ZA200205968B - Vaccine for the prophylactic or therapeutic immunization against HIV. - Google Patents

Description

NOVEL USE

DESCRIPTION

The present invention relates to novel uses of HIV proteins in medicine and vaccine . compositions containing such HIV proteins. In particular, the invention relates to the use of HIV Tat and HIV gp120 proteins in combination. Furthermore, the invention relates to the use of HIV Nef and HIV gp120 proteins in combination.

HIV-1 is the primary cause of the acquired immune deficiency syndrome (AIDS) which is regarded as one of the world’s major health problems. Although extensive research throughout the world has been conducted to produce a vaccine, such efforts thus far have not been successful.

BN The HIV envelope glycoprotein gp120 is the viral protein that is used for attachment. : oo to the host cell. This attachment is mediated by the binding to two surface molecules of helper T cells and macrophages, known as CD4 and one of the two chemokine receptors CCR-4 or CXCR-5. The gp120 protein is first expressed as a larger precursor molecule (gp160), which is then cleaved post-translationally to yield gp120 and gp41. The gp120 protein is retained on the surface of the virion by linkage to the gp41 molecule, which is inserted into the viral membrane.

The gp120 protein is the principal target of neutralizing antibodies, but unfortunately the most immunogenic regions of the proteins (V3 loop) are also the most variable parts of the protein. Therefore, the use of gp120 (or its precursor gp160) as a vaccine antigen to elicit neutralizing antibodies is thought to be of limited use for a broadly protective vaccine. The gp120 protein does also contain epitopes that are recognized by cytotoxic T lymphocytes (CTL). These effector cells are able to eliminate virus- infected cells, and therefore constitute a second major antiviral immune mechanism. ) In contrast to the target regions of neutralizing antibodies some CTL epitopes appear . to be relatively conserved among different HIV strains. For this reason gp120 and gp160 are considered to be useful antigenic components in vaccines that aim at eliciting cell-mediated immune responses (particularly CTL).

1 . WO 01/54719 PCT/EP01/00944

Non-envelope proteins of HIV-1 have been described and include for example internal structural proteins such as the products of the gag and pol genes and, other non-structural proteins such as Rev, Nef, Vif and Tat (Greene et al., New England J. } Med, 324, 5, 308 et seq (1991) and Bryant et al. (Ed. Pizzo), Pediatr. Infect. Dis. J, 11, 5, 390 et seq (1992).

HIV Tat and Nef proteins are early proteins, that is, they are expressed early in infection and in the absence of structural protein.

In a conference presentation (C. David Pauza, Immunization with Tat toxoid attenuates SHIV89.6PD infection in rhesus macaques, 12" Cent Gardes meeting,

Marnes-La-Coquette, 26.10.1999), experiments were described in which rhesus macaques were immunised with Tat toxoid alone or in combination with an envelope glycoprotein gp160 vaccine combination (one dose recombinant vaccinia virus and one dose recombinant protein). However, the results observed showed that the SL oo presence of the envelope glycoprotein gave no advantage over experiments performed with Tat alone.

However, we have found that a Tat- and/or Nef-containing immunogen (especially a

Nef-Tat fusion protein) acts synergistically with gp120 in protecting rhesus monkeys from a pathogenic challenge with chimeric human-simian immunodeficiency virus (SHIV). To date the SHIV infection of rhesus macaques is considered to be the most relevant animal model for human AIDS. Therefore, we have used this preclinical model to evaluate the protective efficacy of vaccines containing a gp120 antigen and a

Nef- and Tat-containing antigen either alone or in combination. Analysis of two markers of viral infection and pathogenicity, the percentage of CD4-positive cells in the peripheral blood and the concentration of free SHIV RNA genomes in the plasma of the monkeys, indicated that the two antigens acted in synergy. Immunization with either gp120 or NefTat + SIV Nef alone did not result in any difference compared to ’ immunization with an adjuvant alone. In contrast, the administration of the combination of gpl20 and NefTat + SIV Nef, antigens resulted in a marked improvement of the two above-mentioned parameters in all animals of those particular experimental group.

Thus, according to the present invention there is provided a new use of HIV Tat and/or Nef protein together with HIV gp120 in the manufacture of a vaccine for the . prophylactic or therapeutic immunisation of humans against HIV. . As described above, the NefTat protein, the SIV Nef protein and gp120 protein together give an enhanced response over that which is observed when either NefTat +

SIV Nef, or gp120 are used alone. This enhanced response, or synergy can be seen in a decrease in viral load as a result of vaccination with these combined proteins.

Alternatively, or additionally the enhanced response manifests itself by a maintenance of CD4+ levels over those levels found in the absence of vaccination with HIV

NefTat, SIV Nef and HIV gp120. The synergistic effect is attributed to the combination of gp120 and Tat, or gp120 and Nef, or gp120 and both Nef and Tat. 3 ~The addition of other HIV proteins may further enhance the synergistic effect, which was observed between gp120 and Tat and/or Nef. These other proteins may also act synergistically with individual components of the gp120, Tat and/or Nef-containing vaccine, not requiring the presence of the full original antigen combination. The additional proteins may be regulatory proteins of HIV such as Rev, Vif, Vpu, and

Vpr. They may also be structural proteins derived from the HIV gag or pol genes.

The HIV gag gene encodes a precursor protein p55, which can assemble spontaneously into immature virus-like particles (VLPs). The precursor is then proteolytically cleaved into the major structural proteins p24 (capsid) and p18 (matrix), and into several smaller proteins. Both the precursor protein p55 and its major derivatives p24 and p18 may be considered as appropriate vaccine antigens which may further enhance the synergistic effect observed between gp120 and Tat and/or Nef. The precursor p55 and the capsid protein p24 may be used as VLPs or as monomeric proteins.

The HIV Tat protein in the vaccine of the present invention may, optionally be linked ’ to an HIV Nef protein, for example as a fusion protein.

£ t WO 01/54719 PCT/EP01/00944

The HIV Tat protein, the HIV Nef protein or the NefTat fusion protein in the present invention may have a C termir al Histidine tail which preferably comprises between 5-

Histidine residues. The presence of an histidine (or ‘His’) tail aids purification.

In a preferred embodiment the proteins are expressed with a Histidine tail comprising : between 5 to 10 and preferably six Histidine residues. These are advantageous in aiding purification. Separate expression, in yeast (Saccharomyces cerevisiae), of Nef (Macreadie I.G. et al., 1993, Yeast 9 (6) 565-573) and Tat (Braddock M et al., 1989,

Cell 58 (2) 269-79) has been reported. Nef protein and the Gag proteins p55 and p18 are myristilated. The expression of Nef and Tat separately in a Pichia expression system (Nef-His and Tat-His constructs), and the expression of a fusion construct

Nef-Tat-His have been described previously in W099/16884.

The DNA and amino acid sequences of representative Nef-His (Seq. ID. No.s 8 and ~~ ~~ ..9), Tat-His (Seq. ID. No.s 10 and 11)and of Nef-Tat-His fusion proteins (Seq. ID. Co

No.s 12 and 13) are set forth in Figure 1.

The HIV proteins of the present invention may be used in their native conformation, or more preferably, may be modified for vaccine use. These modifications may either be required for technical reasons relating to the method of purification, or they may be used to biologically inactivate one or several functional properties of the Tat or Nef : protein. Thus the invention encompasses derivatives of HIV proteins which may be, for example mutated proteins. The term ‘mutated’ is used herein to mean a molecule which has undergone deletion, addition or substitution of one or more amino acids using well known techniques for site directed mutagenesis or any other conventional method.

For example, a mutant Tat protein may be mutated so that it is biologically inactive whilst still maintaining its immunogenic epitopes. One possible mutated tat gene, constructed by D.Clements (Tulane University), (originating from BH10 molecular . clone) bears mutations in the active site region (Lys41->Ala)and in RGD motif (Arg78—Lys and Asp80—Glu) ( Virology 235: 48-64, 1997).

A mutated Tat is illustrated in Figure 1 (Seq. ID. No.s 22 and 23) as is a Nef-Tat

Mutant-His (Seq. ID. No.s 24 and 25). . The HIV Tat or Nef proteins in the vaccine of the present invention may be modified by chemical methods during the purification process to render the proteins stable and . monomeric. One method to prevent oxidative aggregation of a protein such as Tat or Nef is the use of chemical modifications of the protein’s thiol groups. In a first step the disulphide bridges are reduced by treatment with a reducing agent such as

DTT, beta-mercaptoethanol, or gluthatione. In a second step the resulting thiols are blocked by reaction with an alkylating agent (for example, the protein can be carboxyamidated/carbamidomethylated using iodoacetamide). Such chemical modification does not modify functional properties of Tat or Nef as assessed by cell binding assays and inhibition of lymphoproliferation of human peripheral blood mononuclear cells.

The HIV Tat protein and HIV gp120 proteins can be purified by the methods outlined in the attached examples.

The vaccine of the present invention will contain an immunoprotective or immunotherapeutic quantity of the Tat and/or Nef or NefTat and gp120 antigens and may be prepared by conventional techniques.

Vaccine preparation is generally described in New Trends and Developments in

Vaccines, edited by Voller et al., University Park Press, Baltimore, Maryland, U.S.A. 1978. Encapsulation within liposomes is described, for example, by Fullerton, U.S.

Patent 4,235,877. Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S. Patent 4,372,945 and by Armor et al., U.S. Patent 4,474,757.

The amount of protein in the vaccine dose is selected as an amount which induces an - immunoprotective response without significant, adverse side effects in typical vaccinees. Such amount will vary depending upon which specific immunogen is employed. Generally, itis expected that each dose will comprise 1-1000 ug of each for. WOoOousaTI PCT/EP01/00944 protein, preferably 2-200 pg, most preferably 4-40 pg of Tat or Nef or NefTat and preferably 1-150 pg, most preferably 2-25 pg of gp120. An optimal amount for a particular vaccine can be ascertained by standard studies involving observation of . antibody titres and other responses in subjects. One particular example of a vaccine dose will comprise 20 pg of NefTat and 5 or 20 ug of gpl120. Following an initial vaccination, subjects may receive a boost in about 4 weeks, and a subsequent second booster immunisation.

The proteins of the present invention are preferably adjuvanted in the vaccine formulation of the invention. Adjuvants are described in general in Vaccine Design — the Subunit and Adjuvant Approach, edited by Powell and Newman, Plenum Press,

New York, 1995.

Suitable adjuvants include an aluminium salt such as aluminium hydroxide gel (alum) oo ~~ or aluminium phosphate, but may also be a salt of calcium, iron or zinc, or may be an oT insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes.

In the formulation of the invention it is preferred that the adjuvant composition induces a preferential Thl response. However it will be understood that other responses, including other humoral responses, are not excluded.

An immune response is generated to an antigen through the interaction of the antigen with the cells of the immune system. The resultant immune response may be broadly distinguished into two extreme catagories, being humoral or cell mediated immune responses (traditionally characterised by antibody and cellular effector mechanisms of protection respectively). These categories of response have been termed Th1-type responses (cell-mediated response), and Th2-type immune responses (humoral . response). : Extreme Thl-type immune responses may be characterised by the generation of antigen specific, haplotype restricted cytotoxic T lymphocytes, and natural killer cell responses. In mice Thl-type responses are often characterised by the generation of antibodies of the IgG2a subtype, whilst in the human these correspond to IgGl type antibodies. Th2-type immune responses are characterised by the generation of a broad range of immunoglobulin isotypes including in mice IgGl, IgA, and IgM.

It can be considered that the driving force behind the development of these two types . of immune responses are cytokines, a number of identified protein messengers which serve to help the cells of the immune system and steer the eventual immune response to either a Thi or Th2 response. Thus high levels of Th1-type cytokines tend to favour the induction of cell mediated immune responses to the given antigen, whilst high levels of Th2-type cytokines tend to favour the induction of humoral immune responses to the antigen.

It is important to remember that the distinction of Th and Th2-type immune responses 1s not absolute. In reality an individual will support an immune response ~~ whichis described as being predominantly Th! or predominantly Th2. However, it is So often convenient to consider the families of cytokines in terms of that described in murine CD4 +ve T cell clones by Mosmann and Coffman (Mosmann, T.R. and

Coffman, R.L. (1989) THI and TH? cells: different patterns of lymphokine secretion lead to different functional properties. Annual Review of Immunology, 7, p145-173).

Traditionally, Th1-type responses are associated with the production of the INF-y and

IL-2 cytokines by T-lymphocytes. Other cytokines often directly associated with the induction of Thl-type immune responses are not produced by T-cells, such as IL-12.

In contrast, Th2- type responses are associated with the secretion of IL-4, IL-5, 1L.-6,

IL-10 and tumour necrosis factor-p(TNF-B).

It is known that certain vaccine adjuvants are particularly suited to the stimulation of either Th1 or Th2 - type cytokine responses. Traditionally the best indicators of the

Th1:Th2 balance of the immune response after a vaccination or infection includes direct measurement of the production of Thi or Th2 cytokines by T lymphocytes in vitro after restimulation with antigen, and/or the measurement of the IgG1:I1gG2a ratio of antigen specific antibody responses.

1 WO 01/54719 PCT/EP01/00944

Thus, a Thl-type adjuvant is ¢ ne which stimulates isolated T-cell populations to produce high levels of Thl-ty}e cytokines when re-stimulated with antigen in vitro, and induces antigen specific irnmunoglobulin responses associated with Thl-type isotype. : Preferred Th1-type immunostimulants which may be formulated to produce adjuvants suitable for use in the present invention include and are not restricted to the following.

Monophosphory! lipid A, in particular 3-de-O-acylated monophosphoryl lipid A (3D-

MPL), is a preferred Thl-type immunostimulant for use in the invention. 3D-MPL is a well known adjuvant manufactured by Ribi Immunochem, Montana. Chemically it is often supplied as a mixture of 3-de-O-acylated monophosphoryl lipid A with either 4, 5, or 6 acylated chains. It can be purified and prepared by the methods taught in GB 2122204B, which reference also discloses the preparation of diphosphoryl lipid A, and 3-O-deacylated variants thereof. Other purified and synthetic lipopolysaccharides Ce have been described (US 6,005,099 and EP 0 729 473 BI; Hilgers et al., 1986,

Int. Arch. Allergy Immunol. 79(4):392-6; Hilgers et al., 1987, Immunology, 60(1):141- 6; and EP 0 549 074 B1). A preferred form of 3D-MPL is in the form of a particulate formulation having a small particle size less than 0.2um in diameter, and its method of manufacture is disclosed in EP 0 689 454.

Saponins are also preferred Th1 immunostimulants in accordance with the invention.

Saponins are well known adjuvants and are taught in: Lacaille-Dubois, M and Wagner

H. (1996. A review of the biological and pharmacological activities of saponins.

Phytomedicine vol 2 pp 363-386). For example, Quil A (derived from the bark of the

South American tree Quillaja Saponaria Molina), and fractions thereof, are described in US 5,057,540 and “Saponins as vaccine adjuvants”, Kensil, C. R., Crit Rev Ther

Drug Carrier Syst, 1996, 12 (1-2):1-55; and EP 0 362 279 B1. The haemolytic saponins QS21 and QS17 (HPLC purified fractions of Quil A) have been described as potent systemic adjuvants, and the method of their production is disclosed in US . Patent No. 5,057,540 and EP 0 362 279 B1. Also described in these references is the use of QS7 (a non-haemolytic fraction of Quil-A) which acts as a potent adjuvant for systemic vaccines. Use of QS21 is further described in Kensil er al. (1991. J.

vo © WO 01/54719 PCT/EP01/00944

Immunology vol 146, 431-437). Combinations of QS21 and polysorbate or cyclodextrin are also known (WO 99/10008). Particulate adjuvant systems comprising fractions of QuilA, such as QS21 and QS7 are described in WO 96/33739 . and WO 96/11711. ) Another preferred immunostimulant is an immunostimulatory oligonucleotide containing unmethylated CpG dinucleotides (“CpG”). CpG is an abbreviation for cytosine-guanosine dinucleotide motifs present in DNA. CpG is known in the art as being an adjuvant when administered by both systemic and mucosal routes (WO 96/02555, EP 468520, Davis et al., J. Immunol, 1998, 160(2):870-876; McCluskie and

Davis, J.Immunol., 1998, 161(9):4463-6). Historically, it was observed that the DNA fraction of BCG could exert an anti-tumour effect. In further studies, synthetic oligonucleotides derived from BCG gene sequences were shown to be capable of inducing immunostimulatory effects (both in vitro and in vivo). The authors of these .-.. studies concluded that certain palindromic sequences, including a central CG motif, So carried this activity. The central role of the CG motif in immunostimulation was later elucidated in a publication by Krieg, Nature 374, p546 1995. Detailed analysis has shown that the CG motif has to be in a certain sequence context, and that such sequences are common in bacterial DNA but are rare in vertebrate DNA. The immunostimulatory sequence is often: Purine, Purine, C, G, pyrimidine, pyrimidine; wherein the CG motif is not methylated, but other unmethylated CpG sequences are known to be immunostimulatory and may be used in the present invention.

In certain combinations of the six nucleotides a palindromic sequence is present.

Several of these motifs, either as repeats of one motif or a combination of different motifs, can be present in the same oligonucleotide. The presence of one or more of these immunostimulatory sequences containing oligonucleotides can activate various immune subsets, including natural killer cells (which produce interferon y and have } cytolytic activity) and macrophages (Wooldrige et al Vol 89 (no. 8), 1977). Other unmethylated CpG containing sequences not having this consensus sequence have - also now been shown to be immunomodulatory.

ve . WO 01/54719 PCT/EP01/00944

CpG when formulated into vaccines, is generally administered in free solution together with free antigen (WO 96/02555; McCluskie and Davis, supra) or covalently conjugated to an antigen (WO 98/16247), or formulated with a carrier such as . aluminium hydroxide ((Hepatitis surface antigen) Davis et al. supra ; Brazolot-Millan et al., Proc. Natl. Acad.Sci., USA, 1998, 95(26), 15553-8).

Such immunostimulants as described above may be formulated together with carriers, such as for example liposomes, oil in water emulsions, and or metallic salts, including aluminium salts (such as aluminium hydroxide). For example, 3D-MPL may be formulated with aluminium hydroxide (EP 0 689 454) or oil in water emulsions (WO 95/17210); QS21 may be advantageously formulated with cholesterol containing liposomes (WO 96/33739), oil in water emulsions (WO 95/17210) or alum (WO 98/15287); CpG may be formulated with alum (Davis et al. supra ; Brazolot-Millan supra) or with other cationic carriers.

Combinations of immunostimulants are also preferred, in particular a combination of a monophosphoryl lipid A and a saponin derivative (WO 94/00153; WO 95/17210;

WO 96/33739; WO 98/56414; WO 99/12565; WO 99/11241), more particularly the combination of QS21 and 3D-MPL as disclosed in WO 94/00153. Alternatively, a combination of CpG plus a saponin such as QS21 also forms a potent adjuvant for use in the present invention.

Thus, suitable adjuvant systems include, for example, a combination of monophosphory! lipid A, preferably 3D-MPL, together with an aluminium salt.

An enhanced system involves the combination of a monophosphoryl lipid A and a saponin derivative particularly the combination of QS21 and 3D-MPL as disclosed in

WO 94/00153, or a less reactogenic composition where the QS21 is quenched in cholesterol containing liposomes (DQ) as disclosed in WO 96/33739.

A particularly potent adjuvant formulation involving QS21, 3D-MPL & tocopherol in . an oil in water emulsion is described in WO 95/17210 and is another preferred formulation for use in the invention.

Another preferred formulation comprises a CpG oligonucleotide alone or together with an aluminium salt. : In another aspect of the invention, the vaccine may contain DNA encoding one or more of the Tat, Nef and gp120 polypeptides, such that the polypeptide is generated in : situ. The DNA may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems such as plasmid DNA, bacteria and viral expression systems. Numerous gene delivery techniques are well known in the art, such as those described by Rolland, Crit. Rev.

Therap. Drug Carrier Systems 15:143-198, 1998 and references cited therein.

Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal).

When the expression system is a recombinant live microorganism, such as a virus or bacterium, the gene of interest can be inserted into the genome of a live recombinant } virus or bacterium. Inoculation and in vivo infection with this live vector will tead to oT in vivo expression of the antigen and induction of immune responses. Viruses and bacteria used for this purpose are for instance: poxviruses (e.g; vaccinia, fowlpox, canarypox, modified poxviruses e.g. Modified Virus Ankara (MVA)), alphaviruses (Sindbis virus, Semliki Forest Virus, Venezuelian Equine Encephalitis Virus), flaviviruses (yellow fever virus, Dengue virus, Japanese encephalitis virus), adenoviruses, adeno-associated virus, picornaviruses (poliovirus, rhinovirus), herpesviruses (varicella zoster virus, etc), Listeria, Salmonella , Shigella, Neisseria,

BCG. These viruses and bacteria can be virulent, or attenuated in various ways in order to obtain live vaccines. Such live vaccines also form part of the invention.

Thus, the Nef, Tat and gp120 components of a preferred vaccine according to the invention may be provided in the form of polynucleotides encoding the desired proteins.

Furthermore, immunisations according to the invention may be performed with a } combination of protein and DNA-based formulations. Prime-boost immunisations are considered to be effective in inducing broad immune responses. Adjuvanted protein vaccines induce mainly antibodies and T helper immune responses, while delivery of

DNA as a plasmid or a live vector induces strong cytotoxic T lymphocyte (CTL)

’ + WO 01/54719 PCT/EP01/00944 responses. Thus, the combin: tion of protein and DNA vaccination will provide for a wide variety of immune respc nses. This is particularly relevant in the context of HIV, since both neutralising antibo lies and CTL are thought to be important for the immune defence against HIV. . In accordance with the invention a schedule for vaccination with gp120, Nef and Tat, - alone or in combination, may comprise the sequential (“prime-boost”) or simultaneous administration of protein antigens and DNA encoding the above- mentioned proteins. The DNA may be delivered as plasmid DNA or in the form of a recombinant live vector, e.g. a poxvirus vector or any other suitable live vector such as those described herein. Protein antigens may be injected once or several times followed by one or more DNA administrations, or DNA may be used first for one or more administrations followed by one or more protein immunisations. ~~ Aparticular example of prime-boost immunisation according to the invention oo involves priming with DNA in the form of a recombinant live vector such as a modified poxvirus vector, for example Modified Virus Ankara (MVA) or a alphavirus, for example Venezuelian Equine Encephalitis Virus followed by boosting with a protein, preferably an adjuvanted protein.

Thus the invention further provides a pharmaceutical kit comprising: a) a composition comprising one or more of gp120, Nef and Tat proteins together with a pharmaceutically acceptable excipient; and b) a composition comprising one or more of gp120, Nef and Tat-encoding polynucleotides together with a pharmaceutically acceptable excipient; with the proviso that at least one of (a) or (b) comprises gp120 with Nef and/or Tat and/or Nef-Tat.

Compositions a) and b) may be administered separately, in any order, or together.

Preferably a) comprises all three of gp120, Nef and Tat proteins. Preferably b) comprises all three of gp120, Nef and Tat DNA. Most preferably the Nef and Tat are in the form of a NefTat fusion protein.

In a further aspect of the present invention there is provided a method of manufacture of a vaccine formulation as herein described, wherein the method comprises admixing a combination of proteins according to the invention. The protein composition may be mixed with a suitable adjuvant and, optionally, a carrier. : Particularly preferred adjuvant and/or carrier combinations for use in the formulations according to the invention are as follows: ' 1) 3D-MPL + QS21 in DQ if) Alum + 3D-MPL 11) Alum + QS21 in DQ + 3D-MPL 1v) Alum + CpG

Vv) 3D-MPL + QS21 in DQ + oil in water emulsion vi) CpG

The invention is illustrated in the accompanying examples and Figures:

EXAMPLES

: General

The Nef gene from the Bru/Lai isolate (Cell 40: 9-17, 1985) was selected for the constructs of these experiments since this gene is among those that are most closely related to the consensus Nef .

The starting material for the Bru/Lai Nef gene was a 1170bp DNA fragment cloned on the mammalian expression vector pcDNA3 (pcDNA3/Nef).

The Tat gene originates from the BH10 molecular clone. This gene was received as an HTLV III cDNA clone named pCV1 and described in Science, 229, p69-73, 1985. ~The expression of the Nef and Tat genes could be in Pichia or any other host. CL

Example 1. EXPRESSION OF HIV-1 nef AND tat SEQUENCES IN PICHIA

PASTORIS.

Nef protein, Tat protein and the fusion Nef -Tat were expressed in the methylotrophic yeast Pichia pastoris under the control of the inducible alcohol oxidase (AOX1) promoter.

To express these HIV-1 genes a modified version of the integrative vector PHIL-D2 (INVITROGEN) was used. This vector was modified in such a way that expression of heterologous protein starts immediately after the native ATG codon of the AOX1 gene and will produce recombinant protein with a tail of one glycine and six histidines residues . This PHIL-D2-MOD vector was constructed by cloning an oligonucleotide ’ linker between the adjacent Asull and EcoRI sites of PHIL-D2 vector (see Figure 2).

In addition to the His tail, this linker carries Ncol, Spel and Xbal restriction sites between which nef, tat and nef-tat fusion were inserted.

1.1 CONSTRUCTION OF THE INTEGRATIVE VECTORS pRIT14597 (encoding Nef-His protein), pRIT14598 (encoding Tat-His protein) and pRIT14599 (encoding fusion Nef-Tat-His).

The nef gene was amplified by PCR from the pcDNA3/Nef plasmid with primers 01 y and 02.

Ncol

PRIMER 01 (Seq ID NO 1): 5’ ATCGTCCATG.GGT.GGC.AAG.TGG.T 3’

Spel

PRIMER 02 (Seq ID NO 2): 5° CGGCTACTAGTGCAGTTCTTGAA 3°

The PCR fragment obtained and the integrative PHIL-D2-MOD vector were both restricted by Ncol and Spel, purified on agarose gel and ligated to create the integrative plasmid pRIT14597 (see Figure 2).

The rat gene was amplified by PCR from a derivative of the pCV1 plasmid with primers 05 and 04:

Spel

PRIMER 04 (Seq ID NO 4): 5° CGGCTACTAGTTTCCTTCGGGCCT 3’

Ncol ’ PRIMER 05 (Seq ID NO 5): 5’ATCGTCCATGGAGCCAGTAGATC 3’

An Ncol restriction site was introduced at the 5° end of the PCR fragment while a

Spel site was introduced at the 3’ end with primer 04. The PCR fragment obtained and the PHIL-D2-MOD vecto- were both restricted by Ncol and Spel, purified on agarose gel and ligated to create the integrative plasmid pRIT14598. . To construct pRIT14599, a 910bp DNA fragment corresponding to the nef-tat-His coding sequence was ligated between the EcoRI blunted(T4 polymerase) : and Ncol sites of the PHIL-D2-MOD vector. The nef-tat-His coding fragment was obtained by Xbal blunted(T4 polymerase) and Ncol digestions of pRIT 14596. 1.2 TRANSFORMATION OF PICHIA PASTORIS STRAIN GS115(his4).

To obtain Pichia pastoris strains expressing Nef-His, Tat-His and the fusion Nef-Tat-

His, strain GS115 was transformed with linear NotI fragments carrying the respective expression cassettes plus the HIS4 gene to complement his4 in the host genome. Transformation of GS115 with Notl-linear fragments favors recombination at the AOXI locus. Co

Multicopy integrant clones were selected by quantitative dot blot analysis and the type of integration, insertion (Mut phenotype) or transplacement (Mut’phenotype), was determined.

From each transformation, one transformant showing a high production level for the recombinant protein was selected :

Strain Y1738 (Mut” phenotype) producing the recombinant Nef-His protein, a myristylated 215 amino acids protein which is composed of: °Myristic acid °A methionine, created by the use of Ncol cloning site of PHIL-D2-MOD vector °205 a.a. of Nef protein(starting at a.a.2 and extending to a.a.206) . °A threonine and a serine created by the cloning procedure (cloning at Spel site of PHIL-D2-MOD vector. °One glycine and six histidines.

Strain Y1739 (Mut” phenotype) producing the Tat-His protein, a 95 amino acid protein which is composed of: - °A methionine created by the use of Ncol cloning site °85 a.a. of the Tat protein(starting at a.a.2 and extending to a.2.86) °A threonine and a serine introduced by cloning procedure °One glycine and six histidines

Strain Y1737(Mut’® phenotype) producing the recombinant Nef-Tat-His fusion protein, a myristylated 302 amino acids protein which is composed of: °Myristic acid °A methionine, created by the use of Ncol cloning site oo °205a.a. of Nef protein(starting at a.a.2 and extending to 2.2.206) co °A threonine and a serine created by the cloning procedure °85a.a. of the Tat protein(starting at a.a.2 and extending to a.a.86) °A threonine and a serine introduced by the cloning procedure °One glycine and six histidines

Example 2. EXPRESSION OF HIV-1 Tat-MUTANT IN PICHIA PASTORIS

A mutant recombinant Tat protein has also been expressed. The mutant Tat protein must be biologically inactive while maintaining its immunogenic epitopes.

A double mutant tar gene, constructed by D.Clements (Tulane University) was selected for these constructs.

This tat gene (originates from BH10 molecular clone) bears mutations in the active . site region (Lys41—Ala)and in RGD motif (Arg78—Lys and Asp80—Glu) (Virology 235: 48-64, 1997).

; + WO 01/54719 PCT/EP01/00944

The mutant zat gene was received as a cDNA fragment subcloned between the EcoRI and HindIII sites within a CMV expression plasmid (pCMVLys41/KGE) 2.1 CONSTRUCTION OF THE INTEGRATIVE VECTORS i PRIT14912(encoding Tat mutant-His protein) and pRIT14913(encoding fusion

Nef-Tat mutant-His).

The tat mutant gene was amplified by PCR from the pCMVLys41/KGE plasmid with primers 05 and 04 (see section 1.1construction of pRIT14598)

An Ncol restriction site was introduced at the 5’ end of the PCR fragment while a

Spel site was introduced at the 3° end with primer 04. The PCR fragment obtained and the PHIL-D2-MOD vector were both restricted by Ncol and Spel, purified on agarose gel and ligated to-create the integrative plasmid pRIT14912 ) CT

To construct pRIT14913, the tar mutant gene was amplified by PCR from the pCMVLys41/KGE plasmid with primers 03 and 04.

Spel

PRIMER 03 (Seq ID NO 3): 5 ATCGTACTAGT.GAG.CCA.GTA.GAT.C3

Spel

PRIMER 04 (Seq ID NO 4): 5 CGGCTACTAGTTTCCTTCGGGCCT 3’

The PCR fragment obtained and the plasmid pRIT14597 (expressing Nef-His protein) were both digested by Spel restriction enzyme, purified on agarose gel and ligated to create the integrative plasmid pRIT14913 2.2 TRANSFORMATION OF PICHIA PASTORIS STRAIN GS115.

N . WO 01/54719 PCT/EP01/00944

Pichia pastoris strains expressing Tat mutant-His protein and the fusion Nef-Tat mutant-His were obtained, by applying integration and recombinant strain selection strategies previously described in section 1.2.

Two recombinant strains producing Tat mutant-His protein ,a 95 amino-acids protein, - were selected: Y1775 (Mut” phenotype) and Y 1776(Mut® phenotype).

One recombinant strain expressing Nef-Tat mutant-His fusion protein, a 302 amino- acids protein was selected: Y1774(Mut” phenotype).

Example 3: FERMENTATION OF PICHIA PASTORIS PRODUCING

RECOMBINANT TAT-HIS. : -- A typical process is described in the table hereafter.

Fermentation includes a growth phase (feeding with a glycerol-based medium according to an appropriate curve) leading to a high cell density culture and an induction phase (feeding with a methanol and a salts/micro-elements solution). During fermentation the growth is followed by taking samples and measuring their absorbance at 620 nm. During the induction phase methanol was added via a pump and its concentration monitored by Gas chromatography (on culture samples) and by on-line gas analysis with a Mass spectrometer. After fermentation the celis were recovered by centrifugation at 5020g during 30’ at 2-8°C and the cell paste stored at — 20°C. For further work cell paste was thawed, resuspended at an OD (at 620 nm) of 150 in a buffer (Na2HPO4 pH7 50 mM, PMSF 5%, Isopropanol 4 mM) and disrupted by 4 passages in a DynoMill (room 0.6L, 3000 rpm, 6L/H, beads diameter of 0.40- 0.70 mm).

For evaluation of the expression samples were removed during the induction, disrupted and analyzed by SDS-Page or Western blot. On Coomassie blue stained : SDS-gels the recombinant Tat-his was clearly identified as an intense band presenting a maximal intensity after around 72-96H induction.

Lo © WO 01/54719 PCT/EP01/00944 v

Solid preculture Synthetic medium: YNB + glucose + agar

EC ov rr

Liquid preculture in two 2L erlenmeyer Synthetic medium: 2 x 400 ml YNB + glycerol

I

Inoculation of a 20L fermentor SL initial medium (FSCO06AA) 3 ml antifoam SAG471 (from Witco)

Set-points: Temperature : 30°C

Overpressure: 0.3 barg ] Air flow: 20 NV/min : Dissolved 02: regulated > 40% pH : regulated at 5 by NH,OH

I

Fed-batch fermentation: growth phase Feeding with glycerol-based medium FFBOOSAA

Duration: up to 97H. solution (FSE021AB).

I

I eeweimemienoc 000 rr OOO]

Isopropanol 4 mM

Cell disruption in Dyno-mill Dvno-mill: (room 0.6L, 3000 rpm, 6L/H, beads

I

CL "WO 01/54719 PCT/EP01/00944

Media used for fermentation:

Solid preculture: (YNB + glucose + agar)

Glucose: 10 g/l Na2Mo04.2H20: 0.0002 g/l Acide folique: 0.000064 g/1 . KH2PO4: 1 g/l MnS04.H20: 0.0004 g/1 Inositol: 0.064 g/l

MgSO4.7H20: 0.5 g/l H3BO3: 0.0005 g/1 Pyridoxine: 0.008 g/1

CaCl2.2H20: 0.1 g/l Kl: 0.0001 g/1 Thiamine: 0.008 g/l i NaCl: 0.1 g/1 CoCI2.6H20: 0.00009 g/l Niacine: 0.000032 g/1

FeCl3.6H20: 0.0002 g/l Riboflavine: 0.000016 g/l Panthoténate Ca: 0.008 g/l

CuS04.5H20: 0.00004 g/1 Biotine: 0.000064 g/1 Para-aminobenzoic acid: 0.000016 g/l

ZnSO4.7H20: 0.0004 g/t (NH4)2S504: 5 g/l Agar 18 g/l

Liquid preculture .(YNB + glvcerol)

Glycerol: 2% (viv) Na2MoQO4.2H20: 0.0002 g/ Acide folique: 0.000064 g/1

KH2PO4: 1g MnS04.H20: 0.0004 g/1 Inositol: 0.064 g/l

MgS04.7TH20: 0.5g/1 H3BO3: 0.0005 g/l Pyridoxine: 0.008 g/l

CaCl2.2H20: 0.1 gN KI: 0.0001 g/t Thiamine: 0.008 g/l

NaCl: 0.1 g/l CoCI2.6H20: 0.00009 g/1 Niacine: 0.000032 g/1

FeCl3.6H20: 0.0002 g/1 Riboflavine: 0.000016 g/l Panthoténate Ca: 0.008 g/1

CuS04.5H20: 0.00004 g/l Biotine: 0.000064 g/1 Para-aminobenzoic acid: 0.000016 g/]

ZnSO4.7H20: 0.0004 g/1 (NH4)2504: 5 g/l

Initial fermentor charge: (FSCO06AA) (NH4),S04: 64 g/l

KH2PO4: 9 g/l Na2Mo04.2H20: 2.04 mg/l

MgSO04.7H20: 4.7 g/l MnS04.H20: 4.08 mg/l

CaCl2.2H20: 0.94 gn H3BO3: 5.1 mg/l

FeCl3.6H20: 10 mg/l KI: 1.022 mg

HCl: 1.67 ml/l CoCl2.6H20: 0.91mg/l

CuSO04.5H20: 0.408 mg/l NaCk 0.06 g/l

ZnSO4.7H20: 4.08 mg/l Biotine: 0.534 mg/l

Feeding solution used for growth phase (FFBO0SAA)

Glycérol: 38.7 % viv Na2Mo04.2H20: 5.7 mg/l

MgS04.7H20: 13 g/l CuS0O4.5H20: 1.13 mg/l

CaCl2.2H20: 26 g/l CoCl12.6H20: 2.5 mg/l

FeCl3.6H20: 27.8mg/ H3BO3: 14.2 mg/l

ZnS04.7H20 11.3 mg/l Biotine: 1.5 mg/l

MnS04.H20: 11.3 mg/l KI: 2.84mg/]

KH2PO4: 24.93 g/l NaCl: 0.167 g/l

Feeding solution of salts and micro-elements used during induction (FSE021AB): : KH2PO4: 45 g/l Na2Mo04.2H20: 10.2 mg/l

MgS04.7H20: 23.5g/1 . MnS04.H20: 20.4 mg/l

CaCl2.2H20: 4.70 g/l H3BO3: 25.5 mg/l ‘ NaCl: 0.3 g1 KI: 5.11 mg/l

HCl: 8.3 mint CoCl12.6H20: 4.55mg/

CuSO4.5H20: 2.04 mg/l FeCl3.6H20: 50.0 mg/l

ZnSO4.7H20: 20.4 mg/l Biotine: 2.70 mg/l

Example 4: PURIFICATION OF Nef-Tat-His FUSION PROTEIN (PICHIA

PASTORIS)

The purification scheme has been developed from 146g of recombinant Pichia . pastoris cells (wet weight) or 2L Dyno-mill homogenate OD 55. The chromatographic steps are performed at room temperature. Between steps , Nef-Tat positive fractions are kept overnight in the cold room (+4°C) ; for longer time, samples are frozen at -20°C. 146g of Pichia pastoris cells

NZ

Homogenization Buffer: 2. 50 mM PO4 pH 7.0

B | | | final OD:50 oo

NZ

Dyno-mill disruption (4 passes)

J

Centrifugation JA10 rotor / 9500 rpm/ 30 min / room temperature

J

Dyno-mill Pellet

NZ

Wash Buffer: +2L 10 mM POs pH 7.5 - o . (1h - 4°C) 150mM - NaCl 0,5% empigen

NZ

Centrifugation JA10 rotor / 9500 rpm/ 30 min / room temperature

Vv

» r WO 01/54719 PCT/EP01/00944

Pellet

NJ

Solubilisation Buffer: + 660ml 10 mM PO; pH (ON _ 4°C) 7.5 - 150mM NaCl - 4.0M GuHCl ‘ J

Reduction + 0,2M 2-mercaptoethanesulfonic (4H — room temperature - in the dark) acid, sodium salt (powder addition) / pH adjusted to 7.5 (with 0,5M NaOH solution) before incubation

NZ carbamidomethylation + 0,25M lodoacetamide (powder (1/2 h - room temperature - in the dark) addition) / pH adjusted to 7.5 (with 0,5M NaOH solution) before incubation

NZ

Immobilized metal ion affinity Equilibration buffer: 10 mM PO, chromatography on Ni" "-NTA-Agarose pH 7.5 - 150mM NacCl - 4.0M (Qiagen - 30 ml of resin) GuHCl

Washing buffer: 1) Equilibration buffer 2) 10 mM PO, pH 7.5 - 150mM NaCl - 6M Urea 3) 10 mM PO, pH 7.5 - 150mM NaCl - 6M Urea ' -25 mM Imidazol

Elution buffer: 10 mM PO, pH 7.5 - 150mM NaCl - 6M Urea - 0,5M

Imidazol u rr WO 01/54719 PCT/EP01/00944

NZ

Dilution Down to an ionic strength of 18 mS/cm?

Dilution buffer: 10 mM PO, pH : 7.5 - 6M Urea

V

Cation exchange chromatography on SP Equilibration buffer: 10 mM PO,

Sepharose FF pH 7.5 - 150mM NaCl - 6.0M (Pharmacia - 30 ml of resin) Urea

Washing buffer: 1) Equilibration buffer 2) 10 mM PO ~ SL oo oo pH 7.5.-250mM NaCl - 6M Urea Ce

Elution buffer: 10 mM Borate pH 9.0 - 2M NaCl - 6M Urea

NZ

Concentration up to 5S mg/ml 10kDa Omega membrane(Filtron)

NZ

Gel filtration chromatography on Elution buffer: 10 mM PO4 pH 7.5

Superdex200 XK 16/60 - 150mM NaCl - 6M Urea (Pharmacia - 120 ml of resin) 5 ml of sample / injection =» 5 injections

J

) Dialysis Buffer: 10 mM PO, pH 6.8 -

I

(O/N - 4°C) 150mM NaCl - 0,5M Arginin

J

Sterile filtration Millex GV 0,22um

“ + WO 01/54719 PCT/EP01/00944 * ratio: 0,5M Arginin for a protein concentration of 1600pg/ml.

Purity . The level of purity as estimated by SDS-PAGE is shown in Figure 3 by Daiichi

Silver Staining and in Figure 4 by Coomassie blue G250.

After Superdex200 step: > 95%

After dialysis and sterile filtration steps: > 95%

Recovery 51mg of Nef-Tat-his protein are purified from 146g of recombinant Pichia pastoris cells (= 2L of Dyno-mill homogenate OD 55)

Example 5: PURIFICATION OF OXIDIZED NEF-TAT-HIS FUSION

PROTEIN IN PICHIA PASTORIS

The purification scheme has been developed from 73 g of recombinant Pichia pastoris cells (wet weight) or | L Dyno-mill homogenate OD 50. The chromatographic steps are performed at room temperature. Between steps , Nef-Tat positive fractions are kept overnight in the cold room (+4°C) ; for longer time, samples are frozen at -20°C. 73 g of Pichia pastoris cells 2

Homogenization Buffer: 1L 50 mM POs pH 7.0 -

Pefabloc 5 mM final OD:50 2

Dyno-mill disruption (4 passes)

NZ

Centrifugation JA10 rotor / 9500 rpnv/ 30 min / room temperature

Vv . Dyno-mill Pellet

NJ

. Wash Buffer: +1L 10 mM PO4 pH 7.5 - 150 (2h - 4°C) mM NaCl - 0,5% Empigen

NZ

Centrifugation JA10 rotor / 9500 rpn/ 30 min / room temperature

Vv

Pellet

J

Solubilisation Buffer: + 330ml 10 mM POs pH 7.5 - i. Vv Co

Immobilized metal ion affinity Equilibration buffer: 10 mM PO, pH 7.5 chromatography on Ni”-NTA-Agarose — 150 mM NaCl - 4.0 M GuHCl (Qiagen - 15 ml of resin) Washing buffer: 1) Equilibration buffer 2) 10 mM PO4 pH 7.5

T= 150 mM NaCl-6 M

Urea 3) 10 mM PO, pH 7.5 - 150 mM NaCl-6M

Urea - 25 mM Imidazol

Elution buffer: 10 mM PO4 pH 7.5 - 150 mM NaCl-6 M Urea-0,5M

Imidazol

J

Dilution Down to an ionic strength of 18 mS/cm?

Dilution buffer: 10 mM POspH 7.5-6

M Urea

Vv

Cation exchange chromatography on SP Equilibration buffer: 10 mM PO4 pH

Sepharose FF 7.5 — 150 mM NaCl - 6.0 M Urea (Pharmacia - 7 ml of resin) Washing buffer: 1) Equilibration buffer 2) 10 mM PO4 pH 7.5 - 250 mM NaCl-6M

Urea

Elution buffer: 10 mM Borate pH 9.0 - 2 M NaCl - 6 M Urea

J

Concentration up to 0,8 mg/ml 10kDa Omega membrane(Filtron)

Vv

Dialysis Buffer: 10 mM PO4 pH 6.8 — 150 mM (O/N - 4°C) NaCl - 0,5 M Arginin

J

Sterile filtration Millex GV 0,22um =>» Level of purity estimated by SDS-PAGE is shown in Figure 6 (Daiichi Silver

Staining, Coomassie blue G250, Western blotting):

SL After dialysis and sterile filtration steps: > 95% - : =» Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA) 2,8 mg of oxidized Nef-Tat-his protein are purified from 73 g of recombinant

Pichia pastoris cells (wet weight) or 1 L of Dyno-mill homogenate OD 50.

Example 6: PURIFICATION OF REDUCED TAT-HIS PROTEIN (PICHIA

PASTORIS)

The purification scheme has been developed from 160 g of recombinant Pichia pastoris cells (wet weight) or 2L Dyno-mill homogenate OD 66. The chromatographic steps are performed at room temperature. Between steps, Tat . positive fractions are kept overnight in the cold room (+4°C) ; for longer time, samples are frozen at -20°C.

160 g of Pichia pastoris cells

J

Homogenization Buffer: +2 L 50 mM PO, pH 7.0 — 4 mM PMSF final OD:66 \4 .

Dyno-mill disruption (4 passes)

J

Centrifugation JA10 rotor / 9500 rpm / 30 min / room temperature

J

Dyno-mill Pellet

J

Wash Buffer: +2 L 10 mM PO; pH 7.5 — 150 mM NaCl (1h - 4°C) - 1% Empigen \ 2

Co Centrifugation JA 10 rotor / 9500 rpm / 30 min / room temperature oo

NZ

Pellet 2

Solubilisation Buffer: + 660 ml 10 mM PO, pH 7.5 - 150 mM (O/N - 4°C) NaCl - 4.0 M GuHCl

NZ

Centrifugation JA10 rotor / 9500 rpm / 30 min / room temperature

NE

Reduction + 0,2 M 2-mercaptoethanesulfonic acid, sodium (om cope ted $38 Gor in 8 aye 13

NZ carbamidomethylation + 0,25 M lodoacetamide (powder addition) / pH (1/2 h - room temperature - in the dark) dusted 7.5 (with 1 M NaOH solution) before

NZ

Immobilized metal ion affinity Equilibration buffer: 10 mM PO, pH 7.5 - 150 mM chromatography on Ni™-NTA-Agarose NaCl - 4.0 M GuHCl (Qiagen - 60 ml of resin) Washing buffer: 1) Equilibration buffer 2) 10 mM PO, pH 7.5 - 150 mM

NaCl - 6 M Urea 3) 10 mM PO, pH 7.5 - 150 mM

NaCl - 6M Urea - 35 mM

Imidazol

Elution buffer: 10 mM PO, pH 7.5 —- 150 mM NaCl — 6 M Urea - 0,5 M Imidazol

NY

} Dilution Down to an ionic strength of 12 mS/cm

Dilution buffer: 20 mM Borate pH 8.5 —- 6 M Urea

NZ

Cation exchange chromatography on SP Equilibration buffer: 20 mM Borate pH85 -

Sepharose FF 150 mM NaCl - 6.0 M Urea (Pharmacia - 30 ml of resin) Washing buffer: Equilibration buffer

Elution buffer: 20 mM Borate pH 8.5 — 400 mM

NaCl - 6.0 M Urea

Jv

Concentration up to 1,5 mg/ml oo : 10kDa Omega membrane(Filtron) oT

Jv

Dialysis Buffer: 10 mM PO, pH 6.8 — 150 mM NaCl - (O/N - 4°C) 0,5 M Arginin

Vv

Sterile filtration Millex GV 0,22 ym =» Level of purity estimated by SDS-PAGE as shown in Figure 7(Daiichi Silver

Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: > 95% x => Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA) : 48 mg of reduced Tat-his protein are purified from 160 g of recombinant

Pichia pastoris cells (wet weight) or 2 L of Dyno-mill homogenate OD 66.

Example 7: Purification of oxidized Tat-his protein (Pichia Pastoris)

The purification scheme has been developed from 74 g of recombinant Pichia pastoris cells (wet weight) or 1L Dyno-mill homogenate OD60. The chromatographic steps are performed at room temperature. Between steps, Tat positive fractions are kept overnight in the cold room (+4°C) ; for longer time, samples are frozen at -20°C. 74 g of Pichia pastoris cells 2

Homogenization Buffer: +1 L 50 mM PO4 pH 7.0 — 5 mM Pefabloc final OD:60

J

... Dyno-mill disruption (4 passes) I

J

Centrifugation JA10 rotor / 9500 rpm / 30 min / room temperature 2

Dyno-mill Pellet 2

Wash Buffer:+1 L 10 mM PO4 pH 7.5 - 150 mM NaCl (1h - 4°C) - 1% Empigen

J

Centrifugation JA10 rotor / 9500 rpm / 30 min / room temperature

J

Pellet

NZ

Solubilisation Buffer: + 330 ml 10 mM PO, pH 7.5 - 150 mM (ON - 4°C) NaCl - 4.0 M GuHCl . NZ

Centrifugation JA10 rotor / 9500 rpm / 30 min / room temperature . NP

Immobilized metal ion affinity Equilibration buffer: 10 mM PO, pH 7.5 -150 mM chromatography on Ni"*-NTA-Agarose NaCl - 4.0 M GuHCl (Qiagen - 30 ml of resin) Washing buffer: 1) Equilibration buffer : : 2) 10mM PO4 pH 7.5 - 150 mM

NaCl -6 M Urea . 3) 10 mM PO4 pH 7.5 - 150 mM

NaCl - 6 M Urea - 35 mM

Imidazol

Elution buffer: 10 mM PO, pH 7.5 — 150 mM

NaCl —- 6 M Urea - 0,5 M Imidazol

J

Dilution Down to an ionic strength of 12 mS/cm

Dilution buffer: 20 mM Borate pH 8.5 ~ 6 M Urea

NZ

Cation exchange chromatography on SP Equilibration buffer: 20 mM Borate pH 8.5 -

Sepharose FF 150 mM NaCl - 6.0 M Urea - (Pharmacia - 15 ml of resin) Washing buffer: 1) Equilibration buffer Bn 2) 20 mM Borate pH 8.5 - 400 mM NaCl - 6.0 M Urea

Elution buffer: 20 mM Piperazine pH 11.0 -2 M

NaCl —- 6 M Urea

NZ

Concentration up to 1,5 mg/ml kDa Omega membrane(Filtron)

J

Dialysis Buffer: 10 mM PO, pH 6.8 — 150 mM NaCl - (O/N - 4°C) 0,5 M Arginin

NZ

Sterile filtration Millex GV 0,22 pm =» Level of purity estimated by SDS-PAGE as shown in Figure 8 (Daiichi Silver

Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: > 95% > Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

bo » WO 01/54719 PCT/EP01/00944 19 mg of oxidized Ta:-his protein are purified from 74 g of recombinant

Pichia pastoris cells (wet weight) or 1 L of Dyno-mill homogenate OD 60. ’ Example 8: PURIFICATION OF SIV REDUCED NEF-HIS PROTEIN (PICHIA

PASTORIS)

The purification scheme has been developed from 340 g of recombinant Pichia pastoris cells (wet weight) or 4 L Dyno-mill homogenate OD 100. The chromatographic steps are performed at room temperature. Between steps , Nef positive fractions are kept overnight in the cold room (+4°C) ; for longer time, samples are frozen at -20°C. 340 g of Pichia pastoris cells

Vv

Homogenization Buffer: 4L 50 mM PO, pH 7.0 —~ PMSF 4 mM final OD:100

Vv

Dyno-mill disruption (4 passes)

NZ

Centrifugation JA10 rotor / 9500 rpm/ 60 min / room temperature

J

Dyno-mill Pellet

NZ

Solubilisation Buffer: + 2,6 L 10 mM PO, pH 7.5 - 150mM

NaCl - 4.0M GuHCl (O/N -4°C)

Vv

Centrifugation JA10 rotor / 9500 rpm / 30 min / room - temperature ¥

Reduction + 0,2 M 2-mercaptoethanesulfonic acid, sodium salt (powder addition) / pH adjusted t0 7.5 (with (4H - room temperature - in the dark)

I M NaOH solution) before incubation

NZ

Carbamidomethylation +0,25 M Iodoacetamide (powder addition) / pH . adjusted to 7.5 (with 1 M NaOH solution) i (1/2 h - room temperature - in the dark) before incubation ¥ . Immobilized metal ion affinity Equilibration buffer: 10 mM PO, pH 7.5 - 150 chromatography on Ni™-NTA-Agarose ~~ ™M NaCl- 4.0 M GuHCl (Qiagen - 40 ml of resin) Washing buffer: 1) Equilibration buffer 2) 10 mM PO, pH 7.5 - 150 mM NaCl -6 M Urea - mM Imidazol

Elution buffer: 10 mM PO, pH 7.5 — 150 mM

NaCl - 6 M Urea - 0,5 M Imidazol

WV

Concentration up to 3 mg/ml 10kDa Omega membrane(Filtron)

WV

Gel filtration chromatography on Elution buffer: 10 mM PO, pH 7.5 — 150.mM oe -

Superdex 200 NaCl - 6 M Urea (Pharmacia - 120 m! of resin)

J

Concentration up to 1,5 mg/ml 10kDa Omega membrane(Filtron)

J

Dialysis Buffer: 10 mM PO, pH 6.8 — 150 mM NaCl -

Empigen 0,3% (O/N - 4°C) ¥

Sterile filtration Millex GV 0,22um =>» Level of purity estimated by SDS-PAGE as shown in Figure 9 (Daiichi Silver

Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: > 95% - =>» Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

Claims (49)

= WO O01/54719 01-02-2002 EP0100944 '® CLAIMS

1. Use of a) an HIV Tat protein or polynucleotide; or b) an HIV Nef protein or polynucleotide; or ¢) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide (Nef-Tat); and an HIV gp120 protein or polynucleotide in the manufacture of a vaccine for the prophylactic or therapeutic immunisation of humans against HIV, wherein the Tat, Nef or Nef-Tat act in synergy with gp120 in the treatment or prevention of HIV.

2. Use as claimed in claim 1 wherein the vaccine in use reduces the HIV viral load in HIV infected humans.

3. Use as claimed in claims 1 or 2 wherein the vaccine in use results in a : maintenance of CD4+ levels over those levels found in the absence of vaccination } with HIV Tat, Nef or Nef-Tat and HIV gp120. NB

: 4. Use as claimed in any one of claims 1 — 3 wherein the vaccine further comprises an antigen selected from the group consisting of: gag, rev, vif, vpr, vpu.

5. Use as claimed in any one of claims 1 — 4 wherein the Tat protein is a mutated protein.

6. Use as claimed in any one of claims 1 — 5 wherein the Tat, Nef or Nef-Tat protein is reduced.

: 7. Use as claimed in any one of claims 1 — 6 wherein the Tat, Nef or Nef-Tat protein is carbamidomethylated.

8. Use as claimed in any one of claims 1 — 5 wherein the Tat, Nef or Nef-Tat protein is oxidised.

9. Use as claimed in any one of claims 1 — 8 which additionally comprises an adjuvant

10. Use as claimed in claim 9 wherein the adjuvant is a TH1 inducing adjuvant. 51 CLEAN CORY AMENDED SHEET

Loo + WO0O01/54719 01-02-2002 EP0100944 '®

11. Use as claimed in claim 9 or claim 10 wherein the adjuvant comprises - monophosphoryl lipid A or a derivative thereof such as 3-de-O-acylated monophosphoryl lipid A.

12. Use as claimed in any one of claims 9 — 11 additionally comprising a saponin adjuvant. oo

13. Use as claimed in any one of claims 9 — 12 additionally comprising an oil in water emulsion.

14. Use as claimed in claim 9 or claim 10 wherein the adjuvant comprises CpG motif-containing oligonucleotides.

15. Use as claimed in claim 14 further comprising an aluminium salt.

16. Use of a) an HIV Tat protein or polynucleotide; or - b) an HIV Nef protein or polynucleotide; or c) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide; : and an HIV gp120 protein or polynucleotide in the manufacture of a vaccine suitable for a prime-boost delivery for the prophylactic or therapeutic immunisation of humans

17. A method of immunising a human against HIV by administering to the human a vaccine comprising HIV Tat or HIV Nef or HIV NefTat in combination with HIV gp120 proteins or polynucleotides encoding them.

18. A vaccine composition for human use which vaccine composition comprises HIV Tat or HIV Nef or HIV Nef-Tat in combination with HIV gp120 proteins or polynucleotides encoding them.

19 A schedule for vaccination with gp120, nef and tat comprising the sequential administration of protein antigens and DNA encoding gp120, nef and tat.

20 A schedule according to claim 19, wherein the protein antigens are injected once or several times followed by one or more DNA administrations. 52 CLEAN COPY AMENDED SHEET

. PCT/EP01/00944

21 A schedule according to claim 19 wherein the DNA is used first for one or more administrations followed by one or more protein administrations.

22 Use of (a) a composition comprising gp120 Nef, Tat and gp120 proteins; and (b) a composition comprising gp120, Nef and Tat DNA in the preparation of a medicament for treatment of HIV, wherein (2) and (b) may be used separately, in any order or together.

23 Use of gp120, nef and tat protein antigens in the preparation of a medicament for the treatment

_ .._. of HIV in an individual to whom DNA encoding gp120, nef and tat protein antigens has been’ ~~ administered.

24 Use of DNA encoding gpl20, nef and tat protein antigens in the preparation of a medicament for the treatment of HIV in an individual to whom gp120, nef and tat protein antigens have been administered.

A vaccine for use in a method for the prophylactic or therapeutic immunisation of humans against HIV, said vaccine comprising a) an HIV Tat protein or polynucleotide; or b) an HIV Nef protein or polynucleotide; or c) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide (Nef-Tat); and an HIV gp120 protein or polynucleotide, wherein the Tat, Nef or Nef-Tat act in synergy with gpl120, and said method comprising administering said vaccine.

26 A vaccine for use in a method of treatment or prevention as claimed in claim 1 wherein the vaccine in use reduces the HIV viral load in HIV infected humans. - 53 - AMENDED SHEET

. PCT/EP01/00944

27 A vaccine for use in a method of treatment or prevention as claimed in claims 1 or 2 wherein the vaccine in use results in a maintenance of CD4+ levels over those levels found in the absence of vaccination with HIV Tat, Nef or Nef-Tat and HIV gp120.

28 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - 3 wherein the vaccine further comprises an antigen selected from the group consisting of: gag, rev, vif, vpr, vpu.

29 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - 4 wherein the Tat protein is a mutated protein.

30 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - wherein the Tat, Nef or Nef-Tat protein is reduced.

31 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - 6 wherein the Tat, Nef or Nef-Tat protein is carbamidomethylated.

32 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - 5 wherein the Tat, Nef or Nef-Tat protein is oxidised.

33 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 1 - 8 which additionally comprises an adjuvant.

34 A vaccine for use in a method of treatment or prevention as claimed in claim 9 wherein the adjuvant is a TH1 inducing adjuvant.

A vaccine for use in a method of treatment or prevention as claimed in claim 9 or claim 10 wherein the adjuvant comprises monophosphoryl lipid A or a derivative thereof such as 3-de-O- acylated monophosphoryl lipid A.

36 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 9 - 11 additionally comprising a saponin adjuvant.

- 54 - AMENDED SHEET

' PCT/EP01/00944

37 A vaccine for use in a method of treatment or prevention as claimed in any one of claims 9 - 12 additionally comprising an oil in water emulsion.

38 A vaccine for use in a method of treatment or prevention as claimed in claim 9 or claim 10 wherein the adjuvant comprises CpG motif-containing oligonucleotides.

39 A vaccine for use in a method of treatment or prevention as claimed in claim 14 further comprising an aluminium salt.

40 A vaccine for use in a method for the prophylactic or therapeutic immunisation of humans against HIV, said vaccine comprising a) an HIV Tat protein or polynucleotide; or

~b) an HIV Nef protein or polynucleotide; or . ©) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide; a. and an HIV gp120 protein or polynucleotide, and said method comprising administering said vaccine wherein said vaccine is for a prime- boost delivery.

41 A substance or composition for use in a method for treatment of HIV, said substance or composition comprising (a) a composition comprising gp120 Nef, Tat and gp120 proteins; and (b) a composition comprising gpl120, Nef and Tat DNA and said method comprising administering said substance or composition, wherein (a) and (b) may be used separately, in any order or together.

42 A substance or composition for use in a method for the treatment of HIV, said substance or composition comprising gp120, nef and tat protein antigens, and said method comprising administering said substance or composition to an individual to whom DNA encoding gp120, nef and tat protein antigens has been administered.

- 55 - AMENDED SHEET

. PCT/EP01/00944

43 A substance or composition for use in a method for the treatment of HIV, said substance or composition comprising DNA encoding gp120, nef and tat protein antigens, and said method comprising administering said substance or composition to an individual to whom gp120, nef and tat protein antigens have been administered.

44 Use according to any one of claims 1, 16, or 22 to 24, substantially as herein described and illustrated.

45 A method according to claim 17, substantially as herein described and illustrated.

46 A vaccine for use in a method of treatment or prevention according to claim 18 or claim 25, substantially as herein described and illustrated.

47 A schedule according to claim 19, substantially as herein described and illustrated.

48 A substance or composition for use in a method of treatment according to claim 41, or claim 42, or claim 43, substantially as herein described and illustrated.

49 A new use of a protein or polynucleotide as defined in claim 1, a new non-therapeutic method of treatment, a vaccine for a new use in a method of treatment or prevention, a new schedule, or a substance or composition for a new use in a method of treatment or prevention, substantially as herein described.

- 56 - AMENDED SHEET