ZA200201233B - Feline calicivirus genes and vaccines, in particular recombined vaccines. - Google Patents

Description

® ’ The present invention relates to genes of

N particular strains of feline <caliciviruses, to the proteins encoded by these genes, and their use for the production of immunogenic preparations and of recombinant or subunit vaccines against feline calicivirosis. These immunogenic preparations and these vaccines may also be combined with immunogenic preparations or vaccines prepared on the basis of other feline pathogens, for the production of multivalent immunogenic preparations and vaccines.

Feline caliciviruses (FCV) were first described in 1957 (Fastier L.B. Am. J. Vet. Res. 1957. 18, 382- 389). Feline caliciviruses are, with the feline herpesviruses, the two principal sources of viral diseases of the upper respiratory tract in cats. The

FCV viruses affect a large number of animals, with FCV carrying rates of the order of 15 to 25%, and an anti-

FCV seroprevalence of 70 to 100% (Coutts et al. Vet.

Rec. 1994. 135. 555-556; Ellis T.M. Australian Vet. J. 1981. 57. 115-118; Harbour et al. Vet. Rec. 1991. 128. 77-80; Reubel et al. Feline Dendistry 1992. 22. 1347- 1360). After an initial phase of hyperthermia, these respiratory diseases are generally accompanied by buccal ulcerations (palate, tongue, lips, nose), rhinitis, conjunctivitis, possibly anorexia and asthenia. The FCV viruses can also cause pneumonia, enteritis, and articular pain (lameness syndrome).

The FCV virus is transmitted only horizontally, there is no vertical transmission from the mother to its kitten during gestation (Johnson R.P. Res. Vet.

Sci. 1984. 31. 114-119). FCV is transmitted by contact between infected animals and healthy animals or by the airways during sneezing (Wardley RC. Arch. Virol. 1976. 52. 243-249).

Feline caliciviruses are naked viruses of the

Caliciviridae family; they possess a single-stranded positive RNA of about 7.7 kilobase pairs (kbp) in size (Carter M.J. Arch. Virol. 1994. 9. 425-439).

® ) Like many RNA viruses, a large heterogeneity

Y exists within the viral population of FCV. The ) antigenic variations, demonstrated since the beginning of the 70s by cross-serum neutralization experiments, make it possible to classify the FCVs into several viral strains or quasispecies (Radfoord et al. Proc. 1°t

Int. Symp. Caliciviruses ESVV 1997. 93-99).

Several FCV strains have been isolated and sequenced, in particular the strain F9 (Carter et al.

Arch. Virol. 1992. 122. 223-235, sequence deposited in the GenBank databank under the accession number

M86379), FCI (Neill et al. J. Virol. 1991. 65. 5440- 5447, GenBank accession number Ul13992 and M32819),

Urbana or URB (Sosnovtsev and Green Virology 1995. 210. 383-390, GenBank accession number 1.40021), F4 (Tohya et al. Arch. Virol. 1991. 117. 173-181, GenBank accession numbers D31836 and D90357), KCD (Fastier L.B. Am. J.

Vet. Res. 1957. 18. 882-889, GenBank accession number 1,09719), LLK (GenBank accession number U(07131), NADC (GenBank accession number 109718), 2280 (GenBank accession number X99445) and 255 (Kahn and Gillepsie.

Cornell Vet. 1970. 60. 6069-683, GenBank accession number U07130).

Vaccination against FCV was introduced since the end of the 70s from attenuated FCV strains, mainly strain F9 isolated in 1958 by Bittle (Bittle et al. Am.

J. Vet. Res. 1960. 21. 547-550) or strains derived from

F9 by passage in vitro or in vivo (“F9-like”).

Inactivated vaccines are also available. They use strains 255 and 2280, which were isolated respectively in 1970 in a cat with a pneumonia (Kahn and Gillepsie. Cornell Vet. 1970. 60. 669-683) and in 1983 in a cat suffering from lameness (Pedersen et al.

Fel. Prac. 1983. 13. 26-35).

The humoral response is essentially directed against the capsid protein, also called p65 (Guiver et al. J. Gen. Virol. 1992. 73. 2429-2433). The genes encoding the capsid protein of many feline caliciviruses have been sequenced and compared without

® ) it being possible to distinguish more clearly certain v sequences (Glenn et al. Proc. 1° Int. Symp.

Caliciviruses ESVV 1997. 106-110; Geissler et al. Virus

Res. 1997. 48. 193-206; Neill et al. Proc. 1° Int.

Symp. Caliciviruses ESVV 1997. 120-124).

The gene encoding the capsid protein has also been cloned and expressed in various expression systems, in particular the gene encoding the capsid protein of the KS20 FCV virus in plasmids (Geissler et al. J. Virol. 1999. 73. 834-838), the genes encoding the capsid proteins of the CFI-68, JOK63, JOK92, LS012 and F9 FCV viruses in baculoviruses (DeSilver et al.

Proc. 1°° Int. Symp. Caliciviruses ESVV 1997. 131-143), the gene encoding the capsid protein of the F4 FCV wvirus in type 1 feline herpesviruses (Yokoyama et al.

J. Vet. Med. Sci. 1998. 60. 717-723). These various constructs have allowed the production of recombinant capsid proteins.

Because of antigenic drift over time, antisera produced against old vaccine strains isolated in the 60-70s, such as strains F9, 255 or 2280, neutralize only few isolates of the 90s. For example, the anti-F9 serum neutralizes 43% of the isolates of the period 1990-1996, against 56% for the period 1980-89 and 86% for the period 1958-79, and only 10% of the English isolates of the period 1990-96 (Lauritzen et al. Vet.

Microbiol. 1997. 56. 55-63).

The objective of the present invention is the detection of FCV strains, which induce in cats antibodies against a broad cross—-neutralization spectrum.

The objective of the invention is in particular, starting with selected strains, the isolation and characterization of genes encoding immunogenic proteins which can be used for vaccination against feline calicivirosis.

Another objective of the invention is to provide recombinant in vitro and in vivo expression

® vectors containing and expressing at least one such

N nucleotide sequence.

Yet another objective of the invention is to provide immunogenic preparations or vaccines against feline calicivirosis.

Yet another objective of the invention is to provide multivalent immunogenic preparations and multivalent vaccines against feline calicivirosis and against at least one other feline pathogen.

The invention essentially relates to two FCV strains obtained by pharyngeal swabs taken in France and the United Kingdom on cats exhibiting signs of infection by feline caliciviruses. They are respectively strain Gl (deposited at the Collection

Nationale de Cultures de Microorganismes (or CNCM) of

Institut Pasteur, Paris, France, under the accession number I-2167) and strain 431 (deposited at the CNCM under the accession number I-2166), both deposited on 12 March 1999. This FCV Gl strain isolated in France does not correspond to the FCV strain isolated in the

United Kingdom in 1978 by Tohya (Tohya Y. et al. Jpn.

J. Sci., 1990, 52, 955-961) and also called Gl.

The selection of the FCV 431 and Gl strains was carried out by cross-serum neutralization tests with respect to the FCV isolates of a reference panel. This reference panel is composed of 18 current isolates of

FCV taken from cats exhibiting signs of infection with feline <calicivirus and coming from three distinct geographical regions. 7 isolates are American, these isolates are identified RMI1l, RMIZ2, RMI3, RMI5, RMIS6,

RMI7 and RMIS. 7 isolates are French, they are designated A2, Fl, G1, G3, F3031, H3-2 and H1l-4. The last 4 isolates are English, they are designated 431, 388b, 337 and J5.

The panel strains are accessible from the

Applicant simply on request. They have also been published in a review article “Archives of Virology” (Poulet et al. Arch. Virol. February 2000. 145(2). 243-

® 261), available online on Internet on the date of

N filing with the editor.

During cross-serum neutralization tests between 18 FCV isolates of the reference panel, 1t was found, surprisingly, that the antiserum for isolate 431 neutralizes 14 of the 17 heterologous isolates of the reference panel (the homologous serum neutralization titer is not taken into account). By comparison, the antisera for the “historical” vaccine strains 255 and

F9 neutralize only 2 of the 18 panel isolates each.

Unexpectedly, the Applicant has therefore found with the FCV 431 strain a dominant strain which can be used for the protection of the Felidae and in particular of cats against most FCV strains. By virtue of the panel of FCV strains disclosed here, 1t is possible for persons skilled in the art to select other dominant FCV strains. By way of equivalence, the invention also covers through the FCV 431 strain the

FCV strains which are equivalent thereto, which have antibodies with broad cross-neutralization spectrum. - Equivalence exists when the antiserum for an

FCV strain seroneutralizes at least 13 of the 18 heterologous isolates of the reference panel (that is to say including FCV 431), preferably when it seroneutralizes at least 14 of the 18 heterologous isolates of the reference panel, still more preferably when it seroneutralizes at least 15 of the 18 heterologous isolates of the reference panel.

It is generally considered that an FCV strain seroneutralizes another FCV strain when the heterologous serum neutralization titer is greater than or equal to 1.2 logjp VNso (Povey C. and Ingersoll J.,

Infection and Immunity, 1975, 11, 877-885). The

Applicant took this value as the positivity threshold.

However, the Cross-serum neutralization results obtained with an FCV isolate having a homologous serum neutralization titer of less than or equal to 2 1logig

VNsp cannot be interpreted.

A second method for establishing the

Y equivalence of an FCV strain with respect to the FCV 431 strain is to use monoclonal antibodies specific for the FCV 431 strain and to test the candidate FCV strain by indirect immunofluorescence (IIF). The Applicant has thus succeeded in producing several monoclonal antibodies which have proved specific for the 431 strain. One of them was called 44. There is equivalence if there is reactivity in immunofluorescence with monoclonal antibodies specific for 431, for example with the monoclonal antibody 44. This monoclonal antibody and the corresponding hybridoma are available from the Applicant upon simple request and are also disclosed in the article by Poulet et al., supra. The corresponding hybridoma was also deposited on 11 August 1999 at the CNCM under the accession number I-2282. It goes without saying, however, that persons skilled in the art are perfectly capable of producing monoclonal antibodies by conventional techniques and of selecting, relative to the panel, those which are specific for the 431 strain.

The other FCV Gl strain was chosen for its complementarity to the FCV 431 strain, namely that the combination of the antisera for 431 and for G1 seroneutralize 100% of the isolates of the reference panel, that is to say that the FCV Gl strain has a homologous serum neutralization titer greater than or equal to 2 1ogio VNsg and heterologous serum neutralization titers greater than or equal to 1.2 log

VNso with respect to the FCV isolates of the reference panel against which the 431 antiserum does not seroneutralize or sercneutralizes weakly (value less than 1.2 1logip VNsg). The invention also covers the equivalent FCV strains having the same complementarity with respect to the FCV 431 strain. It is also possible to produce and select antibodies specific for this strain, which makes it possible to determine equivalents on this other basis.

® . ~ 7 =

The Applicant has, in addition, succeeded in * isolating, characterizing and sequencing the gene for the capsid of FCV 431 and FCV Gl, the capsid protein, and has determined the corresponding cDNA (complementary DNA) sequences.

The subject of the invention is therefore a nucleic acid fragment comprising all or part of the nucleotide sequence encoding the capsid protein of the 431 virus whose amino acid sequence 1s represented in

SEQ ID NO : 7 or in Figure 2, or an immunologically active fragment of this protein, that is to say an epitope, peptide or polypeptide substantially conserving the immunogenic activity of the capsid protein.

The subject of the invention 1s in particular a

DNA fragment comprising the cDNA sequence of SEQ ID

NO : 6 or a fragment conserving the essential properties of the complete sequence, that is to say encoding a peptide, polypeptide or epitope substantially conserving the immunogenic activity of the capsid protein. The subject of the invention is in particular a DNA fragment comprising this cDNA sequence, which is in particular coupled with elements for the regulation of transcription.

It goes without saying that the invention automatically covers the nucleic acid fragments, DNA fragments and cDNA sequences which are equivalent, that is to say the nucleotide fragments and sequences specific for the FCV capsid which do not change the functionality or the strain specificity of the : described sequence or of the polypeptides encoded by this sequence. The sequences which differ by degeneracy of the code will of course be included.

The invention also automatically covers the nucleotide sequences (RNA, DNA, cDNA) which are equivalent in the sense that they encode an FCV capsid protein, or a specific peptide, polypeptide or epitope of FCV capsid protein, which is capable of inducing in vivo in the feline species, in particular in cats,

SE antibodies having substantially the same Cross- ! neutralization as the antiserum for the FCV 431 strain.

They are in particular the sequences obtained from equivalent FCV strains according to the definition given above with respect to the panel and/or the monoclonal antibody 44.

The subject of the invention is also a nucleic acid fragment comprising all or part of the nucleotide sequence encoding the Gl virus capsid protein as represented in SEQ ID NO : 5 or in Figure 1, or an immunologically active fragment of this protein, that is to say an epitope, peptide or polypeptide substantially conserving the immunogenic activity of the capsid protein.

The subject of the invention is in particular a

DNA fragment comprising the cDNA sequence of SEQ ID

NO : 4 or a fragment conserving the essential properties of the complete sequence, that is to say encoding a peptide, polypeptide or epitope substantially conserving the immunogenic activity of the capsid protein. The subject of the invention is in particular a DNA fragment comprising this cDNA sequence, in particular coupled with elements for the regulation of transcription. It goes without saying that the invention automatically covers the nucleic acid fragments, DNA fragments and cDNA sequences which are equivalent, that is to say the nucleotide fragments and sequences which do not change the functionality or the strain specificity of the sequence described or of the polypeptides encoded by this sequence. The sequences which differ by degeneracy of the code will of course be included.

The invention also automatically covers the nucleotide sequences (RNA, DNA, cDNA) which are equivalent in the sense that they encode a peptide, polypeptide or epitope capable of inducing in vivo in the feline species, in particular in cats, antibodies having substantially the same cross-neutralization spectrum as the antiserum for the FCV Gl strain. They are in particular nucleotide sequences obtained from ¢ FCV strains which are complementary in the sense given above.

The gene encoding the capsid protein of the FCV

Gl and FCV 431 viruses has a size of 2007 nucleotides for FCV 431 and 2010 nucleotides for FCV Gl. The capsid protein has a size of 668 amino acids for FCV 431 and of 669 amino acids for FCV Gl, and a mass of 60-65 kDa (protein p65).

The subject of the invention is also an expression vector comprising at least one DNA fragment according to the invention, in particular a type 431 cDNA or a type Gl cDNA, under conditions allowing its expression in vivo. According to a specific feature, the expression vector comprises a type 431 cDNA and a type G1 cDNA. “Type” should be understood to mean that the cDNA is complementary to an RNA sequence of the strain considered.

These expression vectors may be poxviruses, for example the vaccinia virus, avipoxes (canarypox, fowlpox), including the species-specific poxviruses (swine pox, raccoonpox and camelpox), adenoviruses and herpesviruses, such as the feline herpesviruses (e.g.

FR-A-2 741 806). For the poxviruses, persons skilled in the art can refer to WO-A-9215672, WO-A-9526751, WO-A- 9012882 and WO-A-9527780.

Several insertion strategies may be used for the expression of several heterologous nucleotide sequences from the same expression vector in vivo.

These insertion strategies are in particular the use of a double expression cassette having an opposite orientation, or the use of a double expression cassette having an identical orientation, or alternatively a multiple expression cassette having an “IRES” (Internal

Ribosome Entry Site) element situated between each insert (Patent EP-A1-0803573).

The heterologous nucleotide sequences are inserted under the control of signals for the regulation of transcription and in particular of

® promoters, which are preferably brought during the ) insertion. It is not however excluded to cause these heterologous nucleotide sequences to be expressed under the control of signals which are specific to the expression vector used. For the canarypox expression vectors, one of the preferred promoters 1s the H6 vaccinia promoter (Taylor J. et al. Vaccine, 1988, 6, 504-508; Guo P. et al. J. Virol., 1989, 63, 4189-4198;

Perkus M. et al. J. Virol., 1989, 63, 3829-3836).

The in vivo expression vectors may also be plasmids. The term plasmid is intended to cover any DNA transcription unit in the form of a polynucleotide sequence comprising a cDNA sequence according to the invention and the elements necessary for its expression in vivo. The circular plasmid form, supercoiled or otherwise, is preferred. The linear form also falls within the scope of this invention.

Each plasmid comprises a promoter capable of ensuring, in the host cells, the expression of the cDNA inserted under its control. It is in general a strong eukaryotic promoter in particular an early cytomegalovirus promoter CMV-IE, of human or murine : origin, or possibly of another origin such as rats or guinea pigs. More generally, the promoter is either of viral origin or of cellular origin. As viral promoter other than CMV-IE, there may be mentioned the early or late promoter of the SV40 virus or the LTR promoter of the Rous Sarcoma virus. As cellular promoter, there may be mentioned the promoter of a cytoskeletal gene, such as for example the desmin promoter or alternatively the actin promoter. A subfragment of these promoters, which conserves the same promoter activity is included in the present invention, e.g. the truncated CMV-IE promoters according to WO-A-98/00166.

When several heterologous sequences (cDNA and/or genes of FCV or of other feline pathogens) are present in the same plasmid, these may be present in the same transcription unit or in two different units.

®

The plasmids may also comprise other elements for regulation of transcription, such as for example stabilizing sequences of the intron type, preferably intron II of the rabbit f-globin gene (van Ooyen et al.

Science, 1979, 206: 337-344), signal sequence of the protein encoded by the gene for tissue plasminogen activator (tPA; Montgomery et al. Cell. Mol. Biol. 1997, 43: 285-292), and polyadenylation signal (polyA), in particular of the gene for bovine growth hormone (bGH) (US-A-5,122,458) or the rabbit B-globin gene.

The subject of the invention is also the use of the cDNAs according to the invention for the in vitro production of capsid proteins or of their fragments and immunologically active epitopes and their incorporation into immunogenic preparations and subunit vaccines.

The subject of the invention is also an immunogenic preparation or vaccine against feline calicivirosis comprising at least one recombinant in vivo expression vector according to the invention and a veterinarily acceptable vehicle or excipient, and optionally an adjuvant.

The notion of immunogenic preparation covers any preparation capable, once administered to cats, of inducing at least an immune response directed against the feline pathogen considered. Vaccine is understood to mean a preparation capable of inducing effective protection.

Preferably, this immunogenic preparation or this vaccine comprises an in vivo expression vector into which is inserted a type FCV 431 cDNA, which includes its equivalents or an FCV Gl c¢DNA, which includes the equivalents of the latter.

According to a first very advantageous characteristic feature, this immunological preparation or this vaccine comprises an expression vector into which is inserted an FCV 431 type cDNA, which includes its equivalents, and an FCV Gl type cDNA, which also includes the equivalents of the latter.

According to a second very advantageous " specific feature, this immunological preparation or this vaccine comprises at least two expression vectors: in the first is inserted an FCV 431 type cDNA, which includes its equivalents, and in the second a cDNA of the FCV Gl strain, which also includes the equivalents of the latter.

To supplement the preparations and vaccines in accordance with the invention with adjuvants, it is possible to use any appropriate adjuvant known to persons skilled in the art. However, it is preferable either to formulate them in the form of oil-in-water emulsions, or to add to them polymers of acrylic or methacrylic acid or copolymers of maleic anhydride and of an alkenyl derivative, or alternatively a cationic lipid containing a quaternary ammonium salt.

Among the polymers, the polymers of acrylic or methacrylic acid which are crosslinked, in particular with polyalkenyl ethers of sugars or polyalcohols, are preferred. These compounds are known under the term ’ carbomer (Pharmeuropa vol. 8, No. 2, June 1996).

Persons skilled in the art can also refer to US-A- 2,909,462 (incorporated by way of reference) describing such acrylic polymers crosslinked with a polyhydroxylated compound having at least 3 hydroxyl groups, preferably not more than 8, the hydrogen atoms of at least three hydroxyls being replaced with unsaturated aliphatic radicals having at least 2 carbon atoms. The preferred radicals are those containing 2 to 4 carbon atoms, e.g. vinyls, allyls and other ethylenically unsaturated groups. The unsaturated radicals may themselves contain other substituents, such as methyl. The products sold under the name

Carbopol® (BF Goodrich, Ohio, USA) are particularly appropriate. They are crosslinked with an allyl sucrose or with allylpentaerythritol. Among them, there may be mentioned Carbopol® 974P, 934P and 971P.

Among the copolymers of maleic anhydride and of an alkenyl derivative, the EMA® copolymers (Monsanto)

® ) which are copolymers of maleic anhydride and of ’ ethylene, which are linear or crosslinked, for example crosslinked with divinyl ether, are preferred.

Reference may be made to J. Fields et al., Nature, 186: 778-740, 4 June 1960 (incorporated by way of reference). From the point of view of their structure, the polymers of acrylic or methacrylic acid and the

EMA® copolymers are preferably formed of basic units of the following formula:

R, T —~ -——C ———{CH,) , —C —(CH,) y ———-—

COQOH COOH in which: - Ry; and Ry, which are identical or different, represent H or CHs - x = 0 or 1, preferably x =1 - y=1o0or 2, with x + y = 2

For the EMA® copolymers, x = 0 and y = 2. For the carbomers, x = y = 1.

These polymers are dissolved in water or in physiological saline (NaCl at 20 g/l) and the pH is adjusted to 7.3-7.4 with sodium hydroxide, to give the adjuvant solution into which the expression vector or the subunits will be incorporated.

The concentration of polymer in the final vaccine composition will be from 0.01% to 1.5% W/V, more particularly from 0.05 to 1% W/V, preferably from 0.1 to 0.4% W/V.

The cationic lipids containing a quaternary ammonium salt, which are particularly but not exclusively suitable for the plasmid expression vectors correspond to the formula:

_

R,-O- CH,- is - CH, - ini X

OR, CH, in which R1 is a saturated or unsaturated, linear aliphatic radical having from 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms, and X is a hydroxyl or amine group.

DMRIE (N- (2-hydroxyethyl)-N,N-dimethyl-2, 3- bis (tetradecyloxy)-1l-propanammonium; WO-A-9634109), preferably coupled with a neutral lipid, in particular

DOPE (dicleoyl-phosphatidyl-ethanolamine), to form

DMRIE-DOPE, is preferred. Preferably, the plasmid is mixed with this adjuvant immediately before use and it is preferable, before its administration to the animal, to allow the mixture thus prepared time to form a complex, for example for a period ranging from 10 to 60 minutes, in particular of the order of 30 minutes.

When DOPE is present, the DMRIE:DOPE molar ratio ranges preferably from 95:5 to 5:95, more particularly 1:1.

The plasmid:adjuvant DMRIE or DMRIE-DOPE weight ratio may range in particular from 50:1 to 1:10, in particular from 10:1 to 1:5, preferably from 1:1 to 1:2.

The in vivo expression vectors encoding an FCV type c¢DNA according to the invention may also encode feline GM-CSF or may be combined with a second vector encoding feline GM-CSF (e.g. the plasmids pJdP089 and pJP090, Figure 5 and Figure 6 respectively). In the case of plasmids, a mixture of two plasmids is preferred. In the case of viral vectors, a single vector 1s preferred. This expression vector or this mixture of expression vectors may also be supplemented with adjuvant as described above.

The subject of the invention is also a

To multivalent immunogenic preparation or a multivalent vaccine against feline calicivirosis and against at least one other feline pathogen, using the same recombinant in vivo expression vector containing and expressing at least one FCV type cDNA according to the invention and at least one nucleotide sequence of an immunogen or another feline pathogen or of an immunologically active fragment of this immunogen.

The subject of the invention is also a multivalent immunogenic preparation or a multivalent vaccine comprising at least one in vivo expression vector into which is inserted at least one FCV type cDNA according to the invention and at least a second expression vector into which is inserted a sequence encoding an immunogen, or an immunologically active fragment, of another feline pathogen. Appropriate plasmids into which is inserted a sequence encoding an immunogen, or an immunologically active fragment, of another feline pathogen, may be in particular those described in Examples 7 to 15 and 17 to 19 of Patent

Application WO-A-9803660 (pPB179, pPB180, pPB181, pPAB009, pAB053, pABO052, pAB056, pAB058, pAB029, pAB030, pABO83, pAB041).

The monovalent or multivalent recombinant vaccines as described above may also be combined with at least one conventional vaccine (inactivated, attenuated live, subunit) directed against at least one feline pathogen which is identical or different.

Said other feline pathogens are in particular : chosen from the group comprising the feline rhinotrachitis virus or the feline herpesvirus (FHV), the feline leukemia virus (FelV), the feline parvoviruses (FPV), the feline infectious peritonitis virus (FIPV), the feline immunodeficiency virus (FIV), the rabies virus, Chlamydia.

The subject of the invention is also the isclated, purified or synthetic capsid proteins of the

FCV 431 strain and of the FCV Gl strain, having an amino acid sequence represented in SEQ ID NO : 7, ) respectively SEQ ID NO : 5. This automatically covers the equivalent proteins, that is to say the proteins derived from strains which are equivalent to the FCV 431 and FCV Gl strains according to the definitions given above (use of the panel and/or of a monoclonal antibody, in particular the monoclonal antibody 44).

Advantageously, these capsid proteins may be assembled in the form of empty capsids.

The subject of the invention is also the fragments and epitopes (at least about 8 to 10 amino acids) of these proteins, which conserve the specificity and immunogenicity of the whole protein.

The capsid proteins, optionally assembled in the form of empty capsids, and their fragments and epitopes, may be produced by expression in vitro. The corresponding nucleotide sequence is inserted into an in vitro expression system and expressed by this system, and the product of expression harvested and optionally purified, as is known per se.

The expression system may be of viral origin, in particular the baculovirus (US-A-4,745,051). The coding sequence or a fragment (in the case of the epitope or of the fragment) is integrated into the baculovirus genome (e.g. the baculovirus Autographa californica Nuclear Polyhedrosis Virus AcNPV) and the latter is then propagated, in particular in insect cells, e.g. Spodoptera frugiperda Sf9 (deposit ATCC CRL 1711).

The in vitro expression system may be of prokaryotic origin, e.g. Escherichia coli, or of eukaryotic origin, in particular yeasts, e.g.

Saccharomyces cerevisiae, or mammalian eukaryotic cells, in particular cell lines such as CHO (hamster ovary cells), Hela, BHK or insect cells, e.g.

Spodoptera frugiperda (supra), or alternatively feline cells.

As promoters which can be used in these cellular constructs, there may be mentioned the strong

® ) viral promoters such as those of the SV40 virus (Fiers ‘ et al., Nature, (1978) 273:113) and the early promoter (CMV-IE) of the human CMV virus or cytomegalovirus (McGregor and Caskey, Nucleic Acids Res. 17:2365, 1989) or of murine or other origin, or alternatively that of the polyhedrin gene of the baculovirus AcNPV (Hooft van

Iddekinge et al., 1983, Virology 131:561-565).

Persons skilled in the art know how to purify and/or isolate the proteins, assembled or otherwise in the form of empty capsids, their fragments and epitopes from the product of the techniques described above. By way of example, it can be recalled that persons skilled in the art have at their disposal various methods which comprise in particular: precipitation based on the solubility of the proteins, fragments and epitopes of interest according to the saline conditions of the medium, precipitation with organic solvents, polymers or other materials, affinity precipitation and selective denaturation, column chromatography, including high-performance liquid chromatography (HPLC), ion-exchange chromatography, affinity chromatography, immunoaffinity chromatography, chromatography using ligands, immunoprecipitation, gel filtration, electrophoresis, filtration methods, in particular ultrafiltration, and gradient ultracentrifugation.

Persons skilled in the art can refer by way of example to K.Y. Green et al., J. Clin. Microb., July 1997, Vol 35, 7:1909-1914, for the production of capsids in baculovirus propagated on Sf9 cells and harvested by ultracentrifugation on sucrose gradients (10 to 50%).

The capsid proteins, and their fragments and epitopes, may also be produced by chemical synthesis by the methods available to persons skilled in the art.

The subject of the invention is also the immunogenic preparations and vaccines comprising at least one subunit antigen formed of a capsid protein, preferably assembled in the form of empty capsids, of

® .

FCV 431 and/or FCV Gl, or of a corresponding fragment © or epitope, in a veterinarily acceptable vehicle or excipient, and preferably an adjuvant. Preferably, the preparations and vaccines according to the invention comprise subunit antigens derived from the two strains

FCV 431 and FCV Gl. Likewise, the preparations and vaccines may comprise nonassembled capsid proteins and proteins assembled in the form of empty capsids.

To supplement the subunit vaccines and immunogenic preparations according to the invention with adjuvants, it is possible to use as adjuvant (1) aluminum hydroxide, (2) a polymer of acrylic or methacrylic acid, a polymer of maleic anhydride and of an alkenyl derivative (which are described above), or (3) to formulate the immunogenic preparation or vaccine in the form of an oil-in-water emulsion, in particular the emulsion SPT described p 147 “Waccine Design, The

Subunit and Adjuvant Approach” edited by M. Powell,

M. Newman, Plenum Press 1995, and the emulsion MF59 described p 183 in the same book.

The oil-in-water emulsion may in particular be based on light liquid paraffin oil (European

Pharmacopeia type), isoprenoid oil such as squalane, squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or of decene; esters of acids or alcohols containing a linear alkyl group, more particularly vegetable oils, ethyl oleate, propylene glycol di (caprylate/caprate), glyceryl tri (caprylate/caprate), propylene glycol dioleate; esters of branched fatty alcohols or acids, in particular esters of isostearic acid. The oil is used in combination with emulsifiers to form the emulsion.

The emulsifiers are preferably nonionic surfactants, in particular the esters of sorbitan, mannide, glycerol, polyglycerol, propylene glycol and of oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, the polyoxypropylene- polyoxyethylene block copolymers, in particular the

Pluronic® copolymers, especially L121.

] The subject of the invention is also the

N multivalent vaccines and immunogenic preparations in which the FCV valency 1s a subunit valency as described above.

The subject of the present invention is also a method of immunizing cats against diseases caused by the feline calicivirosis viruses.

This method comprises the administration of an immunological preparation or of a vaccine according to the invention to cats. This administration may be made in particular by the parenteral route, by subcutaneous, intradermal, intramuscular or intraperitoneal administration. Preferably, the administration is made by the subcutaneous or intramuscular route.

Various means of administration may be used for the plasmid vaccines and immunogenic preparations, in particular gold particles coated with DNA and discharged so as to penetrate into the cells of the skin of the subject to be immunized (Tang et al. Nature 1992. 356. 152-154) and liquid-jet injectors which make it possible to transfect both skin cells and cells of the underlying tissues (Furth et al. Analytical Bioch. 1992. 205, 365-368).

Persons skilled in the art possess the necessary competence to precisely define the number of administration and the doses to be used for each immunization protocol.

The invention will now be described in greater detail with the aid of the embodiments taken by way of nonlimiting examples and referring to the drawing in which:

Figure 1 : cDNA sequence of the “capsid” protein of the FCV G1 strain

Figure 2 : cDNA sequence of the “capsid” protein of the FCV 431 strain

Figure 3 : Restriction map of the plasmid pJCA 151

Figure 4 : Sequence of the C6L region of the genome of the canarypox virus (strain ALVAC)

Figure 5 : Restriction map of the plasmid pJP089

Figure 6 : Sequence of the 3R3 feline GM-CSF gene

Figure 7 : Restriction map of the plasmid pJP090

Figure B : Sequence of the 3R4 feline GM-CSF gene

Figure 9 : Table of the cross-serum neutralization titers

List of the sequences for the constructs of the present invention

SEQ ID NO 1 : Oligonucleotide PB331

SEQ ID NO 2 : Oligonucleotide PB333

SEQ ID NO 3 : Oligonucleotide PB332

SEQ ID NO 4 : FCV Gl capsid cDNA sequence

SEQ ID NO 5 : FCV Gl capsid protein sequence

SEQ ID NO 6 : FCV 431 capsid cDNA sequence

SEQ ID NO 7 : FCV 431 capsid protein sequence

SEQ ID NO 8 : Oligonucleotide JCA289

SEQ ID NO 9 : Oligonucleotide JCAZ90

SEQ ID NO 10: Sequence of the C6L region of the canarypox virus (strain ALVAC)

SEQ ID NO 11: Oligonucleotide C6Al

SEQ ID NO 12: Oligonucleotide C6Bl

SEQ ID NO 13: Oligonucleotide C6C1

SEQ ID NO 14: Oligonucleotide C6D1

SEQ ID NO 15: Oligonucleotide JCA291

SEQ ID NO 16: Oligonucleotide JCA292

SEQ ID NO 17: Oligonucleotide JCA293

SEQ ID NO 18: Oligonucleotide JCA294

SEQ ID NO 19: Oligonucleotide JCAZ95

SEQ ID NO 20: Oligonucleotide JP578

SEQ ID NO 21: Oligonucleotide JP579

SEQ ID NO 22: Sequence of the 3R3 feline GM-CSF gene

SEQ ID NO 23: Sequence of the 3R4 feline GM-CSF gene

EXAMPLES

All the constructions of plasmids were carried out using standard molecular biclogy techniques (cloning, digestion with restriction enzymes, synthesis of a single-stranded complementary DNA, polymerase chain amplification, extension of an oligonucleotide

® with a DNA polymerase and the like) described by . Sambrook J. et al. (Molecular Cloning: A Laboratory

Manual. 2" Edition. Cold Spring Harbor Laboratory

Press. Cold Spring Harbor. New York. 1989). All the restriction fragments used for the present invention, as well as the various polymerase chain amplification (PCR) fragments were isolated and purified using the “Geneclean7” kit (BI0O1l01] Inc. La Jolla, CA).

Example 1 : Isolation and culture of feline calicivirus

Gl and 431 strains

The feline calicivirus strain designated G1 was obtained from a sample collected in France on a cat exhibiting signs of calicivirosis. This FCV Gl strain was deposited on 12 March 1999 at the Collection

Nationale de Cultures de Microorganismes (or CNCM) of

Institut Pasteur, Paris, France, under the accession number I-2167.

The feline calicivirus strain designated 431 was isolated from a sample taken in England on a cat exhibiting signs of calicivirosis. This FCV 431 strain was deposited on 12 March 1999 at the Collection

Nationale de Cultures de Microorganismes (or CNCM) of

Institut Pasteur, Paris, France, under the accession number I-2166.

For their amplification, the feline calicivirus strains were cultured on cells of the cat kidney line (Crandell-Reese Feline Kidney or CRFK, No. ATCC CCL-94,

Crandell et al. In Vitro 1973, 9, 176-185).

The CRFK cells are cultured in a 96-well plate or in a 25-cm® Falcon with DMEM medium supplemented with 5% fetal calf serum containing about 100,000 cells per ml. The cells are cultured at +37°C in an atmosphere containing 5% CO;.

After 3 days, the cell layer arrives at confluence. The culture medium is then replaced with serum-free DMEM medium but supplemented with 50 mg/l of gentamycin and the FCV viral isolates are added in an amount of a volume of 100 ul of four-fold serial

® dilutions per well for the «cloning in limiting . dilutions of the FCV viruses or of 1 ml per Falcon.

When the cytopathic effect (CPE) is complete (24-48 hours after the start of the culture), the viral suspensions are harvested and frozen at -70°C. 3 to 4 successive passages are generally necessary for the production of a viral batch. The viral batch is stored at —-70°C.

Example 2 : Extraction of the viral RNA of the feline calicivirus G1 and 431 strains

The CRFK cells are cultured at 37°C in 2-liter roller flasks (850 cm?) in modified Eagle’s medium (MEM, Gibco BRL) supplemented with 2.5% of lactalbumin hydrolysate (Gibco BRL) and 5% fetal calf serum (Gibco

BRL). 300 ml of a cellular suspension in MEM medium containing about 100,000 cells/ml are added per roller flask. After 3 days, the cell layer becomes confluent.

The cell culture medium is then replaced with serum- free MEM medium and the FCV virus added at a multiplicity of infection (mol) of 0.5 CCIDsg/cell. The viral culture is maintained at 37°C for 24 to 48 hours until a cytopathic effect is obtained for the whole cellular lawn. The viral suspension is harvested and then clarified by centrifugation.

The viral RNA contained in 100 ml of viral suspension of the FCV Gl strain, which has just been prepared, was extracted with the solutions of the kit “High Pure™ viral RNA Kit” Cat # 1 858 882, Roche

Molecular Biochemicals), according to the supplier’s instructions for the extraction steps. The RNA pellet obtained at the end of the extraction was resuspended with 10 ml of RNase-free sterile distilled water.

The viral RNA of the FCV 431 strain was extracted under the same conditions from 100 ml of viral suspension of the corresponding strain. The RNA pellet obtained at the end of the extraction was resuspended with 10 ml of RNase-free sterile distilled water.

Example 3 : Synthesis of the DNAs complementary to the capsid genes of the feline calicivirus Gl and 431 strains

The complementary DNAs corresponding to the capsid genes of the feline calicivirus Gl and 431 strains were synthesized with the kit “Gene Amp RNA PCR

Kit” (Cat # N 808 0017, Perkin-Elmer, Norwalk, CT 06859, USA) using the conditions given by the supplier.

For the FCV Gl strain, a reverse transcription reaction, followed by a polymerase chain reaction (“RT-

PCR” reaction) was carried out with 1 ml of the suspension of FCV Gl viral RNA (Example 2) and with the following oligonucleotides:

PB331 (33 mer) (SEQ ID NO 1) 5’ TTGCGGCCGCTGTGATGTGTTCGAATTTGAGC3’ and PB333 (36 mer) (SEQ ID NO 2) 5’ TTGGCGCCGYTGACCMAGTGCAGCYTTRTCCAATTC3”

The conditions for the synthesis of the first complementary DNA strand are a temperature of 42°C for 15 min, then 99°C for 5 min, and finally 4°C for 5 min.

The conditions for the PCR reaction are a temperature of 95°C for 2 min, then 35 cycles (95°C for 1 min, then 62°C for 1 min, and 72°C for 2 min), and finally 72°C for 7 min in order to produce an RT-PCR fragment of about 2000 base pairs (bp) which was identified “G1-4".

For the FCV 431 strain, a reverse transcription reaction, followed by a polymerase chain reaction (“RT-

PCR” reaction) was carried out with 1 ml of the suspension of FCV 431 viral RNA (Example 2) and with the following oligonucleotides:

PB331 (33 mer) (SEQ ID NO 1) and PB332 (38 mer) (SEQ ID NO 3) 5’ TTGGCGCCAAYWGTRTTWGHTACAGTRTCAATYARRCC3’

The conditions for the synthesis of the first complementary DNA strand are a temperature of 42°C for 15 min, then 99°C for 5 min, and finally 4°C for 5 min.

The conditions for the PCR reaction are a temperature of 95°C for 2 min, then 35 cycles (95°C for 1 min, then

_

J - 24 - 62°C for 1 min, and 72°C for 2 min), and finally 72°C - for 7 min in order to produce an RT-PCR fragment of about 2000 base pairs (bp) which was identified “431-27.

Example 4 : Cloning of the gene encoding the capsid protein of the feline calicivirus Gl strain

The RT-PCR fragment Y“G1-4” was digested with

Narl and then with NotI in order to isolate, after agarose gel electrophoresis, the NarI-NotI fragment of about 2000 bp. This fragment was ligated with the vector pBlueScript® II KS+ (Cat # 212208 Stratagene

Inc., La Jolla, CA 92037, USA), previously digested with NotI and ClalI, and then dephosphorylated, to give the plasmid pGl-4-5 (5033 bp).

The NotI-NarI fragment cloned into this plasmid was completely sequenced on both strands in order to determine the sequence of the capsid gene. The sequence of the capsid gene of the FCV Gl strain (2010 bp) (SEQ

ID NO 4), as well as the sequence of the capsid protein (p65) (668 amino acids) (SEQ ID NO 5) encoded by this gene, are presented in Figure 1.

Example 5 : Cloning of the gene encoding the capsid protein of the feline calicivirus 431 strain

The RT-PCR fragment “431-2” was digested with

NarI and then with NotI in order to isolate, after agarose gel electrophoresis, the NarI-NotI fragment of about 2000 bp. This fragment was ligated with the vector pBlueScript® II KS+ (Cat # 212208 Stratagene

Inc., La Jolla, CA 92037, USA), previously digested with NotI and ClaI, and then dephosphorylated, to give the plasmid p431-2-1 (4985 bp).

The NotI-Narl fragment cloned into this plasmid was completely sequenced on both strands in order to determine the sequence of the capsid gene. The sequence of the capsid gene of the FCV 431 strain (2007 bp) (SEQ

ID NO 6), as well as the sequence of the capsid protein

® x - 25 - (p65) (668 amino acids) (SEQ ID NO 7) encoded by this gene, are presented in Figure 2.

Example 6 : Construction of the plasmid pJCAl51

A PCR reaction was carried out using plasmid p431-2-1 (Example 5) as template and the following oligonucleotides:

JCA289 SEQ ID NO 8 (36 mer): 5’ AAACGCGTCGACATGTGCTCAACCTGCGCTAACGTG3' and JCA290 SEQ ID NO 9 (33 mer): 5’ TTTTGATATCTCATATTTTAACCATTCCACTCC3! in order to amplify a PCR fragment of about 2030 bp.

This fragment was digested with the restriction enzymes

SalT and EcoRV in order to isolate, after agarose gel electrophoresis, a Sall-EcoRV fragment of 2014 bp. This restriction fragment was then ligated with the plasmid pVR1012 (Hartikka J. et al. Human Gene Therapy. 1997. 7. 1205-1217), previously digested with Sall and EcoRV, to give the plasmid pJCA151 (6908 bp) (Figure 3).

Example 7 : Construction of the donor plasmid for insertion into the C6L site of the canarypox virus

Figure 4 (SEQ ID NO 10) shows the sequence of a 3700 bp fragment of the genomic DNA of the canarypox virus. Analysis of this sequence revealed an open reading frame (ORF) which was called C6L, which starts : at position 377 and ends at position 2254. The construction of an insertion plasmid resulting in the deletion of the ORF C6L and in its replacement with a multiple cloning site flanked with signals for termination of transcription and of translation was carried out as described below.

A PCR reaction was carried out using the template consisting of the genomic DNA of the canarypox virus and with the following oligonucleotides:

C6Al1 (SEQ ID NO 11) (42 mer) 5’ ATCATCGAGCTCGCGGCCGCCTATCAAAARGTCTTAATGAGTT3’ and C6Bl1 (SEQ ID NO 12) (73 mer)

5’ GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGT

AAGTAAGTATTTTTATTTAA3Z’ in order to isolate a 432 bp PCR fragment (fragment A).

A PCR reaction was carried out using the template consisting of the genomic DNA of the canarypox virus and with the following oligonucleotides:

C6C1l (SEQ ID NO 13) (72 mer) 57’ CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTA

TATATAATTGAAAAAGTAA3’ and C6D1 (SEQ ID NO 14) (45 mer) 5’ GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG3’ in order to isolate a PCR fragment of 1210 bp (fragment

B) .

Fragments A and B were hybridized together in order to serve as template for a PCR reaction carried out with the oligonucleotides C6Al1 (SEQ ID NO 11) and

CeDl (SEQ ID NO 14) in order to generate a PCR fragment of 1630 bp. This fragment was digested with the restriction enzymes Sacl and KpnI, in order to isolate, after agarose gel electrophoresis, a SacI-Kpnl fragment of 1613 bp. This fragment was ligated with the vector pBlueScript® II SK+ (Stratagene, La Jolla, CA, USA, Cat # 212205), previously digested with the enzymes SacI and KpnI, to give the plasmid pCe6L. The sequence of this plasmid was verified by sequencing. This plasmid contains 370 bp of sequences situated upstream of the

ORF C6L (“left flanking arm C6”), a vaccinia signal for early termination of transcription, stop codons in the 6 reading frames, a multiple cloning site containing the SmaI, PstI, Xhol and EcoRI restriction sites, and finally 1156 bp of sequences situated downstream of the

ORF C6L (“right flanking arm C6”).

The plasmid pMP528HRH (Perkus M. et al. J.

Virol. 1989. 63. 3829-3836) was used as template to amplify the complete sequence of the H6 vaccinia promoter (GenBank accession no. M28351) with the following oligonucleotides:

JCA291 (SEQ ID NO 15) (34 mer) 5’ AAACCCGGGTTCTTTATTCTATACTTAAAAAGTG3'

and JCA292 (SEQ ID NO 16) (43 mer) 5" AAAAGAATTCGTCGACTACGATACAAACTTAACGGATATCGCG3! in order to amplify a 149 bp PCR fragment. This fragment was digested with the restriction enzymes Smal and EcoRI in order to isolate, after agarose gel electrophoresis, a Smal-EcoRI restriction fragment of 138 bp. This fragment was then ligated with the plasmid pC6L, previously digested with Smal and EcoRI, to give the plasmid pJCA150.

Example 8 : Construction of the recombinant virus vCP1710 (recombinant canarypox virus expressing the capsid gene of the FCV 431 strain)

A PCR reaction was carried out using the plasmid p431-2-1 (Example 5) as template and the following oligonucleotides:

JCA293 (SEQ ID NO 17) (55 mer): 5" AAATCGCGATATCCGTTAAGTTTGTATCGTAATGTGCTCAACCTGCGCTAACG

TG3' and JCA294 (SEQ ID NO 18) (33 mer): 5’ TTTTGTCGACTCATATTTTAACCATTCCACTCC3 in order to amplify a PCR fragment of about 2050 bp.

This fragment was digested with the restriction enzymes

Nrul and Sall in order to isolate, after agarose gel electrophoresis, the NrulI-Sall fragment of 2035 bp (fragment A). The plasmid pJCAl50 (Example 7) was digested with the restriction enzymes Nrul and Sall in order to isolate, after agarose gel electrophoresis, the NruI-Sall restriction fragment of about 4500 bp (fragment B). Fragments A and B were then ligated together to give the plasmid pJCAl52.

The plasmid pJCA152 was linearized with NotI, and then transfected into chicken embryo primary cells infected with the canarypox virus (strain ALVAC) according to the calcium phosphate precipitation technique previously described (Panicali and Paoletti

Proc. Nat. Acad. Sci. 1982. 79. 4927-4931; Piccini et al. In Methods in Enzymology. 1987. 153. 545-563. Eds.

Wu R. and Grossman L. Academic Press). Positive plaques were selected on the basis of hybridization with a radiolabeled probe specific for the capsid gene of the

FCV 431 strain. These plaques were subjected to 4 successive cycles of selection/purification of plaques until a pure population was isolated. A plaque which is representative of the in vitro recombination between the donor plasmid pJCAl52 and the genome of the canarypox virus ALVAC was then amplified and the recombinant virus stock obtained was designated wvCP1710.

Example 9 : Construction of the recombinant virus vCP1711 (recombinant canarypox virus expressing the capsid gene of the FCV Gl strain)

A PCR reaction was carried out using the plasmid pGl-4-5 (Example 4) as template and the following oligonucleotides:

JCA2983 (SEQ ID NO 17) and JCA285 (SEQ ID NO 19) (33 mer): 5" TTTTGTCGACTCATAGTTTTGTCATAGTACTCC3” in order to amplify a PCR fragment of about 2050 bp.

This fragment was digested with the restriction enzymes

Nrul and Sall in order to isolate, after agarose gel electrophoresis, an NruI-Sall fragment of 2035 bp (fragment A). The plasmid pJCA150 (Example 7) was digested with the restriction enzymes Nrul and Sall in order to isolate, after agarose gel electrophoresis, the NruI-Sall restriction fragment of about 4500 bp (fragment B). Fragments A and B were then ligated together to give the plasmid pJCAl53.

The plasmid pJCA153 was linearized with NotI, and then transfected into chicken embryo primary cells infected with the canarypox virus (strain ALVAC) according to the calcium phosphate precipitation technique previously described (Panicali and Paoletti

Proc. Nat. Acad. Sci. 1982. 79. 4927-4931; Piccini et al. In Methods in Enzymology. 1987. 153. 545-563. Eds.

Wu R. and Grossman L. Academic Press). Positive plaques were selected on the basis of hybridization with a radiolabeled probe specific for the capsid gene of the \ FCV G1 strain. These plaques were subjected to 4 successive cycles of selection/purification of plaques until a pure population was isolated. A plaque which is representative of the in vitro recombination between the donor plasmid pJCA152 and the genome of the canarypox virus ALVAC was then amplified and the recombinant virus stock obtained was designated vCP1711.

Example 10 : Plasmid encoding feline GM-CSF

Cat blood was collected by taking blood in a tube containing EDTA. The mononuclear cells were harvested by centrifugation on a Ficoll gradient, and then cultured in a Petri dish 60 mm in diameter. The cat mononuclear cells were then stimulated with concanavalin A (ConA) (final concentration of about 4 ng/ml) and with phytohemagglutinin (PHA) (final concentration of about 10 pg/ml). After stimulation, the “ConA” and “PHA” lymphoblasts were harvested by scraping the culture dishes, and the total RNA cf these cells was extracted using the kit “mRNA isolation kit for White Blood Cells” (Boehringer Mannheim/Roche Cat # 1 934 325).

The total RNA extracted from the cat lymphoblasts stimulated with ConA and PHA served as template for the synthesis of the first strand of complementary DNA. This first strand of complementary

DNA was produced by extension of the oligonucleotide p(dT)15 (Boehringer Mannheim/Roche Cat # 814 270). The single-stranded complementary DNA obtained was then used as template for a PCR reaction with the following oligonucleotides:

JP578 (SEQ ID NO 20) (33 mer) 5’ TATGCGGCCGCCACCATGTGGCTGCAGAACCTG3’ and JP579 (SEQ ID NO 21) (36 mer) 5’ TATGCGGCCGCTACGTATCACTTCTTGACTGGTTTC3” in order to amplify a PCR fragment of about 450 base pairs (bp). This fragment was digested with NotI in

® order to isolate, after agarose gel electrophoresis, - the NotI-NotI fragment of 450 bp. This fragment was then ligated with the plasmid pVR1012 (Hartikka J. et al. Human Gene Therapy. 1997. 7. 1205-1217). Two clones containing the feline GM-CSF sequence (SEQ ID NO 22 and

SEQ ID NO 23), in the correct orientation relative to the hCMV/IE promoter were identified pJP089 and pJPO0S0 respectively. These two plasmid have a size of 5364 bp (Figures 5 and 7).

The sequence of the feline GM-CSF gene cloned into the plasmid pJP089 contains 13 differences at the nucleotide level with the feline GM-CSF sequence available in GenBank (accession no. AF053007). The most important change is a C — T change which causes a

Leucine — Phenylalanine change for the amino acid (first base of the codon for amino acid # 107; Figure 6). The sequence of the feline GM-CSF gene cloned into the plasmid pJP090 is equivalent to that contained in the plasmid pJP089, except that the Leucine —

Phenylalanine change does not exist for amino acid # 107 (Figure 8). Verification of the 3’ sequence of the feline GM-CSF gene by means of the 3’RACE kit showed that, at this position 107, it is possible to have, in the same cat, the amino acid Leucine or the amino acid

Phenylalanine.

Example 11 : Manufacture of combined plasmid vaccines

The various plasmids necessary for the manufacture of a combined vaccine are mixed. These plasmids may be in particular those described in

Examples 6 and 10 (pJCAl51, pJP089 and pJP090) and

Examples 7 to 15 and 17 to 19 of Patent Application WO-

A-9803660 (pPB179, pPB180, pPB181, pABOOS, pABOS53, pABO52, pABOS56, pABOLS, pABQ029, pAB030, pAB083, pABO41). The mixtures are prepared such that the final concentration of each plasmid corresponds to the effective dose of each plasmid. The solutions which can be used to adjust the final concentration of the

® vaccine may be either a 0.9% NaCl solution, or PBS

CL buffer.

Example 12 : Formulation of the vaccinal plasmids

The solution of DNA containing one or more plasmids according to Example 11 1s concentrated by ethanol precipitation as described in Sambrook et al. (1989). The DNA pellet 1s taken up in a 0.9% NaCl solution so as to obtain a concentration of 1 mg/ml. A solution of DMRIE-DOPE at 0.75 mM is prepared by taking up a freeze-dried product of DMRIE-DOPE with a suitable volume of sterile HO.

The formation of the plasmid DNA-lipid complexes is performed by diluting equal portions of the 0.75 mM DMRIE-DOPE solution with the DNA solution at 1 mg/ml in 0.9% NaCl. The DNA solution is gradually introduced with the aid of a seamed 26G needle along the wall of the vial containing the solution of cationic lipid so as to avoid the formation of foam.

Gentle shaking is carried out as soon as the two solutions have been mixed. A composition comprising 0.375 mM of DMRIE-DOPE and 500 pg/ml of plasmid is finally obtained.

It is desirable for all the solutions used to be at room temperature for all the operations described above. The DNA/DMRIE-DOPE complex formation is allowed to take place at room temperature for 30 minutes before immunizing the animals.

Example 13 : Formulation of the vaccinal canarypox vectors

For the preparation of vaccines, the recombinant canarypox viruses vCP1710 (Example 8) and vCP1711 (Example 9) may be supplemented with carbomer solutions as adjuvant. The preferred carbomer is

Carbopol™ 974P manufactured by BF Goodrich, Ohio, USA (molecular weight of about 3,000,000).

A stock solution containing 1.5% Carbopol™ 974pP is initially prepared in distilled water containing aaa, ——,—__—_—_—___— ® 1 g/1 of sodium chloride. This stock solution is then

Co used for the preparation of a solution containing 4 mg/ml of Carbopol™ 974P in physiological saline. The stock solution is mixed with a suitable volume of physiological saline, either in a single stage or in several successive stages, the pH value is adjusted at each stage with a 1 N (or alternatively a more concentrated) sodium hydroxide solution in order to obtain a final pH value of 7.3-7.4.

The ready-for-use Carbopol™ 974P solution thus obtained may be used to take up freeze-dried recombinant viruses (e.g. vCP1710, vCP1711) or to dilute concentrated stock solutions of recombinant viruses (e.g. vCP1710, vCP1711). For example, to obtain a viral suspension containing 10% pfu per dose of 1 ml, it is possible to dilute a viral stock solution so as to obtain a titer of 10%° pfu/ml, and then to dilute equal portions with said ready-to-use solution of

Carbopol™ 974P at 4 mg/ml.

Example 14 : Indirect immunofluorescence (IIF) tests

The IIF tests are carried out on 96-well plates containing the CRFK cells cultured in monolayers infected with the FCV viruses to be tested. 200 pl per well of a suspension of CRFK cells containing 90,000 cells/ml in F15 medium (Gibco BRL,

Cat # 045-1075) containing 5% of fetal calf serum are cultured in a 96-well plate. At confluence, 320 CCID50 of FCV are inoculated in 100 pl of F15 medium. When the first CPE foci appear, the cells are then rinsed with cold PBS with no calcium or magnesium (PBS, Sigma), and then fixed at -20°C for 30 minutes with cold acetone containing 5% v/v of water. After drying, the infected and fixed cells are brought into contact for 30 minutes at 37°C with 100 pl per well of ascitic fluid corresponding to the anti-FCV 431 monoclonal antibody 44 (hybridoma 431 2 0 17 E9 T, deposited at the CNCM under the accession number 11-2282), diluted 1/5000 approximately in 50 mM TRIS-HC1l buffer, pH 7.6.

_

After two rinses in PBS, the attachment of the ". antibodies is visualized by incubation under the same conditions of a goat anti-mouse IgG antibody conjugated with fluorescein isothianate (Biosys, FITC conjugated at 2 mg/ml) and diluted 1/150 in 50 mM TRIS-HC1l buffer, pH 7.6. The reading is made under an optical microscope under UV light.

This monoclonal antibody was tested with respect to each of the isolates of the panel. It is attached exclusively to the CRFK cells infected with

FCV 431.

This test may be used to determine the equivalents of the FCV 431 strain. These equivalents are those to which the monoclonal antibody 44 attaches.

Example 15 : Cross-serum neutralization in vitro

Cross-serum neutralization tests were carried out between 18 field isolates obtained by pharyngeal swabs performed on cats exhibiting signs of feline calicivirosis. 7 of them have as geographical origin

France, they are the isolates identified A2, F3031, G1,

G3, Fl, H3-2 and H1l-4. 4 have as geographical origin

Great Britain, they are the 1isclates identified J5, 337, 388b and 431. Finally, 7 have as geographical origin the USA, they are the isolates identified RMII,

RMI2, RMI3, RMI5, RMI6, RMI7 and RMIS.

For each FCV virus, an antiserum was produced by inoculating kittens by the oronasal route with 106-0

CCIDsy of the relevant FCV virus. The specific pathogen- free (SPF) kittens were 10 to 14 weeks old. The serum of each animal was collected one month after the infection. The sera were heat-inactivated (30 minutes at 56°C), distributed, aliquoted and stored at -20°C.

The serum obtained for each isolate was tested for its ability to neutralize the 18 isclates. The sera were three-fold serially diluted with DMEM medium in 96-well cell culture plates. 0.05 ml of culture medium containing approximately 100 CCIDsg of the selected viral strain was added to 0.05 ml of the dilute serum.

®

This mixture was incubated for 2 hours at 37°C in an

Co incubator under an atmosphere containing 5% COs. 0.15 ml of a suspension of CRFK cells containing about 100,000 cells per ml was then added to each mixture. The cytopathic effect was observed by phase contrast microscopy after 4 days of culture at 37°C in an atmosphere containing 5% CO;. The neutralizing titers of each serum were calculated according to the Ké&rber method. The titers are given in the form of the highest dilution inhibiting the cytopathic effect for 50% of the wells. The titers are expressed in logjpo. The minimum titer thus found was 0.7 logip VNsg. Each serum was titrated at least twice, preferably three times.

Figure 9 gives all the neutralizing titers obtained during cross-serum neutralizations carried out between these 18 FCV strains and these 18 sera.

It should be clearly understood that the invention defined by the appended claims is not limited to the specific embodiments indicated in the description above, but encompasses the variants which do not depart from the scope or the spirit of the present invention.

Claims (27)

) Claims

1. DNA fragment comprising the nucleotide sequence represented in SEQ ID NO : 6 or a fragment of this sequence encoding an epitope, peptide or polypeptide substantially conserving the immunogenic activity of the protein encoded by the complete sequence.

2. Fragment according to Claim 1, comprising the nucleotide sequence represented in SEQ ID NO : 6 and elements for the regulation of its transcription.

3. Nucleic acid fragment encoding the capsid protein represented in SEQ ID NO : 7 or an immunologically active fragment of this protein.

4. In vivo or in vitro expression vector comprising a nucleic acid fragment according to one of Claims 1 to 3.

5. In vivo expression vector according to Claim 4, characterized in that it is chosen from the group consisting of poxviruses, adenoviruses and herpesviruses.

6. In vivo expression vector according to Claim 4, characterized in that it is a plasmid.

7. In vivo expression vector according to any one of Claims 4 to 6, characterized in that it comprises, in addition, a DNA fragment comprising all or part of the nucleotide sequence represented in SEQ ID NO : 4.

8. DNA fragment comprising all or part of the nucleotide sequence represented in SEQ ID NO : 4 or a fragment of this sequence encoding a peptide or polypeptide substantially conserving the immunogenic activity of the protein encoded by the complete sequence.

9. Fragment according to Claim 8, comprising the nucleotide sequence represented in SEQ ID NO : 4 and elements for the regulation of its transcription.

10. Nucleic acid fragment encoding the capsid protein represented in SEQ ID NO : 5 or an immunologically active fragment of this protein.

®

11. In vivo expression vector according to any one n of Claims 4 to 6, characterized in that it comprises, in addition, a nucleic acid fragment according to one of Claims 8 to 10.

12. Expression vector according to any one of Claims 4 to 7 and 11, characterized in that it comprises, in addition, a nucleotide sequence of an immunogen, or immunologically active fragment, or another feline pathogen.

13. Expression vector according to Claim 12, characterized in that the other feline pathogen is chosen from the group consisting of the feline rhinotrachitis virus (also called feline herpesvirus, FHV), the feline leukemia virus (FelV), the feline parvoviruses (FPV), the feline infectious peritonitis virus (FIPV), the feline immunodeficiency virus (FIV), the rabies virus, Chlamydia.

14. Immunogenic preparation or vaccine against feline calicivirosis, in which the antigen is a protein, a peptide, a polypeptide or an epitope capable of inducing in vivo in the feline species, in particular in cats, antibodies capable of seroneutralizing at least 13 FCV strains among those of a panel consisting of the following 18 FCV strains: RMI1, RMI2, RMI3, RMI5, RMI6, RMI7, RMI9, AZ, Fl, G1, G3, F3031, H3-2, H1-4, 431, 388b, 337 and J5, preferably at least 14 of the said 18 strains, and still more preferably at least 15 of the said 18 strains.

15. Immunogenic preparation or vaccine against feline calicivirosis, in which the antigen is a protein, a peptide, a polypeptide or an epitope of an FCV strain recognized by the monoclonal antibody 44 deposited at the CNCM under the accession number I-2282.

16. Immunogenic preparation or vaccine according to Claim 14 or 15, characterized in that it comprises an in vivo expression vector into which an FCV type cDNA sequence encoding the antigen is inserted.

17. Immunogenic preparation or vaccine according to Co Claim 16, characterized in that it comprises an in vivo expression vector according to one of Claims 4 to 7 and 11, and a veterinarily acceptable vehicle or excipient, and optionally an adjuvant.

18. Immunogenic preparation or vaccine against feline calicivirosis and against at least one other feline pathogen, characterized in that it comprises an in vivo expression vector according to one of Claims 4 to 7 and 11 and an in vivo expression vector into which a sequence encoding an immunogen of another feline pathogen is inserted.

19. Multivalent immunogenic preparation or vaccine against feline calicivirosis and against at least one other feline pathogen, characterized in that it comprises an in vivo expression vector according to Claim 12 or 13, and a veterinarily acceptable vehicle or excipient, and optionally an adjuvant.

20. Immunogenic preparation or vaccine according to any one of Claims 15 to 19, characterized in that at least one of the in vivo expression vectors is a plasmid and in that the adjuvant is a cationic lipid containing a quaternary ammonium salt of formula: CH, © R,-O-CH,- is - He — R,-X OR, CH, in which Rl is a saturated or unsaturated, linear aliphatic radical having from 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms, and X is a hydroxyl or amine group.

21. Immunogenic preparation or vaccine according to Claim 20, characterized in that the adjuvant is DMRIE,

’ preferably coupled with a neutral lipid, DOPE to form - the DMRIE-DOPE.

22. Immunogenic preparation or vaccine according to any one of Claims 15 to 19, characterized in that at least one of the in vivo expression vectors is a poxvirus, preferably a canarypox, and in that the adjuvant is a polymer of acrylic or methacrylic acid, preferably a carbomer.

23. Immunogenic preparation or vaccine according to any one of Claims 15 to 22, characterized in that it comprises, in addition, an in vivo expression plasmid vector into which the gene encoding feline GM-CSF is inserted.

24. Immunogenic preparation or vaccine according to Claim 14, characterized in that it comprises a capsid protein of the FCV 431 strain, optionally assembled in the form of empty capsids, this protein having the sequence SEQ ID NO : 7, or an immunologically active fragment or epitope of this protein.

25. Immunogenic preparation or vaccine according to Claim 14 or 24, characterized in that it comprises a capsid protein of the FCV Gl strain, optionally assembled in the form of empty capsids, this protein having the sequence SEQ ID NO : 5, or an immunologically active fragment or epitope of this protein.

26. Isolated, purified or synthetic capsid protein having the sequence SEQ ID NO : 7.

27. Isolated, purified or synthetic capsid protein having the sequence SEQ ID NO : 5.