WO2025082944A1 - Inhibitor of the low-density lipoprotein receptor family (ldl-r family) and/or apolipoprotein e (apoe) for use in the treatment of crimean-congo hemorrhagic fever virus (cchfv) infection - Google Patents

Abstract

The present invention relates to a treatment of CCHFV infection, in particular CCFHV infection. Here, the inventors showed that antibody blocking LDL-R family at the surface of human cells could reduce CCHFV infection by 80%, such inhibition only occurred when blocking was performed prior to or at the time of infection though not at later time points. Furthermore, they found that incubation of viral particles with a soluble form of LDL-R could impair CCHFV infection. They found that ApoE antibodies could block CCHFV infectivity by up to 10-fold only when the viral particles were produced in cells that express ApoE. Thus, the present invention relates to an LDL-R family and/or an ApoE inhibitor for use in the prevention and/or the treatment of CCHFV infection in subjects in need thereof.

Description

INHIBITOR OF THE LOW-DENSITY LIPOPROTEIN RECEPTOR FAMILY (LDL-R FAMILY) AND/OR APOLIPOPROTEIN E (APOE) FOR USE IN THE TREATMENT OF CRIMEAN-CONGO HEMORRHAGIC FEVER VIRUS (CCHFV) INFECTION

FIELD OF THE INVENTION

The invention relates to a Low-Density Lipoprotein Receptor family (LDL-R family) inhibitor and/or an Apolipoprotein E (ApoE) inhibitor for use in the treatment of Crimean hemorrhagic fever virus (CCHFV) infection in subjects in need thereof.

BACKGROUND OF THE INVENTION

The Crimean-Congo hemorrhagic fever virus (CCHFV) is a tick-bom zoonotic virus, responsible for severe hemorrhagic fever outbreaks in humans, with a case fatality rate of 10- 40%, while being asymptomatic in non-human hosts (Bente D.A et al., 2013, Antiviral Res). CCHFV is an emerging pathogen and it is endemic in Asia, the Middle East, and Africa (Messina J.P et al., 2015, Sci Data), which corresponds to the geographic distribution of its vector and/or reservoir, i.e., mainly Hyalomma and Ixodes ticks. Then, CCHFV has a broad tropism and can infect a variety of tissues or species, implying that it may use multiple receptors or entry factors or, alternatively, a receptor that could be broadly expressed. Currently, there is no really effective antiviral treatment or vaccine for treating patients infected with CCHFV. Some studies suggest that Ribavirin could be a good treatment but its efficacy is controversial. Therefore, the treatment of subjects infected with CCHFV consists mainly on supportive symptomatic treatment. CCHFV is an enveloped virus that belongs to the Nairoviridae family of the Bunyavirales order. The viral genome consists of three single-stranded RNA segments (L, M, and S) of negative or ambisense polarity. The RNA segments exclusively replicate in the cytosol and encode up to five non- structural proteins and four structural proteins, which are the RNA-dependent RNA polymerase L, the nucleoprotein NP, and two envelope glycoproteins (GP) Gc and Gn. The NP protein binds to genomic RNA to form, together with the viral polymerase, the pseudo-helical ribonucleoproteins (RNPs) inside the virions. Inserted on the viral envelope, the Gn and Gc GPs are responsible for the attachment of viral particles to the surface of host cells and their subsequent penetration into the cytosol (Hawman D.W et al., 2023, Nature Reviews Microbiology). The cellular receptors and co-factors involved in CCHFV entry to host cells remain poorly identified. Only the human C-type lectin DC-SIGN and the nuclear factor Nucleolin have been proposed to be involved in CCHFV entry (Suda Y et al., 2016, Arch Virol & Xiao X et al., 2011, Biochem Biophys Res Commun) but they might not be sufficient for CCHFV entry. Lipid transfer receptors are increasingly reported to participate to cell entry of a variety of enveloped viruses. Interestingly, a member of low-density lipoprotein receptor family (LDL-R family), the low-density lipoprotein receptor-related protein 1 (Lrpl) was recently identified as a critical host entry factor for Rift Valley fever virus (Devignot S et al., 2015, J Virol & Ganaie S.S et al., 2021, Cell) and Oropouche orthobunyavirus (Schwarz M.M et al., 2022, Proc Natl Acad Sci U S A), two members of the Bunyavirales order. In addition, other members of the LDL-R family, i.e., the very-low-density lipoprotein receptor (VLDL-R) and the apolipoprotein E receptor 2 (ApoER2) were also recently identified as host factors for cell entry of alphaviruses (Clark L.E et al., 2022, Nature), while LDL-R was identified as host entry factor for hepatitis C virus (HCV) (Yamamoto S et al., 2016, PLoS Pathog Albecka A et al., 2012, Hepatology & Molina S et al., 2007, J Hepatol), hepatitis B virus (HBV) (Li Y et al., 2021, PLoS Pathog) and Vesicular Stomatitis Virus (VSV) (Finkelshtein D et al., 2013, Proc Natl Acad Sci U S A & Amirache F et al., 2014, Blood), but lipid transfer receptors were never described for Nairoviridae family, in particular for CCHFV. Therefore, it is essential to develop new therapies for subjects infected with CCHFV and lipid transfer receptor could be an interesting therapeutic target.

SUMMARY OF THE INVENTION

The present invention relates to a LDL-R family inhibitor and/or an ApoE inhibitor for use in the prevention and/or the treatment of CCHFV infection in subjects in need thereof.

DETAILED DESCRIPTION OF THE INVENTION

The inventors investigated whether an array of lipid transfer receptors, Lrpl, LDL-R, SR-B1 and VLD-R, could mediate CCFHV entry into human cells. As the same way, they demonstrate that VLDL-R increased infection level of tecVLPs. Using CCHFV transcription- and-entry-competent virus like particles (tecVLPs) as well as live, authentic CCHFV, they showed that antibody blocking LDL-R at the surface of human cells could reduce CCHFV infection by 80%, such inhibition only occurred when blocking was performed prior to or at the time of infection though not at later time points. Furthermore, they found that incubation of viral particles with a soluble form of LDL-R could impair CCHFV infection. This suggested that the LDL-R plays a role during the cell entry process. Then, to address how LDL-R could mediate CCHFV entry, the inventors hypothesized that a cellular ligand of LDL-R, rather than CCHFV surface glycoproteins, could permit this interaction. They showed that ApoE, an exchangeable protein that mediate LDL/LDL-R interaction, was incorporated on CCHFV particles, which was dependent on the presence of CCHFV Gn and Gc glycoproteins. Then, they found that ApoE antibodies could block CCHFV infectivity by up to 10-fold only when the viral particles were produced in cells that express ApoE. Therefore, the inventors highlighted the role of LDL-R as cellular receptor involved in CCHFV entry and the role of one of its ligands, ApoE, that is recruited on CCHFV particles to mediate productive interaction with LDL-R during entry.

A first object of the invention relates to a LDL-R family inhibitor and/or an ApoE inhibitor for use in the prevention and/or the treatment CCHFV infection in subjects in need thereof.

In one embodiment, the LDL-R family inhibitor is a LDL-R inhibitor and/or VLDL-R inhibitor.

As used herein, the term “patient” or “subject” refers to a mammal, such as a feline, a canine, an equine or a primate. In a preferred embodiment, the “subject” is a human with an infection according to the invention. The subject may as well be afflicted by the disease as he may be healthy.

By “healthy”, it is herein intended to mean that the subject is not afflicted by the disease, whether or not he is afflicted by another disease.

As used herein, the term “Virus” or “Viral agent” refers to an infectious agent requiring a host, often a cell, whose constituents and metabolism allow the viral replication. Virus change form during their cycle with an extracellular stage and an intracellular stage. "

As used herein, the term “Crimean-Congo hemorrhagic fever virus infection” or “CCHFV infection” or “Crimean-Congo hemorrhagic fever” or CCHF” refers to a Nairoviridae family infection, in particular Crimean-Congo hemorrhagic fever, induced by a CCHFV. CCHFV is an enveloped virus that belongs to the Nairoviridae family and the Orthonairovirus genus. The viral genome consists of three single-stranded RNA segments (L, M, and S) of negative or ambisense polarity. The RNA segments exclusively replicate in the cytosol and encode up to five non- structural proteins and four structural proteins, which are the RNA-dependent RNA polymerase L, the nucleoprotein NP, and two envelope glycoproteins (GP) Gc and Gn. The NP protein binds to genomic RNA to form, together with the viral polymerase, the pseudo-helical ribonucleoproteins (RNPs) inside the virions. Inserted on the viral envelope, the Gn and Gc GPs are responsible for the attachment of viral particles to the surface of host cells and their subsequent penetration into the cytosol (Hawman D.W et al., 2023, Nature Reviews Microbiology). CCHFV has a broad tropism and can infect a variety of tissues or species, implying that that it may use multiple receptors or entry factors or, alternatively, a receptor that could be broadly expressed.

In one embodiment, the LDL-R family inhibitor and/or the ApoE inhibitor is used in the preventive and/or curative treatment of CCHFV infection.

In one embodiment, LDL-R family inhibitor and/or the ApoE inhibitor is used in the treatment of CCHFV infection in the early stage of the infection.

As used herein, the term “early stage of the infection” refers to a period of few hours post-infection. In particular, it refers to [0 ; 72 hours post-infection]. Preferably, it refers to a period of less than 2 hours from the infection.

In one embodiment, the compound according to the invention is used as an alternative to one or more another specific compounds used for preventing and/or treating CCHFV infection in subjects having or developing drug resistance.

As used herein, the term “resistant patient” or “treatment-resistant patient” or “subject developing drug resistance” refers to a subject developing a resistance to one or more compounds used for treating or preventing the disease. More particular, it refers to a subject without biological reactivity after a therapeutic treatment. It also refers to a progressive decrease of the efficacy of a therapeutic treatment.

LDL-R family is well known in the state of the art. LDL-R family regroups structurally related endocytic receptors that mediate lipoproteins transfer to cells such as LDL-R, VLDL-R and LRPs. In particular, these LDL-R family members are mainly involved in endocytosis of triglyceride- and cholesterol-containing lipoprotein particles. The ectodomains of the members of this family share high sequence similarity and capacity to bind a large variety of ligands (Blacklow S.C et al., 2007, Curr Opin Struct Biol). The LDL-R family members can bind different types of proteins or factors, such as ApoE or ApoB suggesting that these receptors could act as capture molecules (Go G.W et al., 2012, J Biol Med).

LDL-R, belonging to the LDL-R family, is composed of cysteine-rich repeats, which are repeats of their ligand-binding domains, and of EGF-like modules and P-propellers, which are required for pH-dependent release of their ligands following internalization. LDL-R is a cell-surface glycoprotein of 164 kDa that plays a critical role in the homeostatic control of blood cholesterol by mediating the removal of cholesterol-containing lipoprotein particles from circulation (Jeon H et al., 2005, Annu Rev Biochem). Lipid transfer receptors are increasingly reported to participate to cell entry of a variety of enveloped viruses and many studies demonstrated the involvement of LDL-R in virus entry (Finkel shtein D et al., 2013, Proc Natl Acad Sci U S A & Agnello V et al., 1999, PNAS). The Entrez reference number of the human gene coding for LDLR is 3949 and the Uniprot reference number of the human LDL-R protein is P01130 (Go G.W et al., 2012, J Biol Med).

VLDL-R belongs to the LDL-R family which has an important role in cholesterol uptake, metabolism of apolipoprotein E-containing triacylglycerol-rich lipoproteins, and neuronal migration in the developing brain. The Entrez reference number of the human gene coding for VLDL-R is 7436 and the Uniprot reference number of the VLDL-R human protein is P98155. It is the main endocytic receptor recognizing ApoE-containing lipoproteins and its structure is highly homologous to that of LDLR (Go G.W et al., 2012, J Biol Med).

ApoE is well known in the state of the art. Its gene is mapped to chromosome 19 in a cluster with apolipoprotein Cl (APOCI) and the apolipoprotein C2 (APOC2). The APOE gene consists of four exons and three introns, totaling 3597 base pairs. ApoE is 299 amino acids long and contains multiple amphipathic a-helices. According to crystallography studies, a hinge region connects the N- and C-terminal regions of the protein. The N-terminal region (residues 1-167) forms an anti-parallel four-helix bundle such that the non-polar sides face inside the protein. Meanwhile, the C-terminal domain (residues 206-299) contains three a-helices which form a large exposed hydrophobic surface and interact with those in the N-terminal helix bundle domain through hydrogen bonds and salt-bridges. The C-terminal region also contains a low- density lipoprotein receptor (LDLR)-binding site (Phillips M.C et al., 2014, IUBMB). ApoE is a protein binding specifically to specific receptors and which is essential for catabolism of triglyceride-rich lipoproteins. As lipid transporters, ApoE is essential for the membrane structure. ApoE can be found as associated with lipoproteins such as LDLs and VLDLs but can also exist in a lipid-free form in the extracellular medium. ApoE belongs to the family of exchangeable apolipoproteins, implying that it can be transferred from a lipoprotein to another lipoprotein or a viral particle. The Entrez reference number of the human gene coding for ApoE is 348 and the Uniprot reference number of the ApoE human protein is P02649. Many studies demonstrated that some viruses directly bind LDL-R via their glycoproteins, like e.g., for RVFV (Ganaie S.S et al., 2021, Cell) or VSV (Finkelshtein D et al., 2013, Proc Natl Acad Sci USA) and that other viruses hijack cellular proteins like e.g., ApoE as ligand cofactor for binding LDL-R (Owen D.M et al., 2009, Virology & Qiao L et al., 2019, PLoS Pathog). As used herein, the term “LDL-R family inhibitor” refers to any molecule or compound natural or not which is capable of inhibiting, neutralizing, blocking, abrogating, reducing or interfering with the function of LDL-R family members like the interaction between the members and its LDL-R family ligand (ie ApoE), or a molecule or compound which destabilizes LDL-R family or induces its internalization from the cell membrane. The term encompasses direct or indirect inhibitors. “LDL-R family inhibitor” also encompasses inhibitors of LDL-R family members expression or any LDL-Rgenetic modification inhibiting the LDL-R family activity. In the present invention the LDL-R family inhibitor according to the invention may be PCSK9 or Berbamine. In one embodiment, a soluble recombinant form of LDL-R is used for the treatment of CCHFV infection in subjects in need thereof.

LDL-R family inhibitors are well known in the state of the art. In particular, LDL-R inhibitors are well known in the state of the art (Owen D.M et al., 2009, Virology, Wang T et al., 2020, Mol Ther Nucleic Acids,' Dixon D.L et al., 2016, ./ Clin Lipidol). VLDL-R inhibitors are well known in the state of the art (Wagner T et al., 2013, Exp Cell res).

In one embodiment, the LDL-R family inhibitor is an inhibitor of LDL-R and/or VLDL- R inhibitor.

In one embodiment, the inhibitor according to the invention is an inhibitor of LDL-R family activity and/or an inhibitor of ApoE activity.

In one embodiment, the inhibitor according to the invention is an inhibitor of LDL-R family expression and/or an inhibitor of ApoE expression.

The term “ApoE inhibitor” refers to all compound inhibiting the ApoE activity or expression. The term “ApoE inhibitors” encompasses any ApoE inhibitor preventing or blocking any interaction between ApoE and a virus, in particular CCHFV. In the same way, the term encompasses any inhibitor which block the interaction between ApoE and LDL-R family (Hui B et al., 2022, IntJ Biol Sci). ApoE inhibitors are well known in the state of the art (Van Niel G et al., 2015, Cell Rep,' Huynh T-PV et al., 2017, Neuron,' Hui B et al., 2022, Ini J Biol Sci,' Gratuze M et al., 2022, Ann Neurol).

The term “LDL-R family inhibitor” or “ApoE inhibitor” encompasses any LDL-R family inhibitor or ApoE inhibitor that is currently known in the art or that will be identified in the future. The term also includes antibodies and antigen-binding fragments thereof, proteins, peptides, glycoproteins, glycopeptides, glycolipids, polysaccharides, oligosaccharides, nucleic acids, bioorganic molecules, peptidomimetics, pharmacological agents and their metabolites, transcriptional and translation control sequences, and the like. More particularly, the inhibitor according to the invention may be an inhibitor of LDL-R family activity (such as small organic molecule, antibody, aptamer, polypeptide,...) and/or an inhibitor of LDL-R family gene expression (such as RNA, nuclease, ribozyme, antisense oligonucleotide,. . .).

Accordingly in a particular embodiment, the inhibitor according to the invention is: an inhibitor of ApoE activity (such as small organic molecule, antibody, aptamer, polypeptide, . . . ) and/or an inhibitor of ApoE gene expression (such as RNA, nuclease, ribozyme, antisense oligonucleotide,...).

The inhibitor may be an antagonist. The term “antagonist” refers to any molecule or compound interacting directly or indirectly with a biological receptor in order to block or reduce the LDL-R family function.

In the context of the present invention, “LDL-R family inhibitor” or “ApoE inhibitor” is an inhibitor which neutralizes, blocks, inhibits, abrogates, reduces or interferes with the biological activity of LDL-R family and/or ApoE. In particular it refers to an inhibitor which reduces the cell infection by CCHFV. In particular, it may be an inhibitor which inhibits the cell entry steps of CCHFV and/or inhibits the binding between LDL-R family and CCHFV complexed with ApoE.

By "biological activity" of LDL-R family and/or ApoE is meant in the context of the present invention, to cell entry steps of CCHFV and/or inhibits the binding between LDL-R family and CCHFV complexed with ApoE.

Methods for selecting an appropriate inhibitor are well known in the art. In particular, the methods for selecting an inhibitor specifically inhibiting LDL-R family and/or ApoE are known in the prior art. For example, LDL-R family and/or ApoE inhibitors are identified by measurement of the LDL-R family or the ApoE concentration in a liquid (blood, serum, plasma) before and after depletion/inhibition of this liquid. Then, LDL-R family or the ApoE is detected using standard protocols such as ELISA or Luminex. Tests for determining the capacity of a compound to be an LDL-R family antagonist are well known to the person skilled in the art and may be determined by any competing assays well known in the art. For example, the assay may consist in determining the ability of the agent to be tested as LDL-R family antagonist to bind to LDL-R family members. The binding ability is reflected by the KD measurement. The term "KD", as used herein, is intended to refer to the dissociation constant, which is obtained from the ratio of Kd to Ka (i.e. Kd/Ka) and is expressed as a molar concentration (M). KD values for binding biomolecules can be determined using methods well established in the art. In specific embodiments, an antagonist that "specifically binds to LDL-R family" is intended to refer to an inhibitor that binds to human LDL-R family with a KD of IpM or less, lOOnM or less, lOnM or less, or 3nM or less. Then a competitive assay may be settled to determine the ability of the agent to inhibit biological activity of LDL-R family.

Tests for determining the capacity of a compound to be an ApoE inhibitor or a LDL-R family inhibitor are well known to the person skilled in the art. In a particular embodiment, the ability of the inhibitor to inhibits the biological activity of LDL-R family and/or ApoE may be determined by assaying the level of infectivity (Neutralization assay) of CCHFV by measuring the viral RNA level by RT-qPCR (see Experimental data and Figure 2 and Figure 3) quantifying cells by flow cytometry (see Experimental Data Figures 1, 2 and 3) or immunostaining (see Figure 3).

Inhibitor of the LDL-R family and/or ApoE activity

In one embodiment, the inhibitor according to the invention is an inhibitor of LDL-R family activity and/or an inhibitor of ApoE activity.

In one embodiment, the inhibitor according to the invention is a small molecule, an antibody, an aptamer or a polypeptide.

As used herein, the term “inhibitor of the LDL-R family activity” or “inhibitor of ApoE activity” refers to a natural or synthetic compound that ability to inhibit the biological activity of LDL-R family and/or the ApoE. In some embodiments, said inhibitor is a small organic molecule, an antibody, an aptamer and/or a polypeptide. Inhibitors of LDL-R family and/or ApoE activity are well known in the state of the art.

• Small organic molecule

In one embodiment, the LDL-R family and/or ApoE inhibitor is low molecular weight compound, e.g. a small organic molecule. In particular, Small organic molecule is used as a LDL-R inhibitor or VLDL-R inhibitor. As used herein, the term “small organic molecule” refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da. The small organic molecules as inhibitors of LDL-R family and/or ApoE are well known in the state of the art.

Examples of small molecules inhibitors of LDL-R family, in particular LDL-R, include but are not limited to is Berbamine.

“Berbamine” or “BBM” or “bis-benzylisoquinoline alkaloid” is a bioactive compound of benzylisoquinoline alkaloids present in Berberis Amurensis plant. It is a calcium channel blocker inducing an improve of bones diseases such as Osteoporosis (Guobin Q et al., 2022, Front Pharmacol). Moreover, studies demonstrate that BBM inhibits tumor growth, MAPK pathway, inflammatory responses or LDL-R expression (Varsha K et al., 2017, Nanostructures for Cancer Therapy & Johan F et al., 2022, Elsevier).

Berbamine has the following structure:

Methods for selecting an appropriate small organic molecule are well known in the art. In particular, the methods for selecting small molecules specifically inhibiting LDL-R family and/or ApoE are known in the prior art.

• Antibody

In another embodiment, the LDL-R family and/or ApoE inhibitor is an antibody (the term including antibody fragment or portion) that can block directly or indirectly the biological activities of ApoE and/or LDL-R family.

In preferred embodiment, the LDL-R family and/or ApoE inhibitor may consist in an antibody directed against the LDL-R family or ApoE, in such a way that said antibody impairs the binding between the LDL-R family and ApoE and able of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with the biological activities of LDL-R family and/or ApoE ("neutralizing antibody").

Then, for this invention, neutralizing antibody of thrombin are selected as above described for their capacity to (i) bind to LDL-R family and/or ApoE and/or (ii) inhibits the cell entry steps of CCHFV and/or inhibits the binding between LDL-R family and CCHFV complexed with ApoE.

In one embodiment, the compound according to the invention is an anti-LDL-R family antibody and/or an anti-ApoE antibody. As used herein, "antibody" includes both naturally occurring and non-naturally occurring antibodies. Specifically, "antibody" includes polyclonal and monoclonal antibodies, and monovalent and divalent fragments thereof. Furthermore, "antibody" includes chimeric antibodies, wholly synthetic antibodies, single chain antibodies, and fragments thereof. The antibody may be a human or nonhuman antibody. A nonhuman antibody may be humanized by recombinant methods to reduce its immunogenicity in man. Significantly, as is well-known in the art, only a small portion of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (see, in general, Clark, W. R. (1986) The Experimental Foundations of Modem Immunology Wiley & Sons, Inc., New York; Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford). The Fc' and Fc regions, for example, are effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc' region has been enzymatically cleaved, or which has been produced without the pFc' region, designated an F(ab')2 fragment, retains both of the antigen binding sites of an intact antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved, or which has been produced without the Fc region, designated an Fab fragment, retains one of the antigen binding sites of an intact antibody molecule. Proceeding further, Fab fragments consist of a covalently bound antibody light chain and a portion of the antibody heavy chain denoted Fd. The Fd fragments are the major determinant of antibody specificity (a single Fd fragment may be associated with up to ten different light chains without altering antibody specificity) and Fd fragments retain epitopebinding ability in isolation. Within the antigen-binding portion of an antibody, as is well-known in the art, there are complementarity determining regions (CDRs), which directly interact with the epitope of the antigen, and framework regions (FRs), which maintain the tertiary structure of the paratope (see, in general, Clark, 1986; Roitt, 1991). In both the heavy chain Fd fragment and the light chain of IgG immunoglobulins, there are four framework regions (FR1 through FR4) separated respectively by three complementarity determining regions (CDR1 through CDRS). The CDRs, and in particular the CDRS regions, and more particularly the heavy chain CDRS, are largely responsible for antibody specificity.

It is now well-established in the art that the non CDR regions of a mammalian antibody may be replaced with similar regions of conspecific or heterospecific antibodies while retaining the epitopic specificity of the original antibody. This is most clearly manifested in the development and use of "humanized" antibodies in which non-human CDRs are covalently joined to human FR and/or Fc/pFc' regions to produce a functional antibody.

Examples of neutralizing antibody inhibitors of LDL-R family and/or ApoE are well known in the state of the art and commonly sold in the trade (Dixon D.L et al., 2016, J Clin Lipidol,' Hui B et al., 2022, IntJ Biol Ser, Gratuze M et al., 2022, Ann Neurol & Owen D.M et al., 2009, Virology). In particular, ApoE antibody may be HAE-4 antibody (Gratuze M, 2022, Ann Neurol), AF2148, AHP2177 or aApoE (Huynh T-PV et al., 2017, Neuron). VLDL-R antibodies may be 1H10, 1H5 or 5F3 (Yakovlev S et al., 2016, Thromb Haemosf).

Antibodies are prepared according to conventional methodology. Monoclonal antibodies may generate using method of Kholer and Milstein (Nature, 256:495, 1975). Antibodies directed against LDL-R family and/or ApoE can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against LDL-R family and/or ApoE can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-LDL-R family and/or anti-ApoE single chain antibodies. Compounds useful in practicing the present invention also include anti-LDL-R family or anti-ApoE antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and/or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to LDL-R family or ApoE.

In another embodiment, the antibody according to the invention is a humanized antibody. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody will also optionally comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397). Humanized anti-LDL-R family or anti-ApoE antibodies and antibody fragments there from can also be prepared according to known techniques. In one embodiment of the humanized forms of the antibodies, some, most or all of the amino acids outside the CDR regions have been replaced with amino acids from human immunoglobulin molecules but where some, most or all amino acids within one or more CDR regions are unchanged. However, using certain methods of humanization, the affinity and/or specificity of binding of the antibody may be increased using methods of "directed evolution", as described by Wu et al., I. Mol. Biol. 294: 151, 1999, the contents of which are incorporated herein by reference. In vitro methods also exist for producing human antibodies. These include phage display technology (U.S. Pat. Nos. 5,565,332 and 5,573,905) and in vitro stimulation of human B cells (U.S. Pat. Nos. 5,229,275 and 5,567,610). The contents of these patents are incorporated herein by reference. Moreover, one of ordinary skill in the art will be familiar with other methods for antibody humanization.

In another embodiment, the antibody according to the invention is a single domain antibody. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”.

Thus, methods for selecting an appropriate antibody are well known in the art. In particular, the methods for selecting an antibody specifically inhibiting LDL-R family and/or ApoE are known in the prior art. For this invention, neutralizing antibodies of LDL-R family and/or ApoE are selected. In particular, neutralizing antibodies of LDL-R or VLDL-R are selected.

• Aptamer

In one embodiment, the LDL-R family and/or ApoE inhibitor is an aptamer. In particular, aptamer is used as a LDL-R inhibitor or a VLDL inhibitor. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. The aptamers as inhibitors of LDL-R family and/or ApoE are well known in the state of the art. In particular, aptamer may be RNV- L7 (Wang T et al., 2020, Mol Ther Nucleic Acids).

Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996). Methods for selecting an aptamer specifically inhibiting LDL-R family and/or ApoE are known in the prior art. Examples of aptamers inhibiting LDL-R, include but are not limited to is RNVL7 (Wang T et al., 2020, Mol Ther Nucleic Acids). For this invention, neutralizing aptamers of LDL-R family and/or ApoE are selected.

• Polypeptide

In one embodiment, the LDL-R family and/or ApoE inhibitor is a polypeptide. In particular, polypeptide is used as a LDL-R inhibitor or a VLDL-R inhibitor. The polypeptides as inhibitors of LDL-R family and/or ApoE function are well known in the state of the art. A polypeptide is a chain of amino acids linked by peptide bonds. In particular, a polypeptide comprises an amino acid chain containing from 10 to 100 amino acids. The polypeptides as inhibitors of LDL-R family and/or ApoE are well known in the state of the art.

Examples of polypeptide inhibitors of LDL-R family include but are not limited to PCSK9 (Dixon D.L et al., 2016, J Clin Lipidol) and VLDL-R inhibitor may be Stx5 (Wagner T et al., 2013, Exp Cell Res).

Examples of polypeptide inhibitors of ApoE include but are not limited to COG 133TFA antagonist (Hui B et al., 2022, Int J Biol) or the recombinant soluble LDL-R (R&D System Catalog Number 2148-LD).

“PCSK9” or “Proprotein convertase subtilisin/kexin type 9” (Entrez: 255738 and Uniprot: Q8NBP7) is an enzyme belonging to the proprotein convertase family. PCSK9 is expressed in many tissues and cell types and it is implicated in the LDL-R degradation (Weinreich M et al., 2014, Cardiol Rev & Lambert G et al., 2012, J Lipid Res & Johan F et al., 2022, Elsevier). Moreover, it has been used in some clinical trial for the treatment of arthritis, cardiac diseases or HIV infection.

Methods for selecting an polypeptide specifically inhibiting LDL-R family and/or ApoE are known in the prior art. The polypeptides of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of polypeptide or functional equivalents thereof for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. Preferably, the polypeptide is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. When expressed in recombinant form, the polypeptide is preferably generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells. HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli. In specific embodiments, it is contemplated that polypeptides used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters. A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water-soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain. Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications. Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri -functional monomers such as lysine have been used by VectraMed (Plainsboro, N. J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e-amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug/linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory halflife of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e.g., less than 60 kDa). In addition, to the polymer backbone being important in maintaining circulatory half-life, and biodistribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.

Inhibitor of LDL-R family and/or ApoE gene expression

In one embodiment, the inhibitor according to the invention is an inhibitor of LDL-R family expression and/or an inhibitor of ApoE expression.

In one embodiment, the inhibitor according to the invention is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide.

As used herein the term “inhibitor of the LDL-R family gene expression” or “inhibitor of the ApoE gene expression” refers to a natural or synthetic compound that has a biological effect to inhibit the expression of a gene. In some embodiments, said inhibitor of gene expression is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide. Inhibitors of LDL-R family and/or ApoE gene expression are well known in the state of the art.

• Small inhibitory RNA In one embodiment, the LDL-R family inhibitor and/or ApoE inhibitor is a Small inhibitory RNAs (siRNAs). In particular, the small inhibitory RNA is used as a LDL-R inhibitor or a VLDL-R inhibitor. Small inhibitory RNA (usually of 20-24 bp) interacting with an mRNA to decrease or inhibit a gene expression. siRNAs as inhibitors of LDL-R family and/or ApoE are well known in the state of the art (Van Niel G et al., 2015, Cell Rep).

LDL-R family or ApoE gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that LDL-R family or ApoE gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01/36646, WO 99/32619, and WO 01/68836). In particular, the methods for selecting small inhibitory specifically inhibiting LDL- R family and/or ApoE gene expression are known in the prior art.

• Nuclease

In one embodiment, the LDL-R family and/or ApoE inhibitor is a Nuclease. In particular, the nuclease is used as a LDL-R inhibitor or a VLDL-R inhibitor. Nuclease or Endonuclease are synthetic nucleases consisting of a DNAbinding site, a linker, and a cleavage module derived from a restriction endonuclease which are used for gene targeting efforts. The synthetic nucleases according to the invention exhibit increased preference and specificity to bipartite or tripartite DNA target sites comprising DNA binding (i.e. TALEN or CRISPR recognition site(s)) and restriction endonuclease target site while cleaving at off-target sites comprising only the restriction endonuclease target site is prevented. The guide RNA (gRNA) sequences direct the nuclease (i.e. Cas9 protein) to induce a site-specific double strand break (DSB) in the genomic DNA in the target sequence. Restriction endonucleases (also called restriction enzymes) as referred to herein in accordance with the present invention are capable of recognizing and cleaving a DNA molecule at a specific DNA cleavage site between predefined nucleotides. In contrast, some endonucleases such as for example Fokl comprise a cleavage domain that cleaves the DNA unspecifically at a certain position regardless of the nucleotides present at this position. Therefore, preferably the specific DNA cleavage site and the DNA recognition site of the restriction endonuclease are identical. Moreover, also preferably the cleavage domain of the chimeric nuclease is derived from a restriction endonuclease with reduced DNA binding and/or reduced catalytic activity when compared to the wildtype restriction endonuclease. According to the knowledge that restriction endonucleases, particularly type II restriction endonucleases, bind as a homodimer to DNA regularly, the chimeric nucleases as referred to herein may be related to homodimerization of two restriction endonuclease subunits. Preferably, the restriction endonuclease from which the cleavage module of the chimeric nuclease is derived is a type IIP restriction endonuclease. The preferably palindromic DNA recognition sites of these restriction endonucleases consist of at least four or up to eight contiguous nucleotides. Preferably, the type IIP restriction endonucleases cleave the DNA within the recognition site which occurs rather frequently in the genome, or immediately adjacent thereto, and have no or a reduced star activity. Nucleases as inhibitors of LDL-R family and/or as inhibitors of ApoE are well known in the state of the art.

Example of gRNA directed to LDL-R that can be used according the invention are disclosed in Jarret KE et al (Arterioscler Thromb Vase Biol. 2018 Sep; 38(9): 1997-2006) and Emmer BT et al (PLoS Genet. 2021 Jan 29;17(l):el009285. doi: 10.1371/journal.pgen.1009285. eCollection 2021 Ja).

Example of gRNA directed to ApoE that can be used according the invention are disclosed in ZHAO J. J. et al (Acta Neuropathol. 2021; 142(5): 807-825.).

• Ribozyme

In one embodiment, the LDL-R family and/or ApoE inhibitor is a Ribozyme. In particular, the ribozyme is used as a LDL-R inhibitor or VLDL inhibitor. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of LDL-R family or ApoE mRNA sequences are thereby useful within the scope of the present invention. Ribozymes as inhibitors of LDL-R family and/or ApoE are well known in the state of the art. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays. Methods for selecting ribozymes specifically inhibiting LDL-R family and/or ApoE gene expression are known in the prior art.

• Antisense oligonucleotide

In one embodiment, the LDL-R family and/or ApoE inhibitor is an Antisense oligonucleotide. In particular, the antisense oligonucleotide is used as a LDL-R inhibitor or a VLDL-R inhibitor. Antisense oligonucleotides, including anti-sense RNA molecules and antisense DNA molecules, would act to directly block the translation of LDL-R family and/or ApoE mRNA by binding thereto and thus preventing protein translation or increasing mRNA degradation, thus decreasing the level of LDL-R family and/or ApoE, and thus activity, in a cell. The antisense oligonucleotides as inhibitors of LDL-R family and/or ApoE are well known in the state of the art (Huynh T-P.V et al., 2017, Neuron). Antisense oligonucleotides can be synthesized, e.g., by conventional phosphodiester techniques. Methods for using antisense techniques for specifically inhibiting gene expression of genes whose sequence is known are well known in the art (e.g. see U.S. Pat. Nos. 6,566,135; 6,566,131; 6,365,354; 6,410,323; 6,107,091; 6,046,321; and 5,981,732). In particular, the methods for selecting antisense oligonucleotides specifically inhibiting LDL-R family and/or ApoE gene expression are known in the prior art. The inhibitor of LDL-R family and/or ApoE gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoter. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

• Inhibitor of LDL-R family and/or ApoE gene expression can be associated with a vector The inhibitor of LDL-R family gene expression and/or ApoE gene expression of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the inhibitor of the gene expression to the cells and preferably cells expressing LDL-R family or ApoE. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the inhibitor of the gene expression. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art.

Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non- essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles are provided in Kriegler, 1990 and in Murry, 1991. Preferred viruses for certain applications are the adeno-viruses and adeno- associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno-associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigenencoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencapsulation.

In one embodiment, the inhibitor of LDL-R family and/or ApoE gene expression according to the invention is associated with a vector. In one embodiment, the inhibitor of LDL- R family and/or ApoE gene expression according to the invention is associated with a viral vector, adeno-viral vector or a plasmid vector. In one embodiment, the inhibitor of LDL-R family and/or ApoE gene expression is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters.

Therapeutic applications

Another object of the invention relates to a method for preventing and/or treating CCHFV infection comprising administrating to a subject in need thereof a therapeutically effective amount of a LDL-R family and/or ApoE inhibitor.

In one embodiment, the LDL-R family inhibitor is an inhibitor of LDL-R and/or VLDL- R inhibitor.

As used herein, the term "therapeutic" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subjects at risk of contracting the disease or suspected to have contracted the disease as well as subjects who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. Preferably, the individual to be treated is a human or non-human mammal (such as a rodent, a feline, a canine or a primate) affected or likely to be affected by the disease. Preferably, the individual is a human.

By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular interval, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]).

As used herein, the term “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. The therapeutically effective amount, the time of administration, route of administration, and the duration of the treatment may vary according to factors well known in the medical art such as the disease state, age, sex, and weight of the individual, and the ability of the compound of the invention to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects are outweighed by the therapeutically beneficial effects.

The efficient dosages and dosage regimens depend on the disease or condition to be treated and may be determined by the persons skilled in the art. A physician having ordinary skill in the art may readily determine and prescribe the effective amount required. For example, the physician could start doses at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicine typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day.

Pharmaceutical composition

Another object of the invention relates to a pharmaceutical composition for use in prevention and/or treatment CCHFV infection comprising a therapeutically effective amount of a LDL-R family and/or ApoE inhibitor. In one embodiment, the pharmaceutical composition comprises an inhibitor of LDL-R family activity and/or an inhibitor of ApoE activity. In one embodiment, the pharmaceutical composition comprises an inhibitor of LDL-R family expression and/or an inhibitor of ApoE expression. In one embodiment, the LDL-R family inhibitor is an LDL-R inhibitor and/or an VLDL-R inhibitor. In one embodiment, the inhibitor of LDL-R family activity and/or ApoE activity is a small molecule, an antibody, an aptamer or a polypeptide. In one embodiment, the inhibitor LDL-R family expression and/or ApoE expression is a RNA, a nuclease, a ribozyme or an antisense oligonucleotide.

In one embodiment, the pharmaceutical composition according to the invention comprises an LDL-R family and/or ApoE inhibitor and a pharmaceutically acceptable carrier. In one embodiment, the compound of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions.

As used herein, the term “pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administrated to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluents, encapsulating material or formulation auxiliary of any type. The composition of the present invention may e.g. be formulated for a topical, oral, intranasal, parenteral, intravenous, intramuscular, intraperitoneal or subcutaneous administration and the like. The uses are adjusted to provide the optimum desired response (e.g., a therapeutic response). Preferably, the composition of the invention may be formulated for any mode of administration suitable for the treatment of CCHFV infection The pharmaceutical compositions may contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions. In particular, these may be in organic solvent such as DMSO, ethanol which upon addition, depending on the case, of sterilized water or physiological saline permit the constitution of injectable solutions. The form of the composition, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the subject, etc. The suitable dose of the compound or the composition of the present invention will be the amount of the compound which is the lowest dose effective to produce a therapeutic effect according to a particular dosage regimen. Such an effective dose will generally depend upon several factors can easily be assessed and measured by the skilled person. For example, a therapeutically effective amount for therapeutic use may be measured by its ability to stabilize the progression of disease. Alternatively, this property of a composition may be evaluated by examining the ability of the compound to induce cytotoxicity by in vitro assays known to the skilled practitioner. One of ordinary skill in the art would be able to determine such amounts based on such factors as the subject's size, the severity of the subject's symptoms, and the particular composition or route of administration selected.

The compound of the invention contained in the pharmaceutical composition can be administered in several dosages or as a single dose until a desired response has been achieved. The treatment is typically monitored and repeated dosages can be administrated as necessary. The compound of the invention may be administrated according to dosage regimens established whenever inactivation of LDL-R family and/or ApoE is required. The daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 10 mg/kg of body weight per day. The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability, and length of action of that compound, the age, the body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host undergoing therapy.

In some embodiments, the compound or the composition of the present invention is administered by slow continuous infusion over a long period, such as more than 24 hours, in order to minimize any unwanted side effects.

FIGURES

Figure 1: LDL-R is a cofactor of CCHFV infectivity. (A) Western blot analysis of cell lysates from Huh-7.5 cells stably expressing Flue, transduced with lentiviral vectors allowing expression of control shRNA or shRNA targeting Lrpl or LDL-R or SR-BI, Transduced cells were lysed 4 days post-transduction. (B) Cells described in (A) were infected with CCHFV tecVLPs. Cells were lysed 24h post infection for measurement of nLuc signal. FLuc signal was used for normalization. Results from 5 independent experiments are presented as percentage of inhibition relative to control shRNA for the knock-down (KD) experiments (C) Huh-7.5 cells, pre-transfected with NP+L expression plasmids were incubated with different concentration of an LDL-R antibody (open bars) or control isotype (IgG goat, dashed bars) for Ih at 37°C before infection with CCHFV tecVLPs GFP or VSVGpp. The media was replaced 3h post-infection (p.i.) and the cells were harvested at 48h p.i. for determination of the levels of infection by flow cytometry. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without antibody. Kruskal-Wallis test with Dunn’s multiple comparison. (D) Same experiment using full length CCHFV. Media was removed Ih post-infection and cells were lysed at 24h p.i. for determination of the levels of infection by RT- qPCR. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without antibody. Kruskal-Wallis test with Dunn’s multiple comparison. (E) Same experiment using HAZV. Media wad removed Ih p.i. and the cells were harvested 16h p.i. for determination of the levels of infection by flow cytometry. CCHFV tecVLPs Nanoluc were used as a positive control (infectivity was assessed by luciferase signal measurement). Results from 3 independent experiments are presented as percentage of inhibition relative to condition without antibody. (F) Huh-7.5 cells stably expressing Flue cells were transduced with a lentiviral vector allowing expression of VLDL-R. Surface expression of VLDL-R assessed 4 days post transduction by flow cytometry (left) and percentage of infection of these cells with CCHFV tecVLPs NanoLuc. Infection level was determined 24h post infection by measurement of nLuc signal. FLuc signal was used for normalization. Results from 4 independent experiments are presented as percentage relation to naive Huh-7.5 cells.

(G) Expression of LDL-E at the surface of Huh-7.5, A549 and TE671 cells assessed by flow cytometry (left). Cells were incubated with 4pg/mL of of LDL-R antibody (open bars) or control isotype (IgG goat, dashed bars) for Ih at 37°C before infection with CCHFV tecVLPs nanoluc. The media was replaced 3h p.i. and the cells were harvested at 48h p.i. for determination of the levels of infection by nLuc measurement. Results from independent experiments are presented as percentage of inhibition relative to condition without antibody.

(H) Same as (G) with Huh-7.5, EBL, MDBK. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without antibody. Kruskal-Wallis test with Dunn’s multiple comparison. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

Figure 2: LDL-R promotes CCHFV entry. (A) Huh-7.5 cells were incubated with 4pg/mL of LDL-R antibody or control isotype before, during or after infection with CCHFV tecVLPs GFP as indicated. Cells were harvested 48h p.i. and level of infectivity was determined by flow cytometry. (B) Percentage of inhibition of CCHFV tecVLPs GFP infectivity relative to condition without antibody (WT) in the experimental set up described in (A). N=3 independent experiments. Kruskal-Wallis test with Dunn’s multiple comparison. (C) CCHFV tecVLPs GFP or VSVGpp were incubated for Ih at room temperature with soluble LDL-R (sLDL-R, open bars) or with soluble CD81 (CD81 LEL, dashed bars) at different concentrations before infection of Huh-7.5 cells pre-transfected with NP+L expression plasmids. The media was replaced 3h post infection and the cells were harvested 48h p.i and the level of infectivity was determined by flow cytometry. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without soluble protein. Kruskal-Wallis test with Dunn’s multiple comparison. (D) Same experiment using full length CCHFV. Media was removed Ih p.i. and cells were lysed 24h p.i.. The level of infectivity was quantified by RT- qPCR. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without soluble protein. Kruskal-Wallis test with Dunn’s multiple comparison. (E) tecVLPs were incubated with sLDL-R or CD81 LEL (both expressing a 6xHis tag) for Ih at RT before capture using magnetic beads. The levels of CCHFV minigenome cocaptured were determined by RT-qPCR. Results from 4 independent experiments are presented. Kruskal-Wallis test. (F) Huh-7.5 cells pre-transfected with NP+L expression plasmids were treated for with DMSO and TyrA23 (100pM) and infected 30min later with tecVLPs GFP in presence of fresh drug. Media was removed 3h p.i and and the cells were harvested at 24h p.i. for determination of the levels of infection by flow cytometry (right). Cell surface expression of LDL-R 30min post treatment determined by flow cytometry (left). Cell viability (middle), Level of infection (right). Results from independent experiments are presented as fold of relative to DMSO. (G) Huh-7.5 cells pre-transfected with NP+L expression plasmids were treated for with DMSO or TyrA23 (lOOpM) and infected 24h later with tecVLPs GFP Media was removed 3h p.i and and the cells were harvested at 24h p.i. for determination of the levels of infection by flow cytometry. Cell surface expression of LDL-R 24h post treatment determined by flow cytometry (left). Cell viability (middle), Level of infection (right). Results from independent experiments are presented fold relative to DMSO. (H) Huh-7.5 cells pretransfected with NP+L expression plasmids were treated for with TyrA23 (lOOpM) for 24h before with tecVLPs GFP and with addition of fresh drug. Media was removed 3h p.i and and the cells were harvested at 24h p.i. for determination of the levels of infection by flow cytometry. Results from independent experiments are presented as fold of infection relative to DMSO. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

Figure 3: ApoE is associated to CCHFV particles. (A) CCHFV tecVLPs, VSVGpp or HCVtcp were incubated for Ih at room temperature with an apoE serum at different dilution before infection of Huh-7.5 cells pre-transfected with NP+L expression plasmids. Cells were harvested 48h post infection and infectivity was determined by flow cytometry (for CCHFV tecVLPs GFP and VSVGpp) or by NS5A immunostaining (for HCVtcp). Results from 3 independent experiments are presented as percentages of inhibition relative to condition without serum. Kruskal-Wallis test with Dunn’s multiple comparison. (B) The same experiment was performed using full length CCHFV. Media was removed Ih post infection and cells were lysed 24h p.i. The infectivity was quantified by RT-qPCR. Results from 4 independent experiments are presented as percentage of inhibition relative to condition without serum. Kruskal-Wallis test. (C) Western blot analysis of cell lysates of cells producing CCHFV tecVLPs or Mock cells and of particles purified by ultracentrifugation. (D) Quantification of the apoE enrichment in pellet of tecVLPs relative to mock condition. (E) Level of CCHFV minigenome coimmunoprecipitated with an apoE serum vs. control IgGs and quantified by RT-qPCR. Results from 3 independent experiments are presented as fold enrichment with apoE antibodies relative to control IgGs. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment. 1

Figure 4: ApoE is responsible for LDL-R dependent entry. (A) Huh-7.5 cells, pretransfected with NP+L expression plasmids were incubated with 4pg/mL of LDL-R antibody (open bars) or control isotype (IgG goat, dashed bars) for Ih at 37°C before infection with CCHFV tecVLPs GFP produced in Huh7.5 or 293T cells. The media was replaced 3h postinfection (p.i.) and the cells were harvested at 48h p.i. for determination of the levels of infection by flow cytometry. Results from 3 independent experiments are presented as percentage of inhibition relative to condition without antibody. (B) CCHFV tecVLPs nanoLuc were incubated for Ih at room temperature with an apoE serum at different dilution before infection of Huh- 7.5 cells stably expressing FLuc and transduced with lentiviral vectors allowing expression of control shRNA or shRNA targeting LDL-R as described in Figure 1. Cells were harvested 24h post infection and infectivity was determined by nanoLuc measurement. FLuc signal was used for normalization. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

Figure 5: Molecules impairing LDL-R surface level impaired CCHFV infection. Huh-7.5 cells, pre-transfected with NP+L expression plasmids were incubated with 0 vs. 10Dg/mL of PCSK9 for 3h at 37°C, or with 0 vs. 75pM of Berbamine (BBM) for 2h at 37DC before infection with tecVLPs. (A) Cell surface expression of LDL-R of cells treated with PCSK9 for 3h relative to non-treated cells. (B) Cell viability of cells treated with PCSK9 for 3h relative to non-treated cells. (C) Level of infection of tecVLPs of cells treated with PCSK9 for 3h relative to non-treated cells. The media was replaced 3h p.i. and the cells were harvested at 48h p.i. for determination of the levels of infection by flow cytometry. Results from 4 independent experiments are presented as level of infection relative to the mean of non-treated cells. (D) Cell surface expression of LDL-R of cells treated with BBM for 2h relative to nontreated cells. (E) Cell viability of cells treated with BBM for 2h relative to non-treated cells. (F) Level of infection of tecVLPs of cells treated with BBM for 2h relative to non-treated cells. The media was replaced 3h p.i. and the cells were harvested at 48h p.i. for determination of the levels of infection by flow cytometry. Results from independent experiments are presented as level of infection relative to the mean of non-treated cells. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

Figure 6: tecVLPs can infect various cell types.

(A) Levels of nanoluc signals detected 48h after infection of Huh-7.5, TE671 and A549 cells with lOO L of tecVLPs with minigenome encoding nanoluc. (B) Levels of nanoluc signals detected 48h after infection of Huh-7.5, EBL and MBDK cells with lOO L of tecVLPs encoding nanoluc. NI=non infected control. Data are represented as the means ± SEM. Each dot in the graphs corresponds to the value of an individual experiment.

Figure 7: tecVLPs can be produced in HEK293T cells lacking apoE.

(A) Western blot of cell lysates of Huh-7.5 and HEK293T cells that were revealed for expression of apolipoprotein E. (B) Western blot of cell lysates and pellets of tecVLPs produced in Huh-7.5 or HEK293T cells and revealed for Gc expression, (C) Infectivity of tecVLPs GFP produced in Huh-7.5 or HEK293T cells. The infectivity was assessed after infection of Huh- 7.5 cells pre-transfected with NP+L expression plasmids, by flow cytometry at 24h p.i.

Figure 8: LDL-R entry functions is conserved in PHH.

(A) Expression of LDL-R at the surface of Huh-7.5 cells and primary human hepatocytes (PHH) assessed by flow cytometry. (B) Levels of nanoLuc signals detected at 24h after transduction of Huh-7.5 cells or PHH with lOOpL of tecVLPs with minigenome encoding nanoLuc. (C) Huh-7.5 cells or PHH were incubated with 4pg/mL of LDL-R antibody (open bars) or IgG goat (dashed bars) for 1 h at 37 °C before transduction with CCHF tecVLP-NanoLuc. Two-way ANOVA test with Sidak’s multiple comparisons.

Figure 9: Association of apoE with CCHFV WT particles.

CCHFV WT particles were immunoprecipitated with an apoE serum vs. control IgGs. (A) Western blot analysis for apoE and Gn or Gc detection. Asterisks indicated unspecific bands from antibodies light chains. (B) Level of CCHFV RNA co-immunoprecipitated with an apoE serum vs. control IgGs and quantified by RT-qPCR. Mann-Whitney test.

Figure 10: KD of apoE impaired CCHFV assembly/secretion and specific infectivity.

(A) Intracellular levels of apoE as assessed by flow cytometry and Western blot of cells transduced with shRNA control (NT) or targeting apoE. (B) Cells described in (A) were used for the production of CCHF tecVLPs or HAZV particles as described in Methods. Percentage of CCHFV NP transfected cells (top) or HAZV-eGFP expressing cells (bottom). Unpaired t-test for CCHFV and Mann-Whitney test for HAZV. (C) Specific infectivity of CCHF tecVLPs (top) or infectivity of HAZV (bottom) particles produced in cells described in (A) as assessed by flow cytometry. Unpaired t-test for CCHFV and Mann-Whitney test for HAZV. (D) Level of secreted viral RNA of tecVLPs (top) or HAZV (bottom) assessed by RT-qPCR. Unpaired t-test for CCHFV and Mann-Whitney test for HAZV. Data are represented as means ± SEM.

EXAMPLES Material & Methods

Cells.

Huh-7.5 cells (kind gift from Charles Rice, Rockefeller University, New York USA), HEK293T kidney cells (ATCC CRL-1573), TE-671 cells (ATCC CRL8805), A549 cells (kind gift from P Boulanger, University of Lyon, Lyon), VeroE6 cells (ATCC CRL-1587), EBL cells (kind gift from Fabienne Archer, University of Lyon, Lyon), MDBK cells (European Collection of Authenticated Cell Cultures (ECACC) were grown Dulbecco’s modified minimal essential medium (DMEM, Invitrogen, France) supplemented with lOOU/mL of penicillin, lOOpg/mL of streptomycin and 10% of fetal bovine serum.

Plasmids.

The constructs encoding wild-type CCHFV strain IbArl0200 L polymerase (pCAGGS- V5-L), N nucleoprotein (pCAGGS-NP), M segment (pCAGGS-M), T7 RNA polymerase (pCAGGS-T7), NanoLuc-expressing minigenome flanked by L NCR under the control of a T7 promotor (pSMART-LCK_L-Luc), pT7_GFP, and an empty vector (pCAGGS) were described previously (Bergeron et al. 2010; Devignot et al. 2015). psPAX2 and phCMV-G (kind gifts from Didier Trono and Jane Burns, respectively), phR’CMV NLuc WPRE (Boson et al. 2022) and phCMV HIV GFP were used for lentiviral production. pFK-JFHl/J6/C-846_Ap7, constructed from pFK-JFHl/J6/C-846 by deletion of p7 and addition of EMCV IRES between E2 and NS2, and phCMV-noSPp7(J6) were used for HCVtcp production. For VDL-R expression, pCSII-EF- VLDLR-HA (kind gift from Yoshiharu Matsuura) was used for production of lentivirus. For the down-regulation assays, TRC2_pLKO_shLRPl (TRCN0000257100; Sigma-Aldrich), TRC2_pLKO_shLDL-R (TRCN0000262146; Sigma-Aldrich) or plasmids described in (Lavillette et al. 2005) or pHR-SIN-CSGW (empty backbone) were used for generation of lentivirus in combination with phCMV-G and psPAX2. The pWPI_LDL-R plasmid was constructed as follows: The LDL-R ORF from pCMV3-LDL-R (HG10231-UT; SinoBiological) was inserted in the pWPI backbone using Pmel-Xbal and PmeLSpel restriction enzymes.

Antibodies and reagents.

Antibodies against Lrpl (EPR3724; Abeam), LDL-R (AF2148, R&D system) SR-B1 (363201; Biolegend), apoE (AHP2177; AbD Serotec), LDL-R (2148-LD-025/CF; R&D systems), VLDL-R (1H10; Abeam)) as well as goat IgG (02-6202; ThermoFisher) and rabbit IgG (02-6102; ThermoFisher) isotypes were purchased and used for flow cytometry, neutralization, and blocking assays, anti apoE (AB947; Sigma-Aldrich) was used for immunoprecipitation, anti actin (AC-74, Sigmal aidrich), Mouse Gc 11E7 (NR-40277; Bei resources), NP 9D5 (NR-40270; Bei resources), and apoE (AHP2177, AbD Serotec) were used for western blot analysis. Mouse NS5A antibodies (clone 9E10) used for HCV titration was a kind gift from Charles Rice (Rockefeller University, USA).

Recombinant PCSK9 (Thermo-Fisher), recombinant LDL-R (R&D systems), Tyrphostin A23 (Sigma- Aldrich), and CD81-LEL were used at the indicated concentration.

Production and titration of full-length CCHFV particles.

Huh-7.5 cells were infected using CCHFV isolate lb Ar 10200 (obtained from Institut Pasteur) at MOI 0.01 and the production was harvested 48h and 72h post infection. Infectious titers were determined by NP immunostaining on VeroE6 cells. For blocking and neutralization assays, viral stocks or cells were treated as described below. 24h post infection, cells were lysed with TRIzol™(ThermoFisher) and RNAs were extracted according to manufacturer’s protocol and level of viral RNA was determined by RT-qPCR.

Production and titration of CCHFV tecVLPs.

For production of tecVLPs, Huh-7.5 cells were transfected with 3.6 pg of pCAGGS- V5-L, 1.2 pg of pCAGGS-NP, 3 pg of pCAGGS-M or pCAGGS, 3 pg of pCAGGS-T7 and 1,2 pg of pSMART-LCK_L-Luc or pT7-GFP, using GeneJammer transfection reagent (Agilent). 6 hours post-transfection, cells were washed two times with OptiMEM before addition of OptiMEM. At 72h post transfection, supernatant was harvested, filtered through a 0.45 pm filter. For infection with tecVLPs, cells were pre-transfected using 2.4 pg of pCAGGS-V5-L and 4.8 pg of pCAGGS-NP using GeneJammer transfection reagent. 6 hours post-transfection, cells were seeded in 24, 48 or 96-well plates in OptiMEM. 24h post transfection, cells were infected and 48h post infection cells were harvested. For tecVLPs with GFP minigenome, infected cells were fixed and the percentage of GFP positives cells was assessed by flow cytometry (MACSQuant® VYB Flow Cytometer; Miltenyi Biotec). For tecVLPs with a NanoLuc minigenome, the infection was done on Huh-7.5 cells stably expressing firefly luciferase (FLuc) and the infectivity was quantified 24h post infection, by lysing the cells with passive lysis buffer (Promega) for lOmin at room temperature and measurement of luciferase signal using Nano- Glo® Dual-Luciferase® Reporter Assay System (Promega).

Production and titration of HAZV particles. rHAZV-eGFP virus (Fuller et al. 2020) (kindly given by J. N. Barr) was amplified in Huh-7.5 cells (MOI=0.001). Ih post infection, media was changed after a PBS wash and 72h post infection, supernatant was harvested and clarified by centrifugation 5min at 750xg. To assess the infectivity, Huh-7.5 cells were inoculated with viral supernatant before PBS wash and medium change, Ih post infection. Level of infection was detected 16h post infection by quantification of GFP positive cells by flow cytometry (MACSQuant® VYB Flow Cytometer; Miltenyi Biotec).

Production and titration ofHCV transcoinplemented particles (HCVtcp).

Huh-7.5 cells were electroporated with 2pg of phCMV-noSPp7 DNA and lOpg of Jcl Ap7 in vitro transcribed RNA as described previously (Denolly et al. 2019). Media was changed 6h post electroporation and supernatant was harvested and filtred (0.45pm) 72h later. For detection of infection, cells were fixed using ethanol 48h post infection and focus-forming units were determined by counting NS5A immunostained foci.

Production and titration of VSVG pseudoparticles or lentiviral vectors.

Lentiviral vectors encoding shRNA sequence or GFP and bearing VSV-G were produced in HEK-293T cells by transfection of psPAX2 and phCMV-G and plasmids described above using calcium phosphate precipitation. Media was replaced 16h later and supernatant was harvested and filtred (0.45pm) 24h later. The level of infection was determined by flow cytometry

Down-regulation assays.

Lentiviral vectors expressing shRNA targeting LRP1, LDL-R and SRBI were produced in HEK-293T cells. Huh-7.5 cells stably expressing Firefly Luciferase cells were transduced at MOI=30 infected with tecVLPs with minigenome expressing Renilla luciferase, 4 days post transduction. The knock-down was assessed by western blot of cell lysate generated 4 days post transduction and using anti-LRPl, anti LDL-R and anti CD36L1. Level of infection was assessed 24h post infection with measurement of luciferase signals using Nano-Gio® DualLuciferase® Reporter Assay System (Promega) as described above.

Overexpression of VLDL-R.

Huh-7.5 cells stably expressing Firefly Luciferase, were transduced at MOI=30 y lentiviral vector encoding VLDL-R and infected with tecVLPs with minigenome expressing Renilla nanolucluciferase, 4 days post transduction. The level of VLDL-R at the cell surface was assessed by flow cytometry at the day of infection. Level of infection was assessed 24h post infection with measurement of luciferase signals using Nano-Gio® Dual-Luciferase® Reporter Assay System (Promega) as described above.

Blocking with anti-LDL-R antibody.

Huh-7.5 cells grown in OptiMEM were incubated with different doses of anti LDL-R or control IgG for Ih at 37°C. Then viral inoculum was added on the cells in presence of antibodies, and media was replaced with DMEM, 10% FCS 3h post infection. For tecVLPs with a GFP minigenome, cells were harvested 48h post infection and level of infectivity was determined by flow cytometry; for full-length virus, cells were harvested 24h post infection and level of infectivity was determined by RT-qPCR. When testing different cell lines (EBL, MDBK, A549, TE-671), cells were infected with tecVLPs with a NanoLuc minigenome, the infectivity was quantified 48h post infection, by lysing the cells with passive lysis buffer (Promega) and measurement of luciferase signal using Nano-Gio® Luciferase Assay System (Promega). For experiment of kinetics of incubation, Huh-7.5 cells were incubated with LDL- R antibody either Ih before infection, at the time of infection or 2h, 4h, 6h post-infection. The antibody-containing media was replaced by fresh media at the time of infection, at 2h post infection in the control condition or at 24h post infection. Cells were harvested at 48h postinfection and the infectivity was assessed by flow cytometry.

Neutralization assays with sLDL-R or apoE antibodies.

Inoculate were incubated for Ih, room temperature with different doses soluble LDL-R (sLDL-R), CD81_6His_LEL or anti apoE and then added on Huh-7.5 cells grown in OptiMEM.3h post infection, media was replaced with DMEM, 10% FCS. For tecVLPs with GFP minigenome, cells were harvested 48h post infection and level of infectivity was determined by flow cytometry; for full-length CCHFV virus, cells were harvested 24h post infection and level of infectivity was determined by RT-qPCR. For HCV, cells were fixed 48h post infection and level of infectivity was determined by immunostaining.

Binding assays.

CCHFV tecVLPs were incubated with 5 pg of sLDL-R or CD81-LEL, both harboring a 6xHis tag for Ih at room temperature before incubation with Ni-particles (MagneHis™ Protein Purification System, Promega), according to manufacturer’s protocol. After 3 washes, beads were resuspended in TriReagent before extraction and determination of the level of cocaptured CCHFV minigenome by RT-qPCR.

Co-immunoprecipitation assay.

CCHFV tecVLPs were incubated with apoE antibodies (AB947; Sigma-Aldrich) or control goat IgG overnight at 4°C. Then 1.5 mg of Dynabeads protein G magnetic beads (source) were added during Ih at room temperature. The beads were then washed 3 times with PBS. For the elution, beads were resuspended in TriReagent and the supernatant was transferred into a new tube for RNA extraction as described previously before extraction and determination of the level of cocaptured CCHFV minigenome by RT-qPCR.

Detection of viral genomes by RT-qPCR.

After extraction, RNA were reverse transcribed (iScript cDNA synthesis kit; Bio-Rad) . In the case of tecVLPs samples, RNA was treated with DNAse (source) according to manufacturer’s protocol. Level of cDNA was then quantified by qPCR. For tecVLPs minigenome, the quantification was done by detection of the NanoLuc minigenome for CCHFV: 5’-TAGTCGATCATGTTCGGCGT-3’ (SEQ ID NO: 1) and 5’- ACCCTGTGGATGATCATC ACT-3’ (SEQ ID NO: 2) with 5’-

GATTACCAGTGTGCCATAGTGCAGGATCAC-3’ (SEQ ID NO: 3) as probe, using TaqMan™ Gene Expression Master Mix (ThermoFisher). For full-length CCHFV and HCVtcp viruses, the quantification was done using FastStart Universal SYBR (Roche) with the following primers 5'-CCCCACACCCCAAGATAATA-3' (SEQ ID NO: 4) and 5'- ACTACTCTGCATTCTCCTCA-3' (SEQ ID NO: 5) for CCHFV and 5’- TCTGCGGAACCGGTGAGTA-3’ (SEQ ID NO: 6) and 5’-TCAGGCAGTACCACAAGGC- 3’ (SEQ ID NO: 7) for HCV

Viral RNA levels were normalized with respect to glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) RNA levels, detected using FastStart Universal SYBR (Roche) and specific primers 5'-AGGTGAAGGTCGGAGTCAACG-3' (SEQ ID NO: 8) and 5'- TGGAAGATGGTGATGGGATTTC-3' (SEQ ID NO: 9). As an internal control of extraction, an exogenous RNA from the linearized Triplescript plasmid pTRI-Xef (Invitrogen) was added into the supernatant prior to extraction and quantified with specific primers (5 - CGACGTTGTCACCGGGCACG (SEQ ID NO: 10) and 5'-

ACCAGGCATGGTGGTTACCTTTGC (SEQ ID NO : 11). All detection were done on an Applied StepOne real-time PCR apparatus.

Western blot analysis.

Proteins obtained in total cell lysates were denatured in Laemmli buffer (250mM Tris- HCL pH 6.8, 10% SDS, 50% glycerol, 500mM P-mercapto-ethanol, bromophenol blue ) at 95°C for 5 min separated by SDS-PAGE, and then transferred to nitrocellulose membrane and revealed with specific primary antibodies, followed by the addition of IRdye secondary antibodies), and imaging with an Odyssey infrared imaging system CLx (Li-Cor Biosciences). In the case of Gc detection, proteins in total cell lysates were loaded in non-denaturing, nonreducing buffer (250mM Tris-HCL pH 6.8, 5% SDS, 50% glycerol, bromophenol blue).

Cell viability measurement.

The cell viability was assessed using Cytotox-Glo Cytotoxicity Assay (Promega) according to the manufacturer’s protocol.

Statistical analysis.

Significance values were calculated by applying tests indicated in the Figure Legends using the GraphPad Prism 9 software (GraphPad Software, USA). P values under 0.05 were considered statistically significant and the following denotations were used: ****, PO.OOOl; ***, P<0.001; **, P<0.01; *, P<0.05; ns (not significant), P>0.05.

Data availability.

The datasets generated during the current study are available from the corresponding author upon reasonable request. The source data underlying figures are provided as a Source Data file.

Results

The low-density-lipoprotein receptor (LDL-R) is a cofactor of CCHFV infectivity.

Lipid transfer receptors may play significant roles during cell entry for different virus families. Here, as Huh-7.5 hepatoma cells that are fully permissive for CCHFV infection express several of such receptors, we sought to address whether they could be involved in CCHFV entry. Thus, we knocked down several of these lipid transfer receptors, namely the low-density lipoprotein receptor (LDL-R), the LDL receptor-related protein 1 (Lrpl) and the scavenger receptor B-l (SR-B1) (Fig. lA). We infected these cells with tecVLPs harboring a nanoluciferase (NanoLuc) reporter gene. While the modulation of expression of SR-B1 and Lrpl did not change the infectivity of tecVLPs, we found that down-regulation of LDL-R could significantly reduce infection of Huh-7.5 cells (Fig. IB).

Next, we aimed at clarifying the role of LDL-R in CCHFV infection. First, we analyzed the effect of blocking of LDL-R present at the surface of Huh-7.5 cells by using an LDL-R antibody added before infection with CCHFV tecVLPs. As a positive control, we used lentiviral particles pseudotyped with VSV-G (VSVpp), whose infection depends on LDL-R for entry into cells (Finkelshtein et al. 2013; Amirache et al. 2014). In agreement with the results of LDL-R KD, we found that LDL-R blocking inhibited both CCHFV tecVLP and VSVGpp infectivity in a LDL-R antibody dose-dependent manner (Fig. lC). Then, we sought to confirm this result using full-length CCHFV. Using infectious virus stocks produced from Huh-7.5 cells, we confirmed that the blocking of LDL-R could dose-dependently inhibit CCHFV infection (Fig. ID).

We also tested the dependency to LDL-R of Hazara virus (HAZV), another member of the genus Orthonairovirus. Interestingly, blocking of LDL-R at the surface of Huh-7.5 cells did not impair HAZV infection (Fig. IE), suggesting that LDL-R is specifically used by CCHFV.

LDL-R shares a highly homologous structure with the very low-density lipoprotein receptor (VLDL-R), which is widely expressed with the exception of the hepatocytes under normoxic conditions (Go and Mani 2012). We therefore tested the effect of its ectopic expression on CCHFV infection using Huh-7.5 cells transduced with a VLDL-R lentiviral vector. Interestingly, expression of VLDL-R increased infection level of tecVLPs by 2-3 folds (Fig. IF).

Finally, we tested the involvement of LDL-R for CCHFV entry in cells from different tissues and species. First, we tested other human cells, either lung epithelial A549 cells or rhabdomyosarcoma TE671 cells, which could readily be infected by tecVLPs (Fig.6A). Interestingly, we found that infection of both A549 and TE671 cells was sensitive to LDL-R blocking. Second, as CCHFV can also infect cattle, we tested the LDL-R dependency of CCHFV entry in bovine cells, EBL and MDBK cells, embryonic lung and kidney cell lines, respectively, permissive to tecVLPs (Data not shown). Yet, while the LDL-R blocking antibody could bind LDL-R expressed at the surface of bovine cells, it no had effect on tecVLP infection in blocking assays, thus suggesting that CCHFV infection in EBL and MDBK cells may not depend on LDL-R. Altogether, these results suggested that LDL-R is used by CCHFV for infection of human cells but not of other mammalian cells.

LDL-R is involved at cell entry steps of CCHFV.

Since the assessment of infectivity of CCHFV tecVLPs requires both cell entry of viral particles and subsequent transcription and replication of their minigenome, we sought to determine if LDL-R is involved at entry vs. transcription/replication steps. To discriminate either possibility, we added LDL-R antibody at different time points of infection of Huh-7.5 cells (Fig.2A). We found that while the addition of the antibody either before or concomitantly to the infection inhibited tecVLPs infectivity to up to 80%, the addition of LDL-R antibody from 2h post-infection had no effect on infectivity (Fig.2B), hence suggesting that LDL-R is involved at an entry step rather than at a later step of transcription/replication.

We thus hypothesized that LDL-R could serve as a CCHFV entry factor through its expression at the cell surface. To test this hypothesis, we incubated tecVLP or live CCHFV particles with a soluble recombinant form of LDL-R (sLDL-R) before infection. We used VSVpp as positive control. While a soluble form of CD81 (CD81 LEL) used as control had no effect on infection, we found that, like for VSVpp, sLDL-R inhibited CCHFV infection in a dose-dependent manner for both tecVLP (Fig.2C) and full length CCHFV (Fig.2D) assays, suggesting that sLDL-R could prevent cell entry through interaction with viral particles. Note that while the blocking of LDL-R with an antibody impaired VSVpp and CCHFV at similar levels (Fig. lC), sLDL-R impaired CCHFV entry at a lesser extent as compared to VSVpp (Fig.2C & Fig.2D). This difference between either virus could be due to a different LDL-R usage for two types of viral particles. Alternatively, this could also be due to the production of CCHFV tecVLPs in Huh-7.5 cells that express competitors for binding to sLDL-R, such as apoB or apoE, which is not the case for HEK293T cells that were used to produce VSVpp.

The above data suggested that CCHFV could bind to LDL-R. To test this hypothesis, we incubated CCHFV tecVLPs with sLDL-R or CD81 LEL before capture of these soluble receptors and determination of the levels of co-captured viral genomes by qPCR. Interestingly, we found that we could capture ca. 10-fold more CCHFV tecVLPs RNAs with sLDL-R than with CD81 LEL (Fig.2E).

Next, we wondered if LDL-R could promote CCHFV tecVLPs endocytosis. Taking advantage of the presence of a tyrosine motif within LDL-R cytoplasmic tail that is essential for its endocytosis (Chen, Goldstein, and Brown 1990), we used the Tyrphostin A23 (TyrA23), a small molecule inhibitor that competes for binding of adaptor proteins to tyrosine motifs (Crump et al. 1998). We checked i) the surface expression levels of LDL-R by flow cytometry and ii) LDL-R endocytosis by using LDLs labeled with pHrodo that fluoresce only after their endocytosis (Ritter et al. 2018). We first tested a 30min pre-treatment with TyrA23 before addition of labelled LDLs or tecVLPs along with fresh drug. This did not change LDL-R at the cell surface (Fig.2F) but rather led to inhibition of LDL-R endocytosis. This also resulted in a slight but reproducible inhibition of tecVLP infection (Fig.2F). Surprisingly, when we tested a 24h TyrA23 pre-treatment of Huh-7.5 cells to extend these results, we found that this resulted in an increased of both LDL-R levels at the cell surface (Fig.2G) and endocytosis of fluorescent LDLs, suggesting that after 24h, TyrA23 treatment led to accumulation of LDL-R but was not any more effective to inhibit LDL-R endocytosis. Yet, we found that this condition increased of tecVLPs infection (Fig.2G), suggesting that cell surface accumulation of LDL-R might increase the binding of tecVLPs to the cell surface and therefore, their cell entry levels. In contrast, when fresh drug was added at the time of infection after a 24h pre-treatment, we observed an inhibition of both LDL-R endocytosis and tecVLPs infection (Fig.2H). This suggested that inhibition of LDL-R endocytosis prevented tecVLPs infection and, therefore, that LDL-R might play a role in CCHFV endocytosis.

Altogether, these results indicated that LDL-R promotes CCHFV entry through binding of viral particles and by facilitating their endocytosis into cells.

The exchangeable apolipoprotein E mediates CCHFV entry.

A natural ligand of LDL-R is the exchangeable apolipoprotein E (apoE). We therefore sought to determine if CCHFV tecVLPs could associate with apoE, which would allow CCHFV particles to bind LDL-R. Indeed, apoE can associate to lipoproteins such as LDLs and VLDLs but can also exist in a lipid-free form in the extracellular medium (Zhang, Gaynor, and Kruth 1996). Importantly, apoE belongs to the family of exchangeable apolipoproteins, implying that it can be transferred from a lipoprotein to another lipoprotein or to a viral particle as described for HCV (Li et al. 2017; Bankwitz et al. 2017).

First, we tested if apoE antibodies could neutralize CCHFV tecVLPs or full-length CCHFV particles. As positive control, we used HCV particles as they can be neutralized by apoE antibodies (Owen et al. 2009) whereas we used VSVpp as negative control as VSV-G is the direct ligand of VSV for LDL-R binding (Nikolic et al. 2018). We incubated viral particles with apoE antibodies for Ih before infection. Interestingly, we found a dose-dependent inhibition of infectivity for both tecVLP (Fig.3 A) and full-length virus (Fig.3B) particles by apoE antibodies, reaching up to 90% inhibition in a manner similar to HCV particles, whereas apoE antibodies did not inhibit VSVpp (Fig.3A). These results suggested that apoE plays a crucial role in CCHFV infectivity.

Next, we sought to determine if apoE can directly associate with tecVLP particles. Thus, we purified tecVLP particles by ultracentrifugation of producer cell supernatants onto a sucrose cushion. We found an enrichment of apoE in the pellets of tecVLPs as compared to pellets obtained from supernatants of mock cells (Fig.3C & Fig.3D), thus indicating a possible interaction between apoE and viral particles. Then, we determined if we could capture viral particles with an apoE antibody, as previously showed for HCV (Calattini et al. 2015). After immuno-precipitation of tecVLPs with an apoE antibody, we quantified the captured particles by detecting viral RNAby RT-qPCR. Interestingly, we found a specific 10-fold enrichment of CCHFV tecVLPs RNA with apoE antibodies relative to control IgG (Fig.3E).

Altogether, these results indicated that CCHFV particles could be associated with apoE, which provides a ligand of LDL-R at the surface of the viral particles.

ApoE is responsible for the binding of tecVLPs to LDL-R.

Next, we sought to determine if apoE displayed on virions could be responsible for the binding of tecVLPs to LDL-R. In order to exclude a potential role of CCHFV surface glycoproteins Gn and Gc for binding to LDL-R, we produced tecVLPs in HEK293T cells, which do not express apoE (Fig.7 A) but which are fully able to produce infectious tecVLPs (Fig.7B & Fig.7C). Interestingly, while the blocking of LDL-R with LDL-R antibody inhibited infection of tecVLPs produced from Huh-7.5 cells, it had little impact on tecVLPs produced in 293T cells (Fig.4A). This indicated that LDL-R dependent entry of CCHFV does not involve its surface glycoproteins and suggested that apoE may fulfill this LDL-R binding function.

Thus, to corroborate the role of apoE displayed at the surface of viral particles in LDL- R mediated entry, we repeated the ApoE neutralization assay (Fig.3A) using Huh-7.5 target cells in which LDL-R was down-regulated. We found that under such conditions, tecVLP infection was less efficiently inhibited by ApoE antibodies (Fig.4B), hence suggesting a synergic role of apoE and LDL-R in CCHFV infection.

Molecules impairing LDL-R surface levels prevent CCHFV infection.

Finally, we tested if molecules that regulate LDL-R surface levels could modulate CCHFV infection, aiming at proposing possible ways to prevent CCHFV entry. Using the proprotein convertase subtili sin-like kexin type 9 (PCSK9) that inhibits LDL-R recycling (Zhang et al. 2007) and therefore decreases LDL-R at the cell surface (Fig.5A), without altering cell viability (Fig.5B), we found that pre-treatment of cells with PCSK9 impaired CCHFV infection (Fig.5C). We also tested berbamine, bis-benzylisoquinoline alkaloid isolated from berberis (one traditional Chinese medicine), reported to inhibit JEV by altering cell surface LDL-R level (Huang et al., 2021). Again, we showed that pre-treatment of the cells with berbamine decreased LDL-R at the cell surface (Fig.5D), without alteration of cell viability (Fig.5E) and impaired CCHFV tecVLPs infection (Fig.5F). These data highlighted that molecules modulating LDL-R surface levels could be used to prevent CCHFV infection.

Altogether, our study identified LDL-R as a factor promoting CCHFV infection via binding and endocytosis of the particles. We also showed that CCHFV particles associated with a natural ligand of LDL-R, apoE, and that this factor might be important for the LDL-R dependent entry.

Confirmation of the dependency of LDL-R for infection in Primary Human Hepatocytes

We aimed at confirming the LDL-R-dependent CCHFV entry in primary human hepatocytes (PHH), which express LDL-R (Fig. 8A) and could be infected with CCHF tecVLPs (Fig. 8B). The read-out was performed at 24 h to maximize the level of signal in these primary cells. We found that the infection of PHH was sensitive to LDL-R blocking (Fig.8C) at a level comparable to that of Huh-7.5 cells.

Confirmation of the association of apoE with CCHFV WT particles

We confirmed the association of WT CCHFV particles with apoE, since we could cocapture both viral RNA (Fig.9A) and CCHFV Gn and Gc proteins (Fig.9B) with apoE antibodies, hence suggesting an association of apoE to particles containing CCHFV glycoproteins and viral genome.

Down-regulation of apoE impairs CCHFV assembly/secretion and specific infectivity

We produced CCHF tecVLPs in Huh-7.5 cells transduced with a shRNA targeting apoE, which induced a robust loss of apoE expression (Fig.10A). While apoE KD did not impair the level of expression of CCHFV NP in producer cells (Fig. lOB, top), it resulted in a strong loss of infection efficiency of CCHF tecVLPs, with a 2-log titer decrease (Fig.10C, top). To determine if this loss resulted from a defect in assembly efficiency vs. specific infectivity of particles, we determined the levels of viral RNA in the supernatant. We found that apoE KD impaired by ca. 1-log the secretion of the viral genome (Fig. lOD, top), indicating that apoE plays a role in both assembly/secretion and specific infectivity of CCHF tecVLP particles. Interestingly, apoE KD had no effect on HAZV production and infectivity (Figs. lOB-D, bottom).

Discussion

Our results highlight the role of LDL-R as an entry factor of CCHFV. This receptor is the prototype member of the ‘LDL-R family’, which regroups structurally related endocytic receptors that mediate lipid transfer to cells. The ectodomains of the members of this family share high sequence similarity and capacity to bind a large variety of ligands (Blacklow 2007). They are composed of cysteine-rich repeats, which are repeats of their ligand-binding domains, and of EGF-like modules and P-propellers, which are required for pH-dependent release of their ligands following internalization.

Interestingly, entry of unrelated bunyaviruses including RVFV and OROV was recently shown to involve Lrpl, a member of the LDL-R family (Devignot et al. 2023; Ganaie et al. 2021; Schwarz et al. 2022), which is seemingly antiviral for CCHFV (Fig.1). Yet, together with our results that LDL-R acts as a cofactor for CCHFV entry though not for HAZV, this implies that different binding and/or post-binding functions of members of the LDL-R family have been coopted by bunyaviruses in a virus-specific manner to promote their entry into cells.

While LDL-R is mainly involved in endocytosis of triglyceride- and cholesterol-containing lipoprotein particles, Lrpl mediates the endocytosis of different types of ligands especially in the liver (Go and Mani 2012). Overall, the members of the LDL-R family can bind different types of proteins or factors, suggesting that these receptors could act as capture molecules. Indeed, as above-mentioned, OROV and RVFV were shown to bind Lrpl whereas we found that CCHFV particles can bind LDL-R. Furthermore, a recent study suggested that Lrpl plays a role in RVFV endocytosis although it was unclear if this occurs via direct or indirect interactions with viral particles (Devignot et al. 2023).

Importantly, the usage of LDL-R family members as cell entry cofactors is not restricted to bunyaviruses since several other viruses seem to hijack members of this family, such as HCV for VLDL-R (Yamamoto et al. 2016; Ujino et al. 2016) and LDL-R (Albecka et al. 2012; Molina et al. 2007; Owen et al. 2009), HBV for LDL-R (Li and Luo 2021), alphaviruses for VLDL-R and apoER2 (Clark et al. 2022), VSV for LDL-R (Amirache et al. 2014; Finkelshtein et al. 2013), Dengue virus and Japanese encephalitis virus for LDL-R (Chen et al. 2017; Huang et al. 2021) as well as some rhinoviruses for LDL-R and VLDL-R (Hofer et al. 1994; Verdaguer et al. 2004).

Altogether, these previous studies combined to our report underscore a wide-range role for receptors of the LDL-R family in viral entry. Yet, how these factors promote virus entry remains poorly defined. The current evidence indicates that overall, most of these factors do not act as bona fide viral receptors but rather, as above discussed, as crucial co-factors of virus entry by promoting capture of the viral particles at the cell surface or alternatively, their endocytosis.

For some of these viruses, it is not even clear if the viral particles bind to these cofactors. While some viruses seem to directly bind these receptors via their glycoproteins, like e.g., for RVFV (Ganaie et al. 2021), OROV (Schwarz et al. 2022) or VSV (Nikolic et al. 2018), some others hijack cellular proteins like e.g., apoE as ligand cofactor for binding LDL-R, as shown in this study for CCHFV and as previously shown for HCV (Owen et al. 2009) and HBV (Qiao and Luo 2019). We may therefore speculate that viruses that can replicate in hepatocytes could have evolved to easily hijack some lipoprotein components, such as apoE or alternative exchangeable apolipoproteins (Dreux et al. 2007; Meunier et al. 2005) that are produced in the same cells, either during their secretion or from the extracellular environment (see below). In contrast, other viruses could have taken advantage of the capacity of LDL-R family members to bind to a large variety of ligand via a relatively unspecific mechanism. Indeed, for some of these ligands, the interactions can involve electrostatic interactions between conserved acidic residues or tryptophans on LDL-R repeats with basic residues on the ligands (reviewed in (Blacklow 2007)), as shown for human rhinovirus serotype 2 (HRV2) and VLDL-R (Verdaguer et al. 2004).

Especially, while OROV and RVFV Gn GP may directly bind Lprl (Ganaie et al. 2021; Schwarz et al. 2022), our results indicate that apoE, a natural ligand of members of the LDL-R family, is incorporated onto CCHFV particles and mediates LDL-R dependent entry. This suggests a different mechanism developed by CCHFV to promote entry, likely in relation with the usage of alternative and/or complementary cell entry factors that may possibly directly interact with CCHFV GPs. Association of CCHFV particles with apoE is reminiscent of the properties of HCV and HBV (Calattini et al. 2015; Dao Thi et al. 2012; Owen et al. 2009; Qiao and Luo 2019). In the case of HCV, previous studies indicated that apoE association with the viral particles allow them to bind different entry factors such as heparan sulphate proteoglycans (HSPG) (Jiang et al. 2012; Lefevre et al. 2014), which act as capture molecule (Dubuisson and Cosset 2014), but also to lipid transfer receptors such as LDL-R (Owen et al. 2009) and SR-BI (Calattini et al. 2015; Dao Thi et al. 2012). As apoE is a high affinity ligand for (most) receptors of the LDL-R family (Herz 2001), whether it acts as a ligand associated to viral particles of the above-mentioned viruses that use lipid transfer receptors remains an open question.

In this respect, it is surprising that only LDL-R though not Lrpl and SR-BI acts as an entry factor of CCHFV. While further studies are needed to understand these differences, one possibility is that LDL-R may participate to the formation of a receptor complex through a specific association with putative Gn/Gc receptors. Alternatively, as the location of the viral binding site on the receptor is a critical determinant of membrane fusion (Buchholz et al. 1996), one could speculate that should apoE allow binding of CCHFV particles to Lrpl and SR-BI, it may not provide the optimal distance between viral and target cell membranes. In addition it was shown that Lrpl could be endocytosed faster than LDL-R (Li et al. 2001 ) also raise the possibility that even should CCHFV bind to Lrpl, this could lead to a non-productive entry. This could be supported by our data suggesting that Lrpl seemed to be antiviral (Fig.1).

How apoE is recruited on CCHFV particles remains ill-defined. On the one hand, its incorporation on viral particles may occur during their production from hepatocytes where apoE is expressed (ref) and could involve interactions with CCHFV determinants such as its surface proteins. On the other hand, as apoE is an exchangeable apolipoprotein (Hatters, Peters-Libeu, and Weisgraber 2006; Nguyen et al. 2009), its incorporation on viral particles may occur passively during their assembly in the Golgi or other organelles of the secretory pathway (Hussain et al. 2008). Finally, like for HCV for which apoE association to viral particles could occur in the extracellular environment (Li et al. 2017), CCHFV may recruit actively or passively apoE after virion egress.

CCHFV is detected in different organs in vivo upon infection and can infect several different cell types in vitro (Dai et al. 2021), hence underscoring the need for ubiquitous cellular receptors and cofactors for cell entry. In this respect, the broad tissue distribution of LDL-R suggests that it may promote entry in a variety of CCHFV target cell types. CCHFV infection is not restricted to humans as it can infect a large diversity of mammals such as cattle, sheep, goats, rhinoceroses, and camels (Spengler, Bergeron, and Rollin 2016), but this infection might not depend on LDL-R, at least according to our results with bovine cells. This could be due to low recognition of human apoE by bovine LDL-R or to a preferential usage of another LDL-R family member in non-human cells. Finally, CCHFV also replicates in tick cells, which poses the question of species-specific entry factors vs. receptors conserved across arthropod and mammal species. Interestingly, the vitellogenin receptor (VgR), which is expressed in arthropod oocytes, shares the similar architecture and functions of human LDL-R (Mitchell, Sonenshine, and Perez de Leon 2019). We note that a plant virus was shown to bind vitellogenin in order to mediate cell entry via VgR in true bug (Huo et al. 2018). In this respect, it would be interesting to know if CCHFV uses a similar mechanism in tick cel 1 s^

REFERENCES

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

Agnello. V et al , 1999, PNAS, DOI : 10.1073/pnas.96.22.12766

Albecka A et al., 2012, Hepatology, DOI : 10.1002/hep.25501

Amirache F et al., 2014, Blood, DOI : 10.1182/blood-2013-ll-540641

Bankwitz D et al., 2017, J Hepatol, DOI : 10.1016/j.jhep.2017.04.010

Bente. D.A et al., 2Q 3 , Antiviral Res, DOI : 10.1016/j. antiviral.2013.07.006

Bergeron E et al., 2010, J Virol, DOI : 10.1128/JVI.01859-09

Blacklow S.C et al., 2007, Curr Opin Struct Biol, DOI : 10.1016/j. sbi.2007.08.017

Boson B et al., 2022, mBio, DOI : 10.1128/mbio.02923-21

Buchholz C. J et al., 1996, J Virol, DOI : 10.1128/JVI.70.6.3716-3723.1996

Calattini. S et al., 2015, J Biol Chem, DOI : 10.1074/jbc.Ml 15.662999

Chen J.M et al., 2017, IntJMolSci, DOI : 10.3390/ijmsl8091957

Chen W.J et al., 1990, J Biol Chem, PMID : 1968060

Clark L.E et al., 2022, Nature, DOI : 10.1038/s41586-021-04326-0

Crump C.M et al., 1998, J Biol Chem, DOI : 10.1074/jbc.273.43.28073

Dai. S et al., 2021, Front Cell Infect Microbiol, DOI : 10.3389/fcimb.2021.648077

Dao Thi VL et al., 2012, J Biol Chem, DOI : 10.1074/jbc.Ml 12.365924

Denolly S et al., 2019, J Hepatol, DOI : 10.1016/j .jhep.2018.11.033

Devignot S et al., 2015, J Virol, DOI : 10.1128/JVI.03691-14

Devignot S et al., 2023, Life Sci Alliance, DOI : 10.26508/lsa.202302005 Dixon. D.L et al., 2016, J Clin Lipidol, DOI : 10.1016/j .jack 2016.07.004 Dreux M et al., 2007, J Biol Chem, DOI : 10.1074/jbc.M705358200 Dubuisson J et al., 2014, J Hepatol, DOI : 10.1016/j .jhep.2014.06.031

Finkelshtein D et al., 2013, Proc Natl Acad Sci USA, DOI : 10.1073/pnas.1214441110

Fuller J et al., 2020, J Virol, DOI : 10.1128/JVI.00766-20

Ganaie. S.S et al., 2021, Cell, DOI : 10.1016/j.cell.2021.09.001

Go G.W et al., 2012, J Biol Med, PMID : 22461740

Gratuze M et al., 2022, Ann Neurol, DOI : 10.1002/ana.26351

Guobin Q et al., 2022, Front Pharmacol, DOI : 10.3389/fphar.2022.1032866

Hatters D.M et al., 2006, Trends Biochem, DOI : 10.1016/j. tibs.2006.06.008

Hawman. D.W et al., 2023, Nature Reviews Microbiology, DOI : 10.1038/s41579-023-00871-9

Herz J et al., 2001, Neuron, DOI : 10.1016/s0896-6273(01)00234-3

Hofer F et al., 1994, Proc Natl Acad Sci U SA, DOI : 10.1073/pnas.91.5.1839

Huang L et al., 2021, Emerg Microbes Infect, DOI : 10.1080/22221751.2021.1941276

Hui B et al., 2022, IntJBiol Sci, DOI : 10.7150/ijbs.70117

Huo. Y et al., 2018, PLoS Pathog, DOI : 10.1371/journal.ppat.1006909

Hussain M.M et al., 2008, Curr Opin Lipidol, DOI : 10.1097/MOL.0b013e3282feea85

Huynh T-PV et al., 2017, Neuron, DOI : 10.1016/j .neuron.2017.11.014

Jeon H et al., 2005, Annu Rev Biochem, DOI : 10.1146/annurev.biochem.74.082803.133354

Jiang J et al., 2012, J Virol, DOI : 10.1128/JVI.07222-11

Johan. F et al., 2022, Elsevier, DOI : 10.1016/j. prmcm.2022.100184

Lambert G et al., 2012, Lipid Res, DOI : 10.1194/jlr.R026658

Lavillette D et al., 2005, Hepatology, DOI : 10.1002/hep.20542

Lefevre M et al., 2014, PLoS One, DOI : 10.1371/joumal. pone.0095550

Li Y et al., 2021, PLoS Pathog, DOI : 10.1371/journal.ppat.1009722

Li. Z et al., 2017, J Virol, DOI : 10.1128/JVI.02227-16

Li Y et al., 2001, JBiol Chem, DOI : 10.1074/jbc.M101589200

Messina J.P et al., 2015, Sci Data, DOI : 10.1038/sdata.2015.16

Meunier J.C et al., 2005, Proc Natl Acad Sci USA, DOI : 10.1073/pnas.0501275102

Mitchell R.D et al., 2019, Front Physiol, DOI : 10.3389/fphys.2019.00618

Molina. S et al., 2007, J Hepatol, DOI : 10.1016/j.jhep.2006.09.024

Nguyen D et al., 2009, Biochemistry, DOI : 10.1021/bi9000694

Nikolic J et al., 2018, Nat Commun, DOI : 10.1038/s41467-018-03432-4

Owen D.M et al., 2009, Virology, DOI : 10.1016/j .virol.2009.08.037

Phillips M.C et al., 2014, IUBMB, DOI : 10.1002/iub.l314

Qiao. L et al., 2019, PLoS Pathog, DOI : 10.1371/journal.ppat.1007874 Ritter P et al., 2018, J Vis Exp, DOI : 10.3791/58564

Schwarz M.M et al., 2022, Proc Natl Acad Sci USA, DOI : 10.1073/pnas.2204706119 Spengler J.R et al., 2016, PLoS Negl Prop Dis, DOI : 10.1371/journal.pntd.0004210 Suda Y et al., 2016, Arch Virol, DOI : 10.1007/s00705-016-2803-l Ujino. S et al., 2016, Proc Natl Acad Sci USA, DOI : 10.1073/pnas.1506524113 Van Niel G et al., 2015, Cell Rep, DOI : 10.1016/j.celrep.2015.08.057 Varsha K et al., 2017, Nanostructures for Cancer Therapy

Verdaguer N et al., 2004, Nat Struct Mol Biol, DOI : 10.1038/nsmb753 Wagner T et al., 2013, Exp Cell Res, DOI : 10.1016/j.yexcr.2013.05.010 Wang. T et al., 2020, Mol Ther Nucleic Acids, DOI : 10.1016/j.omtn.2019.11.004 Weinreich M et al., 2014, Cardiol Rev, DOI : 10.1097/CRD.0000000000000014 Xiao X et al., 2011, Biochem Biophys Res Commun, DOI : 10.1016/j.bbrc.2011.06.109 Yakovlev S et al., 2016, Thromb Haemost, DOI : 10.1160/TH16-04-0333 Yamamoto S et al., 2016, PLoS Pathog, DOI : 10.1371/joumal.ppat.1005610 Zhang. D.W et al., 2007, J Biol Chem, DOI : 10.1074/jbc.M702027200 Zhang W.Y et al., 1996, JBiolChem, DOI : 10.1074/jbc.271.45.28641 Zivcec M et al., 2015, PLoS Negl Trop Dis, DOI : 10.1371/journal.pntd.0004259

Claims

1. A LDL-R family inhibitor and/or an ApoE inhibitor for use in the prevention and/or the treatment of Crimean hemorrhagic fever virus (CCHFV) infection in subjects in need thereof wherein the LDL-R family inhibitor is a LDL-R inhibitor and/or a VLDL-R inhibitor.

The LDL-R family inhibitor and/or the ApoE inhibitor for use according to claim 1 for use in the early stage of the infection.

2. The LDL-R family inhibitor and/or the ApoE inhibitor for use according to the claims 1 or 2 wherein the inhibitor is an inhibitor of LDL-R family activity and/or an inhibitor of ApoE activity.

3. The LDL-R family inhibitor and/or the ApoE inhibitor for use according to claim 3 wherein the inhibitor of activity is a small molecule, an antibody, an aptamer or a polypeptide.

4. The LDL-R family inhibitor and/or the ApoE inhibitor for use according to the claims 1 or 2 wherein the inhibitor is an inhibitor of LDL-R family expression and/or an inhibitor of ApoE expression.

5. The LDL-R family inhibitor and/or the ApoE inhibitor for use according to claim 5 wherein the inhibitor of expression is a siRNA, a nuclease, a ribozyme or an antisense oligonucleotide.

6. A method for preventing and/or treating CCHFV infection comprising administrating to a subject in need thereof a therapeutically effective amount of a LDL-R family and/or ApoE inhibitor according to the claims 1 to 6.

7. The method according to claim 7 wherein the LDL-R family inhibitor is a LDL-R inhibitor and/or VLDL-R inhibitor.

8. A pharmaceutical composition for use in prevention and/or treatment CCHFV infection comprising a therapeutically effective amount of a LDL-R family and/or ApoE inhibitor.

9. The pharmaceutical composition for use according to claim 9 wherein the LDL-R family inhibitor is a LDL-R inhibitor and/or VLDL-R inhibitor.

10. The pharmaceutical composition for use according to claim 10 wherein the inhibitor is an inhibitor of LDL-R family activity and/or an inhibitor of ApoE activity; and/or - is an inhibitor of LDL-R family expression and/or an inhibitor of ApoE expression.

11. The pharmaceutical composition for use according to claim 11 wherein the inhibitor of activity is a small molecule, an antibody, an aptamer or a polypeptide.

12. The pharmaceutical composition for use according to claim 11 wherein the inhibitor of expression is a RNA, a nuclease, a ribozyme or an antisense oligonucleotide