ZA200302168B - Herbicide resistant plants. - Google Patents

Description

HERBICIDE RESISTANT PLANTS

The present invention relates to recombinant DNA technology, and in particular to the production of transgenic plants which exhibit substantial resistance or substantial tolerance to herbicides when compared with non transgenic like plants. The invention also relates, inter alia, to the nucleotide sequences (and expression products thereof), which are used in the production of, or are produced by, the said transgenic plants.

Plants which are substantially “tolerant” to a herbicide when they are subjected to it - provide a dose/response curve which is shifted to the right when compared with that provided by similarly subjected non tolerant like plants. Such dose/response curves have “dose” plotted on the x-axis and “percentage kill”,“herbicidal effect” etc. plotted on the y- axis. Tolerant plants will typically require at least twice as much herbicide as non tolerant like plants in order to produce a given herbicidal effect. Plants which are substantially “resistant” to the herbicide exhibit few, if any, necrotic, lytic, chlorotic or other lesions when subjected to the herbicide at concentrations and rates which are typically employed by the agricultural community to kill weeds in the field in which crops are to be grown for commercial purposes.

It is particularly preferred that the plants are substantially resistant or substantially : tolerant to herbicides (hereinafter "glyphosate" which have 5-enol pyruvyl shikimate phosphate synthetase (hereinafter "EPSPS") as their site of action, of which N- phosphonomethylglycine (and its various salts) is the pre-eminent example.

The herbicide may be applied either pre- or post emergence in accordance with usual techniques for herbicide application to fields comprising crops which have been rendered resistant to the herbicide. The present invention provides, inter alia, nucleotide sequences useful in the production of such herbicide tolerant or resistant plants.

According to the present invention there is provided a glyphosate resistant EPSPS enzyme wherein in comparison with the wild type EPSPS the protein sequence is modified in that a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the conserved region

GNAGTAMRPL in the wild type enzyme such that the modified sequence reads

GNAGIAMRSL, wherein the enzyme does not comprise the sequence

K(A/V)AKRAVVVGCGGKFPVE, characterised in that the enzyme is stable and possesses at least one of the following sequence motifs (i) to (viii) in which X is any amino acid and Z,

Z, and Z, are any amino acid other than those specified:- (1) ALLMZAPLA, wherein Z is not S or T; (i) EIEIZDKL, wherein Z is not V; : (ii) FG(V/M)(K/S)ZEH, wherein Z isnot V; : (iv) ALK/R)ZLGL, wherein Z is not R;

Ww) GLXVEZ,DXZ,XXXA(/V)V, wherein Z, is not T and/or Z, is not E; (vi) ITPPZ,K(L/V)(K/N)Z, wherein Z, is not K and/or Z, is not T; : (vii) TIZ(D/N)PGCT, wherein Z isnot N or L; (viii) (D/N)YFXVLXZXX(K/R)H, wherein Z is not R.

A preferred embodiment of the enzyme comprises at least two of the motifs (i), (ii), (iii), (v) and (vi). In specific embodiments of the present inventive enzyme in motif (i) Z is

A; in motif (ii) Z is I; in motif (iii) Z is A; in motif (iv) Zis K, T or A; in motif (v) Z, isR or

A or less preferably D or E and Z, is preferably V or A or less preferably T; in sequence motif (vi) Z, is E or A and Z, is P, I or V; in motif (vii) Z is R or K; and in motif (viii) Z is T or S or less preferably Q. Particularly preferred embodiments of the said enzyme comprise one or more sequences selected from the group consiting of: )) (I/V)VEGCGGI/L/Q)FP(V/A/T)S/G)

Gi) @V)VVGCGGI/L/Q)FP(V/A/T)E; (iii) (/VYVVGCGG(I/L/IQ)FP(V/A/T)(S/G); (ivy (/V)VVGCGGKFP(V/A/T)(S/G); v) ({/V)VEGCGGKFP(V/A/T)E; vi) ({/V)VEGCGGI/L/Q)FP(V/A/T)E; (vii) (A/V)VEGCGGKFP(V/A/T)(S/G).

The present invention also comprises an isolated polynucleotide comprising a region which encodes the present inventive enzyme, particular such polynucleotides comprising , for example, a sequence depicted in SEQ ID Nos. 4 or 5, or a sequence obtained by hybridising an intron located in the SEQ ID 4 or 5 sequences with polynucleotides comprised in plant genomic libraries. The invention also includes an isolated polynucleotide comprising a region encoding a chloroplast transit peptide and a glyphosate resistant dicotyledenous 5-enolpyruvylshikimate phosphate synthase (EPSPS) 3' of the peptide, the said region being under expression control of a plant operable promoter, with the provisos that the said promoter is not heterologous with respect to the said region, and the chloroplast transit peptide is not heterologous with respect to the said synthase.

By "heterologous" is meant from a different source, and correspondingly "non- heterologous" means derived from the same source - but at a gene rather than organism or tissue level. For example the CaMV35S promoter is clearly heterologous with respect to a petunia EPSPS coding sequence insofar as the promoter is derived from a virus and the sequence - the expression of which it controls - from a plant. The term "heterologous" according to the present invention has a still narrower meaning, however. For example "heterologous" as it relates to the present invention means that the petunia EPSPS coding sequence is "heterologous" with respect to, for example, a promoter also derived from petunia - other than that which controls expression of the EPSPS gene. In this sense the petunia promoter derived from the petunia EPSPS gene then used to control expression of an

EPSPS coding sequence likewise-derived from petunia is "non-heterologous” with respect to the said coding sequence. "Non-heterologous” does not mean, however, that the promoter and coding sequence must necessarily have been obtained. from one and the same (original or progenitor) polynucleotide. Likewise with respect to transit peptides. For example, a rubisco chloroplast transit peptide derived from sunflower is "heterologous" with respect to the coding sequence of an EPSPS gene likewise derived from sunflower (the same plant, tissue or cell). A rubisco transit peptide encoding sequence derived from sunflower is "non- heterologous" with respect to a rubisco enzyme encoding-sequence also derived from sunflower even if the origins of both sequences are different polynucleotides which may have been present in different cells, tissues or sunflower plants.

Most particularly preferred forms of the said polynucleotide include a construct which comprises the following components in the 5' to 3' direction of transcription: either (1):- @) At least one transcriptional enhancer being that enhancing region which is upstream from the transcriptional start of the sequence from which the enhancer is obtained and which enhancer per se does not function as a promoter either in the sequence in which it is endogenously comprised or when present heterologously as part of a construct;

(ii) The promoter from the soybean EPSPS gene; (iii) The soybean genomic sequence which encodes the soybean EPSPS chloroplast transit peptide; (iv) The genomic sequence which encodes the soybean EPSPS; (v) A transcriptional terminator; wherein the soybean EPSPS coding sequence is modified in comparison with a wild type sequence in that a first position is mutated so that the residue at this position is Ile rather than

Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the conserved region

GNAGTAMRPLTAAYV in the wild type enzyme such that modified sequence reads

GNAGIAMRSLTAAV; or (2) @) At least one transcriptional enhancer being that enhancing region which is upstream from the transcriptional start of the sequence from which the enhancer is obtained and which enhancer per se does not function as a promoter either in the sequence in which it is endogenously comprised or when present heterologously as part of a construct; (ii) The promoter from the Brasicca napus EPSPS gene; (iii) The Brasicca napus genomic sequence which encodes the Brasicca napus

EPSPS chloroplast transit peptide; (iv) The genomic sequence which encodes the Brasicca napus EPSPS; (v) A transcriptional terminator; wherein the Brasicca napus EPSPS coding sequence is modified in comparison with a wild type sequence in that a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than

Pro, the mutations being introduced into EPSPS sequences which comprise the conserved region GNAGTAMRPLTAAYV in the wild type enzyme such that the modified sequence reads GNAGIAMRSLTAAYV.

The present inventive polynucleotide, particularly the two disclosed in the immediately preceding paragraphs, may further comprise a sequence which encodes a chloroplast transit peptide/phosphoenolpyruvate synthase (CTP/PPS) or a chloroplast transit peptide/pyruvate orthophosphate di-kinase (CTP/PPDK), which sequence is under expression control of a plant operable promoter. It is particularly preferred that the PPDK protein sequence is directed to the chloroplast in planta via its autologous transit peptide, and accordingly the polynucleotide of the immediately preceding sentence encodes such a non- heterologous combination. The PPDK encoding sequence can be derived from either a monocot or a dicot and the protein thus encoded is optionally not cold-labile. By “not cold labile” is meant that the enzyme retains at least 50% of its activity when incubated at 0 degrees Celsius for 5 minutes under experimental conditions similar to those referred to in

Usami ef al (1995) Plant Mol. Biol., 27, 969-980. Such a ‘cold stable’ enzyme is at least two-fold more stable than the like enzyme isolated from F. bidentis. The PPS or PPDK enzymes provide for elevated levels of PEP in the chloroplast which is the site of action of glyphosate and which contains the EPSPS enzyme.

The enhancing region of the polynucleotide preferably constitutes a sequence the 3 end of which is at least 40 nucleotides upstream of the closest transcriptional start of the sequence from which the enhancer is obtained. In a further embodiment of the polynucleotide, the enhancing region constitutes a region the 3' end of which is at least 60 nucleotides upstream of the said closest start, and in a still further embodiment of the polynucleotide the said enhancing region constitutes a sequence the 3’ of which is at least 10 nucleotides upstream from the first nucleotide of the TATA consensus of the sequence from which the enhancer is obtained.

The polynucleotide according to the invention may comprise two or more transcriptional enhancers, which in a particular embodiment of the polynucleotide may be tandemly present.

In the present inventive polynucleotide the 3’ end of the enhancer, or first enhancer if there is more than one present, may be between about 100 to about 1000 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide or the first nucleotide of an intron or other untranslated leader sequence in the 5' untranslated region in the case that the said region contains an intron or other untranslated sequence. Ina more preferred embodiment of the polynucleotide, the 3’ end of the enhancer, or first enhancer, is between about 150 to about 1000 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide or the first nucleotide of in the 5' untranslated region, and in a still more preferred embodiment the 3’ end of the enhancer, or first nhancer, may be between about 300 to about 950 nucleotides upstream of oo the codon corresp nding to the translational start of the EPSPS transit peptide or the first - nucleotide of an i tron or other untranslated leader sequence in the 5' untranslated region. In a yet more preferr d embodiment, the 3’ end of the enhancer, or first enhancer, may be located between a out 770 and about 790 nucleotides upstream of the codon corresponding to the translationa start of the EPSPS transit peptide or the first nucleotide of an intron or other untranslated adr sequence in the 5' untranslated region.

In an alterjative inventive polynucleotide, the 3’ end of the enhancer, or first enhancer, may be beated between about 300 to about 380 nucleotides upstream of the codon corresponding to t A translational start of the EPSPS transit peptide or the first nucleotide of an intron or other translated leader sequence in the 5' untranslated region, and in a preferred embodi ent of this alternative polynucleotide the 3’ end of the enhancer, or first enhancer, is locat | between about 320 to about 350 nucleotides upstream of the codon corresponding to t 1 translational start of the EPSPS transit peptide, or the first nucleotide of an intron or other translated leader sequence in the 5' untranslated region.

In the poly cleotide according to the invention, the region upstream of the promoter from the EPSPS g ne may comprise at least one enhancer derived from a sequence which is upstream from the transoriptiona start of a promoter selected from the group consisting of those of the actin, folDFd, S-adenosyl homocysteinase, histone, tubulin, polyubiquitin and plastocyanin gene land the CaMV35S and FMV35S genes.

According \ the present inventive polynucleotide may comprise in the 5' to 3' direction a first en ancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or

FMV 35S promote] 5, and a second enhancer comprising a transcriptional enhancing region derived from a se uence which is upstream from the transcriptional start of an actin gene.

Alternativ ly, the polynucleotide may comprise in the 5' to 3' direction a first enhancer comprisi g a transcriptional enhancing region derived from a sequence which is upstream from th transcriptional start of either the CaMV 35S or FMV35S promoters, and a second enhancer comprising a transcriptional enhancing region derived from a sequence 30° which is upstream from the transcriptional start of the rolDfd gene.

Alternatively, the polynucleotide may comprise in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or FMV35S promoters, and a ‘second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of a histone gene.

Alternatively, the polynucleotide may comprise in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or FMV35S promoters, and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of a tubulin gene.

Alternatively, the polynucleotide may comprise in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is “upstream from the transcriptional start of the FMV 35S promoter and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the CaMV35S promoter. :

Alternatively, the polynucleotide may comprise in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the CaMV35S promoter and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the FMV35S promoter.

Whatever the identity and juxtaposition of the various enhancers present in the polynucleotide, the nucleotides 5' of the codon which constitutes the translational start of the

EPSPS chloroplast transit peptide may be Kozack preferred. What is meant by this is well known to the skilled man and will be further apparent from the examples below.

Particularly preferred embodiments of the present inventive polynucleotide comprise up stream of the sequence encoding the EPSPS chloroplast transit peptide a sequence encoding a non-translated 5' leader sequence derived from a relatively highly expressed gene, such as that of the glucanase, chalcone synthase and Rubisco genes.

The polynucleotide of the invention may also comprise a virally derived translational enhancer located within the non translated region 5' of the genomic sequence which encodes the EPSPS chloroplast transit peptide. The man skilled in the art is aware of the identity of such suitable translational enhancers - such as the Omega and Omega prime sequences derived from TMV and that derived from the tobacco etch virus, and how such translational enhancers can be introduced into the polynucleotide so as to provide for the desired result of increased protein expression.

The polynucleotide according to the invention may further comprise regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, dessication, and herbicides. Whilst such a polynucleotide contemplates the herbicide resistance conferring gene being other than an EPSPS, such as glyphosate oxido-reductase (GOX) for example, the herbicide may be other than glyphosate in which case the resistance conferring genes may be selected from the group encoding the following proteins: phosphinothricin acetyl transferase (PAT), hydroxyphenyl pyruvate dioxygenase (HPPD), ‘glutathione S transferase (GST), cytochrome P450, Acetyl-COA carboxylase (ACCase),

Acetolactate synthase (ALS), protoporphyrinogen oxidase (PPO), dihydropteroate synthase, polyamine transport proteins, superoxide dismutase (SOD), bromoxynil nitrilase, phytoene desaturase (PDS), the product of the #/dA gene obtainable from Alcaligenes eutrophus, and known mutagenised or otherwise modified variants of the said proteins. In the case that the polynucleotide provides for multiple herbicide resistance such herbicides may be selected from the group consisting of a dinitroaniline herbicide, triazolo-pyrimidines, a uracil, a phenylurea, a triketone, an isoxazole, an acetanilide, an oxadiazole, a triazinone, a sulfonanilide, an amide, an anilide, an isoxaflutole, a flurochloridone, a norflurazon, and a triazolinone type herbicide and the post-emergence herbicide is selected from the group consisting of glyphosate and salts thereof, glufosinate, asulam, bentazon, bialaphos, bromacil, sethoxydim or another cyclohexanedione, dicamba, fosamine, flupoxam, phenoxy propionate, quizalofop or another aryloxy-phenoxypropanoate, picloram, fluormetron, atrazine or another triazine, metribuzin, chlorimuron, chlorsulfuron, flumetsulam, halosulfuron, sulfometron, imazaquin, imazethapyr, isoxaben, imazamox, metosulam, pyrithrobac, rimsulfuron, bensulfuron, nicosulfuron, fomesafen, fluroglycofen, KIH9201, ET751, carfentrazone, mesotrione, sulcotrione, paraquat, diquat, bromoxynil and fenoxaprop.

A particular embodiment of the polynucleotide according to the invention provides for resistance to both glyphosate and a protoporphyrinogen oxidase (PPGO) inhibitor, in

© WO 02/26995 PCT/GB01/04131 particular butafenicil, for which the corresponding resistance protein is a PPGO or an inhibitor resistant variant thereof. A particularly preferred construct encoding such a herbicide resistance conferring combination comprises the EPSPS encoding sequence of the invention in combination with a sequence which encodes a PPDK or PPS in combination with a PPGO inhibitor resistant PPGO enzyme encoding sequence — such sequences being directed to the chloroplast — if desirable — by their autologous transit peptides and being under the expression control of non-heterologous promoters if the protein encoding sequences are of plant as opposed to bacterial origin.

In the case that the polynucleotide comprises sequences encoding insecticidal proteins, these proteins may be selected from the group consisting of crystal toxins derived from Bt, including secreted Bt toxins; protease inhibitors, lectins,

Xenhorabdus/Photorhabdus toxins. The fungus resistance conferring genes may be selected from the group consisting of those encoding known AFPs, defensins, chitinases, glucanases, and Avr-Cf9. Particularly preferred insecticidal proteins are crylAc, crylAb, cry3A, Vip 1A,Vip 1B, Vip3A, Vip3B, cysteine protease inhibitors, and snowdrop lectin. In the case that the polynucleotide comprises bacterial resistance conferring genes these may be selected from the group consisting of those encoding cecropins and techyplesin and analogues thereof. Virus resistance conferring genes may be selected from the group consisting of those encoding virus coat proteins, movement proteins, viral replicases, and anti-sense and ribozyme sequences which are known to provide for virus resistance; whereas the stress, salt, and drought resistance conferring genes may be selected from those that encode Glutathione-

S-transferase and peroxidase, the sequence which constitutes the known CBF1 regulatory sequence and genes which are known to provide for accumulation of trehalose. :

The polynucleotide according to the invention may be modified to enhance expression of the protein encoding sequences comprised by it, in that mRNA instability motifs and/or fortuitous splice regions may be removed, or crop preferred codons may be used so that expression of the thus modified polynucleotide in a plant yields substantially similar protein having a substantially similar activity/function to that obtained by expression of the protein encoding regions of the unmodified polynucleotide in the organism in which such regions of the unmodified polynucleotide are endogenous. The degree of identity between the modified polynucleotide and a polynucleotide endogenously contained within the said plant and encoding substantially the same protein may be such as to prevent co- ~~ suppression between the modified and endogenous sequences. In this case the degree of identity between the sequences should preferably be less than about 70%.

The invention still further includes a biological or transformation vector comprising the present inventive polynucleotide. Accordingly, by "vector" is meant, infer alia, one of the following: a plasmid, virus, cosmid or a bacterium transformed or transfected so as to contain the polynucleotide.

The invention still further includes plant material which has been transformed with the said polynucleotide or vector, as well as such transformed plant material which has been, or is, further transformed with a polynucleotide comprising regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, dessication, and herbicides.

The invention still further includes morphologically normal fertile whole plants which result from the crossing of plants which have been regenerated from material which has been transformed with the polynucleotide of the invention and plants which result from regeneration of material transformed with a polyncleotide which comprises a sequence which encodes a protein, such as a phosphoenolpyruvate synthase (PPS) or pyruvate orthophosphate di-kinase (PPDK) which proteins are capable of providing for elevated levels of phosphoenolpyruvate in the chloroplast. Such proteins are directed to the chloroplast by a suitable transit peptide — in the case of the PPDK enzyme preferably by the autologous peptide.

The invention still further includes morphologically normal fertile whole plants which contain the present inventive polynucleotide and which result from the crossing of plants which have been regenerated from material transformed with the present inventive polynucleotide or vector, and plants which have been transformed with a polynucleotide comprising regions encoding a CTP/PPS or CTP/PPDK, and/or regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, dessication, and herbicides. The invention also includes progeny of the resultant plants, their seeds and parts.

-11- oo

Plants of the invention may be selected from the group consisting of field crops, . fruits and vegetables such as canola, sunflower, tobacco, sugar beet, cotton, maize, wheat, - Co barley, rice, sorghum, mangel worzels, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, soya spp, sugar cane, pea, field beans, poplar, grape, citrus, alfalfa, rye, oats, turf and forage grasses, flax and oilseed rape, and nut producing plants insofar as they are not already specifically mentioned, their progeny, seeds and parts.

Particularly preferred such plants include soybean, canola, brassica, cotton, sugar beet, sunflower, peas, potatoes and mangel worzels. Lo

The invention still further comprises a method of selectively controlling weeds in a field, the field comprising weeds and plants of the invention or the herbicide resistant progeny thereof, the method comprising application to the field of a glyphosate type herbicide in an amount sufficient to control the weeds without substantially affecting the ‘plants. According to this method, one or more of a herbicide, insecticide, fungicide, nematicide, bacteriocide and an anti-viral may be applied to the field (and thus the plants contained within it) either before or after application of the glyphosate herbicide.

The invention still further provides a method of producing plants which are substantially tolerant or substantially resistant to glyphosate herbicide, comprising the steps of: @ transforming plant material with the polynucleotide or vector of the invention; (ii) selecting the thus transformed material; and (iii) regenerating the thus selected material into morphologically normal fertile whole plants.

The transformation may involve the introduction of the polynucleotide into the material by any known means, but in particular by: (i) biolistic bombardment of the material with particles coated with the polynucleotide; (ii) by impalement of the material on silicon carbide fibres which are coated with a solution comprising the polynucleotide; or (iii) by introduction of the polynucleotide or vector into Agrobacterium and co-cultivation of the thus transformed Agrobacterium with plant material which is thereby transformed and is subsequently regenerated. Plant transformation, selection and regeneration techniques, which may require routine modification in respect of a particular plant species, are well known to the skilled man. The thus transformed plant material may be selected by its resistance to glyphosate. ‘ The invention still further provides the use of the present inventive polynucleotide or vector in the production of plant tissues and/or morphologically normal fertile whole plants which are substantially tolerant or substantially resistant to glyphosate herbicide.

The invention still further includes a method of selecting biological material © transformed so as to express a gene of interest, wherein the transformed material comprises the polynucleotide or vector of the invention, and wherein the selection comprises exposing the transformed material to glyphosate or a salt thereof, and selecting surviving material.

The said material may be of plant origin, and may in particular be derived from a dicot selected from the group consisting of soybean, sugar beet, cotton and the Brassicas.

The invention still further includes a method for regenerating a fertile transformed plant to contain foreign DNA comprising the steps of: (a producing regenerable tissue from said plant to be transformed; )} transforming said regenerable tissue with said foreign DNA, wherein said foreign DNA comprises a selectable DNA sequence, wherein said sequence functions in a regenerable tissue as a selection device; (c) between about one day to about 60 days after step (b), placing said regenerable tissue from step (b) in a medium capable of producing shoots from said tissue, wherein said medium may further contain a compound used to select regenerable tissue containing said selectable DNA sequence to allow identification or selection of the transformed regenerated tissue; (d) after at least one shoot has formed from the selected tissue of step (c) transferring said shoot to a second medium capable of producing roots from said shoot to produce a plantlet, wherein the second medium optionally contains the said compound; and (e) growing said plantlet into a fertile transgenic plant wherein the foreign DNA is transmitted to progeny plants in Mendelian fashion, characterised in that the foreign DNA is, or the selectable DNA sequence comprised by the foreign DNA comprises, the polynucleotide according to the invention, and the said compound is glyphosate or a salt thereof. The plant may be a dicot as indicated above - more preferably selected from soybean, canola, brassica, cotton, sugar beet, sunflower, peas, potatoes and mangel worzel, . and the said regenerable tissue may consist of embryogenic calli, somatic embryos, immature embryos etc. ’ The present invention also includes a diagnostic kit comprising means for detecting the present inventive enzyme or polynucleotide or enzymes encoded by it, and therefore suitable for identifying tissues or samples which contain these. The polynucleotides can be detected by PCR amplification as is known to the skilled man - based on primers which he can easily derive from the enzyme encoding sequences which are disclosed in this application. The enzymes per se can be detected by, for example, the use of antibodies which have been raised against them for diagnostically distinguishing the antigenic regions which they contain.

The present invention will be further apparent from the following description taken in conjunction with the associated drawings and sequence listings.

Of the Sequences:

SEQ ID No.1 depicts Brassicia napus genomic DNA. 2 Bn EPSPS5 (PCR primer) 3 Bn EPSPS3 (PCR primer) 4 BnF1 (PCR primer) 5 BnF2 (PCR primer) 6 BnF3 (PCR primer) 7 BnF4 (PCR primer) 8 BnFS (PCR primer) 9 BnF6 (PCR primer) 10 BnF7 (PCR primer) 11 BnF8 (PCR primer) . 12 BnF9 (PCR primer) 13 BnF10 (PCR primer) ’ 14 BnFl11 (PCR primer) 15 BnF12 (PCR primer) 16 BnXho (PCR primer) 17 BnMUTBot (PCR primer)

18 BaMUTTop (PCR primer) 19 BnNde (PRC primer) : 20 BnRBSEP (PCR primer) 21 Brasr 12 (PCR primer) 22 Brasr 11 (PCR Primer)

23 Bnapus start rev 24 Genome walker 1 25 Genome walker 2 26 CaMV343 (PCR primer)

27 CaMV46C (PCR primer) 28 BnGUSXMa (PCR primer) 29 FMV enhancer 30 CaMV35S enhancer 31 Soybean Genomic EPSPS Sequence clone 1/14

32 Soybean Genomic EPSPS Sequence clone 1/12 33 EPSPS 10 reverse ~~ (PCR primer) 34 EPSPS 4 forward (PCR primer) 35 SEQ ID No. 31 containing double mutation 36 SEQ ID No. 32 containing double mutation

37 FMV35S90 enhancer 38 FMV35546 enhancer 39 Gm Term Bam (PCR primer) 40 Gm Term Eco (PCR primer) 41 BnMUT2PST (PCR primer)

42 BnMUTKPN (PCR primer) 43 GmRubPac (PCR primer) 44 GmRubbot (PCR primer) 45 GmRubtop (PCR primer) 46 GmRubKpn (PCR primer)

47 ZMPPDK 1 (PCR primer) 48 ZMPPDK2 (PCR primer)

49 ECPPS! (PCR primer) 0 50 ECPPS2 (PCR primer) : 51 -65 Motifs present in the stable EPSPS proteins of the invention > .

EXAMPLES

Methods useful for cloning, expressing and characterising the stable glyphosate- resistant EPSP synthases of the current invention are described herein

Stable glyphosate- resistant EPSPSs of the current invention are characterised as being stable (retaining > ~ 80% of their catalytic activity) after being incubated in a suitable buffer at 37 C for at least 4 hours. As exemplified below, enzyme stability experiments can suitably be carried out using substantially purified, part purified or crude preparations of enzyme extracts (for example the latter are readily obtained as extracts of transgenic plants engineered to express the glyphosate-resistant EPSPS or, similarly, extracts of microbes engineered to express a transgene encoding the glyphosate-resistant EPSPS). Ideally, glyphosate-resistant enzymes are tested for stability both in a purified form and thenas purified protein spiked back into a crude plant extract so as to test them under more realistic in planta -like conditions. In such extracts, the enzyme activity due to glyphosate-resistant

EPSPS can easily be discriminated from background susceptible endogenous EPSPS by testing activity over a range of glyphosate concentrations. At a discriminating concentration of glyphosate (e.g 0.1 mM glyphosate in the presence of 0.1 mM PEP) virtually all of the measured activity will originate from the resistant enzyme

Example. 1 Method for identification of stable glyphosate-resistant EPSP synthases

In order to test the stability of a glyphosate-resistant EPSPS, a test solution of the enzyme (prepared as described below in buffer at pH ~ 7.0-7.5 and in purified or part purified form) is heated to 37 C for 4-5h. The glyphosate-resistant activity of the heated enzyme is then compared with the activity of a) a sample similarly prepared but kept at ice temperature and b) a similar sample but freshly prepared.

Stable glyphosate resistant enzymes of the current invention are characterised by the fact that, following incubation for 5 h at 37 C, they lose little, if any, of their original glyphosate-resistant catalytic activity (<20% , preferably < 15% and more preferably < 10%)

-16- | } relative to suitable controls when assayed as described below. Preferably the stability oo - experiment is carried out using substantially pure enzyme although a very similar result will normally be obtained using crude preparations, or when pure protein is spiked back into crude extract. Methods suitably used for assay and preparation of enzyme extracts are further detailed below. The stability of the glyphosate-resistant EPSPS can suitably be assessed in a variety of other, essentially equivalent ways (for example by heating the E enzyme at a slightly higher temperature for a shorter time or a lower temperature for a longer period...e.g at 25 C for 3 d).

Example 2. Method for assaying EPSPS activity and determination of kinetic constants.

Assays are carried out generally according to the radiochemical method of Padgette et al 1987 (Archives of Biochemistry and Biophysics, 258(2) 564-573) with K+ ions as the major species of cationic counterion. Assays in a total volume of 50ul, in 50mM Hepes(KOH) pH 7.0 at 25°C, contain purified enzyme or plant extract (see below) diluted appropriately in

Hepes pH 7.0 containing 10% glycerol, and SmM DTT, 4C PEP either as variable substrate( for kinetic determinations) or fixed at 100 or 250 pM and shikimate 3 Phosphate (K+ salt) at 0.75 or 2 mM as indicated. Optionally, for assays of crude plant extracts, assays also contain 5 mM KF and/or 0.1 mM ammonium molybdate. Assays are started with the addition of *C phosphoenolpyruvate (cyclohexylammonium+ salt) and stopped after 2-10 minutes (2 minutes is preferable) with the addition of 50pl of a solution of 1 part 1M acetic acid and 9 parts ethanol. After stopping, 20pl is loaded onto a synchropak AX100 (25cm x 4.6mm ) column and chromatographed using isocratic elution with a 0.28M potassium phosphate pH 6.5 mobile phase flowing at 0.5 ml/min over 35 minutes. Under these conditions the retention times for PEP and EPSP are, depending on the individual columns, ~ 19 and 25 minutes respectively. A CP 525TR scintillation counter is connected to the end of the AX 100 column. It is fitted with a 0.5ml flow cell, and the flow rate of scintillant ( Ultima Flo

AP) is set at 1ml/min. Relative peak areas of PEP and EPSP are integrated to determine the percentage conversion of labelled PEP to EPSP. Apparent K| and Vmax values are determined by least squares fit to a hyperbola with simple weighting using the Grafit 3.09b from Erithacus Software Ltd. Km values are generally ascertained using 8-9 concentrations of variable substrate ranging from K_, / 2 - 10 K,, and triplicate points. Except where

-17- | oo specifically noted, data points are only included in the analysis where there is < 30% conversion of substrate to EPSP.

Shikimate-3-Pi (S3P) is prepared as follows, To 7mls of 0.3M TAPS pH 8.5 containing 0.05M Shikimate, 0.0665M ATP ( Na salt ), 10mM KF, 5mM DTT, and 0.05M

MgClL,.6H,0, 75ul of a 77 unit ( tmol min" ) ml" solution of shikimate kinase is added. After 24hrs at room temperature, the reaction is stopped by brief heating to 95°C. The reaction solution is diluted 50 fold in 0.01M Tris HCI pH 9, and chromatographed by anion exchange on Dowex 1 X 8 - 400, using a 0 - 0.34M LiCl, gradient. The S3P fractions are combined, : freeze dried, and then redissolved in 7mls distilled H,0. 28mls of 0.1M Ba(CH,COOH), and 189mls of absolute ethanol are then added. This solution is left to stir overnight at 4°C. The resulting precipitate of tri-Barium S3P is collected and washed in 30mls of 67% ethanol. The washed precipitate is then dissolved in ~ 30mls distilled H,0. By adding K,SO, the K” salt of

S3P is produced as required. Great care is taken to add a minimal excess of sulphate. The

BaSO, precipitate is removed and the supernatant containing the required salt of S3P freeze dried. Each salt is weighed and analysed by proton NMR. S3P preparations so-prcpared arc > 90% pure according to proton NMR and, according to their weights and integration of 31P

NMR, contain only low residues of potassium sulphate.

Example 3. Preparation of extracts of plant material suitable for EPSPS assay

Callus or plantlet material (0.5 -1.0 g) is ground to a fine frozen powder in a liquid nitrogen-chilled mortar and pestle. This powder is taken up in an equal volume of a suitable chilled extraction buffer (for example, 50 mM Hepes/ KOH buffer at pH 7.5 containing 1 mM EDTA, 3 mM DTT, 1.7 mM ‘pefabloc’ (serine protease inhibitor), 1.5 mM leupeptin, 1.5 mM pepstatin A, 10% v/v glycerol and 1% polyvinylpyrolidone), resuspended, mixed and centrifuged in a chilled centrifuge to bring down debris. The supernatant is exchanged down a chilled PD10 column of Sephadex G25 into 25 mM Hepes/ KOH buffer at pH 7.5 containing 1 mM EDTA, 3 mM DTT and 10% v/v glycerol. Protein is estimated by the

Bradford method standardised using bovine serum albumen. A portion of the extract is frozen in liquid nitrogen; a portion is assayed immediately. :

Example 4. Method for assaying EPSPS activities in crude plant materials and discriminating the proportion of the total which is resistant to glyphosate.

EPSPS assays of plant extracts are carried out, as described above, with 0.1 mM "“C-

PEP and 0.75 mM shikimate-3-Pi either in the absence or the presence of 0.1 mM N- (phosphonomethyl)glycine. Under these assay conditions, the resistant forms of EPSPS of the current invention are estimated to be inhibited by < 8.5% whilst the sensitive w/t form is essentially fully inhibited (> 98%). Thus, the level of activity observed in the presence of glyphosate (A) is taken to represent ~ 92% of the level of resistant enzyme derived from expression of the transgene whilst the level of susceptible w/t EPSPS is taken to be the total level of EPSPS activity observed in the absence of glyphosate minus the value of A x ~ 1.08.

Because the Vmax of the mutant enzymes of the current invention are estimated to be, for example, only about a third of the Vmax of the w/t enzyme (and because the Km values for

PEP of both w/t and mutant forms are estimated to be about 20 uM or less), the level of expression of the mutant enzyme polypeptide relative to the level of expression of the endogenous w/t EPSPS is taken, to be about three fold higher than the ratio calculated on the basis of the ratio of their relative observed activities. The total level of EPSPS polypeptide expression (mutant + w/t) is also estimated by Western blotting.

Example 5. Cloning and expression of w/t cDNA encoding mature Brassica napus

EPSPS in E.coli

Brassica napus EPSPS cDNA is amplified using RT-PCR from RNA isolated from glass-house grown Brassica napus plants using Superscript RT from BRL according to the recommendation supplied by the manufacturer. PCR is performed using Pfu turbo polymerase from Stratagene according to the methods supplied by the manufacturer.

Suitably designed oligonucleotide primers based on the known nucleotide sequence (EMBL accession X51475) are used in the amplification reaction and the reverse transcription steps.

The PCR product is cloned into pCRBlunt II using Invitrogens Zero Blunt TOPO kit. The sequence of the insert is confirmed by sequencing and it is verified that the predicted open reading frame corresponds to that of the predicted mature chloroplastic Brassica napus

EPSPS protein with the exception of the presence of an initiating Met. The cloned and verified EPSPS sequence is excised using suitable restriction enzymes as known in the art and the purified fragment is cloned into pET24a (Novagen) digested similarly. The recombinant clones are introduced into BL21 (DE3) a codon-optimised RP strain of E.coli supplied by Stratagene. The EPSPS protein is expressed in this strain following addition of 1 mM IPTG to the fermenter medium (LB supplemented with 100ug/ml Kanamycin). The recombinant protein of the correct predicted mass is identified (i) on the basis of Coomassie staining of SDS gels of cell extracts and side by side comparison with Coomassie-stained gels of extracts of similar E.coli cells transformed with an empty pET24a vector and ii) by western analysis using a polyclonal antibody raised to previously-purified plant EPSPS protein.

Example 6. Cloning and expression in E.coli of glyphosate-resistant mutant Brassica napus EPSPS

The Brassica napus EPSPS ¢cDNA in pCRBlunt is used as a template for two further

PCR using primer pairs designed to introduce specific changes such that the resulting reaction product encodes a modified EPSPS protein wherein a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the conserved region GNAGTAMRPLTAAYV in the wild type enzyme such that the modified sequence reads GNAGIAMRSLTAAYV. The sequence of

Brassica napus EPSPS gene is known and methods for designing primers to effect this mutagenesis are well-known in the art.

The resultant PCR product is gel purified and cloned into pCRBIlunt II using Invitrogens

Zero Blunt TOPO kit. It is confirmed that the DNA sequence of the insert and its predicted open reading frame correspond to that of the predicted mature chloroplastic Brassica napus

EPSPS protein (with the exception of the presence of an initiating Met) and also that the desired changes (the specific mutation of TtoIand P to S at specific positions in the EPSPS sequence) are encoded . The thus cloned and verified B.napus EPSPS sequence is excised using suitable restriction enzymes and the purified fragment cloned into pET24a (Novagen) digested similarly. The recombinant clones are introduced into BL21 (DE3), a codon optimised RP strain of E.coli supplied by Stratagene. The EPSPS protein is expressed in this strain following addition of 1 mM IPTG to the fermenter medium (LB supplemented with 100ug/ml Kanamycin). The recombinant protein of the correct predicted mass is identified i) on the basis of Coomassie staining of SDS gels of cell extracts and side by side comparison with Coomassie-stained gels of extracts of similar E.coli cells transformed with an empty pET24a vector and ii) by Western analysis using a polyclonal antibody raised to previously-

purified plant EPSPS protein. This mutant form of Brassica napus EPSPS is purified and characterised as described herein.

Example 7. Purification and characterisation of mutant Brassica napus EPSPS

The mature mutant Brassica napus EPSPS protein is purified at ~ 4 C as follows. 25 g wet weight of cells are washed in 50 ml of 0.1M Hepes/ KOH buffer at pH 7.5 containing 5 mM DTT, 2 mM EDTA and 20% v/v glycerol. Following low-speed centrifugation, the cell pellet is resuspended in 50 ml of the same buffer but also containing 2 mM of ‘Pefabloc’ a serine protease inhibitor. Cells are evenly suspended using a glass homogenizer and then disrupted at 10000 psi using a Constant Systems (Budbrooke Rd, Warwick, U.K.) Basic Z cell disrupter. The crude extract is centrifuged at ~ 30,000 g for 1 h and the pellet discarded.

Protamine sulphate (salmine) is added to a final concentration of 0.2% , mixed and the solution left to stand for 30 min. Precipitated material is removed by centrifugation for 30 min at ~ 30,000 g. Aristar grade ammonium sulfate is added to a final concentration of 40% of saturation, stirred for 30 min and then centrifuged at ~ 27,000 g for 30 min. The pellet is resuspended in ~ 10 ml of the same buffer as used for cell disruption, further ammonium sulfate is added to bring the solution to ~ 70% of saturation, the solution is stirred for 30 min and centrifuged again to yield a pellet which is resuspended in ~ 15 ml of S200 buffer (10 mM Hepes/ KOH (pH 7.8) containing 1 mM DTT, 1 mM EDTA and 20% v/v glycerol).

This is filtered (0.45 micron) loaded and chromatographed down a K26/ 60 column containing Superdex 200 equilibrated with S200 buffer. EPSPS-containing fractions detected on the basis of EPSPS enzyme activity are combined and loaded onto an xk16 column containing 20 ml of HP Q-Sepharose equilibrated with S200 buffer. The column is washed with S200 buffer and then EPSPS eluted within a linear gradient developed from 0.0M to 0.2M KCl in the same buffer. EPSPS elutes within a single peak corresponding to a salt concentration at or below approximately 0.1 M. EPSPS-containing fractions detected on the basis of EPSPS enzyme activity are combined and loaded onto a HiL.oad xk26/60 column of Superdex 75 equilibrated with Superdex 75 buffer (25 mM Hepes/ KOH (pH 7.5) containing 2 mM DTT, 1 mM EDTA and 10% v/v glycerol. EPSPS-containing fractions identified on the basis of enzyme activity are combined and loaded onto a 1m! column of MonoQ equilibrated with the same, Superdex 75 buffer. The column is washed with starting buffer and EPSPS eluted as a single peak over the course of a 15 ml linear gradient

-21- | : developed between 0.0 and 0.2M KCI. EPSPS is obtained near (>90%) pure at this stage in the purification. Optionally, EPSPS is further purified by exchange into Superdex 75 buffer containing 1.0 M (Aristar) ammonium sulphate and loading onto a 10 ml column of phenyl sepharose equilibrated in the same buffer. EPSPS is eluted as a single peak early during the course of a linear gradient of declining ammonium sulphate developed between 1.0 and 0.0

M ammonium sulphate.

The purified mutant form of Brassica napus EPSPS, obtained by these or by similar methods and assayed as described above in the presence of 2 mM shikimate-3-Pi, has an apparent Vmax of ~ 5 pmol/ min/ mg and a Km for PEP of ~ 25 uM. At40 uM PEP, the

IC50 value for the potassium salt of glyphosate is ~ 0.6 mM. The estimated Ki value for potassium glyphosate of the mutant EPSPS is ~ 0.45 mM.

Example 8. Cloning of genomic DNA encoding Brassica napus EPSPS

A Brassica napus genomic DNA fragment (SEQ ID No.1), encoding EPSPS is known in the art (Gasser and Klee, 1990). PCR primers BnEPSPS5 (SEQ ID No.2) and

BnEPSPS3 (SEQ ID No.3) are used to amplify the EPSPS gene from genomic DNA isolated from Brassica napus var. Westar.

Pfu polymerase is used to perform the PCR using the following conditions: 94 °C 5 min 94 °C min 55°C30s 72 °C 12 min

The resulting 3.8 Kb product is cloned into pCR4Blunt-Topo and sequenced using the following primers: M13Forward, M13Reverse (Invitrogen), BnF1 (SEQ ID No.4), BnF2 (SEQ ID No.5), BaF3 (SEQ ID No.6), BnF4 (SEQ ID No.7), BnF5 (SEQ ID No.8), BnF6 (SEQ ID No.9), BnF7 (SEQ ID No.10), BnF8 (SEQ ID No.11), BnF9 (SEQ ID No.12),

BnF10 (SEQ ID No.13), BnF11 (SEQ ID No.14) and BnF12 (SEQ ID No.15).

Example 9. Introduction of mutations into genomic DNA encoding BnEPSPS.

The desired Thr-Ile and Pro-Ser mutations are introduced into the B. napus EPSPS gene by PCR using oligonucleotide primers containing codon changes so as to introduce the desired amino acid changes. Primers BnXho (SEQ ID No.16) and BoMUTBot (SEQ ID

No.17) are used to amplify a desired region of EPSPS from Westar genomic DNA. Likewise,

primers BnMutTop (SEQ ID No.18) and BnNde (SEQ ID No.19) are used to amplify an additional region from Westar genomic DNA. 1 ul of each of the PCR products is mixed and overlapping complementary sequences allowed to anneal. The products are then joined by

PCR using primers BnXho and BnNde. The resulting PCR product is cloned and sequenced : to check for the inclusion of the double mutation. The Xho1/Ndel fragment in the BhEPSPS clone is excised and replace with the cloned Xhol/Ndel fragment containing the double mutant.

Example 10. Construct for expression of mutant B.napus EPSPS in plants having the

Rubisco leader sequence upstream of the gene encoding mutant Brassica napus EPSPS.

The tobacco rubisco leader is introduced into the construct by PCR. Primers

BnRBSEP (SEQ ID No.20) and Brasr12 (SEQ ID No.21) are used to amplify a product from 50 ng wildtype B. napus genomic DNA as template using Pfu-Turbo polymerase. The resulting PCR product is cloned into pCR4 blunt TOPO and clones are identified by restrictions digest that are otientated such as it may be excised as Notl (from vector) and Xhol. The rubisco leader is then introduced into the mutated BnEPSPS clone as Not1/Xhol.

Example 11. Identification of the Brassica napus EPSPS promoter (useful for expression of EPSPS in plants) by genome walking

Increased lengths of upstream or downstream sequence of any plant gene may be obtained using the genome walking kit as supplied and directed by Clontech.

The primers depicted in SEQ ID Nos 22 and 23 (Bras r11 and Bnapus start rev) are used to obtain upstream sequence of the Brasicca napus EPSPS gene using Brasicca napus genomic

DNA according to the methods described in the protocol accompanying the genome walker kit.

The Bras r11 (SEQ ID No. 22) primer is used in conjunction with the AP1 primer supplied in the genome walker kit and the Bnapus start rev primer is used with the AP2 primer supplied with the genome walker kit. Products are cloned into pCR- TOPO using a

TOPO TA Cloning kit from Invitrogen according to the manufacturers instructions. PCR using M13 forward and reverse primers is performed using Ready to Go Beads from

Pharmacia to ascertain which clones. contain inserts of the correct size. A number of these clones are used to make DNA preps and these DNAs are then used to determine the nucleotide sequence of the inserts.

A second set of primers (SEQ ID Nos.24 and 25 respectively) is used for a further walk as shown below:

Genome walker 1 (SEQ ID No.24) with the AP1 primer

Genome walker 2 (SEQ ID No.25) with the AP2 primer

Additional genomic digests are performed in addition to those recommended by

Clontech’s protocols. These digests include Alu I, Hae III, Hinc II and Rsa I. These digested

DNAs are then treated identically to the other digests performed as described by the protocols accompanying the Genome walking kit. This is done to increase the chance of getting a correct and long PCR product. Again the PCR products are cloned into pCR-

TOPO using a TOPO TA Cloning kit from Invitrogen according to the manufactures instructions and sequence determination is performed on random clones obtained from each cloned product that contain inserts of the correct size. The sequence of the inserts are determined. Approximately 1kb of sequence upstream form the translational start site of the

Brasicca napus EPSPS is obtained that is contiguous with the published sequence.

Example 12. Constructs for expression of mutant Brassica napus EPSPS in plants

The 35S enhancer is amplified from vector pMIB1 (Figure 1) by PCR using primers

CaMV343 and CaMV46C (SEQ ID Nos.26 and 27 respectively)

The PCR product is cloned into vector pPCR4Blunt-TOPO and sequenced. The desired promoter, obtained as described in the previous example is amplified from B. napus

Westar genomic DNA using a 5’ primer containing a Sphl site and BnGUSXma (SEQ ID

No.28)

The PCR product is digested directly with Sphl and Xmal and ligated into the pCR4Blunt-T OPO vector containing the 35S enhancer as Sph1/Xmal (partial digest with

Sph 1). The CaMV 35S enhancer fused to the BnEPSPS promoter is then excised from pCR4-

Blunt using Not1 (from vector) and Xma 1 and cloned into the PCR4Blunt vector containing the tobacco rubisco leader and mutated B. napus EPSPS gene. The FMV enhancer (SEQ ID

No.29) or the CaMV35S enhancer (SEQ ID No.30) is synthesised chemically and subcloned into vector pCR4 Blunt TOPO. The FMV enhancer is excised from PCR4-Blunt as

Not1/Sacl and ligated into the CaMV 35S enhancer/B. napus promoter / rubisco leader / B. napus EPSPS as Notl/Sacl. The final construct is shown in Figure 2. The whole expression cassette may be excised using EcoRI and ligated into a suitable vector for plant transformation.

Example 13. Plant Transformation and Regeneration.

The expression cassette is excised from the pFCBnEPSPS vector using EcoR/ and ligated into, for example, a binary vector pBin19 at the unique EcoR 1 restriction site. The binary vector, containing the desired expression cassette transformed into Agrobacterium tumefaciens strain LBA 4404 using the freeze thaw method of transformation provided by

Holsters et al., 1978. Tobacco transformation and whole plant regeneration is performed using Nicotiana tabacum var. Samsun according to protocols in Draper ef al (Plant Genetic

Transformation, Blackwell Sci. Pub. 1989). Transformation events are selected on MS-media containing kanamycin. Alternatively pFCBnEPSPS, or other constructs capable of delivering glyphosate resistance in plants by the expression of a glyphosate resistant EPSPS - gene from soybean may be introduced into plants directly without using Agrobacterium mediated techniques as described for Soybean.

Constructs are transformed into regenerable embryogenic soyabean tissues using either biolistic type approaches (e.g Santarem ER, Finer, J.J (1999) ‘Transformation of soyabean (Glycine max (L.) Merrill) using proliferative embryogenic tissue maintained on a semi-solid medium’ In vitro Cellular and Developmental Biology-Plant 35, 451-455; USP- 5,503,998, USP 5830728 )or via infection with Agrobacterium (e.g. USP-5,024,944, USP- 5,959,179). Regenerable embryogenic soyabean tissues are derived, for example, from the cotyledons of immature embryos or other suitable tissues.

Proliferative embryogenic tissue can, for example, be maintained on a semi-solid medium. Such tissue, is, for example obtained in the following way. Immature zygotic embryos which are 3- 4 mm long are isolated from pods of, for example, Glycine max (L.)

Merrill, 2-3 weeks after flower formation. Pods can be checked for the presence of embryos of the correct length and maturity by ‘backlighting’. Pods are then sterilized. Immature embryos are removed and the axis removed from each. Immature embryos are then plated on ‘D40-Lite’ semi-solid (0.2% gelrite) MS salts medium at pH 7.0 containing BS vitamins, 3% sucrose and 40 mg/l 2,4-D for 3-4 weeks. For proliferation of embryos the material is then transferred to ‘D20’” MS salts medium at pH 5.7 containing BS vitamins, 3% sucrose, 20 mg/1 2,4-D and 0.2% Gelrite. Material with bright green globular proliferative embryos is selected and subcultured every 2-3 weeks.

For bombardment, 20-25 clumps/ plate of tissue are selected (subcultured 4-5 days prior to bombardment) and arranged in the centre of the dish containing D20 medium. The tissue is dried for 15 min by uncovering for 15 minutes under a sterile hood. Gold particles coated in DNA construct (coated, for example, using methods described in the references above) are twice bombarded into the tissue on D20 medium using any one of a large number of commercially available guns. By way of further example a PDS1000 particle gun is used.

Particles may be prepared and coated with DNA in a similar manner to that described by

Klein ef al 1987, Nature, 327, 70-73. Alternatively, for example, 60 mg of gold or tungsten particles (~ 1.0 um) in a microcentrifuge tube are washed repeatedly in HPLC-grade ethanol and then, repeatedly, in sterile water. The particles are resuspended in 1 ml of sterile water and dispensed into 50 pl aliquots in microcentrifuge tubes. Gold particles are stored at 4 C, tungsten particles at - 20 C. 3 mg of DNA are added to each aliquot of (defrosted) particles and the tubes are vortexed at top speed. Whilst maintaining near continuous vortexing, 50 ul of 2.5M CaCl, and 20 pl of 0.1M spermidine is added. After 10 minutes of further vortexing, samples are centrifuged for 5 seconds in an eppendorf microcentrifuge, the supernatant is drawn off and the particles washed in successive additions of HPLC-grade ethanol. The particles are thoroughly resuspended in 60 pl of ethanol and then dispensed in 10 pl aliquots onto the surface of each macrocarrier to be used in the PDS1000 particle gun.

Components of the PDS1000 particle gun are surface sterilised by immersion in 70% ethanol and air-drying. Target plates prepared, as described above, with tissue arranged into an ~ 2.5 cm disc are placed 6 cm from the stopping screen. Suitably chosen rupture discs are then used for bombardment.

One week after bombardment, all tissue clumps are transferred onto D20 medium, buffered to pH 5.7, containing a suitable selective concentration of glyphosate between 0.05 and 5 mM. After an additional 3-4 weeks all tissue is transferred to fresh D20 medium containing an increased concentration of glyphosate within this concentration range. After a further 3-4 weeks, living tissue is selected and subcultured on every 3-4 weeks in similar

D20 medium containing glyphosate. Alternatively, in the case that some other selectable. marker than glyphosate is also present then selections may be made as appropriate (e.g using

. =26- . increasing concentrations of hygromycin). Growing sections are thus maintained and, given enough tissue, may be analysed by PCR to confirm that they are transgenic for the desired

DNA.

In order to develop and mature embryos, tissue clumps are placed onto M6 medium | which comprises MS salts at pH 5.7 containing BS vitamins, 6% maltose and 0.2% gelrite.. 6-9 clumps are placed in a tall dish at 23°C. After 3-4 weeks, embryos elongate and can be separated and transferred to another round of incubation on M6 medium. After 4-6 weeks, embryos are cream-coloured and ready for desiccation. 9 such cream-coloured embryos are placed in a dry Petri dish, sealed with parafilm and placed onto a shelf for 2-3 days.

Embryos should be somewhat flaccid and not “crispy-crunchy”.

Dessicated embryos can be germinated by plating onto OMS (growth regulator-free

MS medium). Following germination which normally occurs within a week plants are transferred to larger boxes and, once there is sufficient root and shoot formation, thence to soil. To prevent fungal contamination it is advisable to wash OMS from the roots with distilled water. Plants may be kept and grown under high humidity and, initially, under 24 - hour lighting. Plants may be grown until about 2 feet tall under 24 hour lighting and then encouraged to flower and form pods through a shift to a 16 hour lighting regime. Seeds are collected and progeny grown on, crossed and backcrossed into order to move the transgenes into the desired plant background using the normal methods of plant breeding. Plants are routinely analysed for the presence and expression of transgenes using the normal methods of molecular biology including analysis by PCR, Southern, Western, ELISA and enzyme assay techniques.

Example 14. Methods of obtaining genes encoding stable glyphosate resistant EPSPs

In one embodiment of the current invention, glyphosate resistant EPSPS genes suitable for expression in E.coli are constructed, as for example, described herein where, in the coding sequence a first position is mutated so that the residue at this position is

Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the following conserved region GNAGTAMRPL in the wild type enzyme such that the modified sequence reads GNAGIAMRSL.

7. oo

Stable glyphosate-resistant EPSP synthases of the current invention and genes encoding these are then obtained by generating a wide range of variants by a process of random or partially random mutagenesis (for example using chemical or UV mutagenesis, by using a non-proof reading DNA polymerase (e.g. in a strain such as XL1 red) or by using any "5 one of a number of ‘directed evolution’ approaches (e.g as reviewed by Kuchner and Arnold, 1997 in TIBTECH, 15, 523-530 or described by Stemmer (1994) in PNAS, 91, 10747- 10751) and selecting genes expressing EPSPSs which are stable and which remain glyphosate resistant. Suitable means of selection include, for example, expression of mutated genes (e.g from a weak constitutive promoter) in an Aro A- strain of E.coli grown at elevated temperatures (e.g 37-42 C) and selecting those transformants most capable of growth in minimal medium (optionally also containing glyphosate). Alternatively, a non-aro

A host strain might be used (preferably e.g. rec A) provided that the medium contains a selective concentration of glyphosate. The skilled man will recognise that many methods of mutagenesis and selection could be used within the ambit of the current invention.

Example 15. Stable glyphosate-resistant EPSPSs and genes encoding them

The stable double mutant form of Brassica napus EPSPS is one example of the current invention. The skilled man will recognise that other examples of such EPSPSs of the current invention and genes encoding them can be cloned, isolated and characterised using methods the same or similar to those described above.

In EPSPSs and the EPSPS gene sequences of the current invention, the coding sequence at a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the following conserved region GNAGTAMRPL in the wild type enzyme such that the modified sequence reads

GNAGIAMRSL.

EPSPS protein sequences of the current invention are further characterised in that they DO NOT comprise a region having the sequence K(A/V)AKRAVVVGCGGKFPVE

EPSPS protein sequences of the current invention are further characterised in that they comprise at least one of the amino acid sequence motifs listed below in (i)-> (viii). (i) ALLMZAPLA where ZisNOT Sor T (ii) EIEIZDKL where Z is NOT V

(iii) FG(V/M)(K/S)ZEH where Z is NOT V (Iv) AL(K/R)ZLGL where Z is NOT R (v) GLXVEZ DXZ,XXXA(I/V)V ~~ where Z, is NOT T and/or Z, is NOT E (vi) ITPPZ,K(L/V)(X/N)Z, where Z, is NOT K and/or Z, is NOT T s (vil) TIZ(D/N)PGCT where Zis NOT Nor L (viii) (D/N)YFXVLXZXX(X/R)H where Z is NOTR wherein X is any amino acid and Z,7Z1, and Z2 are any amino acid other than those : indicated.

Furthermore it is preferred, for EPSPS genes and proteins of the current invention, that the protein sequence comprise at least one of the sequence motifs i), ii) iii), v) and vi), preferably, at least two of these.

Furthermore, in amino acid sequence motif i) Z is preferably A, in sequence motif ii)

Z is preferably I, in sequence motif iii) Z is preferably A, in sequence motif iv) Z is preferably K, T or A, in sequence v) Z, is preferably R or A and less preferably D or E whilst

Z, is preferably V or A and less preferably T, in sequence motif vi) Z, is preferably E or A whilst Z, is preferably P, 1 or V, in sequence motif vii) Z is preferably R or K and in sequence motif viii) Z is preferably T or S and less preferably is Q.

Furthermore, some of the EPSPS protein sequences of the current invention are characterised in that they comprise at least one of the following sequences: (I/V)VEGCGGI/L/Q)FP(V/A/T)S/G) or

I/VYVVGCGGI/L/Q)FP(V/A/T)E or

I/VYIVVGCGGI/L/Q)FP(V/A/T)(S/G) or

I/VY)VV GCGGKFP(V/A/T)S/G)or _ (WV)VEGCGGKFP(V/A/T)E or (I/V)VEGCGG/L/Q)FP(V/A/T)E or (I/VYVEGCGGKFP(V/A/T)(S/G)

Furthermore EPSPS sequences of the current invention are preferably derived from : dicotyledenous plants

Example 16. Stable glyphosate-resistant EPSPSs derived from soyabean

Preferred examples of the current invention are the EPSPS protein sequences and the

DNA sequences which encode these which are derived from soyabean ( see for example

~ WO0226995 PCT/GB01/04131

EPSPS gene SEQ ID Nos 33 and 34) and which are then optionally modified according to

Example 15 to yield a stable glyphosate resistant EPSP synthase.

Particularly preferred examples are EPSP synthase genes derived from soyabean in which:- (a) the coding sequence at a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the following conserved region GNAGTAMRPL in the wild type enzyme such that the modified sequence reads GNAGIAMRSL,

And : (b) the DNA coding sequence may be further modified in accord with Example so that the encoded protein comprises at least one and preferably two or more of the amino acid sequence motifs ii), iii), v) and viii) .

Example 17 Cloning of a soybean partial length cDNA encoding EPSPS. 15 Soybean RNA is isolated using Trizol™ reagent as described by Gibco BRL and first- strand cDNA synthesised using Superscript II (Gibco BRL) using protocols provided by the manufacturer with the degenerate primer EPSPS 10 reverse (SEQ ID No.35). PCR is performed using ready to go PCR beads supplied by AmershamPharmacia™ according to the protocol supplied by the manufacturer using the reverse transcribed soybean first-strand cDNA product as a template and the primers EPSPS 4 forward (SEQ ID No.34) and EPSPS 10 reverse (SEQ ID No.33).

The following PCR conditions are used:- 1. 94°C 3 minutes for 1 cycle 2. 94°C 45 seconds 50°C 30 seconds 72°C 1 minute for 25 cycles 3. 72°C 10 minutes for 1 cycle.

The product obtained of approximately 1 kb is cloned into pCR2.1 using a TOPO TA cloning Kit (Invitrogen) according to the manufacturer’s recommendations. Colonies are picked at random and are selected for further work via plasmid preparation with the QI Aprep

Mini-Prep Kit (Qiagen), followed by digestion with Eco RI to show the size of the insert in these clones. Clones containing the expected 1kb insert are progressed. The polynucleotide sequence of selected clones is determined using an ABI 377 automated sequencer. Database searching is performed using the Blast algorithm (Altschul ef al., 1990) and indicates that the majority of sequenced clones contain partial length cDNAs exhibiting high homology toward known plant EPSPS sequences.

Example 18 Isolation of a genomic polynucleotide sequence encoding soybean EPSPS.

A soybean genomic library constructed in Lambda Fix II is purchased from

Stratagene and 1,000,000 clones are plated out according to the suppliers protocols. Hybond

N+ filters are used to make lifts from the library plates and these were processed according to the protocols supplied by AmershamPharmacia and Molecular Cloning - a laboratory manual (Sambrook et al., 1989). UV cross linking of the DNA to the membrane is carried out using a UV Stratalinker (Stratagene). The soybean EPSPS cDNA probe is prepared by digesting the clone containing the soybean EPSPS partial length cDNA sequence with Eco

RI and purifying the 1 kb product by agarose gel electrophoresis. The probe is labelled with *P dCTP using a Ready-To-Go™ DNA labelling kit (AmershamPharmacia). The filters are prehybridised and hybridised in Rapid-Hyb Buffer (Amersham Pharmacia). Washes are performed using 0.1 x SSPE, 0.5% SDS at 65 °C. The filters are then wrapped in Saran wrap and exposed to film in a cassette containing an intensifying screen as described in Molecular

Cloning - a laboratory manual (Sambrook et al., 1989).

Hybridising plaques are picked into SM buffer, replated at lower density and rescreened through 2 further rounds of purification. Phage DNA is recovered from plaque pure phage stocks using methods well known in the art (Sambrooke et al. 1989). The recovered phage DNA is digested with Not 1, and the genomic DNA subcloned into pBluescript. The resulting vector is transformed into TOP 10 E.coli. The resulting clones are sequenced using the Genome Priming System (NEB) using protocols provided by the manufacturer. Briefly, sufficient batches of 96 GPS events are selected and DNA prepared using a Qiagen™ Biorobot. The DNA was sequenced with the GPS-S and GPS-N primers as supplied by NEB using an ABI 377 automated sequencer. Sequence data are analysed using

Seqman (DNASTAR Inc). The gene encoding EPSPS is identified by homology to known

EPSPS genes using the Blast algorithm. The sequence of two contigs containing sequences showing high homology to known EPSPS are given in SEQ ID No.37 and SEQ ID No.38

NE -31- and are termed GmEPSPS1/14 and GmEPSPS12 respectively. A schematic representation of : these genes is given in Figure 3 and Figure 4.

The person skilled in the art will know that there could be other EPSPS genes present in soybean and that these may be isolated and the nucleotide sequence determined using similar methodologies as described in this example.

Example 19 Production of plant transformation vector harbouring the soybean EPSPS

The two enhancer combinations FMV35S90 (SEQ ID No.37 and FMV35546 (SEQ

ID No.38) are synthesised chemically and subcloned into vector pTCV1001 (Figure 5) using

Hind I / Pac 1. The soybean EPSPS terminator, and a small region of the coding sequence, are obtained by PCR using the primers GmTermBam (SEQ ID No.39) and GmTermEco (SEQ ID No.40) using clone GmEPSPS 1/14 as template. The PCR product is cloned into pCR4-Blunt-TOPO, sequenced, and excised using Pst1 and EcoR1 and ligated into the pTCV1001 vector containing the FMV/CaMV35S enhancers. Finally, the Pacl:BamH]

DNA fragment containing the majority of the soybean EPSPS gene in either GmEPSPS 1/14 is excised and cloned into the pTCV1001 vector comprising both the enhancers and terminator.

Example 20 Introduction of mutation into EPSPS gene.

The desired Thr to Ile and Pro to Ser mutations required to increase tolerance to glyphosate are inserted into the construct in the following manner. Primer BaMUT2PST (SEQ ID No.41), which contains the nucleotide changes that give rise to the desired amino- acid mutation, is used in conjunction with primer BaMUTKPN (SEQ ID No.42) in PCR with pfu-TURBO polymerase (Stratagene) with GmEPSPS 1/14 as template. The PCR product, now containing the desired mutation, is cloned into pCR4-Blunt-TOPO and sequenced. It is then excised as Kpn 1 Pst 1 and used to replace the corresponding fragment in the construct in pTCV1001 containing WT sequence. The final vector is termed pTCVGMEPSPS (Figure 6).

Example 21 Introduction of 5° UTL.

An additional 5° UTL, such as that from the small subunit of ribulose biphosphate carboxylase/oxygenase (Rubisco) or tobacco glucanase can be inserted into the construct by

PCR. In addition the context surrounding the AUG translation initiation codon is optimised to give the consensus Kozak sequence ACCAUGG. With regard the SSU rubisco leader, primers GmRubPac (SEQ ID No.43) and GmRubbot (SEQ ID No.44) are used to introduce the soybean rubisco 5” UTL into 5° UTL of the soybean EPSPS gene. GmRubTop (SEQ ID

No.45) and GmRubKpn (SEQ ID No.46) are then used to introduce the soybean rubisco 5’

UTL into the first exon of the soybean EPSPS gene. The two PCR products are then joined, by PCR using primers GmRubPac and GmRubKpn and the resulting product cloned into pCR4Blunt-TOPO and sequenced. Once the authenticity of the PCR product is confirmed it is excised from the PCR4 vector as Pacl:Kpnl and used to replace the Pacl/Kpnl restriction fragment in vector pTCVGMEPSPS.

These examples outline the construction of a DNA sequence comprising two enhancers fused to a soybean EPSPS gene containing specific mutations in the coding sequence that is capable of producing a glyphosate resistant EPSPS enzyme in plants. The person skilled in the art will know that enhancers may be introduced at various distances up stream from the promoter and transcriptional start site to act to enhance the rate and/or amount of transcription of the double mutant EPSPS soybean gene in plant cells. The distance may have to be determined empirically for each individual gene. This involves making a number of constructs where the enhancers are fused at different distances from the transcriptional start of the double mutant EPSPS soybean gene and introducing these constructs into plant material and assaying the material for resistance to selecting concentrations of glyphosate. The person skilled in the art will also know that enhancer choices are not restricted to CaMV 35S and FMV enhancers, but may also include enhancers from any gene that is highly expressed in plants including inter alia, enhancers from actin genes, ubiquitin genes, mannopine, nopaline and octopine synthase genes, genes from commelina yellow virus and other plant viruses expressed in plants such as potato virus Y and X coat proteins. The choice of 5’ UTR may not be restricted to soybean small subunit rubisco and leader from other genes may be used.

Example 22 Plant Transformation and Regeneration.

The expression cassette is excised from the pTCVGMEPSPS vector using Xma 1 and ligated into a binary vector pBin19 at the unique Xma 1 restriction site. The binary vector, containing the desired expression cassette transformed into Agrobacterium tumefaciens strain

LBA 4404 using the freeze thaw method of transformation provided by Holsters et al., 1978.

Tobacco transformation and whole plant regeneration are performed using Nicotiana tabacum var. Samusun according to protocols in Draper et al (Plant Genetic Transformation,

Blackwell Sci. Pub. 1989). Transformation events are selected on MS-media containing kanamycin.

Alternatively PTCGMEPSPS, or other constructs capable of delivering glyphosate resistance in plants by the expression of a glyphosate resistant EPSPS gene from soybean may be introduced into plants directly without using Agrobacterium mediated techniques as described for Soybean in a number of references including the following: Physiol. Plant. (1990), 79(1), 210-12; USP-5,968,830; WO-0042207; and USP-5,959,179 and as described in Example 13.

Example 23 Analysis of Transgenic Plants

PCR analysis of transformants

Leaf samples were taken from transformed lines and DNA extracted according to known methods. Oligonucleotide primers are designed to specific regions within the transgene to enable its detection in the plant material tested.

RNA analysis :

The presence of mRNA encoding the transgene is detected within the plant using Northern

Blot hybridisation. Total RNA is extracted from leaf tissue using Tri-reagent and protocols provided by the manufacturer (Sigma™). Blots are prepared using existing procedures and probed using radio-labelled soybean EPSPS cDNA.

Protein Analysis

The presence of recombinant protein in the transgenic plant is determined using Western blotting procedures with antibodies raised to recombinant soybean EPSPS using standard protocols.

Enzyme assays

Resistant EPSPS activity is detected in plants using "“C radiolabelled substrates and detection of products by HPLC.

Herbicide tolerance tests

Following tissue culture, transgenic plants are transferred to 5 inch pots containing John

Innes potting compost no. 3. The plants are allowed to acclimatise (approx. 2 weeks) in the greenhouse and formulated glyphosate applied at various concentrations to the aerial tissue using a track spayer. Visual assessment of the transformed plants to identify those that are resistant to glyphosate is performed 21 days post application.

Example 24 Introduction of plastid targeted pyruvate orthophosphate di-kinase (PPDK) or phosphoenolpyruvate synthase (PPS) constructs.

The cDNA encoding PPDK from maize (EMBL Accession J03901), containing its autologous transit peptide sequence, is amplified by RT-PCR from maize tissue using primers ZMPPDK 1 (SEQ ID No. 47) and ZMPPDK2 (SEQ ID no. 48). The RT-PCR product is cloned into the vector pPCR2:1 TOPO and sequenced to check for authenticity. The maize

PPDK gene is excised from the pCR2.1 vector, as a Nco 1/Kpn 1 fragment and ligated into similarly digested pMJB1 (Figure 1). The plant expression cassetee is then subcloned into the pTCVGMEPSPS cassette (Figure 6) prior to further plant transformation. Other PPDK genes, such as that encoding a cold-stable PPDK from Flaveria brownii (EMBL accession AAQ94645) or form rice can be engineered using a similar strategy. Likewise, the gene encoding PPS in E. coli (EMBL Accession X59381) is amplified by PCR using oligos

ECPPS1 (SEQ Id No. 49) and ECPPS2 (SEQ ID No. 50). The PCR product is cloned into plant expression cassette containing a plant operable promoter (such as the cauliflower mosaic virus 35S promoter), a chloroplast transit signal sequence (such as that from the small subunit of rubisco) and a terminator (such as NOS).

Sequence listing

Brassica napus genomic DNA encoding an EPSPS (SEQ ID No.1) geatgcagatcttaaaggctcttticcagtctcacctaccaaaactataagaaaatccactigetgtetgaaatageegacgtggataaag tacttaagacgtggcacattattatigactactagaaaaaaaactcatacaccatcgtaggagttgggatiggtgaagaatttgatgpste cctetecceeccecactcaccaaactcatgttetttgtaaagecgtcactacaacaacaaaggagacgacagttctatagaaaagettte aaattcaatcaatggcgcaatctagcagaatctgecatggegtgcagaacccatgtgttatcatcteeaatetetccaaatccaaccaaa acaaatcacctttctccgtctecttgaagacgeatcagectegagettcttegtggggattgaagaagagtggaacgatgetaaacggtt ctgtaattcgeceggttaaggtaacagettctgtticcacgtccgagaaagettcagagattgtgcticaaccaatcagagaaatctegg gtotcattaagetacecggatecaaatctetctecaateggatectecttctigecgetetatctgaggtacatatacttgettagtgttagge ctitgctgtgagattttgggaactatagacaatttagtaagaatttatatataatttttttaaaaaaaatcagaagcctatatatatttaaatttttc caaaatttttggaggttataggcttatgttacaccattctagtctgeatctttcggtttgagactgaagaattttatttittaaaaaattattatag ggaactactgtagtggacaacttgtigaacagtgatgacatcaactacatgcttgatgegttgaagaagetggggcettaacgtggaacg tgacagtgtaaacaaccgtgcggttgttgaaggatgeggtggaataticccagettcecttagaticcaagagtgatattgagttgtacctt gggaatgcaggaacagccatgegtecactcaccgetgeagttacagetgeaggtggcaacgegaggtaaggttaacgagttttitgtt attgtcaagaaattgatcttgtgtttgatgcttttagtttggtttgtttictagttatgtacttgatggggtocctagaatgagggaaagacctat aggagatttggttettggtcttaageagcettggtgctgatgtigagtgtactetiggcactaactgtectectgttegtgteaatgetaatggt ggccttcecggtggaaaggtgateticacatttactctatgaattgtitgeageagtctttgticatcacagectttgetteacattatttcatcet tttagtttgttgttatattacttgatggatctttanaaaggaattgggtctggtgtgaaagtgattageaatetttctcgattecttgecagggee gtgggcattactaagtgaaacattagectattaacccccaaaatttttgaaaaaaatttagtatatggecccaaaatagtttttaaaaaatta gaaaaacttttaataaatcgtctacagtcccaaaaatcitagagecggecctgcettgtatggtitctegatigatatattagactatgttttga attttcaggtpaagetitctggatcgatcagtagtcagtactigactgeccteetcatggeagetectitagetetiggagacgtggagatt gagatcattgataaactgatatctgticcatatgttgaaatgacattgaagttgatggagcegtittggigttagtgccgageatagtgatag ctgggatcgtttctitgtcaagggcggtcagaaatacaagtaatgagttctittaagttgagagttagattgaagaatgaatgactgattaa ccaaatggcaaaactgattcaggtcgcectggtaatgcttatgtagaaggtgatgettetagtgetagetacttcttggetggtgetgecatt actggtgaaactgttactgtcgaaggtigtggaacaactagectccaggtagtitatccactctgaatcatcaaatattatactcectecgtt ttatgttaagtgtcattagcttttaaatittgtitcattaaaagtgtcattttacattttcaatgcatatattaaataaattttccagtttttactaattc attaattagcaaaatcaaacaaaaattatattaaataatgtaaaattcgtaatitgtgtgcaaataccttaaaccttatgaaacggaaacctta tgaaacagagggagtactaattttataataaaatttgattagttcanagtigtgtataacatgttttgtaagaatetaagetcattetctttitatt ttttgtgatgaatcccaaagggagatgtgaaattcgeagaggticttgagaaaatgggatgtaaagtgtcatggacagagaacagtgty actgtgactggaccatcaagagatgcttitggaatgaggcacttgegtgctgtigatgtcaacatgaacaaaatgectgatgtagecatg actctagcegttgttgetctettigecgatggtccaaccaccatcagagatggtaaagceaaaaccetetctttgaatcagegtgttttaaaa gattcatggttgcttaaactctatitggtcaatgtagtggcetagetggagagttaaggagacagagaggatgattgecattigeacagag cttagaaaggtaagtttccttttctetcatgeictctcattcgaagttaategtigeataactititgeggttitittittgegttcagettggage tacagtggaagaaggttcagattattgtgtgataactccaccagcaaaggtgaaaccggeggagattgatacgtatgatgatcatagaa tggcgatggegttctegetigeagettgtgctgatgticeagtcaccatcaaggatectggetgeaccaggaagactticeetgactactt ccaagtccttgaaagtatcacaaageattaaaagaccctttcetctgatccaaatgtgagaatetgttgetttetettigttgecactgtaaca tttattagaagaacaaagtgtgtgtgttaagagtgtgtttgctigtaatgaactgagtgagatgcaatcgtigaatcagttitgggccttaat aaaggptttaggaagctgcagegagatgattgtitttggtegatcatetttgaaaatgtgtttgtttgagtaattttictagggttgagtigatt acactaagaaacactttttgattttctattacacctatagacacttcttacatgtgacacactttgttgtiggcaagcaacagattgtggacaa tittgectttaatgganaggacacagtigtegatggateatttgtggacgaticatgtetegtiaggteatitgtggacg gatgatgtgtag atgagtgatgagtaatgtgtgaatatgtgatgttaatgtgtttatagtagataagtggacaaactctetgttttgattccataaaactatacaa caatacgtggacatggactcatgttactaaaattataccgtaaaacgtggacacggactctgtatctccaatacaaacacttggcttctica gctcaattgataaattatctgeagttaaacticaatcaagatgagaaagagatgatattgtgaatatgarscggagagagaaatcgaaga agcgtttaccttttgtcggagagtaatgaattc

BnEPSPSS5 (SEQ ID No.2) gcatgcagatcttaaaggctcttttccagtce :

BnEPSPS3 (SEQ'ID No.3) gaattcattactctccgacaaaaggtaaacge

BnF1 (SEQ ID No.4) gcgcaatctagcagaatctg

BnF2 (SEQ ID No.5) tccttcttgecgcetctatet

BnF3 (SEQ ID No.6) gegttgaagaagetggggct

BnF4 (SEQ ID No.7) acctataggagatttggtto

BnF5 (SEQ ID No.8) actaagtgaaacattagcct

BnF6 (SEQ ID No.9) gttccatatgttgaaatgac

BnF7 (SEQ ID No.10) tccactctgaatcatcaaat

BnF8 (SEQ ID No.11) gtaagaatctaagctcattc

BnF9 (SEQ ID No.12) tcatggttgcttaaactcta

BnF10 (SEQ ID No.13) cagcttgtgctgatgticca

BnF11 (SEQ ID No.14) cgatcatctttgaaaatgtg

BnF12 (SEQ ID No.15) ctctctgttitgattccata BnXho (SEQ ID No.16) cgcatcagcctcgagcttettegtg :

BnMUTBot (SEQ ID No.17) ggtgagtgaacgcatggcetatteetgeat

BnMutTop (SEQ ID No.18) atgcaggaatagccatgcgttcactcace

BnNde (SEQ ID No.19) catttcaacatatggaacagatatc

BnRBSEP (SEQ ID No.20) ccegggatattggangttanaggaraagagagaaagagaaatctitctgtotaagtgtaattaaccatggegeaatctageagaatctg c

Brasr12 (SEQ ID No.21) : ggacgtggaaacagaagctg

Bras rl11 (SEQ ID No.22) : {ctcaaaccgaaagatgcag Bnapus start rev (SEQ ID No.23) ggttgaagcacaatctctgaagcticcatgg

Genome walker 1 (SEQ ID No.24) gatcttgggtcattttaatggpcctictaac with the AP1 primer

Genome walker 2 (SEQ ID No.25) aaataaacccattaaccactaatgaaaaagggat with the AP2 primer

CaMV343 (SEQ ID No.26) ocggagctogagactiticaacasgeg

CaMV46C (SEQ ID No.27) atcccgggaagcatgegaaggatagigggattgtg

BnGUSXma (SEQ ID No.28) cgeecegggattgaatttbaaage

FMV enhancer (SEQ ID No.29) tctagagcagetggetigtegggaccagacaaaaaaggaatggtecagaatigttaggegeacctaccaaaageatetttgectttatt 3 geaaagataaagcagattcctctagtacaagtggggaacaaaataacgtggaaaagagetgtectgacageecactcactaatgegta tgacgaacgcagtgacgaccacaaaagagetc

CaMV35S enhancer (SEQ ID No.30) tgagacttttcaacaaagggtaatatccggaaacctccteggaticcattgcecagcetatetgteactttatigtgaagatagtggaaaag gaaggtggctcctacaaatgccatcattgegataaaggaaaggccatcgttgaagatgectetgeegacagtggteccaaagatgga cccccacccacgaggagceatcgtggaaaaagaagacgttccaaccacgtcticaaagcaagtggattgatgtgatatctecactgacg taagggatgacgcacaatcccactatccttcgecaagacccttc

Soyabean genomic DNA encoding an EPSPS (SEQ ID No. 31) aaaaaataccttttagtaaaataagagcgtragatcaatcagacgttttctcttigggacttctcaticttaattgaattgacaataactaaagt gaaactaaggctaaaatcaactcgectagtcaagcetcgtccacaaaaataggtttitgaaagtttaccatgtcagtttcttactaagtaaaa aaggatcatttgtaaggtccaacgccttaaaatgatcaccettcaaagtaaaagaatcacttgtttcacgcataagtaagaactacgtagg tctgatttcctctccaaaggagggtacgtaggagcaaaagecccegcettttgtcgaccttaaaaaataaaaagaaacaaaagttaaggta acacaatttccacaattctagaaataaggttgttgtctttcgagacaaacgtaagaggtgctaataccttcctcaaacgtaaatacaactce cgaacttagaattttcattttgaccggtticcticggttticccgacgttttccacaaataaacgttggtggcgactecgegcatctticcteet ttggaaagcgcacccatgagectcgecctegetegecegegaagggeacgttgegacactaggttaataagaagtttagtcecacatat ctatggacctcttaaggtgattatcaaagtggaagtggtgacctacatgttggeectaccagcettattcgtatatttacccecatcaaccat gtatctcagctgaaacatgctatcaatccaaatgttatcagaggaacatgagctgcatgticaaccagaagtagttctagtcttaatacaa atgtcaaatggcacaagtgagattttgaattictgatgttgtaaaaatctcaggacatgaatactattgggaagcaattattcatacttcace aatccaaactgacccaaaattctcaaatcacatgaaagcaaaaatgcatataacacgaagaataagaagaagaggaactaacctggg gtttcgatgattaaagegttgtigtigatgatgaaaacgatgattatggagagaaatigiigtigaatggigaaatigttatagaaagagaa cgaagatagagaaaaagatatatagatttticaaggctcaaaccctaaaatcaccatgagagagaacaaagattgagaaacctacaac cactatgagagagaatgagcagaacagaagcgtgagatagagaacgagagttaaggtgcgagaggacacgaagaacaaaaggtg tgagaganagaacaaaggagcetacggtgtgagatgagagaatitganatictiaccatitaggtggaatticaattctacaatitatict attaaaattattttaaaaaatgatgtcattitaaaticttiaaaatctcatatccaacaactgaattatgatagaggtatttcaaaticacttaaaa aaattatcttatttaaataccccatccaaacatagcgaaatgticatgagaaggatcaagtggtttggaaacatagtactaatggtotttata cagttcatggaatcctigatagataatttaaaggttgctggaaatiggatgaaggtgtggagattaaataticticcaaaaataaagegtttt atttggagagtgttgtgtggtigictccectgtaggcaaaageticgatgtaaaggagttcaatgtccaataacctatgctitctateccteg attattgaaaatgaatgacacattttatttggttgaaatcaagaaataagcatgtggcaagcaacgggtatttgacaaticatagaacaaaa ggtgaatgcagcaaaagaattaatgaactcctittcgatctacttggatcactacatggagatattatcaacaaatttgatgttactttatgg agcagttggaattcttggaatgacaagatatgaaatgaacataccaaccctectettgttictgtttcggtttctatgcagtatittgttgaatg gcaaagtgcaaggtaatatgctectcaacatcaattaacaaatgttcatgacatctettaccagctceaacttggggacgtttgacaaaca ccaccgtcaagittecttaaatgeaacattaatgtigeteatiicaaggagpagaatagtittggtetcggcatgatactccatcaaggaag attcgtcaaagctcactcacgttticgacatgggtcgacatgggttacctgacccaaaggetgaggcttaggettgggtttocttcaagta ttgatctgggcccagactattggtttacataatatcattittgaaaacctaacaictaaaactcaaggtigtttagaggtgegecattccaaa ataagattatcctatttgtgcatgaatgcgaccaactatctectgtttcageattataaagtataaacaacaaactictttaatcaagggacta aaagatattggacatacaagctaaaagtgatagaatttgagaaaacaaatattgacaacaatattcaagaggacactaaaacataattct caaattitttttgtttatttaaaataaagtggttcattaggtagctcttgaaaaaaaaaagtgattaacatgctagtacatgttaaaaaaagtga ataatattctattataagtaaagaggaataatttatcgatgtctcatttttgagatagttcaccgaagccaatttttttacttttttctcttcaatca attttattttgttaatagttgtcattgtggatggattataataattitgaaatgattiaaaatgagatatatattaataaatttaattaattcataaata tettactaaatataaatticatggtatactcaggacggitatancggaaatcaaataaataataaaatagaataatatiaattigeagtaaaa agaataatattaatttattctgtttacactatgtataacgaaattaaatatattcatttaatatgattitattttictitaatitaaaaacatgaattattt gtttcttattttattaccatttigttcacttctcaattaataaaataaaaatatattctacaattatagtaaaaaggtttaattitatataatgttagca tacagatttttctctattaactaattaattaaaaattatccttatittaaggaaattaaaaattatcatatatatataagttttaaattaattatcttata tatgtaccaaaaagttttaaagcaattattataaaaattaataaatttatcatataaaataatttataattaaattitaaattatcaattcattaaatt aaattatttaaaatititgaatgataatataataattttatectctactaagteccaacgtitcetatittattccactittageaataaatittgtcat aaacacttataacaaaaaaagtaagtaaaaaataaaaaaaagtitttcaataaagtataaactaatttgtataaacttttagaaaaaataaag ttatacattgataatataaattttttacataattatccgatcaactcattatatatgataaatttattgatittttaaaataattatcttaaaataattta aacaatgatttgcaattagatgataatataaaattattttacacactacatgtattaaactcaaacttttatatattagtttttctaaaaactaatttt taactcaaaaaaaatgttacttataattttcttatcticttttittataagtattttttaagaaatttattgaaacatgaccatgcttgggtcaataat actactctcttagacaccaaacaacccttcccaaactataatctaatccaaaagecatcattcattttccttggtaggtaaagttccaagace ttcaccaactttttcactcaattgttttggtgtaagcaattcgacatgtgttagtgttagttggcaaccaaaaatecctttatgtgactcaatee aacaaccactcacaccaccaaccccceataaccatttctcacaataccettcatttacacattatcatcaccaaaaataaataaaaaaaace tctcatitcagagagagagagagagacttcacagaccaaagtgcagagaacaacdnagticacaactttaaggaaaatigaaatggeo cangigagcagagtgeacaatctigetearageactcaaatttitggecaticticcaactocaacaaactcanatoggtgaatteggtite attgaggccacgcctttgggggpcctcaaaatctcgeatcecgatgeataaaaatggaagcettiatgggaaattitaatgtggpoaagg gaaattccggegtgttiaaggtttctgcatcggtegecgecgeagagaagecgteaacgtegeeggagategtgttggaacecatcaa agacttctcgggtaccatcacattgccagggtecaagtcetetgtccaategaattttgettctigetgetetctetgaggtgaagtttatttatt tatttatttgttigtttgtigttgggtotgpgaataggagtttgatgtgtagagtggattitgaatatttgattttitittgtattatictgtpaaaatg aagcatcatgtcccatgaaagaaatggacacgaaattaagtggcttatgatgtgaaatgaggatagaaatgtgtgtagggttitttaatgg " gtagcaataagcatattcaatatctggattgatttggacgtttctgtataaaggagtatgctageaatgtgttaatgtatggettgetaaaata ctcctaaaaatcaagtgggagtagtatacatatctacagcaaatgtattaggtgaggeatttggettctetattgtaaggaacaaataatat cagttaatgtgaaaatcaatggttgataticcaatacattcatgatgtgttatttatatgtacctaatattgactgttgtttttctccgcaatgace aagattatttattttatcctctaaagtgactaattgagttgcttactttagagaagttggacceattaggtgagagegtggggggaactaatc ttgaatatacaatctgagtcttgattatccaagtatggttgtatgaacaatgttagcetctagaagataaacectcccccaaaacacaaatta gaatgacatttcaagttccatgtatgtcactttcattctattatttttacaacttttagttacttaacagatgtcttgttcagcataaattataatttat tctgttittttttagggaacaactgtigtagacaacttgtigtatagtgaggatattcattacatgettggtgcattaaggacccttggactge gtgtggaagatgacaaaacaaccaaacaagcaatigttgaaggetgtgggggattgtiicecactagtaaggaatctaaagatgaaate aatttattccttggaaatgetggtactgcaatgegtectttgacageagetgtggttgctgcaggtggaaatgeaaggtetgttttttttittit gttcagcataatcttigaattgttceicgtataactaatcacaacagagtacgtgticticttcctgttataatctaaaaatctcatccagattag tcatcctticticttaaaaggaaccittaattatcaatgtatttatttaatatitaaattagctigtcaaagtctageatatacatatittgattatatt ctgagaaatgcacctgagggtgttcetcatgatctacttcaacctctgttattattagatittctatcatgattactggtitgagictctaagtag accatcttgatgitcaaaatatttcagctacgtacttgatggggtgcccegaatgagagagaggecaattggggatttggtigetggtett aagcaacttggtgcagatgttgatigctitctiggeacaaactgtccacctgttegtgtaaatgggaagggaggacticctggeggaaag gtatggtitggatttcatttagaataaggtggagtaactttcctggatcaaaattctaatttaagaagecteectgttticetcictitagaataa gactaagggtaggtttaggagttoggitttggagagaaatggaagggagagcaattttttictictictaataaatatictttaatitgataca tttittaagtaaaagaatataaagatagattagcataacttaatgttttaatcttitatttatttitataaatattatatacctgtctatttaaaaatca aatatttgtcctecatteccttteccticaaaacctcagttceaaatatacegtagttgaattatattitggaaggectattggttggagactttt ccttttcagagattatccetcacctitattatagectttetatttttaaacticatatagacgcceattettgttttaaaaaacactaagttttctitta gttataccttccectecttattctctecaaagtaaatattgtageaagtgitggttgatecattgigaatcttattatectatttaacatgeaggt gaaactgtctggatcagttagcagtcaatacttgactgcetttgettatggeagetcectitagetctiggtgatgtggaaattgagatigttgat aaactgatttctgttccatatgttgaaatgactctgaagitgatggagegttttggagttictgtggaacacagtggtaattgggataggttc ttggtccatggaggtcaaaagtacaagtaggtitctatgitttagtgttacatcacttitagtatccaaaatgcaatgaaattaaaacteatgtt tectattaggtetectggeaatgcetittgttgaaggtgatgcettcaagtgecagttatitactagetggtgeageaattactggtgggactat ’ cactgttaatggctgtggeacaageagtttacaggtattcatgaatgacactatcttctattatcttttatittatagettacactatcattectaa ttcaacccccttettttctetttccecteactcecaaaatagagettateattgtatecttaatagetettttatgtgetgtitcatetettgageag attctacatgattatcctttttagtgaacttttitgtcttitaaataattgatatcatcatttgaacttgcacatcatctctatecttecteattttattat atttcattaagagtgataaaattacattgicaagtaaagcaagttagcgtatcagataatgatgettcgatigeagaattggtgaaagettg cacaattcattagcttagtgacaattgtgatgtagatagccataatcttccatgeaacttattatgetttttgtctaaaacttcttttgeacttaaa catgaattagagagttaggatgaacaatagtaacagacacaaagcttatttctagaccacccagiggtgaagacgaagcageatgagt gagattaatggcagcatctgattgaagcttetttiggtattattggagatgaaatcttgagccaaattagggcttttgectectcaatageca ttggttcaaaattgctttcaataaaatgattacagaatcaaattcttaagaaagaccticaagaacaacatcaagatgtttcctgtgcaaaac aggctcacctacaaaagagtgtctacaageacctttacacttgcaaaaaattccttaactgaacaattgecaagagtcatgttgcaaactt gagattggagttgattagattiggtgotgtetgagatictggaaatgagcatgaagttttttgcaaagctcataaaatgaatgcagecaaga atcctagataggattgaatttgagagagaggctigaagtcaagataaccgcaactgatettgetgticecatgetgeataggaciegtig attctaccaagataacaatcttctgtggtgagaatatgagtgggaattgicaggcaacaaagaaaatgaaggctatgagectttgttaag gtgcagagagaaaacagaaaatgaagaacttgtgtattgaaggaattgaaaagccaattacaattgtgttgcagagagatatttatagtt ctgaagtgtataactaactaaacagaatgctaccaacctagaggeagttgagaattgcteccttattacaatactctcacagecttgatgat aggcttgatttgctgeccaccgaagaagaacattattgttggagagtttticagtgattgcatcagagaaagttacaagtgtgattggagat gaaggacttgcggtegtcgaaggttaagtgttaagtggtggaatgtgtatcggaggtogtigectageecaagaagetggttgeagty gaagcggatgcggcagaagcecatgggttcagatcagaactatgttctagataccatattagggttagetttcaagagaaaacttatgaa actgaactgtaaactgttgtattattgattagctgatctagtagtgatggaagcttgcttgegaagettetatggaggetggateattgaget } tcaatgaggtccticaatggtgatttttcaccatggagatgcagcggaagataaatgaagaggtgagaggaggegtcatccactagga aataaactatggaagaaggagcttcaccaccaagagagtgtcttggataagaagcttagagaggaagcttcaatggaggaatagaaa gagagagggggaacaaaaaattgaaggaggaaaagagggagagaagttpaactitgaagtgtgtctcacaagactcatteattaaag ttacaacaagtgttacacatgcttctatttatagtctaggtaacttccttgagaagctagaacttaactacacacacctctctaataactaaga taacctccttgagaaatttccttgagaagettcettaagaagattcctagagaagcetaaagcettagttacacacacctctctaataactaagt tcacctcctigagatgagaagctagagecttagetacacacacccttataatagetaaactcactctattccaaaatacatgaaaatacaa aaaagttcctactacaaagattactcaaaatgtcctgaaatacaagactaaaactctatactactagaatggtcaaaatacaaggtccaaa agaaggaaaaacctattctaatatttacaaagagagtggacccaaccttagtccatgggetcagaaatctacectgaggticatgggaat cctagggtctictitagtagctctagtccaattitcttggagicttctatccaatatecttgggggtaggattgeatcatgtagtacaagagag gggaatatatatacagttgtaagtigtaactacctaatcaaacccaactgactcaccatacacagaaaaacaatgtacaaaggataatag aaaaactgaaactgagatatactcattacatagaagaattacatgatgaatctgaaaattttaattgggaaactgaggacaataacaagg ctttcagagttcatittgacaataggtaaattatggacttcaacttagacctcaagggtatgettgggagtegggtittagaggaaaagge panggaggganattititaatictagtaaatattcictatittgatiaatttttaaaatasaacasataaactiatagatiageaticactiaatgt cctgatcttttatttgtttcatgaagttittiatagccttictgttictgttaaaagaaattggagggtgticataatctatatgcccatatatatgta ttgtectgttgtetgtgtitetgtttictitetttagtgtetegectttecttaattccttatcaacaccttgtitatittigaaaacttaaatgtecteat tttttttacctgtactataactttccaaacaaatagtagaaaatgtttcaaataticcccagaactgtttcagtgaacaaagttcaagecagaa aaaaagcaagcagaggctaaagaagtatatcttattgtgaagagtaatcteaattggttaattatcgaattgtatcattttacaatagaaaat tagaagtgggttgattagtttatacgaacaattatttaaatagggttgatggtgtggttaattactgatcatatgtiaagactatgagtcgatg accagcctcagtgcagtcattttaagttceattattttitaattgtgcttatgtttaactttgtcctictittaaagggagatgtaaaatttgetgaa gttcttgaaaagatgggagctaaggttacatggtcagagaacagtgteactgtttctggaccaccacgagatttitctggtcgaaaagtet tgcgaggcattgatgtcaatatgaacaagatgcecagatgttgecatgacactigetgttgttgeactatttgetaatggteccactgetata agagatggtatggtitagctgtitgtitttgctcaagagctigttticacatatitgtggtcaagageggtitagetgtttttttttttaaatigtgg ttaatgaaattattataattatactaatattgaaattggatcactaaccatgtgaaatgcttgaatttttagettgaaaacttctitigtggatgatt tttcttttatctatgtagtgtggggcatctatgtigttectttaagetitgtgtcatagtigtacaacctggtetgtgggetggtecagttettact catgactgtcttttgcagcaaactggttaaacttgggtgacctgttgacccacccagattggectgttcttitttaaataaaactccaaaagg ctacttataagatttcaacatgatacttgaatgaccacccttactttaaaggtcatiatgecatcagaccectigatictetgttcagttatgtic : ttattcttattattttttaatttatattattatccaacgatctgatctttgtacatgatgetggacaatcatcaaagetagtttggttacatcatataa taccttttttttcataaattattttttcccataatatatttatatgtatttttitaatacaatattctggggaaatttittttttctgttttctittitctggtitg aatactatttcaatgactgggccttattattttctggtttgggttatacaactgtectttgatgtacttitgaatgeticaatagtatttttcataate atggaaggcactagagtgcagtgcatattgcacaaggttctitaatggcatctigaatitgitagaacatggagttatgatatacaaccatt cctatgtcttcatctaatagctaaagcettitggegtagttggttaacatggtattggaatcttattttaaaggtccatcttattcgcaagtacaa ggcaggtggacctgegcattattcacgtgecaggetcaaagggattitgtatgagpgggaatttttggaatataatatatagaatcattca tgtggttcacctatcatgtgtcaactcaagttittgtcctagttgtattattgeagtgtctaaactaggeatgatettetgtggaaggaaatita acctaaggaacttgaatgcttcttgtictgagatctttattitttttctccaatctttitaatacttgaaaggttttagtigtatctataaagggtge aganttaggggptcagcittictgtigtaagegteaattaagtgeatittatgttgticeotattttatacatitpaactatcaaccatateattta gcaaacttctitgttgctcagattcecatttatictigtticetctatittttagtggcaagtiggagagitaaagagactgagaggatgatage aatctgcacagaactcagaaaggtcttgctaattcetitatggtttctatattactggactttttacatctcactgacctactactgtcttggtat ttcagctaggagcaacagttgaagaaggtcctgattactgtgtgattactccacctgagaaattgaatgtcacagctatagacacatatga tgaccacagaatggccatggcattetetcttgetgetigtggggatgttceagtaaccatcaaggatectggttgeaccaggaagacatt tcctgactactttgaagtccttgagaggttaacaaageactaagceattttgtacattgagtagggaagagagagagatatatataaatact cacaaagcagtgagtatatggcttgcttttgttictaaacattectttataaggacttgagataattigtattgtitaaaagagcecattggttct gitgtatcaaagtaatttaattttcagtaccgactiggetctactcatatgtggtggtatacattgeatettigeatttgaticeatatctattgg gatgggaccatacattttttgtttattatttaagtcaaacatatcagataatatgtggtgaccagaaaagtgictagcaatcaaatgggtetgt gattgcatgtttgagttcaggacatttattaatgagtgacagaattitaaaaagcetcgecaataggagtigecacatetgategagtettetg taaacactaactgtaacttgagtttgataatcagattccccccgttggtaggtaatatgtaaatttcactatagattcttactgaggatgatgg tcttgacttcgaagtggtgagtgtaaticictaatctaaactttatatatatataaaaaaagaatgttaaaaacttgagtgacatacagcaaat agcaatgaaagcatgaccatggectiggggggccaaatggecatgtaccacttttccacctacttgagagecatggtectgaatgag gt ccttttgtttcattttttitacaataaagaaagttcatattctiggcaatagcaaggcaaatcatttgtggaagtcacatgaaattcaccatagg cttcattgttcaaatectttagtcactaaggcagggcectatgtaagaattttgactactcttgtaaatgetgtgeggtaaagactacgggaa aatataaattattgcatatctagaggtgaggttcattictccgatccatttctccaagtaataaaaatatatataaattattaatatggtatgata oo -43 - tggttatttgtcctttaaatatgcgatiataggttcaatcttiggttaatctatcaaatgcatctcaatatttigagagaatagtitttagetctiga ctgagagatactttgagttaaaaaaatgtatttataaactattgtctattgaatttttattttttttgtaacaccacatgtgagtattttactaaatcc atgttacaatgtactgaatgttttacaatacagtctggtitgataataaaatatgcacaaagtecagettatgtaactcittcaaticatggaaa atgatgatatgcgaattgaaagaaagaaaaccataatgtaagtgtattttttttttcttictctictitaatattactcaatatcagatigcacatg ggaagggtactggctcatgtgggatattaatttttatcccttacctaaaaagagagaaagagaaaataactatttaaaaagagtaccacc accacctttttcgcttttaagttttgttctgttttcactactctttcatgegttgtttgttgacticcgatagtgacgaatatgataatgattitacgt tgagaaaaaaaatgtgccatgtaaattccagagattgaaattitagcticaaattaatatttattttattatcttticaaattggttgeatgtgaa agaatttgaagttcttcaacaaggaaataaacacttcaatgctcaatccttagagtcagtcactagatcccaaaagaatgtgatgtitacac acattagtatatatatatatataaacacagcttatattatattaatgagtgatgecgegaggacggtggtgacactacatggccaaaacaag aaatgtaatttaatttitttttctitaagtattactctatccttgaatattagtcttaaatcticaaagaccttgcgaacgaagcaatcttgtectga tectgtgattgttctacactagtecttacgtgtacctaageacatgatactttgetgecctaacataaattgtaccataaggattcttgggga gatgcttttgecttcattttcaagtttgtttacactttcaagtcgttttttcaatgcattctetttccetitctgggaceccttgtetttaacacgege geacacaaaaactagtagacaataattagtactactigggitecattaaatigtaactacatatacatgtgtititttttottggatcaactge atatacatatgttttatgagtttcattgaatttatatitacacaaacagttattaaaacataatgtagagccttgtcattaacctgatgttaggatt ataatttcatgctttgattttgattgtacgttitttgtttttatigtaaagtgtttattttattaaaatttgtcttggagtgetgtgatctttagggtgea ccgticaaaagagagacgacaaggataatactaatactagtagattccacgcattcaaccctagttagtitagctatgacaaattaageat ggtaagaaaaggggaggagaaaagtaagaatgaaaacatataacaaattgtgattgaacttttccatgacgtaatgaaaacattaatttt aagataagcttcaactcctaagaagagatatgtcaaagaaacttaggattttttctctatttataacggtaaattactcatccttttaaatgatt aattigcettpttpaaticgtigtaaaggganaatcaagangteicticacgggaaagttatatcaaagtateatatactagactteatgget agcttttactttgattataagtaatgcatgcaattaatgggeaaataaattatttgaaaccaactaaagtacaaataattitcctccaaaacct ctcaagttcgcattgaaattaaataaaccaatgcatattaaggcgtaaatctaaaccatgtttgtttcatctigtattgtatatcatagtattaat aaggtactttgaatttagttgttatigaccgttaaatttaggggtgagtigttttactatctcitactcaatigetittattcaacgcaaattctagt aggattttcagcccaaattaaaagaagttttacggtttgaticictacaaacttgaattgagattictaatttcagaaatcaataatigeggtet taattaactctataatcaaaccttttaacccaatcttttictcaattctctgaattaagacaatcaaaatttaaactcacacgaatctcacacge cttcccacggtagagaaatatagggagtcccttaatagecaaaagectcaaaattcagaaaatctcatccattgeatttgeacattcaacaa accacccattattatgttccettaataaatctcacacttaaaaaccetectcacceataattaacccaaaaggaagiticetccacacaaaa aatatccttaaacaaagagcctctataaatctattttaaaaaaacccccaaatttaagga

Soyabean genomic DNA encoding an EPSPS (SEQ ID No. 32) aaaagtctgaatgaagtgaagttgtigtgttagggpgatgetgaatitgatittaatttaatttaaataaattaccigigtaaaggatittigta ccgccttttaatcacaaattgtegtgtategaaagtttgtigaattttatagtaactatctiggaggttatacctagtaggatticigattagtta accatgtaaatttttttaatgggtitgtotttgtittaactgatgttgtttitgatatgtacgtggtaagtgtgatgagtitgtgeatatctigatca aagactgaagtgaagttgttgtgtitgggegttgactctittaggaagaggatttgagggaatticgecaatgggggageagaactce gggacaccctgagaattttgagactccgggaattgaagttacaacaggtttgatatgagttagagttigtataatagaatagtaattcttttt attttttattittattgtitatttatccattattgctatttttgtaggtectettggteaggggattgecaatgetgtiggtttggeccttgeagagaa geacttggetgcaagatacaacaagectgacaatgagattgttgaccattacacgtaaaaataactaaatcatacacaacttgcaagact ttagttgttggtetittgctaatggegttigttitatgcaggtatgetattetgggtgatggitgtcaaatggagggaattgeaaatgaageat getcacttgetggecactggggactggggaagetgatageattttatgatgacaatcatattictattgatggtaacacagagattgegtt caccgagagtgttgatagtegttitgagggacttgggtggcatgttattigggtaaagaatggaaataatggetatgatgatattegiget gecattaaggaagcaaaagcetgtcaaagacaaacccacattaatcaaggttagtttactaattgtggeaatgatatgeatagatttetgge tgtagttaccataacaatcataatcigteatgatttatagggattctittanactaaggttataaacatgatatgttactaaagactgcattge attgtagtacctcatttgagaaactggaagttataggtgggaaatcaaaatagtaaattatgggtcagittattaagtgtagetggtitgtctt ttgctaactctatcatttcacaggtcacaacaaccattggttatggttctcetaacaaggetaactectacagtgtgeatggaagtgeactg ggtoccaaagaagttgatgccaccaggeagaacciiggatggteacatgagecattccacgtgectgaggatgteaaaaagtatggat gatgggtttagagatticttttttcetgtgacactgetgatgtitataatgatactgaataagaattgettgtctgteccecaggeattggagte gecacacccctgagggtgctgeacttgaagetgagtggaatgetaagtttgetgagtatgaaaagaaatacaaggaggaageigeag aattgaaatctattatcaatggtgaattcectgetggitgggagaaageacttecggtgagtaaattctaaactcacaggtttiicttacatgt ttgtaactittcaaggttiggattacatactatccaaagttgatcatgatttcagttigattiggtagtatggggcticaaaaagttaticcaaat attaaaacctggcttccaatttgatticagacatacactccagagagceccageggatgecaccagaaacctgtctcaaacaaaccttaat gecettgeaaaggttettceeggtetgettggtggeagtgeagatettgettcticcaacatgacctigetcaaaatgticggggacticea anaggatactccageagagegtaatgtiagattcggtgtiagagaacacggaatgggagctatetgeaacggcatigetcticacagee ctggactgattccatattgtgcaaccttcttigtaticactgactacatgagaggtgccataaggetttctgegetgtetgaggetggggtta tttatgtcatgacccatgattcaataggacttggagaagatgggecaaccecaccageetatigageacctageaageticegggeaaty ccaaacattttgatgcttcgtectgecgacggtaacsgaaacagecsgageatacaaagtggeegtgetcaacaggaaagagacect ccattcttgeectatccaggeaaaaactgecccagettcecggaacttheattgaaggagttpaaaagggtggttacaccatticggpa canctccactggcaacaagectgatgtoatitigateggaactggticggaattggaaategetgecaaagetgetgatgacctaagga aggaagggaaggctgttagagtigtticectigtitettggggaactttttgatgageaatcagaagestacaaggagagtgtittccetg ctgetgtttcagecagagttageatigaggeaggatcaacatitgggtgggagaanatigtiggageaaagggaaaagcaataggeat tgatcgttitggagctagtgetccagetggaagaatatacaaagaatttggtatcactaaggaagetgttgttgetgeagetaaagagett atctagaacttttgattitittitgcctictggtittggttgagageattccatgtcatgaataagaaaaaggtiaaatatecticgattgg gaat ttgggatictaagtgaagaagcaacatagatcaaagaattitgtgaacttgtaataactattigacaatttagititgcactgecacatggtta aattcaatgtttgatcatatcaaccatagatgctagtitatactacttgtataattigtttcacttgeagattcactcttageatitgagtgtttgg atggccgtgttttgttcattaagaaatgtigacatggatagtitgttgcatggtaaattggtgatiaatacctititaagettcititggeaagtt gttaaaaagtgttttgitttaatctctagttaatctaaaaatgectacttattitatittgactttcaaaacttgtctatatgecgagtataaaaaaa acttgtctatataagttccttatggaaaaaggacctacaaaataatttaaaaatgctgaatttgttaggaagtttgacaacttiagacattaat aattgtttttttticatatatataattgactttcaaaacttgtctatatattataaattcgttatggaaagggegaccacacgtaaaacgtaacat gccaatctctccctagtgaactgttattcteattcagttttigtaagttcaccticaaattticaatittttitttgacaaaaatatctttgatggaac acgttaggggtgtaaattcaccaticatcatiicaticattatacacaatagtetticataatccaatganaactigtitttgttgttatitititctg aaaaatctitataaaataaataaaaacatitttitgttataaatttcagttgaaatacataaccattaattctacagagtgttaatgttgatgtaaa ataaaaaaatattggatatcaaacttaatgaacagaacaaaaattacaaaattgtacaatttaaatgataaaaaaccaaattcacaaaaata aaaattaaggacgaaatttgagaaatgataattaaaaacgattaaaaatataattaaactaaaatttattatgtaatictitaatatatatatata tatatatatatatatatatatatatatatatataataaaagttttacattataattttgaaatgaagtatttgataaacgaacaacccacccttggg gitggtgagagtgaaacggagaacagtgtctcecteacttggtettctgagtegagtectattcatcaccaaccecactegtcaaaattgtt gtatgctatgtaaccattttgtittttaataaataaaagtgttitgtictgctatgcactccecatcaaataccatttacttttttittgtctictatca atttctatttagttcctagttgctacaacttccagetggtgaaaaatagtcaacagagactacaatattctaataaaatagaataacaaaatc aaatatattcatttaatatgattttatttitatttaatttaaaacatgaattatttgtitcttatttaattaccgtttcgttcactictcaattaataaaata aaanattictacaatiatagaaaaagtttagtittgtagattgtiaacataaagatttticctattaactaattaattaaaagtcatctiatatataa gitttaaagtaattatcttatatatgtacccaaaagttttaaagcaattattataaaaaagtaanattitatcatatacaataatctataattacat gaaagtataatttitaaattattaatacgttaaaattattitttiaaaatttgaatgatcatatagtaattitattitataccaagtcccaacatttcet attttattccacttttaccaataaatttcctcataaacacttataagaaaaaaagtaagtaaagaataaaataagcttttctataaactataaac aaatttgtataaactticttatattagtttttctgaaaactaattitaaattatacataaattgaatttactgataatttittatttictttttgtataagtg ttttttaaganattigticaaacatatttitatgacatgtcaatgcttgagagatataaggtgagtiaaatcataaatgattaaagaaaaataaa agaagaaaaagataattaatttaattttttattaacattctaacaaattaacattatataaataaaaataatatticaataatiggatcaataatac tattgttcttaaacaccaaaccaaccttcctaaagtcctaatctaatccaaaagccateatteattitectiggtaggtaaagticcaaaacct ttaccaaccttttcactcaattattttggtgtaagcaattcgacatgtgttagtgttagttggcaaccaaaaacccetttatgtgactcactcaa tccaacaacctctcacaccaccaacceccccataactcataaggecaaaaccatttctcacaaaaccettcattacacacattattatcatt atcacacacacaaaaaacctctcatttcaaagagagagagagatticacagaccaaattgcagaggacgacaaagttcacaacttcaa ggaaaatcgaaatggceccaagtgageagagtgeacaatettgetcaaageactcaaattity ggycaticttccaayyccaacaaacy caaatcggygaaticggtttcattgaggccacgectttggggkscetcaaaatetegeateyygrtgmayaaaamtggaageyttat gggaaattitaatgyggggaagggaaaticcggortgtttaaggttictgeatesgicgecgeegecgeagagaageegtcaacgteg ccggagatcgtgttggaacceatcaaagacttotegggtaccatcacatigecagggteyaagtetetgiceaategaattitgettettg ctgctctetctgaggtaaagtttatitatitatitatttctgtatccaaaaatgtaaattgttagttgttaatitttgttageagtgagagtegaact acttggetictitctiagteatccaaccaacctiatatetceaaaatiiatitatiggtittitttggggtiatgtegttaggaataggagtitgatg cgtggagtggattitgaatatttgattitttittttitgtattattcagtgaaaatgaagcatctigicccatgaaagaaatggacacgaaatta agtggcgtatgatttagaatgatgatagaaatgtgtataggtggtittaatgtgiagcaataageatattcaatatctggatigatitggacg “ ttictgtataaaggagtatgctagcaatgtgttaataatgtctigttaaaagtatggatggctaaaataatcataaaaatcgagtgggagta gtatacatatctacaggaaatgtattaggtgaggcatttggettctetattgcgagtaaggaacaagtaatctcagttaatgtgaaaatcaa ) tggttgatattccaatacattcatgatgtgttatttacgggaacgcaatattgactgttgattttatctgcagetgagattatatactatatectt ccaaagaaatctttgactcttgattatccaagtatggttgtattaccaattitagctctagaagataatcectcceccaaaacacaaattaga atggtgctecaagttcegtgttactttcatictattatttttataacttttaattatitaatagatgtcttgttiggcataaactataatitattetgttit tttttattcttatttagggaacaactgtigtagacaactigytgtayagygaggatattcattacatgettggtgcattaaggacccttggact gegtgtggaagay gacmaaacaaccaaacaagceaattgtkgaaggetgtgggggattgtttcccactaktaargaatctaaagatga aatcaatttattccttggaaatgctggtactgeratgegtectttgacageagetgtrgtigetgcaggtggaaatgcaaggtetgttttitgt tttgtitgttcatcatgatctctgaattgttcetegtataactaatcacatcagactatgtgticticctccatectgttataatctaaaaatctcat ccagattagtcatccttctitaaatgaacctttaattatatctatgtatttatttaacatgtaaattagcttgtcaagtcaaagtctagcatataga tatactgattacactctgaggaatgcacctgagggtcttaatcatgatctatticaacctigecactttettctittattattagatcacctatcat gattactggtttgagtcictaaatagaccatcttgatgttcaaaatatttcagetacgtacttgatggrgtgececgaatgagagagaggee aattggggatttggtigctggtcttaagcarctyggtgcagatgttgattgetticttggeacaaactgtccacctgitegtgtaaatg gga agggaggacttcctggeggaaaggtatggtttggatticcattagaataaggtggactaactttcctggagceaaaattctadtttataceet etttccocctetttagaataagacactaagggtatgtitaggagttggetittegegaganagggaagggagggcaattitititctaataa atattctttaatttgataaattitttaaacgaaggaatatgaagatagattagcataacttaatgttttaatcttttatttatttttataaatattatata cctctatttaaadacaagatatttttcctecattecctttcectttaaaacctcagticcaaatataccgtacttgaattatattttggaaggtgta ttggttggagacctttcctittcagaggttatceeteacctitattatagectttctactctettaatgagtteatigigeattgagteattgaactt cctetganaaganattgtitactitciitattigtiacetacatccttaticetgtittanaaaatactangtitictittagttatgooticecctco ttattctctccaaagaaaatataatagcgaatgtiggtttatccattgtgaatcttattatcctatttcacatgcaggtgaaactgtctggatea gttagcagtcaatacytractgctttgettatggeagetcctttagetetiggygatgtggaaattgagattgttgataaactgatttetgtic catatgttganatgactctgaagttgatggagegttitggagttictgtggaacacagiggtaattgggatargticttggtccatggaggt caaaagtacaagtaggtttctatgttttagcattacatcacttittagtatccaaaatgcaatgaaatcaaaactcatgttitctatcaggtete ctggcaatgcttitgttgaaggtgatgcticaagtgecagttayttmetagetggtgeagearttactggtgggactatcactgttaatgg ’ ctgtggeacaageagtttacaggtattcatgcttgacactattttctattatcttttattitatggtetatactgtatcattectaattcaacceect tetttictetttccccteacttccanaaaaatagagcttatcattgtattcttaatagetctigtatgtcctttttcgtetctigageagattctace gtgattatcctittiagtaaactittititigtgtgtciittaaataatigatatcatcatatgaattcacacatcatctetatcecticeteattttatta tatttcattaacagtgataaagataaaaataaattgtcaagtaaagcaagttagcatgicagataatgatgcttcaattgeaaaattggtgaa agctigcacagtacattagetttggtgacaattgtgatgtagatagceataaccteccatgeaacttattatgtigitigettaaacttcttttg cacttaaacacggattagagagagtgaggatgaacaataataacagacacaaagcettagttttataccacccggeacceagtggtgaa oo -47 - gaccaagcagtatgagtgagatcaatggcageatctgattgaagcttettgtggtatttttggagatgaaatccgaggegaattagggea tctggcteaacaatagecattggticanactigettttaatanaatigatiacagaatcaaatictigaggaagecticaagaactacateat gatgticeetgtgeanaacaggttcacegacaaaagagaacatctacaagticetitacacatgecaaaaatiectcaactgaacaatig ccaagagtcatgttgegaacttcaggtiggagtigacgaaatttggtgcatgtatgatictggaaatgageatgaagtttiticctaagete ataaaagtgaatgcagccaagaaccctagataggattgaatcggagagaggcttgaagecaagataacageaactgatcttgetgtte ccatgetgegtaggactcattgattetaccaagatcacaatettctgtggtgagaaaatgagggtgaattgtcaaccaataaagaaaatg oteaaggctgagtctigatgatagectigattigetipogetgaagangaacgtiattgtigtagagtitctagtgattgtatgagagtaa gttacaggtgcgattggagatgacggacttgtggtgggaggaggataagtgttaagtggtogaatgegtatcagaggtggtigeeca occasagaagetggttgeggteeaggagatagtegtecagtggaageeatgggtitigatgctittgagaganaacatacgaaactg aactgtaaacttttgtattattgattagctgatttggtagtacaagagaggaatatatatacagttttaatgtaactacctaaccaaacatgag gaactctccatacacagaaagacgtatacaaaggataacagacaaacagaaacttagatatactcatacagagaagaattacaggatg aatctgagaattttaattgggaaactgaggaaaatagcaagggtitcagaaticattitgacgataggcaaatcatggacttaacttagac ctcaagggtacgettgggagtgggggtttitagaggganaagggaaggagggcaaacttttaattcctaataaatattctetttitigatitt tttttaaatanaacaaataaacttatagattagcatacacttaatgtcctaatcttttatttatttgcatgagtttitttcttttatattctitcigtiict gttttctttcttcagtgtctettgtctttecttaattcettatcaatacctigtttatitttgaaaacttaattitccteattitittaacttataggetata ctatagtatgtataactattcaaataaatagtagaaaatgtttcaaatattcccecagaactgtttcagtgaacaaagticaagecagaaaaa agaagtatatcttcttgtgaagagtagtctcaagtggitaattgicaaattgtatcattttagaatacaaaattagaagtggitigattagtttat acgaacgattatttaaatagggttgatgatgtggttaattactgatcatatgtgaagactgtgagtegatgaccageecagtgeagtcatit taaattccattattttitaatttgtgcttatgttaaactttgtccttctttcaaagggagatgtaaaatttgctgaagtictigaaaagatgggage taaggttacatggtcagagaacagtgtcacygttwetggacerecacragattytictggtcraaaagtcttgeraggeatigatgtcaat atgaacaagatgccagatgttgccatgacwettgeygttgtygeactattigetaatggtemmactreyatmagagatggtatggtit agctgtitgtttgtgticaagagctigttttaacaaattgttitttttaattatggttaatgaaattattataattacactaatatigaaatiggatca ctaaccatgtgaaatgcttgaatititagctigaaaacttetittgiggacaatititctittatctatggattgtgggecatetatgtigiteettt aagcttcgtacaacctggtctgtgggctggtecagiccticttactcatgacagtcttttgeagtaaactggtiaaactigggtgaccigttg acccacccagattggectgttcttittaaataaaacttggctacttataagatttcaacatgatacttgaatgatcaccettactctaaaggee attatctgticagttatgttcticticticttattattitiaatttatattatatccaacgatetgatctttgaacatgatgcig gacaatcatcaaag ctagtttggttacatcatataataccttttitttcatatattatttttcccatagtatattittgtgttittitticatacaatattatictgaaaaaaactt gtitcgtttttticctggettgaatgetatitcaatgactgggectiatiatitictggtitaggttatacaactgtectecaattgacttitgaatg cticaatagtittcticttaatcatggaaggcactagagtgcatatigaatatgttagaacatggaaggcttaaatatctttitagtctitgeaat ttaacgtitttttgcttttagtcetigeaaaattataatitittittagtectgactaattatgtttgtttigtittigagggcgagecctggtgeage ggtaaagttgtgeettggtgactigtiggteatgggticgaatccggaaacagectctitgeatatgeaagggtaaggetgegtacaatat cecteccecataccttcgeatagegaagagectetgggeaatggggtagaaaaagaagaatgetttagataacactitittigttactgtt caaagcactatctaaagtgctttgaggactaaacacaaaacaaacataatttgcaaggactgaaaaacaaaaaaataatittgcaagga caaaaaaacaaaaaaaaaaaacaaaattgcaaggaccaaaaatatatttaaaccaacatgaaattatggtataaaaccattcatatgteit catctaatagcttaagettttgggatagttggttaacaatatggtattagagtcttatgatttitaggtggtctttgagticaatccttgetgete ccagttctagttaatttctttttggtccactticaaataaaaagttgaatttaagggtaag gcagetggacctgegeattaatcatgtgicagg ctcaaagggctittgtatggggggcatgtttggaatataatatagaatcattcatgtggtttcacctatcaaggacaactctagtttttgtcat acttgtattattacagtgictaaactagacatgatctttticcggaaggaaatttaacttaaaaggaacttagatgcttctigttctgtgatcttt atttgtttattttticcaatctttttaacaattgaaaggttttagttgtatccaatctttttatacatttggactatctaccatatcatttagcaaacttg titgetgetcagattetectitggactatetaccatateatttagcaaacctgticactgoteagattcteatttattetttgtttectetatttttca gtggcaagttggagagttaaagagactgagaggatgatagcaatctgeacagaactcagaaaggtgagtgtcttgctaattectttatg gtticgatattactggactttttacatctcactgacctactctgtcttggtatttcagctaggagcaacagttgaagaaggtcctgattactgt gtgattactccacctgagaaattgaatgtcacagetatagacacatatgatgaccacagaatggecatggeatictetettgetgetigtg gggatgttccagtaaccatcaaggatcetggttgcaccaggaagacatttceygactactttgaagtecttgagaggttmacaaagea ctaagcattttgtacattgagtaggaagagagagagagataaatactcacaaaacagtgagtatatgeatggcttgcttttgtttcttaaca ttcccttgtaagaacttgagataatttgtattgttggaaagagctattgattctgtigtatcaaagtaatttaatttccagtacagacttggetet attcctcatatgtggtggtgtacattgcatctitgeatttgatcccatttctattgggataggaccataccttttittgtttattattcaagtcaaac ttagcagataatatgtggtgaccagaaaatagtctagctagcaaatagacctgtgattgeatgtitgaattcaggacttcaggacatitaat taatgagtgacaatgttaaaaagctcgccaacaggagttgacacatctgattgagtcttctattaacactaactgtaacttgagtttgattat cagattcctectgttggtaggtaatatgtaaatticactatatatttaccgaggtiggtggtettactigacttigaagaggtgagtgtaattta aacitttatatcasaaanagatigetanaagctigagtggcatgcaacaaatageaatgaaagaatgactatggcectigggaaccaaatg gccacgtaccacttttccaccaacttgagagecctggtcetggatgatgeccctttttttitttcattictttgacaataaagaaagttcttattc ttggcaattgcaagtcgtttgtggaagtcacatgaaattcaccataggetticattgticaaatectttagtcactaactaaaggcetggaccta tgcaagaattttggctactcttataaatgctgtgeggeaaagactacggaaaaatataaattattgeatatetagaggtgaggttcattget cccatccatttttccaagaactaaaatatatataaattattaatatgatattacattgaaaaataatattiticttttaaatatgtgatcataagttta attttaagtctaticatacgaaaaaaatatitattagaaaagattaatttattaaatggatctcaatattttaagaaattaacttttagetctcaac caacagatgatttgagttaaaaaaatgtatatataaactattgcatatctgetgatttttgtttgtaacaccaataagtgggcattttactaaat ccatgtgacaatgtactgaatgtittagaatacagtctggtttgataataaaacgtgcataaagtccagettatgttaactcttaattcatgga aaatgatgatatgcgaattgaaagaaagaaaaccataatgtaagtgcagttttctctetcttitttaatattattcaatatcagattgcacatg ggaaggggtattggctcatgtgggatattagttttigtcecttacctaaaaagagagaaagagaaaaataacaatitaaaaagagtacca ccgetaccacctttttcgcttttaaatttttgtictgttttcactactetttcatgegtigttigttggetictgatagtgacgaatatgatataatga ttitatgttgggaaaaaagtgccatgtaaatictagagattgaaattttageatcaaattatttatittatcacctittaaaatttgtigeatgtga aagaatttgaagctctccaacaaggaaataacacticaatccttagagtcatcctctagatcecaaaagaatgtgatgtttatacacattag tatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatagggtttatattatattaatgagtgatgtacgaggac ggtggtgacactatatggccaaaacaagtgtaatataattattttttitctcaagtattactctatecttgaatattattagtettaaatcttcaa gcaccfttgtgaacgaagcaatcttgicc 5s EPSPS 10 reverse (SEQ ID No.33) gcacarcgigcaagigaraaigccatigccat

EPSPS 4 forward (SEQ ID No.34) gcwggaacwgematgegicerytiacige :

SEQ ID No. 31 with double mutation (SEQ ID No.35) aaaaaataccttttagtaaaataagagcgtragatcaatcagacgttttctctttgggacttctcattcttaattgaattgacaataactaaagt gaaactaaggctaaaatcaactcgectagtcaagetegtecacaaaaataggtittigaaagtttaccatgteagtttettactaagtaaaa aaggatcatttgtaaggtccaacgecttaaaatgatcacccticaaagtaaaagaatcacttgtticacgeataagtaagaactacgtagg {ctgatttcctctecanaggagggiacetaggageasaagocoogtitiptogacotioansaatasaaaganacasaagitaaggta acacaatttccacaattctagaaataaggttgttgtctttcgagacaaacgtaagaggtgctaataccttcctcaaacgtaaatacaactce cgaacttagaattttcatittgaccggtttcetteggtiticcegacgtiticcacaaataaacgttggtggegactcegegcatctitectect ttggaaagcgcacccatgagectegeectegetegeecgegaagggeacgttgegacactaggttaataagaagtttagtceacatat ctatggacctcttaaggtgattatcaaagtggaagtggtgacctacatgttggecctaccagcettattegtatatttacceecatcaaccat gtatctcagctgaaacatgetatcaatccaaatgttatcagaggaacatgagetgeatgticaaccagaagtagttctagicttaatacaa atgtcaaatggcacaagtgagatittgaatitctgatgttgtaaaaatctcaggacatgaatactattgggaagcaattattcatacttcace ‘ aatccaaactgacccaaaattctcaaatcacatgaaagcaaaaatgcatataacacgaagaataagaagaagaggaactaacctggg gtttcgatgattaaagegtigttgttgatgatgaaaacgatgattatggagagaaatigtigtigaatggteaaatigttatagaaagagaa cgaagatagagaaaaagatatatagatttttcaaggctcaaaccctaaaatcaccatgagagagaacaaagattgagaaacctacaac cactatgagagagaatgagcagaacagaagcgtgagatagagaacgagagttaaggtgcgagaggacacgaagaacaaaaggtg tgagagaaagaacaaaggagcctacggtgigagatgagagaatitgaaaticttaccatttaggtggaatitcaatictacaattttattct attaaaattattttaaaaaatgatgtcattttaaatictttaaaatctcatatccaacaactgaattatgatagaggtatttcaaattcacttaaaa aaattatcttatttaaataccccatccaaacatagcgaaatgticatgagaaggatcaagtggtttggaaacatagtactaatggtotitata cagttcatggaatcctigatagataatttaaaggttpctggaaattggatgaaggtgtggagattaaataticticcaaaaataaagegtitt atttggagagtgttgigtggtigictccectgtaggeaaaagcticgatgtaaaggagttcaatgtccaataacctatgettictateecteg attattgaaaatgaatgacacattitatttggttgaaatcaagaaataagcatgtggcaageaacgggtatitgacaaticatagaacaaaa ggtgaatgcagcaaaagaattaatgaactectittcgatetactiggatcactacatggagatattatcaacaaatttgatgitactitatgg agcagttggaattcttggaatgacaagatatgaaatgaacataccaaccctectettgtttctgtitcggttctatgeagtattitgtigaatg geanagtgcaaggtaatatgctecteaacatcaattaacaaatgttcatgacatctcttaccagetecaacttggggacgtitgacaaaca ccaccgtcaagtttccttaaatgeaacattaatgttgetcatttcaaggaggagaatagttttggtgtcggeatgatactccatcaaggaag attcgtcaaagctcactcacgttttcgacatgggtcgacatgggttacctgacccaaaggetgaggcttaggettgggttigeticaagta ttgatctgggeccagactattggtttacataatatcattittgaaaacctaacatctaaaactcaaggttgtitagaggtgegecaticcaaa ataagattatcctatttgtgcatgaatgcgaccaactatctcetgtitcagcattataaagtataaacaacaaacttctttaatcaagggacta aaagatattggacatacaagctaaaagtgatagaatttgagaaaacaaatattgacaacaataticaagaggacactaaaacataattct caaatttttittgtttatttaaaatanagtegticattaggtagctettganaananaaagtgatiaacatgetagtacatgttaaaaaaagtga ataatattctattataagtasagaggaataatttatcgatgtctcatttttgagatagticaccgaagccaatttttttacttttttctcttcaatca attttattitgttaatagttgtcattgtggatggattataataattttgaaatgatttaaaatgagatatatattaataaatttaattaattcataaata tgttactaaatataaatttcatggtatactcaggacggttataacggaaatcaaataaataataaaatagaataatattaatitgcagtaaaa agaataatattaatttattctgtttacactatgtataacgaaattaaatatattcatttaatatgattttattittctttaatttaaaaacatgaattattt gittcttattttattaccattttgttcactictcaattaataaaataaaaatatatictacaattatagtanaaaggtttaattttatataatgttagca tacagatttttctctattaactaattaattaaaaattatccitatittaaggaaattaaaaattatcatatatatataagtittaaattaatiatcitata tatgtaccaaaaagttttaaagcaattattataaaaattaataaatitatcatataaaataatitataattaaatittaaattatcaaticattaaatt aaattatttaaaatttttgaatgataatataataattttatcctctactaagtcccaacgtttectattttattceacttitagcaataaattitgtcat anacacttataacaaaaaaagtaagtanaaaataaaaaaaagtitticaataaagtatasactaatttgtataaacttitagaaaaaataaag ttatacattgataatataaattttttacataattatccgatcaactcattatatatgataaatttattgattittiaaaataattatcttaaaataattta aacaatgatttgcaattagatgataatataaaattattttacacactacatgtattaaactcaaacttitatatattagtittictaaaaactaatttt taactcaaaaaaaatgttacttataattttcttatcttctttttttataagtatttittaagaaatttattgaaacatgaccatgettgggteaataat actactctcttagacaccaaacaacccttcccaaactataatctaatccaaaagecatcattcattticettggtaggtaaagticcaagace ttcaccaactttttcactcaattgttttggtgtaagcaaticgacatgtgttagtgttagttggeaaccaaaaatecctttatgtgactcaatee aacaaccactcacaccaccaaccoccataaccattteteacaatacecttcatttacacattatcatcaccaaaaataaataaaaaaaace tcteatttcagagagagagagagagacttcacagaccaaagtgcagagaacaacaaagttcacaactttaaggaaaattgaaatggec caagtgagcagagtgcacaatcttgctcaaageactcaaatttttggecaticttccaactccaacaaactcaaatcggtgaatteggttte attgaggccacgectitggggggectcaaaatetcgeateecgatgeataaaaatggaagetttatgggaaatittaatgtgggoaagg gaaattccggegtgtitaaggtttetgcatcggtegecgeegeagagaageegtcaacgicgeeggagategtgitggaacceateaa agacttctcgggtaccatcacattgccagggtecaagtctctgtccaategaattttgettettgetgetctetetgaggtgaagtttatitatt tatttatttgttigtttottgttggptgtapgaataggagtttgatgtgtagagtggattitgaatatttgattttittitgtattatictgtgaaaatg aagcatcatgtcccatgaaagaaatggacacgaaattaagtggettatgatgtgaaatgaggatagaaatgtgtgtaggptittttaatgg gtagcaataagcatattcaatatctggattgatitggacgttictgtataaaggagtatgetagcaatgigttaatgtatggctigetaaaata ctcctanaaatcaagtgggagtagtatacatatctacagceaaatgtattaggtgaggcatttggcettetctatigtaaggaacaaataatat oo Co -.51- | oo cagttaatgtgaaaatcaatggttgatattccaatacattcatgatgtgttatttatatgtacctaatattgactgttgtttttctccgcaatgacc | _ aagattatttatittatcctctaaagtgactaattgagttgcttactttagagaagttggacceattaggtgagagegtg gggggaactaate ttgaatatacaatctgagtcttgattatccaagtatggtigtatgaacaatgttagctctagaagataaaccctceccccaaaacacaaatta gaatgacatttcaagttccatgtatgtcactttcattctattatttitacaacttttagttacttaacagatgtcttgttcagcataaattataatitat ttgtttttittaggpaacaactgttgtagacaacttgttgtatagtgaggatattcattacatgettggtgcattaaggaccetiggactge gtgtggaagatgacaaaacaaccaaacaagcaattgtigaaggcetgtgggggeattgtticccactagtaaggaatctaaagatgaaatc aatttattccttggaaatgotggtactgcaatgegtectitgacageagetgtggtioctecaggtoganatgcaggtctg ittitittttt gttcagcataatctttgaattgttcctegtataactaatcacaacagagtacgtgttcticttcctgttataatctaaaaatctcatccagattag tcatcctticticttaaaaggaacctttaattatcaatgtatitatitaatatttaaattagetigtcaaagtctagcatatacatattttgattatatt ctgagaaatgcacctgagggtgttcctcatgatctacttcaacctetgttattattagattttctatcatgattactggtttgagtctctaagtag accatcttgatgttcaaaatatttcagctacgtacttgatggggtgccccgaatgagagagaggecaattggggatttggttgetggtett aagcaacttggtgcagatgttgattgctticttggcacaaactgtccacctgttcgtgtaaatgggaagggaggacttectggeggaaag gtatggtitggatttcatttagaataaggtggagtaactttcctggatcaaaattctaatttaagaagectecctgttticctctcetttagaataa gactaagggtaggtttaggagttgggtittogagagaaatggaagggagagcaatttttticticttctaataaatattctitaatttgataca tttittaagtaaaagaatataaagatagattagcataacttaatgttttaatctittatttattttiataaatattatatacctgtctatttaaaaatca aatatttgtcctceattcectttcecticaaaacctcagttccaaatataccgtagttgaattatatttiggaaggectattggttggagactttt ccttttcagagattatccctcacctttattatagectttctatttttaaacttcatatagacgcecattctigtittaaaaaacactaagtttictttta gttataccttccectecttattctctccaaagtaaatattgtagcaagtgttggttgatceattgtgaatcttattatcetatttaacatgeaggt gaaactgtctggatcagttagcagtcaatacttgactgctttgcttatggcagetectttagetctiggtgatgtggaaattgagattgttgat aaactgatttctgticcatatgttgaaatgactctgaagttgatggagegttttggagtttctgtggaacacagtggtaattgggataggttce ttggtccatggaggtcaaaagtacaagtaggtitctatgtittagtgttacatcactittagtatccaaaatgcaatgaaattaaaactcatgtt tcctattaggtctectggeaatgettttgtigaaggtgatgettcaagtgecagttatttactagetggtgcagceaattactggtggpgactat cactgttaatggctgtggcacaagcagtttacaggtattcatgaatgacactatcttctattatcttttattttatagcttacactatcattcctaa ttcaacccccttettttctetttcececteactcccaaaatagagettatcattgtatecttaatagetcettttatgtgetgttteatetettgageag attctacatgattatcctttttagtgaacttittigtcttitaaataattgatatcatcatitgaacttgcacatcatctctatecttccteattttattat atttcattaagagtgataaaattacattgtcaagtaaagcaagttagegtatcagataatgatgcticgattgcagaattggtgaaagcttg cacaattcattagcttagtgacaattgtgatgtagatagccataatcttccatgcaacttattatgctttttgtctaaaacttcttttgcacttaaa catgaattagagagttaggatgaacaatagtaacagacacaaagcttatttctagaccacccagtggtgaagacgaagcagceatgagt gagattaatggcagcatctgattgaagcttctittggtattattggagatgaaatcttgagecaaattagggettttgectectcaatageca ttggttcaaaattgcittcaataaaatgattacagaatcaaattcttaagaaagaccttcaagaacaacatcaagatgtticctgtgcaaaac aggctcacctacaaaagagtgtctacaagceacctttacacttgcaaaaaattecttaactgaacaattgecaagagteatgttgcaaactt gagattggagttgattagatttggtotgtetgagatictggaaatgagcatgaagttitttgcaaagctcataaaatgaatgcagecaaga : atcctagataggattgaatttgagagagaggcttgaagtcaagataaccgcaactgatcttgetgttcecatgetgeataggactegtts : attctaccaagataacaatctictgtggtgagaatatgagtgggaattgtcaggcaacaaagaaaatgaaggctatgagcctttgttaag gtgcagagagaaaacagaaaatgaagaacttgtgtattgaaggaattgaaaagccaattacaattgtgttgcagagagatatttatagtt ctgaagtgtataactaactaaacagaatgctaccaacctagaggceagttgagaattgetcccttattacaatactctcacagecttgatgat : aggcttgatttgctgccaccgaagaagaacattattgtiggagagtttticagtgattgcatcagagaaagttacaagtgtgattggagat gaaggacttgcggtegtcgaaggttaagtgtiaagtggtggaatgtetatcggaggtggttgectageecaagaagetggttgeagty gaagcggatgcggcagaagccatgggttcagatcagaactatgttctagataccatattagggttagctitcaagagaaaacttatgaa actgaactgtaaactgttgtattattgattagctgatctagtagtgatggaagcttgetigegaagcttctatggaggctggatcattgaget tcaatgaggtccttcaatggtgatttttcaccatggagatgcageggaagataaatgaagaggtgagaggaggegtcatccactagga aataaactatggaagaaggagcticaccaccaagagagtgtcttggataagaagcttagagaggaagcticaatggaggaatagaaa gagagagggggaacaaaaaattgaaggaggaaaagagggagagaagttgaactttgaagtgtgtctcacaagactcattcattaaag ttacaacaagtgttacacatgcttctatttatagtctaggtaacttccttgagaagctagaacttaactacacacacctctctaataactaaga taacctccttgagaaatticetigagaagettcctiaagaagattcctagagaagctaaagcttagttacacacacctctctaataactaagt fcacctcctigagatgagangctagageetiagetacacacaceetiataatagetaaacteactetaticeanaatacatgasaatacaa aaaagttcctactacaaagattactcaaaatgtcctgaaatacaagactaaaactctatactactagaatggtcaaaatacaaggtccaaa agaaggaaaaacctattctaatatttacaaagagagtggacccaaccttagtccatgggetcagaaatctaccetgaggttcatgggaat cctagggtcttctttagtagcictagtccaattttcttggagtcttctatccaatatcctigggggtaggattgeatcatgtagtacaagagag gggaatatatatacagttgtaagttgtaactacctaatcaaacccaactgactcaccatacacagaaaaacaatgtacaaaggataatag anaaactgaaactgagatatactcattacatagaagaattacatgatgaatetgaaaatittaatiggganactgaggacaataacaagg ctttcagagttcattttgacaataggtaaattatggacttcaacttagacctcaagggtatgcttgggagtggpgttttagaggaaaaggg gaaggagggaaattttttaattctagtaaatattctctattttgattaatttitaaaataaaacaaataaacttatagattagcattcacttaatgt cctgatcttttatttgtttcatgaagttttttatagectttctgtitctgttaaaagaaattggagggtgticataatctatatgcceatatatatgta ttgtcctgttgtetgtgtttctgtttictitctitagtgtctcgectttccttaattecttatcaacaccttgtitatitttgaaaacttaaatgtccteat ttittttacctgtactataactticcaaacaaatagtagaaaatgtttcaaatattccccagaactgtttcagtgaacaaagttcaagccagaa aaaaagcaagcagaggctaaagaagtatatcttattgtgaagagtaatctcaattggttaattatcgaattgtatcattttacaatagaaaat tagaagtgggttgattagtttatacgaacaattatttaaatagggttgatg gtgtggttaattactgatcatatgttaagactatgagtcgatg accagcctcagtgceagtcattttaagttccattattttttaattgtgcttatgtitaactttgtectictittaaagggagatgtaaaatttgetgaa gttcttgaaaagatgggagctaaggttacatggtcagagaacagtgtcactgttictggaccaccacgagattitttctggtegaaaagtct tgcgaggcattgatgtcaatatgaacaagatgecagatgttgecatgacactigetgtigtigeactatttgetaatggteccactgetata agagatggtatggtitagetgtitgtititgctcaagagettgttticacatattigtggicaagageggtitagetgttttititittaaattgtog ttaatgaaattattataattatactaatattgaaattggatcactaaccatgtgaaatgcttgaatttttagcttgaaaacttcttttgtggatgatt ’ titcttttatctatgtagtgtggggcatctatgttgttcctttaagetttgtgtcatagttgtacaacctggtetgtgggetggtecagtictiact . catgactgtcttttgcagcaaactggttaaacttgggtgacctgttgacccacccagattggectgticttitttaaataaaactccaaaagg ctacttataagatttcaacatgatacttgaatgaccacccttactttaaaggtcattatgccatcagaccecttgattctetgttcagttatgtic fttattcttattattttttaatttatattattatccaacgatctgatctttgtacatgatgctggacaatcatcaaagcetagtttggttacatcatataa taccttttttticataaatiattitticceataatatatitatatetattittttaatacaatattctggggaaattitititttctgttitctittitctggtity aatactatttcaatgactgggccttattattttctggtitgggttatacaactgtecttigatgtacttttgaatgcettcaatagtatttttcataate atggaaggcactagagtgcagtgcatattgcacaaggtictttaatggcatctigaatttgttagaacatggagttatgatatacaaccatt cctatgtcttcatctaatagctaaagcttttggegtagtiggttaacatggtattggaatcttattitaaaggtccatctiaticgcaagtacaa ggcaggtggacctgegcattattcacgtgeccaggetcaaagggattitgtatgaggpgpaatttttggaatataatatatagaatcattca .tgtggttcacctatcatgtgtcaactcaagttitigtcctagttgtattattgcagtgtctaaactaggeatgatcttctgtggaaggaaattta acctaaggaacttgaatgcttcttgttctgagatctttatttttttictccaatctttttaatacttgaaaggttttagttgtatctataaagggtge agaattagggggtcagctittctgtigtaagegtgaattaagtgcattttatgttgttcectattitatacatttgaactatcaaccatatcattta gcaaacttctttgttgctcagattcccatitattcttgtticetctattttttagtggeaagttggagagttaaagagactgagaggatgatage aatctgcacagaactcagaaaggtcitgctaattcctitatggtttctatattactggactttttacatctcactgacctactactgtcttggtat ttcagctaggagcaacagttgaagaaggtcctgattactgtgtgattactccacctgagaaattgaatgtcacagcetatagacacatatga tgaccacagaatggccatggcattctctettgetgettgtggggatgticcagtaaccatcaaggatectggttgecaccaggaagacatt tcctgactactttgaagtccttgagaggttaacaaageactaageattttgtacatigagtagggaagagagagagatatatataaatact cacaaagcagtgagtatatggcttgctttigttictaaacaticctitataaggacttgagataatttgtattgtitaaaagagcecattggtict gttgtatcaaagtaatttaattttcagtaccgacttggctctactcatatgtggtggtgtacatigeatetttgeatitgaticcatatctattgg gatgggaccatacattttttgtttattatttaagtcaaacatatcagataatatgtggtgaccagaaaagtgtctagcaatcaaatgggtetgt gattgcatgtttgagttcaggacatttattaatgagtgacagaattttaaaaagctcgccaataggagttgccacatctgatcgagtctietg taaacactaactgtaacttgagtttgataatcagattccececcgttggtaggtaatatgtaaatttcactatagaticttactgaggatgatgg tcttgacttcgaagtggtgagtgtaatictctaatctaaactttatatatatataaaaaaagaatgttaaaaactigagtgacatacagcaaat agcaatgaaagcatgaccatggccttgggggeccaaatggecatgtaccactittccacctactigagagecatggtectgaatgaggt ’ ccttttgtticattttttttacaataaagaaagttcatattcttggcaatagcaaggcaaatcatitgtggaagtcacatgaaattcaccatagg cttcattgttcaaatcctttagtcactaaggecagggectatgtaagaattttgactactctigtaaatgetgtgeggtaaagactacgggaa aatataaattattgcatatctagaggtgagottcatttctcegatccattictccaagtaataaaaatatatataaattattaatatggtatgata tggttatttgtcctitaaatatgegattataggttcaatctttggttaatctatcaaatgeatcteaatattitgagagaatagtttttagetettga ctgagagatactitgagttaaaaaaatgtatitataaactattgtctattgaatttttatttttittgtaacaccacatgtgagtattttactaaatcc atgttacaatgtactgaatgttttacaatacagtctgtitgataatanaatatgeacaaagtccagettatgtaactetticaatteatggaaa atgatgatatgcgaatiganagaaagasaaccataatgtaagtgtatititttttictitotcttetttaatatiactcaatatcagattgeacatg ggaagggtactggctcatgtgggatattaatttttatcecttacctaaaaagagagaaagagaaaataactatttaaaaagagtaccacc accacctttttcgettttaagttitgtictgtittcactactctttcatgegttgtttgttggettccgatagtgacgaatatgataatgattttacgt tgagaaanaaaatgtgccatgtaaattccagagattgaaattitagcttcaaattaatatttattitattatcttttcanattggttgcatgtgaa agaatttgaagticttcaacaaggaaataaacacttcaatgctcaatccttagagtcagteactagatcccaaaagaatgtgatgtttacac acattagtatatatatatatataaacacagcttatattatattaatgagtgatgcgegaggacggtggtgacactacatggccaaaacaag aaatgtaatttaatttttttttctttaagtattactctatccttgaatattagtcttaaatcticaaagaccttgegaacgaagcaatettgtcctga tcctgtgattgttetacactagtecttacgtgtacctaageacatgatactttgetgeectaacataaattgtaccataaggattettgggga gatpcttttgccttcattttcaagtttgtitacactttcaagtegtttittcaatgeattetetttcetitctgggaccectigtetitaacacgege gcacacaaaaactagtagacaataattagtactacttgggttccattaaattgtaactacatatacatgtgtttttittttcttggatcaactge atatacatatgttttatgagtttcattgaatttatatttacacaaacagttattaaaacataatgtagagccttgtcattaacctgatgttaggatt ataatttcatgctttgattttgattgtacgttttitgttittattgtaaagtgtitattitattaaaattigtcttggagtgetgtgatctttagggigea ccgttcaaaagagagacgacaaggataatactaatactagtagattccacgcattcaaccetagttagtttagctatgacaaattaageat gotasgasaaggggaggagaaaagtaagaatgaanacatatancaaatigtgattgaacttttccatgacgtaatgaaaacattaattit aagataagcticaactcctaagaagagatatgtcaaagaaacttaggattttticictatttataacggtaaattactcatcetittaaatgatt aatttgcgttgttgaaticgttgtaaagggaaaatcaagaagtcteticacgggaaagttatatcaaagtatcatatactagacttcatgget agcttttactttgattataagtaatgcatgcaattaatgggcaaataaattatttgaaaccaactaaagtacaaataattttcctccaaaacct ctcaagttcgeattgaaattaaataaaccaatgeatattaaggegtaaatctaaaccatgtitgtitcatctigtatigtataicatagtattaat aaggtactitgaatttagttgttatigaccgttaaatttaggggtgagttgtttactatctcttactcaattgetittattcaacgcaaattetagt aggatittcagcccaaattaaaagaagttttacggtttgatictctacaaacttgaattgagattictaatticagaaatcaataattgeggtet taattaactctataatcaaaccttttaacccaatcttttictcaatictctgaattaagacaatcaaaatttaaactcacacgaatctcacacge cttcccacggtagagaaatatagggagtcecttaatagcaaaagectcaaaattcagaaaatctcatceattgeatitgeacattcaacaa accacccattattatgttcccttaataaatctcacacttaaaaaccetectecacecataattaacccaaaaggaagtticctccacacaaaa aatatccttaaacaaagagcctctataaatctattttaaaaaaacccccaaatttaagga

SEQ ID No. 32 with double mutation (SEQ ID No. 36) aaaagtctgaatgaagtgaagtigtigtgttagggggatgctgaatttgattitaatitaatttaaataaattacctgtgtaaaggatttttgta cogectittaatcacaaattgtegtgtatcgaaagtitgitgaattitatagtaactatcttggaggtiatacctagtaggattictgattagtta accatgtaaatttttttaatgggtttgigttigtittaactgatgitgtttttgatatgtacgtggtaagtgtgatgagtitgtgcatatctigatca aagactgaagtgaagtigttgtgtitogggggttgactcttitaggaagaggatttgagggaatticgccaatgggggageagaactce gggacaccctgagaattitgagactccgggaattgaagttacaacaggtttgatatgagttagagttigtataatagaatagtaattctittt attttttatttttattgtttatttatccattattgctatttttgtaggtcctettggtcaggggattgecaatgetgtiggttiggeecttgeagagaa geacttggetgcaagatacaacaagectgacaatgagattgttgaccattacacgtaaaaataactaaatcatacacaacttgcaagact ttagttgttgtottttgctaatggegtitgttitatgcaggtatgctattctgggtgatgptigtcaaatggagggaattgeaaatgaageat getcacttgctggecactggggactggggaagetgatagcattttatgatgacaatcatattictattgatggtaacacagagatigegtt caccgagagtgttgatagtcgtttigagggacttgggtggcatgttatttgggtaaagaatggaaataatggetatgatgatattegtget occattaaggaageanaagetgieanagacasacceacattaatcaaggiiagtitactaatigtggeaatgatatgeatagatitctgge ttgtagttaccataacaatcataatctgtcatgatttatagggattcttitaaactaaggttataaacatgatatgttactaaagactgcattge attgtagtacctcatttgagasactggaagtiataggtgggaaatcaaaatagtaaattatgggteagtttattaagtgtagetggtttgtott ttgctaactctatcatttcacaggtcacaacaaccattggttatggtictcctaacaaggetaactectacagtgtgeatggaagtgeactg gotgccaaagaagttgatgecaccaggeagaaccitggatggteacatgagecaticeacgtgectgaggatgtcaaaaagtatggat gatgggtttagagattictittttcctgtgacactgetgatgtitataatgatactgaataagaattgettgtetgtecccaggeattggagte gceacacceetgagggtgctgeacttgaagetgagtggaatgetaagtttgetgagtatgaaaagaaatacaaggaggaagetgeag aattgaaatctattatcaatggtgaattccetgetggtigggagaaageacttceggtgagtaaatictaaactcacaggittticttacatgt ttgtaacttitcaaggtttggattacatactatccaaagttgatcatgatttcagtitgattiggtagtatggggcticaaaaagtattccaaat attaaaacctggcttccaatttgatttcagacatacactccagagageccageggatgecaccagaaacctgictcaaacaaaccttaat geectigeaaaggticticeeggtetgettggtggeagtgeagatcttgeticticcaacatgaccttgetcaaaatgticggggacttcea aaaggatactccagcagagegtaatgitagaticpgtgttagagaacacggaatgggagetatctgcaacggeattgetcticacagee ctggactgattccatattgtgeaaccitcttigtaticactgactacatgagaggtgecataaggettictgegetgtetgaggetggggtta tttatgtcatgacccatgattcaataggacttggagaagatgggecaacceaccagectatigageacctageaageticegggeaatg ccaaacattttgatgcttcgtectgcegacggtaacsgaaacagecsgageatacaaagtggeegtgetcaacaggaaagagaccet ccattcttgecctatccaggeaaaaactgecccageticecggaactthcattgaaggagttgaaaagggtggttacaccatttcggga caactccactggeaacaagcectgatgteattttgatcggaactggticggaattggaaategetgecaaagetgetgatgacctaagga aggaagggaaggctgttagagtigtticectigttictiggggaactitttgatgagcaatcagaagestacaaggagagtgtittecetg ctoctgtttcagecagagttageattgaggcaggatcaacatttgggtgggagaaaatigitggagcaaagggaaaageaataggeat tgatcgtittggagcetagtgetecagetggaagaatatacaaagaatttggtatcactaaggaagetgitgtigetgeagetaaagagett

: atctagaactittgatttitttitgectictggititggtigagageaticeatgteatgaataagaaaaggtiaaatatecticgattgggaat ttgggattctaagtgaagaagcaacatagatcaaagaattitgtgaacitgtaataactatttgacaatttagtittgcactgecacatggtta BE aattcaatgtttgatcatatcaaccatagatgctagtitatactacttgtataattigtttcacttgeagattcactcttageatttgagtgtiigg Le atggccgtgtittgttcattaagaaatgttgacatggatagtttgttgeatggtaaatiggteattaatacctitttaagettettttggeaagtt gttaaaaagtgttttgttitaatctetagttaatctaaaaatgectacttattttattttgactticaaaacttgtctatatgeccgagtataaaaaaa acttgtctatataagttccttatggaaaaaggacctacaaaataatitaaaaatgctgaattigttaggaagtitgacaactttagacattaat anttgtttttitttcatatatataatigactitcasaactigtctatatattatanaticgttatgganagggogaccacacgtaaaacgtaacat gccaatctetecctagtgaactgttattetcatteagttittgtaagticaccttcaaattttcaatttttittttgacaaaaatatctttgatggaac acgttaggggtetaaaticaccattcatcatttcattcattatacacaatagtctitcataatccaatgaaaactigtittgtigtiatitittictg aaaaatctttatanaataaataaaaacatittittgttataaattcagttgaaatacataaccattaattotacagagtgttaatgttgatgtaaa ataaaaanatattggatatcaaacttaatgaacagaacaaaaattacaaaattgtacaatttaaatgataaaaaaccaaattcacaaaaata aaaattaaggacgaaatttgagaaatgataattaaaaacgattaaaaatataattaaactaaaatttattatgtaattctitaatatatatatata tatatatatatatatatatatatatatatatataataaaagttttacattataattttgaaatgaagtatttgataaacgaacaacccacccttggg sttegtgagagtganacggagaacagtgtcteecteactiggtettetgagtegagicctattcatcaccaacceeactegteaaaattgtt gtatgctatgtaaccatitigttttitaataaataaaagtglittgitctgctatgeactccecatcaaataccatttacttitttitigtctictatca , atttctatttagttcctagttgctacaacttccagetggtgaaaaatagtcaacagagactacaatattctaataaaatagaataacaaaatc anatataticatttaatatgattttatittiatttaatitaaaacatgaattattigtitcttatttaattaccgtitcgttcactictcaattaataaaata aaaaatttctacaattatagaaaaagtttagttttgtagattgttaacataaagattiticctattaactaattaattaaaagtcatctiatatataa gtittanagtaattatcitatatatgtacccaaaagtittaaagcaatiattataaaaaagtaaaattttatcatatacaataatctataattacat gaaagtataatttttaaattattaatacgttaaaattattittttaaaatttgaatgatcatatagtaattitattitataccaagtcccaacatttect attttattccacttttaccaataaatttcctcataaacacttataagaaaaaaagtaagtaaagaataaaataagcttttctataaactataaac aaatitgtataaactttcttatattagtttttctgaaaactaattttaaattatacataaattgaatttactgataatttitattitctttttgtataagty ttttttaagaaatttgttcaaacatatttttatgacatgtcaatgcttgagagatataaggtgagttaaatcataaatgatiaaagaaaaataaa agaagaaaaagataattaatttaattttttattaacatictaacaaattaacattatataaataaanataatatitcaataatiggatcaataatac tattgttcttaaacaccaaaccaaccttcctaaagtectaatctaatccaaaagecatcattcatittcettggtaggtaaagticeaaaacet ttaccaaccttitcactcaattattttggtgtaagcaattcgacatgtgttagtgtiagttggcaaccaaaaaccectttatgtgactcactcaa tccaacaacctctcacaccaccaacceccccataactcataaggecaaaaccattictcacaaaacceticattacacacattattateatt atcacacacacaaaaaacctctcatttcaaagagagagagagatttcacagaccaaattgcagaggacgacaaagttcacaacttcaa opanaatcganatggoccaagigageagagigeacaatetigeicaaageacteaaatittyggycatteticcaayyceaacaaacy caaatcggygaattcggtttcattgaggecacgecetttggggkscetcaaaatctegeatcyygrigmayaaaamtggaagceyttat gggaaattttaatgyggggaagggaaaticeggertgtitaaggttictgeatesgicgeegeegeegeagagaagecgicaacgteg ccggagatcgtgttggaacceatcaaagacttctegggtaccatcacattgecagggtceyaagtctetgtecaatcgaattttgettcttg - ctgcetetetetgaggtaaagtttatitatttatttatttctgtatccaaaaatgtaaattgttagtttgttaatitttgttagcagtgagagtcgaact acttggctictttcttagtcatccaaccaaccttatatctccaaaatttatttattggttttttttggg gttatgt ggttaggaataggagtttgatg oo cgtggagtggattttgaatatttgattitttittitittgiattaticagtgaaaatgaageatctigtcccatgaaagaaatg gacacgaaatta agtggcgtatgatttagaatgatgatagaaatgtgtataggtggttttaatgtgtagcaataagcatattcaatatctggattgatttggacg tttctgtataaaggagtatgctagceaatgtgttaataatgtcttgttaaaagtatggatggctaaaataatcataaaaatcgagtgggagta gtatacatatctacaggaaatgtattaggtgaggcatttggctictctattgegagtaaggaacaagtaatctcagttaatgtgaaaatcaa tggttgatattccaatacattcatgatgtgttatttacgggaacgcaatattgactgttgattttatctgecagetgagattatatactatatectt ccaaagaaatctttgactcttgattatccaagtatggttgtattaccaattttagctctagaagataatcectcecccaaaacacaaattaga atggtgctgcaagttccgtgttactttcattctattatitttataacttttaattatttaatagatgtcttgtttgg cataaactataatttattctgtttt titttattcttatitagggaacaactgtigtagacaacttgytgtayagygaggatattcattacatgetiggtgcattaaggaccettggact gegtgtggaagay gacmaaacaaccaaacaagcaattgtkgaaggetgtgggggattgtticccactaktaargaatctaaagatga aatcaatttattcctiggaaatgctggtactgeratgegtectitgacageagotgtrgtgetgcaggtgganatgcaaggtotgttttttgt titgtitettcatcatgateteigaattgticetcgtataactaatcacatcagactatgtgticttectecatcctgttataatetaaaaateteat ccagattagtcatccttetttaaatgaaccttiaattatatctatgtatttatitaacatgtaaattagctigtcaagtcaaagtctageatataga tatactgattacactctgaggaatgcacctgagggtcttaatcatgatctatttcaaccttgecactttcticttttattattagatcacctatcat gattactggtttgagtctctaaatagaccatcttgatgticaaaatatttcagcetacgtacttgatggrgtgececgaatgagagagaggee aattgggpatttggtigetggtettaagcarcty ggtgcagatgtigattgetttctiggeacaaactgiccacctgiicgtgtaaatggga agggaggacttcctggeggaaaggtatggtttgpatticcattagaataaggtggactaactticctggageaaaattctaatttataccct gtttccecctetitagaataagacactaagggtatgtttaggagttgggttitggecgagaaagggaagggagggcaattttititctaataa atattctttaatttgataaattttttaaacgaaggaatatgaagatagattagcataacttaatgttttaatctittatttatttttataaatattatata cctctatttaaaaacaagatatttttcctecattcectttecctitaaaacctcagttccaaatatacegtacttgaattatattttggaaggtota ttggttggagacctttccttttcagaggttatceeteaccetttattatagecttictactctettaatgagttcatigtgeattgagtcattgaactt cctgtgaaaagaaattgtttactittctttatitgttacctacatcettattcetgttttaaaaaatactaagttttcttttagttatgecttecectee ttattctctccaaagaaaatataatagcgaatgttggtttatccattgtgaatcttattatcctatttcacatgcaggtgaaactgtctggatea gttagcagtcaatacytractgcetttgettatggeagetcctitagetetiggygatgtggaaattgagatigtigataaactgatttctgttc catatgttgaaatgactctgaagttgatggagegttttggagtttctgtggaacacagtggtaattgggatargticttggtccatggaggt

. canangtacaagtaggtttctatgtittagcattacateactttttagtatccanaatgcaatgaaatcaaaacteatgtttictatcaggtote ctggcaatgettttgtigaaggtgatgeticaagtgecagttayttmetagetggtgeagearttactggtgggactatcactgttaatgg ctgtggcacaagcagtttacaggtattcatgettgacactattttctattatctittattttatggtetatactgtatcattcctaattcaacceect tetttictetttccectcacttccaaaaaaatagagcttatcattgtattcttaatagetettgtatgtectttttegtetettgageagattctace gtgattatcctttitagtaaacttttttittgtgtgtctittaaataattgatatcatcatatgaattcacacatcatctctatcecttecteattttatta tatticattaacagtgataaagatasaaataaatigtcangtasagcaagtiageatgteagataatgatgcticaatigcaanatiggtgaa agcttgcacagtacattagctttggtgacaattgtgatgtagatagcecataacctcecatgeaacttattatgttgtttgettaaacttettttg cacttaaacacggattagagagagtgaggatgaacaataataacagacacaaagctiagtttiataccacceggeacecagiggtgaa gaccaagcagtatgagtgagatcaatggcagcatctgattgaagcttcttgtggtattttiggagatgaaatccgaggegaattagggcea tctggctcaacaatagecattggticaaacttgcttttaataaaattgattacagaatcaaattcttgaggaagcecttcaagaactacatcat gatgttccctgtgcaaaacaggttcaccgacaaaagagaacatctacaagttcetttacacatgecaaaaattcctcaactgaacaattg ccaagagtcatgttgcgaacttcaggttggagttgacgaaatttggtgcatgtatgattctggaaatgagcatgaagtttittcctaagete ataaaagtgaatgcagccaagaaccctagataggattgaatcggagagaggcttgaagecaagataacagceaactgatcttgetgtic ccatgctgegtaggactcattgattctaccaagatcacaatctictgtggtgagaaaatgagggtgaattgtcaaccaataaagaaaatg gtgaaggctgagtcttgatgataggetigatttgettgcgetgaagaagaacgttatigttgtagagttictcagtgattgtatgagagtaa gitacaggtgcgattggagatgacggacttgtggtoggaggaggptaagtgttaagtggtggaatgcgtatcagaggtggttgccea gccaaagaagetggttgcggtegaggaggtggtaptecagtggaagecatgggttttgatgctittgagagaaaacatacgaaactg aactgtaaacttttgtattattgattagctgattiggtagtacaagagaggaatatatatacagttttaatgtaactacctaaccaaacatgag gaactctccatacacagaaagacgtatacaaaggataacagacaaacagaaacttagatatactcatacagagaagaattacaggatg aatctgagaattttaattgggaaactgaggaaaatagcaagggtticagaattcattttgacgataggcaaatcatggacttaacttagac ctcaagggtacgcttgggagtggggotttttagaggpaaaagggaaggagggcaaacttitaaticctaataaatattctcttttitgattit tttttaaataaaacaaataaacttatagattagcatacacttaatgtcctaatcttttatttatttgcatgagttttittcttttatattctttctgtitct gttttctitcttcagtgtctettgtctticettaaticcttatcaataccttgtttatttitgaaaacttaattttcctcatttttttaacttataggetata ctatagtatgtataactattcaaataaatagtagaaaatgtttcaaatattccccagaactgtiicagtgaacaaagticaagccagaaaaa agaagtatatcttcttgtgaagagtagtctcaagtggttaattgtcaaattgtatcattttagaatacaaaattagaagtggtttgattagtttat acgaacgattatttaaatagggttgatgatgtggttaattactgatcatatgtgaagactgtgagtcgatgaccageecagtgeagtcatit taaattccattattttitaatttgtgcttatgttaaactttgtcctictttcaaagggagatgtaaaatttgctgaagticttgaaaagatgggage taaggttacatggtcagagaacagtgtcacygttwetggaccrceacragattyttctggteraaaagtcttgeraggeatigatgteaat atgaacaagatgccagatgtigccatgacwettgeygtigtygeactatttgetaatggtcmmactrcyatmagagatggtatggttt agctgtttgtitgtgticaagagctigttitaacaaattgtittttttaattatggttaatgaaattattataattacactaatatigaaattggatca ctaaccatgtgaaatgctigaatttttagcttgaaaacttcttttgtggacaattittcttttatctatggattgtggggcatctatgttgticctit aagcttcgtacaacctggtetgtgggetggtecagtecttcttactcatgacagtcttttgcagtaaactggttaaacttgggtgacctgttg acccacccagattggcctgticttittaaataaaacttggctacttataagatttcaacatgatacttgaatgatcaccettactctaaaggec attatctgticagttatgtictictictictiattatititaatitatattattatccaacgatetgatctttgaacatgatectggacaateatcanag ctagtttggttacatcatataatacctttitittcatatattatitticccatagtatatttttgtgtitttttitcatacaatattatictgaaaaaaactt gtttcgittttttcctggettgaatgctatttcaatgactgggecttattatittctggtitaggttatacaactgtectccaattgactttigaatg cttcaatagttttcttcttaatcatggaaggcactagagtgcatatigaatatgttagaacatggaaggcttaaatatctttttagtetttgeaat ttaacgtttttttgctittagtccttgcaaaattataattittitttagtcctgactaattatgtttgttttgttittgagggcgagecctggtgeage ggtaaagttgtgecttggtgactigttggteatgggticgaatccggaaacagcectetttgeatatgcaagggtaaggctgcgtacaatat cectececcataccttcgcatagegaagagectetgggeaatggggtagaaaaagaagaatgctttagataacacttttittgttactgtt caaagcactatctaaagtgctttgaggactaaacacaaaacaaacataatttgcaaggactgaaaaacaaaaaaataattitgcaagga caaaaaaacaaaaaaaaaaaacaaaatigcaaggaccaaaaatatatttaaaccaacatgaaattatggtataaaaccattcatatgtett catctaatagcttaagcttitgggatagttggttaacaatatggtattagagtcttatgatttttaggtggtetttgagttcaatccttgetgete ccagttctagttaatttcttittggtccacticanataaanagtigaatttaagggtaaggeagetggacctgcgeattaatcatgtgteagg ctcaaagggcttttgtatggggggcatgtttggaatataatatagaatcattcatgtggtttcacctatcaaggacaactctagtttitgtcat acttgtattattacagtgtctaaactagacatgatctttttccggaaggaaatttaacttaaaaggaacttagatgcttcttgttctgtgatettt atttgtttattttticcaatctttitaacaattgaaaggttttagtigtatccaatctttitatacatitggactatctaccatatcatttagcaaactig tttgctgctcagattctectitggactatctaccatatcatttagcaaacctgttcactgetcagattctcatttattctttgtttcctetatttitca gtggcaagttggagagttaaagagactgagaggatgatagcaatctgcacagaactcagaaaggtgagtgtcttgctaattectttatg gtttcgatattactggactttttacatctcactgacctactctgtettggtatticagctaggageaacagttgaagaaggtectgattactgt gtgattactccacctgagaaattgaatgtcacagetatagacacatatgatgaccacagaatggecatggcattetctctigetgettgtg gggatgticcagtaaccatcaaggatcetggttgcaccaggaagacatttccygactactttgaagtecttgagaggttmacaaagcea ctaagcattttgtacatigagtaggaagagagagagagataaatactcacaaaacagtgagtatatgcatggcttgcttitgtttcttaaca ttcccttgtaagaacttgagataatttgtattgttggaaagagctattgattctgttgtatcaaagtaatttaatttccagtacagacttggcetet aftcctcatatgtggtggtgtacattgcatcttigeatttgatcecatttctattgggataggaccatacctttttttgtitattattcaagtcaaac ttagcagataatatgtggtgaccagaaaatagtctagctagcaaatagacctgtgattgeatgtttgaattcaggacttcaggacatttaat taatgagtgacaatgttaaaaagctcgccaacaggagttgacacatctgatigagtctictattaacactaactgtaacttgagtttgattat cagattcctectgttggtaggtaatatgtaaatttcactatatatttaccgaggttggtoptcttacttgactttgaagaggtgagtgtaattta aacttttatatcaaaaaaagattgctaaaagettgagtpggcatgcaacaaatagcaatgaaagaatgactatggecttgggaaccaaatg gccacgtaccacttttccaccaacttgagagccctggtceetggatgatgeccctttttttttttcatttctitgacaataaagaaagttcttatte ttggcaattgcaagtcgtttgtggaagtcacatgaaattcaccataggctteattgttcaaatcctitagtcactaactaaaggetggaccta tgcaagaattttggctactcttataaatgetgtgecggeaaagactacggaaaaatataaattattgeatatctagaggtgaggttcattgct cccatccatttttccaagaactaaaatatatataaattattaatatgatattacatigaaaaataatatitttcttttaaatatgtoatcataagttta attttaagtctattcatacgaaaaaaatatitattagaaaagattaatttattaaatggatctcaatattttaagaaattaacttttagctetcaac caacagatgatttgagttaaaaaaatgtatatataaactattgcatatctgetgatttttgtttgtaacaccaataagtgggcattttactaaat ccatgtgacaatgtactgaatgttttagaatacagtctggtttgataataaaacgtgcataaagtccagcttatgttaactcttaattcatgga aaatgatgatatgcgaattgaaagaaagaaaaccataatgtaagtgcagtittctetetcttttitaatattattcaatatcagattgeacatg ggaaggggtattggctcatgtggpatattagtttttgtcecttacctaaaaagagagaaagagaaaaataacaatttaaaaagagtacca : ccgctaccacctttttcgcttttaaatttitgtictgttticactactetttcatgegttgtttgttggetictgatagtgacgaatatgatataatga ttttatgttgggaaaaaagtgccatgtaaattctagagattgaaattttagcatcaaattatttattttatcaccttttaaaatttgtigcatgtga 5S aagaatttgaagctctccaacaaggaaataacacttcaatccttagagtcatcetctagatcccaaaagaatgtgatgtttatacacattag tatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatagggtttatattatattaatgagtgatgtacgaggac ggtggtgacactatatggccaaaacaagtgtaatataattatttttttttctcaagtattactctatccttgaatattattagtcttaaatcticaa gcaccttgtgaacgaagcaatcttgicc :

FMV S35S90 enhancer (SEQ ID No.37) aagcttccegggecggecgeagetggetigtggggaccagacaaaaaaggaatggtgcagaattgttaggegeacctaccaaaage atctttgcctttattgcaaagataaagcagattcctctagtacaagtggggaacaaaataacgtggaaaagagetgtectgacageecac tcactaatgcgtatgacgaacgceagtgacgaccacaaaactcgagacttticaacaaagggtaatatccggaaacctcetcggattcea ttgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggetcctacaaatgecatcattgegataaaggaaaggecat cgttgaagatgcctctgccgacagtggtcccaaagatggacceccacccacgaggageatcgtggaaaaagaagacgttccaacca cgtcttcaaagcaagtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatecttcttaattaa

FMV 35846 enhancer (SEQ ID No38) aagcttcccgggecggeegeagetggetigtggggaccagacaaaaaaggaatggtgcagaattgttaggegeacctaccaaaage atctttgcctttattgcaaagataaagcagattcetctagtacaagtggggaacaaaataacgtggaaaagagetgtcectgacageccac tcactaatgcgtatgacgaacgcagtgacgaccacaaaactcgagaacatggtggageacgacacacttgtctactccaagaatatea . aagatacagtctcagaagaccagagggctattgagacttitcaacaaagggtaatatcgggaaacctcctcggattccatigeecaget atctgtcacttcatcgaaaggacagtagaaaaggaagatggctictacaaatgccatcattgegataaaggaaaggcetategticaaga tgcctctaccgacagtggtcccaaagatggacceccacecacgaggaacatcgtggaaaaagaagacgttccaaccacgtettcaaa gcaagtggattgatgttaattaa

GmTerm Bam (SEQ ID No.39) ctgcagggatcctggtigcaccaggaag

GmTermEco (SEQ ID No.40) gaattcccgggtatggtgaatttcatgtg

BnMUT2PST (SEQ ID No.41) gactictcgggtaccatcacattge

BnMUTkpn (SEQ ID No.42) cacctgcagcaaccacagcetgcetgtcaaagaacgeattgcaataccageatttce

] -6] - oo

GmRubPac (SEQ ID No.43) aatttaattaattcataaatatgttac

GmRubbot (SEQ ID No.44) ggtcttetecttettagttctcaactacttgttctictgetgecagatttcaattttcctiaaagtigtgaac

GmRubtop (SEQ ID No.45) atctggcagcagaagaacaagtagttgagaactaagaaggagaagaccatggeccaagtgageagagigeac ’

GmRubKpn (SEQ ID No.46) ggcaatgtgatggatcccgagaag

ZMPPDK1 (SEQ ID No. 47) gcgccatggeggeatcggtitccaggg

ZMPPDK?2 (SEQ ID No. 48) gegggtacctcagacaagcacctgagcetgeage

ECPPS1 (SEQ ID No. 49) geggceatgeccaacaatggetegtc }

ECPS2 (SEQ ID No. 50) : gcggatccttatttcttcagttcageca :

EPSPS motif (SEQ ID No. 51)

ALLMZAPLA, wherein Z isnot Sor T

EPSPS motif (SEQ ID No. 52)

EIEIZDKL, wherein Z is not V

EPSPS motif (SEQ ID No. 53)

FG(VM)XK/S)ZEH, wherein Z isnot V

EPSPS motif (SEQ ID No. 54)

AL(K/R)ZLGL, wherein Z is-not R

EPSPS motif (SEQ ID No. 55)

GLXVEZ,DXZ,XXXA/V)V, wherein Z, is not T and/or Z, is not E

EPSPS motif (SEQ ID No. 56)

ITPPZ K(L/V)YK/N)Z, wherein Z, is not K and/or Z, isnot T

EPSPS motif (SEQ ID No. 57)

TIZ(D/N)PGCT, wherein Z isnot N or L

EPSPS motif (SEQ ID No. 58)

(D/N)YFXVLXZXX(K/R)H, wherein Z is not R

EPSPS motif (SEQ ID No. 59) (I/V)VEGCGG(I/L/Q)FP(V/AITY(S/G)

EPSPS motif (SEQ ID No. 60) (I/IV)VVGCGG(/L/Q)FP(V/A/T)E

EPSPS motif (SEQ ID No. 61)

UV)VVGCGGULIQFP(V/ATYS/G)

EPSPS motif (SEQ ID No. 62) (I/V)VVGCGGKFP(V/A/T)(S/G)

EPSPS motif (SEQ ID No. 63) (/V)VEGCGGKFP(V/A/T)E

EPSPS motif (SEQ ID No. 64) (I/V)VEGCGG(U/L/Q)FP(V/A/T)E;

EPSPS motif (SEQ ID No. 65) (/V)VEGCGGKFP(V/A/T)S/G).

Claims (64)

CLAIMS :

1. A glyphosate resistant EPSPS enzyme wherein in comparison with the wild type EPSPS the protein sequence is modified in that a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into "EPSPS sequences which comprise the conserved region GNAGTAMRPL in the wild type enzyme such that the modified sequence reads GNAGIAMRSL, wherein the enzyme does not comprise the sequence K(A/V)AKRAVVVGCGGKFPVE, characterised in that the enzyme is stable and possesses at least one of the following sequence motifs (i) to (viii) in which X is any amino acid and Z, Z, and Z, are any amino acid other than those specified:- ®) ALLMZAPLA, wherein Z isnot S or T; (ii) EIEIZDKL, wherein Z is not V; (iii) FG(VA)K/S)ZEH, wherein Z is not V;. (iv) AL(K/R)ZLGL, wherein Z is not R; (v) GLXVEZ,DXZ,XXXAUV)V, wherein Z, is not T and/or Z, is not E; (vi) ITPPZ,K(L/V)(K/N)Z, wherein Z, is not K and/or Z, is not T; (vii) TIZ(D/N)PGCT, wherein Z isnot N or L; (viii) (D/N)YFXVLXZXX(K/R)H, wherein Z is not R.

2. An enzyme according to claim 1, which comprises at least two of the motifs (i), (ii), (iii), (v) and (vi).

3. An enzyme according to either of claims 1 or 2, wherein in motif (i) Z is A; in motif (ii) Z is I; in motif (iii) Z is A; in motif (iv) ZisK, T or A; in motif (v) Z, isR or A or less preferably D or E and Z, is preferably V or A or less preferably T; in sequence motif (vi) Z, is E or A and Z, is P, I or V; in motif (vii) ZisR or K; and in motif (viii) Z is T or S or less preferably Q.

4, An enzyme according to claim 1, which comprises one or more sequences selected from the group consiting of: ® (I/V)VEGCGG(/L/Q)FP(V/A/T)(S/G) Gi) @/V)VVGCGGI/L/QFP(V/A/T)E; (iii) (A/V)VVGCGGI/L/Q)FP(V/A/T)(S/G); (iv) (I/V)VVGCGGKFP(V/A/T)(S/G); (v) (I/V)VEGCGGKFP(V/A/T)E; (vi) (/V)VEGCGG/L/Q)FP(V/A/T)E; (vii) (UV)VEGCGGKFP(V/A/T)(S/G).

5. An isolated polynucleotide comprising a region which encodes an EPSPS according to any one of claims 1 to 4.

6. A polynucleotide according to claim 5, having a sequence depicted in SEQ ID Nos. 4 or 5.

7. A polynucleotide encoding an EPSPS, which polynucleotide is obtainable by screening plant genomic DNA libraries with a polynucleotide constituting an intron located within SEQ ID Nos. 4 or 5.

8. A polynucleotide according to any one of claims 5-7, comprising the following components in the 5' to 3' direction of transcription:- 6) At least one transcriptional enhancer being that enhancing region which is upstream from the transcriptional start of the sequence from which the enhancer is obtained and which enhancer per se does not function as a promoter either in the sequence in which it is endogenously comprised or when present heterologously as part of a construct; (ii) The promoter from the soybean EPSPS gene; (iii) The soybean genomic sequence which encodes the soybean EPSPS chloroplast transit peptide; (iv) The genomic sequence which encodes the soybean EPSPS;

(v) A transcriptiohal terminator; wherein the soybean EPSPS coding sequence is modified in comparison with the wild type sequence ir that a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which comprise the conserved region GNAGTAMRPLTAAYV in the wild type enzyme such that modified sequence reads GNAGIAMRSLTAAV.

9. A polynucleotide according to claim 1, comprising the following components in the 5' to 3' direction of transcription:- 6) At least one transcriptional enhancer being that enhancing region which is upstream from the transcriptional start of the sequence from which the enhancer is obtained and which enhancer per se does not function as a promoter either in the sequence in which it is endogenously comprised or when present heterologously as part of a construct; (ii) The promoter|from the Brasicca napus EPSPS gene; (iti) The Brasicca napus genomic sequence which encodes the Brasicca napus EPSPS chloroplast transit peptide; (iv) The genomic sequence which encodes the Brasicca napus EPSPS; (v) A transcriptional terminator; wherein the Brasiccalnapus EPSPS coding sequence is modified in comparison with the wild type sequence, in that a first position is mutated so that the residue at this position is Ile rather than Thr and a second position is mutated so that the residue at this position is Ser rather than Pro, the mutations being introduced into EPSPS sequences which conintise the conserved region GNAGTAMRPLTAAYV in the wild type enzyme such that modified sequence reads GNAGIAMRSLTAAV.

10. A polynucleotide according to any one of claims 5-9, further comprising a sequence which encodes a chloroplast transit peptide/phosphoenolpyruvate synthase (CTP/PPS) or a chloroplast transit peptide/pyruvate orthophosphate di-kinase

(CTP/PPDK), which sequence is under expression control of a plant operable promoter.

11. A polynucleotide according to the preceding claim, wherein the CTP and PPDK encoding sequences are non-heterologous with respect to each other.

12. A polynucleotide according to any one of claims 5-11, wherein the said enhancing region constitutes a sequence, the 3’ end of which is at least 40 nucleotides upstream of the closest transcriptional start of the sequence from which the enhancer is obtained.

13. A polynucleotide according to claim 12, wherein the enhancing region constitutes a region the 3’ end of which is at least 60 nucleotides upstream of the said closest start.

14. A polynucleotide according to claim 12, wherein the said enhancing region constitutes a sequence the 3’ end of which is at least 10 nucleotides upstream from the first nucleotide of the TATA consensus of the sequence from which the enhancer is obtained.

15. A polynucleotide according to any one of claims 5-14, comprising first and second transcriptional enhancers which are tandemly present in the polynucleotide.

16. A polynucleotide according to any one of claims 5-15, wherein the 3’ end of the enhancer, or first enhancer, is between about 100 to about 1000 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region.

17. A polynucleotide according to any one of claims 5-16, wherein the 3’ end of the enhancer, or first enhancer, is between about 150 to about 1000 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region.

-67 - oo

18. A polynucleotide according to any one of claims 5-17, wherein the 3’ end of the enhancer, or first enhancer, is between about 300 to about 950 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region.

19. A polynucleotide according to any one of claims 5-18, wherein the 3’ end of the enhancer, or first enhancer, is between about 770 and about 790 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region.

20. A polynucleotide according to any one of claims 5-19, wherein the 3’ end of the enhancer, or first enhancer, is between about 300 and about 380 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region. :

21. A polynucleotide according to any one of claims 5-18 and 20, wherein the 3’ end of the enhancer, or first enhancer, is between about 320 and about 350 nucleotides upstream of the codon corresponding to the translational start of the EPSPS transit peptide, or the first nucleotide of an intron in the 5' untranslated region.

22. A polynucleotide according to any one of claims 5-21, wherein the region upstream of the promoter from the EPSPS gene comprises at least one enhancer derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or FMV35S promoters.

23. A polynucleotide according to any one of claims 5 -21, wherein the region upstream of the promoter from the EPSPS coding sequence comprises at least one enhancer derived from a sequence which is upstream from the transcriptional start of a promoter selected from the group consisting of those of the actin, rolDFd, S-adenosyl

O3/zt6 & homocysteinase, histone, tubulin, polyubiquitin and plastocyasnin genes and the CaMV35S and FMV35S genes.

24. A polynucleotide according to claim 23, comprising in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or FMV358 promoters, and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of an actin gene. !

25. A polynucleotide according to claim 23, comprising in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV35S or FMV35S promoters, and a%econd enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the rolDfd gene.

26. A polynucleotide according to claim 23, comprising in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV358 or FMV358 promoters, and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of a histone gene.

27. | A polynucleotide according to claim 23, comprising in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of either the CaMV358S or FMV35S promoters, and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of a tubulin gene.

28. A polynucleotide according to claim 23, comprising in the 5' to 3' direction a first enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the FMV35S promoter and a second enhancer comprising a transcriptional enhancing region derived from a sequence which is upstream from the transcriptional start of the CaMV35S promoter.

29. A polynucleotide according to any one of claims 5-28, wherein the nucleotides 5' of the codon which constitutes the translational start of the soybean EPSPS chloroplast transit peptide are Kozack preferred.

30. A polynucleotide according to any one of claims 8 to 29, wherein 5' of the genomic sequence which encodes the EPSPS CTP there is located a 5' untranslated leader sequence derived from a relatively highly expressed gene 1s

31. A polynucleotide accérding to the preceding claim, wherein the said highly expressed gene is selected from the group consisting of those which encode glucanase, chalcone synthase and Rubisco.

32. A polynucleotide according to any one of claims 8-31, which comprises a virally derived translational enhancer or non-viral translational enhancer located within the non translated region 5' of the genomic sequence which encodes the EPSPS chloroplast transit peptide.

33. A polynucleotide according to any one of claims 5-32, further comprising regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, dessication, and herbicides.

34. A polynucleotide according to claim 33, wherein the herbicide is other than glyphosate.

35. A polynucleotide according to the preceding claim wherein the herbicide is a protoporphyrinogen oxidase (PPGO) inhibitor, in particular butefenicil, and the corresponding resistance protein is a PPGO or inhibitor resistant variant thereof.

36. A polynucleotide according to either of claims 33 to 35, wherein the insect resistance conferring regions encode crystal toxins derived from Bt, including secreted Bt toxins; protease inhibitors, lectins, Xenhorabdus/Photorhabdus toxins; the fungus resistance conferring regions are selected from the group consisting of those encoding known AFPs, defensins, chitinases, glucanases, Avr-Cf9; the bacterial resistance conferring regions are selected from the group consisting of those encoding cecropins and techyplesin and analogues thereof; the virus resistance regions are selected from the group consisting of genes encoding virus coat proteins, movement proteins, viral replicases, and antisense and ribozyme sequences which are known to provide for virus resistance; the stress, salt, and drought resistance conferring regions are selected from those that encode Glutathione-S-transferase and peroxidase, the sequence which constitutes the known CBF1 regulatory sequence and genes which are known to provide for accumulation of trehalose.

37. A polynucleotide according to claim 36, wherein the insect resistance conferring regions are selected from the group consisting of those that encode crylAc, crylAb, cry3A, cry1BC, ViplA, ViplB, Vip3A, Vip3B, cystein protease inhibitor, and snowdrop lectin.

38. A polynucleotide according to any preceding claim, which is modified in that mRNA instability motifs and/or unwanted splice regions are removed, or crop preferred codons are used so that expression of the thus modified polynucleotide in a plant yields substantially similar protein having a substantially similar activity/function to that obtained by expression of the protein encoding regions of the unmodified polynucleotide in the organism in which they are endogenous.

39. A polynucleotide according to the preceding claim, wherein the degree of identity between the modified polynucleotide and a polynucleotide endogenously contained within the said plant and encoding substantially the same protein is such as to prevent co-suppression between the modified and endogenous sequences.

40. A polynucleotide according to the preceding claim, wherein the said degree is less than about 70%.

41. A vector comprising the polynucleotide of any preceding claim.

42. Plant material which has been transformed with the polynucleotide of any one of claims 5-40, or the vector of claim 41.

43. Plant material which has been transformed with the polynucleotide of any one of claims 5-40 or the vector of claim 41, and which has been, or is, further transformed with a polynucleotide comprising regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, desiccation, and herbicides.

44. Morphologically normal, fertile whole plants which have been regenerated from the material according to either of claims 42 or 43, their progeny seeds and parts.

45. Morphologically normal fertile whole plants which result from the crossing of pints which have been regenerated from material which has been transformed with the polynucleotide of any one of claims 5-40 and plants which result from regeneration of material transformed with a polyncleotide which comprises a sequence which encodes a protein capable of providing for elevated levels of phosphoenolpyruvate in the chloroplast.

46. Plants according to the preceding claim, wherein the said capable protein is a fusion of a CTP and PPS or a fusion of a CTP and a PPDK.

47. Morphologically normal fertile whole plants which comprise the polynucleotide of any one of claims 5-40 and which result from the crossing of plants which have been regenerated from material transformed with the polynucleotide of any one of claims 5 - 40 or the vector of claim 41, and plants which have been transformed with a polynucleotide comprising regions encoding a CTP/PPS or CTPPPDK, and/or regions encoding proteins capable of conferring upon plant material containing it at least one of the following agronomically desirable traits: resistance to insects, fungi, viruses, bacteria, nematodes, stress, desiccation, and herbicides, the progeny of the resultant plants, their seeds and parts.

48. Plants according to any one of claims 44 to 47, selected from the group consisting of field crops, fruits and vegetables such as canola, sunflower, tobacco, sugar beet, cotton, maize, wheat, barley, rice, sorghum, tomato, mango, peach, apple, mangel worzel, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, soya spp, sugar cane, pea, field beans, poplar, grape, citrus, alfalfa, rye, oats, turf and forage grasses, flax and oilseed rape, and nut producing plants insofar as they are not already specifically mentioned, their progeny, seeds and parts.

49, Soybean, canola, brassica, cotton, sugar beet, sunflower, peas, potatoes and mangel worzels according to any one of claims 44-48.

50. A method of selectively controlling weeds in a field, the field comprising weeds and plants or progeny according to any one of claims 44-49, the method comprising application to the field of a glyphosate type herbicide in an amount sufficient to control the weeds without substantially affecting the plants.

Sl. A method according to the preceding claim, further comprising application to the field either before or after application of the glyphosate herbicide of one or more of the following: a herbicide, insecticide, fungicide, nematicide, bacteriocide and an anti-viral.

52. A method of producing plants which are substantially tolerant or substantially resistant to glyphosate herbicide, comprising the steps of: ®) transforming plant material with the polynucleotide of any one of claims 5 to 40 or the vector of claim 41; ; (ii) selecting the thus transformed material; and (ili) regenerating the thus selected material into morphologically normal fertile whole plants.

53. A method according to the preceding claim, wherein the transformation involves the introduction of the polynucleotide into the material by: (i) biolistic bombardment of the material with particles coated with the polynucleotide; or (ii) impalement of the material on silicon carbide fibres which are coated with a solution comprising the polynucleotide; or (iii) introduction of the polynucleotide or vector into Agrobacterium and co-cultivation of the thus transformed Agrobacterium with plant material which is thereby transformed and is subsequently regenerated.

54. A method according to the preceding claim, wherein the transformed material is selected by its resistance to glyphosate.

55. Use of the polynucleotide of any one of claims 5 to 40, or the vector of claim 41, in the production of plant tissues and/or morphologically normal fertile whole plants which are substantially tolerant or substantially resistant to glyphosate herbicide.

56. Use of the polynucleotide of any one of claims 5 to 40, or the vector of claim 41, in the production of a herbicidal target for the high throughput in vitro screening of potential herbicides.

57. A method of selecting biological material transformed so as to express a gene of interest, wherein the transformed material comprises the polynucleotide of any one of claims 5 to 40 or the vector of claim 41 and wherein the selection comprises exposing the transformed material to glyphosate or a salt thereof, and selecting surviving material.

58. A method according to the preceding claim, wherein the biological material is of plant origin.

59. A method according to the preceding claim, wherein the plant is a dicot.

60. A method according to the preceding claim, wherein the dicot is selected from group consisting of soybean, cotton, sugar beet, Brassica napus, campestris or oleraceae.

61. A method for regenerating a fertile transformed plant to contain foreign DNA comprising the steps of: (2) producing regenerable tissue from said plant to be transformed; (b) transforming said regenerable tissue with said foreign DNA, wherein said : foreign DNA comprises a selectable DNA sequence, wherein said sequence functions in a regenerable tissue as a selection device; (©) between about one day to about 60 days after step (b), placing said regenerable tissue from step (b) in a medium capable of producing shoots from said tissue, wherein said medium may further contain a compound used to select regenerable tissue containing said selectable DNA sequence to allow identification or selection of the transformed regenerated tissue; (d) after at least one shoot has formed from the selected tissue of step (c) transferring said shoot to a second medium capable of producing roots from said shoot to produce a plantlet, wherein the second medium optionally contains the said compound; and (e) growing said plantlet into a fertile transgenic plant wherein the foreign DNA is transmitted to progeny plants in Mendelian fashion, wherein between step (b) and step (c) there is an optional step of placing the transformed material onto callus inducing medium, characterised in that the foreign DNA is, or the selectable DNA sequence comprised by the foreign DNA comprises, the polynucleotide according to any one of claims 5 to 40, and the said compound is glyphosate or a salt thereof.

62. A method according to the preceding claim, wherein the plant is a dicot selected from the group consisting soybean, cotton, sugar beet, Brassica napus, campestris or oleraceae.

63. A method according to either of claims 61 or 62, wherein the said regenerable tissue is selected from the group consisting of embryogenic calli, somatic embryos, immature embryos etc.

64. A diagnostic kit comprising means for detecting the enzyme of any one of claims 1-4 or that encoded by the polynucleotide of any one of claims 5 to 40 or the polynucleotide or vector of any one of claims 5 to 41.