WO2025033596A1 - 골질환 예방 또는 치료용 약학 조성물 - Google Patents
골질환 예방 또는 치료용 약학 조성물 Download PDFInfo
- Publication number
- WO2025033596A1 WO2025033596A1 PCT/KR2023/014722 KR2023014722W WO2025033596A1 WO 2025033596 A1 WO2025033596 A1 WO 2025033596A1 KR 2023014722 W KR2023014722 W KR 2023014722W WO 2025033596 A1 WO2025033596 A1 WO 2025033596A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bone
- lsd1
- chemical formula
- osteoclast
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/08—Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2200/00—Function of food ingredients
- A23V2200/30—Foods, ingredients or supplements having a functional effect on health
- A23V2200/306—Foods, ingredients or supplements having a functional effect on health having an effect on bone mass, e.g. osteoporosis prevention
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2250/00—Food ingredients
- A23V2250/30—Other Organic compounds
Definitions
- the present invention relates to a pharmaceutical composition for preventing or treating bone disease.
- Bone tissue is a tissue in which bone resorption by osteoclasts and bone formation by osteoblasts are continuously maintained. Osteoblasts are promoted to differentiate by signaling factors such as Bone Morphogenetic Protein 2 (BMP2). Osteoclast differentiation is promoted by the RANKL (Receptor Activator of Nuclear Factor Kappa- ⁇ Ligand) signaling substance produced during the osteoblast differentiation stage, and apoptosis occurs when differentiation is completed. Therefore, it is important that the differentiation and activity of osteoblasts and osteoclasts are harmoniously achieved during the normal bone regeneration process.
- BMP2 Bone Morphogenetic Protein 2
- osteoporosis When the balance between osteoblasts and osteoclasts is disrupted and bone absorption exceeds bone formation, the calcium in bone tissue decreases, bone density becomes thinner, and the medullary cavity widens. As the condition progresses, the bones become weaker and more prone to fracture even with small impacts. The disease caused by these symptoms is osteoporosis.
- Osteoporosis is a condition in which bone matrix is pathologically thinned, bone density is reduced, bone strength is weakened, and the risk of fracture increases.
- the strength of the skeleton is primarily formed and maintained by the bone matrix and the deposition of minerals within the bone matrix, which is clinically reflected in bone density. Osteoporosis is divided into primary osteoporosis and secondary osteoporosis depending on the cause.
- Osteoclasts play a very important role in inducing bone resorption in bone diseases such as osteoporosis, periostitis, and rheumatoid arthritis. Therefore, many efforts have been made to find alternative drugs that can treat bone diseases by inhibiting osteoclast differentiation.
- the present invention aims to provide a novel compound capable of inhibiting hyperdifferentiation of osteoclasts.
- the purpose of the present invention is to provide a pharmaceutical composition for preventing or treating bone disease.
- the purpose of the present invention is to provide a health functional food for preventing or improving bone disease.
- a pharmaceutical composition for preventing or treating bone disease comprising a compound represented by the following chemical formula 1:
- the bone disease is any one selected from the group consisting of fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, bone atrophy, osteoarthritis, and avascular necrosis of the femur, a pharmaceutical composition for preventing or treating bone disease:
- novel compound of the present invention and the pharmaceutical composition containing the same can exhibit excellent preventive or therapeutic effects on various bone diseases including osteoporosis by inhibiting osteoclast differentiation and/or production.
- a health functional food containing the novel compound of the present invention can exhibit excellent preventive or improvement effects on various bone diseases, including osteoporosis, by inhibiting osteoclast differentiation and/or production.
- FIGS 1a and 1b schematically illustrate the synthetic process of a TCP-(MP)-caffeic acid (Tranylcypromine-Methylpiperidine-Caffeic acid) analogue.
- Figures 2a to 2g show the osteoclast formation inhibition effect (in vitro) of TCP-(MP)-caffeic acid analogues (CD-I-448 and 478) and three TCP-caffeic acid analogues (CD-I-389, CD-I-439, CD-I-442) corresponding to the chemical formula 1 compound of the present invention.
- a and b are the results of fixing and staining mature osteoclasts using a Tartrate-Resistant Acid Phosphatase (TRAP) staining kit after culturing bone marrow-derived macrophages (BMDMs) in the induction medium supplemented with macrophage-colony stimulating factor (M-CSF) (30 ng/mL) and RANKL (50 ng/mL) for 4 days, and the result of calculating the area of TRAP-positive multinucleated osteoclasts (b).
- M+R+D group treated with M-CSF, RANKL, and DMSO (Dimethyl sulfoxide) is the control group.
- c is the result of in vitro LSD1 (Lysine-specific histone demethylase 1) activity assay.
- CTRL DMSO treatment
- d and e show the effect of CD-I-448 and CD-I-478, corresponding to compounds of formula 1, on protein methylation in bone-marrow derived macrophages (BMDMs) using an LSD1 activity x-in vivo assay.
- MR ((M-CSF and RANKL treated group) and GSK-LSD1 (GSK-LSD1 Dihydrochloride treated group) are controls.
- f and g are the results of staining cells using an alkaline phosphatase (ALP staining) assay kit after primary calvarial cells were treated with BMP2 (100 ng/mL) and cultured with DMSO or labeled novel LSD1 inhibitors (2 ⁇ M) for 9 days (f) and the ALP positivity density (%) (g) indicating osteoblast differentiation measured by Image J.
- BMP2 is the control.
- the data reflect the results of three independent experiments (scale bar: 100 ⁇ m. * p ⁇ 0.05 and ** p ⁇ 0.05 vs. DMSO control).
- Figures 3a to 3h show the dose-dependent osteoclast formation inhibitory effects (in vitro) of TCP-(MP)-caffeic acid analogues.
- a to d show the results of fixing the formed mature osteoclasts and staining them using a TRAP staining kit after culturing BMDMs for 4 days in the induction medium supplied with M-CSF (30 ng/mL) and RANKL (50 ng/mL) with or without the indicated doses of CD-I-448 (a), and calculating the area of TRAP-positive multinucleated osteoclasts (b), the number of cells by nuclear type (c), and the total number of cells per well (d).
- MR the group treated with M-CSF and RANKL
- e to g show the osteoclast bone resorption assay effect (in vitro) to evaluate the effect of CD-I-448 (e), the result of supernatant fluorescence analysis of the indicated groups (f), and the result of calculating the resorbed pore area (%) (g) of the indicated groups using Image J software.
- MR M-CSF and RANKL-treated group
- h shows the results of cell viability assay of CD-I-448 at the indicated doses. Data are representative of at least three independent experiments. (Scale bar: 200 ⁇ m. 0 ⁇ M - control group vs. MR (M-CSF and RANKL-treated group) * p ⁇ 0.05, ** p ⁇ 0.01, and *** p ⁇ 0.001; G indicates GSK-LSD1.)
- Figure 4a and b show that CD-I-448 inhibits the formation of F-actin belts (in vitro).
- a shows the results of F-actin staining analysis to evaluate the effect of CD-I-448 on RANKL-induced F-actin belt formation.
- b shows the results of calculating the size (%) of the F-actin ring in the indicated groups using Image J.
- CTRL M-CSF + RANKL treatment group
- Figure 5a and b show that CD-I-478 inhibits osteoclast bone resorption (in vitro).
- a shows the results of a bone resorption assay performed to evaluate the extent of osteoclast bone resorption according to the difference in the indicated dose of CD-I-478.
- b shows the results of calculating the resorption pit area (%) of the indicated groups using Image J.
- MR the group treated with M-CSF and RANKL
- Figures 6a to 6f show the preventive effects of CDI-448 on bone loss in ovariectomized rat (OVX)-induced osteoporotic mice.
- b and c represent the measured and calculated bone mineral density (BMD), bone surface (BS), trabecular volume (Tb-V), and total volume (TV) of each sample.
- d represents the mouse body weights of each group for in vivo analysis.
- e histological evaluation of the effects of CDI-448 (5 or 10 mg/kg) on OVX-induced bone loss and representative images of demineralized bone stained with TRAP and H&E (hematoxylin and eosin).
- FIG. 7 shows the results of purifying the LSD1/CoREST (Corepressor for RE1-Silencing Transcription factor) complex.
- Figures 8a to 8f show the results of confirming the interaction of CD-I-448 and CD-I-478 with the LSD1/CoREST complex, and showing the structure of CD-I-478 within the LSD1/CoREST complex.
- a and b show the results of SPR (Surface Plasmon Resonance) analysis of CD-I-448 and CD-I-478 and the LSD1/CoREST complex.
- c shows the result of ITC (Isothermal Titration Calorimetry) analysis of CD-I-478 and the LSD1/CoREST complex.
- d shows the crystal structure of the complexed LSD1/CoREST, and the two protein chains of LSD1 and CoREST are represented as ribbons and are distinguished by color (LSD1 is green, CoREST is turquoise).
- LSD1 is green
- CoREST is turquoise
- the cylinder and the arrow represent an alpha-helix and a beta-strand, respectively.
- the FAD cofactor within the active site of LSD1 was derived from CD-1-478, as magnified in the lower left panel. It is represented as a stick model in different atomic colors in the 2Fo-Fc electron density, with yellow contour lines at the 1.5 s level.
- e is shown for comparison of inhibitors bound to the active site of LSD1. Inhibitors bound to protein backbones are indicated in different colors.
- Figures 9a to h show the results of SPR and differential scanning fluorimetry (DSF) analyses of TCP-(MP)-caffeic acid analogues using the LSD1/CoREST complex.
- SPR kinetics analyses of GSK-LSD1 and GSK2879552 (a and b), and DSF analyses of GSK2879552, CD-I-448, and CD-I-478 (c to h) are shown.
- Figures 10a to 10d show that CD-I-448 is converted to CD-I-478 by releasing TBS (t-butyldimethylsilyl) and the like.
- Blank rat plasma (a), CD-I-448 in mouse plasma (b), CD-I-478 in mouse plasma (c), and mouse plasma after intravenous injection of CD-I-448 (d) are shown.
- Samples (b) and (c) were prepared at a concentration of 5 ⁇ g/ml and incubated in rat plasma for 0.5 h, and the plasma sample (d) was obtained 5 minutes after intravenous administration at a dose of 20 mg/kg, and the chromatogram of each sample represents the results measured using mass spectrometry.
- Figures 11a to g show the effect of CDI-448 on inhibiting the expression of osteoclast-specific genes and proteins.
- a to f show the effect of CDI-448 on inhibiting the expression of osteoclast-specific markers induced through RANKL.
- the black bar represents the control group (Con), and the gray bar represents the CD-I-448 treatment group.
- Transcript levels are normalized to the expression of the control group on day 0.
- g indicates that CD-I-448 inhibits the expression of key osteoclast proteins induced by RANKL, such as NFATc1, c-fos, and Ctsk.
- ⁇ -Actin is shown as a loading control. (* p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001 vs. vehicle-treated “Con” (0 ⁇ M).)
- Figure 12a to d show that BMDMs were cultured with or without 2 ⁇ M of CD-I-448 or CD-I-448+MG132 (Z-Leu-leu-leu-al), and that 10 ⁇ M MG132 was treated for the last 6 hours, and then the protein expression of NFATc1 was analyzed (a).
- b shows that the protein expression of CtsK, an osteoclast maturation-specific protein, was analyzed, and the expression of CBL (Casitas B-lineage Lymphoma), p-LSD1, and methyl lysine was analyzed for 0, 1, 2, and 4 days.
- c shows that the lysine methylation of CBL protein was analyzed in the indicated groups, and the interaction of CBL with p-LSD1 and NFATc1 was analyzed.
- CBL protein was used as an input control.
- d shows the effect of CD-I-448 and GSK-LSD1 at the indicated doses on NFATc1 lysine 48-linked Ub. (0 ⁇ M - treated as “Con”, “M” indicates ‘M-CSF’.)
- Figures 13a and b show the results of CO-IP analysis (a) to examine CBL methylation via IP methyl lysine and Western blot CBL, and the results of CO-IP analysis (b) to confirm the interaction of p-LSD1 and CBL via IP p-LSD1 and Western blot CBL.
- Figure 14 shows a mechanism diagram of a proposed TCP-(MP)-caffeic acid analogue in the treatment of osteoclast bone loss. (Created with BioRender.com)
- the present invention relates to a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof; and uses thereof.
- the present invention provides a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:
- R is hydrogen or t-butyldimethylsilyl (TBS).
- the compound represented by chemical formula 1 is a compound represented by chemical formula 2 or chemical formula 3 below.
- the compound represented by chemical formula 1 and a pharmaceutically acceptable salt thereof can exhibit an effect of inhibiting osteoclast differentiation. More specifically, the compound represented by chemical formula 1 and a pharmaceutically acceptable salt thereof can inhibit the demethylation activity of LSD1 and stabilize the CBL protein by reducing the direct interaction between LSD1 and CBL, thereby inhibiting osteoclast differentiation.
- osteoclast bone loss was inhibited after treatment with CD-I-448 corresponding to the compound of chemical formula 1 in an OVX-induced osteoporosis mouse model.
- the present invention provides a pharmaceutical composition for preventing or treating bone disease, comprising a compound represented by the following chemical formula 1 or a pharmaceutically acceptable salt thereof:
- R is hydrogen or t-butyldimethylsilyl (TBS).
- pharmaceutically acceptable means that the compound or composition exhibits the property of not causing significant irritation to the subject, cell, tissue, etc. to which it is administered and does not impair the biological activity and physical properties of the compound.
- Pharmaceutically acceptable salts can be, for example, acid addition salts, base addition salts or metal salts.
- Acid addition salts can be formed from inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, nitrous or phosphorous acid, and non-toxic organic acids such as aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanedioates, aromatic acids, aliphatic and aromatic sulfonic acids.
- inorganic acids such as hydrochloric, nitric, phosphoric, sulfuric, hydrobromic, hydroiodic, nitrous or phosphorous acid
- non-toxic organic acids such as aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanedioates, aromatic acids, aliphatic and aromatic sulfonic acids.
- These pharmaceutically non-toxic salts include sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, nitrates, phosphates, monohydrogen phosphates, dihydrogen phosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, fluorides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caprates, heptanoates, propylates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyn-1,4-dioate, hexane-1,6-dioate, benzoates, chlorobenzoates, methylbenzoate, dinitrobenzoate, hydroxybenzoates, methoxybenzoates, phthalates, terephthalate, benzenesulfonate
- an acid addition salt of a compound represented by formula 1 can be obtained by dissolving the compound in an excess aqueous acid solution and precipitating the salt using a hydratable organic solvent, such as methanol, ethanol, acetone or acetonitrile.
- a hydratable organic solvent such as methanol, ethanol, acetone or acetonitrile.
- the metal salt may be a sodium, potassium or calcium salt.
- the metal salt may be prepared using a base, for example, an alkali metal or alkaline earth metal salt may be obtained by dissolving the compound in an excess of an alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering off the undissolved compound salt and evaporating and/or drying the filtrate.
- the bone disease that can be prevented or treated by the pharmaceutical composition of the present invention may be caused by an imbalance in the activity of osteoblasts and osteoclasts, and more specifically, the bone disease may be caused by osteoclast hyperdifferentiation or decreased osteoblast activity.
- osteoclasts When osteoclasts become overdifferentiated, they may increase abnormally, resulting in excessive bone resorption, which may lower bone density and cause various diseases such as osteoporosis, osteomalacia, osteopenia, bone atrophy, and periodontitis.
- the above bone disease may be, but is not limited to, a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, osteoatrophy, osteoarthritis or avascular necrosis of the femur, bone loss, an osteoporotic fracture, a diabetic fracture, a nonunion fracture, osteogenesis imperfecta, an osteomalacia fracture, an osteogenesis disorder, a degenerative bone disease, a malocclusion, a bone union disorder, pseudarthrosis, osteonecrosis, osteoarthritis, a bone tumor, a bone cancer, and the like.
- the bone disease may be any one selected from the group consisting of a fracture, osteoporosis, rheumatoid arthritis, periodontitis, Paget's disease, osteomalacia, osteopenia, osteoatrophy, osteoarthritis, and avascular necrosis of the femur.
- Periodontitis is an inflammatory response caused by the immune cell defense against periapical bacterial infection.
- Neutrophils which are mainly involved in periodontitis, secrete prostaglandins, which are inflammatory mediators.
- Osteoclasts which absorb bone tissue, are activated by cell signaling substances such as prostaglandins, and alveolar bone loss is observed around the inflamed area.
- chronic periodontitis shows continuous inflammation and alveolar bone erosion of the periodontal apex, and when periodontitis worsens and the tooth cannot be saved, the tooth is extracted and an implant is performed.
- the pharmaceutical composition of the present invention can be used to prevent or treat periodontitis by inhibiting the differentiation of osteoclasts and preventing bone absorption.
- prevention includes any action that inhibits or delays the onset of a bone disease.
- treatment includes any action that improves or beneficially alters the symptoms of a subject with a bone disease.
- the pharmaceutical composition of the present invention may be administered in combination with known substances for the prevention or treatment of bone diseases.
- the pharmaceutical composition of the present invention may be administered in combination with cinchonine, brown worm extract, aloe-imodin, and omega-3 fatty acids, arteannuin B, indole-2-carboxylate derivatives, euphobia factor L1, skullcapflavone derivatives, and fraxinelone.
- administration means introducing a given substance into a subject by an appropriate method
- subject means any animal, including humans, rats, mice, livestock, etc., that has developed or can develop a bone disease.
- subject means any animal, including humans, rats, mice, livestock, etc., that has developed or can develop a bone disease.
- a specific example may be a mammal, including humans.
- the pharmaceutical composition of the present invention may be in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage.
- the pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as external preparations, suppositories, and injections.
- the pharmaceutical composition of the present invention may contain the active ingredient alone, or may further contain one or more pharmaceutically acceptable carriers, excipients or diluents.
- the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
- the pharmaceutically acceptable carrier may be a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc. for oral administration, and may be used in combination with a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. for injections, and may be used in combination with a base, an excipient, a lubricant, a preservative, etc. for topical administration.
- the formulation of the pharmaceutical composition of the present invention can be variously manufactured by mixing it with a pharmaceutically acceptable carrier, and for example, in the case of oral administration, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be manufactured in the form of unit dose ampoules or multiple doses.
- the formulation of the pharmaceutical composition of the present invention can be manufactured in the form of solutions, suspensions, tablets, capsules, sustained-release preparations, etc.
- Carriers, excipients and diluents for formulation may be lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers or preservatives.
- the route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal, but is not limited thereto.
- the pharmaceutical composition of the present invention can be administered orally or parenterally, and when administered parenterally, the injection method can be selected from external application to the skin, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection.
- the dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, the degree of the disease, the drug form, the route of administration, and the period of administration, but can be appropriately selected by a person skilled in the art.
- the pharmaceutical composition of the present invention may be administered at 0.0001 mg to 1000 mg/kg or 0.001 mg to 500 mg/kg per day.
- the pharmaceutical composition of the present invention may be administered once a day or divided into several doses.
- the present invention provides a health functional food for improving bone health, comprising a compound represented by the following chemical formula 1 or a food-wise acceptable salt thereof:
- R is hydrogen or t-butyldimethylsilyl (TBS).
- improving bone health includes all effects that ensure that the balance between bone breakdown and remodeling is maintained.
- the health functional food of the present invention can improve bone health by helping to maintain the balance between bone decomposition and bone remodeling.
- Health functional foods refer to foods manufactured and processed using raw materials or ingredients with functionality useful to the human body according to the Health Functional Food Act, and the functionality may mean consumption for the purpose of obtaining useful effects for health purposes such as regulating nutrients for the structure and function of the human body or physiological effects.
- a health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including one or more of a carrier, diluent, excipient, and additive.
- Health functional foods can be, for example, various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, or health functional foods.
- Additives that may be included in health functional foods may be selected from the group consisting of natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, antioxidants, glycerin, alcohol, carbonating agents, and fruit pulp.
- natural carbohydrates flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, antioxidants, glycerin, alcohol, carbonating agents, and fruit pulp.
- Natural carbohydrates include, for example, monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as dextrin, cyclodextrin, etc., common sugars, and sugar alcohols, such as xylitol, sorbitol, erythritol, etc.
- sweetening agents thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)
- synthetic flavoring agents sacharin, aspartame, etc.
- Health functional foods may further include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and fruit pulp for the production of natural fruit juice and vegetable beverages.
- flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.
- pectic acid and its salts such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.
- pectic acid and its salts such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.
- pectic acid and its salts such as synthetic flavoring agents and
- Carriers, excipients, diluents and additives may be selected from the group consisting of, but not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil.
- the health functional food of the present invention can be prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.
- diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.
- TCP-(MP)-caffeic acid analogues CD-I-448 (compound 12 below) and 478 (compound 13 below)
- TCP-caffeic acid analogues CD-I-389 (compound 6 below), CD-I-439 (compound 7 below), CD-I-442 (compound 9 below)
- CD-I-389 compound 6 below
- CD-I-439 compound 7 below
- CD-I-442 compound 9 below
- (B) a) (i) TBDMSCl, DIEA, CH 2 Cl 2 , 25 °C, 14 h; (ii) K 2 CO 3 , THF/H 2 O(5:1 v/v), room temperature, 2 h; b) TMSCl, Et 3 N, CH 2 Cl 2 , from 0 °C to room temperature, 3 h; c) EDC HCl, HOBt H 2 O, DIEA, CH 2 Cl 2 , room temperature, 12 h; d) (i) Dess-Martin periodinane, CH2Cl2 , 0°C to room temperature, 3 hours; (ii) TCP ⁇ HCl( 3 ), NaBH(OAc) 3 , DCE, 0°C to room temperature, 12 hours; e) 6N HCl propanol solution, MeOH, 0°C, 3 hours
- Trans-( ⁇ )-tranylcypromine-hydrochloride (trans-( ⁇ )-TCP-HCl) (3) and caffeic acid (4) were prepared in four steps to produce trans-( ⁇ )-tranylcypromine-caffeic acid analogue (TCP-CA, 7) and TCP-3,4,5-trimethoxy cinnamic acid derivative ( 9 ).
- Step 2 4-(( E )-3-oxo-3-(((1S,2R)-2-phenylcyclopropyl)amino)prop-1-en-1-yl)-1,2-phenylene diacetate (diacylated TCP-CA derivative) (6) Preparation
- Step 3 ( E )-3-(3,4-dihydroxyphenyl) -N -((1S , 2R ) -2-Phenylcyclopropyl)acrylamide (TCP-caffeic acid) (7) manufacturing
- TCP-MP-CA (13) was prepared as an analogue of GSK-2879552 (TCP-MP-BzOH structure) through five steps from trans-( ⁇ )-TCP-HCl (TCP-HCl) (3).
- Step 1 ( E )-3-(3,4-bis((tyr-butyldimethylsilyl)oxy)phenyl)acrylic acid (non-silylated caffeic acid derivative)(10) Preparation
- Step 4 ( E Preparation of )-3-(3,4-bis((tyr-butyldimethylsilyl)oxy)phenyl)-1-(4-(((1R,2S)-2-phenylcyclopropyl)amino)methyl)piperiden-1-yl)prop-2-en-1-one (disilylated TCP-MP-CA derivative)(12)
- the concentrate was dissolved in 6.5 mL of anhydrous DCE and treated with tranylcypromine hydrochloride (0.6 g, 3.56 mmol) and sodium triacetoxyborohydride (1.5 g, 7.12 mmol) at 0°C.
- the reaction solution was stirred at room temperature for 12 h and then poured into ice-ether (1:1 v/v).
- the organic layer was separated and washed with saturated NaHCO 3 (10 mL).
- the organic layer was dried over Na 2 SO 4 and concentrated under reduced pressure.
- GSK-LSD1 Dihydrochloride (PubChem CID: 91663353, molecular formula: C 14 H 22 Cl 2 N 2 , molecular weight: 289.24) was purchased from MedChemExpress and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich).
- Fetal bovine serum (FBS) and alpha modified Eagle's minimal essential medium ( ⁇ -MEM) were purchased from Thermo Fisher Scientific.
- Mouse M-CSF and RANKL were purchased from PeproTech.
- Anti- ⁇ -actin (A5441) from Sigma-Aldrich; Anti-cathepsin K (sc-48353), anti-cbl (sc-1651); anti-K48-linked specific polyubiquitin (8081s), anti-c-fos (4384s), anti-NFATc1 (8032s), and secondary antibodies (7074s and 7076s) were purchased from Santa Cruz Biotechnology.
- Anti-Methyl-Lysine (nb500-824) was purchased from Novus, and anti-p-LSD1 (ABE1462) was purchased from Merck Millipore.
- the ECL system for chemiluminescence signal detection (RPN2106) was purchased from iNtRON. Tartrate-resistant acid phosphatase staining kit was purchased from CosmoBio.
- Bone marrow cells from 8-week-old C57/BL6 female mice were isolated by rinsing or washing the femurs and tibias with ⁇ -MEM. Then, BMCs were cultured in ⁇ -MEM containing 10% FBS, 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin at 37°C in a 5% CO 2 incubator for 24–36 h. Supernatant cells were collected and cultured for 3 days while supplying 30 ng/mL M-CSF. Adherent cells were then collected and used as BMDMs for osteoclast induction. All experiments using animals were approved by the Chonnam National University IACUC (Approval Number: CNU IACUC-YB-2022-123).
- adherent cells were harvested and cultured in ⁇ -MEM containing 10% FBS, 100 U/mL penicillin, 100 ⁇ g/mL streptomycin, 30 ng/mL M-CSF, and 50 ng/mL RANKL with or without TCP-(MP)-caffeic acid analogues for about 4 days.
- ⁇ -MEM containing 10% FBS, 100 U/mL penicillin, 100 ⁇ g/mL streptomycin, 30 ng/mL M-CSF, and 50 ng/mL RANKL with or without TCP-(MP)-caffeic acid analogues for about 4 days.
- all osteoclasts were fixed using 4% formalin for about 20 min.
- the cells were stained using a TRAP staining kit.
- the spread osteoclast area was visualized using a microscope and calculated using imageJ.
- the viability of BMDM (1 ⁇ 104 cells/well) was assessed in 96-well plates using a cell viability as
- Bone resorption assays were performed as previously described. BMDMs at 2 ⁇ 104 cells/well were cultured in coated 48-well plates provided in the kit (CSR-BRA-48X2KIT). They were then cultured with or without the indicated doses of CD-I-448 and CD-I-478 until mature osteoclasts were observed. 100 ⁇ L of supernatant per well was collected into a black polypropylene 96-well microplate, and fluorescence intensity was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm using a SpectraMax i3x fluorescence plate reader. Resorbed pit areas were visualized using a microscope and calculated by ImageJ. For F-actin ring analysis, belts were visually identified using a rhodamine-conjugated phalloidin staining kit (abcam) as previously described.
- abcam rhodamine-conjugated phalloidin staining kit
- the mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene was used as a reference gene.
- the primers used are as shown in Table 1 below.
- Total protein was extracted from osteoclasts treated or not with CD-I-448 using cold RIPA buffer on ice for 30 min. After quantifying the protein concentration with a gold BCA protein assay kit, the proteins were loaded and separated using 8% or 12% SDS-PAGE. They were then transferred to polyvinylidene fluoride (PVDF) membranes. Next, the PVDF membranes were blocked with 5% skim milk for 1 h, excised based on the molecular weight of the target proteins, and incubated overnight with primary antibodies diluted 1:2,000 times. They were washed with 1 ⁇ TBST and reacted with secondary antibodies diluted 1:2,000 times for 2 h at room temperature (RT). Finally, the membranes were washed and developed using Super Plus chemiluminescence (ECL) buffer for exposure and imaging.
- ECL Super Plus chemiluminescence
- TCP-(MP)-caffeic acid analogues were assayed using the LSD1 inhibitor screening kit according to the manufacturer's instructions (Caymanchem, Michigan, USA).
- the mixture sample, assay buffer, LSD1 human recombinant assay reagent, LSD1 assay fluorometric substrate, LSD1 assay horseradish peroxidase, and LSD1 assay peptide were added to a 96-well plate (black). Background wells were not supplemented with LSD1 assay peptide, and the LSD1 assay peptide group used as the initial activity and the inhibitor were not added.
- mice in the OVX, CD-I-448, and GSK-LSD1 groups underwent OVX surgery.
- the control group underwent abdominal incision.
- the CD-I-448 and GSK-LSD1 groups received intraperitoneal injections of 5 or 10 mg/kg dissolved in a mixture of 10% Tween 80 and 10% DMSO.
- Mice in the Sham and OVX groups were administered the same volume of a mixture of 10% Tween 80 and 10% DMSO by intraperitoneal injection every day.
- the injection volume was 200 ⁇ L per mouse, and the treatment was conducted for 4 weeks.
- the body weights of the mice were measured weekly.
- the mice were euthanized, and the femurs were separated, fixed with 4.0% paraformaldehyde, and then used for micro-computed tomography (micro-CT) analysis.
- micro-CT micro-computed tomography
- Sprague-Dawley mice male, 6-7 weeks old, weighing 200-230 g were purchased from Orient Bio (Seongnam, Korea). All animal experiments were approved by the Kmedihub Animal Care and Use Committee and performed in accordance with the Kmedihub guidelines for the welfare and ethics of laboratory animals. Chromatographic analysis of plasma samples for CD-I-448 was performed by LC-MS/MS at the Kmedihub Preclinical Research Center. Chromatograms collected at different time points were analyzed by LC-MS/MS scanning method using an Agilent 6400 triple quadrupole instrument (Agilent Technologies, Waldbronn, Germany).
- the mobile phase was acetonitrile:water (80:20) containing ammonium formate, and the flow rate was set at 0.2 ml/min.
- the column effluent was monitored by a mass spectrometer equipped with ESI in positive ion mode.
- the purified protein was concentrated to 8 mg mL -1 in a buffer consisting of 20 mM Tris-HCl (pH 7.5), 200 mM NaCl, and 10 mM mercaptoethanol for crystallization.
- concentration of the purified LSD1/CoREST protein complex was determined using absorbance measurements at 280 nm and the theoretical extinction coefficient at 280 nm.
- the purified LSD1/CoREST was crystallized using the hanging-drop vapor-diffusion method in VDX plates (Hampton Research). A protein solution (1 ⁇ L) at a concentration of 8 mg mL -1 was mixed with an equal volume of reservoir solution at 295 K.
- the structure was determined to a resolution of 3.5 ⁇ using the molecular replacement method in the PHENIX package, using the human LSD1/CoREST complex (PDB ID 6K3E) as a search model.
- PDB ID 6K3E human LSD1/CoREST complex
- One copy of the LSD1 and CoREST complexes in the asymmetric unit was identified, refined using the PHENIX package, and then manually rebuilt.
- the final model was obtained at a resolution of 3.0 ⁇ after iterative manual model building and refinement with the Coot17 and PHENIX packages, respectively.
- Molecular model figures were prepared using the PyMol molecular graphics program (Schr ⁇ dinger, LLC).
- Micro-CT scanning was performed using the Quantum GX Micro-CT imaging system at the Korea Basic Science Institute (Gwangju, Korea).
- CD-I-448 corresponding to the compound RANKL-induced osteoclast differentiation, F-actin belt formation and bone resorption inhibition effect (in vitro)
- TRAP staining (a specific characteristic of osteoclasts) analysis was adopted to confirm the inhibitory effect of CD-I-448 on RANKL-induced osteoclast formation in the indicated concentration range (Fig. 3a to d).
- Fig. 3a to h the differentiation of BMDM was significantly inhibited by CD-I-448.
- rhodamine-labeled phalloidin was used to mark the formed F-actin belt of mature osteoclasts, as shown in Fig. 4a and b, the control group (CTRL) had well formed rings, while CD-I-448 inhibited the formation of F-actin rings at 1 ⁇ M CD-I-448.
- Bone resorption is an important function of osteoclasts in the bone remodeling process. Therefore, the osteoclast bone resorption inhibition ability of CD-I-448 was assayed in vitro using a fluoresceinamine-labeled calcium phosphate plate. As shown in Fig. 3 e to g, obvious bone resorption pits were observed in the group treated with M-CSF and RANKL (MR group); the resorption pit area was significantly reduced by CD-I-448 treatment (1, 2, and 4 ⁇ M). In addition, Fig. 3 f and g confirmed that CD-I-448 reduced the fluorescence intensity and pit area formation in a dose-dependent manner (GSK-LSD1 (G) was used as a control inhibitor).
- CD-I-478 significantly inhibited osteoclast bone resorption in vitro (Fig. 5 a and b).
- CD-I-448 did not significantly affect the cell viability of BMDMs at least below 10 ⁇ M, whereas it completely blocked the formation of multinucleated mature osteoclasts when treated at 4 ⁇ M (Fig. 3a and b). This indicates that CD-I-448 dose-dependently inhibits RANKL-mediated osteoclast formation.
- CD-I-448 could significantly inhibit RANKL-mediated osteoclast differentiation and osteoclast-related bone resorption activity by reducing the formation of osteoclasts.
- the compound of formula 1 was confirmed to inhibit osteoclast differentiation, F-actin belt formation, and bone resorption induced by RANKL.
- CD-I-448 As shown in Figures 8a and b, the results confirmed that both CD-I-448 and CD-I-478 directly bound to the LSD1/CoREST complex. In addition, since we found that CD-I-448 would soon be converted to CD-I-478 and function ( Figure 10a to d), CD-I-478 was selected for isothermal calorimetric titration (ICT) analysis and crystal structure analysis using LSD1/CoREST ( Figure 8c to f). The ICT curves of 50 ⁇ M LSD1-CoREST and 500 ⁇ M CD-I-478 at 20 °C are shown in Figure 8c. The upper panel shows the raw ITC data.
- ICT isothermal calorimetric titration
- the lower panel shows the integrated heat per injection (solid circles) corrected for background plotted for the injection of CD-I-478 into LSD1/CoREST.
- the solid line is a fit to a single-site independent binding model, which yielded a stoichiometry of 1.1, a molar enthalpy change ( ⁇ H) of -20.44 kJ mol-1, and a binding affinity (Kd) of 2.331 ⁇ 10 -7 M (Fig. 8c).
- ⁇ H molar enthalpy change
- Kd binding affinity
- the solved structure shows an adduct that is continuous with the flavin ring of flavin adenine dinucleotide but does not allow for the full chemistry of CD-I-478 (Fig. 8d). Instead, the adduct may be slightly larger than the phenyl ring that is part of CD-I-478.
- the adduct may be slightly larger than the phenyl ring that is part of CD-I-478.
- no extra bulky electron density is observed for the entire chemical entity, suggesting that the highly active cyclopropyl ring of the inhibitor opens to form an extra five-membered ring with the flavin ring atom of FAD.
- This kind of covalent bond formation with the N5 atom of the flavin ring has been reported for several LSD1 inhibitors (Fig. 8e).
- CD-I-448 inhibited osteoclastogenesis (in vitro) and osteoclast bone loss (in vivo) (Figs. 3a to h, 4a and b).
- CD-I-448 directly targeted the LSD1/CoREST complex to reduce its demethylation activity during osteoclastogenesis (Figs. 8a to f, 2c and d).
- LSD1 demethylation activity by CD-I-448 blocks osteoclastogenesis.
- the lysine methylation of CBL after CD-I-448 treatment during osteoclastogenesis was increased after TCP-(MP)-caffeic acid analogue treatment compared to the control group (Con group), and GSK-LSD1 (a popular LSD1 inhibitor) was used as a control.
- the interaction between p-LSD1 and CBL was reduced (convert CO-IP analysis is shown in a and b of Fig. 13).
- the interaction of CBL and NFATc1 protein increased with the treatment of TCP-(MP)-caffeic acid analogue.
- CBL protein is an E3 ligase that mediates protein degradation through lysine 48-linked ubiquitination. Therefore, we analyzed the level of lysine 48-linked ubiquitination protein of NFATc1 according to the presence or absence of CD-I-448 treatment (Fig. 12d). GSK-LSD1 was used as a control inhibitor for LSD1 inhibition.
- lysine 48 ubiquitination of NFATc1 significantly increased after treatment with TCP-(MP)-caffeic acid analogues compared to the control group (Con group), confirming that CD-I-448 inhibits osteoclastogenesis induced by RANKL by increasing the degradation of NFATc1 protein through lysine 48 ubiquitination.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Physical Education & Sports Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Food Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Rheumatology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Polymers & Plastics (AREA)
- Nutrition Science (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
Abstract
본 발명은 골질환 예방 또는 치료용 약학 조성물에 관한 것으로, 보다 상세하게는 TCP-(MP)-Caffeic acid 유사체를 포함함으로써 파골세포 분화 및/또는 생성을 억제하고, 골다공증 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 치료 효과를 나타낼 수 있다.
Description
본 발명은 골질환 예방 또는 치료용 약학 조성물에 관한 것이다.
골조직은 파골세포(osteoclast)에 의한 골흡수와 조골세포(osteoblast)에 의한 골형성 과정이 지속적으로 유지되는 조직이다. 조골세포는 골 형태 발생 단백질 2 (Bone Morphogenetic Protein 2, BMP2) 등의 신호인자에 의해 분화가 촉진된다. 조골세포 분화단계에서 생성되는 RANKL(Receptor Activator of Nuclear factor Kappa-β Ligand) 신호전달물질에 의해 파골세포의 분화가 촉진되며, 분화가 완료되면 세포사멸(apoptosis)이 일어난다. 따라서, 정상적인 골 재생 과정에서 조골세포와 파골세포의 분화 및 활성이 조화롭게 이루어지는 것이 중요하다.
이러한 조골세포와 파골세포의 평형이 무너져 골 흡수가 골 형성보다 항진되면 골 조직의 석회가 감소되어 골의 치밀질이 엷어지고 그로 인해 골수강(骨髓腔)이 넓어지게 되며, 증세가 진전됨에 따라 골이 약해지기 때문에 작은 충격에도 골절되기 쉽다. 이런 증상으로 유발되는 질환이 골다공증이다.
골다공증은 골 기질이 병적으로 희박해져 골 밀도가 감소되고 골 강도가 약화되어 골절의 위험성이 증가된 상태를 말한다. 골격의 강도는 일차적으로 골 기질과 골 기질 내부의 무기질의 침착에 의해 형성되고 유지되는데 이는 임상적으로 골 밀도에 반영된다. 골다공증은 발생 원인에 따라 원발성 골다공증(primary osteoporosis)과 속발성 골다공증(secondary osteoporosis)으로 구분한다.
파골세포는 골다공증을 비롯한 골막염 및 류마티스 관절염과 같은 골 질환에서 골흡수를 유발하는데 매우 중요한 역할을 한다. 따라서, 파골세포의 분화를 억제하여 골 질환을 치료할 수 있는 대체 약물을 발굴하려는 많은 노력이 수행되어 왔다.
본 발명은 파골세포의 과분화를 억제할 수 있는 신규 화합물을 제공하는 것을 목적으로 한다.
본 발명은 골질환 예방 또는 치료용 약학 조성물을 제공하는 것을 목적으로 한다.
본 발명은 골질환 예방 또는 개선용 건강기능식품을 제공하는 것을 목적으로 한다.
1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염:
[화학식 1]
(식 중, R은 수소 또는 t-부틸디메틸실릴 임).
2. 하기 화학식 1로 표시되는 화합물을 포함하는 골질환 예방 또는 치료용 약학 조성물:
[화학식 1]
(식 중, R은 수소 또는 t-부틸디메틸실릴 임).
3. 위 2에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택되는 어느 하나인, 골질환 예방 또는 치료용 약학 조성물:
4. 화학식 1로 표시되는 화합물을 포함하는 골 건강 개선용 건강기능식품:
[화학식 1]
(식 중, R은 수소 또는 t-부틸디메틸실릴 임).
본 발명의 신규 화합물 및 이를 포함하는 약학 조성물은 파골세포 분화 및/또는 생성을 억제함으로써 골다공증 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 치료 효과를 나타낼 수 있다.
본 발명의 신규 화합물을 포함하는 건강기능식품은 파골세포 분화 및/또는 생성을 억제함으로써 골다공증 등을 포함하는 다양한 골질환에 대해 우수한 예방 또는 개선 효과를 나타낼 수 있다.
도 1의 a 및 b는 TCP-(MP)-카페인산(Tranylcypromine-Methylpiperidine-Caffeic acid) 유사체의 합성과정을 개략적으로 나타낸 것이다.
도 2의 a 내지 g는 본 발명의 화학식 1 화합물에 해당하는 TCP-(MP)-카페인산 유사체(CD-I-448 및 478) 및 TCP-카페인산 유사체 3종(CD-I-389, CD-I-439, CD-I-442)의 파골세포 형성 억제 효과(in vitro)에 관한 것이다. a 및 b는 M-CSF(Macrophage-colony stimulating factor)(30ng/mL) 및 RANKL(50ng/mL)이 공급된 유도 배지에서 골수 유래 대식세포(BMDM)에 4일 동안 각각의 신규 LSD1 억제제(CD-I-389, CD-I-439, CD-I-442, CD-I-448 및 CD-I-478)를 처리하여 배양한 후 TRAP(Tartrate-Resistant Acid Phosphatase) 염색 키트(Staining Kit)를 이용하여 성숙한 파골세포를 고정 및 염색한 결과(a), 그리고 TRAP 양성 다핵 파골세포의 면적을 계산한 결과를 나타낸다(b). M+R+D(M-CSF, RANKL 및 DMSO(Dimethyl sulfoxide)로 처리된 그룹)은 대조군이다. c는 시험관 내 LSD1(Lysine-specific histone demethylase 1) 활성 분석 결과를 나타낸다. CTRL(DMSO 처리)는 대조군이다. d 및 e는 LSD1 활성 x-in vivo 검정을 사용하여 BMDM(Bone-marrow derived macrophage)에서 단백질 메틸화에 대한 화학식 1 화합물에 해당하는 CD-I-448 및 CD-I-478의 효과를 나타낸다. MR((M-CSF 및 RANKL로 처리된 그룹)과 GSK-LSD1(GSK-LSD1 Dihydrochloride로 처리된 그룹)는 대조군이다. f 및 g는 1차 두개골 세포(Primary calvarial cells)를 BMP2 (100ng/mL)로 처리하고, DMSO 또는 표지된 신규 LSD1 억제제(2μM)와 함께 9일 동안 배양한 후 알칼리성 포스파타제(Alkaline phosphatase(ALP 염색)) 분석 키트를 사용하여 세포를 염색한 결과(f) 및 Image J로 측정한 조골세포 분화를 표현하는 ALP 양성 밀도(%)(g)를 나타낸다. BMP2는 대조군이다. 데이터는 3개의 독립적인 실험이 반영되었다(눈금 막대: 100 μm. 대조군 DMSO 대비 * p <0.05 및 ** p <0.05).
도 3의 a 내지 h는 TCP-(MP)-카페인산 유사체의 용량 의존적인 파골세포 형성 억제 효과(in vitro)에 관한 것이다. a 내지 d는 BMDM을 M-CSF(30 ng/mL) 및 RANKL(50 ng/mL)이 공급된 유도 배지에서 표시된 용량의 CD-I-448을 첨가하거나 첨가하지 않고 4일 동안 배양한 후, 형성된 성숙한 파골세포를 고정하고 TRAP 염색 키트를 사용하여 염색한 결과(a), 그리고 TRAP 양성 다핵 파골세포의 면적(b), 핵 종류별 세포수(c) 및 웰당 총세포수(d)를 계산한 결과를 나타낸다. MR(M-CSF 및 RANKL로 처리된 그룹)은 대조군이다. e 내지 g는 CD-I-448의 효과를 평가하는 파골세포 골 흡수 분석 효과(in vitro)(e), 표시된 그룹의 상등액 형광 분석 결과(f), Image J 소프트웨어를 사용하여 표시된 그룹의 재흡수된 구멍 면적(%)(g)을 계산한 결과를 나타낸다. MR(M-CSF 및 RANKL로 처리된 그룹)은 대조군이다. h는 표시된 용량에서 CD-I-448의 세포 생존력 분석 결과를 나타낸다. 데이터는 최소 3개의 독립적인 실험을 대표한다. (눈금 막대: 200μm. 0 μM - 대조군 MR(M-CSF 및 RANKL로 처리된 그룹) 대비 * p < 0.05, ** p < 0.01 및 *** p < 0.001; G는 GSK-LSD1로 표시된다.)
도 4의 a 및 b는 CD-I-448은 F-액틴 벨트의 형성을 억제한다는 결과를 나타낸다(in vitro). a는 RANKL로 유도된 F-액틴 벨트 형성에 대한 CD-I-448의 효과를 평가를 위해, F-액틴 염색 분석한 결과를 나타낸다. b는 표시된 그룹의 F-액틴 고리의 크기(%)는 Image J를 사용하여 계산한 결과를 나타낸다. CTRL(M-CSF + RANKL 처리 그룹)으로 대조군이다.
도 5의 a 및 b는 CD-I-478은 파골세포 골 흡수를 억제한다는 결과를 나타낸다(in vitro). a는 CD-I-478의 표시된 용량의 차이에 따른 파골세포 골 흡수 정도를 평가하기 위해 골 흡수 검정을 수행한 결과를 나타낸다. b는 Image J를 사용하여 표시된 그룹의 재흡수 피트(pit) 면적(%)을 계산한 결과를 나타낸다. MR(M-CSF 및 RANKL로 처리된 그룹)은 대조군이다.
도 6의 a 내지 f는 OVX(Ovariectomized rat) 유발 골다공증 마우스에서 CDI-448의 골 손실 예방 효과를 나타낸다. a는 대조군(Sham)(n=10), OVX(n=7), 저용량-5mg/kg(n=7) 및 고용량-10mg/kg(n=7)처리 마우스 그룹의 대표적인 마이크로-CT 3D 재구성 이미지를 나타낸다. b 및 c는 각 샘플의 BMD(Bone Mineral Density), BS(Bone Surface), Tb-V(Trabecular Volume), TV(Total Volume)를 측정하고 계산했다. d는 생체 내 분석(in vivo analysis)을 위한 각 그룹의 마우스 체중을 나타낸다. e는 OVX에 의한 골 손실에 대한 CDI-448(5 또는 10 mg/kg)의 효과에 대한 조직학적 평가와 TRAP 및 H&E(Hematoxylin and eosin)로 염색된 탈회된 골의 대표적인 이미지를 나타낸다. f는 골 표면당 파골세포 표면 백분율의 정량 분석(OC. S/BS(OsteoClast Surface per Bone Surface))을 나타낸다. (OVX 그룹 대비 * p<0.05, "ns"는 중요하지 않음을 나타낸다(흉터 막대 = 200μm)).
도 7는 LSD1/ CoREST(Corepressor for RE1-Silencing Transcription factor) 복합체(complex)를 정제한 결과를 나타낸다.
도 8의 a 내지 f은 CD-I-448 및 CD-I-478의 LSD1/CoREST 복합체와의 상호작용을 확인하고, CD-I-478의 LSD1/CoREST 복합체 내 구조를 나타낸 결과이다. a 및 b는 CD-I-448 및 CD-I-478과 LSD1/CoREST 복합체의 SPR(Surface Plasmon Resonance) 분석 결과를 나타낸다. c는 CD-I-478과 LSD1/CoREST 복합체의 ITC(Isothermal Titration Calorimetry) 분석결과를 나타낸다. 그리고 d는 복합된 LSD1/CoREST의 결정 구조를 나타내고, LSD1과 CoREST의 두 단백질 사슬은 리본으로 나타내어지며 색상에 따라 구별하여 나타냈다 (LSD1은 녹색, CoREST는 청록색). 여기서 원통과 화살표는 각각 알파-헬릭스와 베타-스트랜드를 나타낸다. LSD1의 활성 부위 내의 FAD 보조인자는 CD-1-478로 유도되었으며, 왼쪽 하단 패널에서 확대했다. 2Fo-Fc 전자 밀도에서 다른 원자 색상의 스틱 모델로 표시되며 노란색으로 등고선이 1.5 s 수준으로 그려서 나타냈다. e는 LSD1의 활성 부위에 결합된 억제제를 비교하기 위해 나타냈다. 단백질 백본(backbones)과 결합된 저해제를 서로 다른 색상으로 표시했다. 퀴나졸린 유래 가역적 저해제(quinazoline-derived reversible inhibitor)는 5L3E로, 트라닐시프로민 유래 비가역적 저해제(tranylcypromine-derived irreversible inhibitors)는 7VQT로, GSK2879552 유래 비가역적 저해제는 6NQU로, CD-I -478 유래 비가역적 억제제는 CDI으로 나타냈다. f는 (B)에서 비교했던 억제제를 확대하여 나타냈으며, 각 억제제에서 FAD가 유도체화되거나 가역적 억제제에 가깝게 위치하는 경우를 나타낸다.
도 9의 a 내지 h은 LSD1/CoREST 복합체(complex)를 사용한 TCP-(MP)-카페인 산 유사체의 SPR 및 DSF(differential scanning fluorimetry) 분석 결과를 나타낸다. GSK-LSD1 및 GSK2879552의 SPR 동역학 분석(a 및 b), GSK2879552, CD-I-448 및 CD-I-478의 DSF 분석(c 내지 h) 결과를 나타낸다.
도 10의 a 내지 d는 CD-I-448은 TBS(t-butyldimethylsilyl) 등을 방출하여 CD-I-478로 변환됨을 나타낸다. 빈(Blank) 쥐 혈장(a), 마우스 혈장 내 CD-I-448(b), 마우스 혈장 내 CD-I-478(c) 및 CD-I-448의 정맥 주사 후 마우스 혈장(d)을 나타낸다. 샘플 (b) 및 (c)는 5 μg/ml 농도로 제조하고 쥐 혈장에서 0.5시간 동안 배양했고, 혈장 샘플 (d)는 20 mg/kg의 용량으로 정맥 투여 후 5분에 얻었으며, 각 샘플의 크로마토그램은 질량 분석법을 사용하여 측정한 결과를 나타낸다.
도 11의 a 내지 g는 CDI-448의 파골세포 특이 유전자와 단백질 발현을 억제하는 효과를 나타낸다. a 내지 f는 CDI-448의 RANKL을 통해 유도된 파골세포 특이적 마커의 발현을 억제하는 효과를 나타낸다. CD-I-448(2μM) 처리하거나 처리하지 않고, 파골세포 특이 유전자 Acp5(Acid Phosphatase 5), NFATc1(Nuclear factor of activated T-cells, cytoplasmic 1), DC-STAMP(Dendritic cell-specific transmembrane protein), ATP6v0d2(ATPase H+ Transporting V0 Subunit D2), Oscar, CtsK의 상대적인 mRNA 발현을 0, 1, 2, 4일 동안 qRT-PCR로 분석한 결과를 나타냈다. 검정색 막대는 대조군(Con)을, 회색 막대는 CD-I-448 처리 그룹을 나타낸다. 전사체 수준(Transcript levels)은 0일째 대조군의 발현에 대해 정규화되어 나타낸다. g는 CD-I-448은 RANKL에 의해 유도된 주요 파골세포 단백질 발현, 예를 들어 NFATc1, c-fos 및 Ctsk의 발현을 억제함을 나타낸다. β-액틴은 로딩 대조군으로 사용되어 나타낸다. (비히클 처리된(vehicle-treated) "Con"(0 μM) 대비 * p < 0.05, ** p < 0.01, *** p < 0.001)
도 12의 a 내지 d는 CD-I-448 또는 CD-I-448+MG132(Z-Leu-leu-leu-al)를 2 μM 첨가 또는 첨가하지 않고 BMDM을 배양하고, 마지막 6시간 동안 10 μM의 MG132를 처리한 후 NFATc1의 단백질 발현을 분석하여 나타낸다(a). b는 파골세포 성숙 특이 단백질인 CtsK의 단백질 발현을 분석하고, 0, 1, 2, 4일 동안 CBL(Casitas B-lineage Lymphoma), p-LSD1 및 메틸 라이신의 발현을 분석하여 나타낸다. c는 표시된 그룹에서 CBL 단백질의 라이신 메틸화를 분석하고, CBL과 p-LSD1 및 NFATc1의 상호 작용을 분석하여 나타낸다. CBL 단백질을 입력 대조군으로 사용된다. d는 표시된 용량의 CD-I-448 및 GSK-LSD1이 NFATc1 라이신 48 연결된 Ub에 미치는 영향을 분석하여 나타낸다. (0 μM - "Con"으로 처리, "M"은 'M-CSF'로 표시하여 나타낸다.)
도 13의 a 및 b는 IP 메틸 라이신(IP Methyl lysine) 및 웨스턴 블롯 CBL을 통해 CBL 메틸화를 검사하기 위한 CO-IP 분석 결과(a) 및 IP p-LSD1 및 웨스턴 블롯 CBL을 통해 p-LSD1과 CBL의 상호작용을 확인하기 위한 CO-IP 분석 결과(b)를 나타낸다.
도 14은 파골세포 골 손실 치료에서 제안된 TCP-(MP)-카페인산 유사체의 메커니즘 다이어그램을 나타낸다. (BioRender.com으로 생성)
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염; 및 이의 용도에 관한 것이다.
본 발명의 화학식(구조식)에서 치환기가 필요한 자리이나, 어떠한 치환기도 기재되지 않은 경우, 수소 치환기를 생략한 것이며, 이는 본 발명의 모든 화학식(구조식)에서 동일하게 적용된다.
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염을 제공한다:
[화학식 1]
화학식 1 중, R은 수소 또는 t-부틸디메틸실릴 (t-butyldimethylsilyl, TBS)이다.
예를 들어, 화학식 1로 표시되는 화합물은 하기 화학식 2 또는 화학식 3으로 표시되는 화합물이다.
[화학식 2]
[화학식 3]
화학식 1로 표시되는 화합물 및 이의 약학적으로 허용 가능한 염은 파골세포 분화 억제 효과를 나타낼 수 있다. 보다 구체적으로 화학식 1로 표시되는 화합물 및 이의 약학적으로 허용 가능한 염은 LSD1의 탈메틸화 활성을 억제하고, LSD1과 CBL의 직접적인 상호작용을 감소시킴으로써, CBL 단백질을 안정화시킬 수 있고, 이를 통해 파골세포의 분화를 억제할 수 있다.
본 발명의 일 실시예에서, OVX-유도 골다공증 마우스 모델에서 상기 화학식 1 화합물에 해당하는 CD-I-448을 처리한 후 파골세포 골손실이 억제됨을 확인하였다.
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용 가능한 염을 포함하는 골질환 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 1]
화학식 1 중, R은 수소 또는 t-부틸디메틸실릴 (t-butyldimethylsilyl, TBS)다.
용어 "약학적으로 허용 가능한"은 화합물 또는 조성물이 투여되는 개체, 세포, 조직 등에 심각한 자극을 유발하지 않고 화합물의 생물학적 활성과 물성들을 손상시키지 않는 특성을 나타내는 것을 의미한다.
약학적으로 허용 가능한 염은 예를 들어 산 부가염, 염기 부가염 또는 금속염일 수 있다.
산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 형성될 수 있다. 이러한 약학적으로 무독한 염은 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트, 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피을레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴- 1,4-디오에이트, 핵산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 를투엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드톡시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함할 수 있다. 예를 들어, 화학식 1로 표시되는 화합물의 산 부가염은 화합물을 과량의 산 수용액 중에 용해시키고, 염을 수화성 유기 용매, 예를 들어 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜 수득할 수 있다.
금속염은 나트륨, 칼륨 또는 칼슘염일 수 있다. 금속염은 염기를 사용하여 제조할 수 있으며, 예를 들어, 알칼리 금속 또는 알칼리 토금속 염은 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고 여액을 증발 및/또는 건조시켜 수득할 수 있다.
본 발명의 약학 조성물에 의해 예방 또는 치료될 수 있는 골질환은 조골세포와 파골세포의 활성 불균형에 의해 유발되는 것 일 수 있으며, 보다 구체적으로 골질환은 파골세포 과분화 또는 조골세포 활성 감소에 의한 것일 수 있다.
파골세포가 과분화되면 파골세포가 비정상적으로 증가하여 과도한 골 흡수가 나타나, 골 밀도가 낮아질 수 있으며, 예를 들어, 골다공증, 골연화증, 골감소증, 골위축, 치주염 등 다양한 질환이 나타날 수 있다
상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 또는 무혈성대퇴골괴사, 골결손, 골다공증성 골절, 당뇨병성 골절, 불유합 골절, 골형성 부전증, 골연화증 성 골절, 골형성 장애, 퇴행성 골질환, 부정교합, 골 유합장애, 가관절증, 골 괴사, 골 관절염, 골종양, 골암 등일 수 있으나, 이에 제한되지 않는다. 바람직하게는, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택되는 어느 하나일 수 있다.
치주염은 치근단 세균감염에 대한 면역세포의 방어작용에 의한 염증반응이다. 치주염에 주로 관여하는 호중구는 염증매개물질인 프로스타글란딘을 분비한다. 프로스타글란딘 등의 세포신호전달 물질에 의해 골조직을 흡수하는 파골세포가 활성화되어 염증부위 주변의 치조골 소실이 관찰된다. 또한, 만성 치주염은 지속적인 치주근단 부분의 염증 및 치조골 부식을 나타내는데, 치주염이 악화되어 치아를 살릴 수 없는 경우 발치를 하고 임플란트를 시행한다. 이를 예방하기 위해 치주염 초기단계에서 감염을 일으키는 세포수 감소를 위한 항생제 투여 및 염증 매개물질에 의한 파골세포 활성화를 극복할 수 있는 파골세포 억제제를 투여하여 만성치주염의 완화 및 치료를 기대할 수 있다. 따라서, 본 발명 의 약학 조성물은 파골세포의 분화를 억제하여 골 흡수를 방지함으로써 치주염의 예방 또는 치료에 이용될 수 있다.
본 명세서에서 용어 "예방"은 골질환의 발생을 억제시키거나 또는 지연시키는 모든 행위를 포함한다.
용어 "치료"는 골질환이 발병된 개체의 증상이 호전되거나 이롭게 변경되는 모든 행위를 포함한다.
본 발명 약학 조성물은 공지된 골질환의 예방 또는 치료 물질과 병용 투여될 수 있다. 예를 들어 본 발명 약학 조성물은 신코닌, 갈색거저리 추출물, 알로에-이모딘 및 오메가-3 지방산, 아르테아뉴인 B, 인돌-2-카르복실레이트 유도체, 유포비아 인자 L1, 스컬캅플라본 유도체, 프락시넬론 등과 병용 투여될 수 있다.
본 명세서에서 용어 "투여"란 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, "개체"란 골질환이 발병하였거나 발병할 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 동물을 의미한다. 구체적인 예로, 인간을 포함한 포유동물일 수 있다.
본 발명 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태일 수 있다.
본 발명 약학 조성물은 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 주사제의 형태로 제형화하여 사용될 수 있다.
본 발명 약학 조성물은 유효성분을 단독으로 포함하거나, 하나 이상의 약학적으로 허용되는 담체, 부형제 또는 희석제를 더 포함할 수 있다.
본 발명 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 약학적으로 허용 가능한 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등일 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다.
본 발명 약학 조성물의 제형은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있으며, 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조될 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조될 수 있다. 또한, 본 발명 약학 조성물의 제형은 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제조될 수 있다.
제제화를 위한 담체, 부형제 및 희석제는 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트, 광물유, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제 또는 방부제 등일 수 있다.
본 발명 약학 조성물의 투여 경로는 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강 내, 비강내, 장관, 국소, 설하 또는 직장일 수 있으며, 이에 제한되지 않는다.
본 발명 본 발명 약학 조성물은 경구 또는 비경구로 투여될 수 있으며, 비경구 투여 시 피부 외용 또는 복강내 주사, 직장내주사, 피하주사, 정맥주사, 근육내 주사 또는 흉부내 주사 주입방식이 선택될 수 있다.
본 발명의 약학 조성물의 투여량은 환자의 상태 및 체중, 질병의 정도, 약물형태, 투여경로 및 기간에 따라 다르지만, 당업자에 의해 적절하게 선택될 수 있다
예를 들어, 본 발명 약학 조성물은 1일 0.0001 mg 내지 1000mg/kg 또는 0.001mg 내지 500mg/kg으로 투여될 수 있다. 본 발명 약학 조성물의 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다.
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 식품학적으로 허용 가능한 염을 포함하는 골 건강 개선용 건강기능식품을 제공한다:
[화학식 1]
화학식 1 중, R은 수소 또는 t-부틸디메틸실릴 (t-butyldimethylsilyl, TBS)이다.
화학식 1로 표시되는 화합물은 앞서 설명한 것과 동일하다.
본 명세서에서 용어 "골 건강 개선"은 골의 분해와 재형성의 균형이 유지되도록 하는 모든 효과를 포함한다.
본 발명의 건강기능식품은 골 분해 및 골 재형성의 균형 유지를 도와줌으로써, 골 건강을 개선시킬 수 있다.
건강기능식품은 건강기능식품에 관한 법률에 따른 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및 가공한 식품을 의미하며, 상기 기능성은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건 용도에 유용한 효과를 얻을 목적으로 섭취하는 것을 의미할 수 있다.
건강기능식품은 담체, 희석제, 부형제 및 첨가제 중 하나 이상을 더 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형될 수 있다.
건강기능식품은 예를 들어, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 또는 건 강기능성 식품류일 수 있다
건강기능식품에 포함될 수 있는 첨가제는 천연 탄수화물, 향미제, 영양제, 비타민, 광물(전해질), 풍미제(합성 풍미제, 천연 풍미제 등), 착색제, 충진제(치즈, 초콜렛 등), 팩트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH조절제, 안정화제, 방부제, 산화 방지제, 글리세린, 알콜, 탄산화제 및 과육으로 이루어진 군으로부터 선택될 수 있다.
천연 탄수화물은 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비 톨, 에리트리톨 등의 당알콜이다. 상기 향미제로서 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디 오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.
건강기능식품은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제, 천연 과일 쥬스 및 야채 음료의 제조를 위한 과육을 등을 더 포함할 수 있다.
담체, 부형제, 희석제 및 첨가제는 이에 한정되는 것은 아니나, 락토즈, 덱스트로즈, 슈크로즈, 솔비톨, 만니톨, 에리스리톨, 전분, 아카시아 고무, 인산칼슘, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리 케이트, 미세결정성 셀룰로즈, 폴리비닐피롤리돈, 셀룰로즈, 폴리비닐피롤리돈, 메틸셀룰로즈, 물, 설탕시럽, 메틸셀룰로즈, 메틸 하이드록시 벤조에이트, 프로필하이드록시 벤조에이트, 활석, 스테아트산 마그네슘 및 미네 랄 오일로 이루어진 군에서 선택될 수 있다
본 발명 건강기능식품을 제제화할 경우에는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다.
이하, 실시예를 통해 본 발명을 보다 상세하기 설명한다.
제조예
다음과 같은 Scheme으로 본 발명의 화학식 1 화합물에 해당하는 TCP-(MP)-카페인산 유사체(CD-I-448(하기 화합물 12) 및 478(하기 화합물 13)) 및 TCP-카페인산 유사체(CD-I-389(하기 화합물 6), CD-I-439(하기 화합물 7), CD-I-442(하기 화합물 9))을 합성하였다.
(A) a) Ac2O, 피리딘, 상온, 24시간; b) EDC·HCl, HOBt·H2O, DIEA, CH2Cl2, 0℃이후 상온, 12시간; c) LiOH·H2O, THF/MeOH/H2O(3:1:1 v/v), 0℃, 20분. (B) a) (i) TBDMSCl, DIEA, CH2Cl2, 25℃, 14시간; (ii) K2CO3, THF/H2O(5:1 v/v), 상온, 2시간; b) TMSCl, Et3N, CH2Cl2, 0℃ 이후 상온, 3시간; c) EDC·HCl, HOBt·H2O, DIEA, CH2Cl2, 상온, 12시간; d) (i) Dess-Martin periodinane, CH2Cl2, 0℃ 이후 상온, 3시간; (ii) TCP·HCl(3), NaBH(OAc)3, DCE, 0℃ 이후 상온, 12시간; e) 6N HCl 프로판올 용액, MeOH, 0℃, 3시간
제조예 1. 트랜스-(±)-트라닐시프로민-카페인산 유사체(TCP-CA, 7) 및 TCP-3,4,5-트리메톡시 신남산 유도체(CD-I-442,
9) 제조
트랜스-(±)-트라닐시프로민-염산염(trans-(±)-TCP-HCl)(3)과 카페인산(4)으로부터 4단계를 거쳐 트랜스-(±)-트라닐시프로민-카페인산 유사체(TCP-CA, 7) 및 TCP-3,4,5-트리메톡시 신남산 유도체(9)를 제조했다.
(1) 단계 1: (
E
)-3-(3,4- 디아세톡시페닐)아크릴산(디아세틸화 된 카페산 유도체)(5) 제조
피리딘 4.5 mL의 카페산(4) 용액(10 g, 55.5 mmol)에 아세트산 무수물 45 mL를 첨가하고 상온에서 교반했다. 24시간 후, 혼합물에 얼음과 찬물 100 mL를 첨가하고 충분히 고체가 형성될 때까지 냉장 보관하였다. 생성된 흰색 침전물을 여과하고 얼음 냉수로 4회(40 mL) 세척한 후, 50 ℃에서 건조하여 백색 고체 생성물(13.1 g, 49.4 mmol)을 94% 수득율로 얻었다.
1H NMR (DMSO-d 6, 400 MHz) δ 12.47 (br, 1H), 7.66 (d, J = 1.6 Hz, 1H), 7.65 (d, J = 1.6 Hz, 1H), 7.62 (d, J = 1.6 Hz, 1H), 7.59 (d, J = 16.0 Hz, 1H), 7.32 (d, J = 8.4 Hz, 1H), 6.56 (d, J = 16.0 Hz, 1H), 2.29 (s, 3H), 2.28 (s, 3H).
(2) 단계 2: 4-((
E
)-3-옥소-3-(((1S,2R)-2-페닐사이클로프로필)아미노)프로프-1-엔-1-일)-1,2-페닐렌 디아세테이트(디아실화된 TCP-CA 유도체)(6) 제조
무수(anhydrous) CH2Cl2 25 mL에 녹인 화합물 5(0.2 g, 0.75 mmol)의 용액에 EDC 염산염(0.118 g, 0.75 mmol), 1-히드록시벤조트리아졸 수화물(1-hydroxybenzotriazole hydrate)(0.1 g, 0.75 mmol), DIEA(0.195 g, 1.52 mmol) 및 트라닐시프로민 염산염(tranylcypromine hydrochloride) (0.086 g, 0.50 mmol)을 아르곤 대기 하에서 0 ℃에서 첨가했다. 생성된 용액을 상온에서 12시간 동안 교반한 다음 얼음-EtOAc(4:1 v/v)에 부었다. 유기층을 분리하고, 수용액을 EtOAc(25 mL x 3)로 추출하였다. 유기층을 모아서 Na2SO4로 건조 후 감압 하에 농축하였다. 농축액을 실리카겔 컬럼 크로마토그래피(헥산:EtOAc = 5:1 에서 3:1 v/v)로 정제하여 화합물 6(0.25 g, 0.66 mmol)를 89% 수득율로 얻었다.
1H NMR (CDCl3, 400 MHz) δ 7.59 (d, J = 15.6 Hz, 1H), 7.34-7.22 (m, 5H), 7.18 (d, J = 8.4 MHz, 3H), 6.30 (d, J = 15.6 Hz, 1H), 6.14 (br, 1H), 3.03-2.98 (m, 1H), 2.29 (s, 6H), 2.14-2.09 (m, 1H), 1.32-1.20 (m, 2H); 13C NMR (CDCl3, 100 MHz) δ 168.13, 168.11, 166.47, 142.97, 142.34, 140.30, 139.42, 133.76, 128.39, 126.58, 126.20, 126.18, 123.82, 122.35, 121.40, 32.31, 24.98, 20.66, 20.64, 16.22; HRMS-ESI+: C22H21NO5 (M+H+)에 대한 m/z 계산치 380.1498, 실측치 380.1496.
(3) 단계 3: (
E
)-3-(3,4-디히드록시페닐)
-N
-((1S
,
2R
)
-2-페닐시클로프로필)아크릴아미드(TCP-카페인산)(7) 제조
화합물 6 (0.037 g, 0.10 mmol)의 용액에 1.6 mL의 THF/MeOH/H2O (3:1:1 v/v)에 수산화 리튬 일 수화물(lithium hydroxide monohydrate)(0.012 g, 0.3 mmol)을 아르곤 하에서 0 ℃에서 첨가했다. 동일한 온도에서 20분 동안 교반한 후 반응 혼합물을 얼음물(5 mL)에 부은 후 pH 2에 도달할 때까지 5% HCl 용액으로 처리했다. 수용액을 EtOAc (10 mL x 3)로 추출했다. 유기층을 모아서 Na2SO4로 건조 후 감압 하에서 화합물7(0.02 g, 0.07 mmol)를 71% 수득율로 얻었다.
1H NMR (CD3OD, 400 MHz) δ 7.42 (d, J = 15.6 Hz, 1H), 7.26-7.21 (m, 2H), 7.15-7.09 (m, 3H), 7.00 (d, J = 2.0 Hz, 1H), 6.91 (dd, J = 2.0 Hz, 1H), 6.76 (d, J = 8.0 Hz, 1H), 6.34 (d, J = 15.6 Hz, 1H), 2.99-2.95 (m, 1H), 2.09-2.04 (m, 1H), 1.28-1.20 (m, 2H); 13C NMR (CD3OD, 100 MHz) δ 169.03, 147.44, 145.33, 140.99, 140.86, 127.93, 126.81, 125.80, 125.57, 120.78, 116.52, 115.04, 113.64, 32.16, 24.06, 14.82; HRMS-ESI+: C18H17NO3 (M+H+)에 대한 m/z 계산치 296.1287, 실측치 296.1287.
(4) 단계 4: (
E
)-
N
-((1S,2R)-2-페닐사이클로프로필)-3-(3,4,5-트리메톡시페닐)아크릴아미(TCP-3,4,5-트리메톡시 신남산 유도체)(9) 제조
화합물 9은 화합물 6와 동일한 합성과정에 따라 84% 수득율로 제조하였다.
1H NMR (acetone-d6, 400 MHz) δ 7.62 (br, 1H), 7.48 (d, J = 15.6 Hz, 1H), 7.28-7.25 (m, 2H), 7.19-7.14 (m, 3H), 6.87 (s, 2H), 6.59 (d, J = 15.6 Hz, 1H), 3.85 (s, 6H), 3.74 (s, 3H), 3.08-3.03 (m, 1H), 2.11-2.07 (m, 1H), 1.28-1.21 (m, 2H); 13C NMR (acetone-d6, 100 MHz) δ 166.00, 165.91, 153.67, 141.49, 139.61, 139.43, 130.81, 128.19, 126.16, 125.69, 120.87, 120.83, 105.04, 59.70, 55.50, 32.69, 32.56, 24.54, 24.52, 15.11, 15.08; HRMS-ESI+: C21H23NO4 (M+H+)에 대한 m/z 계산치 354.1705, 실측치 354.1704.
제조예 2. 본 발명 화학식 1에 해당하는 디실릴화된 TCP-MP-CA유도체(CD-I-448, 12) 및 TCP-MP-CA 유도체(CD-I-478, 13) 제조
트랜스-(±)-TCP-HCl(TCP-HCl)(3)으로부터 5단계를 거쳐 GSK-2879552 (TCP-MP-BzOH 구조)의 유사체로서 TCP-MP-CA(13)를 제조했다.
(1) 단계 1: (
E
)-3-(3,4-비스((티르-부틸디메틸실릴)옥시)페닐)아크릴산(비실릴화 카페산 유도체)(10) 제조
무수(anhydrous) CH2Cl2 14 mL에 녹인 카페산(4)(2 g, 11.10 mmol) 용액에 DIEA(7.89 g, 61.05 mmol) 및 TBSCl(8.37 g, 55.50 mmol)을 0℃에서 아르곤 하에 첨가했다. 생성된 용액을 상온에서 14시간 동안 교반한 다음 얼음-에테르(1:1 v/v)에 부었다. 유기층을 분리하고 수용액을 에테르(15 mL x 3)로 추출하였다. 유기층을 모아서 Na2SO4 로 건조 후 감압 하에서 농축하였다. 농축액을 THF/H2O(5:1 v/v) 18 mL에 용해하고 0℃에서 K2CO3 1.6 g으로 처리했다. 생성된 용액을 상온에서 2시간 동안 교반한 후 얼음-에테르(1:1 v/v)에 부었다. 유기층을 분리하고 수용액을 에테르(20 mL x 3)로 추출하였다. 유기층을 모아서 Na2SO4 로 건조 후 감압 하여 농축하였다. 농축액을 실리카겔 컬럼 크로마토그래피(헥산:EtOAc = 5:1 에서 1:1 v/v)로 정제하여 화합물 10(4.31 g, 10.54 mmol)을 95% 수득율로 얻었다.
1H NMR (400 MHz, CDCl3) δ 7.70 (d, J = 16.0 Hz, 1H), 7.06-7.03 (m, 2H), 6.85 (d, J = 8.8 Hz, 1H), 6.27 (d, J = 16.0 Hz, 1H), 1.00 (d, J = 4.4 Hz, 18H), 0.22 (d, J = 3.2 Hz, 12H).
(2) 단계 2: 퍼실릴화된 4-(히드록시메틸)피페리딘(4-HOMP, 9) 제조
트리에틸아민(Et3N)의 존재 하에 트리메틸실릴 클로라이드(TMSCl)를 첨가하여 제조했다(in situ).
(3) 단계 3: (
E
)-3-(3,4-비스((티르-부틸디메틸실릴)옥시)페닐)-1-(4-(히드록시메틸)피페리딘-1-일)프로프-2-엔-1-온(one)(디실릴화된 4-HOMP-CA 유도체)(11) 제조
4.4 mL의 무수(anhydrous) CH2Cl2에 녹인 4-피페리딘메탄올 (piperidinemethanol)(9)(0.3 g, 2.60 mmol)의 용액에 Et3N(0.29 g, 2.86 mmol) 및 TMSCl(0.31 g, 2.86 mmol)을 0℃에서 아르곤 하에 첨가한 후 생성된 용액을 3시간 동안 교반하였다. 화합물 10(1.27 g, 3.12 mmol)의 용액을 14 ml의 무수(anhydrous) CH2Cl2에 넣고 EDC 염산염(hydrochloride)(0.52 g, 3.38 mmol), 1-하이드록시벤조트리아졸 수화물(hydroxybenzotriazole hydrate)(0.45 g, 3.38 mmol), DIEA(0.87 g, 1.52 mmol)를 첨가하여 0℃에서 1분 동안 반응 혼합물에 천천히 첨가했다. 생성된 용액을 상온에서 12시간 동안 교반 후 얼음-에테르(4:1 v/v)에 부었다. 유기층을 분리하고 수용액을 에테르(20 mL x 3)로 추출하였다. 유기층을 모아서 Na2SO4로 건조 후 감압 하여 농축하였다. 농축액을 실리카겔 컬럼 크로마토그래피(헥산:EtOAc = 1:1 에서 1:10 v/v)로 정제하여 화합물 11(0.91 g, 1.78 mmol)을 68% 수득율로 얻었다.
1H NMR (CDCl3, 400 MHz) δ 7.54 (d, J = 15.6 Hz, 1H), 7.04 (dd, J = 2.4 Hz, 8.4 Hz, 1H), 6.96 (d, J = 2.4 Hz, 1H), 6.81 (d, J = 8.0 Hz, 1H), 6.71 (d, J = 15.6 Hz, 1H), 4.73 (br, 1H), 4.12 (br, 1H), 3.53 (d, J = 6.0 Hz, 2H), 3.07 (br, 1H), 2.70 (br, 1H), 1.85-1.74 (m, 2H), 1.50 (br, 2H), 1.27 (qd, J = 4.0 Hz, 12.0 Hz, 2H), 0.98 (d, J = 3.2 Hz, 18H), 0.20 (d, J = 2.8 Hz, 12H); 13C NMR (CDCl3, 100 MHz) δ 206.98, 165.73, 148.55, 147.00, 142.37, 129.05, 121.16, 120.93, 120.90, 115.29, 67.39, 38.94, 30.94, 25.92, 25.88, 18.48, 18.45, -0.01, -4.08, -4.10; HRMS-ESI+: C27H47NO4Si2 (M+H+)에 대한 m/z 계산치 506.3122, 실측치 506.3116
(4) 단계 4: (
E
)-3-(3,4-비스((티르-부틸디메틸실릴)옥시)페닐)-1-(4-((((1R,2S)-2-페닐사이클로프로필)아미노)메틸)피페라이드n-1-yl)프로프-2-엔-1-온(디실릴화된 TCP-MP-CA 유도체)(12) 제조
화합물 11(0.91 g, 1.78 mmol)의 용액에 12 mL의 무수(anhydrous) CH2Cl2를 넣고 아르곤 하에 0℃로 데스-마틴 피르마니난(Dess-Martin periodinane)(0.43 g, 1.02 mmol)을 첨가했다. 생성된 용액을 상온에서 3시간 동안 교반한 후 얼음물(25 mL)에 부었다. 결과 수용액을 에테르(15 mL x 3)로 추출하고, 포화 수성 NaHCO3(10 mL) 및 포화 수성 Na2S2O3(10 mL)로 세척한 다음 Na2SO4로 건조시켰다. 과량의 Na2SO4를 여과하고 여과액을 감압 하에서 농축하였다. 농축액을 무수 DCE 6.5 mL에 용해시키고 트라닐시프로민 염산염(tranylcypromine hydrochloride)(0.6 g, 3.56 mmol) 및 나트륨 트리아세톡시보로하이드라이드(sodium triacetoxyborohydride)(1.5 g, 7.12 mmol)로 0℃에서 처리하였다. 반응 용액을 상온에서 12시간 동안 교반 후 얼음-에테르(1:1 v/v)에 부었다. 유기층을 분리하고 포화 NaHCO3(10mL)로 세척하였다. 유기층을 Na2SO4로 건조 후 감압 농축하였다. 농축액을 모아서 실리카겔 컬럼 크로마토그래피(CH2Cl2:CH3OH = 70:1 에서 10:1 v/v)로 정제하여 화합물 12 (0.57 g, 0.92 mmol)을 52% 수득율로 얻었다.
1H NMR (400 MHz, CDCl3) δ 7.54 (d, J = 15.2 Hz, 1H), 7.26 (t, J = 7.2 Hz, 2H), 7.16 (t, J = 7.2 Hz, 1H), 7.04 (dd, J = 1.6, 8.4 Hz, 2H), 6.96 (d, J = 2.0 Hz, 1H), 6.81 (d, J = 8.4 Hz, 1H), 6.71 (d, J = 15.2 Hz, 1H), 4.71 (br, 1H), 4.09 (br, 1H), 3.08 (br, 1H), 2.65 (d, J = 6.8 Hz, 3H), 2.35-2.31 (m, 1H), 1.92-1.97 (m, 1H), 1.81-1.72 (m, 3H), 1.25 (s, 1H), 1.23 (qd, J = 4.0, 12.4 Hz, 2H), 1.09-1.05 (m, 1H), 0.99 (d, J = 3.6 Hz, 18H), 0.20 (d, J = 2.0 Hz, 12H); 13C NMR (acetone-d
6, 100 MHz) δ 164.57, 163.59, 163.53, 148.14, 146.87, 141.27, 141.15, 140.44, 129,73, 128.40, 128.15, 126.57, 126.11, 125.89, 121.32, 121.30, 121.23, 121.21, 120.89, 120.84, 116.51, 116.40, 52.69, 48.91, 45.19, 41.66, 38.96, 35.26, 35.07, 34.39, 25.45, 25.42, 23.99, 18.21, 18.17, 15.04; HRMS-ESI+: C36H57N2O3Si2 (M+H+)에 대한 m/z 계산치 621.3908, 실측치 621.3893.
(5) 단계 5: (
E
)-3-(3,4-디하이드록시페닐)-1-(4-((((1R,2S)-2-페닐사이클로프로필)아미노)메틸)피페리딘-1-일)프로피-2-엔-1-온(TCP-MP-CA 유도체)(13) 제조
화합물 12을 5 mL의 MeOH에 용해시키고 0℃에서 6N HCl 프로판올 용액 2 mL로 처리하였다. 반응 혼합물을 0℃에서 시간 동안 교반 후 감압하여 농축하였다. 농축액을 실리카겔 컬럼 크로마토그래피(CH2Cl2:CH3OH = 10:1 v/v)로 정제하여 화합물 13(0.03 g, 0.07 mmol)를 47% 수득율로 얻었다.
1H NMR (400 MHz, CD3OD) δ 7.47 (d, J = 15.2 Hz), 7.32 (t, J = 7.2 Hz, 2H), 7.24 (t, J = 7.2 Hz, 1H), 7.19 (d, J = 6.8 Hz, 2H), 7.05 (d, J = 2.0 Hz, 1H), 6.98 (dd, J = 2.0, 8.0 Hz, 1H), 6.90 (d, J = 15.2 Hz, 1H), 6.78 (d, J = 8.0 Hz, 1H), 4.67 (br, 1H), 4.33 (br, 1H), 3.20-3.17 (m, 1H), 31.15 (d, J = 6.8 Hz, 2H), 3.02-2.98 (m, 1H), 2.77 (br, 1H), 2.57-2.52 (m, 1H), 2.11 (m, 1H), 1.91 (m, 2H), 1.59-1.53 (m, 1H), 1.42-1.36 (m, 1H), 1.29 (br, 2H); 13C NMR (CD3OD, 100 MHz) δ 166.81, 147.53, 145.30, 143.67, 137.91, 128.35, 127.06, 126.63, 126.02, 120.87, 115.05, 113.94, 113.08, 53.40, 52.88, 45.09, 41.61, 38.30, 33.35, 30.01, 29.02, 21.06, 12.05; HRMS-ESI+: C24H29N2O3 (M+H+)에 대한 m/z 계산치 393.2178, 실측치 393.2180.
실험예
1. 방법
1.1. 재료 및 시약
GSK-LSD1 이염산염(GSK-LSD1 Dihydrochloride)(PubChem CID: 91663353, 분자식: C14H22Cl2N2, 분자량: 289.24)는 메드켐익스프레스(MedChemExpress)에서 구입하여 디메틸 설폭사이드(dimethyl sulfoxide(DMSO; Sigma-Aldrich))에 용해했다. 소태아 혈청(FBS)과 Eagle 최소 필수 배지(α-MEM)의 알파 변형은 써모 피셔 사이언티픽(Thermo Fisher Scientific)에서 구입했다. 마우스 M-CSF 및 RANKL은 페프로텍(PeproTech)에서 구입했다. 시그마-알드리치(Sigma-Aldrich)에서 구입한 항-β-액틴(A5441); 산타 크루즈 생명공학(Santa Cruz Biotechnology)에서 구입한 항-카텝신 K(sc-48353), 항-cbl(sc-1651); 항-K48-연결 특이적 폴리유비퀴틴(8081s), 항-c-fos(4384s), 항-NFATc1(8032s) 및 두 번째 항체(7074s 및 7076s)는 세포 신호 기술(Cell Signaling Technology)에서 구입했다. 안티-메틸-라이신(Anti-Methyl-Lysine(nb500-824))은 노부스(Novus)에서 구입하였고, Anti-p-LSD1(ABE1462)은 머크 밀리포어(Merck Millipore)에서 구입했다. 화학 발광 신호 검출을 위한 ECL 시스템(RPN2106)은 인트론(iNtRON)에서 구입했다. 타르타르산염 저항성 산 포스파타제(Tartrate-resistant acid phosphatase) 염색 키트는 코스모바이오(CosmoBio)에서 구입했다.
1.2. 골수 유래 대식세포 분리 및 배양
8주 된 C57/BL6 암컷 마우스의 골수 세포 (BMCs)는 α-MEM를 사용하여 대퇴골과 경골을 헹구거나 세척하여 분리했다. 그런 다음 BMC를 10% FBS, 100 U/mL 페니실린 및 100μg/mL 스트렙토마이신을 포함하는 α-MEM에 37℃, 5% CO2 배양기에서 24~36시간 동안 배양했다. 상등액의 세포를 수집하고 30 ng/mL M-CSF를 공급하면서 3일 동안 배양했다. 그 후 부착 세포를 수집하여 파골세포 유도를 위한 BMDM으로 사용했다. 동물을 이용한 모든 실험은 전남대학교 IACUC의 승인을 받았다(승인번호: CNU IACUC-YB-2022-123).
1.3. 파골세포 형성(in vitro), TRAP 염색 및 세포 생존력 분석
파골세포 형성에 대한 세포 분석 모델을 확립하기 위해, 부착 세포(BMDM)을 수확하고, 10% FBS, 100 U/mL 페니실린, 100 μg/mL 스트렙토마이신, 30 ng/mL M-CSF 및 50 ng/mL RANKL을 함유한 α-MEM에서 약 4일 동안 TCP-(MP)-Caffeic acid 유사체를 포함하거나 또는 포함하지 않고 배양했다. 양성 그룹이 성숙한 파골세포를 형성하면, 모든 파골세포는 약 20분 동안 4% 포르말린을 사용하여 고정했다. 그리고 PBS로 1회 세척한 후 TRAP 염색 키트를 이용하여 세포를 염색했다. 퍼진 파골세포 영역은 현미경을 사용하여 볼 수 있었고 imageJ를 사용하여 계산했다. BMDM(1 x 104개 세포/웰)의 생존력은 이전에 기술된 바와 같이 세포 생존능 분석 키트를 사용하여 96-웰 플레이트에서 평가했다.
1.4. 골 형성 및 ALP(Alkaline Phosphatase) 염색 분석
원시 골아세포(Primary osteoblasts)는 3-4일 마우스의 두개골(calvarias)에서 분리했다. 세포를 BMP2(100 ng/mL)의 존재 하에 TCP-(MP)-Caffeic acid 유사체가 있거나 없는 10% FBS 및 1% 페니실린-스트렙토마이신 용액을 함유하는 α-MEM에서 9일 동안 37℃에서 5 % CO2 인큐베이터에서 9일 동안, 배지는 격일로 교체했다. 세포를 PBS로 세척하고; 그런 다음 70% 얼음처럼 차가운 에탄올로 1시간 동안 고정하고 이중 증류된 H2O로 두 번 헹구었다. 그 후, BCIP®/NBT 액체 기판 시스템(Liquid Substrate System)을 사용하여 제조업체의 지침에 따라 실온에서 5-15분 동안 세포를 염색했다. 이미지는 현미경으로 캡처하거나 직접 스캔했다. ALP 양성의 강도는 Image J를 사용하여 계산됐다.
1.5. 골 재흡수 및 F-액틴 벨트 염색 분석
골 흡수 분석은 이전에 설명한 대로 수행됐다. 2 × 104개 세포/웰 BMDM을 키트로 제공된 코팅 처리된 48-웰 플레이트(CSR-BRA-48X2KIT)에서 배양했다. 이어서, 성숙한 파골세포가 관찰될 때까지 지시된 용량의 CD-I-448 및 CD-I-478과 함께 또는 없이 배양했다. 각 웰에 100 μL의 상층액이 검정색 폴리프로필렌 96 웰 마이크로플레이트(black polypropylene 96-well microplate)로 채취되었고, 스펙트라맥스(SpectraMax) i3x 형광 플레이트 리더를 사용하여 흥분 파장(excitation wavelength) 485 nm과 방출 파장(emission wavelength) 535 nm에서 형광 강도를 측정했다. 재흡수된 구덩이 영역(resorbed pit areas)은 현미경을 사용하여 볼 수 있었고 ImageJ에 의해 계산됐다. F-액틴 링 분석의 경우, 이전에 설명한 바와 같이 로다민 결합 팔로이딘 염색 키트 (rhodamine-conjugated phalloidin staining kit (abcam))를 사용하여 벨트가 시각적으로 확인됐다.
1.6. RNA 분리 및 정량적 실시간 PCR
TRIzol 시약을 사용하여 세포에서 총 RNA를 추출했다. RNA 농도를 정량화한 후 프라인스크립트 RT 리젠트 키트(PrimeScript RT Reagent Kit(Takara))를 사용하여 cDNA로 역전사했다. 다음으로 cDNA는 파워 SYBR 그린 PCR 마스터 믹스(Power SYBR Green PCR Master Mix)를 이용하여 Real-time PCR 증폭 반응에 사용했다. 마우스의 GAPDH(glyceraldehyde-3-phosphate dehydrogenase) 유전자를 참조 유전자로 사용했다.
사용된 프라이머는 하기 표 1과 같다.
| 유전자 명칭 | 프라이머 서열 (5' →3') | |
| Acp5 | Forward | CAGCTGTCCTGGCTCAAAA (서열번호 1) |
| Reverse | ACATAGCCCACACCGTTCTC (서열번호 2) | |
| Nfatc1 | Forward | ACCACCTTTCCGCAACCA (서열번호 3) |
| Reverse | GGTACTGGCTTCTCTTCCGTTTC (서열번호 4) | |
| Dc-stamp | Forward | CGCACGATGCTTCATTCTTC (서열번호 5) |
| Reverse | CAGTGCCAGCCGCAATC (서열번호 6) | |
| Atp6v0d2 | Forward | ACTATGGCCACCCGGGAAT (서열번호 7) |
| Reverse | GGCCCAAGGGAGTCATGTG (서열번호 8) | |
| Oscar | Forward | TGGCGGTTTGCACTCTTCA (서열번호 9) |
| Reverse | GGAAGAACTCAGCCAGCTCA (서열번호 10) | |
| Cathepsin k | Forward | GGACGCAGCGATGCTAACTAA (서열번호 11) |
| Reverse | CAGAGAGAAGGGAA (서열번호 12) | |
| Gapdh | Forward | TGTGTCCGTCGTGGATCTGA (서열번호 13) |
| Reverse | GATGCCTGCTTCACCACCTT (서열번호 14) | |
1.7. 웨스턴 블로팅 분석
얼음 위에서 30분 동안 차가운 RIPA 완충액을 사용하여, CD-I-448가 처리되었거나 처리되지 않은 파골세포로부터 총 단백질을 추출됐다. 골드 BCA 단백질 어세이 키트(gold BCA protein assay kit)로 단백질 농도를 정량한 후, 8% 또는 12% SDS-PAGE를 사용하여 단백질을 로딩하고 분리했다. 그런 다음 폴리비닐리덴 플루오라이드(polyvinylidene fluoride (PVDF)) 멤브레인으로 옮겼다. 다음으로, PVDF 멤브레인을 5% 탈지유를 사용하여 1시간 동안 차단하고, 표적 단백질의 분자량을 기준으로 멤브레인을 절개하고 1:2,000배로 희석한 1차 항체와 밤샘 배양시켰다. 1 × TBST로 세척하고 실온(RT)에서 2시간 동안 1:2,000배로 희석한 2차 항체와 반응시켰다. 마지막으로, 막을 세척하고 노출 및 영상화를 위해 수퍼 플러스 화학발광(ECL) 완충액을 사용하여 현상했다.
1.8. LSD1 활동 분석
LSD1 활성에 대한 TCP-(MP)-카페인산 유사체의 효과는 제조업체의 지침(Caymanchem, Michigan, USA)에 따라 LSD1 억제제 스크리닝 키트를 사용하여 분석됐다. 먼저, 혼합물 샘플, 분석 완충액, LSD1 인간 재조합 분석 시약, LSD1 분석 형광 측정 기질, LSD1 분석 홀스래디시 과산화효소(LSD1 assay horseradish peroxidase) 및 LSD1 분석 펩티드를 96-웰 플레이트(검은색)에 첨가했다. 배경 웰은 LSD1 분석 펩티드를 첨가하지 않았고, 초기 활성으로 사용된 LSD1 분석 펩티드 그룹 및 억제제를 첨가하지 않았다. 엑제제 활성 그룹은 다양한 종류나 농도의 TCP-(MP)-카페인산(Caffeic acid) 유사체를 첨가한 웰들을 의미한다. 스펙트라맥스 i3x (SpectraMax i3x) 다중 모드 마이크로플레이트 검출 플랫폼(Molecular Devices, Silicon Valley, CA, USA)을 사용하여 흥분 파장 530-540 nm 및 방출 파장 585-595 nm로 형광을 측정한 후 억제율을 계산했다. (억제율(inhibition)(%) = [(초기 활동 - 억제제 활동) / 초기 활동] x 100)
1.9. OVX-유도 파골세포 골소실 마우스 모델
C57BL/6 마우스의 성장을 위해 특정 병원균이 없는 시설을 사용했다. 그리고 생체 내에서 GSK-LSD1 및 CD-I-448의 효과를 확인하기 위해 앞서 설명한 바와 같이 OVX-유도 골다공증 마우스 모델을 확립했다. 7주 된 C57BL/6 암컷 마우스는 두 개의 집단으로 분류됐다. 한 집단은 대조군(Sham), OVX, CD-I-448 (5 mg/kg), (10 mg/kg) 네 그룹으로 구성되었고, 다른 집단은 대조군(Sham), OVX 및 GSK-LSD1 (10 mg/kg)로 구성됐다.
그 중 OVX, CD-I-448 및 GSK-LSD1 그룹의 마우스는 OVX 수술을 받았다. 대조군은 복부 절개를 받았다. 1주 동안의 회복 기간 후, CD-I-448 및 GSK-LSD1 그룹은 10% Tween 80과 10% DMSO로 이루어진 혼합물에 5 또는 10 mg/kg을 녹여 복강 내 주사를 받았다. Sham 및 OVX 그룹의 마우스들은 복강 내 주사로 매일 동일한 용량의 10% Tween 80과 10% DMSO 혼합물을 투여했다. 주사 용량은 마우스 당 200 μL이며, 4주 동안 진행됐다. 주간마다 마우스의 체중이 측정됐다. 실험의 마지막 날에는 마우스들이 안락사되고, 허벅지골이 분리되어 4.0% 파라포름알데하이드로 고정되었으며, 이후 마이크로 컴퓨터 단층촬영 (마이크로-CT) 분석을 위해 사용됐다.
1.10. SD 마우스의 혈장에서 CD-I-448의 안정성 확인
마우스 혈장 내 CD-I-448의 안정성과 대사산물을 조사하기 위해 다양한 시간대(0.5시간, 2시간, 6시간, 24시간)에 마우스 혈장이 존재하는 상태에서 질량분석기(MASS)를 사용하여 이 약물의 크로마토그래피 분석을 수행하였고, 그 결과 크로마토그램을 마우스에게 CD-I-448을 정맥 투여한 후 혈장으로부터 얻은 크로마토그램과 비교했다. 또한, CD-I-448과 CD-I-448의 대사산물로 간주되는 CD-I-478의 상관관계를 조사하기 위해 크로마토그램을 CD-I-478과 비교하여 그 관계를 조사했다.
1.11. 안정성 테스트를 위한 생체 내 실험
스프래그-도울리(Sprague-Dawley) 마우스(수컷 6-7주, 체중 200-230g)는 오리엔트바이오(Orient Bio)(대한민국 성남)에서 구입했다. 모든 동물 실험은 케이메디허브 동물실험윤리위원회(Kmedihub Animal Care and Use Committee)의 승인을 받아 케이메디허브(Kmedihub) 실험 동물의 복지 및 윤리에 대한 지침에 따라 수행됐다. CD-I-448에 대한 혈장 시료 분석의 크로마토그래피 분석은 케이메디허브(Kmedi-Hub) 전임상 연구 센터에서 LC-MS/MS를 통해 수행된다. 서로 다른 시점에서 수집된 크로마토그램은 애질런트(Agilent) 6400 삼중 사중극자(triple quadrupole) 기기(Agilent Technologies, Waldbronn, Germany)를 사용하여 LC-MS/MS 스캐닝 방법으로 분석된다. 이동상은 아세토니트릴(Acetonitrile): 물 (80:20)에 암모늄 포름산(ammonium formate)이 포함된 것이었으며, 유속은 0.2 ml/min으로 설정됐다. 컬럼 용출액은 양이온 모드에서 ESI가 장착된 질량 분석기로 모니터링했다.
1.12. 등온 적정 열량계(ITC) 분석
ITC 실험은 NanoITC(TA Instruments, New Castle, DE, USA)에 의해 수행됐다. LSD1/CoREST는 20mM HEPES, 100mM NaCl, 0.5mM TCEP를 포함하는 완충액에서 50μM로 농축되었고 CD-I-478은 희석 열을 최소화하기 위해 동일한 완충액에 용해됐다. 1% DMSO 내 500 μM CD-I-478을 250 rpm으로 회전하는 주사기에서 200℃의 1% DMSO 내 50 μM LSD1/CoREST가 포함된 셀에 2 μL 간격으로 주입했다(주입 간격 200초 유지). TA 장비에서 제공하는 NanoAnalyze 소프트웨어를 사용하여 결합 등온선을 분석했다. 기준선 컨트롤은 완충액에서 얻었고 CD-I-478 용액은 동일한 완충액에서 측정했다. 피팅은 단일 사이트 독립 바인딩 모델을 사용하여 수행됐다.
1.13. 결정화 및 구조 결정
정제된 단백질은 결정화를 위해 20mM Tris-HCl(pH 7.5), 200mM NaCl 및 10mM 머캅토에탄올 (mercaptoethanol)로 구성된 완충액에서 8mg/mL-1로 농축됐다. 정제된 LSD1/CoREST 단백질 복합체의 농도는 280 nm에서의 흡광도 측정 및 280 nm에서의 이론적 흡광 계수를 사용하여 결정했다. 정제된 LSD1/CoREST는 VDX 플레이트(Hampton Research)에서 행잉 드롭 증기 확산 방법(hanging-drop vapor-diffusion method)을 사용하여 결정화됐다. 8 mg/mL-1 농도의 단백질 용액(1 μL)을 295 K에서 동량의 저장 용액과 혼합했다. 최상의 결정은 32~38 %(v/v) 탁산염(Tacsimate)(pH 7.0)의 존재하여 성장했다. 데이터 수집을 위해 단결정을 15%(v/v) 에틸렌 글리콜(ethylene glycol)이 보충된 저장소 용액으로 동결 보호하고 나일론 루프를 사용하여 100K 질소 스트림에서 직접 급속 동결했다. 180개의 프레임으로 구성된 X-선 회절 데이터 세트는 포항 가속기 연구소(PAL, 포항, 대한민국)의 포항 광원 Ⅲ(Pohang Light Source Ⅲ)(PLS Ⅲ) 빔라인 11C에서 필라투스(Pilatus) 6M 검출기를 사용하고 파장 0.9793Å에서 1°진동을 사용하여 수집됐다. 데이터는 HKL-2000 소프트웨어 패키지로 인덱싱되고 스케일링됐다. 인간 LSD1/CoREST 복합체 (PDB ID 6K3E)를 검색 모델로 사용하여, PHENIX 패키지의 분자 대체 방법을 사용하여 3.5Å의 해상도로 구조를 결정했다. 비대칭 유닛에서 LSD1 및 CoREST 복합체의 한 사본을 식별하고 PHENIX 패키지를 사용하여 정제 한 다음 수동으로 재구축했다. 최종 모델은 각각 Coot17 및 PHENIX 패키지로 반복적인 수동 모델 구축 및 개선 후 3.0Å의 해상도로 얻었다. 분자 모델 그림은 PyMol Molecular 그래픽 프로그램(Schrφdinger, LLC)을 사용하여 작성됐다.
1.14. 마이크로 CT 스캐닝
Micro-CT 스캐닝은 한국기초과학지원연구원(광주, 한국)에서 퀀텀 GX 마이크로-CT(Quantum GX Micro-CT) 이미징 시스템을 사용하여 수행했다.
1.15. 통계 분석
두 그룹 간의 차이를 비교하기 위해 Unpaired Student's t-test를 사용했다. 그래프패드 프리즘(GraphPad Prism) 8.3.0을 이용하여 여러 그룹 간의 차이를 비교하기 위해 일원분산분석(ANOVA)과 더넷(Dunnett)의 다중 비교 검정을 사용했다. (*p<0.05; **p<0.01; ***p<0.001; NS, 유의하지 않음) 모든 오차 분석은 평균 ± 표준편차로 표시된다.
2. 결과
2.1. [화학식 1] 화합물에 해당하는 CD-I-448 및 478의 파골세포 형성 억제 효과(in vitro)
CD-I-389 (6), CD-I-439 (7), CD-I-442 (9), CD-I-448(12), CD-I-478 (13)). 파골세포형성(osteoclatogenesis)에 대한 화합물들의 억제 효과는 1 μM을 사용하여 평가됐다. 결과는 화합물들 중 CD-I-389, 448 및 478이 파골세포의 분화를 크게 억제함을 확인했다(도 2의 a 및 b). 다음으로, 화합물들을 사용한 LSD1 효소 활성의 억제를 분석한 결과, CD-I-448 및 CD-I-478이 시험관 내에서 투여량 의존적 방식으로 LSD1 탈메틸화 활성에 대한 상당한 억제를 나타냄을 확인했다(도 2의 c). 일반적으로 알려진 LSD1 탈메틸화 억제제인 GSK-LSD1을 대조군으로 사용했다(도 2의 c). LSD1 탈메틸화에 대한 현저히 억제(in vitro)를 확인했고, 파골세포 분화 동안 LSD1 관련 메틸화에 대한 화합물들의 효과를 LSD1 활성 키트를 사용하여 확인했다. 도 2의 d 및 e에서 볼 수 있듯이 파골세포 분화 중(48시간 처리) 단백질 메틸화 수준은 용량 의존적으로 증가했으며, 이는 CD-I-448 및 CD-I-478 처리가 파골세포 분화를 억제하고 LSD1 효소 활성을 감소시켜 파골세포 형성 중 메틸화를 증가시켰음을 확인할 수 있다. 마지막으로, 골 형성 분석도 수행되었으며, 결과는 CD-I-448이 in vitro에서 2μM 처리에서 골 형성에 대한 유의한 억제를 나타내지 않았기 때문에 리드 화합물로 선택될 수 있었다(도 2의 f 및 g). 그러나 고용량(2 μM 이상)으로 처리했을 때 골 형성이 감소했다. 이를 통해 [화학식 1] 화합물이 파골세포 형성을 억제함을 확인하였다.
2.2. [화학식 1] 화합물에 해당하는 CD-I-448의 RANKL에 의해 유도된 파골세포 분화, F-액틴 벨트 형성 및 골 흡수 억제 효과(in vitro)
파골세포 형성에 대한 CD-I-448의 억제 효과를 추가로 조사하기 위해 TRAP 염색(파골세포의 특정 특성) 분석을 채택하여 표시된 농도 범위에서 RANKL에 의해 유도된 파골세포 형성에 대한 CD-I-448의 억제 효과를 확인했다(도 3의 a 내지 d). 도 3의 a 내지 h에 나타낸 바와 같이, BMDM의 분화는 CD-I-448에 의해 상당히 억제됐다. 또한, 로다민 표지 팔로이딘(rhodamine-labeled phalloidin)은 성숙한 파골세포의 형성된 F-액틴 벨트를 표시하는 데 사용되는데, 도 4의 a 및 b에서 볼 수 있듯이 대조군(CTRL) 그룹은 고리가 잘 형성된 반면 CD-I-448은 1μM의 CD-I-448에서 F-액틴 고리 형성을 억제했다. 골 재흡수는 골 재형성 과정에서 파골세포의 중요한 기능이다. 따라서 CD-I-448의 파골세포 골흡수 억제능을 플루오레세인아민 표지 인산칼슘 플레이트(fluoresceinamine-labeled calcium phosphate plate)를 이용하여 골흡수 분석법을 수행했다(in vitro). 도 3의 e 내지 g에 나타낸 바와 같이, M-CSF 및 RANKL로 처리된 그룹(MR 그룹)에서 명백한 골 흡수 구덩이가 나타났다; 흡수 피트 면적은 CD-I-448 처리(1, 2, 4 μM)로 현저하게 감소했다. 또한, 도 3의 f 및 g는 CD-I-448이 용량 의존적 방식으로 형광 강도 및 피트 영역 형성을 감소시켰음을 확인했다(GSK-LSD1(G)는 대조군 억제제로 사용됐다). 또한, CD-I-478은 시험관 내에서 파골세포 골 흡수를 크게 억제했다(도 5의 a 및 b). 마지막으로, CD-I-448은 적어도 10 μM 미만의 BMDM의 세포 생존율에 유의한 영향을 미치지 않은 반면, 4 μM에서 처리할 때 다핵 성숙 파골세포의 형성을 완전히 차단했다(도 3의 a 및 b). 이는 CD-I-448이 용량 의존적으로 RANKL 매개 파골세포 형성을 억제함을 나타낸다. 이러한 결과들을 바탕으로 CD-I-448이 파골세포의 형성을 감소시킴으로써 RANKL 매개 파골세포 분화 및 파골세포 관련 골흡수 활성을 유의하게 억제할 수 있음을 확인했다. 즉, [화학식 1] 화합물은 RANKL에 의해 유도된 파골세포 분화, F-액틴 벨트 형성 및 골 흡수를 억제함을 확인하였다.
2.3. [화학식 1] 화합물에 해당하는 CD-I-448 처리 후 OVX-유도 파골세포에 의한 골 손실의 억제 효과(In vivo).
파골세포 골 흡수 질환에 대한 CD-I-448의 전략 치료를 확인하기 위해 OVX 유도 골다공증 마우스 모델(도 6의 a 내지 c)을 확립했다(in vivo). 각 그룹의 마우스 체중을 매주 기록했다(도 6의 d). 대퇴골의 관심 부위에 대한 마이크로 컴퓨터 단층촬영(micro-CT) 분석 결과, OVX 마우스는 섬유주 골량(trabecular bone mass)을 광범위하게 상실한 반면, CD-I-448 처리군에서는 도 6의 a 내지 c에서와 같이 유의하게 감소한 것으로 나타났다. 또한 5 mg/kg 또는 10 mg/kg 처리에서 섬유주 부피, 골 표면 밀도 및 총 골 부피는 OVX 군에 비해 CD-I-448 처리 후 더 강한 회복을 확인했다(도 6의 a 내지 c). TRAP 또는 H&E 염색을 사용한 조직학적 분석(도 6의 e 및 f)은 파골세포에 의한 골 손실이 OVX 후 크게 증가한 반면 5mg/kg 또는 10mg/kg 처리 후 감소했음을 보여줬다. 이러한 결과는 GSK-LSD1과 달리 CD-I-448이 생체 내에서 OVX에 의한 골 손실을 방지했음을 확인했다. 즉, [화학식 1] 화합물이 OVX-유도 파골세포에 의한 골 손실을 억제함을 확인하였다.
2.4. TCP-(MP)-Caffeic acid 유사체의 LSD1 탈메틸화 효소 활성감소 효과
현재 데이터로 TCP-(MP)-Caffeic acid 유사체인 CD-I-448 및 CD-I-478은 LSD1의 탈메틸화를 용량 의존적으로 억제함을 확인했다(in vitro, ex in vivo). 또한 CoREST(RCOR1)은 LSD1이 탈메틸화 활동을 수행하는 데 중요했다. TCP-(MP)-Caffeic acid 유사체가 FAD 관련 LSD1/CoREST 복합체를 통해 LSD1 탈메틸화 효소 활성을 억제하는지 확인하기 위해, LSD1/CoREST 복합체 단백질을 준비하고(도 7 및 표 2) LSD1/CoREST 복합체를 포함하는 TCP-(MP)-Caffeic acid analogs(CD-I-448 및 CD-I-478)의 SPR 및 DSF 분석을 수행했다(도 8의 a 및 b, 도 9의 a 내지 f).
| 데이터값 | LSD1/CoREST/CD-1-478 |
| 공간그룹(Space group) | I222 |
| 단위 셀 치수(Unit cell dimensions) a, b, c (Å), α, β, γ (°) |
120.3, 181.3, 235.9 90, 90, 90 |
| 파장(Wavelength) (Å) | 0.97930 |
| 분해능(Resolution) (Å) | 50-3.0 (3.05-3.0) |
| Rpim (%) | 8.4 (131.9) |
| I/σ(I) | 3.9 (0.44) |
| 완성도(Completeness) (%) | 98.6 (99.2) |
| 중복성(Redundancy) | 6.1 (5.0) |
| 정제(Refinement) | |
| 분해능(Resolution) (Å) | 50-3.0 (3.07-3.0) |
| 반사 횟수(No. of reflections) | 50543 |
| Rwork / Rfree (%) | 20.3 (41.7) / 22.4 (41.3) |
| 원사 번호(No. atoms) 단백질/비단백질 |
6287 / 62 |
| RMSD 결합길이 (Å) / 각도 (°) |
0.003 / 0.593 |
| 평균 B-벨류(Average B-value) (Å2) | 100.4 |
| 라마찬드란 플롯(Ramachandran plot) (%) 선호(favored)/허용(allowed)/특이(outliers) |
96.6 / 3.3 / 0.1 |
| (괄호 안의 값은 가장 높은 해상도의 셸(shell)에 대한 값이다. 무작위로 선택된 리플렉션의 4%가 Rfree 값 계산에 사용됐다.) | |
도 8의 a 및 b에 나타낸 바와 같이, 결과는 CD-I-448 및 CD-I-478 모두가 LSD1/CoREST 복합체에 직접적으로 결합함을 확인했다. 또한 CD-I-448이 곧 CD-I-478로 변환되어 기능할 것이라는 사실을 발견했기 때문에(도 10의 a 내지 d), CD-I-478를 선택하여 LSD1/CoREST를 사용한 등온 열량 적정 분석(ICT) 및 결정 구조 분석을 했다(도 8의 c 내지 f). 20℃에서 50μM LSD1-CoREST와 500μM CD-I-478의 ICT 곡선은 도 8의 c와 같다. 위쪽 패널에는 원시 ITC 데이터가 표시된다. 하단 패널은 LSD1/CoREST에 대한 CD-I-478의 주입에 대해 플롯된 백그라운드에 대해 보정된 주입당 통합 열(실선 원)을 나타낸다. 실선은 화학량론 1.1, 몰 엔탈피 변화(ΔH) -20.44 kJmol-1, 결합 친화도(Kd) 2.331×10-7 M을 산출한 단일 부위 독립 결합 모델에 대한 적합도이다(도 8의 c). 결정 구조 분석을 위해, CD-I-478을 함유한 LSD1/CoREST의 복합 결정 구조는 아포-결정(apo-crystals)을 CD-I-478이 보충된 저장 용액에 담가서 결정했다. 밝혀진 구조는 플라빈 아데닌 디뉴클레오타이드의 플라빈 고리(flavin ring of flavin adenine dinucleotide)에 연속적이지만 CD-I-478의 전체 화학물질을 허용하지 않는 부가물을 보여준다(도 8의 d). 대신, 부가물은 CD-I-478의 일부인 페닐 고리보다 약간 더 큰 부분이 될 수 있다. 정제된 구조에서는 전체 화학물질에 대해 여분의 부피가 큰 전자 밀도가 관찰되지 않기 때문에 억제제의 고활성 사이클로프로필 고리가 열려 FAD의 플라빈 고리 원자와 함께 여분의 오원자 고리(five-membered ring)를 형성한 것으로 보인다. 이러한 종류의 플라빈 고리의 N5 원자와의 공유 결합 형성은 여러 LSD1 억제제에서 보고됐다(도 8의 e).
2.5. [화학식 1] 화합물에 해당하는 CD-I-448의 파골세포 분화 관련 유전자 및 단백질 발현 억제효과
위의 데이터는 CD-I-448이 파골세포 분화 및 골 흡수를 차단했음을 나타내고, CD-I-448은 LSD1/CoREST 복합체와 상호작용하며 시험관 내에서 LSD1 탈메틸화 활성을 감소시켰음을 나타낸다. 따라서 CD-I-448이 파골세포의 형성과 기능을 억제하는 기작을 이해하기 위해 파골세포의 형성과 분화에 필요한 파골세포 특이 유전자와 단백질의 발현을 분석했다. 도 11의 a 내지 f에 나타낸 바와 같이, M-CSF 및 RANKL(Con)을 사용한 자극은 지시된 파골세포 특이적 유전자(검은색 막대)의 전사를 현저하게 유도한 반면, CD-I-448 처리는 Acp5, Nfatc1, Dc-stamp, Atp6v0d2, Mmp9 및 Ctsk(회색 막대)를 포함하여 RANKL에 의해 유도된 파골세포 형성 관련 유전자의 상대적인 mRNA 발현 수준을 분명히 감소시켰다. RANKL-유도 파골세포 단백질의 웨스턴 블로팅 분석은 NFATc1, c-fos 및 주요 재흡수 프로테아제 CtsK의 단백질 수준이 M-CSF 및 RANKL(Con) 그룹과 비교할 때 CD-I-448과 함께 배양한 후 감소했음을 확인할 수 있었다(도 11의 g). 종합적으로, 이러한 결과는 CD-I-448이 RANKL 매개 파골세포 분화 요청 유전자 및 단백질 발현을 차단함으로써 파골세포 분화를 억제함을 나타낸다.
2.6. [화학식 1] 화합물에 해당하는 CD-I-448의 CBL 단백질 안정화 효과.
CD-I-448이 파골세포 생성을 억제(in vitro)하고 파골세포 골 손실을 억제(in vivo)함을 확인했다(도 3의 a 내지 h, 도 4의 a 및 b) ). 또한 CD-I-448은 파골세포 형성 동안 탈메틸화 활성을 감소시키기 위해 LSD1/CoREST 복합체를 직접 표적으로 삼았다(도 8의 a 내지 f, 도 2의 c 및 d). CD-I-448에 의한 LSD1 탈메틸화 활성의 억제가 파골세포 형성을 차단하는 기전을 조사하기 위해 파골세포 요청 유전자 및 단백질의 발현을 분석했다. NFATc1의 mRNA 발현이 CD-I-448 처리 후 4일 동안 약간 감소했음을 발견했다(도 11의 b). 그러나 극적으로 감소된 NFATc1 단백질은 2일과 4일 동안 나타났다(도 11의 g). 이 발견을 통해 CD-I-448이 NFATc1 분해 조절에 관여하는지 분석할 수 있었다. 결과는 CD-I-448 처리 후 NFATc1의 발현이 상당히 감소한 반면, MG132(10uM) 처리 6시간 후 급격히 축적되는 것을 확인했다. 따라서 CD-I-448 처리 유무에 따른 파골세포 형성 과정 중 CBL 단백질의 발현을 분석하였고, 일치하는 CtsK 발현을 통해 CD-I-448 처리 후 파골세포 분화가 억제됨을 확인했다(도 12의 b). RANKL 처리가 CBL 단백질 발현을 크게 유도하는 반면 파골세포 분화 후 단백질 수준이 감소하는 결과를 확인했다. 그러나 CD-I-448 처리 후, 파골세포 분화 후 CBL 단백질의 감소율은 분명히 지연되었는데, 이는 CD-I-448 매개 파골세포형성 억제가 대조군(Con 그룹)과 비교하여 NFATc1 단백질 분해의 증가와 일치하는 CBL 단백질의 지연된 감소로 인한 것일 수 있음을 확인했다.
CD-I-448 처리 후 파골세포 형성 동안 CBL 단백질의 지연된 감소가 CBL 라이신 메틸화의 증가에 의해 매개되는지 조사하기 위해, 파골세포 형성 동안 단백질의 모든 메틸 라이신을 분석했다. 도 12의 b에 나타낸 바와 같이, 메틸 라이신 수준은 CD-I-448 처리 후에 분명히 증가했다. 한편, p-LSD1 발현은 변화되지 않았으며, 심지어 약간의 증가를 보였다(유의하지는 않았다). TCP-(MP)-Caffeic acid 유사체 처리에 의한 LSD1 탈메틸화 활성의 억제가 CBL 단백질을 안정화시키기 위해 CBL 단백질 라이신 메틸화를 매개하는지 추가로 확인하기 위해 CO-IP 분석을 수행했다. 도 12의 c에 도시된 바와 같이, 파골세포 형성 과정에서 CD-I-448 처리 후 CBL의 라이신 메틸화는 대조군(Con 그룹)에 비해 TCP-(MP)-Caffeic acid 유사체 처리 후 증가했으며, 대조군으로 GSK-LSD1을 사용했다(대중적으로 사용되는 LSD1 억제제). 또한, p-LSD1과 CBL 간의 상호 작용이 감소했다(convert CO-IP 분석은 도 13의 a 및 b에 표시됨). 또한, CBL과 NFATc1 단백질의 상호작용은 TCP-(MP)-Caffeic acid 유사체의 처리에 따라 증가했다. 투입된 CBL 단백질과의 관계에서, TCP-(MP)-Caffeic acid 유사체 처리 후 p-LSD1과 CBL 사이의 상호작용만 방해받았다는 것을 확인할 수 있었는데, 이는 CD-I-448 처리가 p-LSD1과 CBL 단백질 사이의 상호작용을 방해하여 CBL 단백질의 라이신 메틸화를 증가시켜 CBL 단백질을 안정화시키고, 이후 증가된 CBL 단백질은 NFATc1 단백질의 분해를 증가시켜 파골세포 생성 억제에 기여했음을 의미했다.
2.7. [화학식 1] 화합물에 해당하는 CD-I-448의 NFATc1 단백질의 라이신 48 유비퀴틴화 유도 및 이를 통한 파골세포 형성 억제 효과
CBL 단백질은 라이신 48 연결 유비퀴틴화를 통해 단백질 분해를 매개하는 E3 리가아제이다. 따라서 CD-I-448 처리 유무에 따라 NFATc1의 라이신 48 연결 유비퀴틴화 단백질 수준을 분석했다(도 12의 d). GSK-LSD1은 LSD1 억제를 위한 대조군 억제제로 사용했다.
그 결과 TCP-(MP)-Caffeic acid 유사체 처리 후 NFATc1의 라이신 48 유비퀴틴화가 대조군(Con 그룹)에 비해 유의미하게 증가했으며, 이를 통해 CD-I-448이 라이신 48 유비퀴틴화를 매개로 NFATc1 단백질의 분해를 증가시킴으로써 RANKL에 의한 파골세포 생성이 억제됨을 확인하였다.
Claims (4)
- 청구항 2에 있어서, 상기 골질환은 골절, 골다공증, 류마티스성 관절염, 치주염, 파제트병, 골연화증, 골감소증, 골위축, 골관절염 및 무혈성대퇴골괴사로 이루어진 군에서 선택되는 어느 하나인, 골질환 예방 또는 치료용 약학 조성물.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2023-0104186 | 2023-08-09 | ||
| KR1020230104186A KR102960952B1 (ko) | 2023-08-09 | 골질환 예방 또는 치료용 약학 조성물 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2025033596A1 true WO2025033596A1 (ko) | 2025-02-13 |
Family
ID=94534607
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2023/014722 Pending WO2025033596A1 (ko) | 2023-08-09 | 2023-09-26 | 골질환 예방 또는 치료용 약학 조성물 |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2025033596A1 (ko) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20180051523A (ko) * | 2015-08-12 | 2018-05-16 | 인사이트 코포레이션 | Lsd1 저해제의 염 |
| WO2018091691A1 (en) * | 2016-11-17 | 2018-05-24 | Cytoo | Lsd1 inhibitors as skeletal muscle hypertrophy inducers |
| KR20180117602A (ko) * | 2015-12-29 | 2018-10-29 | 미라티 테라퓨틱스, 인크. | Lsd1 억제제 |
| KR20180134675A (ko) * | 2017-06-09 | 2018-12-19 | 한미약품 주식회사 | 시클로프로필아민 유도체 화합물 및 이의 용도 |
-
2023
- 2023-09-26 WO PCT/KR2023/014722 patent/WO2025033596A1/ko active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20180051523A (ko) * | 2015-08-12 | 2018-05-16 | 인사이트 코포레이션 | Lsd1 저해제의 염 |
| KR20180117602A (ko) * | 2015-12-29 | 2018-10-29 | 미라티 테라퓨틱스, 인크. | Lsd1 억제제 |
| WO2018091691A1 (en) * | 2016-11-17 | 2018-05-24 | Cytoo | Lsd1 inhibitors as skeletal muscle hypertrophy inducers |
| KR20180134675A (ko) * | 2017-06-09 | 2018-12-19 | 한미약품 주식회사 | 시클로프로필아민 유도체 화합물 및 이의 용도 |
Non-Patent Citations (1)
| Title |
|---|
| DING MINA, CHEN ZHIHAO, CHO EUNJIN, PARK SANG-WOOK, LEE TAE-HOON: "Crucial Role of Lysine-Specific Histone Demethylase 1 in RANKL-Mediated Osteoclast Differentiation", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 24, no. 4, CH, pages 3605 - 3605-16, XP093275524, ISSN: 1422-0067, DOI: 10.3390/ijms24043605 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20250024570A (ko) | 2025-02-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115175900B (zh) | Sarm1的抑制剂 | |
| CN113501821B (zh) | 具有mgat-2抑制活性的稠合环衍生物 | |
| CN111868055B (zh) | Trpc6的抑制剂 | |
| WO2011111880A1 (ko) | 세포핵에서 세포질로의 gsk3의 이동을 억제하는 화합물을 함유하는 세포핵에서 세포질로의 gsk3 이동에 의해 발생되는 질환의 치료 또는 예방용 약학적 조성물 | |
| WO2010104306A2 (ko) | 세포핵에서 세포질로의 gsk3의 이동을 억제하는 화합물을 함유하는 세포핵에서 세포질로의 gsk3 이동에 의해 발생되는 질환의 치료 또는 예방용 약학적 조성물 | |
| RU2736208C2 (ru) | Гризеофульвиновое соединение | |
| HUP0202049A2 (hu) | Egyebek mellett osteoporosis kezelésére alkalmazható indolszármazékok | |
| WO2017147312A1 (en) | Combination therapies for treatment of spinal muscular atrophy | |
| WO2021230600A1 (ko) | 대사항암제를 포함하는 항암용 조성물 | |
| JP2017515900A (ja) | ナフタキノンメチルトランスフェラーゼ阻害剤およびそれらの使用 | |
| WO2025033596A1 (ko) | 골질환 예방 또는 치료용 약학 조성물 | |
| WO2020141828A2 (en) | Anticancer compositions comprising immune checkpoint inhibitors | |
| WO2023163539A1 (ko) | 신규한 포말리도마이드 유도체의 뇌질환 치료 용도 | |
| KR20250117710A (ko) | 알도스테론증의 치료에 사용되는 r-파드로졸 | |
| WO2022234447A1 (en) | Nlrp3 inflammasome-inhibiting compounds and the use thereof | |
| EA018024B1 (ru) | Фенантреноновые соединения, композиции и способы | |
| WO2024063537A1 (en) | Pharmaceutical composition comprising sacubitril valsartan calcium salt | |
| WO2021054510A1 (ko) | 셀레노사마필린 a를 유효성분으로 포함하는 유방암 예방 및 치료용 조성물 | |
| WO2024101763A1 (ko) | 아릴시클로알킬아마이드 구조를 갖는 이소인돌리논 유도체 및 이의 용도 | |
| WO2024191252A1 (ko) | 골수에 작용하는 5-아자-4'-티오-2'-데옥시사이티딘의 최고 혈중농도를 정교하게 제어가능한 경구용 제형 | |
| WO2021091358A1 (en) | Prostaglandin analogs and uses thereof | |
| WO2024128359A1 (ko) | 골질환의 예방 또는 치료용 약학 조성물 | |
| WO2024128802A1 (ko) | 간과 신장의 염증 및 섬유화 치료 효과가 있는 신규 트리아진 유도체 및 이의 제조방법 | |
| WO2024101764A1 (ko) | 퀴놀린 아마이드 구조를 갖는 이소인돌리논 유도체 및 이의 용도 | |
| WO2024054097A1 (ko) | 이나보글리플로진의 대사체를 포함하는 약학적 조성물 및 이의 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23948589 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |




















