding of compounds to receptors | |
JP4848282B2 (en) | A novel cell-based assay using potential and calcium dyes | |
Fay et al. | Purification and Analysis of by Functional Site-Directed CB1 Fluorescence Labeling Methods | |
WO2004010108A2 (en) | Method for the identification of ligands | |
Chen et al. | Application of large-scale transient transfection to cell-based functional assays for ion channels and GPCRs | |
US20060024844A1 (en) | Method for the idenification of ligands | |
Park et al. | Protein–Protein Interactions | |
Hintersteiner et al. | Identification of a Small Molecule Inhibitor of Importin Mediated Nuclear Import by Confocal On-Bead Screening of Tagged One-Bead One-Compound Libraries |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
EEER | Examination request | ||
FZDE | Discontinued |