WO2025024573A1

WO2025024573A1 - Ccr4-not binding rna degraders

Info

Publication number: WO2025024573A1
Application number: PCT/US2024/039375
Authority: WO
Inventors: Robin Prince; Wilnelly Martinez ORTIZ; Elias NDARU; Lee Roberts
Original assignee: Arrakis Therapeutics, Inc.
Priority date: 2023-07-24
Filing date: 2024-07-24
Publication date: 2025-01-30
Also published as: WO2025024573A9

Abstract

The present invention includes compounds and compositions, and methods of use thereof for modulating an RNA transcript, or a precursor, isoform, fragment, or mutant thereof by degradation of the RNA transcript via recruitment or binding of one or more decay factors (e.g., an RNA binding protein).

Description

CCR4-NOT BINDING RNA DEGRADERS CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application Nos.63/515,259, filed July 24, 2023; 63/589,853, filed October 12, 2023; and 63/655,954, filed June 4, 2024; the entirety of each of which is hereby incorporated by reference. TECHNICAL FIELD OF THE INVENTION [0002] The present invention relates to compounds and methods of use thereof for modulating the activity of RNA transcripts, as well as isoforms, mutants, and fragments thereof, via modulating their degradation and/or otherwise modulating their activity. The invention also provides methods of treating various diseases and conditions mediated by a target RNA transcript, such as those described herein. BACKGROUND OF THE INVENTION [0003] RNA, both coding and messenger RNA (mRNA), as well as non-coding RNA (ncRNA), play a multitude of critical regulatory roles in the cell. The total of all RNAs transcribed from DNA – both coding and non-coding – comprise the transcriptome and all cellular biology flows from the transcriptome. All endogenous mammalian diseases are ultimately derived from or modulated by the transcriptome, either directly by RNA or through expressed proteins. Thus, there is the potential to intervene in all human diseases that are protein-mediated or RNA-mediated by modulating the translation or regulatory function of the corresponding mRNAs or ncRNAs. [0004] RNA quality control (QC) mechanisms are varied and ubiquitous. After transcription, RNAs must undergo processing to produce their active forms. RNA processing includes a variety of endo- and exonucleolytic cleavage of sequences at either end of the initial transcript, cleavage of internal sequences (e.g., internal transcribed spacers and introns), nucleotide editing, and various types of functionalization via chemical modification. Notably, most cellular RNAs undergo multiple processing reactions, with alternate pathways (e.g., alternative splicing) leading to distinct products. Multiple RNAs from otherwise similar or identical RNA primary transcripts result in an increase in the functional diversity of RNA and protein species encoded by individual genes. [0005] mRNA decay is the process that causes programmed nucleolytic degradation of the mRNA. The process is enabled by the association of mRNAs with specific RNA-binding proteins (RBPs). Thus, mRNA decay has the potential to directly influence the steady state levels of a translatable pool of mRNAs in vivo. Eukaryotic mRNA decay occurs primarily by enzymatic removal of nucleotides in the 5 '-3 ' direction and is catalyzed by Xrn1. mRNAs are also degraded in the 3 '-5 ' direction by the multi-subunit protein complex called the exosome, the catalytic subunit of which is Rrp44. The contribution of 3 '-5 ' decay to global mRNA turnover is higher in metazoans as compared to lower eukaryotes. [0006] RNA QC mechanisms normally operate to eliminate incorrectly or incompletely processed RNAs. However, if the normal activity of these nucleases and QC pathways could be harnessed to selectively degrade (or not degrade) a disease-causing (or disease-treating) RNA target, it would lead to novel and indeed transformative modes of treating a variety of diseases. [0007] Thus, there is a broad need for agents that selectively inhibit or eradicate target RNAs. The present invention achieves this using bifunctional or chimeric molecules and compositions that both (i) bind to target RNA transcripts and (ii) recruit decay factors, such as RNA-binding proteins (RBPs), that activate an RNA degradation mechanism to degrade the target RNAs or otherwise abrogate the function of the target RNAs (e.g., the availability of the RNA for translation into an active protein). The compounds of this invention and pharmaceutically acceptable compositions thereof meet these requirements and provide other related benefits, as described herein. SUMMARY OF THE INVENTION [0008] In one aspect, the present invention provides a compound of Formula A:

A or a pharmaceutically acceptable salt thereof, wherein: RNA Binder is a moiety that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. [0009] In some embodiments, the RNA Binder is an oligonucleotide, a polypeptide or an RNA-binding small molecule (rSM). In some embodiments, the RNA Binder is an oligonucleotide. In some embodiments, the RNA Binder is an rSM. [0010] In some embodiments, the present invention provides a compound of Formula A wherein a second instance of RNA binder or DFL is attached to the compound of Formula A by a single or double covalent bond to L¹, wherein L¹ is trivalent. [0011] In one aspect, the present invention provides a compound of Formula B:

or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and L¹ is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. [0012] In some embodiments, the present invention provides a compound of Formula B wherein a second instance of rSM or DFL is attached to the compound of Formula B by a single or double covalent bond to L¹, wherein L¹ is trivalent. [0013] In some embodiments,

is a compound of Formula I:

or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O- -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3.

[0018] In some embodiments, R⁴ is selected from

, , , ,

. [0019] In some embodiments, ring A is phenyl. [0020] In some embodiments, R^A is F. [0021] In some embodiments, R^B is selected from F, Br, Me, Et, -OMe,

. [0022] In some embodiments, R^C is selected from F, and Me. [0023] In some embodiments,

is a compound of Formula Ia:

Ia or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O- -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3.

[0029] In some embodiments, Ring A is phenyl. [0030] In some embodiments, R^A is F. [0031] In some embodiments, R^B is selected from F, Br, Me, Et, -OMe,

. [0032] In some embodiments, R^C is selected from F and Me. [0033] In some embodiments,

is a compound of Formula Ib:

Ib or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from C_1-6 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, C_1-6 aliphatic optionally substituted with a phenyl, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8- 10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, an 8-14 membered tricyclic carbocyclic ring, a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; -L¹- is a covalent bond, a bivalent or trivalent C_1-28 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, - C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶, R⁷, R⁸ and R⁹ are each independently hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)OR, -OC(O)R, -C(O)N(R)₂, -OC(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, - S(O)R, -S(O)₂R, or -N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; s is 0, 1, 2, or 3; t is 0, 1, 2, or 3; u is 0, 1, 2, or 3; and is a single or a double bond.

. [0037] In some embodiments, -L¹- is selected from

,

[0038] In some embodiments, R⁴ is selected from

, ,

[0039] In some embodiments, Ring A is phenyl. [0040] In some embodiments, R^A is selected from F, CF₃ and Me. [0041] In some embodiments, R^B is selected from F, Br, Cl, OH, Me, Et, Bu, t-Bu, i-Bu, - OMe, Ph, -SO₂Me, -NHC(O)CH₃, -C(O)Ot-Bu, -OC(O)NMe₂, -C(O)NMe₂,

[0042] In some embodiments, R^C is selected from F, Cl, Me, -CF₃, -SO₂F and -OMe. [0043] In some embodiments, the compound,

, is of Formula II:

or a pharmaceutically acceptable salt thereof. [0044] In some embodiments, the compound is of Formula III:

or a pharmaceutically acceptable salt thereof. [0045] In some embodiments, the compound is of Formula IV:

or a pharmaceutically acceptable salt thereof. [0046] In some embodiments, the compound is of Formula V:

or a pharmaceutically acceptable salt thereof. [0047] In some embodiments, the compound is of Formula VI:

or a pharmaceutically acceptable salt thereof. [0048] In some embodiments, the compound is of Formula VII:

or a pharmaceutically acceptable salt thereof. [0049] In some embodiments, the compound is of Formula VIII:

VIII or a pharmaceutically acceptable salt thereof. [0050] In some embodiments, the compound is of Formula IXa, Formula IXb or Formula IXc:

IXc or a pharmaceutically acceptable salt thereof. [0051] In some embodiments, the decay factor is a protein that binds or interacts with RNA (an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the target RNA transcript in vivo. [0052] In some embodiments, the RBP is part of the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex. [0053] In some embodiments, the target RNA transcript is an mRNA or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. [0054] In some embodiments, the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. [0055] In some embodiments, the rSM is selected from any one of those described in the disclosure under the heading RNA-Binding Small Molecules (rSMs). [0056] In some embodiments, the rSM is one of those shown in Table 2. [0057] In some embodiments, the present invention provides a pharmaceutical composition comprising the compound described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. [0058] Another aspect of the present invention provides a method of modifying the amount of a protein in a cell, the method comprising administering the compound or composition described herein, or a pharmaceutically acceptable salt thereof, that acts on a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, in an amount sufficient to modify the amount of the protein in the cell. [0059] In some embodiments, modifying the amount of a protein in a cell is reducing the amount of protein in the cell. [0060] Another aspect of the present invention provides a method of modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition described herein, or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. [0061] Another aspect of the present invention provides a method of modulating the translation of a target protein or mutant thereof, comprising contacting a target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition described herein, or a pharmaceutically acceptable salt thereof. [0062] Another aspect of the present invention provides a method of decreasing the half-life or increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or the precursor, isoform, fragment, or mutant thereof with the compound or composition described herein, or a pharmaceutically acceptable salt thereof. [0063] Another aspect of the present invention provides a method of treating a disease, comprising administering to a subject in need thereof the compound or composition described herein, or a pharmaceutically acceptable salt thereof. [0064] In some embodiments, the disease is characterized by an aberrant level of a protein in a cell. [0065] In some embodiments, the disease is one of those listed in Table C or D. [0066] In some embodiments, the disease is a cancer. BRIEF DESCRIPTION OF THE DRAWINGS [0067] FIG. 1 shows a schematic of the CCR4-NOT complex, a major mediator of RNA deadenylation. [0068] FIG. 2 shows the structures of Compound I-306 and Compound I-305, which both consist of a CCR4-NOT binding moiety, a linker and an RNA binding moiety. [0069] FIG.3 shows that bifunctional compounds can accelerate the degradation of RNA, as shown in a biochemical assay. [0070] FIG. 4 shows that the non-conjugated RNA binding moiety and the non-conjugated CCR4-NOT binding moiety can outcompete the bifunctional molecule. [0071] FIG. 5 shows the ability of selected heterobifunctional compounds to accelerate deadenylation according to the assay described in examples 1 and 2. DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS 1. General Description of Certain Embodiments of the Invention; Definitions [0072] In one aspect, the present invention provides a bifunctional compound of Formula A:

A or a pharmaceutically acceptable salt thereof, wherein: RNA Binder is a moiety that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. [0073] In some embodiments, the RNA binder is an oligonucleotide, peptide, oligosaccharide or an RNA-binding small molecule (rSM). In some embodiments, the RNA binder is an oligonucleotide. In some embodiments, the RNA binder is an rSM. In some embodiments, the DFL binds an RBP. In some embodiments, the present invention provides a bifunctional composition comprising an RNA binder and a DFL useful as a modulator of targeted degradation of a variety of target RNA transcripts, which are then degraded and/or otherwise inhibited by the bifunctional composition as described herein. An advantage of the composition provided herein is that a broad range of pharmacological activities is possible, consistent with the degradation/inhibition of a target RNA transcript from virtually any RNA class or family. [0074] In some embodiments, the composition includes an RNA binder, such as an oligonucleotide, and the composition binds the RNA through its oligonucleotide. Oligonucleotides that bind RNA are well known. Generally, the oligonucleotide that binds the target RNA will have a nucleic acid sequence that is complementary to a nucleic acid sequence in the target RNA. The binding of an oligonucleotide with a complimentary sequence to a target RNA sequence is stable and highly specific. In some embodiments, the composition including an RNA binder, such as an oligonucleotide, is optimized for intracellular delivery. Optimization of oligonucleotides and compositions comprising oligonucleotides for intracellular delivery is well established. [0075] In some embodiments, the composition comprises an RNA binder. In some embodiments, the RNA binder is an oligonucleotide. In some embodiments, the oligonucleotide can specifically bind an RNA target. In some embodiments, the oligonucleotide comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. In some embodiments, the oligonucleotide consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. In some embodiments, the oligonucleotide has been modified for therapeutic delivery. [0076] In some embodiments, the oligonucleotide is an antisense oligonucleotide (ASO). In some embodiments, the ASO is a therapeutic ASO. Non-limiting examples of therapeutic ASOs include Mipomersen, Custirsen, Fomivirsen, Oblimersen, Eteplirsen, Nusinersen, Inotersen, Givosiran, Golodirsen and Viltolarsen. [0077] In some embodiments, the DFL binds to or recruits CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex. In some embodiments, the DFL activates CCR4- NOT complex. In some embodiments, the DFL increases the activity of CCR4-NOT complex. In some embodiments, the DFL binds to or recruits one or more components of the CCR4-NOT complex, such as CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. In some embodiments, the DFL binds to or recruits CNOT1. In some embodiments, the DFL binds to or recruits CNOT2. In some embodiments, the DFL binds to or recruits CNOT3. In some embodiments, the DFL binds to or recruits CNOT6. In some embodiments, the DFL binds to or recruits CNOT6L. In some embodiments, the DFL binds to or recruits CNOT7. In some embodiments, the DFL binds to or recruits CNOT8. In some embodiments, the DFL binds to or recruits CNOT9. In some embodiments, the DFL binds to or recruits CNOT10. In some embodiments, the DFL binds to or recruits CNOT11. [0078] In one aspect, the present invention provides a bifunctional compound of Formula B:

or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. [0079] In some embodiments,

is a compound of Formula I:

or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O- -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3. [0080] As defined generally above, R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with q instances of R^A, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with q instances of R^A, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A. [0081] In some embodiments, R¹ is C_1-4 aliphatic group. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with 0 to 4 halogens. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with q instances of R^A. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with q instances of R^A. In some embodiments, R¹ is a 3-8 membered saturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [0082] In some embodiments, R¹ is selected from

, , , , ,

[0083] In some embodiments, R¹ is selected from those depicted in Table 1, below. [0084] As defined generally above, R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B. [0085] In some embodiments, R² is a phenyl group. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a phenyl group substituted with r instances of R^B. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. In some embodiments, R² is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. [0086] In some embodiments, R² is selected from

, , , , ,

[0087] In some embodiments, R² is selected from those depicted in Table 1, below. [0088] As defined generally above, R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [0089] In some embodiments, R³ is a covalent bond. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-.

. [0091] As defined generally above, -L¹- is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [0092] In some embodiments, -L¹- is a covalent bond. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-. [0093] In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C_2- ₁₈, C_2-16, C_2-14, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-14, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-18, C_4- 16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-8, C_1-4, C_1-2, C_2-18, C_2-16, C_2-14, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-16, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-18, C4_-16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [0094] In some embodiments, one methylene unit of -L¹- is replaced with -CH₂CH₂O-. In some embodiments, two methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, three methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, four, five, six, seven, eight, nine, or ten methylene units of -L¹- are replaced with -CH₂CH₂O-.

and

. [0098] In some embodiments, R³ is selected from those depicted in Table 1, below. [0099] As defined generally above, R⁴ is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C. [00100] In some embodiments, R⁴ is a phenyl group. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a phenyl group substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C.

[00102] In some embodiments, R⁴ is selected from those depicted in Table 1, below. [00103] As defined generally above, Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00104] In some embodiments, Ring A is a phenyl group. In some embodiments, Ring A is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, Ring A is a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, Ring A is an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00105] In some embodiments, Ring A is a phenyl. [00106] In some embodiments, Ring A is selected from those depicted in Table 1, below. [00107] As defined generally above, each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, - N(R)₂, -NO₂, -N₃, -SR, -S(O)R, -S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R. [00108] In some embodiments, R⁵ is R. In some embodiments, R⁵ is halogen. In some embodiments, R⁵ is -CN. In some embodiments, R⁵ is -NC. In some embodiments, R⁵ is -C(O)OR. In some embodiments, R⁵ is -OC(O)R. In some embodiments, R⁵ is -C(O)N(R)₂. In some embodiments, R⁵ is -N(R)C(O)R. In some embodiments, R⁵ is -N(R)C(O)N(R)₂. In some embodiments, R⁵ is -OC(O)N(R)₂. In some embodiments, R⁵ is -N(R)C(O)OR. In some embodiments, R⁵ is -OR. In some embodiments, R⁵ is -N(R)₂. In some embodiments, R⁵ is -NO₂. In some embodiments, R⁵ is -N₃. In some embodiments, R⁵ is -SR. In some embodiments, R⁵ is - S(O)R. In some embodiments, R⁵ is -S(O)₂R. In some embodiments, R⁵ is -S(O)₂N(R)₂. In some embodiments, R⁵ is -NRS(O)₂R. [00109] In some embodiments, R⁵ is hydrogen. In some embodiments, R⁵ is an optionally substituted C_1-6 aliphatic group. In some embodiments, R⁵ is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted phenyl. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00110] In some embodiments, R⁵ is selected from those depicted in Table 1, below. [00111] As defined generally above, R⁶ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁶ is hydrogen. In some embodiments, R⁶ is C_1-4 aliphatic group. [00112] In some embodiments, R⁶ is selected from those depicted in Table 1, below. [00113] As defined generally above, each R^A is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00114] In some embodiments, R^A is halogen. In some embodiments, R^A is R. In some embodiments, R^A is C_1-4 aliphatic group. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^A is -CN. In some embodiments, R^A is -NC. In some embodiments, R^A is -C(O)R. In some embodiments, R^A is - C(O)OR. In some embodiments, R^A is -OC(O)R. In some embodiments, R^A is -C(O)N(R)₂. In some embodiments, R^A is -N(R)₂C(O)R. In some embodiments, R^A is -OR. In some embodiments, R^A is -N(R)₂. In some embodiments, R^A is -NO₂. In some embodiments, R^A is -SR. In some embodiments, R^A is -S(O)R. In some embodiments, R^A is -S(O)₂R. In some embodiments, R^A is - N(R)SO₂R. [00115] In some embodiments, R^A is hydrogen. In some embodiments, R^A is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^A is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^A is an optionally substituted phenyl. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^A is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00116] In some embodiments, R^A is F. [00117] In some embodiments, R^A is selected from those depicted in Table 1, below. [00118] As defined generally above, each R^B is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00119] In some embodiments, R^B is halogen. In some embodiments, R^B is R. In some embodiments, R^B is C_1-4 aliphatic group. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^B is -CN. In some embodiments, R^B is -NC. In some embodiments, R^B is -C(O)R. In some embodiments, R^B is - C(O)OR. In some embodiments, R^B is -OC(O)R. In some embodiments, R^B is -C(O)N(R)₂. In some embodiments, R^B is -N(R)₂C(O)R. In some embodiments, R^B is -OR. In some embodiments, R^B is -N(R)₂. In some embodiments, R^B is -NO₂. In some embodiments, R^B is -SR. In some embodiments, R^B is -S(O)R. In some embodiments, R^B is -S(O)₂R. In some embodiments, R^B is - N(R)SO₂R. [00120] In some embodiments, R^B is hydrogen. In some embodiments, R^B is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^B is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^B is an optionally substituted phenyl. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^B is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. F [00121] In some embodiments, R^B is selected from F, Br, Me, Et, -OMe,

an . [00122] In some embodiments, R^B is selected from those depicted in Table 1, below. [00123] As defined generally above, each R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00124] In some embodiments, R^C is halogen. In some embodiments, R^C is R. In some embodiments, R^C is C_1-4 aliphatic group. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^C is -CN. In some embodiments, R^C is -NC. In some embodiments, R^C is -C(O)R. In some embodiments, R^C is - C(O)OR. In some embodiments, R^C is -OC(O)R. In some embodiments, R^C is -C(O)N(R)₂. In some embodiments, R^C is -N(R)₂C(O)R. In some embodiments, R^C is -OR. In some embodiments, R^C is -N(R)₂. In some embodiments, R^C is -NO₂. In some embodiments, R^C is -SR. In some embodiments, R^C is -S(O)R. In some embodiments, R^C is -S(O)₂R. In some embodiments, R^C is - N(R)SO₂R. [00125] In some embodiments, R^C is hydrogen. In some embodiments, R^C is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^C is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^C is an optionally substituted phenyl. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^C is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00126] In some embodiments, R^C is selected from F, and Me. [00127] In some embodiments, R^C is selected from those depicted in Table 1, below. [00128] As defined generally above, -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-. [00129] In some embodiments, -X- is a single covalent bond. In some embodiments, -X- is-O- . In some embodiments, -X- is -S-. In some embodiments, -X- is -S(O)-. In some embodiments, - X- is -S(O)₂-. In some embodiments, -X- is -N(R)-. [00130] In some embodiments, -X- is selected from those depicted in Table 1, below. [00131] As defined generally above, m is 0, 1, 2, 3, or 4. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 0, 1, 2, or 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00132] In some embodiments, m is selected from those depicted in Table 1, below. [00133] As defined generally above, n is 1, 2, or 3. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 1, or 2. [00134] In some embodiments, n is selected from those depicted in Table 1, below. [00135] As defined generally above, p is 1, 2, or 3. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 1, or 2. [00136] In some embodiments, p is selected from those depicted in Table 1, below. [00137] As defined generally above, q is 0, 1, 2, or 3. In some embodiments, q is 0. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00138] In some embodiments, q is selected from those depicted in Table 1, below. [00139] As defined generally above, r is 0, 1, 2, or 3. In some embodiments, r is 0. In some embodiments, r is 1. In some embodiments, r is 2. In some embodiments, r is 3. In some embodiments, r is 0, 1, or 2. In some embodiments, r is 1, 2, or 3. [00140] In some embodiments, r is selected from those depicted in Table 1, below. [00141] As defined generally above, s is 0, 1, 2, or 3. In some embodiments, s is 0. In some embodiments, s is 1. In some embodiments, s is 2. In some embodiments, s is 3. In some embodiments, s is 0, 1, or 2. In some embodiments, s is 1, 2, or 3. [00142] In some embodiments, s is selected from those depicted in Table 1, below. [00143] Exemplary compounds of the invention are set forth in Table 1 below. [00144] In some embodiments,

is a compound of Formula Ia:

or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O- -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3. [00145] As defined generally above, R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with q instances of R^A, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with q instances of R^A, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A. [00146] In some embodiments, R¹ is C_1-4 aliphatic group. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with 0 to 4 halogens. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with q instances of R^A. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with q instances of R^A. In some embodiments, R¹ is a 3-8 membered saturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00147] In some embodiments, R¹ is selected from

, , , , ,

[00148] In some embodiments, R¹ is selected from those depicted in Table 1, below. [00149] As defined generally above, R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B. [00150] In some embodiments, R² is a phenyl group. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a phenyl group substituted with r instances of R^B. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. In some embodiments, R² is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. [00151] In some embodiments, R² is selected from

, , , , ,

[00152] In some embodiments, R² is selected from those depicted in Table 1, below. [00153] As defined generally above, R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00154] In some embodiments, R³ is a covalent bond. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-.

. [00156] As defined generally above, -L¹- is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00157] In some embodiments, -L¹- is a covalent bond. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-. [00158] In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C₂- 18, C_2-16, C_2-16, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-16, C_3-12, C_3-10, C_3-8, C₃-6, C₃-4, C4_-18, C_4- ₁₆, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C_2-18, C_2-16, C_2-16, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-14, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-18, C_4-16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00159] In some embodiments, one methylene unit of -L¹- is replaced with -CH₂CH₂O-. In some embodiments, two methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, three methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, four, five, six, seven, eight, nine, or ten methylene units of -L¹- are replaced with -CH₂CH₂O-. [00160] In some embodiments, -

. [00161] In some embodiments,

. [00162] In some embodiments,

selected from

. [00163] In some embodiments, R³ is selected from those depicted in Table 1, below. [00164] As defined generally above, R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, -OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C. [00165] In some embodiments, R⁴ is a C_1-4 aliphatic group. In some embodiments, R⁴ is a substituted C_1-4 aliphatic group. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 halogen. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -OR. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -C(O)OR. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -N(R)₂. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -OC(O)R. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -C(O)N(R)₂. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 3-6 membered saturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 3-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 4-6 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 4-6 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 3-8 membered saturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 3-8 membered saturated monocyclic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. In some embodiments, R⁴ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. [00166] In some embodiments, R⁴ is a phenyl group. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a phenyl group substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C.

[00168] In some embodiments, R⁴ is selected from those depicted in Table 1, below. [00169] As defined generally above, Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00170] In some embodiments, Ring A is a phenyl group. In some embodiments, Ring A is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, Ring A is a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, Ring A is an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00171] In some embodiments, Ring A is a phenyl. [00172] In some embodiments, Ring A is selected from those depicted in Table 1, below. [00173] As defined generally above, each R⁵ is independently -R, halogen, -CN, -NC, - C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, - OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, -S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R. [00174] In some embodiments, R⁵ is R. In some embodiments, R⁵ is halogen. In some embodiments, R⁵ is -CN. In some embodiments, R⁵ is -NC. In some embodiments, R⁵ is -C(O)OR. In some embodiments, R⁵ is -OC(O)R. In some embodiments, R⁵ is -C(O)N(R)₂. In some embodiments, R⁵ is -N(R)C(O)R. In some embodiments, R⁵ is -N(R)C(O)N(R)₂. In some embodiments, R⁵ is -OC(O)N(R)_2. In some embodiments, R⁵ is -N(R)C(O)OR_. In some embodiments, R⁵ is -OR. In some embodiments, R⁵ is -N(R)₂. In some embodiments, R⁵ is -NO₂. In some embodiments, R⁵ is -N₃. In some embodiments, R⁵ is -SR. In some embodiments, R⁵ is - S(O)R. In some embodiments, R⁵ is -S(O)₂R. In some embodiments, R⁵ is -S(O)₂N(R)₂. In some embodiments, R⁵ is -NRS(O)₂R. [00175] In some embodiments, R⁵ is hydrogen. In some embodiments, R⁵ is an optionally substituted C_1-6 aliphatic group. In some embodiments, R⁵ is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted phenyl. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00176] In some embodiments, R⁵ is selected from those depicted in Table 1, below. [00177] As defined generally above, R⁶ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁶ is hydrogen. In some embodiments, R⁶ is C_1-4 aliphatic group. [00178] In some embodiments, R⁶ is selected from those depicted in Table 1, below. [00179] As defined generally above, each R^A is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00180] In some embodiments, R^A is halogen. In some embodiments, R^A is R. In some embodiments, R^A is C_1-4 aliphatic group. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^A is -CN. In some embodiments, R^A is -NC. In some embodiments, R^A is -C(O)R. In some embodiments, R^A is - C(O)OR. In some embodiments, R^A is -OC(O)R. In some embodiments, R^A is -C(O)N(R)₂. In some embodiments, R^A is -N(R)₂C(O)R. In some embodiments, R^A is -OR. In some embodiments, R^A is -N(R)₂. In some embodiments, R^A is -NO₂. In some embodiments, R^A is -SR. In some embodiments, R^A is -S(O)R. In some embodiments, R^A is -S(O)₂R. In some embodiments, R^A is - N(R)SO₂R. [00181] In some embodiments, R^A is hydrogen. In some embodiments, R^A is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^A is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^A is an optionally substituted phenyl. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^A is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00182] In some embodiments, R^A is F. [00183] In some embodiments, R^A is selected from those depicted in Table 1, below. [00184] As defined generally above, each R^B is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00185] In some embodiments, R^B is halogen. In some embodiments, R^B is R. In some embodiments, R^B is C_1-4 aliphatic group. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^B is -CN. In some embodiments, R^B is -NC. In some embodiments, R^B is -C(O)R. In some embodiments, R^B is - C(O)OR. In some embodiments, R^B is -OC(O)R. In some embodiments, R^B is -C(O)N(R)₂. In some embodiments, R^B is -N(R)₂C(O)R. In some embodiments, R^B is -OR. In some embodiments, R^B is -N(R)₂. In some embodiments, R^B is -NO₂. In some embodiments, R^B is -SR. In some embodiments, R^B is -S(O)R. In some embodiments, R^B is -S(O)₂R. In some embodiments, R^B is - N(R)SO₂R. [00186] In some embodiments, R^B is hydrogen. In some embodiments, R^B is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^B is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^B is an optionally substituted phenyl. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^B is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00187] In some embodiments, R^B is selected from F, Br, Me, Et, -OMe,

. [00188] In some embodiments, R^B is selected from those depicted in Table 1, below. [00189] As defined generally above, each R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00190] In some embodiments, R^C is halogen. In some embodiments, R^C is R. In some embodiments, R^C is C_1-4 aliphatic group. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^C is -CN. In some embodiments, R^C is -NC. In some embodiments, R^C is -C(O)R. In some embodiments, R^C is - C(O)OR. In some embodiments, R^C is -OC(O)R. In some embodiments, R^C is -C(O)N(R)₂. In some embodiments, R^C is -N(R)₂C(O)R. In some embodiments, R^C is -OR. In some embodiments, R^C is -N(R)₂. In some embodiments, R^C is -NO₂. In some embodiments, R^C is -SR. In some embodiments, R^C is -S(O)R. In some embodiments, R^C is -S(O)₂R. In some embodiments, R^C is - N(R)SO₂R. [00191] In some embodiments, R^C is hydrogen. In some embodiments, R^C is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^C is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^C is an optionally substituted phenyl. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^C is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00192] In some embodiments, R^C is selected from F, and Me. [00193] In some embodiments, R^C is selected from those depicted in Table 1, below. [00194] As defined generally above, -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-. [00195] In some embodiments, -X- is a single covalent bond. In some embodiments, -X- is-O- . In some embodiments, -X- is -S-. In some embodiments, -X- is -S(O)-. In some embodiments, - X- is -S(O)₂-. In some embodiments, -X- is -N(R)-. [00196] In some embodiments, -X- is selected from those depicted in Table 1, below. [00197] As defined generally above, m is 0, 1, 2, 3, or 4. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 0, 1, 2, or 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00198] In some embodiments, m is selected from those depicted in Table 1, below. [00199] As defined generally above, n is 1, 2, or 3. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 1, or 2. [00200] In some embodiments, n is selected from those depicted in Table 1, below. [00201] As defined generally above, p is 0, 1, 2, or 3. In some embodiments, p is 0. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 1, or 2. In some embodiments, p is 0, 1, or 2. In some embodiments, p is 1, 2, or 3. [00202] In some embodiments, p is selected from those depicted in Table 1, below. [00203] As defined generally above, q is 0, 1, 2, or 3. In some embodiments, q is 0. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00204] In some embodiments, q is selected from those depicted in Table 1, below. [00205] As defined generally above, r is 0, 1, 2, or 3. In some embodiments, r is 0. In some embodiments, r is 1. In some embodiments, r is 2. In some embodiments, r is 3. In some embodiments, r is 0, 1, or 2. In some embodiments, r is 1, 2, or 3. [00206] In some embodiments, r is selected from those depicted in Table 1, below. [00207] As defined generally above, s is 0, 1, 2, or 3. In some embodiments, s is 0. In some embodiments, s is 1. In some embodiments, s is 2. In some embodiments, s is 3. In some embodiments, s is 0, 1, or 2. In some embodiments, s is 1, 2, or 3. [00208] In some embodiments, s is selected from those depicted in Table 1, below. [00209] Exemplary compounds of the invention are set forth in Table 1 below. [00210] In some embodiments,

is a compound of Formula Ib:

Ib or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from C_1-6 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, C_1-6 aliphatic optionally substituted with a phenyl, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8- 10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, an 8-14 membered tricyclic carbocyclic ring, a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; -L¹- is a covalent bond, a bivalent or trivalent C_1-28 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, - C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶, R⁷, R⁸ and R⁹ are each independently hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)OR, -OC(O)R, -C(O)N(R)₂, -OC(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, - S(O)R, -S(O)₂R, or -N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; s is 0, 1, 2, or 3; t is 0, 1, 2, or 3; u is 0, 1, 2, or 3; and is a single or a double bond. [00211] As defined generally above, R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A. [00212] In some embodiments, R¹ is C_1-4 aliphatic group. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with 0 to 4 halogens. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with q instances of R^A. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with q instances of R^A. In some embodiments, R¹ is a 3-8 membered saturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R¹ is a 4-10 membered bicyclic carbocyclic ring. In some embodiments, R¹ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R¹ is a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00213] In some embodiments, R¹ is selected from

, , , , ,

[00214] In some embodiments, R¹ is selected from

, , , ,

. [00215] In some embodiments, R¹ is selected from those depicted in Table 1, below. [00216] As defined generally above, R² is selected from C_1-6 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, C_1-6 aliphatic optionally substituted with a phenyl, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, an 8-14 membered tricyclic carbocyclic ring, a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B. [00217] In some embodiments, R² is a C_1-6 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a C_1-6 aliphatic optionally substituted with a phenyl. In some embodiments, R² is a phenyl group. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R² is a 4-10 membered bicyclic carbocyclic ring. In some embodiments, R² is an 8-14 membered tricyclic carbocyclic ring. In some embodiments, R² is a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R² is a phenyl group substituted with r instances of R^B. In some embodiments, R² is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. In some embodiments, R² is an 8- 10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. In some embodiments, R² is a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is a 4-10 membered bicyclic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is an 8-14 membered tricyclic carbocyclic ring substituted with r instances of R^B. In some embodiments, R² is a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B. In some embodiments, R² is a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with r instances of R^B.

[00220] In some embodiments, R² is selected from those depicted in Table 1, below. [00221] As defined generally above, R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00222] In some embodiments, R³ is a covalent bond. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, R³ is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-.

. [00224] As defined generally above, -L¹- is a covalent bond, a bivalent or trivalent C_1-28 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, - OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, - C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00225] In some embodiments, -L¹- is a covalent bond. In some embodiments, -L¹- is a C_1-28 straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L¹- is a C_1-28 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00226] In some embodiments, -L¹- is a C_1-28, C_1-26, C_1-24, C_1-22, C_1-20, C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C_2-28, C_2-26, C_2-24, C₂-22, C_2-20, C_2-18, C_2-16, C_2-16, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-28, C_3-26, C_3-24, C_3-22, C_3-20, C_3-18, C_3-16, C_3-14, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-28, C_4-26, C_4-24, C_4-22, C_4-20, C4_-18, C4_-16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-28, C_5-26, C_5-24, C_5-22, C_5-20, C_5-18, C_5- ₁₆, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₂₈, C₂₇, C₂₆, C₂₅, C₂₄, C₂₃, C₂₂, C₂₁, C₂₀, C₁₉, C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-28, C_1-26, C_1-24, C_1-22, C_1-20, C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1- ₆, C_1-4, C_1-2, C_2-28, C_2-26, C_2-24, C_2-22, C_2-20, C_2-18, C_2-16, C_2-16, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-28, C_3- ₂₆, C_3-24, C_3-22, C_3-20, C_3-18, C_3-16, C_3-16, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-28, C_4-26, C_4-24, C_4-22, C_4-20, C_4-18, C_4-16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-28, C_5-26, C_5-24, C_5-22, C_5-20, C_5-18, C_5-16, C_5-14, C_5- ₁₂, C_5-10, C_5-8, C_5-6, or C₂₈, C₂₇, C₂₆, C₂₅, C₂₄, C₂₃, C₂₂, C₂₁, C₂₀, C₁₉, C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O- . [00227] In some embodiments, one methylene unit of -L¹- is replaced with -CH₂CH₂O-. In some embodiments, two methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, three methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, four, five, six, seven, eight, nine, or ten methylene units of -L¹ - are replaced with -CH₂CH₂O-. In some embodiments, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty one or twenty two methylene units of -L¹- are replaced with -CH₂CH₂O- [00228] In some embodiments, -

[00229] In some embodiments, L1 is selected from

, ,

. [00232] In some embodiments, R³ is selected from those depicted in Table 1, below. [00233] As defined generally above, R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, -OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C. [00234] In some embodiments, R⁴ is a C_1-4 aliphatic group. In some embodiments, R⁴ is a substituted C_1-4 aliphatic group. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 halogen. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -OR. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -C(O)OR. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -N(R)₂. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -OC(O)R. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with 1 -C(O)N(R)₂. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 3-6 membered saturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 3-6 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 4-6 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a C_1-4 aliphatic group substituted with a 4-6 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 3-8 membered saturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁴ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1- 2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a 3-8 membered saturated monocyclic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 3-8 membered partially unsaturated monocyclic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 4-8 membered saturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. In some embodiments, R⁴ is a 4-8 membered partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. [00235] In some embodiments, R⁴ is a phenyl group. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁴ is a phenyl group substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic aromatic carbocyclic ring substituted with s instances of R^C. In some embodiments, R⁴ is a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. In some embodiments, R⁴ is an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur substituted with s instances of R^C. [00236] In some embodiments, R⁴ is selected from

, , , ,

. [00237] In some embodiments, R⁴ is selected from

, , , , ,

[00238] In some embodiments, R⁴ is selected from those depicted in Table 1, below. [00239] As defined generally above, Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00240] In some embodiments, Ring A is a phenyl group. In some embodiments, Ring A is an 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, Ring A is a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, Ring A is an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00241] In some embodiments, Ring A is a phenyl. [00242] In some embodiments, Ring A is selected from those depicted in Table 1, below. [00243] As defined generally above, each R⁵ is independently -R, halogen, -CN, -NC, - C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, - OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, -S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R. [00244] In some embodiments, R⁵ is R. In some embodiments, R⁵ is halogen. In some embodiments, R⁵ is -CN. In some embodiments, R⁵ is -NC. In some embodiments, R⁵ is -C(O)OR. In some embodiments, R⁵ is -OC(O)R. In some embodiments, R⁵ is -C(O)N(R)₂. In some embodiments, R⁵ is -N(R)C(O)R. In some embodiments, R⁵ is -N(R)C(O)N(R)₂. In some embodiments, R⁵ is -OC(O)N(R)₂. In some embodiments, R⁵ is -N(R)C(O)OR. In some embodiments, R⁵ is -OR. In some embodiments, R⁵ is -N(R)₂. In some embodiments, R⁵ is -NO₂. In some embodiments, R⁵ is -N₃. In some embodiments, R⁵ is -SR. In some embodiments, R⁵ is - S(O)R. In some embodiments, R⁵ is -S(O)₂R. In some embodiments, R⁵ is -S(O)₂N(R)₂. In some embodiments, R⁵ is -NRS(O)₂R. [00245] In some embodiments, R⁵ is hydrogen. In some embodiments, R⁵ is an optionally substituted C_1-6 aliphatic group. In some embodiments, R⁵ is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted phenyl. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R⁵ is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R⁵ is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00246] In some embodiments, R⁵ is selected from those depicted in Table 1, below. [00247] As defined generally above, R⁶ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁶ is hydrogen. In some embodiments, R⁶ is C_1-4 aliphatic group. [00248] In some embodiments, R⁶ is selected from those depicted in Table 1, below. [00249] As defined generally above, R⁷ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁷ is hydrogen. In some embodiments, R⁷ is a methyl group. In some embodiments, R⁷ is C_1-4 aliphatic group. [00250] In some embodiments, R⁷ is selected from those depicted in Table 1, below. [00251] As defined generally above, R⁸ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁸ is hydrogen. In some embodiments, R⁷ is a methyl group. In some embodiments, R⁸ is C_1-4 aliphatic group. [00252] In some embodiments, R⁸ is selected from those depicted in Table 1, below. [00253] As defined generally above, R⁹ is hydrogen or a C_1-4 aliphatic group. In some embodiments, R⁹ is hydrogen. In some embodiments, R⁹ is a methyl group. In some embodiments, R⁹ is C_1-4 aliphatic group. [00254] In some embodiments, R⁹ is selected from those depicted in Table 1, below. [00255] As defined generally above, each R^A is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00256] In some embodiments, R^A is halogen. In some embodiments, R^A is R. In some embodiments, R^A is C_1-4 aliphatic group. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^A is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^A is -CN. In some embodiments, R^A is -NC. In some embodiments, R^A is -C(O)R. In some embodiments, R^A is - C(O)OR. In some embodiments, R^A is -OC(O)R. In some embodiments, R^A is -C(O)N(R)₂. In some embodiments, R^A is -N(R)₂C(O)R. In some embodiments, R^A is -OR. In some embodiments, R^A is -N(R)₂. In some embodiments, R^A is -NO₂. In some embodiments, R^A is -SR. In some embodiments, R^A is -S(O)R. In some embodiments, R^A is -S(O)₂R. In some embodiments, R^A is - N(R)SO₂R. [00257] In some embodiments, R^A is hydrogen. In some embodiments, R^A is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^A is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^A is an optionally substituted phenyl. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^A is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^A is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00258] In some embodiments, R^A is F. In some embodiments, R^A is -CF₃. In some embodiments, R^A is a methyl group. [00259] In some embodiments, R^A is selected from those depicted in Table 1, below. [00260] As defined generally above, each R^B is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00261] In some embodiments, R^B is halogen. In some embodiments, R^B is R. In some embodiments, R^B is C_1-4 aliphatic group. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^B is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^B is -CN. In some embodiments, R^B is -NC. In some embodiments, R^B is -C(O)R. In some embodiments, R^B is - C(O)OR. In some embodiments, R^B is -OC(O)R. In some embodiments, R^B is -C(O)N(R)₂. In some embodiments, R^B is -N(R)₂C(O)R. In some embodiments, R^B is -OR. In some embodiments, R^B is -N(R)₂. In some embodiments, R^B is -NO₂. In some embodiments, R^B is -SR. In some embodiments, R^B is -S(O)R. In some embodiments, R^B is -S(O)₂R. In some embodiments, R^B is - N(R)SO₂R. [00262] In some embodiments, R^B is hydrogen. In some embodiments, R^B is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^B is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^B is an optionally substituted phenyl. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^B is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^B is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00263] In some embodiments, R^B is selected from F, Br, Me, Et, -OMe,

. [00264] In some embodiments, R^B is selected from F, Br, Cl, OH, Me, Et, Bu, t-Bu, i-Bu, -

[00265] In some embodiments, R^B is selected from those depicted in Table 1, below. [00266] As defined generally above, each R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, - S(O)₂R, or -N(R)SO₂R. [00267] In some embodiments, R^C is halogen. In some embodiments, R^C is R. In some embodiments, R^C is C_1-4 aliphatic group. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1, 2, or 3 halogens. In some embodiments, R^C is C_1-4 aliphatic group substituted with 1 -CN, =O, -OR, -N(R)₂, or -SR group. In some embodiments, R^C is -CN. In some embodiments, R^C is -NC. In some embodiments, R^C is -C(O)R. In some embodiments, R^C is - C(O)OR. In some embodiments, R^C is -OC(O)R. In some embodiments, R^C is -C(O)N(R)₂. In some embodiments, R^C is -N(R)₂C(O)R. In some embodiments, R^C is -OR. In some embodiments, R^C is -N(R)₂. In some embodiments, R^C is -NO₂. In some embodiments, R^C is -SR. In some embodiments, R^C is -S(O)R. In some embodiments, R^C is -S(O)₂R. In some embodiments, R^C is - N(R)SO₂R. [00268] In some embodiments, R^C is hydrogen. In some embodiments, R^C is an optionally substituted C_1-6 aliphatic group. In some embodiments, R^C is an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring. In some embodiments, R^C is an optionally substituted phenyl. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic aromatic carbocyclic ring. In some embodiments, R^C is an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. In some embodiments, R^C is an optionally substituted 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00269] In some embodiments, R^C is selected from F, and Me. [00270] In some embodiments, R^C is selected from F, Cl, Me, -CF₃, -SO₂F and -OMe. [00271] In some embodiments, R^C is selected from those depicted in Table 1, below. [00272] As defined generally above, -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-. [00273] In some embodiments, -X- is a single covalent bond. In some embodiments, -X- is -O- . In some embodiments, -X- is -S-. In some embodiments, -X- is -S(O)-. In some embodiments, - X- is -S(O)₂-. In some embodiments, -X- is -N(R)-. [00274] In some embodiments, -X- is selected from those depicted in Table 1, below. [00275] As defined generally above, m is 0, 1, 2, 3, or 4. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 0, 1, 2, or 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00276] In some embodiments, m is selected from those depicted in Table 1, below. [00277] As defined generally above, n is 1, 2, or 3. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 1, or 2. [00278] In some embodiments, n is selected from those depicted in Table 1, below. [00279] As defined generally above, p is 0, 1, 2, or 3. In some embodiments, p is 0. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 1, or 2. In some embodiments, p is 0, 1, or 2. In some embodiments, p is 1, 2, or 3. [00280] In some embodiments, p is selected from those depicted in Table 1, below. [00281] As defined generally above, q is 0, 1, 2, or 3. In some embodiments, q is 0. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, m is 0, 1, or 2. In some embodiments, m is 1, 2, or 3. [00282] In some embodiments, q is selected from those depicted in Table 1, below. [00283] As defined generally above, r is 0, 1, 2, or 3. In some embodiments, r is 0. In some embodiments, r is 1. In some embodiments, r is 2. In some embodiments, r is 3. In some embodiments, r is 0, 1, or 2. In some embodiments, r is 1, 2, or 3. [00284] In some embodiments, r is selected from those depicted in Table 1, below. [00285] As defined generally above, s is 0, 1, 2, or 3. In some embodiments, s is 0. In some embodiments, s is 1. In some embodiments, s is 2. In some embodiments, s is 3. In some embodiments, s is 0, 1, or 2. In some embodiments, s is 1, 2, or 3. [00286] In some embodiments, s is selected from those depicted in Table 1, below. [00287] As defined generally above, t is 0, 1, 2, or 3. In some embodiments, t is 0. In some embodiments, t is 1. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 0, 1, or 2. In some embodiments, t is 1, 2, or 3. [00288] In some embodiments, t is selected from those depicted in Table 1, below. [00289] As defined generally above, u is 0, 1, 2, or 3. In some embodiments, u is 0. In some embodiments, u is 1. In some embodiments, u is 2. In some embodiments, u is 3. In some embodiments, u is 0, 1, or 2. In some embodiments, u is 1, 2, or 3. [00290] In some embodiments, u is selected from those depicted in Table 1, below. [00291] Exemplary compounds of the invention are set forth in Table 1 below. [00292] In some embodiments, the present invention provides a compound of Formula B, wherein

is a compound of Formula II:

or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², R³ and R⁴ are as defined above and described in embodiments herein, both singly and in combination. [00293] In some embodiments, the present invention provides a compound of Formula III:

III or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00294] In some embodiments, the present invention provides a compound of Formula IV:

IV or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00295] In some embodiments, the present invention provides a compound of Formula V:

V or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00296] In some embodiments, the present invention provides a compound of Formula VI:

VI or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00297] In some embodiments, the present invention provides a compound of Formula VII:

VII or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00298] In some embodiments, the present invention provides a compound of Formula VIII:

VIII or a pharmaceutically acceptable salt thereof, wherein: each of R¹, R², and R³ are as defined above and described in embodiments herein, both singly and in combination. [00299] In some embodiments, the present invention provides a compound of Formula IXa, Formula IXb or Formula IXc:

IXc or a pharmaceutically acceptable salt thereof, wherein: each of R² and R³ are as defined above and described in embodiments herein, both singly and in combination. Table 1. Exemplary Compounds

I-7

I-99

I-103

I-131

I-219

I-247

I-306

I-466

I-486

I-497

I-521

I-536

I-543

I-546

I-559

I-570

I-573

I-576

I-580

I-584

I-587

I-590

I-597 [00300] In some embodiments, the compound is selected from one of those shown in Table 1, above. In some embodiments, the compound is selected from one of those shown in Table 1, above, or a pharmaceutically acceptable salt thereof. Table 1A. Exemplary DFL

I A

I-19A

I-35A

I41A

I-58A

I-82A

I-88A

I-121A

I-127A

I-143A

I-170A

I-198A

I-248A

I-253A

I-264A

I-270A

I-299A

I-309A

I-350A

I-354A

I-358A

I-392A

I-397A

I-416A

I-425A

I-434A

I-444A

I-463A

I-473A

I-482A

I-488A

I-536A

I-539A

I-548A

I-554A

I-567A

[00301] In some embodiments, DFL is selected from one of those shown in Table 1A, above. In some embodiments, the DFL is selected from one of those shown in Table 1A, above, or a pharmaceutically acceptable salt thereof. It should be appreciated that the disclosure includes any of the DFLs disclosed herein, such as those depicted in Table 1A, coupled to any of the linkers disclosed herein and any rSM. [00302] In some embodiments, the compound of the present invention can be used as a CCR4- NOT binder or recruiter. In some embodiments, the compound of the present invention can be used to modulate the activity of CCR4-NOT. In some embodiments, the compound of the present invention can be used to inhibit the activity of CCR4-NOT. In some embodiments, the compound can be used to increase the activity of CCR4-NOT. In some embodiments, the compound activates the CCR4-NOT complex. In some embodiments, the compound increases the activity of the CCR4-NOT complex. In some embodiments, the compound binds to or recruits one or more components of the CCR4-NOT complex, such as CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. In some embodiments, the compound binds to or recruits CNOT1. In some embodiments, the compound binds to or recruits CNOT2. In some embodiments, the compound binds to or recruits CNOT3. In some embodiments, the compound binds to or recruits CNOT6. In some embodiments, the compound binds to or recruits CNOT6L. In some embodiments, the compound binds to or recruits CNOT7. In some embodiments, the compound binds to or recruits CNOT8. In some embodiments, the compound binds to or recruits CNOT9. In some embodiments, the compound binds to or recruits CNOT10. In some embodiments, the compound binds to or recruits CNOT11. [00303] In some embodiments, the compound increases degradation of a target RNA transcript. In some embodiments, the compound increases degradation of a target RNA transcript by bringing the CCR4-NOT complex in proximity of the target RNA. In some embodiments, the compound increases deadenylation of a target RNA transcript, for example a target mRNA transcript. In some embodiments, the compound increases deadenylation of a target RNA transcript by bringing the CCR4-NOT complex in proximity of the target RNA. 2. Compounds and Related Definitions [00304] As described generally above, the present invention provides a bifunctional compound of Formula B:

B or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. RNA-Binding Small Molecules (rSMs) [00305] In one aspect, the disclosure provides bifunctional compounds of Formula B wherein the compound includes an rSM. A variety of rSMs known in the art may be used in accordance with the present invention. In some embodiments, the rSM is modified from its known structure in order to covalently attach the rSM to the linker, L¹, at any available and modifiable C atom or a heteroatom such as an N, O, S, or P atom of the rSM. In the context of a C atom, “modifiable” refers to a C atom having 1) an attached H atom that can be replaced by a bond to L¹ via a chemical reaction such as an oxidation, reduction, nucleophilic substitution, or cross-coupling reaction; or 2) a C atom that can participate in a chemical reaction such as oxidation, reduction, nucleophilic substitution, or cross-couple reaction due to unsaturation or the presence of a leaving group attached to the C atom. For example, a C=O group, C=N group, or C-Br group is “modifiable.” Similarly, a modifiable heteroatom may be attached to an H atom capable of being replaced by a bond to L¹, or is modifiable due to unsaturation or the presence of a leaving group attached to the heteroatom. [00306] In some embodiments, the rSM is a small molecule or pharmaceutically acceptable salt thereof. In some embodiments, the rSM has a molecular weight (MW) of 1000 or less. In some embodiments, the rSM has a MW of about 750 or less. In some embodiments, the rSM has a MW of about 600 or less. In some embodiments, the rSM has a MW of about 500 or less. In some embodiments, the rSM has a MW of between about 100 and about 1000. In some embodiments, the rSM has a MW of between about 150 and about 800, about 150 and about 600, about 150 and about 400, about 150 and about 350, about 200 and about 350, or between about 200 and about 450. [00307] In some embodiments, the rSM or compound of Formula B binds to the target RNA transcript, or an isoform, fragment, or mutant thereof, with a Kd of 1 µM, 500 nM, 100 nM, 50 nM, 10 nM, 1 nM, 500 pM, 10 pM, or 1 pM or lower affinity under biological conditions. In some embodiments, the rSM or compound binds to the target RNA transcript, or an isoform, fragment, or mutant thereof, with a K_d of 0.1 nm to 500 nm, 10 nm to 250 nm, 0.001-25 µM, 0.01-25 µM, 0.1-25 µM, 0.1-15 µM, 0.01-10 µM, 0.001-1 µM, 0.001-0.1 µM, or 0.001-0.01 µM. Exemplary rSMs [00308] In some embodiments,

, the rSM is covalently bound to L¹. In some embodiments, rSM is

wherein the rSM is covalently bound to any of the compounds of Table 1A. [00309] In some embodiments, the rSM is selected from one of the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, or O atom. [00310] In some embodiments, the rSM is a G-quadruplex binder, such as one of those described in Peng, W. et al., J. Med. Chem.2018, 61, 6629-6646, which is hereby incorporated by reference. [00311] In some embodiments, the rSM is a compound disclosed in Shi, Y. et al., Cell Chem. Biol.2019, 26, 319-330, which is hereby incorporated by reference, such as one of the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00312] In some embodiments, the rSM is a compound disclosed in Velagapudi, S.P. et al. (2014), “Sequence-based design of bioactive small molecules that target precursor microRNAs,” Nat. Chem. Biol.10, 291, hereby incorporated by reference, for example the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, or O atom. [00313] In some embodiments, the rSM is a MALAT-1 binder such as the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, or O atom. [00314] In some embodiments, the rSM is a G-quadruplex binder such as the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C or N atom. [00315] In some embodiments, the rSM is one of the following compounds:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, S, or O atom. [00316] In some embodiments, the rSM is selected from one of those described in J. Med. Chem. 2018, 61(15), 6501-6517, or U.S. 8,729,263, each of which is hereby incorporated by reference. For example, the rSM is selected from a compound according to Formula I from U.S. 8,729,263:

or a pharmaceutically acceptable salt thereof, wherein each variable is as defined therein; and wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00317] In some embodiments, the rSM is selected from one of those described in U.S. 9,040,712, which is hereby incorporated by reference. For example, in some embodiments, the rSM is selected from a compound according to Formula X from U.S.9,040,712:

or a pharmaceutically acceptable salt thereof, wherein each variable is as defined therein; and wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00318] In some embodiments, the rSM is selected from one of those described in Angelbello, A. J., et al., “Small molecule targeting of RNA structures in neurological disorders, ”Annals of the New York Academy of Sciences, 2020 Jul;1471(1):57-71, hereby incorporated by reference, or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. In some embodiments, the rSM is one of the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00319] In some embodiments, the rSM is

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ of Formula A at the shaded ball in the structure above. In some embodiments, the rSM binds to an miRNA such as miR-21. [00320] In some embodiments, the rSM is selected from one of those depicted in Table 2A, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00321] In some embodiments, the rSM is a compound according to Formula IX:

IX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,150,612, the entirety of which is hereby incorporated by reference. [00322] In some embodiments, the rSM is a compound according to Formula X:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,550,769, the entirety of which is hereby incorporated by reference. In some embodiments, variable L¹ above is

wherein each variable is as defined in U.S.9,550,769. [00323] In some embodiments, the rSM is selected from one of those disclosed in U.S. 10,157,261, the entirety of which is hereby incorporated by reference; and wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. [00324] In some embodiments, the rSM is a compound according to Formula XI:

XI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,586,944, the entirety of which is hereby incorporated by reference. [00325] In some embodiments, the rSM is a compound according to Formula XII: H-Y-H XII wherein H is a group of the structure

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,795,687, the entirety of which is hereby incorporated by reference. [00326] In some embodiments, the rSM is a compound selected from one of the following:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; or another compound disclosed in WO 2018/151810, the entirety of which is hereby incorporated by reference. [00327] In some embodiments, the rSM is a compound of the following structure:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; or another compound disclosed in in WO 2018/152414, the entirety of which is hereby incorporated by reference. [00328] In some embodiments, the rSM is a compound of the following structure:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; or another compound disclosed in US 2018/0334678, the entirety of which is hereby incorporated by reference. [00329] In some embodiments, the rSM is a compound according to Formula XIII:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018/0296532, the entirety of which is hereby incorporated by reference. [00330] In some embodiments, the rSM is a compound according to Formula XIV:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018/098297, the entirety of which is hereby incorporated by reference. [00331] In some embodiments, the rSM is a compound according to Formula XV, XVI, or XVII:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019/0152924, the entirety of which is hereby incorporated by reference. [00332] In some embodiments, the rSM is a compound according to Formula XVIII:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/005993, the entirety of which is hereby incorporated by reference. [00333] In some embodiments, the rSM is a compound according to Formula XIX:

XIX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018/232039, the entirety of which is hereby incorporated by reference. [00334] In some embodiments, the rSM is a compound according to Formula XX:

XX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/005980, the entirety of which is hereby incorporated by reference. [00335] In some embodiments, the rSM is a compound according to Formula XXI:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2018/226622, the entirety of which is hereby incorporated by reference. [00336] In some embodiments, the rSM is a compound according to Formula XXII:

XXII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and [00337] wherein each variable is as defined in WO 2018/098446, the entirety of which is hereby incorporated by reference. [00338] In some embodiments, the rSM is a compound according to Formula XXIII:

XXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2017/087364, the entirety of which is hereby incorporated by reference. [00339] In some embodiments, the rSM is ataluren:

or a deuterated analog thereof or pharmaceutically acceptable salt thereof, disclosed in US 2018/0333397 or WO 2017/087364, each of which is hereby incorporated by reference. [00340] In some embodiments, the rSM is a compound of the following structure:

or a pharmaceutically acceptable salt thereof, wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; as described in US 2018/147228, the entirety of which is hereby incorporated by reference. [00341] In some embodiments, the rSM is a compound according to Formula XXIV:

XXIV or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,969,754, the entirety of which is hereby incorporated by reference. [00342] In some embodiments, the rSM is a compound according to Formula XXV-i:

XXV-i or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,371,336, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,371,336, or a pharmaceutically acceptable salt thereof. [00343] In some embodiments, the rSM is a compound according to Formula XXV-ii:

XXV-ii or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.9,617,268, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S. 9,617,268, or a pharmaceutically acceptable salt thereof. [00344] In some embodiments, the rSM is a compound according to Formula XXVI:

XXVI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019/0000844, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2019/0000844, or a pharmaceutically acceptable salt thereof. [00345] In some embodiments, the rSM is a compound according to Formula XXVII:

XXVII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2018/0161456, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in US 2018/0161456, or a pharmaceutically acceptable salt thereof. [00346] In some embodiments, the rSM is a compound according to Formula XXVIII:

XXVIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in U.S.10,195,202, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in U.S.10,195,202, or a pharmaceutically acceptable salt thereof. [00347] In some embodiments, the rSM is a compound according to one of Formulae XXIX- XXXIII:

XXXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/028440, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019/028440, or a pharmaceutically acceptable salt thereof. [00348] In some embodiments, the rSM is a compound according to one of Formulae XXXIV- XLXI:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/060917, the entirety of which is hereby incorporated by reference. In some embodiments, the rSM is a compound disclosed in WO 2019/060917, or a pharmaceutically acceptable salt thereof. [00349] In some embodiments, the rSM is a compound according to Formula XLXII or XLXIII:

XLXII XLXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 9,879,007, the entirety of which is hereby incorporated by reference. [00350] In some embodiments, the rSM is a compound according to Formula XLXIV or XLXV:

XLXIV XLXV or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/191229, the entirety of which is hereby incorporated by reference. [00351] In some embodiments, the rSM is a compound according to Formula XLXVI:

XLXVI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/191092, the entirety of which is hereby incorporated by reference. [00352] In some embodiments, the rSM is a compound according to Formula XLXVII:

or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in US 2019/315773, the entirety of which is hereby incorporated by reference. [00353] In some embodiments, the rSM is a compound according to Formula LVIII, LIX, or

LX or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2019/199972, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating splicing of the FOXM1 gene for use in the treatment of cancer. [00354] In some embodiments, the rSM is a compound according to Formula LXI:

LXI or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined for Formula (I) in WO 2020/005873, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in modulating RNA targets that mediate Huntington’s disease. In some embodiments, the compound is of formula (Ibb1) described therein:

wherein or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined therein. [00355] In some embodiments, the rSM is a compound according to Formula LXII or LXIII:

LXIII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2020/005877, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in binding to HTT RNA transcripts for use in the treatment of diseases such as Huntington’s. [00356] In some embodiments, the rSM is a compound according to Formula LXIV, LXV, LXVI, or LXVII:

LXVI LXVII or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom; and wherein each variable is as defined in WO 2020/005882, the entirety of which is hereby incorporated by reference. Such compounds are useful, for example, in binding to HTT RNA transcripts for use in the treatment of diseases such as Huntington’s. [00357] In some embodiments, the rSM is selected from one of those depicted in US Patents 8,729,263, 9,545,404, 9,856,474, or 7,838,657, each of which is hereby incorporated by reference. [00358] In some embodiments, the rSM is selected from one of those depicted in Table 2, below; or a pharmaceutically acceptable salt thereof; wherein the rSM is covalently bound to L¹ at any available modifiable C, N, O, S, or P atom. Table 2: Additional rSMs

Decay Factors and RNA-Binding Proteins (RBPs) [00359] In one aspect, the disclosure provides a composition comprising an RNA binder that binds to a target RNA transcript and a Decay Factor-recruiting Ligand (DFL), wherein the DFL binds to or recruits a decay factor. [00360] In one aspect, the disclosure provides compositions that comprise a decay factor ligand that binds decay factors, and wherein the decay factor is a protein that binds or interacts with RNA (an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the target RNA transcript in vivo. [00361] A decay factor as provided herein is any protein, polypeptide or biological molecule present in a cell that when brought in the proximity of a target RNA modulates that RNA. Modulating an RNA as provided herein includes, destabilizing the RNA, stabilizing the RNA, degrading the RNA, or acting on the RNA in any other capacity. Decay factors include any protein that interferes with the stability and/or activity of the RNA. In some embodiments, the decay factor is an RNA destabilizing protein, a nuclease, or an RNA-binding protein. It should be appreciated that nucleases and RNA-binding proteins are not mutually exclusive and that, for instance, some RNA-binding proteins also have nuclease activity. In some embodiments, the present disclosure provides a bifunctional compound or composition that effects recruitment to a target RNA to a nuclease capable of degrading the target RNA, or to an RNA-binding protein (RBP) that destabilizes the target RNA towards degradation by any of a cell’s or tissue’s mechanisms of RNA degradation. [00362] In some embodiments, the DFL binds or attracts a complex of proteins that can degrade or otherwise modulate the RNA function (e.g., the availability for protein translation). In some embodiments, the protein complex is the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex. CCR4-NOT complex [00363] In some embodiments, the DFL binds or attracts a complex of proteins that can degrade or otherwise modulate the RNA function. In some embodiments, the DFL binds the protein complex. In some embodiments, the DFL binds one or more RBPs that are part of the protein complex. Binding of one or more RBPs is expected to bring the complete protein complex in proximity to the target RNA. In some embodiments, the DFL binds the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex, or an RBP that is a member of the CCR4-NOT complex. The CCR4-NOT complex is a large and highly conserved multifunctional assembly of proteins involved in different aspects of mRNA metabolism. Without wishing to be bound by theory, it is believed that the CCR4-NOT complex plays a role in deadenylation- dependent mRNA turnover. RBPs that are part of the CCR4-NOT complex include CNOT1, CNOT2, CNOT3, CNOT6, CNOT6L, CNOT7, CNOT8, CNOT9, CNOT10 and CNOT11. The function of the CCR4-NOT complex and each of the RBPs that make up the complex is discussed for instance in Shirai et al. Multifunctional roles of the mammalian CCR4-NOT complex in physiological phenomena, Frontiers in Genetics, 2014, 5, Article 286, which is incorporated by reference. CNOT7 [00364] In some embodiments, the DFL binds to or recruits CNOT7. In some embodiments, a disclosed compound or composition comprises a small molecule CNOT7 ligand as the DFL. CNOT7 is a member of the CCR4-NOT complex. Without wishing to be bound by theory, it is believed that CNOT7 acts as exonuclease. It is thought to either directly, or in conjunction with other members of the CCR4-NOT complex, induce degradation of the target RNA (e.g., through deadenylation). CNOT7 is widely expressed in the human body. [00365] In some embodiments, the disclosure provides compounds that bind CNOT7, but that do not bind the active site of CNOT7. In some embodiments, the disclosure provides compounds and compositions thereof, wherein the DFL binds CNOT7 without abrogating the enzymatic activity of the CNOT7 and/or the CCR4-NOT complex. By binding CNOT7 on a site other than the active site, CNOT7 will maintain its capacity to act and/or degrade RNA. Thus, the compositions provided herein, in one embodiment, can bring CNOT7 in the proximity of the target RNA, by binding both the target RNA and CNOT7, and allow the CNOT7 to act on the Target RNA (e.g., degrade it), because the CNOT7 is still functional. [00366] In some embodiments, the DFL binds to or recruits CNOT1. In some embodiments, the DFL binds to or recruits CNOT2. In some embodiments, the DFL binds to or recruits CNOT3. In some embodiments, the DFL binds to or recruits CNOT6. In some embodiments, the DFL binds to or recruits CNOT6L. In some embodiments, the DFL binds to or recruits CNOT8. In some embodiments, the DFL binds to or recruits CNOT9. In some embodiments, the DFL binds to or recruits CNOT10. In some embodiments, the DFL binds to or recruits CNOT11. [00367] In any of the compositions, compounds and methods provided herein, in some embodiments, the compositions or compounds bind or interact with target RNA, and the target RNA transcript is an mRNA or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. In any of the compositions, compounds and methods provided herein, in some embodiments, the compositions or compounds bind or interact with target RNA, and the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. In any of the compositions, compounds and methods provided herein, in some embodiments, the compositions and compounds include an rSM that binds a target RNA. In any of the compositions, compounds and methods provided herein, in some embodiments, the rSM is selected from any one of those described in the section entitled exemplary rSMs. In any of the compositions, compounds and methods provided herein, in some embodiments, the rSM is one of those shown in Table 2. [00368] In any of the compositions, compounds and methods provided herein, in some embodiments, the composition is a pharmaceutical composition. In any of the compositions, compounds and methods provided herein, in some embodiments, the pharmaceutical composition includes any of the compounds or compositions provided herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. [00369] In one aspect, the present invention provides methods and compositions for the diagnosis and prognosis of cellular proliferative disorders (e.g., cancer) and the treatment of these disorders by modulating (e.g., degrading) a target RNA transcript. Cellular proliferative disorders described herein include, e.g., cancer, obesity, and proliferation-dependent diseases. Such disorders may be diagnosed using methods known in the art. [00370] In one aspect, the present invention provides methods and compositions for the treatment of cancer by modulating (e.g., degrading) a target RNA transcript. In some embodiments, the cancer is driven or characterized by the overexpression of a protein (e.g. an oncogenic protein) and the cancer is treated by modulating (e.g. degrading) a target RNA transcript that corresponds to the overexpressed protein. In one aspect, the present invention provides methods and compositions for the treatment of cancer. [00371] It should be appreciated that the compositions, compounds and methods provided herein allow for the modulation of the amount of target RNA and thereby the modulation of the amount of protein, or levels of protein that are expressed from the target RNA. Thus, in some embodiments, the disclosure provides compositions and compounds for methods of modifying the amount of a protein in a cell. In some embodiment, those methods include administering any of the compositions or compounds provided herein, or a pharmaceutically acceptable salt thereof, that acts on a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, in an amount sufficient to modify the amount of the protein in the cell. In some embodiments, modifying the amount of a protein in a cell includes or equals reducing the amount of protein in the cell. [00372] It should be appreciated that the compositions, compounds and methods provided herein allow for modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof. Thus, in some embodiments, the disclosure provides compositions and compounds for methods of modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof. In some embodiment, those methods include contacting the target RNA transcript or a precursor, isoform, fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. [00373] It should be appreciated that the compositions, compounds and methods provided herein allow for modulating the translation of a target protein or mutant thereof. Thus, in some embodiments, the disclosure provides compositions and compounds for methods that include contacting a target RNA transcript or a precursor, isoform, fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof. [00374] It should be appreciated that the compositions, compounds and methods provided herein allow for decreasing the half-life or increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof. Thus, in some embodiments, the disclosure provides compositions and compounds for methods that include contacting the target RNA transcript or the precursor, isoform, fragment, or mutant thereof with any of the compounds or compositions provided herein or a pharmaceutically acceptable salt thereof. Linkers [00375] As defined generally above, the linker, -L¹-, in the formulae described herein is a bivalent group that connects the rSM, or RNA Binder to the ligand for the decay factor ligand (DFL). In some embodiments, e.g., for compounds of Formula I and embodiments thereof, -L¹- is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O- , -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, - (R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00376] In some embodiments, -L¹- is a covalent bond. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy. In some embodiments, -L¹- is a C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, - (R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with - CH₂CH₂O-. [00377] In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C₂- 1₈, C_2-16, C_2-14, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-14, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-18, C_4- ₁₆, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain. In some embodiments, -L¹- is a C_1-18, C_1-16, C_1-14, C_1-12, C_1-10, C_1-8, C_1-6, C_1-4, C_1-2, C_2-18, C_2-16, C_2-14, C_2-12, C_2-10, C_2-8, C_2-6, C_2-4, C_3-18, C_3-16, C_3-14, C_3-12, C_3-10, C_3-8, C_3-6, C_3-4, C_4-18, C_4-16, C_4-14, C_4-12, C_4-10, C_4-8, C_4-6, C_4-5, C_5-18, C_5-16, C_5-14, C_5-12, C_5-10, C_5-8, C_5-6, or C₁₈, C₁₇, C₁₆, C₁₅, C₁₄, C₁₃, C₁₂, C₁₁, C₁₀, C₉, C₈, C₇, C₆, C₅, C₄, C₃, or C₂ straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-. [00378] In some embodiments, one methylene unit of -L¹- is replaced with -CH₂CH₂O-. In some embodiments, two methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, three methylene units of -L¹- are replaced with -CH₂CH₂O-. In some embodiments, four, five, six, seven, eight, nine, or ten methylene units of -L¹- are replaced with -CH₂CH₂O-. [00379] In some embodiments,

[00381] In some embodiments, -L¹- is a covalent bond or a C_1-8 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, - (R)NC(O)O-, -N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, - OC(S)-, -C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-. In some embodiments, -L¹- is a covalent bond or a bivalent, saturated or unsaturated, straight or branched, optionally substituted C1₅₀ hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L¹- are independently replaced by -Cy²-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -N(R)S(O)₂-, -S(O)₂N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)₂-, -

each -Cy²- is independently an optionally substituted bivalent ring selected from phenylenyl, an 8-12 membered bicyclic arylenyl, a 3-8 membered saturated or partially unsaturated carbocyclylenyl, an 8-12 membered bicyclic saturated or partially unsaturated carbocyclylenyl, a 3-8 membered saturated or partially unsaturated heterocyclylenyl having 1- 3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8-12 membered bicyclic saturated or partially unsaturated heterocyclylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered heteroarylenyl having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroarylenyl having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur; wherein each q is independently 1, 2, or 3. [00382] In some embodiments, -L¹- is a covalent bond. In some embodiments, -L¹- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C_1-50 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L¹- are independently replaced by -Cy²-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -N(R)S(O)₂-, - S(O)₂N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, - N(R)C(S)N(R)-, -Si(R)₂-, -Si(OH)(R)-, -Si(OH)₂-, -P(O)(OR)-, -P(O)(R)-, -P(O)(N(R)₂)-, an amino acid,

[00383] In some embodiments, -L¹- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C_1-50, C_1-40, C_1-30, C_1-20, C_1-15, C_1-10, C_1-5, C_2-50, C_2-40, C_2-30, C_2-20, C_2-15, C_2- ₁₀, C_3-50, C_3-40, C_3-30, C_3-20, C_3-15, C_3-10, C_4-50, C_4-40, C_4-30, C_4-20, C_4-15, C_4-10, C_5-50, C_5-40, C_5-30, C_5-20, C_5-15, C_5-10, C_6-50, C_6-40, C_6-30, C_6-20, C_6-15, C_7-50, C_7-40, C_7-30, C_7-20, C_7-15, C_8-50, C_8-40, C_8-30, C_8-20, C_8- ₁₅, C₁₀₅₀, C_10-40, C_10-30, C_10-20, C_10-15, C₁₂₅₀, C_12-40, C_12-30, C_12-20, C₁₅₅₀, C_15-40, C_15-30, C_15-20, C₂₀₅₀, C_20-40, or C_20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of L¹ are independently replaced by -Cy²-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -N(R)S(O)₂-, -S(O)₂N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, - N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)₂-, -Si(OH)(R)-, -Si(OH)₂-, -P(O)(OR)-, -P(O)(R)-, - P(O)(N(R)₂)-, an amino acid,

, , , , or

. [00384] In some embodiments, -L¹- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C₁₅₀, C_1-40, C_1-30, C_1-20, C1_-15, C_1-10, C_1-5, C₂₅₀, C_2-40, C_2-30, C_2-20, C_2-15, C₂- 1₀, C_3-50, C_3-40, C_3-30, C_3-20, C_3-15, C_3-10, C_4-50, C_4-40, C_4-30, C_4-20, C_4-15, C_4-10, C_5-50, C_5-40, C_5-30, C_5-20, C_5-15, C_5-10, C_6-50, C_6-40, C_6-30, C_6-20, C_6-15, C_7-50, C_7-40, C_7-30, C_7-20, C_7-15, C_8-50, C_8-40, C_8-30, C_8-20, C_8- ₁₅, C₁₀₅₀, C_10-40, C_10-30, C_10-20, C_10-15, C₁₂₅₀, C_12-40, C_12-30, C_12-20, C₁₅₅₀, C_15-40, C_15-30, C_15-20, C₂₀₅₀, C₂₀-40, or C₂₀-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of -L¹- are independently replaced by -Cy²-, -O-, -N(R)-, -S-, -OC(O)-, -C(O)O-, -C(O)-, -C(S)-, -S(O)-, -S(O)₂-, -N(R)S(O)₂-, -S(O)₂N(R)-, -N(R)C(O)-, -C(O)N(R)-, -OC(O)N(R)-, -N(R)C(O)O-, -N(R)C(O)N(R)-, -N(R)C(S)N(R)-, -Si(R)₂-, - Si(OH)(R)-, -Si(OH)₂-, -P(O)(OR)-, -P(O)(R)-, -P(O)(NR₂)-, an amino acid,

, . [00385] In some embodiments, -L¹- is a bivalent, saturated or unsaturated, straight or branched, optionally substituted C_1-50, C_1-40, C_1-30, C_1-20, C_1-15, C_1-10, C_1-5, C_2-50, C_2-40, C_2-30, C_2-20, C_2-15, C_2- 10, C₃₅₀, C₃-40, C_3-30, C_3-20, C_3-15, C_3-10, C_4-50, C_4-40, C_4-30, C_4-20, C_4-15, C_4-10, C₅₅₀, C_5-40, C_5-30, C_5-20, C_5-15, C_5-10, C_6-50, C_6-40, C_6-30, C_6-20, C_6-15, C₇₅₀, C_7-40, C_7-30, C_7-20, C_7-15, C₈₅₀, C_8-40, C_8-30, C_8-20, C_8- ₁₅, C_10-50, C_10-40, C_10-30, C_10-20, C_10-15, C_12-50, C_12-40, C_12-30, C_12-20, C_15-50, C_15-40, C_15-30, C_15-20, C_20-50, C_20-40, or C_20-30 hydrocarbon chain, wherein 0, 1, 2, 3, 4, 5, 6, 7, or 8 methylene units of -L¹- are independently replaced by -Cy²-, -O-, -N(R)-,

[00387] In some embodiments, -L¹- is a saturated chain. In some embodiments, -L¹- comprises at least one unsaturated pair of carbon atoms, i.e., at least one double or triple carbon-carbon bond. In some embodiments, -L¹- comprises 1, 2, 3, 4, or 5 double or triple carbon-carbon bonds. In some embodiments, -L¹- is a straight hydrocarbon chain wherein methylene units of -L¹- are optionally replaced or substituted as described above. In some embodiments, -L¹- is a saturated, straight hydrocarbon chain wherein methylene units of -L¹- are optionally replaced or substituted as described above. [00388] In some embodiments, -L¹- is substituted with 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 “optional substituents” as defined herein. In some embodiments, each substituent is independently selected from deuterium, halogen, -CN, -OR, -N(R)₂, -SR, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl optionally substituted with one or more C_1-4 alkyl, -CO₂R, -OR, -CON(R)₂, -N(R)₂, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or a C_1-6 aliphatic group optionally substituted with -CN, -OR, -N(R)₂, -SR, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl optionally substituted with one or more C_1-4 alkyl, -CO₂R, - OR, -CON(R)₂, -N(R)₂, or halogen, an 8-10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or the C_1-6 aliphatic is optionally substituted with 1, 2, 3, 4, 5, or 6 deuterium or halogen atoms; or two substituents attached to the same carbon atom, taken together with the carbon atom to which they are attached, form a 3-6 membered saturated monocyclic carbocyclic ring or 3-6 membered saturated heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, or sulfur. [00389] As described above, in some embodiments, a methylene unit of L¹ is replaced with an amino acid. The amino acid may be naturally-occurring or non-naturally occurring. In some embodiments, the amino acid is selected from a non-polar or branched chain amino acid (BCAA). In some embodiments, the amino acid is selected from valine, isoleucine, leucine, methionine, alanine, proline, glycine, phenylalanine, tyrosine, tryptophan, histidine, asparagine, glutamine, serine threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, cysteine, selenocysteine, or tyrosine. In some embodiments, the amino acid is an L-amino acid. In some embodiments, the amino acid is a D-amino acid.

. [00391] In some embodiments, -L¹- is selected from one of those depicted in Table 3, below. Table 3: Exemplary Linkers

[00392] In some embodiments, L¹ is selected from those depicted in Table 1, as shown above. Definitions [00393] As used herein, a “nucleoside” refers to a molecule consisting of a guanine (G), adenine (A), thymine (T), uridine (U), or cytidine (C) base covalently linked to a pentose sugar, whereas “nucleotide” or “mononucleotide” refers to a nucleoside phosphorylated at one of the hydroxyl groups of the pentose sugar. “Nucleoside” also encompasses analogs of G, A, T, C, or U and natural or non-natural nucleic acid components wherein the base, sugar, and/or phosphate backbone have been modified or replaced. Nucleoside analogs are known in the art and include those described herein. Also included are endogenous, post-transcriptionally modified nucleosides, such as methylated nucleosides. [00394] Linear nucleic acid molecules are said to have a “5′ terminus” (5′-end) and a “3′ terminus” (3′-end) because, except with respect to adenylation (as described elsewhere herein), mononucleotides are joined in one direction via a phosphodiester linkage (or analog thereof) to make oligonucleotides, in a manner such that a phosphate (or analog thereof) on the 5′ carbon of one mononucleotide sugar is joined to an oxygen on the 3′ carbon of the sugar of its neighboring mononucleotide. Therefore, an end of an oligonucleotide is referred to as the “5′ end” if its 5′ phosphate (or analog thereof) is not linked to the oxygen of the 3′ carbon of a mononucleotide sugar, and as the “3′ end” if its 3′ oxygen is not linked to a 5′ phosphate (or analog thereof) of a subsequent mononucleotide sugar. A “terminal nucleotide,” as used herein, is the nucleotide at the end position of the 3′ or 5′ terminus. The 3′ or 5′ terminus may alternatively end in a 3′-OH or 5′-OH if the terminal nucleotide is not phosphorylated. [00395] As used herein, the term “nucleic acid” refers to a covalently linked sequence of nucleotides in which the 3′ position of the sugar of one nucleotide is joined by a phosphodiester bond to the 5′ position of the sugar of the next nucleotide (i.e., a 3′ to 5′ phosphodiester bond), and in which the nucleotides are linked in specific sequence; i.e., a linear order of nucleotides. “Nucleic acid” includes analogs of the foregoing wherein one or more nucleotides are modified at the base, sugar, or phosphodiester. Such analogs are known in the art and include those described elsewhere herein. As used herein, “polynucleotide” or “polynucleic acid” refers to a long nucleic acid sequence (or analog thereof) of many nucleotides. For example, but without limitation, a polynucleotide (or polynucleic acid) may be greater than 60, 61-1,000, or 201-1,000, or greater than 1,000 nucleotides in length. As used herein, an “oligonucleotide” or “oligonucleic acid” is a short polynucleotide or a portion of a polynucleotide. For example, but without limitation, an oligonucleotide may be between 5-10, 10-60, or 10-200 nucleotides in length. [00396] In some embodiments, a nucleic acid, oligonucleotide, or polynucleotide consists of, consists primarily of, or is mostly 2′-deoxyribonucleotides (DNA) or ribonucleotides (RNA). In some embodiments, an oligonucleotide consists of or comprises 2′-deoxyribonucleotides (DNA). In some embodiments, the oligonucleotide consists of or comprises ribonucleotides (RNA). In some embodiments, the oligonucleotide is a DNA-RNA hybrid, such as a DNA sequence of contiguous nucleotides linked to an RNA sequence of contiguous nucleotides, or with some regions of RNA and some regions of DNA. [00397] As used herein, the term “RNA-mediated” in reference to RNA-mediated disorders, diseases, and/or conditions means any disease or other deleterious condition in which RNA, such as an overexpressed, underexpressed, mutant, misfolded, expanded, pathogenic, or oncogenic RNA, is known to play a role. [00398] Compounds of the present invention include those described generally herein, and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this invention, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75^th Ed. Additionally, general principles of organic chemistry are described in Organic Chemistry, Thomas Sorrell, University Science Books, Sausalito: 1999, and March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7^th Edition, John Wiley & Sons: 2013; the entire contents of each of which are hereby incorporated by reference. [00399] The term “aliphatic” or “aliphatic group,” as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “carbocycle,” “cycloaliphatic” or “cycloalkyl”), that has a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” (or “carbocycle” or “cycloalkyl”) refers to a monocyclic C₃-C₆ hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl. [00400] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system. Thus, the term includes any permissible ring fusion, such as ortho-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally, or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include:

[00401] Exemplary bridged bicyclics include:

[00402] The term “lower alkyl” refers to a C_1-4 straight or branched alkyl group. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl. [00403] The term “lower haloalkyl” refers to a C_1-4 straight or branched alkyl group that is substituted with one or more halogen atoms. [00404] The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR⁺ (as in N-substituted pyrrolidinyl)). [00405] The term “unsaturated,” as used herein, means that a moiety has one or more units of unsaturation. [00406] As used herein, the term “bivalent C_1-8 (or C_1-6) saturated or unsaturated, straight or branched, hydrocarbon chain,” refers to bivalent alkylene, alkenylene, and alkynylene chains that are straight or branched as defined herein. [00407] The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., –(CH₂)n–, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group. [00408] The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group. [00409] The term “halogen” means F, Cl, Br, or I. [00410] The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present invention, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like. [00411] The terms “heteroaryl” and “heteroar–,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 ^ electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms “heteroaryl” and “heteroar–,” as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-1,4-oxazin-3(4H)-one. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted with a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted. [00412] As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 5– to 7-membered monocyclic or 7–10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term “nitrogen” includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0–3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4– dihydro–2H–pyrrolyl), NH (as in pyrrolidinyl), or ⁺NR (as in N–substituted pyrrolidinyl). [00413] A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H–indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be mono– or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted with a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted. [00414] As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined. [00415] As described herein, compounds of the invention may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent (“optional substituent”) at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein. [00416] Suitable monovalent substituents on a substitutable carbon atom of an “optionally substituted” group are independently halogen; –(CH₂)_0–4R^o; –(CH₂)_0–4OR^o; -O(CH₂)_0–4R^o, –O– (CH₂)_0–4C(O)OR°; –(CH₂)_0–4CH(OR^o)₂; –(CH₂)_0–4SR^o; –(CH₂)_0–4Ph, which may be substituted with R°; –(CH₂)_0–4O(CH₂)_0–1Ph which may be substituted with R°; –CH=CHPh, which may be substituted with R°; –(CH₂)_0–4O(CH₂)_0–1-pyridyl which may be substituted with R°; –NO₂; –CN; –N₃; -(CH₂)_0–4N(R^o)₂; –(CH₂)_0–4N(R^o)C(O)R^o; –N(R^o)C(S)R^o; –(CH₂)_0– ₄N(R^o)C(O)NR^o ₂; -N(R^o)C(S)NR^o ₂; –(CH₂)_0–4N(R^o)C(O)OR^o; – N(R^o)N(R^o)C(O)R^o; -N(R^o)N(R^o)C(O)NR^o ₂; -N(R^o)N(R^o)C(O)OR^o; –(CH₂)_0–4C(O)R^o; – C(S)R^o; –(CH₂)_0–4C(O)OR^o; –(CH₂)_0–4C(O)SR^o; -(CH₂)_0–4C(O)OSiR^o ₃; –(CH₂)_0–4OC(O)R^o; – OC(O)(CH₂)_0–4SR–, SC(S)SR°; –(CH₂)_0–4SC(O)R^o; –(CH₂)_0–4C(O)NR^o ₂; –C(S)NR^o ₂; –C(S)SR°; –SC(S)SR°, -(CH₂)_0–4OC(O)NR^o ₂; -C(O)N(OR^o)R^o; –C(O)C(O)R^o; –C(O)CH₂C(O)R^o; – C(NOR^o)R^o; -(CH₂)_0–4SSR^o; –(CH₂)_0–4S(O)₂R^o; –(CH₂)_0–4S(O)₂OR^o; –(CH₂)_0–4OS(O)₂R^o; – S(O)₂NR^o ₂; -(CH₂)_0–4S(O)R^o; -N(R^o)S(O)₂NR^o ₂; –N(R^o)S(O)₂R^o; –N(OR^o)R^o; –C(NH)NR^o ₂; – P(O)₂R^o; -P(O)R^o ₂; -OP(O)R^o ₂; –OP(O)(OR^o)₂; SiR^o ₃; –(C_1–4 straight or branched alkylene)O– N(R^o)₂; or –(C_1–4 straight or branched alkylene)C(O)O–N(R^o)₂, wherein each R^o may be substituted as defined below and is independently hydrogen, C_1–6 aliphatic, –CH₂Ph, –O(CH₂)_0– 1Ph, -CH₂-(5-6 membered heteroaryl ring), or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R^o, taken together with their intervening atom(s), form a 3–12–membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, which may be substituted as defined below. [00417] Suitable monovalent substituents on R^o (or the ring formed by taking two independent occurrences of R^o together with their intervening atoms), are independently halogen, –(CH₂)_0–2R^●, –(haloR^●), –(CH₂)_0–2OH, –(CH₂)_0–2OR^●, –(CH₂)_0–2CH(OR^●)₂; -O(haloR^●), –CN, –N₃, –(CH₂)_0– ₂C(O)R^●, –(CH₂)_0–2C(O)OH, –(CH₂)_0–2C(O)OR^●, –(CH₂)_0–2SR^●, –(CH₂)_0–2SH, –(CH₂)_0–2NH₂, – (CH₂)_0–2NHR^●, –(CH₂)_0–2NR^●2, –NO₂, –SiR^●3, –OSiR^●3, -C(O)SR^●, –(C_1–4 straight or branched alkylene)C(O)OR^●, or –SSR^● wherein each R^● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from C_1–4 aliphatic, – CH₂Ph, –O(CH₂)_0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0– 4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on a saturated carbon atom of R^o include =O and =S. [00418] Suitable divalent substituents on a saturated carbon atom of an “optionally substituted” group include the following: =O, =S, =NNR^* ₂, =NNHC(O)R^*, =NNHC(O)OR^*, =NNHS(O)₂R^*, =NR^*, =NOR^*, –O(C(R^* ₂))_2–3O–, or –S(C(R^* ₂))_2–3S–, wherein each independent occurrence of R^* is selected from hydrogen, C_1–6 aliphatic which may be substituted as defined below, or an unsubstituted 5–6-membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: –O(CR^* ₂)₂– 3O–, wherein each independent occurrence of R^* is selected from hydrogen, C_1–6 aliphatic which may be substituted as defined below, or an unsubstituted 5–6-membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00419] Suitable substituents on the aliphatic group of R^* include halogen, –R^●, -(haloR^●), -OH, –OR^●, –O(haloR^●), –CN, –C(O)OH, –C(O)OR^●, –NH₂, –NHR^●, –NR^● ₂, or –NO₂, wherein each R^● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C_1–4 aliphatic, –CH₂Ph, –O(CH₂)_0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00420] Suitable substituents on a substitutable nitrogen of an “optionally substituted” group include –R^†, –NR^†2, –C(O)R^†, –C(O)OR^†, –C(O)C(O)R^†, – C(O)CH₂C(O)R^†, -S(O)₂R^†, -S(O)₂NR^† ₂, –C(S)NR^† ₂, –C(NH)NR^† ₂, or –N(R^†)S(O)₂R^†; wherein each R^† is independently hydrogen, C_1–6 aliphatic which may be substituted as defined below, unsubstituted –OPh, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R^†, taken together with their intervening atom(s) form an unsubstituted 3–12-membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00421] Suitable substituents on the aliphatic group of R^† are independently halogen, – R^●, -(haloR^●), –OH, –OR^●, –O(haloR^●), –CN, –C(O)OH, –C(O)OR^●, –NH₂, –NHR^●, –NR^● ₂, or -NO₂, wherein each R^● is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C_1–4 aliphatic, –CH₂Ph, –O(CH₂)_0–1Ph, or a 5–6- membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. [00422] As used herein, the term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1–19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2–hydroxy–ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2– naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3–phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p–toluenesulfonate, undecanoate, valerate salts, and the like. [00423] Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N⁺(C_1–4alkyl)₄ salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl sulfonate. [00424] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a ¹³C- or ¹⁴C-enriched carbon are within the scope of this invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present invention. [00425] As used herein, the term “binder” or “ligand” is defined as a compound that binds to a target RNA transcript or decay factor (e.g., nuclease) or RBP with measurable affinity. In certain embodiments, a binder has an IC₅₀ and/or binding constant of less than about 50 μM, less than about 1 μM, less than about 500 nM, less than about 100 nM, less than about 10 nM, or less than about 1 nM. [00426] A compound of the present invention may be tethered to a detectable moiety. It will be appreciated that such compounds are useful as imaging agents. One of ordinary skill in the art will recognize that a detectable moiety may be attached to a provided compound via a suitable substituent. As used herein, the term “suitable substituent” refers to a moiety that is capable of covalent attachment to a detectable moiety. Such moieties are well known to one of ordinary skill in the art and include groups containing, e.g., a carboxylate moiety, an amino moiety, a thiol moiety, or a hydroxyl moiety, to name but a few. It will be appreciated that such moieties may be directly attached to a provided compound or via a tethering group, such as a bivalent saturated or unsaturated hydrocarbon chain. In some embodiments, such moieties may be attached via click chemistry. In some embodiments, such moieties may be attached via a 1,3-cycloaddition of an azide with an alkyne, optionally in the presence of a copper catalyst. Methods of using click chemistry are known in the art and include those described by Rostovtsev et al., Angew. Chem. Int. Ed.2002, 41, 2596-99 and Sun et al., Bioconjugate Chem., 2006, 17, 52-57. [00427] As used herein, the term “detectable moiety” is used interchangeably with the term “label” and relates to any moiety capable of being detected, e.g., primary labels and secondary labels. Primary labels, such as radioisotopes (e.g., tritium, ³²P, ³³P, ³⁵S, or ¹⁴C), mass-tags, and fluorescent labels are signal generating reporter groups which can be detected without further modifications. Detectable moieties also include luminescent and phosphorescent groups. [00428] The term “secondary label” as used herein refers to moieties such as biotin and various protein antigens that require the presence of a second intermediate for production of a detectable signal. For biotin, the secondary intermediate may include streptavidin-enzyme conjugates. For antigen labels, secondary intermediates may include antibody-enzyme conjugates. Some fluorescent groups act as secondary labels because they transfer energy to another group in the process of nonradiative fluorescent resonance energy transfer (FRET), and the second group produces the detected signal. [00429] The terms “fluorescent label,” “fluorescent dye”, and “fluorophore” as used herein refer to moieties that absorb light energy at a defined excitation wavelength and emit light energy at a different wavelength. Examples of fluorescent labels include, but are not limited to: Alexa Fluor dyes (Alexa Fluor 350, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 660 and Alexa Fluor 680), AMCA, AMCA-S, BODIPY dyes (BODIPY FL, BODIPY R6G, BODIPY TMR, BODIPY TR, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665), Carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), Cascade Blue, Cascade Yellow, Coumarin 343, Cyanine dyes (Cy3, Cy5, Cy3.5, Cy5.5), Dansyl, Dapoxyl, Dialkylaminocoumarin, 4’,5’-Dichloro-2’,7’-dimethoxy-fluorescein, DM-NERF, Eosin, Erythrosin, Fluorescein, FAM, Hydroxycoumarin, IRDyes (IRD40, IRD 700, IRD 800), JOE, Lissamine rhodamine B, Marina Blue, Methoxycoumarin, Naphthofluorescein, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PyMPO, Pyrene, Rhodamine B, Rhodamine 6G, Rhodamine Green, Rhodamine Red, Rhodol Green, 2’,4’,5’,7’-Tetra-bromosulfone- fluorescein, Tetramethyl-rhodamine (TMR), Carboxytetramethylrhodamine (TAMRA), Texas Red, Texas Red-X. [00430] The term “mass-tag” as used herein refers to any moiety that is capable of being uniquely detected by virtue of its mass using mass spectrometry (MS) detection techniques. Examples of mass-tags include electrophore release tags such as N-[3-[4’-[(p- Methoxytetrafluorobenzyl)oxy]phenyl]-3-methylglyceronyl]isonipecotic Acid, 4’-[2,3,5,6- Tetrafluoro-4-(pentafluorophenoxyl)]methyl acetophenone, and their derivatives. The synthesis and utility of these mass-tags is described in United States Patents 4,650,750, 4,709,016, 5,360,8191, 5,516,931, 5,602,273, 5,604,104, 5,610,020, and 5,650,270. Other examples of mass- tags include, but are not limited to, nucleotides, dideoxynucleotides, oligonucleotides of varying length and base composition, oligopeptides, oligosaccharides, and other synthetic polymers of varying length and monomer composition. A large variety of organic molecules, both neutral and charged (biomolecules or synthetic compounds) of an appropriate mass range (100-2000 Daltons) may also be used as mass-tags. [00431] The term “RNA” (ribonucleic acid) as used herein, means a naturally-occurring or synthetic oligo- or polyribonucleotide independent of source (e.g., the RNA may be produced by a human, animal, plant, virus, or bacterium, or may be synthetic in origin), biological context (e.g., the RNA may be in the nucleus, circulating in the blood, in vitro, cell lysate, or isolated or pure form), or physical form (e.g., the RNA may be in single-, double-, or triple-stranded form (including RNA-DNA hybrids), may include epigenetic modifications, native post-transcriptional modifications, artificial modifications (e.g., obtained by chemical or in vitro modification), or other modifications, may be bound to, e.g., metal ions, small molecules, protein chaperones, or co- factors, or may be in a denatured, partially denatured, or folded state including any native or unnatural secondary or tertiary structure such as junctions (e.g., cis or trans three-way junctions (3WJ)), quadruplexes, hairpins, triplexes, hairpins, bulge loops, pseudoknots, and internal loops, etc., and any transient forms or structures adopted by the RNA). In some embodiments, the RNA is 100 or more nucleotides in length. In some embodiments, the RNA is 250 or more nucleotides in length. In some embodiments, the RNA is 350, 450, 500, 600, 750, or 1,000, 2,000, 3,000, 4,000, 5,000, 7,500, 10,000, 15,000, 25,000, 50,000, or more nucleotides in length. In some embodiments, the RNA is between 250 and 1,000 nucleotides in length. In some embodiments, the RNA is a pre- RNA, pre-miRNA, or pretranscript. In some embodiments, the RNA is a non-coding RNA (ncRNA), messenger RNA (mRNA), micro-RNA (miRNA), a ribozyme, riboswitch, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, pseudo-gene, viral RNA, or bacterial RNA. The term “target RNA” as used herein, means any type of RNA having or capable of adopting a secondary or tertiary structure that is capable of binding a small molecule ligand described herein. The target RNA may be inside a cell, in a cell lysate, or in isolated form prior to contacting the small molecule. Targeting RNA Transcripts with Compounds of the Present Invention [00432] In one aspect, the present invention provides a method of modulating the activity of a target RNA transcript or an isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound or a pharmaceutically acceptable salt thereof that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. [00433] In another aspect, the present invention provides a method of modulating the activity of a target protein or mutant thereof, comprising contacting a corresponding target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound or a pharmaceutically acceptable salt thereof that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. [00434] In one aspect, the present invention provides a method of decreasing the half-life or increasing degradation of a target RNA transcript or an isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. [00435] In some embodiments, translation of the target RNA transcript is decreased or inhibited, e.g., by decreasing the half-life of the transcript. In some embodiments, production of the corresponding functional protein or a mutant thereof is decreased or inhibited. [00436] In some embodiments, the administration of a compound or composition provided herein results in decrease or inhibition of the production of a functional protein or a mutant thereof. In some embodiments, the production of a functional protein or a mutant thereof is decreased by at least 10%, at least 20%, at least 30%, at least 40%, at least 25%, at least 60%, at least 70%, at least 80%, at least 90%, or is no longer produced at detectable levels. [00437] In some embodiments, the activity of the target RNA transcript or an isoform, fragment, or mutant thereof is inhibited or decreased. In some embodiments, processing or splicing of the target RNA transcript or an isoform, fragment, or mutant thereof is inhibited. [00438] In some embodiments, the target RNA is an mRNA, or a precursor, isoform, fragment, or mutant thereof. In some embodiments, inhibition of processing or splicing results in a decrease in levels of mature mRNA and/or protein. In some embodiments, the activity of the protein or mutant thereof is inhibited or decreased, e.g., due to a decreased level of the protein in a cell. [00439] In some embodiments, the target RNA transcript comprises a functionally relevant fragment of a disease-causing RNA. A target RNA transcript or an isoform, fragment, or mutant thereof is “functionally relevant” if it includes at least a portion of a target RNA transcript that is ultimately transcribed and that is essential to producing a corresponding, disease-causing functional protein or mutant thereof. [00440] In some embodiments, the target RNA transcript is a pre-mRNA, mature mRNA, or partially processed mRNA, or an isoform, fragment, or mutant thereof. [00441] In some embodiments, the RNA transcript comprises a 5′ untranslated region (UTR). [00442] In some embodiments, the RNA transcript comprises an open reading frame (ORF). [00443] In some embodiments, the RNA transcript comprises a 5′ cap. [00444] In some embodiments, the RNA transcript comprises a 3′ polyA tail (polyadenylated tail). [00445] In some embodiments, the compound binds to a 5′ untranslated region (5′ UTR), a 3′ UTR, or an intron present in the RNA transcript. [00446] In some embodiments, translation of the RNA transcript is reduced. In some embodiments, levels of protein encoded by the RNA transcript are decreased in a biological sample contacted with a disclosed compound or composition, such as a cell culture, or decreased in a patient treated with a disclosed compound or composition. In some embodiments, degradation of the RNA transcript is increased. In some embodiments, degradation of the RNA transcript is increased due to binding of the disclosed compound. [00447] In one aspect, the present invention provides a method of identifying a compound that binds to a target RNA transcript or an isoform, fragment, or mutant thereof, comprising i) contacting the target RNA transcript or an isoform, fragment, or mutant thereof with a disclosed compound and ii) analyzing the results by an assay disclosed herein, optionally in combination with a computational method. In some embodiments, the method comprises the use of an SEC- MS, SPR, or DEL screen to identify the compound. [00448] In another aspect, the present invention provides a method of treating an RNA- mediated disease, disorder, or condition (which includes any protein-mediated disease, disorder or condition) in a patient in need thereof, comprising administering to the patient an effective amount of a disclosed compound or a pharmaceutically acceptable salt thereof. In some embodiments, the disease, disorder, or condition is a proliferative disorder, such as a cancer. [00449] A variety of RNA transcripts are appropriate as target RNA transcripts for use in the present invention. In some embodiments, the target RNA transcript is selected from one of those in Table A, Table B, Table C, or Table D below, or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. [00450] In some embodiments, the target RNA transcript is single-stranded. In some embodiments, the target RNA transcript is double-stranded or partially double-stranded. In some embodiments, the target RNA is a pair of nucleic acids engaged in an interaction, such as a miRNA-mRNA hybridized (or partially hybridized) pair. In some embodiments, the target RNA comprises one, two, or more miRNAs bound to an mRNA. In some embodiments, the target RNA is an mRNA, miRNA, premiRNA, or a viral or fungal RNA. [00451] In some embodiments, the target RNA transcript includes structural features such as at least some intramolecular base pairing, a junction (e.g., cis or trans three-way junctions (3WJ)), quadruplex, hairpin, triplex, bulge loop, pseudoknot, or internal loop, etc., and any transient forms or structures adopted by the nucleic acid. In some embodiments, the target RNA transcript includes a bound protein, such as a chaperone, RNA-binding protein (RBP), or other nucleic acid- binding protein. [00452] Target RNA transcripts of various lengths are target RNA transcripts within the scope of the present invention. For example, the target RNA may be from 20-10,000 nucleotides in length. In some embodiments, the target RNA is a relatively short sequence of, e.g., less than 250, less than 100, or less than 50 nucleotides in length. In some embodiments, the target RNA is 100 or more nucleotides in length. In some embodiments, the target RNA is 250 or more nucleotides in length. In some embodiments, the target RNA is up to about 350, 450, 500, 600, 750, or 1,000, 2,000, 3,000, 4,000, 5,000, 7,500, 10,000, 15,000, 25,000, 50,000, or more than 50,000 nucleotides in length. In some embodiments, the target RNA is between about 30 and about 500 nucleotides in length. In some embodiments, the target RNA is between about 250 and about 1,000 nucleotides in length. In some embodiments, the target RNA is between about 20-50, 30-60, 40-70, 50-80, 20-100, 30-100, 40-100, 50-100, 20-200, 30-200, 40-200, 50-200, 20-300, 50-300, 75-300, 100- 300, 20-400, 50-400, 100-400, 200-400, 20-500, 50-500, 100-500, 250-500, 20-750, 50-750, 100- 750, 250-750, 500-750, 20-1,000, 100-1,000, 250-1,000, 500-1,000, 20-2,000, 100-2,000, 500- 2,000, 1,000-2,000, 20-5,000, 100-5,000, 1,000-5,000, 20-10,000, 100-10,000, 1,000-10,000, or 20-25,000 nucleotides in length. [00453] Where the target or other referenced nucleic acid is an RNA, “nucleotides” refers to ribonucleotides. Where the target or other referenced nucleic acid is DNA, “nucleotides” refers to 2′-deoxyribonucleotides. In some embodiments, a target RNA comprises one or more nucleotide analogs (modified nucleotides) as defined herein and as known in the art. [00454] In some embodiments, the target RNA is a pre-mRNA, pre-miRNA, pretranscript, partially spliced mRNA, fully spliced mRNA, fully spliced and partially processed mRNA, or a mature mRNA (i.e., fully spliced and processed mRNA). [00455] In some embodiments, the RNA is a non-coding RNA (ncRNA), messenger RNA (mRNA), micro-RNA (miRNA), a ribozyme, riboswitch, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, rRNA, ceRNA, or pseudo-gene, wherein each of the foregoing may be selected from a human or non-human RNA, such as viral RNA, fungal RNA, or bacterial RNA. Targeting mRNA [00456] In some embodiments, the target RNA transcript is an mRNA or a precursor to a mature mRNA; or an isoform, fragment, or mutant thereof. Within mRNAs, noncoding regions can affect the level of mRNA and protein expression. Briefly, these include internal ribosome entry sites (IRES) and upstream open reading frames (uORF) that affect translation efficiency, intronic sequences that affect splicing efficiency and alternative splicing patterns, 3′ UTR sequences that affect mRNA and protein localization, and elements that control mRNA decay and half-life. Therapeutic modulation of these RNA elements can have beneficial effects. Also, mRNAs may contain expansions of simple repeat sequences such as trinucleotide repeats. These repeat expansion containing RNAs can be toxic and have been observed to drive disease pathology, particularly in certain neurological and musculoskeletal diseases (see Gatchel & Zoghbi, Nature Rev. Gen.2005, 6, 743-755). Accordingly, in some embodiments, the present invention provides a method of degrading an mRNA that contains a toxic repeat expansion, or an isoform, fragment, or mutant thereof, comprising contacting the mRNA with a disclosed compound. The present invention further provides a method of treating a disease, disorder, or condition mediated by an mRNA that contains a toxic repeat expansion, or an isoform, fragment, or mutant thereof. [00457] Additionally, in some embodiments, the expression of a target mRNA and its translation products is modulated by targeting noncoding sequences and structures in the 5′ and 3′ UTRs. For instance, RNA structures in the 5′ UTR can affect translational efficiency. RNA structures such as hairpins in the 5′ UTR have been shown to affect translation. In general, RNA structures are believed to play a critical role in translation of mRNA. One example of these are internal ribosome entry sites (IRES), which can affect the level of translation of the main open reading frame (Komar and Hatzoglou, Frontiers Oncol.5:233, 2015; Weingarten-Gabbay et al., Science 351, 4939, 2016; Calvo et al., Proc. Natl. Acad. Sci. USA 106:7507-7512; Le Quesne et al., J. Pathol. 220:140-151, 2010; Barbosa et al., PLOS Genetics 9:e10035529, 2013). Small molecules targeting these RNAs could be used to modulate specific protein levels for therapeutic benefit. In some embodiments, the small molecule rSM binding site is a 5′ UTR, internal ribosome entry site, or upstream open reading frame. Non-Coding RNA Transcripts [00458] Non-coding RNAs regulate cellular biology directly through function of RNA structures (e.g., ribonucleoproteins) as well as via regulating protein expression. These ncRNAs include (but are not limited to) miRNA, lncRNA, lincRNA, snoRNA, snRNA, scaRNA, piRNA, ceRNA, and pseudo-genes. Drugs that intervene at this level have the potential of modulating any cellular process. [00459] In some embodiments, the target RNA transcript is an RNA that is transcribed but not translated into protein, termed “non-coding RNA” or “ncRNA.” Non-coding RNA is highly conserved, and the many varieties of non-coding RNA play a wide range of regulatory functions. The term “non-coding RNA,” as used herein, includes but is not limited to micro-RNA (miRNA), long non-coding RNA (lncRNA), long intergenic non-coding RNA (lincRNA), Piwi-interacting RNA (piRNA), competing endogenous RNA (ceRNA), and pseudo-genes. Each of these sub- categories of non-coding RNA offers a large number of RNA targets with significant therapeutic potential. Accordingly, in some embodiments, the present invention provides methods of treating a disease mediated by a non-coding transcript. In some embodiments, the disease is caused by a lncRNA, lincRNA, ceRNA, or pseudo-gene. In another aspect, the present invention provides a method of producing a small molecule that modulates the activity of a target non-coding transcript to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to or degradation of the target non-coding transcript; and analyzing the results by an RNA binding assay disclosed herein. In some embodiments, the target non-coding transcript is a lncRNA, lincRNA, ceRNA, or pseudo-gene. [00460] In some embodiments, the target RNA transcript is an miRNA. miRNA are short double-strand RNAs that regulate gene expression (see Elliott & Ladomery, Molecular Biology of RNA, 2^nd Ed.). Each miRNA can affect the expression of many human genes. There are nearly 2,000 miRNAs in humans. These RNAs regulate many biological processes, including cell differentiation, cell fate, motility, survival, and function. miRNA expression levels vary between different tissues, cell types, and disease settings. They are frequently aberrantly expressed in tumors versus normal tissue, and their activity may play significant roles in cancer (for reviews, see Croce, Nature Rev. Genet.10:704-714, 2009; Dykxhoorn Cancer Res.70:6401-6406, 2010). miRNAs have been shown to regulate oncogenes and tumor suppressors and themselves can act as oncogenes or tumor suppressors. Some have been shown to promote epithelial-mesenchymal transition (EMT) and cancer cell invasiveness and metastasis. In the case of oncogenic miRNAs, their inhibition could be an effective anti-cancer treatment. Accordingly, in one aspect, the present invention provides a method of producing a small molecule that modulates the activity of a target miRNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to or degradation of the target miRNA; and analyzing the results by an RNA binding assay disclosed herein. In some embodiments, the miRNA regulates an oncogene or tumor suppressor, or acts as an oncogene or tumor suppressor. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor. [00461] Beyond oncology, miRNAs play roles in many other diseases including cardiovascular and metabolic diseases (Quiant and Olson, J. Clin. Invest.123:11-18, 2013; Olson, Science Trans. Med.6: 239ps3, 2014; Baffy, J. Clin. Med.4:1977-1988, 2015). [00462] Many mature miRNAs are relatively short in length and thus may lack sufficient folded, three-dimensional structure to be targeted by small molecules. However, it is believed that the levels of such miRNA could be reduced by small molecules that bind the primary transcript or the pre-miRNA to block the biogenesis of the mature miRNA. Accordingly, in some embodiments of the methods described above, the target miRNA is a primary transcript or pre-miRNA whose corresponding mature miRNA affects an oncogene or tumor suppressor, or which affects the levels or activity of a disease-causing RNA transcript or protein. [00463] In some embodiments, the target RNA transcript is an lncRNA. lncRNA are RNAs of over 200 nucleotides (nt) that do not encode proteins (see Rinn & Chang, Ann. Rev. Biochem. 2012, 81, 145-166; (for reviews, see Morris and Mattick, Nature Reviews Genetics 15:423-437, 2014; Mattick and Rinn, Nature Structural & Mol. Biol.22:5-7, 2015; Iyer et al., Nature Genetics 47(:199-208, 2015)). They can affect the expression of the protein-encoding mRNAs at the level of transcription, splicing and mRNA decay. Considerable research has shown that lncRNA can regulate transcription by recruiting epigenetic regulators that increase or decrease transcription by altering chromatin structure (e.g., Holoch and Moazed, Nature Reviews Genetics 16:71-84, 2015). lncRNAs are associated with human diseases including cancer, inflammatory diseases, neurological diseases and cardiovascular disease (for instance, Presner and Chinnaiyan, Cancer Discovery 1:391-407, 2011; Johnson, Neurobiology of Disease 46:245-254, 2012; Gutscher and Diederichs, RNA Biology 9:703-719, 2012; Kumar et al., PLOS Genetics 9:e1003201, 2013; van de Vondervoort et al., Frontiers in Molecular Neuroscience, 2013; Li et al., Int. J. Mol. Sci. 14:18790-18808, 2013). In general, lncRNA are expressed at a lower level relative to mRNAs. Many lncRNAs are physically associated with chromatin (Werner et al., Cell Reports 12, 1-10, 2015) and are transcribed in close proximity to protein-encoding genes. They often remain physically associated at their site of transcription and act locally, in cis, to regulate the expression of a neighboring mRNA. [00464] lncRNAs regulate the expression of protein-encoding genes, acting at multiple different levels to affect transcription, alternative splicing and mRNA decay. For example, lncRNA has been shown to bind to the epigenetic regulator PRC₂ to promote its recruitment to genes whose transcription is then repressed via chromatin modification. lncRNA may form complex structures that mediate their association with various regulatory proteins. A small molecule that binds to these lncRNA structures could be used to modulate the expression of genes that are normally regulated by an individual lncRNA. Targeting Toxic RNA (Repeat RNA) [00465] Simple repeats in mRNA often are associated with human disease. These are often, but not exclusively, repeats of three nucleotides such as CAG (“triplet repeats”) (for reviews, see Gatchel and Zoghbi, Nature Reviews Genetics 6:743-755, 2005; Krzyzosiak et al., Nucleic Acids Res. 40:11-26, 2012; Budworth and McMurray, Methods Mol. Biol. 1010:3-17, 2013, hereby incorporated by reference). Triplet repeats are abundant in the human genome, and they tend to undergo expansion over generations. Approximately 40 human diseases are associated with the expansion of repeat sequences. Diseases caused by triplet expansions are known as Triplet Repeat Expansion Diseases (TRED). Healthy individuals have a variable number of triplet repeats, but there is a threshold beyond which a higher repeat number causes disease. The threshold varies in different disorders. The triplet repeat can be unstable. As the gene is inherited, the number of repeats may increase, and the condition may be more severe or have an earlier onset from generation to generation. When an individual has a number of repeats in the normal range, it is not expected to expand when passed to the next generation. When the repeat number is in the premutation range (a normal, but unstable repeat number), then the repeats may or may not expand upon transmission to the next generation. Normal individuals who carry a premutation do not have the condition but are at risk of having a child who has inherited a triplet repeat in the full mutation range and who will be affected. TREDs can be autosomal dominant, autosomal recessive or X- linked. The more common triplet repeat disorders are autosomal dominant. [00466] The repeats can be in the coding or noncoding portions of the mRNA. In the case of repeats within noncoding regions, the repeats may lie in the 5′ UTR, introns, or 3′ UTR sequences. Some examples of diseases caused by repeat sequences within coding regions are shown in Table A. Table A: Repeat Expansion Diseases in Which the Repeat Resides in the Coding Regions of mRNA

[00467] In some embodiments, the target RNA is one of those listed in Table A, or a precursor, isoform, fragment, or mutant thereof. [00468] Some examples of diseases caused by repeat sequences within noncoding regions of mRNA are shown in Table B. Table B: Repeat Expansion Diseases in Which the Repeat Resides in the Noncoding Regions of mRNA

[00469] In some embodiments, the target RNA is one of those listed in Table B, or a precursor, isoform, fragment, or mutant thereof. [00470] The toxicity that results from the repeat sequence can be direct consequence of the action of the toxic RNA itself, or, in cases in which the repeat expansion is in the coding sequence, due to the toxicity of the RNA and/or the aberrant protein. The repeat expansion RNA can act by sequestering critical RNA-binding proteins (RBP) into foci. One example of a sequestered RBP is the Muscleblind family protein MBNL1. Sequestration of RBPs leads to defects in splicing as well as defects in nuclear-cytoplasmic transport of RNA and proteins. Sequestration of RBPs also can affect miRNA biogenesis. These perturbations in RNA biology can profoundly affect neuronal function and survival, leading to a variety of neurological diseases. [00471] Repeat sequences in RNA form secondary and tertiary structures that bind RBPs and affect normal RNA biology. One specific example disease is myotonic dystrophy (DM1; dystrophia myotonica), a common inherited form of muscle disease characterized by muscle weakness and slow relaxation of the muscles after contraction (Machuca-Tzili et al., Muscle Nerve 32:1-18, 2005, hereby incorporated by reference). It is caused by a CUG expansion in the 3′ UTR of the dystrophia myotonica protein kinase (DMPK) gene. This repeat-containing RNA causes the misregulation of alternative splicing of several developmentally regulated transcripts through effects on the splicing regulators MBNL1 and the CUG repeat binding protein (CELF1) (Wheeler et al., Science 325:336-339, 2009, hereby incorporated by reference). Small molecules that bind the CUG repeat within the DMPK transcript would alter the RNA structure and prevent focus formation and alleviate the effects on these spicing regulators. Fragile X Syndrome (FXS), the most common inherited form of mental retardation, is the consequence of a CGG repeat expansion within the 5′ UTR of the FMR1 gene (Lozano et al., Intractable Rare Dis. Res.3:134-146, 2014, hereby incorporated by reference). FMRP is critical for the regulation of translation of many mRNAs and for protein trafficking, and it is an essential protein for synaptic development and neural plasticity. Thus, its deficiency leads to neuropathology. A small molecule targeting this CGG repeat RNA may alleviate the suppression of FMR1 mRNA and FMRP protein expression. Another TRED having a very high unmet medical need is Huntington’s disease (HD). HD is a progressive neurological disorder with motor, cognitive, and psychiatric changes (Zuccato et al., Physiol Rev.90:905-981, 2010, hereby incorporated by reference). It is characterized as a poly- glutamine or polyQ disorder since the CAG repeat within the coding sequence of the HTT gene leads to a protein having a poly-glutamine repeat that appears to have detrimental effects on transcription, vesicle trafficking, mitochondrial function, and proteasome activity. However, the HTT CAG repeat RNA itself also demonstrates toxicity, including the sequestration of MBNL1 protein into nuclear inclusions. One other specific example is the GGGGCC repeat expansion in the C9orf72 (chromosome 9 open reading frame 72) gene that is prevalent in both familial frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS) (Ling et al., Neuron 79:416-438, 2013; Haeusler et al., Nature 507:195-200, 2014, hereby incorporated by reference). The repeat RNA structures form nuclear foci that sequester critical RNA binding proteins. The GGGGCC repeat RNA also binds and sequesters RanGAP1 to impair nucleocytoplasmic transport of RNA and proteins (Zhang et al., Nature 525:56-61, 2015, hereby incorporated by reference). Selectively targeting any of these repeat expansion RNAs could add therapeutic benefit in these neurological diseases. [00472] The present invention includes a method of treating a disease or disorder wherein aberrant RNAs themselves cause pathogenic effects, rather than acting through the agency of protein expression or regulation of protein expression. In some embodiments, the target RNA is a repeat RNA, such as those described herein or in Table A or Table B. In some embodiments, the repeat RNA mediates or is implicated in a repeat expansion disease in which the repeat resides in the coding regions of mRNA. In some embodiments, the disease or disorder is a repeat expansion disease in which the repeat resides in the noncoding regions of mRNA. In some embodiments, the disease or disorder is selected from Huntington’s disease (HD), dentatorubral-pallidoluysian atrophy (DRPLA), spinal-bulbar muscular atrophy (SBMA), or a spinocerebellar ataxia (SCA) selected from SCA1, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, myotonic dystrophy (DM1 or dystrophia myotonica), Friedreich’s Ataxia (FRDA), a spinocerebellar ataxia (SCA) selected from SCA8, SCA10, or SCA12, or C9FTD (amyotrophic lateral sclerosis or ALS). [00473] In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Huntington’s disease (HD), frontotemporal dementia (FTD), myotonic dystrophy (DM1 or dystrophia myotonica), or Fragile X Syndrome. [00474] Also provided is a method of producing a small molecule that modulates the activity of a target repeat expansion RNA to treat a disease or disorder, comprising the steps of: screening one or more disclosed compounds for binding to the target repeat expansion RNA; and analyzing the results by an RNA binding assay disclosed herein. In some embodiments, the repeat expansion RNA causes a disease or disorder selected from HD, DRPLA, SBMA, SCA1, SCA2, SCA3, SCA6, SCA7, or SCA17. In some embodiments, the disease or disorder is selected from Fragile X Syndrome, DM1, FRDA, SCA8, SCA10, SCA12, or C9FTD. Target RNAs and Diseases/Conditions [00475] An association is known to exist between a large number of RNAs and diseases or conditions, some of which are shown below in Table C or Table D. Accordingly, in some embodiments of the methods described above, the target RNA transcript is selected from one of those in Table C or Table D. In some embodiments, the target RNA mediates or is implicated in a disease or disorder selected from one of those in Table C or Table D. Accordingly, the present invention further provides a method of treating a disease, disorder, or condition selected from one of those in Table C or Table D, comprising the step of administering to a patient in need thereof an effective amount of a disclosed compound. In some embodiments, the method up- or down- regulates the target RNA transcript as shown in the “UP/DOWN REGULATION DESIRABLE?” column in Table C or Table D, below, thus treating the disease, disorder, or condition. Table C: Exemplary Target RNA Transcripts and Associated Diseases

Table D: Additional Target RNA Transcripts

3. General Methods of Providing the Present Compounds [00476] The compounds of this invention may be prepared or isolated in general by synthetic and/or semi-synthetic methods known to those skilled in the art for analogous compounds and by methods described in detail in the Examples and Figures, herein. [00477] In the schemes and chemical reactions depicted in the detailed description, Examples, and Figures, where a particular protecting group (“PG”), leaving group (“LG”), or transformation condition is depicted, one of ordinary skill in the art will appreciate that other protecting groups, leaving groups, and transformation conditions are also suitable and are contemplated. Such groups and transformations are described in detail in March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7^th Edition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3^rd Edition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5^th edition, John Wiley & Sons, 2014, the entirety of each of which is hereby incorporated herein by reference. [00478] As used herein, the phrase “leaving group” (LG) includes, but is not limited to, halogens (e.g., fluoride, chloride, bromide, iodide), sulfonates (e.g., mesylate, tosylate, benzenesulfonate, brosylate, nosylate, triflate), diazonium, and the like. [00479] As used herein, the phrase “oxygen protecting group” includes, for example, carbonyl protecting groups, hydroxyl protecting groups, etc. Hydroxyl protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5^th edition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Examples of suitable hydroxyl protecting groups include, but are not limited to, esters, allyl ethers, ethers, silyl ethers, alkyl ethers, arylalkyl ethers, and alkoxyalkyl ethers. Examples of such esters include formate, acetates, carbonates, and sulfonates. Specific examples include formate, benzoyl formate, chloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate, 4,4- (ethylenedithio)pentanoate, pivaloate (trimethylacetyl), crotonate, 4-methoxy-crotonate, benzoate, p-benzylbenzoate, 2,4,6-trimethylbenzoate, carbonates such as methyl, 9-fluorenylmethyl, ethyl, 2,2,2-trichloroethyl, 2-(trimethylsilyl)ethyl, 2-(phenylsulfonyl)ethyl, vinyl, allyl, and p- nitrobenzyl. Examples of such silyl ethers include trimethylsilyl, triethylsilyl, t- butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and other trialkylsilyl ethers. Alkyl ethers include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, allyl, and allyloxycarbonyl ethers or derivatives. Alkoxyalkyl ethers include acetals such as methoxymethyl, methylthiomethyl, (2-methoxyethoxy)methyl, benzyloxymethyl, beta- (trimethylsilyl)ethoxymethyl, and tetrahydropyranyl ethers. Examples of arylalkyl ethers include benzyl, p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, and 2- and 4-picolyl. [00480] Amino protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, P. G. M. Wuts, 5^th edition, John Wiley & Sons, 2014, and Philip Kocienski, in Protecting Groups, Georg Thieme Verlag Stuttgart, New York, 1994, the entireties of which are incorporated herein by reference. Suitable amino protecting groups include, but are not limited to, aralkylamines, carbamates, cyclic imides, allyl amines, amides, and the like. Examples of such groups include t-butyloxycarbonyl (Boc), ethyloxycarbonyl, methyloxycarbonyl, trichloroethyloxycarbonyl, allyloxycarbonyl (Alloc), benzyloxocarbonyl (Cbz), allyl, phthalimide, benzyl (Bn), fluorenylmethylcarbonyl (Fmoc), formyl, acetyl, chloroacetyl, dichloroacetyl, trichloroacetyl, phenylacetyl, trifluoroacetyl, benzoyl, and the like. [00481] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens and nitriles can be interconverted by techniques well known in the art including, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. See, for example, March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7^th Edition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3^rd Edition, John Wiley & Sons, 2018, the entirety of each of which is incorporated herein by reference. Such interconversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below. [00482] One of skill in the art will appreciate that various functional groups present in compounds of the invention such as aliphatic groups, alcohols, carboxylic acids, esters, amides, aldehydes, halogens and nitriles can be interconverted by techniques well known in the art including, but not limited to reduction, oxidation, esterification, hydrolysis, partial oxidation, partial reduction, halogenation, dehydration, partial hydration, and hydration. Such groups and transformations are described in detail in March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, M. B. Smith and J. March, 7^th Edition, John Wiley & Sons, 2013, Comprehensive Organic Transformations, R. C. Larock, 3^rd Edition, John Wiley & Sons, 2018, and Protective Groups in Organic Synthesis, P. G. M. Wuts, 5^th edition, John Wiley & Sons, 2014, the entirety of each of which is hereby incorporated herein by reference. Such interconversions may require one or more of the aforementioned techniques, and certain methods for synthesizing compounds of the invention are described below in the Exemplification and Figures. EXEMPLIFICATION [00483] As depicted in the Examples below, exemplary compounds are prepared according to the following general procedures and used in biological assays and other procedures described generally herein. It will be appreciated that, although the general methods depict the synthesis of certain compounds of the present invention, the following general methods, and other methods known to one of ordinary skill in the art, can be applied to all compounds and subclasses and species of each of these compounds, as described herein. Similarly, assays and other analyses can be adapted according to the knowledge of one of ordinary skill in the art. Example 1: Evaluating the degradation of RNA by CCR4-NOT and the acceleration of degradation by bifunctional molecules [00484] An assay was established that showed the ability of CCR4-NOT to degrade RNA, and the acceleration of such degradation by bifunctional molecules. Fluorescently labeled RNA substrates were synthesized (Integrated DNA Technologies) with the following sequences: 5’ FAM– AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCUAAAA AAAAAA (SEQ ID NO:1) [00485] 5’ FAM– AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCU (SEQ ID NO:2). [00486] SEQ ID NO:2 corresponds to RNA Sequence X, while SEQ ID NO:1 corresponds to SEQ ID NO:2 with a poly-A tail. RNA Substrates (500 nM) were prepared in the following buffer conditions: 50 mM HEPES pH 7.3, 10 mM KCl, 45 mM NaCl, 2 mM MgCl₂, 0.1 mM TCEP, 0.5% glycerol. [00487] The CCR4-NOT complex was obtained by immunoprecipitation of cell engineered to express CNOT7-FKBPV. CNOT7 is a member of the CCR4-NOT complex, and immunoprecipitating the overexpressed CNOT7 fusion protein is expected to result in a pull down of the CCR4-NOT complex components. Specifically, H1299 cells were transfected with plasmid expressing HA-tagged CNOT7-FKBP12(F36V) fusion protein. After 24 hours, cells were pelleted and lysed in the following lysis buffer: 20 mM HEPES pH 7.3, 0.2 mM EGTA, 10% glycerol, 0.1 mM DTT with Complete EDTA-free protease inhibitors (Millipore). After freeze-thawing, NaCl was added to a concentration of 400 mM and lysates were pelleted to clear cellular debris. Cleared lysate was adjusted to buffer conditions containing 0.1% NP-40 and 150 mM NaCl before being applied to Pierce Anti-HA magnetic beads (ThermoFisher) at 4 °C for 2-20 hours with end-over- end rotation. After washing, the bound protein fraction was competitively eluted with 2 mg/mL HA peptide (ThermoFisher) in activity assay buffer at 4 °C for 2-20 hours. [00488] FIG. 2 shows the bifunctional molecules that were evaluated for their ability to accelerate degradation of RNA by the CCR4-NOT complex. The bifunctional molecules consist of a CCR4-NOT binding moiety (Bach M et al. J Med Chem.201760(10):4147-4160) coupled to a linker and the following rSM:

which binds to the RNA sequence of AST-X. The positive control bifunctional compound consists of the rSM conjugated to AP1867 (a small molecule binder of FKBP12(F36V)), resulting in rSM- AP1867tag. [00489] The assay that was used to evaluate the bifunctional molecules is depicted in the top right panel in FIG.3. Fluorescently labeled RNA substrates were refolded in the presence of Mg²⁺ and incubated with increasing concentrations of bifunctional molecules before the enzymatic reaction was initiated with the elution fraction (containing CNOT7-FKBP12(F36V) fusion protein, and associated proteins from the CCR4-NOT complex) from the immunoprecipitation protocol above. The reactions were incubated at 37 °C, with specified timepoints removed from the reaction and combined with 2X formamide RNA loading buffer with 10 mM EDTA before boiling for 3 minutes to quench the reaction. Samples were run on a pre-warmed 15% TBE-Urea polyacrylamide gel at 180V for 90 minutes and then imaged using Cy2 settings on the Azure Biosystems 600 Imaging System. As shown in FIG.3, an increase in the deadenylation rate of the RNA substrate was observed when Compound I-305 is compared to no compound control (DMSO) at both 2 uM and 10 uM concentrations. This shows that heterobifunctional molecules that bind target RNA, the first functionality, and the CCR4-NOT complex as the second functionality, can accelerate the degradation of target RNA by the CCR4-NOT complex. [00490] FIG. 4 shows that the degrader activity of the bifunctional molecules can be outcompeted with unconjugated (“free”) rSM and the unconjugated (“free”) CCR4-NOT binding moiety. The middle panel shows that addition of Compound I-305 accelerates the degradation of the target RNA as compared to DMSO (no bifunctional molecule, left panel). Addition of an excess of the free rSM together with the bifunctional molecule abrogates the activity of the bifunctional molecule as the free rSM binds to the target RNA (see right hand panel and bar graph). A similar observation is made when an excess of the unconjugated (“free”) CCR4-NOT binder is added to the reaction with the bifunctional molecule, in that the free CCR4-NOT binder outcompetes the bifunctional compound for binding to the CCR4-NOT complex, thereby abrogating the activity of the bifunctional compound (see bar graph). As expected, the free CCR4- NOT binder was not able to outcompete the positive control, which has a different binding site from the CCR4-NOT binder (data not shown). Example 2: Results for degradation of RNA by CCR4-NOT and the acceleration of degradation by bifunctional molecules [00491] A selected number of compounds was also evaluated using the gel shift assay as described in Example 1. Table 4 shows the activity by gel shift assay for some compounds described herein. The symbol “+” indicates an activity observed as compared to DMSO control. The symbol “-” indicates no activity activity observed as compared to DMSO control. A control experiment in which the CCR4NOT complex was omitted did not show any degradation (data not shown). The positive control bifunctional compound consists of the rSM conjugated to AP1867 (a small molecule binder of FKBP12(F36V)). The gel shifts for selected compounds are also shown in FIG.5. Table 4

Example 3: Biochemical AMP-Glo assay to measure deadenylation [00492] The CCR4-NOT complex was generated via a pulldown method. First, H1299 cells were transfected with a plasmid expressing CNOT7 with a C-terminal FKBP(F36V) fusion and an HA affinity tag. 24 hours later, the cells were harvested and lysed via hypotonic lysis. Cleared lysate was applied to equilibrated Anti-HA Magnetic Beads (Pierce) for 24 hours, rotating at 4 °C. Beads were then washed three times, and CNOT7 (and associated CCR4-NOT complex members) were eluted via excess synthetic HA peptide into assay buffer. Glycerol was then added to a final concentration of 5%. Immunoblotting and/or mass spectrometry was performed to confirm the presence of CCR4-NOT complex members. Activity assays were performed on each batch to assess overall activity and choose dilution factors and timepoints for subsequent experiments. Triplicate deadenylation reactions were carried out by refolding 8 microM fluorescently labeled RNA substrate (5’ 6-FAM- AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCUAAAA AAAAAA) SEQ ID NO:1 in the presence of 100 mM KCl and 3 mM MgCl2 at 37C for 30 minutes and then pre-incubating the RNA with 100 microM bifunctional molecule at room temperature for 30 minutes before initiating the deadenylation reaction with the addition of CCR4-NOT complex. In the reactions, the final concentration of RNA was 0.8 microM and the final concentration of compounds was 10 microM. After 20 minutes at 37 °C, reactions were quenched by adding EDTA to a final concentration of 10 mM. AMP detection was performed using the AMP-Glo kit from Promega. In short, 10 microL quenched reactions were mixed with 10 microL AMP-Glo Reagent I, shaken at 500 rpm for 2 min, then centrifuged at 1000 rpm for 1 min. Plate was incubated at room temperature for 1 hour. Then, AMP Detection Solution was prepared by mixing Kinase-Glo and AMP Reagent II at 100:1 proportion, and 20 microL of AMP Detection Solution is added to samples. Again, plates were shaken at 500 rpm for 2 min, then centrifuged at 1000 rpm for 1 min. Plate was incubated at room temperature for 1 hour. Luminescence readings were taken using an Envision plate reader. Raw luminescence values were normalized to DMSO background and values for each compound were reported as fold change over DMSO. [00493] The ability of selected heterobifunctional compounds to accelerate deadenylation was shown in Table 5. A control experiment in which the CCR4NOT complex was omitted did not show any degradation (data not shown). The positive control bifunctional compound consists of the rSM conjugated to AP1867 (a small molecule binder of FKBP12(F36V)). [00494] Table 5 and Table 6 show the activity by biochemical AMP-glo assay for some compounds described herein. Table 5

[00495] Table 6 shows the activity by biochemical AMP-glo assay for some additional compounds described herein. Table 6

Example 4: Biochemical tag-less AMP-Glo assay to measure deadenylation

[00497] The CCR4-NOT complex was generated via a pulldown method. First, H1299 cells were transfected with a plasmid expressing CNOT7 with a HA affinity tag. As compared to Example 3 (the AMP-Glo assay), the CNOT protein does not contain the FKBPV tag. 24 hours later, the cells were harvested and lysed via hypotonic lysis. Cleared lysate was applied to equilibrated Anti-HA Magnetic Beads (Pierce) for 24 hours, rotating at 4 °C. Beads were then washed three times, and CNOT7 (and associated CCR4-NOT complex members) were eluted via excess synthetic HA peptide into assay buffer. Glycerol was then added to a final concentration of 5%. Immunoblotting and/or mass spectrometry was performed to confirm the presence of CCR4- NOT complex members. Activity assays were performed on each batch to assess overall activity and choose dilution factors and timepoints for subsequent experiments. Triplicate deadenylation reactions were carried out by refolding 8 microM fluorescently labeled RNA substrate (5’ 6-FAM- AGGGAAGGGCUGGGAUGGCAGUAGACUUGGCUUUCCCAUUACUCUUUUCUAAAA AAAAAA) SEQ ID NO:1 in the presence of 100 mM KCl and 3 mM MgCl₂ at 37C for 30 minutes and then pre-incubating the RNA with 100 microM bifunctional molecule at room temperature for 30 minutes before initiating the deadenylation reaction with the addition of CCR4-NOT complex. In the reactions, the final concentration of RNA was 0.8 microM and the final concentration of compounds was 10 microM. After 20 minutes at 37 °C, reactions were quenched by adding EDTA to a final concentration of 10 mM. AMP detection was performed using the AMP-Glo kit from Promega. In short, 10 microL quenched reactions were mixed with 10 microL AMP-Glo Reagent I, shaken at 500 rpm for 2 min, then centrifuged at 1000 rpm for 1 min. Plate was incubated at room temperature for 1 hour. Then, AMP Detection Solution was prepared by mixing Kinase-Glo and AMP Reagent II at 100:1 proportion, and 20 microL of AMP Detection Solution is added to samples. Again, plates were shaken at 500 rpm for 2 min, then centrifuged at 1000 rpm for 1 min. Plate was incubated at room temperature for 1 hour. Luminescence readings were taken using an Envision plate reader. Raw luminescence values were normalized to DMSO background and values for each compound were reported as fold change over DMSO. [00498] The ability of selected heterobifunctional compounds to accelerate deadenylation was shown in Table 7. A control experiment in which the CCR4NOT complex was omitted did not show any degradation (data not shown). [00499] Table 7 shows the activity by biochemical tag-less AMP-glo assay for some compounds described herein. Compounds that show activity in the AMP-Glo assay (Example 3; Tables 5 and 6), but not in the tag-less AMP-Glo assay (Example 4, Table 7) are thought to interact with the FKBPV tag. [00500] Table 7 shows the activity by biochemical AMP-glo tagless assay for some compounds described herein. Table 7

Claims

CLAIMS 1. A compound of Formula A:

or a pharmaceutically acceptable salt thereof, wherein: RNA Binder is a moiety that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the RNA Binder to the DFL; wherein the DFL binds to or recruits a decay factor; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript. 2. The compound of claim 1, wherein the RNA Binder is an oligonucleotide, a polypeptide or an RNA-binding small molecule (rSM). 3. The compound of claim 1, wherein the RNA Binder is an oligonucleotide. 4. The compound of claim 2, wherein the RNA Binder is an rSM. 5. A compound of Formula B:

B or a pharmaceutically acceptable salt thereof, wherein: rSM is an RNA-binding small molecule that binds to a target RNA transcript; DFL is a Decay Factor-recruiting Ligand; and -L¹- is a bivalent linker group that covalently connects the rSM to the DFL; wherein the DFL binds to or recruits one or more decay factors that degrade the target RNA transcript.

6.

or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3. 7. The compound of claim 5 or 6, wherein R¹ is selected from

, , ,

8. The compound of any one of claims 5 to 7, wherein R² is selected from

,

9. The compound of any one of claims 5 to 8, wherein R³ is

10. The compound of any one of claims 5 to 9, wherein -L¹- is

12. The compound of any one of claims 5 to 11, wherein ring A is phenyl. 13. The compound of any one of claims 5 to 12, wherein R^A is F. 14. The compound of any one of claims 5 to 13, wherein R^B is selected from F, Br, Me, Et, - OMe, , and . 15. The compound of any one of claims 5 to 14, wherein R^C is selected from F and Me. 16. The compound of claim 5, wherein

is a compound of Formula Ia:

Ia or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, and a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; -L¹- is a covalent bond or a C_1-20 bivalent straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy-; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶ is hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)R, -C(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, -S(O)R, -S(O)₂R, or - N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; and s is 0, 1, 2, or 3. 17. The compound of claim 16, wherein R¹ is selected from

, , , , ,

18. The compound of claim 16 or 17, wherein R² is selected from

, ,

. 19. The compound of any one of claims 16 to 18, wherein R³ is

. The compound of any one of claims 16 to 19, wherein -L¹- is

. 21. The compound of any one of claims 16 to 20, wherein R⁴ is selected from

,

22. The compound of any one of claims 16 to 21, wherein ring A is phenyl. 23. The compound of any one of claims 16 to 22, wherein R^A is F. 24. The compound of any one of claims 16 to 23, wherein R^B is selected from F, Br, Me, Et, -

25. The compound of any one of claims 16 to 24, wherein R^C is selected from F, and Me. 26. The compound of claim 5, wherein

is a compound of Formula Ib:

or a pharmaceutically acceptable salt thereof, wherein: R¹ is selected from C_1-4 aliphatic optionally substituted with 0 to 4 halogens, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R¹ is substituted with q instances of R^A; R² is selected from C_1-6 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, C_1-6 aliphatic optionally substituted with a phenyl, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an 8- 10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-10 membered bicyclic carbocyclic ring, an 8-14 membered tricyclic carbocyclic ring, a 3-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-10 membered bicyclic heterocyclic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R² is substituted with r instances of R^B; R³ is a covalent bond or a bivalent C_1-20 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, -C(O)-, - C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 methylene units of the chain are optionally replaced with -CH₂CH₂O-; -L¹- is a covalent bond, a bivalent or trivalent C_1-28 straight or branched hydrocarbon chain wherein 1, 2, or 3 methylene units of the chain are independently and optionally replaced with -O-, - C(O)-, -C(O)O-, -OC(O)-, -N(R)-, -C(O)N(R)-, -(R)NC(O)-, -OC(O)N(R)-, -(R)NC(O)O-, - N(R)C(O)N(R)-, -S-, -SO-, -SO₂-, -SO₂N(R)-, -(R)NSO₂-, -C(S)-, -C(S)O-, -OC(S)-, - C(S)N(R)-, -(R)NC(S)-, -(R)NC(S)N(R)-, or -Cy; and wherein 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 methylene units of the chain are optionally replaced with -CH₂CH₂O-; each R is independently hydrogen or an optionally substituted group selected from C_1-6 aliphatic, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, phenyl, an 8- 10 membered bicyclic aromatic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each -Cy is independently an optionally substituted 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, optionally substituted phenylene, an optionally substituted 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, an optionally substituted 8-10 membered bicyclic or bridged bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or an optionally substituted 8-10 membered bicyclic or bridged bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; R⁴ is selected from C_1-4 aliphatic optionally substituted with 1 halogen, -OR, -C(O)OR, -N(R)₂, - OC(O)R, or -C(O)N(R)₂, C_1-4 aliphatic optionally substituted with a 3-6 membered saturated or partially unsaturated monocyclic carbocyclic ring, C_1-4 aliphatic optionally substituted with a 4-6 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, a 3-8 membered saturated or partially unsaturated monocyclic carbocyclic ring, a 4-8 membered saturated or partially unsaturated monocyclic heterocyclic ring having 1-2 heteroatoms independently selected from nitrogen, oxygen, and sulfur, phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-6 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, and sulfur; wherein R⁴ is substituted with s instances of R^C; Ring A is selected from phenyl, an 8-10 membered bicyclic aromatic carbocyclic ring, a 5-8 membered monocyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, and an 8-10 membered bicyclic heteroaromatic ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur; each R⁵ is independently -R, halogen, -CN, -NC, -C(O)OR, -OC(O)R, -C(O)N(R)₂, -N(R)C(O)R, -N(R)C(O)N(R)₂, -OC(O)N(R)₂, -N(R)C(O)OR, -OR, -N(R)₂, -NO₂, -N₃, -SR, -S(O)R, - S(O)₂R, -S(O)₂N(R)₂, or -NRS(O)₂R; R⁶, R⁷, R⁸ and R⁹ are each independently hydrogen or a C_1-4 aliphatic group; each R^A, R^B, and R^C is independently selected from halogen, R, C_1-4 aliphatic substituted with 1, 2, or 3 halogens or 1 -CN, =O, -OR, -N(R)₂, or -SR group, -CN, -NC, -C(O)R, -C(O)OR, - OC(O)OR, -OC(O)R, -C(O)N(R)₂, -OC(O)N(R)₂, -N(R)₂C(O)R, -OR, -N(R)₂, -NO₂, -SR, - S(O)R, -S(O)₂R, or -N(R)SO₂R; -X- is a single covalent bond, -O-, -S-, -S(O)-, -S(O)₂-, or -N(R)-; m is 0, 1, 2, 3, or 4; n is 1, 2, or 3; p is 0, 1, 2, or 3; q is 0, 1, 2, or 3; r is 0, 1, 2, or 3; s is 0, 1, 2, or 3; t is 0, 1, 2, or 3; u is 0, 1, 2, or 3; and is a single or a double bond. 27. The compound of claim 26, wherein R¹ is selected from

, , , ,

30. The compound of any one of claims 26 to 29, wherein -L¹- is selected from

, ,

31. The compound of any one of claims 26 to 30, wherein R⁴ is selected from

, ,

32. The compound of any one of claims 26 to 31, wherein ring A is phenyl. 33. The compound of any one of claims 26 to 32, wherein R^A is selected from F, CF₃, and Me. 34. The compound of any one of claims 26 to 33, wherein R^B is selected from F, Br, Cl, OH, Me, Et, Bu, t-Bu, i-Bu, -OMe, Ph, -SO₂Me, -NHC(O)CH3, -C(O)Ot-Bu, -OC(O)NMe2, -

35. The compound of any one of claims 26 to 34, wherein R^C is selected from F, Cl, Me, -CF₃, -SO₂F and -OMe. 36. The compound of any one of claims 5 to 35, wherein the compound is of Formula II:

II or a pharmaceutically acceptable salt thereof. 37. The compound of any one of claims 5 to 35, wherein the compound is of Formula III:

III or a pharmaceutically acceptable salt thereof. 38. The compound of any one of claims 5 to 35, wherein the compound is of Formula IV:

IV or a pharmaceutically acceptable salt thereof. 39. The compound of any one of claims 5 to 35, wherein the compound is of Formula V:

V or a pharmaceutically acceptable salt thereof. 40. The compound of any one of claims 5 to 35, wherein the compound is of Formula VI:

or a pharmaceutically acceptable salt thereof.

41. The compound of any one of claims 5 to 35, wherein the compound is of Formula VII:

VII or a pharmaceutically acceptable salt thereof. 42. The compound of any one of claims 5 to 35, wherein the compound is of Formula VIII:

VIII or a pharmaceutically acceptable salt thereof. 43. The compound of any one of claims 5 to 35, wherein the compound is of Formula IXa, Formula IXb or Formula IXc:

or a pharmaceutically acceptable salt thereof.

44. A compound of any of the preceding claims, wherein the decay factor is a protein that binds or interacts with RNA (an RBP) and wherein the interaction of the RBP with the RNA leads to modulation of the target RNA transcript in vivo. 45. The compound of claim 44, wherein the RBP is part of the CCR4-NOT (Carbon Catabolite Repression-Negative On TATA-less) complex. 46. The compound of any one of the preceding claims, wherein the target RNA transcript is an mRNA or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. 47. The compound of any one of the preceding claims, wherein the target RNA transcript is selected from one of those listed in Table C or D; or a precursor, isoform, unspliced isoform, splicing intermediate, fragment, or mutant thereof. 48. The compound of any one of the preceding claims, wherein the rSM is selected from any one of those described in the disclosure under the heading RNA-Binding Small Molecules (rSMs). 49. The compound of any one of the preceding claims, wherein the rSM is one of those shown in Table 2. 50. A pharmaceutical composition comprising the compound of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. 51. A method of modifying the amount of a protein in a cell, the method comprising administering the compound or composition of any of the preceding claims, or a pharmaceutically acceptable salt thereof, that acts on a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, in an amount sufficient to modify the amount of the protein in the cell. 52. The method of claim 51, wherein modifying the amount of a protein in a cell is reducing the amount of protein in the cell.

53. A method of modulating the availability for protein translation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition of any one of the preceding claims, or a pharmaceutically acceptable salt thereof, that binds to the target RNA transcript or an isoform, fragment, or mutant thereof. 54. A method of modulating the translation of a target protein or mutant thereof, comprising contacting a target RNA transcript or a precursor, isoform, fragment, or mutant thereof with the compound or composition of any one of preceding claims, or a pharmaceutically acceptable salt thereof. 55. A method of decreasing the half-life or increasing degradation of a target RNA transcript or a precursor, isoform, fragment, or mutant thereof, comprising contacting the target RNA transcript or the precursor, isoform, fragment, or mutant thereof with the compound or composition of any one of the preceding claims, or a pharmaceutically acceptable salt thereof. 56. A method of treating a disease, comprising administering to a subject in need thereof the compound or composition of any one of preceding claims, or a pharmaceutically acceptable salt thereof. 57. The method of claim 56, wherein the disease is characterized by an aberrant level of a protein in a cell. 58. The method of claim 57, wherein the disease is one of those listed in Table C or D. 59. The method of claim 58, wherein the disease is a cancer.