Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Our reference Date B 1351 WO 21 March 2025 Applicant: BioNTech SE An der Goldgrube 12 55131 Mainz/DE Cytotoxic polynucleotides, particles containing the cytotoxic polynucleotides and uses thereof The present invention relates to cytotoxic polynucleotides comprising at least one nucleotide analogue comprising a modified base providing cytotoxicity to the polynucleotide whereas the free modified base compound is non-cytotoxic for mammalian cells. The present invention is also directed to particles comprising the polynucleotide of the invention and a cationic polymer and/or lipid composition. Further subject matter of the invention are pharmaceutical compositions comprising the polynucleotide and/or the particle as well as medical uses thereof. Chemotherapies are standard care for most cancer types. Pyrimidine analogues including 5- fluorouracil (5FU), cytosine arabinoside, 5-azacytidine and gemcitabine are effective drugs that are utilised as part of a number of anti-cancer regimens. However, their lack of cell- specificity results in severe side-effects. Therefore, there is capacity to improve the efficacy of such therapies, while decreasing unwanted side-effects. Although immunotherapies have emerged as potent and safe tools against numerous malignancies, chemotherapies remain the standardised treatment of care for most cancers. Pyrimidine analogues such as 5-fluorouracil (hereinafter also denoted as “5FU”), cytosine arabinoside, 5-azacytidine or gemcitabine are effective drugs that are the basis of a number of anti-cancer regimens, including breast cancer and colorectal cancer. Specifically, 5FU remains the first-line of treatment in colorectal cancer management. Despite efficaciousness of such chemotherapies, their lack of cell-specificity induces side-effects and extended treatment courses that can lead to drug resistance (1). Fluoropyrimidines (hereinafter also referred to as “FPs”) were first noted for their anti-tumour effects when it was discovered that rat hepatomas acquired uracil more rapidly than normal tissue, indicating that uracil metabolism could be a potential therapeutic target (2, 3). Since then, the FP 5FU has been used for the treatment of a number of cancers, including breast and head and neck cancers but has especially made an impact in colorectal cancer
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys management (4). Indeed, 5FU is the standard of care for patients with colorectal cancer (hereinafter also referred to as “CRC”) having KRAS mutations, as seen in as much as half of all CRC cases (3). This is of importance because CRC is the third biggest cause of cancer mortality. 5FU is usually administered continuously over 24 - 48 hours of intravenous infusion for an optimal risk-to-benefit ratio. Capecitabine is a relatively new oral pro-drug of 5FU, which showed non-inferiority in clinical trials and can be used as a second-line therapy for colorectal, gastric and esophageal cancers. In dermatology, 5FU topical creams may be used to treat actinic keratosis, certain types of basal cell carcinomas or verruca vulgaris also known as skin warts (5). 5FU is an uracil analogue with a fluorine atom at the C-5 position. Most anti-metabolite drugs either inhibit essential biochemical processes or are incorporated into nucleic acids.5FU does both, making it a potent toxic molecule to tumour cells (4). While >80% of 5FU is metabolized into non-active compounds by dihydropyrimidine dehydrogenase, the rest of the intravenously administered 5FU enters the cell the same way uracil does, where it is converted into several active metabolites: 2’-deoxy-5-fluorouridine monophosphate (FdUMP), 2’-deoxy-5-fluorouridine triphosphate (FdUTP) and 5-fluorouridine triphosphate (FUTP) (4). These active metabolites determine the three 5FU-induced mechanisms of action. Firstly, extensive misincorporation of 5FU into RNA subsequent to its transformation into FUTP, leads to disruption of physiological RNA function and processing.5FU exerts toxic effects not only through incorporation in mRNA, but also in tRNA, rRNA and snRNA (6-9). The second mechanism of action is the metabolization of 5FU into FdUTP and its incorporation into DNA and termination of replication. The last and what is believed to be the most important pathway is the inhibition of thymidylate synthase (TS), an essential enzyme in replenishing the thymidylate pools of the cell, by FdUMP. This leads to a lack of dTMP and an accumulation of dUMP and its phosphorylated metabolites. This deficiency of dTMP can be evaded by resistant tumour cells by an overexpression of thymidine kinase (TK) (10), 11). 5FU therapy is associated with mild or severe cardiotoxicity, can lead to life-threatening conditions in less than 1% of 5FU-treated individuals and thus to discontinuation of treatment (12). Other significant side-effects include neutropenia, thrombocytopenia and diarrhea, which can especially be a big problem for oral drug delivery of the 5FU precursor, capecitabine (13) Additionally, as mentioned above, there is an issue concerning drug resistance to long-term treatment with 5FU (1, 14).
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys WO 2009/144230 A1 discloses protamine/RNA nanoparticles of defined average size, a pharmaceutical composition containing said nanoparticles and to a method of producing the same. The nanoparticles of the present invention are disclosed as useful as an immunostimulating medicament with a precise pattern of immunostimulation WO 2012/103985 A1 discloses cell penetrating RNA formulations consisting of RNA molecules having an alkali metal as counter ion and being formulated in the presence of dications. These RNA formulations are disclosed to be useful in stimulating Toll-like receptors (TLRs) and other intracellular sensors of immunity (such as RIG-I) resulting in triggering of immune modulation. WO 2017/067592 A1 and WO 2017/068013 A1 disclose particles comprising RNA, in which the RNA is associated with a cationic polymer or lipid or with both a cationic polymer and lipid, wherein the RNA comprises a cytotoxic nucleotide or cytotoxic nucleotide analogue and/or the RNA is covalently attached to a cytotoxin, pharmaceutical compositions containing said particles and pharmaceutical uses of the particles and pharmaceutical compositions. The particles of WO 2017/057692 A1 and WO 2017/068013 A1, respectively are described therein to be useful as an immunostimulating medicament capable to block proliferation or induce death in dividing cells such as tumor cells. The technical problem underlying the present invention is to provide improved polynucleotide molecules useful in the treatment of tumors and cancer. The solution to the above technical problem is provided by the embodiments of the present invention as described herein and in the claims. According to a first aspect, the present invention provides a cytotoxic polynucleotide comprising at least one nucleotide analogue comprising a modified base providing cytotoxicity to the polynucleotide whereas the free modified base compound is non-cytotoxic for mammalian cells. According to the invention, the term “nucleotide analogue comprising a modified base providing cytotoxicity to the polynucleotide” shall mean that inclusion of said nucleotide analogue into a polynucleotide leads to a cytotoxic activity of the polynucleotide as compared to the otherwise same polynucleotide without said nucleotide analogue.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys The term “the free modified base compound is non-cytotoxic for mammalian cells” as defined herein shall mean that the modified base moiety of the modified nucleotide when said modified base is not present in a polynucleotide, preferably not present in a nucleoside tri,- di or monophosphate, more preferably not present in a nucleoside, most preferably not covalently bound to another chemical entity, essentially does not exert an antimetabolic activity in a mammalian cell, preferably human cell. Preferably, the nucleotide analogue providing cytotoxicity to the polynucleotide which incorporated therein, but being essentially non-cytotoxic to mammalian cells, comprises a modified pyrimidine base. More preferably, the nucleotide analogue providing cytotoxicity to the polynucleotide which incorporated therein, but being essentially non-cytotoxic to mammalian cells, comprises 5-fluorocytosine. 5-Fluorocytosine (hereinafter also referred to as “5FC”) is known as an antimycotic functioning as a prodrug exerting its antifungal activity by deamination by cytosine deaminase to yield 5-fluorouracil. Since mammalian, and in particular human, cells essentially lack the enzyme cytosine deaminase 5FC is essentially not cytotoxic for mammals, in particular humans. The present invention is based at least in part on the surprising finding that while certain modified nucleotide bases, in particular modified pyrimidine analogues, more particularly FPs, specifically 5FC, lacking itself antimetabolic activity, such modified analogues induce cytotoxic effects on cancer cells. According to preferred embodiments of the first aspect of the invention, the cytotoxic polynucleotide comprises at least one further nucleotide analogue being different from the above-defined nucleotide analogue comprising a modified base providing cytotoxicity to the polynucleotide whereas the free modified base compound is non-cytotoxic for mammalian cells. The further nucleotide analogue may be cytotoxic or non-cytotoxic. Preferably, the cytotoxic nucleotide analogue is selected from one or more of Gemcitabine, 2’,2’-difluoro-5-fluorocytidin, 5-Fluorouridine, Azacitidine, Cladribine, Clofarabine, Cytarabine, Decitabine, Floxuridine, Fludarabine, Nelarabine, Pentostatin, Azathioprine, Carmofur, Mercaptopurine, Tegafur, and Tioguanine.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Most preferred, the further cytotoxic nucleotide analogue(s) in the polynucleotide of the first aspect of the invention is/are at least one 5-Fluorouridine nucleotide analogue and/or at least one Gemcitabine nucleotide analogue. A second aspect of the invention is the nucleoside 2’,2’-difluoro-5-fluorocytidin. A third aspect of the invention is a nucleotide comprising 2’,2’-difluoro-5-fluorocytidin. A fourth aspect of the invention is another cytotoxic polynucleotide comprising at least one nucleotide according to the third aspect of the invention. The cytotoxic nucleotide analogue present in the cytotoxic polynucleotide of the fourth aspect of the invention is thus a combination of Gemcitabine and 5FC having the benefit of combining both cytotoxic potential of both Gemcitabine and 5FC in one nucleotide analogue species in the polynucleotide of the fourth aspect of the invention. According to preferred embodiments of the fourth aspect of the invention, the cytotoxic polynucleotide comprises at least one further nucleotide analogue being different from the above-defined nucleotide analogue comprising 2’,2’-difluoro-5-fluorocytidin. The further nucleotide analogue in the polynucleotide of the fourth aspect of the invention may be cytotoxic or non-cytotoxic. Preferably, the further cytotoxic nucleotide analogue in the polynucleotide of the fourth aspect of the invention is selected from one or more of Gemcitabine, 5-Fluorocytosin, 5- Fluorouridine, Azacitidine, Cladribine, Clofarabine, Cytarabine, Decitabine, Floxuridine, Fludarabine, Nelarabine, Pentostatin, Azathioprine, Carmofur, Mercaptopurine, Tegafur, and Tioguanine. As used herein, the term "polynucleotide" shall mean multiple nucleotides, i.e. a molecule comprising a ribose or deoxyribose linked to a phosphate group and to an organic base selected from the group consisting of cytosine (C), adenine (A), guanine (G) and uracil (U) in the case of RNA polynucleotides or thymine (T) in the case of DNA polynucleotides, with the proviso that the polynucleotide comprises at least one of the analogues thereof as defined above. An oligomer generally is defined to consist of a finite number of monomer units, which number typically ranges from a few to more than a hundred. In the context of the present invention, an oligoribonucleotide may have a length of from about 2 to about 100 ribonucleotides. More preferred oligoribonucleotide have length of from 12 to 40 nt, and even
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys more preferably the length is from 16 to 24 nt. The same length considerations (in base pairs, bp) are valid for double stranded species. Polynucleotides of the invention can be DNA or RNA or mixed DNA/RNA species. Polynucleotides of the invention can be single stranded or double stranded DNA or RNA or mixed species having partially doubled-stranded regions of DNA or RNA or mixed DNA/RNA. Partially double stranded polynucleotides of the invention may be formed of a single nucleotide strand having self-complementary segments forming hair-pin structures. One example of partially double stranded polynucleotides of the invention formed from a single strand having self-complementary segments are microRNAs (also denoted as “miR” or “µRNA”). Double stranded polynucleotides of the invention can be partially double stranded including double stranded polynucleotides having one or more segments of double stranded structure. Double stranded polynucleotides of the invention include double stranded polynucleotides having one or two blunt ends. Double stranded polynucleotides of the invention may be essentially double stranded but having short single stranded overhangs of 1 to 10 nucleotides. In preferred embodiments polynucleotides of the invention are single or doubled stranded RNA. Further preferred RNA polynucleotides of the invention are single stranded RNA oligonucleotides. Preferred double stranded RNA polynucleotides of the invention are siRNAs. Especially preferred siRNAs of the invention are directed against mRNAs encoding thymidylate synthase. Other preferred RNA polynucleotides of the invention are microRNA, preferably microRNA directed against mRNAs encoding thymidylate synthase. According to a third aspect, the invention provides an siRNA or a microRNA directed against thymidylate synthase wherein the siRNA or the microRNA comprises at least one 5- Fluorouridine (5FU) and/or 5-Fluorocytidine (5FC). In certain preferred embodiments of the invention polynucleotides of the invention are provided with an immunostimulating activity. More specifically, for providing a polynucleotide of the invention with an immunomodulating, in particular immunostimulating activity, it comprises at least a structure activating at least one pattern recognition receptor (PRP). According to preferred embodiments, the polynucleotide molecule of the invention comprises
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys a structure activating a Toll-like receptor (TLR), more preferably TLR-3, TLR-7 and/or TLR-8 and/or TLR-9 and/or a RIG-I-like receptor (RLR), more preferably RIG-I and/or MDA-5. Polynucleotides of the invention for activating TLR-3 are typically double-stranded RNA and comprise at least 45 bp (or at least contain a double-stranded section of at least that length). Polynucleotides of the invention triggering TLR-7 and/or -8 and/or 9 are typically single- stranded RNA. Polynucleotides of the invention triggering RIG-I and/or MDA-5 comprise a free triphosphate group at a 5’ end of the molecule. Preferably, the free 5’-triphosphate is attached to a blunt end dsRNA, wherein the dsRNA may be blunt at one or both ends. In the latter case the dsRNA can have a free triphosphate group at the 5’ terminus of one strand or at both 5’ termini. Other preferred RNA of the invention having a free 5’-phosphate group are partially double stranded RNAs made of a single strand having self-complementary hairpin sections, preferably microRNAs, having a blunt end wherein the free 5’-.phosphate group is present at the 5’-end of the partially double-stranded RNA, preferably the microRNA. According to the invention, polynucleotides of the invention may trigger one or more kinds of PRPs, e.g. in one embodiment, the RNA molecules of the invention can trigger TLR-3 and RIG-I. In other embodiments, polynucleotides of the invention exert no, essentially no or low immunostimulating activity, i.e. such polynucleotides are non-immunuostimulating, essentially non-immunostimulating or low immunostimulating, respectively. Preferred non-stimulating, essentially non-immunostimulating or low immunostimulating polynucleotides are siRNAs as further elaborated below, According to the invention, the term “essentially non-immunostimulating” or “exerting essentially no immunostimulating activity”, respectively, means that the polynucleotide, preferably a siRNA, does not induce detectable activation of innate immune cells in a typical test setting. Preferably, the essentially non-immunostimulating polynucleotide, preferably siRNA, does not induce detectably activation of innate immune cells as measured by secretion, or essentially lack thereof, TNF-alpha and INF-alpha, wherein essentially lack of secretion of TNF-alpha and INF-alpha shall mean that secretion of TNF-alpha and INF-alpha is below the detectable level in a typical assay, preferably as outline further below.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Preferably, the “innate immune cells” in this context are peripheral blood mononuclear cells (“PMBCs”). PBMCs are typically isolated from whole blood by density gradient centrifugation of diluted whole blood typically using saccharose epichlorohydrin copolymer and collecting the PBMCs at the interphase between the copolymer phase and the blood plasma phase according to standard methods known in the art such as preferably according to standard operating procedures (SOPs) recommended by the National Institutes of Health, branch National Institute of Allergy and Infectious Diseases, USA disclosed in (16) (as outlined in particular in Section 6.2 thereof) or (17) (as outlined in particular in Section 5.3 thereof) . Saccharose epichlorohydrin copolymers of different densities are available from various manufactures under tradenames or trademarks such as Ficoll®, Histopaque® and Polysucrose. Most preferably “essentially non-immunostimulating” polynucleotides, preferably, siRNAs, of the invention do not induce detectable secretion of TNF-alpha and INF-alpha by PBMCs, preferably isolated as outlined above, according to the following test protocol: 1 µg of polynucleotide, e.g. single stranded RNA or double-stranded RNA, preferably siRNA) in 1 µl of water is mixed with 2 or 3 µg of a cationic polymer such as Protamine in 2 or 3 µl of water followed by 10 min incubation at room temperature and addition of 200 µl PBMCs (preferably fresh isolated as outlined above) containing one million of cells in complete medium (RPMI+10% fetal calf serum). The samples are incubated overnight at 37°C under a 5% CO2 atmosphere, followed by ELISA on the supernatants using 10 µl of supernatant for TNF- alpha (suitable ELISA kits are commercially available, for example TNF-alpha ELISA MAX™ Standard ELISA Kit from BioLegend, Inc., San Diego, CA, USA) and 20 µl of supernatant for INF-alpha (suitable ELISA kits are commercially available, for example Human IFN-alpha pan ELISA development kit (HRP), from Mabtech AB, Nacka Strand, Sweden) in a final volume of 100 µl. Essentially no immunostimulation would mean essentially no detectable TNF-alpha and INF-alpha (expressed as pg/ml of the respective cytokine) when compared with identically treated PBMCs alone. “Low immunostimulating” according to the present invention, preferably means that the tested polynucleotide leads to a concentration of less than 100 pg/ml, more preferably less than 50 pg/ml, most preferably less than 25 pg/ml, of each cytokine in supernatant (TNF-alpha and INF-alpha) under the described test conditions. Low or essentially non-immunostimulating polynucleotides, in particular oligonucleotides, preferably RNAs, more preferably siRNA or microRNAs, of the invention are preferably chemically synthesized. When low or essentially non-immunostimulating polynucleotides, more preferably siRNAs (more specifically the strands thereof) or microRNAs are prepared
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys enzymatically, it is preferred that free 5’-phosphate groups are removed, preferably by incubation with a suitable phosphatase. In preferred siRNAs of the invention one, preferably the antisense strand, or both siRNA strands comprises at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide. More preferably, one strand of the siRNA, preferably the antisense strand, comprises at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide, and the other strand of the siRNA, preferably the sense strand, comprises least one nucleotide analogue selected from the group consisting of a Gemcitabine nucleotide, a 5-fluorouridine ribonucleotide and a 5-fluorouridine deoxynucleotide. In preferred embodiments, the antisense strand of the siRNA comprises at least one 5- fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide, and the sense strand of the siRNA comprises at least one Gemcitabine nucleotide. In further preferred embodiments, the antisense strand of the siRNA comprises at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide, and the sense strand of the siRNA comprises at least one Gemcitabine nucleotide and at least one 5-fluorouridine ribonucleotide. In other particularly preferred embodiments, the antisense strand of the siRNA comprises at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide, and the sense strand of the siRNA comprises at least one Gemcitabine nucleotide and at least one 5- fluorouridine deoxyribonucleotide. According to preferred embodiments, siRNAs of the above-described type (Gemcitabine, 5FC, 5FU) are low immunostimulating, more preferably essentially non-immunostimulating with the proviso that not both stands comprise Gemcitabine nucleotide(s). Preferred microRNAs of the invention comprise at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide. In other preferred embodiments of the invention the microRNA comprise at least one 5-fluorocytosin nucleotide and at least one 5-fluorouridine nucleotide and at least one Gemcitabine nucleotide. According to a preferred embodiment, any of the polynucleotides as defined and described herein may be complexed with alkaline earth metal ions such as calcium.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys In certain embodiments of the invention, the respective polynucleotide of the invention, preferably an RNA, is preferably present in a complex with alkali metal ions, more preferably Na+, preferably in an inventive composition According to the present invention, the letter “G” means guanosine (guanine associated to a ribose). According to the present invention, the letter “U” means uridine (uracil associated to a ribose). According to the present invention, the letter “A” means adenosine (adenine associated to a ribose). According to the present invention, the letter “C” means cytidine (cytosine associated to a ribose). According to the present invention, the letter “T” means thymidine (thymine associated to a deoxyribose) or ribothymidine (thymine associated to a ribose). Besides the above preferred sequence requirements (wherein the RNA polynucleotide can comprise one or more of the sequence features as described herein), the sequence of the RNA molecule is generally not restricted. As explained herein, all or a portion such as at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% of the pyrimidine residues of a polynucleotide of the invention may be modified so as to provide the cytotoxic nucleotide or cytotoxic nucleotide analogue, for example 5FC and/or 2’,2’-difluoro-5-fluorocytosin . In preferred embodiments, the polynucleotides of the invention may also comprise 5FU in addition to 5FC and/or 2’,2’- difluoro-5-fluorocytosin. In one embodiment polynucleotides of the present invention are preferably DNA or RNA oligonucleotides, more preferably DNA or RNA oligonucleotides prepared through chemical synthesis, more preferred DNA or RNA oligonucleotides having a length of from 2 to 100 nucleotides or, in the case of DNA 2 to 100 bp. In other embodiments, the DNA or RNA polynucleotides can be made enzymatically. Preferred enzymatically prepared RNA polynucleotides as taught herein are prepared by in vitro transcription, and typically comprises more than 100 nucleotides such as from about 50 to about 40000 nucleotides, preferably from about 100 to about 10,000 nucleotides. Polynucleotides of the invention such as RNA polynucleotides can comprise – besides the nucleotide analogues providing cytotoxic activity - at least one cytotoxic chemical moiety linked to the RNA.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Examples of cytotoxic chemical moieties linked to polynucleotides of the invention, preferably RNA polynucleotides, comprise small toxic chemical groups such as a cyanide group and, according to certain preferred embodiments of the invention, tumor toxins such as tyrosine kinase inhibitors (e.g. Sunitinib or Sorafenib) or inhibitors of mutated oncogenes (e.g. Vemurafenib). The term “cytotoxic nucleotide or cytotoxic nucleotide analogue” as used herein refers to any nucleotide or nucleotide analogue, in particular nucleotide or nucleotide analogue which can be incorporated into nucleic acids such as RNA or DNA, which is cytotoxic or comprises a moiety such as a nucleoside or nucleoside analogue or nucleobase or nucleobase analogue which is cytotoxic. The cytotoxic nucleotide or cytotoxic nucleotide analogue may be cytotoxic if part of a nucleic acid molecule and/or following release of a cytotoxic moiety such as a nucleoside or nucleoside analogue or nucleobase or nucleobase analogue. Typically, analogues are similar to natural compounds and moieties, however, they are modified so as to provide certain effects such as cytotoxicity. Accordingly, the term “cytotoxic nucleotide or cytotoxic nucleotide analogue” includes cytotoxic purine nucleoside analogues and cytotoxic pyrimidine nucleoside analogues such as cytotoxic analogues or homologs of A, G, U, C, dA, dG, dT, dC. Cytotoxic nucleotides or cytotoxic nucleotide analogues to provide cytotoxicity can be modified (in comparison to non-modified nucleotide) on the base moiety (e.g.5-fluoro-uridine (5FU), 5-fluoro-cytosin (5FC), 6-mercaptopurine, deoxycoformycin (Pentostatin) and 2- chloro-adenine) or on the sugar moiety (e.g. cytosine arabinoside (cytarabine) or Gemcitabine) or both (e.g. Fludarabine). In various embodiments, adenine and/or guanine residues are modified in 6-mercaptopurine or deoxycoformycin or fludarabine, adenine residues are modified in 2-chloro-adenine, cytidine residues are modified in cytarabine or gemcitabine and/or uracil residues are modified in fluorouracil such as 5-fluorouracil. In one particularly preferred embodiment, uracil residues are modified in fluorouracil such as 5-fluorouracil. According to the invention, the term “cytotoxic nucleotide or cytotoxic nucleotide analogue” includes, but is not limited to, nucleotide and nucleotide analogues comprising a moiety selected from the group consisting of: Azacitidine (4-Amino-1-β-D-ribofuranosyl-1,3,5-triazin-2(1H)-one), Cladribine (5-(6-Amino-2-chloro-purin-9-yl)-2-(hydroxymethyl)oxolan-3-ol),
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Clofarabine (5-(6-amino-2-chloro-purin-9-yl)-4-fluoro-2-(hydroxymethyl)oxolan-3-ol), Cytarabine (4-amino-1-[(2R,3S,4R,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl] pyrimidin-2-one), Decitabine (4-Amino-1-(2-deoxy-β-D-erythro-pentofuranosyl)-1,3,5-triazin-2(1H)-one), Floxuridine (5-Fluoro-1-[4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl]-1H-pyrimidine-2,4- dione), Fludarabine ([(2R,3R,4S,5R)-5-(6-amino-2-fluoro-purin-9-yl)-3,4-dihydroxy-oxolan-2- yl]methoxyphosphonic acid), 5-fluorocytidine, Fluorouridine such as 5-fluoro-uridine, Gemcitabine (4-amino-1-(2-deoxy-2,2-difluoro-β-D-erythro-pentofuranosyl)pyrimidin-2(1H)- on), 2’,2’-difluoro-5-fluorocytidin, Nelarabine ((2R,3S,4S,5R)-2-(2-amino-6-methoxy-purin-9-yl)-5-(hydroxymethyl)oxolane-3,4- diol), Pentostatin ((R)-3-((2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2-yl)-3,6,7,8- tetrahydroimidazo[4,5-d][1,3]diazepin-8-ol), Azathioprine (6-[(1-Methyl-4-nitro-1H-imidazol-5-yl)sulfanyl]-7H-purine), Carmofur (5-fluoro-N-hexyl-2,4-dioxo-pyrimidine-1-carboxamide), Mercaptopurine (3,7-dihydropurine-6-thione), Tegafur ((RS)-5-Fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), and Tioguanine (2-amino-1H-purine-6(7H)-thione). In preferred embodiments of polynucleotides of the invention, in particular in the case of oligonucleotides such as single-stranded DNA or RNA oligonucleotides or double-stranded DNA or RNA oligonucleotides, preferably siRNAs, or mixed dsRNA/DNA, a majority of, i.e. more than 50 %, more preferably all nucleotides a particular unmodified nucleotide present in the respective oligonucleotide, in the case of double-stranded oligonucleotides at least one strand, preferably both strands thereof, is replaced by a corresponding modified, preferably cytotoxic nucleotide. For example, it is preferred that a majority of, preferably all C nucleotides in such constructs of the invention (in the case of double-stranded species such as dsRNA, preferably siRNA, in at least one, preferably both strands thereof) are replaced by 5FC and/or Gemcitabine nucleotides with the proviso, concerning the first aspect of the invention, that a corresponding polynucleotide, preferably an oligonucleotide such as single- stranded DNA or RNA oligonucleotide or a double-stranded DNA or RNA oligonucleotide, preferably siRNA, comprises at least one 5FC nucleotide, in the case of dsDNA or dsRNA, preferably siRNA, in one strand thereof. In further preferred embodiments, at least a majority
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys of, preferably all U nucleotides in RNA or all T nucleotides in DNA are replaced by 5FU or deoxy-5FU (=d5FU) nucleotides, in the case of double stranded DNA or double stranded DNA or mixed double-stranded DNA/RNA, preferably corresponding oligonucleotide species, in at least one, preferably both strands, thereof. In certain preferred embodiments of double- stranded polynucleotides of the invention, preferably oligonucleotides such as single- double- stranded DNA or RNA oligonucleotides, preferably siRNAs, or mixed dsRNA/DNA, at least a majority of, preferably all C nucleotides in one stand thereof are replaced by 5FC nucleotides and/or Gemcitabine nucleotides, and at least a majority of, preferably all, U or T, respectively, nucleotides in the other strand are replaced by 5FU. It is further preferred in certain embodiments that double-stranded polynucleotides of the invention, preferably oligonucleotides such as single- double-stranded DNA or RNA oligonucleotides, preferably siRNAs, or mixed dsRNA/DNA, are designed such that at least a majority of, preferably all, C nucleotides and at least a majority of, preferably all, U or T, respectively, nucleotides in one stand thereof (in siRNAs, preferably the antisense strand) are replaced by 5FC nucleotides and 5FU, respectively, nucleotides, and at least a majority of, preferably all C nucleotides in the other strand (in siRNAs, preferably the sense strand) are replaced by Gemcitabine nucleotides. According to the invention, the stability of RNA polynucleotides including siRNAs as taught herein may be modified as required. For example, RNA may be stabilized by one or more modifications having stabilizing effects on RNA. The term “modification” in the context of RNA as used according to the present invention includes any modification of RNA which is not naturally present in said RNA. In one embodiment of the invention, the RNA used according to the invention does not have uncapped 5′-triphosphates. Removal of such uncapped 5′-triphosphates can be achieved by treating RNA with a phosphatase. In one embodiment of the invention, the RNA used according to the invention has uncapped 5′-triphosphates (for example on non-coding transcript). The RNA according to the invention may have modified naturally occurring or synthetic ribonucleotides to increase its stability. For example, in one embodiment, in the RNA used according to the invention 5-methylcytidine is substituted partially or completely, preferably completely, for cytidine. Alternatively, or additionally, in one embodiment, in the RNA used
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys according to the invention pseudouridine is substituted partially or completely, preferably completely, for uridine. In one embodiment, the term “modification” relates to providing an RNA with a 5′-cap or with a 5′-cap analogue. The term “5′-cap” refers to a cap structure found on the 5′-end of an mRNA molecule and generally consists of a guanosine nucleotide connected to the mRNA via an unusual 5′ to 5′ triphosphate linkage. In one embodiment, this guanosine is methylated at the 7-position. The term “conventional 5′-cap” refers to a naturally occurring RNA 5′-cap, preferably to the 7-methylguanosine cap (m7 G). In the context of the present invention, the term “5′-cap” includes a 5′-cap analog that resembles the RNA cap structure and is modified to possess the ability to stabilize RNA if attached thereto, preferably in vivo and/or in a cell. Providing an RNA polynucleotide with a 5′-cap or 5′-cap analog may be achieved by in vitro transcription of a DNA template in the presence of said 5′-cap or 5′-cap analog, wherein said 5′-cap is co-transcriptionally incorporated into the generated RNA strand, or the RNA may be generated, for example, by in vitro transcription, and the 5′-cap may be attached to the RNA post-transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus. The RNA may comprise further modifications. For example, a further modification of the RNA used in the present invention may be an extension or truncation of the naturally occurring poly(A) tail. The term “stability” of RNA relates to the “half-life” of RNA. “Half-life” relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules. In the context of the present invention, the half-life of an RNA is indicative for the stability of said RNA. Of course, if according to the present invention it is desired to decrease stability of RNA, it is possible to modify RNA so as to interfere with the function of elements as described above increasing the stability of RNA. In one embodiment, as defined above, RNA polynucleotides described herein such is modified RNA, in particular modified mRNA, encoding a peptide or protein. According to the invention, the term “RNA encoding a peptide or protein” means that the RNA, if present in the appropriate environment, preferably within a cell, can direct the assembly of amino acids to produce, i.e. express, the peptide or protein during the process of translation. Preferably,
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys RNA according to the invention is able to interact with the cellular translation machinery allowing translation of the peptide or protein. The term “expression” is used according to the invention in its most general meaning and comprises the production of RNA and/or peptides or proteins, e.g. by transcription and/or translation. With respect to RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins. It also comprises partial expression of nucleic acids. Moreover, expression can be transient or stable. In the context of the present invention, the term “transcription” relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA. Subsequently, the RNA may be translated into protein. According to the present invention, the term “transcription” comprises “in vitro transcription”, wherein the term “in vitro transcription” relates to a process wherein RNA, in particular mRNA, is in vitro synthesized in a cell-free system, preferably using appropriate cell extracts. Preferably, cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term “vector”. The term “translation” according to the invention relates to the process in the ribosomes of a cell by which a strand of messenger RNA directs the assembly of a sequence of amino acids to make a peptide or protein. In certain embodiments, one or more cytotoxic agents may be linked to a polynucleotide of the invention, preferably an RNA polynucleotide of the invention. Useful classes of cytotoxic agents (cytotoxins) include, for example, antitubulin agents, DNA minor groove binders (e.g., enediynes and lexitropsins), DNA replication inhibitors, alkylating agents (e.g., platinum complexes such as cis-platin, mono(platinum), bis(platinum) and tri- nuclear platinum complexes and carboplatin), anthracyclines, antibiotics, antifolates, antimetabolites, chemotherapy sensitizers, duocarmycins, etoposides, fluorinated pyrimidines, ionophores, nitrosoureas, platinols, pre-forming compounds, purine antimetabolites, puromycins, radiation sensitizers, steroids, taxanes (e.g., paclitaxel and docetaxel), topoisomerase inhibitors, vinca alkaloids, antimicrotubule agents, or the like. Individual cytotoxic agents include, for example, an androgen, anthramycin (AMC), asparaginase, 5-azacytidine, azathioprine, bleomycin, busulfan, buthionine sulfoximine, camptothecin, carboplatin, carmustine (BSNU), CC-1065, chlorambucil, cisplatin, colchicine, cyclophosphamide, cytarabine, cytidine arabinoside, cytochalasin B, dacarbazine,
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys dactinomycin (formerly actinomycin), daunorubicin, decarbazine, docetaxel, doxorubicin, an estrogen, 5-fluordeoxyuridine, 5-fluorouracil, gramicidin D, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine (CCNU), mechlorethamine, melphalan, 6-mercaptopurine, methotrexate, mithramycin, mitomycin C, mitoxantrone, nitroimidazole, paclitaxel, plicamycin, procarbizine, streptozotocin, tenoposide, 6-thioguanine, thioTEPA, topotecan, vinblastine, vincristine, vinorelbine, VP-16 and VM-26. Examples of anti-tubulin agents include, but are not limited to, dolastatins (e.g., auristatin E, AFP, MMAF, MMAE, AEB, AEVB), maytansinoids, taxanes (e.g., paclitaxel, docetaxel), T67 (Tularik), vinca alkyloids (e.g., vincristine, vinblastine, vindesine, and vinorelbine), baccatin derivatives, taxane analogues (e.g., epothilone A and B), nocodazole, colchicine and colcimid, estramustine, cryptophysins, cemadotin, combretastatins, discodermolide, and eleutherobin. In one embodiment, the term "cytotoxin" refers to cytotoxic antibodies. The term "cytotoxic antibody" includes but is not limited to monoclonal antibodies (mABs) having the ability to target diseased cells such as tumor cells, marking them for immune-effector mediated cell killing (complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC)) and/or leading to reduced proliferation and apoptosis. The term "cytotoxin" also includes antigen-specific structures such as mABs conjugated to cytotoxic drugs as described herein. By combining the unique targeting capabilities of an antibody with the cancer-killing ability of a cytotoxic drug, antibody-drug conjugates (ADCs) exhibit lower side effects and provide a wider therapeutic window compared to traditional chemotherapeutic agents. In one preferred embodiment, the target antigen (disease- associated antigen) bound by the cytotoxic antibody is localized on the cell surface and accessible to circulating antibody. According to the invention, the term "antigen-specific structure" includes any compound that has a binding capacity to a target antigen such as a disease-associated antigen. The term includes molecules such as antibodies and antibody fragments, bispecific or multispecific molecules, chimeric antigen receptors (CARs) and all artificial binding molecules (scaffolds) having a binding capacity to the target including but not limited to nanobodies, affibodies, anticalins, DARPins, monobodies, avimers, and microbodies. In one embodiment said binding is a specific binding.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys The term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies and chimeric antibodies. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region. Each light chain is comprised of a light chain variable region (VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. In preferred embodiments, the cytotoxic antibody is selected from the group consisting of alemtuzumab, bevacizumab, cetuximab, denosumab, gemtuzumab, ozogamicin, ibritumomab tiuxetan, ipilimumab, ofatumumab, panitumumab, pertuzumab, rituximab, tositumomab, and trastuzumab. The term "polynucleotide covalently attached to a cytotoxin" includes situations where one or more molecules of the same cytotoxin are covalently attached to a polynucleotide of the invention such as an RNA polynucleotide as well as where different cytotoxins are covalently attached to an inventive polynucleotide, preferably a RNA polynucleotide. In the latter situation, one or more molecules of each of the different cytotoxins may be attached to a polynucleotide of the invention, preferably a RNA polynucleotide, or a combination thereof (e.g. one molecule of one cytotoxin is attached while several molecules of another cytotoxin are attached). The generation of polynucleotide-cytotoxin conjugates such as RNA-cytotoxin conjugates can be accomplished by any technique known to the skilled artisan. polynucleotide-cytotoxin conjugates can be prepared by binding the cytotoxin to the inventive polynucleotide in accordance with a conventional technique. A polynucleotide of the invention and a cytotoxin may be directly bound to each other via their own linker groups or indirectly via a linker or other substance. There are many linking groups known in the art for making polynucleotide- cytotoxin conjugates. A linker preferably comprises one or more functional groups that react with either or both the polynucleotide and the cytotoxin.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys In certain preferred embodiments, the polynucleotide according to the invention is selected from the following (or comprises the following) sequences, preferably RNA sequences: 5’-A.[5FC].A.[5FC].[5FC].C.[5FC].[5FC].G.C[5 F].A.C[[5F].G.G.G.G.G.G-3’ (SEQ ID NO: 1) 5’-G.G.G.G.G.G.A.[5FC].[5FC].C.[5FC].[5FC].G.[5FC].A.[5FC].A.[5FC]-3’ (SEQ ID NO: 2) 5’-A.G.[5FC].G.[5FC].C5F].A.[5FC].C.[5FC].[5FC].G.[5FC].A.[5FC].G.G.G.G.G.G-3’ (SEQ ID NO: 3) 5’-A.[5FC].A.[5FC].[5FC].C.[5FC].[5FC].G.[5FC].A.[5FC].G.G.G.G.G.G.G.G.G.G.G.G-3’ (SEQ ID NO: 4) 5’-G.G.G.G.G.G.A.[5FC].A.[5FC].[5FC].C.[5FC].[5FC].G.[5FC].A.[5FC].G.G.G.G.G.G-3’ (SEQ ID NO: 5) 5’-A.[5FC].A.[5FC].[5FC].[5FC].[5FC].[5FC].G.[5FC].A.[5FC].G.G.G.G.G.G-3’ (SEQ ID NO: 6) 5’-G.G.G.G.G.G.A.[5FC].A.[5FC].[5FC].C.[5FC].[5FC].G.[5FC].A.C[5 F].G.G.G.G.G.G-3’ (SEQ ID NO: 7) 5’- [5FU].[5FC].[5FU] [5FC].[5FU].[5FC] [5FU][5FC].[5FU] [5FC].[5FU].[5FC] [5FU].[5FC].[5FU] [5FC].[5FU].[5FC]-3’ (SEQ ID NO: 8) 5'- [5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[5FC].[ 5FC].[5FC].C-3 (SEQ ID NO: 9) 5’-A.G.[5FC].G.[5FC].[5FC].A.[5FC].[5FC].U.[5FC].[5FC].G.[5FC].A.[5FC].G.G-3’ (SEQ ID NO: 10) Further preferred polynucleotides of invention are selected from the following sequences (or comprises the following sequences): 5'-[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC] [d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC]-3' (SEQ ID NO: 25) 5'-[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC] [d5FC].[dFdC].[d5FC].[dFdC].[d5FC].[dFdC]-3' (SEQ ID NO: 26) wherein “[5FC]” denotes a 5FC nucleotide (as ribonucleotide or deoxyribonucleotide), “[5FU] denotes a 5FU nucleotide (as ribonucleotide or a deoxyribonucleotide) and the other nucleotide abbreviations are defined as outlined above. For better understanding of the sequences, the nucleotides are separated by a point. According to preferred embodiments, the polynucleotides of the first and fourth aspect of the invention as well as the siRNA of the third aspect of the invention can comprise, optionally
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys besides the one or more tumor cytotoxic nucleotide analogues, other chemically modified or labelled, respectively, nucleotide analogues known in the art. According to preferred embodiments, the inventive polynucleotide, preferably a RNA or RNA/DNA hybrid polynucleotide, is preferably single-stranded and, besides the tumor cytotoxic modification, usually does not contain (further) chemical modifications to its subunits (e.g. on the base, or on the phosphate, or on the ribose residue). However, modifications (e.g. phosphorothioate backbone, peptide nucleic acid: PNA, backbone, 2’ Fluoro) that could help manufacturing or formulation or biological activities or linkage to a cargo of the polynucleotide, preferably RNA polynucleotide, described herein are also subject of the present invention. The 5’ end of an inventive RNA can be OH, monophosphate or triphosphate, the latter, as mentioned before, allowing stimulation of the cytosolic RIG-I, thus enhancing immunostimulation. In an embodiment of the invention, the inventive polynucleotides are present in complex with alkali metal ions, i.e. lithium, sodium, potassium, rubidium, caesium and/or francium ions, preferably sodium (Na+) or potassium (K+). Most preferred, the complex contains the RNA molecule and sodium ions. Complexes of the invention may be prepared by precipitating the RNA molecule using an alkali metal salt such as sodium chloride (NaCl) and/or sodium acetate (NaAc) and an alcohol, preferably ethanol or propanol. According to an alternative embodiment, the alkali metal-RNA complex may be prepared by ion exchange chromatography, preferably using commercially available HPLC systems. With respect to further details for the preparation protocol, it is referred to WO-A-2012/003985. The present invention also relates to formulations containing a polynucleotide as defined herein, such as an RNA polynucleotide according to the invention, preferably RNA-alkali metal complexes, more preferably RNA-sodium-complexes, in a dication-containing solution, preferably an aqueous solution. With respect to RNA polynucleotides such formulation is also referred to herein as “RNA formulation”. Dications for use in this aspect of the invention are preferentially selected from alkaline earth metals, i.e. beryllium, magnesium, calcium, strontium, barium and/or radium, and transition metals such as manganese and/or cobalt. Especially preferred solutions of the inventive formulation contain calcium (Ca2+), magnesium (Mg2+) and/or manganese (Mn2+), with calcium being the most preferred dication species. The dication, in particular Ca2+, is preferably used at a concentration of 0.2 mM to 20 mM. Particularly preferred solutions for providing the inventive RNA polynucleotide formulation are Ringer solutions such as Ringer, Ringer lactate or Ringer acetate. Especially preferred formulations of the invention are prepared by providing an RNA as defined above (preferably containing a poly-G sequence, a
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys poly- U sequence and/or the sequence motif GPunG and/or the sequence motif GGAmAGG as defined above) or a corresponding RNA-alkali metal complex at a concentration of between 0.1 mg/ml to 3 mg/ml in Ringer lactate or another Ca2+-containing solution. More preferred formulations of the invention contain RNA-sodium complexes prepared by diluting an RNA-sodium complex as described herein to a concentration of between 0.1 mg/ml to 3 mg/ml in Ringer lactate or another Ca2+-containing solution. As a practical example, the dried RNA or RNA-alkali metal complex (typically being present in lyophilized form) may be suspended in Ringer lactate or other suitable Ca2+-containing solution so that the appropriate concentration of the RNA or RNA-alkali metal complex, respectively, is attained. It has been surprisingly shown according to the invention that the replacement of one or more C nucleotides in RNA polynucleotide such as RNA oligonucleotides by 5FC provides the poly-/oligonucleotides with immunochemotherapeutic properties. An siRNA or a microRNA of the invention incorporating 5FU and/or 5FC can be used as a tri-functional therapeutic molecule in that it provides RNAi function (e.g. directed against oncogenic polypeptides), can be equipped with immunostimulant functions and serving as chemotherapeutic agent. The immunostimulant properties of the inventive polynucleotides can be modulated (ranging from strong immunostimulation, typically by induction of cytokines such as TNF-alpha and/or INF-alpha, down to low or essentially no immunostimulation as evidenced by essentially undetectable induction of cytokines, preferably by using the described in vitro assay outlined above) and fine-tuned as desired using adjustment of sequence and formulation. Immunochemotherapeutic siRNA of the invention can target mRNAs coding for proteins increased in 5FU-resistant tumor cells such as thymidylate synthase. Further subject matter of the invention is a particle comprising a polynucleotide of the invention, i.e. at least one polynucleotide of the first and/or fourth aspect of the invention, preferably at least one RNA polynucleotide of the first and/or fourth aspect of the invention, and/or a siRNA or mciroRNA of the third aspect of the invention wherein the particle further comprises a cationic polymer and/or lipid. Preferred polycation for use in the invention include, but are not limited to, of Protamine, poly-L.-arginine, Polybrene, polyethyleneimine (PEI), manosylated PEI, poly-L-lysine, histones. poly(amidoamines) and cationic polypeptides of aculeates, preferably Melittin and homologues thereof form such as from the genera Vespula, Vespa and Polistes.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Particles of the present invention preferably have a defined average size (diameter) of about 10 to about 1000 nm, preferably about 50 nm to about 400 nm, more preferably about 100 nm to about 200 nm. The average “size” of the particles is generally the “design size” or intended size of the particles prepared according to an established process. Size may be a directly measured dimension, such as average or maximum diameter, or may be determined by an indirect assay such as a filtration screening assay. Direct measurement of particle size is typically carried out by dynamic light scattering. As minor variations in size arise during the manufacturing process, a variation up to 40% of the stated measurement is acceptable and considered to be within the stated size. Alternatively, microcarrier size may be determined by filtration screening assays. For example, a particle preparation is less than a stated size, if at least 97% of the particles pass through a “screen-type” filter of the stated size. Cationic polymers or lipids contemplated for use as carriers in the particles of the present invention include any substances or vehicles with which RNA can be associated, e.g. by forming complexes with the RNA or forming vesicles in which the RNA is enclosed or encapsulated, preferably resulting in increased stability of the RNA compared to naked RNA. The carriers useful according to the invention include lipid-containing carriers such as cationic lipids, ionizable lipids, liposomes and micelles, cationic polymers such as DEAE dextran or polyethyleneimine and nanoparticles. Cationic lipids may form complexes with negatively charged nucleic acids. Any cationic lipid may be used according to the invention. Cationic lipids and cationic polymers can be used to complex nucleic acids, thereby forming so-called lipoplexes (lipids plus RNA), polyplexes (polymer plus RNA), and lipopolyplexes (lipid plus polymer plus RNA), respectively, and these complexes have been shown to deliver nucleic acids into cells. In one embodiment, the polyplex or lipopolyplex comprises at least one agent selected from the group consisting of an RNA-complexing peptide or protein. In one embodiment, the at least one cationic polymer comprises at least one agent selected from the group consisting of Protamine, polyethyleneimine, a poly-L-lysine, a poly-L-arginine or a histone. In one embodiment, the lipoplex is a cationic liposome. In one embodiment, the liposome comprises a phospholipid such as phosphatidylcholine and/or a sterol such as cholesterol.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Liposomes are microscopic lipidic vesicles often having one or more bilayers of a vesicle- forming lipid, such as a phospholipid, and are capable of encapsulating a drug. Different types of liposomes may be employed in the context of the present invention, including, without being limited thereto, lipid nanoparticles (LNP), multilamellar vesicles (MLV), small unilamellar vesicles (SUV), large unilamellar vesicles (LUV), sterically stabilized liposomes (SSL), multivesicular vesicles (MV), and large multivesicular vesicles (LMW) as well as other bilayered forms known in the art. The size and lamellarity of the liposome will depend on the manner of preparation and the selection of the type of vesicles to be used will depend on the preferred mode of administration. Preferred injectable liposomes are those in the size range of 10-500, 20-400, 50-200, 50-150, 50-120, 50-100, or 50-90 nm in diameter. Cationic liposomes are structures that are made of positively charged lipids and are increasingly being used in gene therapy due to their favorable interactions with negatively charged nucleic acids and cell membranes. Cationic liposomes are also known as cationic lipoplexes. Liposomes should not be confused with micelles and reverse micelles composed of monolayers. The lipid assembly may be combined with stabilizers. Non-limiting examples of stabilizers include cholesterol and similar membrane active sterols, lipopolymers such as PEGylated lipids. Formation of liposomes is not a spontaneous process. Lipid vesicles are formed when phospholipids such as lecithin are placed in water and consequently form one bilayer or a series of bilayers, each separated by water molecules, once enough energy is supplied. Liposomes may be formed using standard methods such as the reverse evaporation method (REV), the dehydration-rehydration method (DRV), sonication or other suitable methods. Liposomes can be created, for example, by sonicating phospholipids in water. Low shear rates create multilamellar liposomes, which have many layers. Continued high-shear sonication tends to form smaller unilamellar liposomes. In this technique, the liposome contents are the same as the contents of the aqueous phase. Sonication is generally considered a “gross” method of preparation as it can damage the structure of the drug to be encapsulated. Newer methods such as extrusion and Mozafari method are employed to produce materials for human use. After liposome formation, the liposomes can be sized to obtain a population of liposomes having a substantially homogeneous size range, typically between about 10 and 500 nm. Any suitable liposome-forming material can be used in the present liposomes. The liposomes can include a vesicle-forming lipid derivatized with a hydrophilic polymer to form a surface coating of hydrophilic polymer chains on the liposome surface.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys According to the invention, Protamine is preferred as cationic carrier agent (cationic polymer). The term “Protamine” refers to any of various strongly basic proteins of relatively low molecular weight that are rich in arginine and are found associated especially with DNA in place of somatic histones in the sperm cells of various animals (as fish). In particular, the term “Protamine” refers to proteins found in fish sperm that are strongly basic, are soluble in water, are not coagulated by heat, and yield chiefly arginine upon hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin. According to the invention, the term “Protamine” as used herein is meant to comprise any Protamine amino acid sequence obtained or derived from native or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof. Furthermore, the term encompasses (synthesized) polypeptides which are artificial and specifically designed for specific purposes and isolated from native or biological sources. The Protamine used according to the present invention can be sulfated Protamine or hydrochloride Protamine. In a preferred embodiment, the Protamine source used for the production of the particles of the invention is Protamine 5000 which contains Protamine at more than 10 mg/ml (5000 heparin-neutralizing units per ml) in an isotonic salt solution and which is diluted as set forth above. The particles of the invention preferably have a Protamine:RNA weight ratio from 16:1 to 1:2, preferably from 8:1 to 1:2, more preferably from 4:1 to 1:2. In one embodiment, the lower range limit of the Protamine:RNA weight ratio is 1:1, preferably 2:1. The RNA may consist only in mtiRNA or in a mixture of mtiRNA and other RNA such as non-toxic RNA. In accordance with one embodiment of the invention the particles of the invention comprise on their outer surface a targeting agent or ligand such as an antibody which can selectively or preferably deliver the particles to a target cell population, and/or to a target organ or tissue. For example, liposomes bearing ligands can target receptors expressed on diseased cells. This ligand-binding promotes efficient drug uptake into cells and enhances efficacy. One targeting means which has been explored employs antibodies attached covalently or through electrostatic interactions to particle surfaces. The ligand may be capable of binding to a disease-associated antigen such that the particles when administered accumulate at a diseased organ or tissue characterized by cells expressing the disease-associated antigen and preferably being characterized by association
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys of the disease-associated antigen with their cell surface, e.g. the disease-associated antigen is a transmembrane protein. The disease-associated antigen may be a tumor-associated antigen and is preferably associated with the surface of a diseased cell such as a tumor cell but preferably not with the surface of a healthy cell. Preferably the ligand for site specific targeting binds to an extracellular portion of the disease-associated antigen. The term “peptide” according to the invention comprises oligo- and polypeptides and refers to substances comprising two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 10 or more, preferably 13 or more, preferably 16 more, preferably 21 or more and up to preferably 8, 10, 20, 30, 40 or 50, in particular 100 amino acids joined covalently by peptide bonds. The term “protein” preferentially refers to large peptides, preferably to peptides with more than 100 amino acid residues, but in general the terms “peptide” and “protein” are synonyms and are used interchangeably herein. According to the present invention, RNA polynucleotides may encode a peptide or protein, preferably a cytotoxic polypeptide and/or a polypeptide enhancing sensitivity to cancer or tumor therapy. Accordingly, RNA polypeptides of the invention may contain a coding region (open reading frame (ORF)) encoding a peptide or protein. For example, RNA may encode and express an antigen or a pharmaceutically active peptide or protein such as an immunologically active compound (which preferably is not an antigen). In this respect, an “open reading frame” or “ORF” is a continuous stretch of codons beginning with a start codon and ending with a stop codon. The term “pharmaceutically active peptide or protein” includes a peptide or protein that can be used in the treatment of a subject where the expression of a peptide or protein would be of benefit, e.g., in ameliorating the symptoms of a disease or disorder. For example, a pharmaceutically active protein can replace or augment protein expression in a cell which does not normally express a protein or which misexpresses a protein, e.g., a pharmaceutically active protein can compensate for a mutation by supplying a desirable protein. In addition, a “pharmaceutically active peptide or protein” can produce a beneficial outcome in a subject, e.g., can be used to produce a protein to which vaccinates a subject against an infectious disease. Preferably, a “pharmaceutically active peptide or protein” has a positive or advantageous effect on the condition or disease state of a subject when administered to the subject in a therapeutically effective amount. Preferably, a pharmaceutically active peptide or protein has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease or disorder. A pharmaceutically active peptide or protein
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease or pathological condition. The term “pharmaceutically active peptide or protein” includes entire proteins or polypeptides and can also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active analogs of a peptide or protein. The term “pharmaceutically active peptide or protein” includes peptides and proteins that are antigens, i.e., the peptide or protein elicits an immune response in a subject which may be therapeutic or partially or fully protective. Examples of pharmaceutically active proteins include, but are not limited to, cytokines and immune system proteins such as immunologically active compounds (e.g., interleukins, colony stimulating factor (CSF), granulocyte colony stimulating factor (G-CSF), granulocyte- macrophage colony stimulating factor (GM-CSF), erythropoietin, tumor necrosis factor alpha (TNFa), interferons, integrins, addressins, seletins, homing receptors, T cell receptors, immunoglobulins, soluble major histocompatibility complex antigens, immunologically active antigens such as bacterial, parasitic, or viral antigens, allergens, autoantigens, antibodies), hormones (insulin, thyroid hormone, catecholamines, gonadotrophines, trophic hormones, prolactin, oxytocin, dopamine, bovine somatotropin, leptins and the like), growth hormones (e.g., human grown hormone), growth factors (e.g., epidermal growth factor, nerve growth factor, insulin-like growth factor and the like), growth factor receptors, enzymes (tissue plasminogen activator, streptokinase, cholesterol biosynthetic or degradative, steriodogenic enzymes, kinases, phosphodiesterases, methylases, de-methylases, dehydrogenases, cellulases, proteases, lipases, phospholipases, aromatases, cytochromes, adenylate or guanylaste cyclases, neuramidases and the like), receptors (steroid hormone receptors, peptide receptors), binding proteins (growth hormone or growth factor binding proteins and the like), transcription and translation factors, tumor growth suppressing proteins (e.g., proteins which inhibit angiogenesis), structural proteins (such as collagen, fibroin, fibrinogen, elastin, tubulin, actin, and myosin), blood proteins (thrombin, serum albumin, Factor VII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator, protein C, von Wilebrand factor, antithrombin glucocerebrosidase, erythropoietin granulocyte colony stimulating factor (GCSF) or modified Factor VIII, anticoagulants and the like. In one embodiment, the pharmaceutically active protein according to the invention is a cytokine which is involved in regulating lymphoid homeostasis, preferably a cytokine which is involved in and preferably induces or enhances development, priming, expansion, differentiation and/or survival of T cells. In one embodiment, the cytokine is an interleukin. In one embodiment, the pharmaceutically active protein according to the invention is an interleukin selected from the group consisting of IL-2, IL-7, IL-12, IL-15, and IL-21.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys The term “immunologically active compound” relates to any compound altering an immune response, preferably by inducing and/or suppressing maturation of immune cells, inducing and/or suppressing cytokine biosynthesis, and/or altering humoral immunity by stimulating antibody production by B cells. Immunologically active compounds possess potent immunostimulating activity including, but not limited to, antiviral and antitumor activity, and can also down-regulate other aspects of the immune response, for example shifting the immune response away from a TH2 immune response, which is useful for treating a wide range of TH2 mediated diseases. Immunologically active compounds can be useful as vaccine adjuvants. In one embodiment, RNA that codes for an antigen such a disease-associated antigen is administered to a mammal, in particular if treating a mammal having a disease involving or expressing the antigen (disease-associated antigen) is desired. The RNA is preferably taken up into the mammal's antigen-presenting cells (monocytes, macrophages, dendritic cells or other cells). An antigenic translation product of the RNA is formed, and the product is displayed on the surface of the cells for recognition by T cells. In one embodiment, the antigen or a product produced by optional procession thereof is displayed on the cell surface in the context of MHC molecules for recognition by T cells through their T cell receptor leading to their activation. Interferons are important cytokines characterized by antiviral, antiproliferative and immunomodulatory activities. Interferons are proteins that alter and regulate the transcription of genes within a cell by binding to interferon receptors on the regulated cell's surface, thereby preventing viral replication within the cells. The interferons can be grouped into two types. IFN-gamma is the sole type II interferon; all others are type I interferons. Type I and type II interferons differ in gene structure (type II interferon genes have three exons; type I, one), chromosome location (in humans, type II is located on chromosome-12; the type I interferon genes are linked and on chromosome-9), and the types of tissues where they are produced (type I interferons are synthesized ubiquitously, type II by lymphocytes). Type I interferons competitively inhibit each other’s binding to cellular receptors, while type II interferon has a distinct receptor. According to the invention, the term “interferon” or “IFN” preferably relates to type I interferons, in particular IFN-alpha and IFN-beta. In the context of the present invention the terms “salt(s)” and “electrolyte(s)” are used interchangeably and mean a compound that at least partially dissociates into its respective counter ions in water.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys According to the present invention, the term “mM electrolytes” means the concentration in 10−3 mol per liter of the sum of all electrolytes (including inorganic salts such as NaCl, KCl, NaH2PO4 , Na2HPO4, KH2PO4 , K2HPO4 , MgCl2 , MnCl2, Na2SO4 , K2SO4, MgSO4 and salts such Tris-HCl, EDTA, Hepes, etc.) in the solutions used to resuspend or to dilute the RNA solutions and in the solutions used to dilute a Protamine stock solutions (such as Protamine 1000 or 5000). The present invention is also directed to pharmaceutical compositions containing a polynucleotide such as the RNA molecules of the invention, more preferably siRNAs and/or mircorRNAs, or their complexes or formulations or particles containing the polynucleotide species as described herein, optionally in combination with one or more pharmaceutically acceptable carrier(s), excipient(s) and/or diluent(s). In the inventive compositions (RNA formulation and/or pharmaceutical composition), one or several polynucleotide sequences such as RNA sequences for example, oligonucleotide sequences, can be combined to generate the final composition. Attachment of the polynucleotide(s) such as RNA(s) to a cargo (e.g. a peptide) can be used so that the formulated polynucleotide such as RNA introduces relevant, in particular bioactive, moieties into cells. It is also contemplated that polynucleotide compositions of the invention comprise one or more polynucleotide of the invention such as an inventive RNA containing the one or more chemical modifications (as defined above) providing the cytotoxicity, preferably tumor toxicity, and another polynucleotide species, for example RNA species, having an immunostimulating activity (as outlined before). The compositions and formulations according to the invention can comprise one or more adjuvants. "Adjuvant" in this context encompasses any compound which promotes an immune response. Various mechanisms are possible in this respect, depending on the various types of adjuvants. For example, compounds which allow the maturation of dendritic cells (DCs), e.g. lipopolysaccharides or CD40 ligand, form a first class of suitable adjuvants. Generally, any agent which influences the immune system of the type of a "danger signal" (LPS, gp96, dsRNA etc.) or cytokines, such as GM-CSF, can be used as an adjuvant which enables an immune response to be intensified and/or influenced in a controlled manner. CpG oligodeoxynucleotides can optionally also be used in this context, although their side effects which occur under certain circumstances are to be considered. Because of the presence of the immunostimulating/tumor cytotoxic agent according to the invention comprising RNA as the primary immunostimulant, however, only a relatively small amount of CpG DNA is
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys necessary (compared with immunostimulation with only CpG DNA). Particularly preferred adjuvants are cytokines, such as monokines, lymphokines, interleukins or chemokines, e.g. IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFα, INF-γ, GM-CFS, LT-α, or growth factors, e.g. hGH. Further known adjuvants are aluminium hydroxide, Freund's adjuvant or oil such as Montanide®, most preferred Montanide® ISA51. Lipopeptides, such as Pam3Cys, are also particularly suitable for use as further adjuvants in the compositions of the present invention. In a preferred embodiment, the compositions according to the invention can also be used in conjunction with another therapeutic reagent. The composition of the present invention may on its own synergize with other treatments such as chemotherapeutic drugs for cancer patients. Many chemotherapy regimens (e.g. etopophos, cis-platin, carbo-platin, etc.) or radiotherapy protocols can be used at dosages that do not severely affect the immune system. Thus, during radio/chemotherapy in cancer patients, the RNA compositions of the invention can be used whereby the death of tumor cells can be accompanied by the enhanced induction of an immune response. Systemic, preferably intra-venous and/or sub-cutaneous, as well as local, preferably intra-tumor or intradermal, injections of an RNA composition according to the present invention in patients under radio/chemotherapy may help the immune system to increase a response against the tumor as well as to combat the tumor directly by the tumor cytotoxic modification of the RNA. This regimen could also control tumor growth. The pharmaceutical composition including RNA formulation according to the invention may be used in combination with chloroquine, a pharmaceutical compound that impacts intracellular distribution (leakage from endosomes) and also increases cross presentation and thus the induction of antigen-specific effector T-cells. The present polynucleotides of the invention such as RNA polynucleotides as well as particles and/or compositions and/or complexes and/or formulations comprises them, are particularly suitable for use in inducing death of tumor and/or cancer cells and at the same time production, or increasing the level of, a cytokine. When added to human PBMC cells in vitro, certain preferred embodiments of the composition of the invention at a final concentration of 5 micrograms per ml are capable of inducing production of at least 100 pg/ml of a given cytokine by 1 million of fresh human PBMCs cultivated 24 hours in 200 μl culture medium (typically RPMI plus 10% fetal calf serum).
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys One preferred pharmaceutical composition is an injectable formulation comprising a polynucleotide of the invention in combination with a pharmaceutically acceptable excipient such as Ringer Lactate. The present invention further provides a method of treating cancer and/or tumor in a subject, in particular by stimulating a host immune response and introducing an anti-metabolite into cancer/tumor cells in a subject, preferably a mammal, especially a human. An effective amount of a pharmaceutical composition according to the invention is administered, optionally in combination with another therapeutic treatment (for example, radiotherapy) or agent, such as a protein vaccine, an additional cancer chemotherapy agent, an additional immunomodulating agent, and/or a pharmaceutical drug modifying intracellular distribution and/or enhancing cross-priming such as chloroquine. Thus, the present invention also comprises the use of penetrating RNA formulation as defined herein for the preparation of a pharmaceutical composition or medicament for immunomodulation and cancer or tumor, respectively, therapy in a subject, preferably a mammal, especially a human. Preferably, the additional immunomodulating agent is an anti-CTLA-4 or an anti PD1 or PDL1 or anti-regulatory T-cell reagent such as an anti-CD25 antibody or cyclophosphamide. The at least one additional therapeutic agent may be administered simultaneously with the pharmaceutical composition of the invention, or the at least one additional therapeutic agent is administered sequentially with the pharmaceutical composition according to the present invention. The method and composition of the present invention may be used to supplement IFN-alpha treatment, or to increase IFN-alpha in a subject. The method and composition of the present invention may be used to supplement interferon treatments, or to increase interferons (e.g. alpha, beta or lambda) in a subject, preferably a mammal, more preferred a human. The pharmaceutical composition of the invention typically comprises, in addition to a polynucleotide, an siRNA and/or inventive particles, other therapeutic or immunogenic agents, a pharmaceutically acceptable carrier and/or a pharmaceutically acceptable vehicle and/or pharmaceutically acceptable diluent. Appropriate routes for suitable formulation and preparation of the RNA agents and compositions according to the invention and the are disclosed in Remington: “The Science and Practice of Pharmacy,” 20th Edn., A.R. Gennaro, Editor, Mack Publishing Co., Easton, PA (2003). Possible carrier substances for parenteral administration are e.g. sterile water, Ringer, Ringer lactate, sterile sodium chloride solution,
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide/glycolide copolymers or polyoxyethylene/polyoxy- propylene copolymers. RNA compositions according to the invention can comprise filler substances or substances such as lactose, mannitol, substances for covalent linking of polymers (for example polyethylene glycol), or inclusion of materials in or on particular preparations of polymer compounds, such as e.g. polylactate, polyglycolic acid, hydrogel or to liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte fragments or spheroblasts. The particular embodiments of the RNA agent and compositions are chosen according to the physical and chemical properties, for example in respect of solubility, stability, bioavailability or degradability. Controlled or constant release of the active drug (- like) components according to the invention includes formulations based on lipophilic depots (e.g. fatty acids, waxes or oils). RNA formulations or compositions according to the invention can furthermore have protective coatings, e.g. protease inhibitors or permeability intensifiers. Preferred carriers are typically aqueous carrier materials, water for injection (WFI) or water buffered with phosphate, citrate, HEPES or acetate, or Ringer or Ringer Lactate etc. being used, and the pH is typically adjusted to 5.0 to 8.0, preferably 6.5 to 7.5. The carrier or the vehicle will additionally preferably comprise salt constituents, e.g. sodium chloride, potassium chloride or other components which render the solution e.g. isotonic. Furthermore, the carrier or the vehicle can contain, in addition to the abovementioned constituents, additional components, such as human serum albumin (HSA), polysorbate 80, sugars or amino acids. The mode and method of administration and the dosage of the pharmaceutical compositions according to the invention depend on the nature of the disease to be treated and, where appropriate, the stage thereof, the antigen (in the case of using the present compositions together with a vaccine) and also the body weight, the age and the sex of the patient. The pharmaceutical composition of the present invention may preferably be administered to the patient parenterally, e.g. intravenously, intraarterially, subcutaneously, intradermally, intra-lymph node or intramuscularly. It is also possible to administer the medicaments as defined herein topically or orally. According to preferred embodiments, the composition is administered by injection into a tumor tissue or tumor cavity, e.g. after a tumor is removed by surgery such as in the case of brain tumors. Examples of cancers treatable with the inventive pharmaceutical composition or formulation according to the invention include malignant melanoma, all types of carcinoma (colon, renal cell, bladder, prostate, non-small cell and small cell lung carcinoma, etc.), lymphomas, sarcomas, blastomas, gliomas, etc.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys As mentioned above, preferred embodiments of polynucleotides of the invention are toxic coding RNAs (mRNA in general with the following structure: 5’ cap, coding sequence starting with a start codon and ending with a stop codon, untranslated 3’ end followed by a poly-A tail), preferably having a length of from 50 to 40000 nt. In preferred embodiments, the mRNA species contains a poly-G (more than three consecutive G residues) or a poly-U (more than four consecutive U residues) or a GPurine(n)G (where Purine is G or A residues and n from 1 to 4 or more) sequence(s) such that it can penetrate cells thereby allowing transient transgenic protein expression. Messenger RNA coding for a protein of interest can be produced in vitro by transcription using for example a plasmid DNA matrix. If needed, a poly- G (more than three consecutive G residues) or a poly-U (more than 4 consecutive U residues) or a GPurine(n)G (where Purine is G or A residues and n from 1 to 4 or more) sequence can for example be added after the poly-A tail by adding in the DNA matrix a poly- dG (more than three consecutive dG residues) or a poly-dT (more than 4 consecutive dT residues) or a dGdPurine(n)dG (where dPurine is dG or dA residues and n from 1 to 4 or more) sequence (d stands for deoxy). Alternatively, poly-G or poly-U sequences can be added to the mRNA using terminal transferase. With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides the use of polynucleotides such as siRNA and/or microRNA, particles and pharmaceutical compositions comprising such polynucleotides such as siRNAs and/or microRNAs as defined herein as medicaments. With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides the use of polynucleotides such as siRNA and/or microRNA, particles and pharmaceutical compositions comprising such polynucleotides such as siRNAs and/or microRNAs as defined herein for inducing an immune response and/or for inducing cytotoxicity. With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides the use of polynucleotides such as siRNA and/or microRNA, particles and pharmaceutical compositions comprising such polynucleotides such as siRNAs and/or microRNAs as defined herein in therapy, preferably for treating and/or preventing a tumor or cancer, more preferably by inducing an immune response and/or for inducing cytotoxicity in a subject.
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides a method for treating a subject in need thereof, preferably a subject having a cancer and/or a tumor, comprising administering an effective amount of a polynucleotides such as siRNA and/or microRNA, particles and pharmaceutical composition comprising such polynucleotides such as siRNAs and/or microRNAs as defined herein to induce an immune response and/or induce cytotoxicity in said subject. With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides the use of polynucleotides such as siRNA and/or microRNA, and particles and compositions comprising such polynucleotides as siRNAs and/or microRNAs as defined herein for the manufacture of a medicament for inducing an immune response and/or for inducing cytotoxicity. With reference to the present disclosure, especially as outlined in more detail above, the present invention inter alia provides the use of polynucleotides such as siRNA and/or microRNA, and particles and compositions comprising such polynucleotides such as siRNAs and/or microRNAs as defined herein for the manufacture of a medicament for treating and/or preventing a tumor or cancer, preferably by inducing an immune response and/or for inducing cytotoxicity in a subject. The Figures show: Fig. 1: siRNA containing 5FU or 5FC are functional for RNAi. HEK cells (in RPMI 1640 medium in combination with 10% fetal bovine serum) were transfected essentially as taught in (15) with slight modifications: 2 µl MessengerMax.in 50 µl Opti-Mem medium 400 ng target mRNA + 40 pmol of siRNA or 80pmol sense in 50 µl Opti-MEM medium.25 µl of the mixture were applied per well for 100 ng of target mRNA (SEQ ID NO: 12) or control mRNA (SEQ ID NO: 24). The well plates were incubated for 5 hours at 37°C whereafter 100 µl samples were removed in test tubes and 100 µl of Firefly Luciferase HTS Assay was added. (A) shows the results of the experiments with target mRNA; (B) shows the results of the experiments with control mRNA. siRNA target sequence: 5'-C.U.U.A.C.G.C.U.G.A.G.U.A.C.U.U.C.G.A-3’ (SEQ ID NO: 11). The target sequence is underlined in the target mRNA of SEQ ID NO: 12 shown below. siRNA: fully unmodified sense strand 5'-C.U.U.A.C.G.C.U.G.A.G.U.A.C.U.U.C.G.A.dT.dT-3’ (SEQ ID NO: 13) antisense strand 5'-U.C.G.A.A.G.U.A.C.U.C.A.G.C.G.U.A.A.G.dT.dT-3'(SEQ ID NO: 14) siRNA 5FU: both strands have 5FU instead of U
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys sense strand 5'-C.[5FU].[5FU].A.C.G.C.[5FU].G.A.G.[5FU].A.C.[5FU].[5FU].C.G.A.dT.dT-3' (SEQ ID NO: 15) antisense strand 5'-[5FU].C.G.A.A.G.[5FU].A.C.[5FU].C.A.G.C.G.[5FU].A.A.G.dT.dT-3' (SEQ ID NO: 16) siRNA 5FC: both strands have 5FC instead of C sense strand 5'-[5FC].U.U.A.[5FC].G.[5FC].U.G.A.G.U.A.[5FC].U.U.[5FC].G.A.dT.dT-3’ (SEQ ID NO: 17) antisense strand 5'-U.[5FC].G.A.A.G.U.A.[5FC].U.[5FC].A.G.[5FC].G.U.A.A.G.dT.dT-3’ (SEQ ID NO: 18) Hybrids: SUC: sense strand unmodified according to SEQ ID NO: 13 A5FU: anti 5FU; antisense strand according to SEQ ID NO: 16 A5FC: anti 5FC; antisense strand according to SEQ ID NO: 18 AUC: antisense strand unmodified according to SEQ ID NO: 14 S5FU: sense 5FU, sense strand according to SEQ ID NO: 15 S5FC: sense 5FC, sense strand according to SEQ ID NO: 17 Fig. 2: ssRNA and siRNA containing 5FU or 5FC are immunostimulating. PBMCs were cultured overnight in 200 µl of medium (RPMI 1640 medium in combination with 10% fetal bovine serum) with 1 µg RNA per well and 3 µg of Protamine per well. (A) shows the results for the experiments with ssRNAs; (B) shows the results for the experiments with siRNAs. R185FC: 5'-A.G.[5FC].G.[5FC].[5FC].A.[5FC].[5FC].U.[5FC].[5FC].G.[5FC].A.[5FC].G.G-3’ (SEQ ID NO: 19) R85FU: 5'-A.G.[5FU].G.[5FU].[5FU].A.[5FU].[5FU].C.[5FU].[5FU].G.[5FU].A.[5FU].G.G-3’ (SEQ ID NO: 20) R18C: 5'-A.G.C.G.C.C.A.C.C.U.C.C.G.C.A.C.G.G-3’ (SEQ ID NO: 21) R18U: 5'-A.G.U.G.U.U.A.U.U.C.U.U.G.U.A.U.G.G-3’ (SEQ ID NO: 22) Homo5FU: 5‘- [5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[5FU].[ 5FU].[5FU].[5FU]-3‘ (SEQ ID NO: 23) siRNA target sequence: 5' C.U.U.A.C.G.C.U.G.A.G.U.A.C.U.U.C.G.A 3’ (SEQ ID NO: 11) siRNA: fully unmodified as outlined above for Fig.1 siRNA 5FU: both strands have 5FU instead of U as outlined above for Fig.1 siRNA 5FC: both strands have 5FC instead of C as outlined above for Fig.1 Hybrids: SUC: sense strand unmodified as outlined above for Fig.1 S5FU: sense 5FU as outlined above for Fig.1 S5FC: sense 5FC as outlined above for Fig.1 AUC: antisense strand unmodified
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys A5FU: anti 5FU as outlined above for Fig.1 A5FC: anti 5FC as outlined above for Fig.1 Fig. 3: ssRNAs containing 5FU or 5FC show chemotherapeutic activity. HEK cells (in RPMI 1640 medium in combination with 10% fetal bovine serum) were incubated for three days with the indicated amount of RNA either naked (A) or in complex with Protamine (B) or in lipofectamine (MessengerMax) (C). Fig. 4: siRNAs containing 5FU or 5FC show chemotherapeutic activity. HEK cells (in RPMI 1640 medium in combination with 10% fetal bovine serum) were incubated three days with 1.66 µg siRNA per ml in complex with Protamine. Fig.5: immunostimulative properties of ssRNA and siRNAs containing Gemcitabine nucleotides, 5FC nucleotides and 5FU nucleotides. 1 µg of ssRNA or siRNA in 1 µl of water were mixed with 2 µg of Protamine® in 2 µl of water followed by 10 min incubation at room temperature and addition of 200 µl fresh is PBMCs (preferably fresh isolated top of those 3 microliters of 200 microliters of fresh human PBMCs containing one million of cells in complete medium (RPMI+10% fetal calf serum). The samples were incubated overnight at 37°C under a 5% CO2 atmosphere, followed by ELISA on the supernatants using 10 µl of supernatant for TNF-alpha and 20 µl of supernatant for INF-alpha in a final volume of 100 µl. (A) shows the results of of induction of TNF-alpha by the indicated ssRNAs and siRNAs, respectively. (B) shows the results of induction of INF-alpha by the indicated ssRNAs and siRNAs, respectively. Asterisks indicate degree of significance according to one-way ANOVA. The results show that single stranded RNAs containing Gemcitabine and fluoropyrimidine nucleotides (5FU and 5FC) significantly induce secretion of INF-alpha (through triggering of TLR7) and/or TNF-alpha (through triggering of TLR8) by PBMCs. In contrast thereto, when ssRNAs are combined to form siRNAs and mixed with Protamine, they show low or essentially no induction of stimulation of TNF-alpha and INF-alpha, except when the strands of the siRNA contain Gemcitabine nucleotides instead of C nucleotides resulting in a strong induction of TNF-alpha. ssRNAs: N S: 5'-C.U.U.A.C.G.C.U.G.A.G.U.A.C.U.U.C.G.A.dT.dT-3’ (SEQ ID NO: 13) N R: 5'-U.C.G.A.A.G.U.A.C.U.C.A.G.C.G.U.A.A.G.dT.dT-3’(SEQ ID NO: 14) Gem S: 5'-[dFdC].U.U.A. [dFdC].G. [dFdC].U.G.A.G.U.A. [dFdC].U.U. [dFdC].G.A.dT.dT-3’ (SEQ ID NO: 27)
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Gem R: 5'-U.[dFdC].G.A.A.G.U.A. [dFdC].U. [dFdC].A.G. [dFdC].G.U.A.A.G.dT.dT-3’ (SEQ ID NO: 28) F S:5'- [5FC].[5FU].[5FU].A.[5FC].G.[5FC].[5FU].G.A.G.[5FU].A.[5FC].[5FU].[5FU].[5FC].G.A.dT.dT- 3’ (SEQ ID NO: 29) F R: 5'-[5FU].[5FC].G.A.A.G.[5FU].A.[5FC].[5FU].[5FC].A.G.[5FC].G.[5FU].A.A.G.dT.dT-3’ (SEQ ID NO: 30) N S TS: 5'-G.G.A.U.A.U.U.G.U.C.A.G.U.C.U.U.U.A.G.G.dT.dT-3’ (SEQ ID NO: 31) N R TS: 5'-C.C.U.A.A.A.G.A.C.U.G.A.C.A.A.U.A.U.C.C.dT.dT-3’ (SEQ ID NO: 32) F S TS: 5'- G.G.A.[5FU].A.[5FU].[5FU].G.[5FU].[5FC].A.G.[5FU].[5FC].[5FU].[5FU].[5FU].A.G.G.dT.dT-3’ (SEQ ID NO: 33) F R TS: 5'- [5FC].[5FC].[5FU].A.A.A.G.A.[5FC].[5FU].G.A.[5FC].A.A.[5FU].A.[5FU].[5FC].[5FC].dT.dT-3’ (SEQ ID NO: 34) siRNAs: (“S” denotes the sense strand and “R” denotes the antisense strand) siRNA NN: N S + N R siRNA GG: Gem S + Gem R siRNA FF: F S + F R Fig.6: RNAi activities of siRNAs containing Gemcitabine nucleotides in one or both strands, siRNAs containing 5FC and 5FU nucleotides in one or both strands and siRNAs wherein in one strand contains Gemcitabine nucleotides and the other strand contains 5FC and 5FU nucleotides.200 ng mRNA and 1 pmol siRNA (1 µl of a 10 x dilution in PBS of the respective siRNA stock solution) in 50 µl Opti-MEM medium were combined with a mixture of 1 ul of MessengerMax in 50 µl Opti-MEM medium.5 µl of the resulting mixture of mRNA, siRNA and transfection reagent MessngerMax were added to 200 µl HeLa cells in a well of a suitable well plate (corresponding to 30,000 HeLa cells per well). Cells were incubated overnight. Then 20 µl lysis buffer and 100 µl of luciferase system substrate were added and luminescence measured in a Glomax® device. Calculation: 100*(1-exp/mean fLuc alone). Statistics: ordinary one-way ANOVA Strands of siRNAs directed against firefly luciferase: (“S” denotes the sense strand and “R” denotes the antisense strand) N S: 5'-C.U.U.A.C.G.C.U.G.A.G.U.A.C.U.U.C.G.A.dT.dT-3’ (SEQ ID NO: 13] N R: 5' U.C.G.A.A.G.U.A.C.U.C.A.G.C.G.U.A.A.G.dT.dT 3’ (SEQ ID NO: 14)
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys Gem S: 5'[dFdC].U.U.A. [dFdC].G. [dFdC].U.G.A.G.U.A. [dFdC].U.U. [dFdC].G.A.dT.dT 3’ (SEQ ID NO 27) Gem R: 5-'U.[dFdC].G.A.A.G.U.A. [dFdC].U. [dFdC].A.G. [dFdC].G.U.A.A.G.dT.dT-3’ (SEQ ID NO: 28) F S:5' [5FC].[5FU].[5FU].A.[5FC].G.[5FC].[5FU].G.A.G.[5FU].A.[5FC].[5FU].[5FU].[5FC].G.A.dT.dT 3’ (SEQ ID NO: 29) F R: 5'-[5FU].[5FU].G.A.A.G.[5FU].A.[5FU].[5FU].[5FC].A.G.[5FC].G.[5FU].A.A.G.dT.dT-3’ (SEQ ID NO: 30) Strands of siRNAs directed against human Thymidylate Synthase (“S” denotes the sense strand and “R” denotes the antisense strand) N S TS: 5'-G.G.A.U.A.U.U.G.U.C.A.G.U.C.U.U.U.A.G.G.dT.dT-3’ (SEQ ID NO: 31) N R TS: 5'-C.C.U.A.A.A.G.A.C.U.G.A.C.A.A.U.A.U.C.C.dT.dT-3’ (SEQ ID NO: 32) F S TS: 5'- G.G.A.[5FU].A.[5FU].[5FU].G.[5FU].[5FC].A.G.[5FU].[5FC].[5FU].[5FU].[5FU].A.G.G.dT.dT-3’ (SEQ ID NO: 33) F R TS: 5'- [5FC].[5FC].[5FU].A.A.A.G.A.[5FC].[5FU].G.A.[5FC].A.A.[5FU].A.[5FU].[5FC].[5FC].dT.dT-3’ (SEQ ID NO: 34) siRNAs: (“S” denotes the sense strand and “R” denotes the antisense strand) NN: N S + N R (positive control) GG: Gem S + Gem R NG: N S + Gem R GN: Gem S + N R FF: F S + F R FG: F S + Gem R GF: Gem S + F R NN TS: N S TS + N R TS FF TS: F S TS + F R TS The results according to Fig.6 show that Gemcitabine does not perturbate (indicated in the Fig.6 by “ns”, i.e. the respective siRNA is as effective as the positive control (unmodified) siRNA NN) RNAi only when the sense strand contains Gemcitabine nucleotides instead of C nucleotides. In contrast, when antisense strand contains Gemcitabine nucleotides, no RNAi or decreased RNAi occurs (marked by asterisks)
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys 5FU and 5FC nucleotides can be present in the sense and/or the antisense strand without diminishing RNAi. siRNAs wherein Gemcitabine nucleotides are present in the sense strand and 5FC and 5FU are present in the antisense strand (see siRNA GF). Fig.7: Chemotherapeutic properties of siRNAs containing Gemcitabine nucleotides in one or both strands, siRNAs containing 5FC and 5FU nucleotides in one or both strands and siRNAs wherein in one strand contains Gemcitabine nucleotides and the other strand contains 5FC and 5FU nucleotides.40'000 HeLa cells (Fig. 7A) or 20’000 HEK cells (Fig. 7B) per well present in 200 µl RPMI medium + 10 % foetal calf serum were incubated with titrating amounts of siRNA as indicated, starting with 10 pmol siRNA per well in 200 µl total volume (130 ng per well, 650 ng/ml) on day one and successively diluted 3 times over the next two days. The supernatant was removed on the third day and 100 µl PBS were added. Cell survival was determined using the Cell Counting Kit-8 with measurement of OD at 450 nm. The results show that all modified siRNAs exert a chemotherapeutic effect in both tumor cell lines. siRNA containing 5FC and 5FU nucleotides in both strands are most effective against HeLa cells whereas all siRNAs tested showed comparable effects on HEK cells, with an siRNA containing Gemcitabine nucleotides (only C nucleotides are substituted by Gemcitabine nucleotides) show almost the same chemotherapeutic effect as siRNA containing 5FC nucleotides and 5FU nucleotides in both strands. ssRNAs and siRNAs of the experiments for Fig.7 were the same as in the experiment described for Fig.6. All oligonucleotide species used in the above-described experiments were supplied by Dhamacon, Inc., Lafayette, CO, USA, or Bio-Synthesis, Inc., Lewisville, TX, USA. Opti-MEM medium and Messenger Max were supplied by Thermo Fisher Scientific, Inc., Waltham, MA, USA.. TNF-alpha ELISA kit: MAX™ Standard ELISA Kit from BioLegend, Inc., San Diego, CA, USA IFN-alpha ELISA kit: Human IFN-alpha pan ELISA development kit (HRP), from Mabtech AB, Nacka Strand, Sweden. Firefly Luciferase Assay System and Glomax® devices were supplied by Promega Corp., Madison, WI, USA. Nucleotide sequence of target (“BioNTech”) mRNA (SEQ ID NO: 12): m7GpppAmGGCAAGAUGGAAGACGCCAAAAACAUAAAGAAAGGCCCGGCGCCAUUCUAUCCGCUGGAA GAUGGAACCGCUGGAGAGCAACUGCAUAAGGCUAUGAAGAGAUACGCCCUGGUUCCUGGAACAAUUGC UUUUACAGAUGCACAUAUCGAGGUGGACAUCACUUACGCUGAGUACUUCGAAAUGUCCGUUCGGUUGG CAGAAGCUAUGAAACGAUAUGGGCUGAAUACAAAUCACAGAAUCGUCGUAUGCAGUGAAAACUCUCUU
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys CAAUUCUUUAUGCCGGUGUUGGGCGCGUUAUUUAUCGGAGUUGCAGUUGCGCCCGCGAACGACAUUUA UAAUGAACGUGAAUUGCUCAACAGUAUGGGCAUUUCGCAGCCUACCGUGGUGUUCGUUUCCAAAAAGG GGUUGCAAAAAAUUUUGAACGUGCAAAAAAAGCUCCCAAUCAUCCAAAAAAUUAUUAUCAUGGAUUCU AAAACGGAUUACCAGGGAUUUCAGUCGAUGUACACGUUCGUCACAUCUCAUCUACCUCCCGGUUUUAA UGAAUACGAUUUUGUGCCAGAGUCCUUCGAUAGGGACAAGACAAUUGCACUGAUCAUGAACUCCUCUG GAUCUACUGGUCUGCCUAAAGGUGUCGCUCUGCCUCAUAGAACUGCCUGCGUGAGAUUCUCGCAUGCC AGAGAUCCUAUUUUUGGCAAUCAAAUCAUUCCGGAUACUGCGAUUUUAAGUGUUGUUCCAUUCCAUCA CGGUUUUGGAAUGUUUACUACACUCGGAUAUUUGAUAUGUGGAUUUCGAGUCGUCUUAAUGUAUAGAU UUGAAGAAGAGCUGUUUCUGAGGAGCCUUCAGGAUUACAAGAUUCAAAGUGCGCUGCUGGUGCCAACC CUAUUCUCCUUCUUCGCCAAAAGCACUCUGAUUGACAAAUACGAUUUAUCUAAUUUACACGAAAUUGC UUCUGGUGGCGCUCCCCUCUCUAAGGAAGUCGGGGAAGCGGUUGCCAAGAGGUUCCAUCUGCCAGGUA UCAGGCAAGGAUAUGGGCUCACUGAGACUACAUCAGCUAUUCUGAUUACACCCGAGGGGGAUGAUAAA CCGGGCGCGGUCGGUAAAGUUGUUCCAUUUUUUGAAGCGAAGGUUGUGGAUCUGGAUACCGGGAAAAC GCUGGGCGUUAAUCAAAGAGGCGAACUGUGUGUGAGAGGUCCUAUGAUUAUGUCCGGUUAUGUAAACA AUCCGGAAGCGACCAACGCCUUGAUUGACAAGGAUGGAUGGCUACAUUCUGGAGACAUAGCUUACUGG GACGAAGACGAACACUUCUUCAUCGUUGACCGCCUGAAGUCUCUGAUUAAGUACAAAGGCUAUCAGGU GGCUCCCGCUGAAUUGGAAUCCAUCUUGCUCCAACACCCCAACAUCUUCGACGCAGGUGUCGCAGGUC UUCCCGACGAUGACGCCGGUGAACUUCCCGCCGCCGUUGUUGUUUUGGAGCACGGAAAGACGAUGACG GAAAAAGAGAUCGUGGAUUACGUCGCCAGUCAAGUAACAACCGCGAAAAAGUUGCGCGGAGGAGUUGU GUUUGUGGACGAAGUACCGAAAGGUCUUACCGGAAAACUCGACGCAAGAAAAAUCAGAGAGAUCCUCA UAAAGGCCAAGAAGGGCGGAAAGAUCGCCGUGUGAUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Nucleotide sequence of control (“Trilink”) mRNA (SEQ ID NO: 24): m7GpppAmGGACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAAGUGUCGUCACCAUGGAGGACGCCA AGAACAUCAAGAAGGGCCCCGCCCCCUUCUACCCCCUGGAGGACGGCACCGCCGGCGAGCAGCUGCAC AAGGCCAUGAAGCGGUACGCCCUGGUGCCCGGCACCAUCGCCUUCACCGACGCCCACAUCGAGGUGGA CAUCACCUACGCCGAGUACUUCGAGAUGAGCGUGCGGCUGGCCGAGGCCAUGAAGCGGUACGGCCUGA ACACCAACCACCGGAUCGUGGUGUGCAGCGAGAACAGCCUGCAGUUCUUCAUGCCCGUGCUGGGCGCC CUGUUCAUCGGCGUGGCCGUGGCCCCCGCCAACGACAUCUACAACGAGCGGGAGCUGCUGAACAGCAU GGGCAUCAGCCAGCCCACCGUGGUGUUCGUGAGCAAGAAGGGCCUGCAGAAGAUCCUGAACGUGCAGA AGAAGCUGCCCAUCAUCCAGAAGAUCAUCAUCAUGGACAGCAAGACCGACUACCAGGGCUUCCAGAGC AUGUACACCUUCGUGACCAGCCACCUGCCCCCCGGCUUCAACGAGUACGACUUCGUGCCCGAGAGCUU CGACCGGGACAAGACCAUCGCCCUGAUCAUGAACAGCAGCGGCAGCACCGGCCUGCCCAAGGGCGUGG CCCUGCCCCACCGGACCGCCUGCGUGCGGUUCAGCCACGCCCGGGACCCCAUCUUCGGCAACCAGAUC AUCCCCGACACCGCCAUCCUGAGCGUGGUGCCCUUCCACCACGGCUUCGGCAUGUUCACCACCCUGGG CUACCUGAUCUGCGGCUUCCGGGUGGUGCUGAUGUACCGGUUCGAGGAGGAGCUGUUCCUGCGGAGCC UGCAGGACUACAAGAUCCAGAGCGCCCUGCUGGUGCCCACCCUGUUCAGCUUCUUCGCCAAGAGCACC
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys CUGAUCGACAAGUACGACCUGAGCAACCUGCACGAGAUCGCCAGCGGCGGCGCCCCCCUGAGCAAGGA GGUGGGCGAGGCCGUGGCCAAGCGGUUCCACCUGCCCGGCAUCCGGCAGGGCUACGGCCUGACCGAGA CCACCAGCGCCAUCCUGAUCACCCCCGAGGGCGACGACAAGCCCGGCGCCGUGGGCAAGGUGGUGCCC UUCUUCGAGGCCAAGGUGGUGGACCUGGACACCGGCAAGACCCUGGGCGUGAACCAGCGGGGCGAGCU GUGCGUGCGGGGCCCCAUGAUCAUGAGCGGCUACGUGAACAACCCCGAGGCCACCAACGCCCUGAUCG ACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCUUCAUCGUG GACCGGCUGAAGAGCCUGAUCAAGUACAAGGGCUACCAGGUGGCCCCCGCCGAGCUGGAGAGCAUCCU GCUGCAGCACCCCAACAUCUUCGACGCCGGCGUGGCCGGCCUGCCCGACGACGACGCCGGCGAGCUGC CCGCCGCCGUGGUGGUGCUGGAGCACGGCAAGACCAUGACCGAGAAGGAGAUCGUGGACUACGUGGCC AGCCAGGUGACCACCGCCAAGAAGCUGCGGGGCGGCGUGGUGUUCGUGGACGAGGUGCCCAAGGGCCU GACCGGCAAGCUGGACGCCCGGAAGAUCCGGGAGAUCCUGAUCAAGGCCAAGAAGGGCGGCAAGAUCG CCGUGUGAUAAGAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUC CAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAAACAUUU AUUUUCAUUGCUGCGUCGAGAGCUCGCUUUCUUGCUGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCC UAAGUCCAACUACUAAACUGGGGGAUAUUAUGAAGGGCCUUGAGCAUCUGGAUUCUGCCUAAUAAAAA ACAUUUAUUUUCAUUGCUGCGUCGUCGACAAUCAACCUCUGGAUUACAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA References (1) Subbarayan PR, Sarkar M, Nelson G, Benitez E, Singhal S, Ardalan B. Chronic exposure of colorectal cancer cells in culture to fluoropyrimidine analogs induces thymidylate synthase and suppresses p53. A molecular explanation for the mechanism of 5-FU resistance. Anticancer Res 2010;30(4):1149–56. (2) Heidelberger C, Leibman KC, Harbers E, Bhargava PM. The comparative utilization of uracil-2-C14 by liver, intestinal mucosa, and Flexner-Jobling carcinoma in the rat. Cancer Res 1957;17(5):399–404. (3) Rutman RJ, Cantarow A, Paschkis KE. Studies in 2-acetylaminofluorene carcinogenesis. III. The utilization of uracil-2-C14 by preneoplastic rat liver and rat hepatoma. Cancer Res 1954;14(2):119–23. (4) Longley DB, Harkin DP, Johnston PG.5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer 2003;3(5):330–8. (5) Moore AY. Clinical applications for topical 5-fluorouracil in the treatment of dermatological disorders. J Dermatolog Treat 2009;20(6):328–35. (6) Glazer RI, Lloyd LS. Association of cell lethality with incorporation of 5-fluorouracil and 5-fluorouridine into nuclear RNA in human colon carcinoma cells in culture. Mol Pharmacol 1982;21(2):468–73. (7) Ghoshal K, Jacob ST. Specific inhibition of pre-ribosomal RNA processing in extracts
Habermann, Hruschka & Schnabel Patentanwälte ^ European Patent and Trade Mark Attorneys from the lymphosarcoma cells treated with 5-fluorouracil. Cancer Res 1994;54(3):632–6. (8) Santi DV, Hardy LW. Catalytic mechanism and inhibition of tRNA (uracil-5-)- methyltransferase: evidence for convalent catalysis. Biochemistry 1987;26(26):8599– 606. (9) Patton JR. Ribonucleoprotein particle assembly and modification of U2 small nuclear RNA containing 5-fluorouridine. Biochemistry 1993;32(34):8939–44. (10) Grem JL, Fischer PH. Enhancement of 5-fluorouracil’s anticancer activity by dipyridamole. Pharmacol Ther 1989;40(3):349–71. (11) Ladner RD. The role of dUTPase and uracil-DNA repair in cancer chemotherapy. Curr Protein Pept Sci 2001;2(4):361–70. (12) Brayfield A. Fluorouracil. Martindale: The Complete Drug Reference. 2013. (13) Australian Medicines Handbook 2013. Australian Medicines Handbook Pty. Limited; 2013. (14) Wei Y, Yang P, Cao S, Zhao L. The combination of curcumin and 5-fluorouracil in cancer therapy. Arch Pharm Res 2018;41(1):1–13. (15) Moradian H, Roch T, Lendlein A, Gossen M. mRNA Transfection-Induced Activation of Primary Human Monocytes and Macrophages: Dependence on Carrier System and Nucleotide Modification. Sci Rep.2020 Mar 6;10(1):4181. doi: 10.1038/s41598-020- 60506-4. (16) “PBMC and Plasma Collection SOP for cell Activation/CMI” Version 5.0, 6 February 2017, available at https://brd.nci.nih.gov/brd/sop/download-pdf/2221. (17) “Peripheral Blood Mononuclear Cell (PBMC) and Associated Plasma Collection”, Document No. DMID-LB-SOP-00001, Version No.1, 19 September 2024, available at https://www.niaid.nih.gov/sites/default/files/PBMC_SOP.pdf Abbreviations If not stated otherwise the following abbreviations are used in the present invention: 5FC 5-fluorocytosine 5FU 5-fluorouracil [5FC] ribonucleotide comprising 5FC [5FU] ribonucleotide comprising 5FU [d5FC] deoxyribonucleotide comprising 5FC [d5FU] deoxyribonucleotide comprising 5FU dFdC Gemcitabine [dFdC] nucleotide comprising dFdC If not indicated otherwise, all nucleotide sequences disclosed herein are denoted from 5’ to 3’, and all amino acid sequences disclosed herein are denoted from N-terminal to C-terminal.