WO2024173816A1

WO2024173816A1 - Methods of detecting telomere-encoded dipeptide repeat proteins and therapeutic applications

Info

Publication number: WO2024173816A1
Application number: PCT/US2024/016186
Authority: WO
Inventors: Jack D. GRIFFITH; Taghreed M. AL TURKI
Original assignee: The University Of North Carolina At Chapel Hill
Priority date: 2023-02-17
Filing date: 2024-02-16
Publication date: 2024-08-22

Abstract

Disclosed herein is the discovery of two telomere-encoded dipeptide repeat proteins, repeating VR protein and repeating GL protein. The properties of the proteins and their association with telomere health, biological age, and cancer are disclosed. Antibodies specific for telomere-encoded dipeptide repeat proteins, methods for detecting the proteins, and therapeutic approaches are also provided herein.

Description

Attorney Docket No.035052/607414 METHODS OF DETECTING TELOMERE-ENCODED DIPEPTIDE REPEAT PROTEINS AND THERAPEUTIC APPLICATIONS CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No.63/485,766, filed February 17, 2023. STATEMENT OF GOVERNMENT SUPPORT [0002] This invention was made with government support under Grant Nos. GM031819, ES013773, ES031635 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO A SEQUENCE LISTING [0003] The Sequence Listing written in file 607414SEQLIST is 34 kilobytes, was created on February 14, 2024, and is hereby incorporated by reference. BACKGROUND [0004] A telomere is a region of repetitive DNA sequences found at the end of a chromosome in all eukaryotic organisms. Telomeres protect the ends of the chromosomes from unwanted recombination with other chromosomes and sequester the ends of the DNA so that they do not activate pathways signaled by broken DNA ends. As a result of the constant, slow diminution of the telomere length over many cell divisions, telomeres provide an aging clock which limits the lifespan of normal cells. [0005] In humans and many other organisms, telomeres guard against prolonged uncontrolled division and progression to cancer. Thus, telomeres are of great interest and concern both at the level of molecular biologic studies, and studies of aging and cancer. However, better methods are needed for the detection of telomere health including status, signaling, and function for scientific research and diagnostic medicine. The present disclosure meets these shortcomings. Attorney Docket No.035052/607414 BRIEF SUMMARY [0006] In one embodiment, VR and GL peptides were synthesized and found to form amyloid fibers which cause cellular toxicity. Accordingly, aspects of this disclosure relate to chemically synthesized telomere-encoded dipeptide repeat proteins selected from repeating VR protein and repeating GL protein. [0007] In another embodiment, a rabbit polyclonal antibody was raised against a repeating VR peptide, and the antibody was found to be highly specific to repeating VR protein. Thus, aspects of this disclosure relate to isolated antibodies specific for repeating VR protein and/or repeating GL protein. [0008] In some aspects, the disclosure relates to a method of producing an antibody for a telomere-encoded dipeptide repeat protein comprising administering to a subject the repeating VR protein or the repeating GL protein, and isolating the antibody from the subject. [0009] Elevated levels of repeating VR protein were detected in human sarcoma cells, cancerous tissue, and cells from a human patient with a genetic disease affecting telomere health. Elevated levels of repeating VR protein were also detected in a human cancer derived cells treated with a drug developed for cancer treatment, and in cells undergoing mitosis. Aspects of this disclosure relate to a method of detecting a telomere-encoded dipeptide repeat proteins comprising determining a level of repeating VR protein or repeating GL protein in a biological sample and comparing the level of repeating VR protein or repeating GL protein to a control sample. [0010] In some aspects, the determined level of repeating VR protein or repeating GL protein is used as a marker for studying biological age, studying telomere status and health, detecting cancer or cancer progression, detecting genetic diseases associated with telomere disfunction, or detecting systemic inflammation. [0011] In some embodiments, the biological sample comprises blood from a vertebrate animal. In other embodiments, the biological sample comprises cells or tissue from a vertebrate animal. In some embodiments, the vertebrate animal is a human. In other embodiments, the vertebrate animal is chosen from the group consisting of non-human mammals, reptiles, amphibians, birds or fish. [0012] In some embodiments, the method of detecting the telomere-encoded dipeptide repeat protein comprises an assay. Attorney Docket No.035052/607414 [0013] In some embodiments, the method of detecting the telomere-encoded dipeptide repeat protein comprises the use of an antibody raised to repeating VR protein or repeating GL protein. [0014] In some embodiments the assay comprises an immunoassay using an antibody specific for repeating VR protein or repeating GL protein. [0015] In some embodiments, the immunoassay is a continuous flow assay. [0016] In some embodiments the continuous flow assay is a chip assay comprising flowing a biological sample through a chip, wherein the chip comprises a central enclosed chamber that is optically transparent through the top and bottom surface, and the surface of the central enclosed chamber is coated with single strand (ss) DNA; flowing a solution comprising a primary antibody specific for repeating VR protein through the chip; and detecting the presence of the primary antibody. [0017] In one embodiment, the detection comprises passing light of a selected wavelength through the chamber; followed by measuring the intensity of fluorescence emitted, wherein the primary antibody comprises a fluorescent tag which is excited by the selected wavelength. In another embodiment, the detection comprises flowing a solution comprising a secondary antibody through the chip; flowing a wash solution through the chip; passing light of a selected wavelength through the chamber; and measuring an intensity of fluorescence emitted, wherein the secondary antibody is selective for the primary antibody and comprises a fluorescent tag that is excited by the selected wavelength. In another embodiment, the method of detection comprises optically measuring an amount of the primary antibody bound to ssDNA on the surface of the chip using surface plasmon resonance detection. [0018] In some embodiments, the immunoassay is a sandwich bead-based assay. The presence and concentration of the repeating VR protein or repeating GL protein in fluids including serum or plasma may be measured with specific antibodies to the repeating VR protein or repeating GL protein and beads to which the antibodies are attached. Analysis may involve activation of specific dyes via lasers in a liquid flow optical system. [0019] Aspects of this disclosure also relate to a method of detecting telomere-encoded dipeptide repeat proteins in a blood sample of a subject wherein the level of the repeating VR protein or the repeating GL protein that is elevated in the blood of the subject compared to a control level indicates that the subject has a disease associated with telomere dysfunction. Attorney Docket No.035052/607414 [0020] In one aspect, the method of detection comprises cytological or histological analysis, wherein the level of the repeating VR protein or the repeating GL protein that is elevated in the cells or the tissue compared to a control level indicates that the subject has a disease associated with telomere dysfunction. [0021] Other aspects of the disclosure relate to a method of treatment of a subject having a disease associated with telomere dysfunction, wherein the treatment comprises decreasing or preventing increase of a level of repeating VR protein or repeating GL protein in the subject. [0022] In one aspect, the method of treatment of a subject having a disease associated with telomere dysfunction comprises the therapeutic use of an antibody specific for repeating VR protein or repeating GL protein, wherein the antibody targets aberrant expression of repeating VR protein or repeating GL protein. BRIEF DESCRIPTION OF FIGURES [0023] Figures 1A-1P show electron microscopic visualization of filaments and networks generated by GL, GA, and VR dipeptide proteins. An 18 amino acid (a.a.) peptide containing 9 GL repeats (GL)₉ (SEQ ID NO:4) and a 14 a.a. peptide containing 7 GA repeats (GA)₇ (SEQ ID NO:6) were taken up at 2 mg/mL in 10 mM Hepes (pH 7.5), 20 mM NaCl, 1 mM EDTA buffer and incubated on ice followed by dilution to 20 µg/mL. For rotary metal shadow casting (Figures 1A, 1C, and 1E) the samples were mixed with a buffer containing spermidine, adsorbed to glow-discharge treated thin carbon foils, dehydrated, and rotary shadow cast with tungsten. Figure 1B shows field of (GL)9 fibers (SEQ ID NO:4) frozen in vitreous ice and imaged by cryoEM. Figure 1D shows negative staining of GA filaments carried out by adsorbing samples to thin glow discharge treated carbon foils and staining with 2% uranyl acetate. Figures 1E, and 1F show VR10-bio dipeptide (SEQ ID NO:1) taken up at 2 mg/mL in PBS buffer, then diluted to 20 µg/mL and prepared for EM by rotary metal shadow casting (Figure 1E) or negative staining (Figure 1F). TEM imaging was at 40 kV (Figures 1A, 1C, and 1E), 80 kV (Figures 1D, and 1F) and 200 kV (Figure 1B). Figures 1A, 1C, and 1E shown in reverse contrast. Magnification bars are shown for each field. Figure 1G shows M13 ssDNA (SEQ ID NO:13) visualized by TEM in a buffer of 10 mM Hepes (pH 7.5), 50 mM NaCl. Figure 1H shows M13 ssDNA (SEQ ID NO:13) in the same buffer incubated with a (VR)₁₀-bio (SEQ ID NO:1) at a 1:1 mass ratio. Figure 1I shows a field of 157 nucleotide (nt) TERRA molecules Attorney Docket No.035052/607414 (SEQ ID NO:12) (small dots) visualized by TEM. Figure 1J shows a 157 nt TERRA molecules (SEQ ID NO:12) incubated with (VR)10-bio (SEQ ID NO:1) at a 1:1 mass ratio. Figure 1K shows a 3 kb pRST5 (SEQ ID NO:16) plasmid DNA consisting of a mixture of open circular and supertwisted forms mixed with (VR)10-bio (SEQ ID NO:1) at a 1:1 mass ratio and visualized by TEM. Samples shown in Figures 1G-1K were prepared for TEM as in A,C,E at DNA or RNA concentrations of 1 microgram/ml and incubations carried out for 20 min at room temperature. Magnification bars in Figures 1G, 1H, and 1K equal 50 nM. Figure 1L shows 500 ng aliquots of a mixture of 3 pRST5 DNA fragments (1937, 1018, and 558 bp) were incubated with 0, 125, 250, 375, 500, 750, and 1000 ng of (VR)₁₀-bio (SEQ ID NO:1) (lanes 1-8 respectively) and electrophoresed on an agarose gel. In Figures 1M-1P a 3 kb pRST5 plasmid (SEQ ID NO:16) (pGLGAP) containing a 400 bp displaced arm and a 5 nt gap at the base of the fork was incubated with (VR)10-bio (SEQ ID NO:1), then further incubated with streptavidin as a tag for the presence of (VR)₁₀-bio (SEQ ID NO:1) for 20 min. This was followed by preparation for TEM. DNAs were scored sequentially as they were encountered in fields observed in the TEM. Figure 1M shows replication fork DNA alone. Figures 1N-1P show replication fork DNA incubated with (VR)₁₀-bio (SEQ ID NO:1) and streptavidin. The molecule in Figure 1P shows a fork which had undergone slippage to generate a 4-armed “chicken foot” structure. Bar equals 50 nm for Figure 1M-1P. [0024] Figure 2 shows validation of VR specific antibodies by immunoblotting and direct expression of VR in cells. In Figure 2A a peptide consisting of 4 VR repeats and a short linker (SEQ ID NO:2) was used to raise polyclonal rabbit antibodies and was affinity-purified on a column containing (VR)₁₅ which lacks the linker (SEQ ID NO:3). Increasing amounts of (VR)₁₅ (SEQ ID NO:3), and (GL)₉ (negative control) (SEQ ID NO:4) were blotted onto nitrocellulose membranes and incubated with the 1:1000 VR antibody for overnight. The blot was then stained with a conjugated horseradish peroxidase secondary antibody (1:3000) (NA934V Cytiva) and the signals developed and detected using Clarity western ECL substrate (1705061 Bio-Rad) and a Bio-Rad imager. Figure 2B shows a schematic of a DNA construct containing the CMV promoter followed by a 3X Flag tag and 60 repeats of the VR dipeptide and terminated in a stop codon (SEQ ID NO:7). This construct was inserted into a pcDNA3.1(+) vector (GenScript Inc) for transfection. Figure 2C shows representative confocal images (Z-projections) of U2OS cells overexpressing the 3X Flag-VR60 construct. Cells were fixed, co-immunostained with Flag and Attorney Docket No.035052/607414 VR antibodies. The Flag antibody was labeled using Alexa fluor 488 (top panel) and the VR antibody labeled with Alexa 594 (middle panel). The white arrows indicate dot-like aggregates. The merged image (bottom panel) shows the colocalization of Flag and VR (yellow signals) in the nucleus (DAPI-blue). White arrows indicate the VR signals (red) that do not overlap with Flag (green). Figure 2D shows a graph of the percentage of Flag colocalized with VR. Percentage colocalization was determined by calculating Mander’s Colocalization Coefficient (MCC) using ImageJ and the JACoP plugin within the Region of Interest (ROI) for individual cells. Colocalization was measured by applying Mander’s Overlap Coefficient (MOC) method. The value of MOC can range from 0 to 1, where 0 represents no overlap and 1 represents maximum overlap. The fraction of red and green signals (in pixels) that contribute to the overlap area were determined. Fifty cells were quantified from three independent experiments. Error bars indicate standard error. All images are single confocal plane images. [0025] Figures 3A-3C shows Western analysis of SDS PAGE gels which reveals specific staining of the repeating VR protein. Figure 3A shows a Western Blot of increasing amounts of VR15 dipeptide protein. Three independent experiments were performed. Figure 3B shows Ponceau-S staining of U2OS, U2OS overexpressing (VR)₆₀ (SEQ ID NO:7), and FSK cell line revealing that total protein from the three samples, including the expected band at the top of the gel, was successful transferred. Protein molecular weight markers are in the left lane. In Figure 3C the destained PVDF membrane in Figure 3B was subjected to Western Blot analysis. Beta actin was detected and was used as a loading control. Three independent experiments were performed. [0026] Figures 4A-4D show the identification and characterization of VR peptides in U2OS (ALT), ICF and primary human cells FSK. Figure 4A shows Representative confocal images (Z- projections) showing nuclei (DAPI- blue), nuclear VR foci heterogeneous in size and intensity (green), and actin rhodamine-phalloidin (red). Figure 4B shows representative confocal images of nuclear and cytoplasmic VR staining sites. Figure 4C shows the percentage of VR positive cells (≥ 5 VR foci) in U2OS, ICF and FSK. Data presented are the ± standard error of the mean of three independent experiments. Unpaired two-tailed t-test; *P < 0.05, **P < 0.01, ***P < 0.01, ****P < 0.0001, ***P = 0.0003 for U2OS versus FSK, and **P =0.0019 for ICF versus FSK. Figure 4D shows the percentage of VR foci localized in the nucleus or cytoplasm. Unpaired T two-tailed t-test; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, **P = 0.002 Attorney Docket No.035052/607414 for nuclear U2OS versus cytoplasmic U2OS cells, **P = 0.006 for nuclear FSK versus cytoplasmic FSK cells. [0027] Figures 5A-5D show that alteration of TERRA levels cause aggregation of VR dipeptides. Figure 5A shows representative confocal images (Z-projections) of 100nM control (SEQ ID NO:11) and TERRA-LNA GapmeR (SEQ ID NO:10) treated U2OS 24 h after transfection. TERRA molecules were detected using the TelC-Alexa647 probe (upper and lower left panel). Nuclei were stained with DAPI and merged images with TERRA signals reveal nuclear and cytoplasmic TERRA (upper and lower right panels). In Figure 5B quantification of TERRA signals from Figure 5A in U2OS cells show ∼40% depletion of TERRA. Data presented are the ± standard error of the mean of two independent experiments. Two-tailed, unpaired t-test *P < 0.05, p=0.04. In Figure 5C U2OS cells from Figure 5A were immunolabeled with the rabbit VR primary antibody overnight at 4 °C and labeled with Alexa flour 488 secondary antibody. The large solid VR aggregates (left bottom panel) were distinguished from the small spherical VR signals. Nuclei were stained with DAPI and merged images with VR dipeptides show the nuclear signals. Figure 5D shows a quantification of the percentage of cells showing an accumulation of large solid nuclear aggregates. No bar is shown for the control-GapmeR as no cells with large solid aggregates were observed. Data are presented as mean ± standard error of the mean of two independent experiments. [0028] Figures 6A-6D show that TRF2 knockdown leads to higher levels of cytoplasmic VR dipeptide. Figure 6A shows Western Blot analysis of the level of TRF2 expressed in U2OS cells (untreated) or infected with two lentivirus constructs (18358, 4811) (SEQ ID NOs:15&14) encoding TRF2 shRNAs. Actin was used as loading control. In Figure 6B untreated U2OS cells and U2OS cells infected with shTRF2-18358 (SEQ ID NO:15) as shown in Figure 6A were immunolabeled with VR primary antibody. Nuclei were stained with DAPI and merged images with VR dipeptides show the nuclear vs cytoplasmic signals. Figure 6C shows quantification of the percentage of cells expressing 5 or more VR aggregates. Data presented are the ± standard error of the mean of two independent experiments. Two-tailed, unpaired t-test *P < 0.05, p=0.036. Figure 6D shows quantification of the percentage of cells expressing 5 or more cytoplasmic VR aggregates. Data are presented as mean ± standard error of the mean of two independent experiments. Two-tailed, unpaired t-test *P < 0.05, p=0.04. Attorney Docket No.035052/607414 [0029] Figure 7 shows a flow chamber with single strand DNA attached to the surface of the chamber. The chamber is enclosed in a glass slide or chip and has inlets and outlets for fluids that allow fluid flow into and out of the chamber. The slide or chip is optically clear in the region of the chamber so that optical viewing or analysis of fluorescence from the chamber can be recorded by passing light through the chamber. This could include but not be limited to measurement of fluorescence from a tagged antibody, color change from horseradish peroxidase staining, or detection of probes such as Q-dots bound to the antibodies. Surface plasmon resonance could also be measured. [0030] Figures 8A-8C show that TRF2 knockdown in a non-transformed cell line, IMR90 leads to higher levels of VR dipeptide aggregates in the cytoplasm. Cells were treated and imaged as described in Figure 6. Figure 8A shows an image of cells not treated with the shRNA, Figure 8B shows cells treated with the shRNA, Figure 8C shows quantitation of the number of cytoplasmic aggregates in the cells following shRNA treatment. [0031] Figures 9A-9E show that cells undergoing cell division stain strongly with the polyclonal antibody to VR protein. Figure 9A shows a spread of U2OS cells in which the nuclei are stained blue with DAPI and the VR protein is detected using an antibody to VR protein (green). In this field most of the cells stain only blue, however two cells undergoing cell division are brightly stained for the VR protein. In Figure 9B-9E, the U2OS cells were treated with the cdk1 inhibitor RO-3306 to block cells in metaphase. Examples, left to right show cells in prophase (Figure 9B) metaphase (Figure 9C), anaphase (Figure 9D) and telophase (Figure 9E). [0032] Figure 10A-10D show that treating U2OS cells with the drug BRACO-19 induces large VR deposits in the nuclei. In Figure 10A, U2OS cells were treated with 2 micromolar BRACO- 19 for 6 hours, and only in two blue nuclei, were large VR aggregates detected (green). In Figure 10B, VR aggregates were detected in a greater number of nuclei upon treating U2OS cells with 2 micromolar BRACO-19 for 24 hours. Figure 10C shows additional examples of VR aggregates (green) expressed exclusively in the nuclei (blue) and with no evidence for their accumulation in cytoplasm (red). Figure 10C (right) shows cells in which F-actin has been stained red to show the actin network and the VR protein is stained green. Figure 10D shows quantification of the percentage of positive cells expressing VR in its aggregate form in the nucleus. Attorney Docket No.035052/607414 [0033] Figure 11 shows an illustration of the relationship between the levels of VR or GL proteins in serum or plasma with age and disease status. [0034] Figures 12A-12F illustrates the use of a VR antibody to stain microarray slides to detect tissues involved in cancer, inflammation, and aging. In Figure 12A stomach tissue from a normal individual showed little or no dark brown staining while in Figure 12B, stomach tissue from an individual with chronic superficial gastritis showed positive dark brown VR signals indicative of high VR levels. In Figure 12C, staining of brain tissue from a 22 year-old male showed only dim VR signals while staining in Figure 12D of brain tissue from a 50 year old individual showed more intense staining specifically in the neurons. In Figure 12E, normal blood vessel tissue adjacent to a tumor showed little or no staining in while in Figure 12F, a nearby adjacent low malignant glomus tumor in the blood vessel of a 67-year-old patient showed positive dark brown VR signals. [0035] Figure 13 shows a schematic for measuring VR or GL proteins in a sample such as serum or plasma using antibodies bound to magnetic microspheres and laser flow analysis. In the first step (step 1) the sample is incubated with antibodies which specifically bind to VR or GL proteins that are attached to magnetic microspheres infused with dye that can be excited by illumination by a laser. The beads are washed using a magnetic field, resuspended in buffer, and incubated with the same or a different antibody which specifically bind to the VR or GL protein and is tagged with a fluorescent dye that can be excited by a laser at a wavelength different from that used to excite the dye infused into the magnetic microspheres. Following washing using magnetic pull down, in step 2, the beads are passed through the optical path of an instrument and the dye in each magnetic bead is excited by the laser specific for that dye and identifies a region containing a magnetic microsphere. Simultaneously the second laser specific for the fluorescent tag on the detection antibody bound to the magnetic microspheres through the target protein excites the fluorescent tag on the second antibody and the amount of signal recorded provides a measure of the amount of the detection antibody bound for each bead. Analysis is carried out in step 3 in which the content of VR or GL protein in the sample is determined based on standard curves generated with the purified VR or GL protein. [0036] Figure 14 shows the measurement of the fluorescence intensity based on the concentration of a VR₁₀ repeating dipeptide using a magnetic beads in a sandwich assay. The measurement was performed using a Luminex single plex assay with magnetic microspheres Attorney Docket No.035052/607414 internally dyed with red and infrared fluorophores of differing intensities. An individual bead set was coated with the anti-VR capture antibody. The captured VR peptide is detected using biotinylated anti VR antibody and the readout and quantification acquired by signal from streptavidin-conjugated phycoerythrin (SA-PE). DETAILED DESCRIPTION [0037] Telomeres play an important role by protecting the DNA at the ends of chromosomes in eukaryotic organisms, guarding against prolonged uncontrolled cell division and progression to cancer. The length of a telomere shortens in a progressive manner with each cell division, and therefore provides an aging clock. Studying telomere length provides valuable information about biological age, which can be different from chronological age due to stress or exposure to environmental factors. [0038] Telomere health has significant implications for the molecular biology of aging and cancer, however existing method for studying telomere health have significant experimental limitations. Telomere health is an important aspect of biological age and health, but it challenging to assess telomere length with current experimental techniques. It was believed that telomeres did not undergo transcription, until it was discovered that telomere DNA was transcribed from the C-rich strand into RNA, termed TERRA (1). However, it was still not believed that TERRA was translated into protein due to the lack of canonical ribosome loading sequences. As described herein, telomere-encoded TERRA was found to be translated into two dipeptide repeat proteins, repeating valine-arginine (VR) protein and repeating glycine-leucine (GL) protein, through repeat-associated non-ATG (RAN) translation. [0039] Reported herein, two previously unknown telomere-encoded repeat proteins, repeating valine-arginine (VR) and repeating glycine-leucine (GL) are described. The existence of these proteins could have great significance in the molecular biology of aging and cancer as the proteins, reported herein, have been found to form amyloid fibers with apparent cytotoxic effects. Furthermore, the detection of telomere-encoded dipeptide repeat proteins through standard practices known to those skilled in the art may provide a valuable tool for the facile study of telomere health, meeting a great need in the field. In addition, the detection of these proteins can be useful for the diagnosis of a wide-range of diseases related to telomere dysfunction, including cancer, inflammation and genetic telomere-related diseases. With the Attorney Docket No.035052/607414 detection method described herein, a simple blood test or analysis of a sample of cells or tissue can rapidly provide information about telomere health or detect cancer. These methods can be valuable in clinical medicine, veterinary medicine and agricultural industries. Additionally, the targeting of these telomere-encoded dipeptide repeat proteins could provide a useful therapeutic treatment for cancer or other diseases related to telomere dysfunction. [0040] The presently disclosed subject matter will now be described more fully hereinafter. However, many modifications and other embodiments of the presently disclosed subject matter set forth herein will come to mind to one skilled in the art to which the presently disclosed subject matter pertains having the benefit of the teachings presented in the foregoing descriptions. Therefore, it is to be understood that the presently disclosed subject matter is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. In other words, the subject matter described herein covers all alternatives, modifications, and equivalents. In the event that one or more of the incorporated literature, patents, and similar materials differs from or contradicts this application, including but not limited to defined terms, term usage, described techniques, or the like, this application controls. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in this field. All publications, patent applications, patents and other references mentioned herein are incorporated by reference into their entirety. Definitions [0041] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the present application and relevant art and should not be interpreted in an idealized or overly formal sense unless expressly so defined herein. The terminology used in the description of the invention herein is for the purpose of describing particular aspects only and is not intended to be limiting of the invention. In case of a conflict in terminology, the present specification is controlling. Attorney Docket No.035052/607414 [0042] As used herein, the term “and/or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”). [0043] The term “or” refers to any one member of a particular list. [0044] The singular forms of the articles “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a protein” or “at least one protein” can include a plurality of proteins, including mixtures thereof. [0045] The terms “protein,” “polypeptide,” and “peptide,” used interchangeably herein, include polymeric forms of amino acids of any length, including coded and non-coded amino acids and chemically or biochemically modified or derivatized amino acids. [0046] Proteins are said to have an “N-terminus” (amino-terminus) and a “C-terminus” (carboxy-terminus or carboxyl-terminus). The term “N-terminus” relates to the start of a protein or polypeptide, terminated by an amino acid with a free amine group (-NH₂). The term “C- terminus” relates to the end of an amino acid chain (protein or polypeptide), terminated by a free carboxyl group (-COOH). [0047] The term “telomere-encoded” refers to a protein translated from RNA which is transcribed from DNA located at a telomere. [0048] The term “dipeptide repeat protein” refers to a protein or peptide comprising a repeating two amino acid sequence. A “telomere-encoded dipeptide repeat protein” comprises a repeating two amino acid sequence selected from VR or GL. [0049] The term “repeating VR protein” refers to a dipeptide repeat protein comprising a sequence of valine (V) and arginine (R) alternating for a given number of units. For example, (VR)₄ is a repeating VR protein comprising 4 repeating units of valine and arginine with the sequence VRVRVRVR. The terms “repeating VR” and “repeating RV” refer to the same entity and can be used interchangeably herein. [0050] The term “repeating GL protein” refers to a dipeptide repeat protein comprising a sequence of glycine (G) and leucine (L) alternating for a given number of units. For example, (GL)9 is a repeating GL protein comprising 9 repeating units of glycine and leucine with the sequence GLGLGLGLGLGLGLGLGL. The terms “repeating GL” and “repeating LG” refer to the same entity and can be used interchangeably herein. Attorney Docket No.035052/607414 [0051] The term “endogenous protein” refers to a protein that occurs naturally within a cell or organism. [0052] The term “beta sheet” refers to a common motif of protein secondary structure comprised of two or more polypeptide chains linked in a regular manner by hydrogen bonds between residues on two different strands. [0053] The term “amyloid” refers to aggregates of proteins characterized by a fibrillar morphology of typically 7–13 nm in diameter. [0054] The terms “nucleic acid” and “polynucleotide,” used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single-, double-, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers comprising purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derivatized nucleotide bases. [0055] Nucleic acids are said to have “5’ ends” and “3’ ends” because mononucleotides are reacted to make oligonucleotides in a manner such that the 5’ phosphate of one mononucleotide pentose ring is attached to the 3’ oxygen of its neighbor in one direction via a phosphodiester linkage. An end of an oligonucleotide is referred to as the “5’ end” if its 5’ phosphate is not linked to the 3’ oxygen of a mononucleotide pentose ring. An end of an oligonucleotide is referred to as the “3’ end” if its 3’ oxygen is not linked to a 5’ phosphate of another mononucleotide pentose ring. A nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5’ and 3’ ends. In either a linear or circular DNA molecule, discrete elements are referred to as being “upstream” or 5’ of the “downstream” or 3’ elements. [0056] A “promoter” is a regulatory region of DNA usually comprising a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular polynucleotide sequence. [0057] The term “transcript” refers to RNA produced from the transcription of DNA. [0058] The term “translation” refers to process in which ribosomes synthesize protein from RNA based on the sequence of triplet codons. Attorney Docket No.035052/607414 [0059] The term “reading frame” refers to the way of dividing the sequence of nucleotides into a set of consecutive, non-overlapping triplets, wherein these triplets equate to amino acids or stop signals during translation in the 5’ to 3’ direction. [0060] The term “hypomethylated subtelomeric region” refers to highly heterogeneous repeated sequences next to telomeres containing reduced DNA methylation. DNA methylation refers to the epigenetic modification of cytosine residues to 5-methylcytosine. [0061] The term “canonical ribosome loading sequence” refers to a known RNA sequence to which ribosomes can bind and initiate translation. [0062] The term “antibody”, also known as an immunoglobulin, refers to a Y-shaped protein produced by the immune system to identify and neutralize foreign objects or antigens. [0063] The term “epitope” refers to the part of an antigen molecule to which an antibody binds. [0064] The term “primary antibody” refers to an antibody that binds directly to an antigen through a variable region which recognizes an epitope of the antigen. Primary antibodies can be raised against proteins, peptides, carbohydrates, small molecules, or posttranslational modifications using animals as the host, often mice, rats, rabbits, goats or donkey. For example, an antibody for a human protein could be raised in a mouse, producing a mouse anti-human antibody which binds to that human protein. Antibodies can be either monoclonal, which bind to one specific epitope on the antigen, or polyclonal which bind to multiple different epitopes on the antigen. A primary antibody can be optionally modified for detection, including through the incorporation of a fluorescent molecule. [0065] The term “secondary antibody” refers to an antibody produced by immunizing a host animal with antibodies from a different species. Secondary antibodies often contain an enzyme such as horseradish peroxidase (HRP) or a fluorescent molecule for the detection of a primary antibody, and/or a molecular tag for detection or isolation. For example, a goat anti-mouse secondary antibody could be raised through injecting mouse antibodies into a goat and may be modified to include a fluorescent tag, which could then be used for the detection of a mouse anti- human antibody for the visualization or quantification of a human protein. [0066] The term “specific binding” refers to a molecule that reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity, avidity, more readily, and/or with greater duration than it binds to other substances. “Specific binding” does not necessarily require exclusive binding. Attorney Docket No.035052/607414 [0067] The term “Flag” or “Flag tag” refers to a peptide protein tag that can be added to a protein using recombinant DNA technology for detection and isolation. A Flag tag comprises the amino acid sequence DYKDDDDK and can be used in many different assays with an antibody against the Flag tag sequence. Additionally, Flag tags can be used in tandem including the 3x Flag tag comprised of amino acid sequence DYKDHDG-DYKDHDI-DYKDDDDK. [0068] The term “synthetic chemical handle” refers to a molecule which is covalently attached to a protein for the purposes of isolation, purification or detection. For example, biotin, a PEG- linker and/or Flag tag may be covalently attached to the N- or C-terminus of a protein in order to isolate and/or detect the protein. [0069] The term “fluorescent tag” or” refers to fluorescent molecule or fluorophore that is attached chemically to aid in the detection of biomolecule such as a protein or antibody. A fluorescent molecule re-emits light following light excitation. For example, fluorescein isothiocyanate (FITC) is a common fluorescent tag that has excitation and emission spectrum peak wavelengths of approximately 495 nm and 519 nm and is often conjugated to primary antibodies for detection by flow cytometry and fluorescent microscopy. [0070] The term “dot blot analysis” refers to a technique used to detect proteins comprising the application of a sample (often a cell culture supernatant, cell or tissue extract, or blood serum) onto a membrane (usually nitrocellulose or PVDF) followed by incubation with blocking buffer then a primary antibody for the protein of interest. The primary antibody may contain a detection molecule, or a secondary antibody may be used for detection. A dot blot may be used for rapid validation of the efficacy of a primary antibody and comprises a simplification of the western blot method, with the exception that the proteins to be detected are not first separated by electrophoresis. [0071] The term “serum” refers to the clear liquid part of blood that remains after blood cells and clotting proteins have been removed. [0072] The term “in vitro” includes artificial environments and to processes or reactions that occur within an artificial environment (e.g., a test tube or an isolated cell or cell line). [0073] The term “ELISA” refers to an enzyme-linked immunosorbent assay in which an antigen is immobilized on solid surface (e.g.96 well plate) and then complexed with an antibody that is linked to a reporter enzyme for detection. Attorney Docket No.035052/607414 [0074] The term “transfection” refers to method of inserting foreign nucleic acids into eukaryotic cells and can include physical, chemical or viral methods (e.g. nucleofection or lipofection). [0075] The term “colocalization” refers to observation of the spatial overlap between two different fluorescent labels, each having a separate emission wavelength, to see if the different targets (e.g. two proteins of interest) are located in the same area of the cell or very near to one another. [0076] The term “foci” refers to a central site in which a disease localizes or develops, often detected by a fluorophore in a microscope image. [0077] The term “puncta” refers to a small, distinct point in the field of view in fluorescent microscopy. [0078] The term “fixed” refers to biological specimens (e.g. cells or tissue) that have been preserved from decay for histological study. Common fixation methods include exposing cells or tissue to formaldehyde, methanol or ethanol and is often performed before flow cytometry, microscopy and/or immunohistochemistry. [0079] The term “tumor microarray” (TMA) refers to glass light microscope slides containing many small punches of fixed human tissue embedded in paraffin. The punches can be from many different sources, (e.g. normal human tissues or tissues from human cancers). [0080] The term “vertebrate animal” refers to an animal in the subphylum Vetebrata. Vertebrata animals include mammals, birds, reptiles, amphibians, and fish. [0081] Compositions or methods “comprising” or “including” one or more recited elements may include other elements not specifically recited. For example, a composition that “comprises” or “includes” a protein may contain the protein alone or in combination with other ingredients. Overview [0082] Telomeres in all mammals, including humans and many higher eukaryotic species, consist of a long monotonous repeat of the DNA sequence 5’ (TTAGGG)_n3’. The length of telomers shortens in a progressive manner with each cell division, thus telomere shortening occurs with age. Additionally, it has been found that stress and cancer-causing environmental agents have been shown to result in more rapid shortening of telomeres. [0083] It was long assumed that telomere DNA was not transcribed to RNA, until it was shown by Lingner and Azzalin (1) that mammalian telomeres are transcribed into RNA from the C-rich Attorney Docket No.035052/607414 telomere strand to generate long RNAs of the sequence (UUAGGG)n. This telomeric repeat- containing RNA, termed TERRA, can be up to 9000 nt in length in humans and can be found in the cytoplasm (2) and is also seen as cargo in extracellular vesicles (2, 3) . TERRA levels are elevated in cancer cells and cells that utilize the ALT (Alternative Lengthening of Telomeres) pathway that operates when telomerase activity is absent (4). Very recent work from the Shadel and Karlseder groups (5) revealed that when telomeres are rendered dysfunctional, for example through loss of TRF2, TERRA appears in the cytoplasm in larger amounts and interacts with key factors in the innate immune response pathways to activate autophagy. [0084] As the TERRA RNA consists of a simple 6 nucleotide repeat and lacks canonical ribosome loading sequences, it was thought that this RNA is purely structural and that these sequences do not encode proteins. [0085] If TERRA RNA was translated, the sequence would form two dipeptide repeat proteins, repeating valine-arginine and repeating glycine-leucine in vertebrates. Repeating valine-arginine (VR) protein, is highly charged and would be expected to bind nucleic acids, whereas repeating glycine-leucine (GL) protein is hydrophobic and might form amyloid structures. Telomere-Encoded Dipeptide Repeat Proteins [0086] As described herein, two previously unknown dipeptide repeat proteins, repeating valine- arginine (VR) and repeating glycine-leucine (GL) were found to be translated from telomeric repeat-containing RNA (TERRA). Without wishing to be bound by theory, it is believed these telomere-encoded dipeptide repeat proteins are produced through Repeat Associated non-ATG translation (RAN), in which both sense and antisense transcripts containing long runs of expanded triplet repeats which form stable hairpins are translated in all possible reading frames. It has been proposed that ribosomes can load and begin translation at hairpins or G- quadruplexes, but due to the lack of an AUG start codon, translation can begin at any nucleotide in the repeat, thus giving rise multiple possible products in each direction (6) . [0087] Aspects of the invention relate to telomere-encoded dipeptide repeat proteins and uses thereof. The telomere-encoded dipeptide repeat proteins are selected from the group consisting of repeating VR protein and repeating GL protein. Each dipeptide repeat protein comprises a repeat amino acid sequence, which contains a dipeptide repeat unit of the formula (VR)_x or (GL)x, where X can be from 2-200. Attorney Docket No.035052/607414 [0088] Each telomere-encoded dipeptide repeat protein may further comprise an N- and/or C- terminal amino acid sequence that comprises a non-dipeptide repeat sequence. In some embodiments, the N-terminal amino acid is modified by the addition of a biotin molecule. In some embodiments, the C-terminal amino acid sequence comprises the sequence C(Cys)-amide. In some embodiments, the C-terminal amino acid sequence comprises the sequence CKKKK- amide. Described herein are chemically modified dipeptide repeat proteins comprising an alternating repeating amino acid sequence and a synthetic chemical handle for isolation, purification, or detection, wherein the alternating repeating amino acid sequence consists of (VR)_n or (GL)_n, wherein n is greater than 2; and wherein the synthetic chemical handle is on an N-terminus or a C-terminus of the alternating repeating amino acid sequence. [0089] In some embodiments, n is greater than 3, greater than 4, greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, or greater than 10. In some embodiments, n is between 2 and 400, between 3 and 400, between 3 and 200, between 4 and 200, or between 5 and 200. [0090] The synthetic chemical handle can be any moiety useful for the isolation, purification, or detection of the dipeptide repeat protein. In some embodiments, the synthetic chemical handle comprises biotin, a polyhistidine tag, a polylysine tag, a FLAG tag, an HA tag, a c-Myc tag, a V5 tag, or a C-terminal amide. In some embodiments, the synthetic chemical handle is a fluorescent protein or a fluorescent molecule. In some embodiments, the amino acid sequence of the polyhistindine tag is HHHHHH (SEQ ID NO:17). In some embodiments, the amino acid sequence of the polylysine tag is CKKKK (SEQ ID NO:18). In some embodiments, the amino acid sequence of the FLAG tag is DYKDDDD (SEQ ID NO:19), DYKDDDDK (SEQ ID NO:20), or DYKDDDK (SEQ ID NO: 21). In some embodiments, the amino acid sequence of the HA tag is YPYDVPDYA (SEQ ID NO: 22), YAYDVPDYA (SEQ ID NO: 23), or YDVPDYASL (SEQ ID NO: 24). In some embodiments, the amino acid sequence of the c-Myc tag is EQKLISEEDL (SEQ ID NO: 25). In some embodiments, the amino acid sequence of the V5 tag is GKPIPNPLLGLDST (SEQ ID NO: 26). [0091] In some embodiments, the chemically modified dipeptide repeat protein comprises a sequence provided in Table 1. Attorney Docket No.035052/607414 Table 1: Telomere-encoded dipeptide repeat proteins Peptide Sequence SEQ ID NO:1 biotin-H₂N-VRVRVRVRVRVRVRVRVRVR

[0092] Aspects of the disclosure relate to a method of determining telomere length by analyzing a level of a telomere-encoded dipeptide repeat protein in a biological sample. [0093] Aspects of the disclosure relate to the detection of a level of a telomere-encoded dipeptide repeat protein comprising repeating VR protein and/or repeating GL protein in a biological sample. In some embodiments, the detection of a telomere-encoded dipeptide repeat protein is used as a marker for telomere health. [0094] Telomere length has been proposed as a measure of an individual's real biological age as contrasted to chronological age. However, the measurement of telomere length is difficult and depends on many confounding factors which make it impractical in clinical settings. Single chromosome analysis performed in a laboratory setting is very costly, limiting its practical use. PCR-based approaches to determining telomere length are imprecise, comprising the conclusions reached from these types of studies. A simple and accurate protein assay which provides information about telomere length and health, described herein addresses deficiencies in the field. [0095] Without wishing to be bound by theory, experimental data suggests that as cells age and telomeres shorten, levels of repeating VR protein and repeating GL protein increase due to an increasing number of telomeres reaching a critically short length and thus triggering higher expression of the telomeric TERRA RNA. In some embodiments, a level of repeating VR protein and/or repeating GL protein is used as a marker of biological age. [0096] In one embodiment, data collected on repeating VR protein and/or repeating GL protein levels is studied to examine the correlation between "telomere health" and stress or exposure to environmental toxins. In some embodiments, a simple blood test is used to study telomere health Attorney Docket No.035052/607414 in relationship to many variables using standard techniques well-known in the art for the quantification and study of repeating VR protein and/or repeating GL protein. [0097] In a clinical analysis in which the amount of VR and or GL proteins shed by cells into the blood, levels of VR and or GL are measured in serum or plasma using one of the methods described herein. As illustrated, without wishing to be bound by theory it is proposed that as an individual or non-human animal ages, the levels of VR and or GL proteins in the blood shed from cells undergoing telomere crisis will slowly rise as shown in the smooth curve of Figure 11. However, any of a number of insults, illnesses or inflammation can result in higher levels of VR and or GL in the blood as shown for cancer, exposure to toxins or life stresses, inflammatory disease or telomere biology diseases such as but not exclusive to Idiopathic pulmonary fibrosis. [0098] Provided herein are isolated dipeptide repeat proteins, wherein the alternating repeating amino acid sequence consists of (VR)n or (GL)n, wherein n is greater than 2. [0099] Provided here are isolated dipeptide repeat proteins (e.g., repeating VR protein or repeating GL protein) specifically bound to a detectable molecule. In some embodiments, the detectable molecule is a labeled primary antibody. In some embodiments, the detectable molecule is a primary antibody which is detected by a labeled secondary antibody. In some embodiments, a labeled antibody (primary or secondary) comprises a fluorescent molecule, a radioisotope, or enzyme (e.g., HRP). [0100] In some embodiments, the isolated dipeptide repeat protein is specifically bound to an antibody fixed on a surface. In some embodiments, the specific binding of the dipeptide repeat protein to an antibody fixed on a surface is detected by surface plasmon resonance. [0101] In some embodiments, the dipeptide repeat protein is specifically bound to an antibody in a tissue sample and detected. In some embodiments, the dipeptide repeat protein is specifically bound to an antibody for isolation from a blood sample. In some embodiments, the dipeptide repeat protein is specifically bound to an antibody for isolation from plasma or serum isolated from blood. [0102] Disclosed are methods of determining telomere health, the method comprising measuring a detectable molecule bound to an isolated dipeptide repeat protein from a biological sample, determining a level of the dipeptide repeat protein in the biological sample, and comparing the level to an age-appropriate control level. Attorney Docket No.035052/607414 Controls and Control Levels [0103] Aspects of the disclosure relate to comparison of a level of one or more telomere-encoded dipeptide repeat proteins to a control level. In some embodiments, the control level is a level of repeating VR protein and/or repeating GL protein in a sample, such as a fluid or tissue sample, obtained from a healthy subject or population of healthy subjects. In some embodiments, the sample is a blood sample. As used herein, a healthy subject is a subject that is apparently free of disease and has no history of disease, such as cancer or other disease associated with telomere dysfunction. [0104] In some embodiments, a control level is a level of one or more telomere-encoded dipeptide repeat proteins that is undetectable or below a background level obtained using standard methods of detection (e.g. dot blot, Western blot, immunohistochemistry). Such a level could be obtained by measuring a level of one or more telomere-encoded dipeptide repeat proteins in a sample that is known to be free of telomere-encoded dipeptide repeat proteins. [0105] The disclosure also involves comparing the level of one or more telomere-encoded dipeptide repeat proteins with a predetermined level or value, such that a control level need not be measured every time. The predetermined level or value can be a single cut-off value, such as a median or mean. The predetermined level can be established based upon comparative groups, such as where one defined group is known not to have a disease associated with telomere dysfunction and another defined group is known to have a disease associated with telomere dysfunction. [0106] An “age-appropriate control level” refers to a control level from a healthy individual or population of healthy subjects that are in a similar relative age range (e.g., within 5 to 15 years) as the test subject. Samples [0107] Aspects of this disclosure relate to determining a level of one or more telomere-encoded dipeptide repeat proteins in a biological sample. [0108] In one embodiment, the biological sample comprises cells from a cultured cell line. Attorney Docket No.035052/607414 [0109] In some embodiments, the biological sample is obtained from a subject comprising a human or non-human vertebrate animal. In some embodiments, the biological sample is cells obtained from the subject. In some embodiments, the cells obtained from the subject are grown in culture before use. [0110] In some embodiments, the biological sample is a blood sample (e.g., whole blood, plasma or serum) obtained from a subject. The blood sample may be obtained by any method known in the art, such as using a needle or fingerprick device. The blood may be processed, including through the addition of an anti-coagulant, removal of blood cells, and/or freezing the blood. [0111] In some embodiments the biological sample is a fluid other than blood, such as saliva or urine. In other embodiments, the biological sample is a tissue sample, such as a skin biopsy or surgically resected tissue from a tumor. Antibodies [0112] Aspects of the disclosure relate to isolated antibodies specific for a telomere-encoded dipeptide repeat proteins comprising repeating VR protein or repeating GL protein. The isolated antibody may recognize a region or regions of the telomere-encoded dipeptide repeat protein or may recognize the entire telomere-encoded dipeptide repeat protein. [0113] An antibody that “specifically binds” to a target or an epitope is a term understood in the art, and methods to determine such specific binding are also known in the art. [0114] In some embodiments, the isolated antibody is specific for a telomere-encoded dipeptide repeat protein comprising repeating VR protein or repeating GL protein. In some embodiments, the isolated antibody is specific for an antigen comprising a sequence defined in Table 1. [0115] An isolated antibody may be a monoclonal or polyclonal antibody. In some embodiments, an isolated antibody specific for a telomere-encoded dipeptide repeat protein is a rabbit polyclonal antibody. Methods for producing polyclonal and monoclonal antibodies are well known in the art (see, e.g., Greenfield, “Antibodies: A Laboratory Manual” (2^nd Ed.), Cold Spring Harbor Laboratory Press (2014)). [0116] In some embodiments, antibodies are generated by administering to a subject a repeating VR or repeating GL protein, isolating antibodies from the subject, and identifying one or more antibodies that selectively bind to the repeating VR or repeating GL protein. The subject may be a rabbit, a mouse, a rat, a goat, a sheep, a donkey, a chicken, a guinea pig, or a llama. Attorney Docket No.035052/607414 [0117] In some embodiments, antibodies are generated by phage display. [0118] Isolated antibodies of the disclosure may also have an attached detectable label. The label may be, for example, a fluorescent, enzymatic, affinity or isotopic label. Examples include fluorescein isothiocyanate (FITC) for detection by fluorescence, horseradish peroxidase which allows detection by cleavage of a chromogenic substrate (e.g., reporter enzyme), radioisotopes such as I¹²⁵ for detection by autoradiography and avidin/biotin for antibody detection and affinity purification of antigens and antigen-bearing cells. [0119] Also encompassed by the disclosure are hybridoma cell lines producing a monoclonal antibody specific for a telomere-encoded dipeptide repeat protein comprising repeating VR protein or repeating GL protein. Assays [0120] Aspects of this disclosure relate to performing an assay to determine a level of or presence/absence of one or more telomere-encoded dipeptide repeat proteins. Assays known in the art for detecting proteins (see Current Protocols in Molecular Biology, F.M. Ausubel, et al. eds., John Wiley & Sons, Inc., New York.) can be used alone or in combination with techniques and compositions described herein for measuring a telomere-encoded dipeptide repeat protein level. [0121] Assays for detecting protein levels include, but are not limited to, immunoassays (e.g. Western blot, immunohistochemistry and ELISA assays), mass spectrometry, and multiplex bead-based assays. Such assays for protein detection are well-known in the art. [0122] Any suitable binding partner for a telomere-encoded dipeptide repeat protein is contemplated for detection of a telomere-encoded dipeptide repeat protein level. In some embodiments, the binding partner is any molecule that binds specifically to a telomere-encoded dipeptide repeat protein. As described herein, “binds specifically to a telomere-encoded dipeptide repeat protein” means that the molecule is more likely to bind to a portion of or the entirely of a telomere-encoded dipeptide repeat protein than to a portion or entity of a non- telomere-encoded dipeptide repeat protein. In some embodiments, the binding partner is an antibody. [0123] The binding partner may comprise a label including, but not limited to, a fluorescent, enzymatic, affinity or isotopic label. Attorney Docket No.035052/607414 [0124] In some embodiments, an assay comprises an immunoassay. In some embodiments, the immunoassay comprises an isolated antibody specific for one or more telomere-encoded dipeptide repeat proteins. In some embodiments, the isolated antibody specific for one or more telomere-encoded dipeptide repeat proteins is an isolated antibody specific for an antigen or sequence described in Table 1. [0125] Accordingly, a telomere-encoded dipeptide repeat protein binding partner (e.g. a telomere-encoded dipeptide repeat protein specific antibody) can be labeled with a detectable moiety. Immunoassays [0126] In one embodiment, the assay is a dot blot analysis using an antibody for repeating VR protein or repeating GL protein. In the dot blot assay, a sample (such as cleared serum) is blotted onto a membrane substrate allowing proteins in the serum to attach to the membrane. Following washing, the membrane is then exposed to an antibody specific for repeating VR protein or repeating GL protein (e.g., a rabbit polyclonal antibody or a mouse monoclonal antibody) by incubating the membrane in solution with the antibody, followed by washing to remove unbound antibody. The presence of the repeating VR protein or repeating GL protein specific antibody on the membrane is detected using a secondary antibody (e.g. goat anti-rabbit or goat anti-mouse) conjugated with a labeled marker (e.g., horseradish peroxidase or fluorescent tag) followed by washing and detection of the labeled marker. [0127] In one embodiment, the assay is an indirect ELISA assay for repeating VR protein or repeating GL protein. In the indirect ELISA assay, a sample containing repeating VR protein and/or repeating GL protein is adsorbed to wells of an assay plate, washed, and then incubated with antibodies specific for repeating VR protein or repeating GL protein. The amount of antibody retained following washing is determined by adding a labelled secondary antibody, such as goat anti-rabbit, conjugated with an enzyme-based or fluorescent tag for detection. [0128] In some embodiments, the assay is a sandwich ELISA assay for repeating VR protein or repeating GL protein. In one embodiment, the sandwich ELISA assay is performed on a plate, wherein an antibody specific for repeating VR protein or repeating GL protein is attached to the wells of an assay plate followed by the addition of a sample, incubation and washing. The repeating VR protein or repeating GL protein is captured on the surface of the well, then another Attorney Docket No.035052/607414 antibody for repeating VR protein or repeating GL protein with a detectable label is added. The amount of the second antibody with a detectable label is determined by enzyme-based or fluorescent methods. In other embodiments, the assay is a sandwich assay performed in solution. In one embodiment, a sample containing repeating VR protein is incubated on ice with 1X phosphate buffered saline (PBS) for several hours to generate large amyloid aggregates of the repeating VR filament, which is formed in the presence of phosphate. The repeating VR filaments are collected by high-speed centrifugation and suspended in a small liquid volume of 1X PBS. An antibody specific for repeating VR protein is incubated with the mixture, followed by centrifugation to remove unbound antibodies. The amount of antibody bound to the repeating VR aggregates is determined in solution by adding a fluorescent labeled secondary antibody. [0129] In other embodiments, the assay is a double antibody assay. In some embodiments, a commercial antibody specific for beta sheet amyloid filaments (e.g. Abcam: Anti-beta Amyloid antibody [mOC64]) is used in vitro for the detection of both repeating VR protein and repeating GL protein when they are assembled into the filamentous amyloid fiber forms. In one embodiment, the amyloid antibody is attached to wells in an ELISA plate, followed by the addition of a sample and washing. The amount of repeating VR protein or repeating GL protein is then determined by adding repeating VR protein or repeating GL protein specific antibodies, washing, and detection using an enzyme or fluorescent labeled secondary antibody (e.g. goat anti rabbit). In another embodiment, the amyloid specific antibody is attached to beads and is incubated with a sample, followed by washing. The amount of repeating VR protein or repeating GL protein bound to the beads is determined using an antibody specific for repeating GL protein or repeating VR protein, followed by incubation with a labeled secondary antibody. Continuous Flow Chip-based Assays [0130] In some embodiment, the assay is a continuous flow chip-based assay for the detection of repeating VR protein. Without wishing to be bound by theory or mechanism, it is believed that repeating VR protein binds tightly to single strand (ss) DNA and RNA due to the high concentration of basic arginine residues. Accordingly, in one aspect the disclosure relates to an assay using a chip with a central enclosed chamber that is optically transparent through the top and bottom surface, wherein the surface of the enclosed chamber has attached ssDNA (Figure 7). In one embodiment, streptavidin is adsorbed on the surface of the central enclosed chamber Attorney Docket No.035052/607414 of the chip, followed by flowing biotin-tagged ssDNA over the surface to generate a chip coated in ssDNA. [0131] In some embodiments, the chip assay comprises flowing the biological sample through the chip, flowing a wash solution (e.g., saline or a dilute detergent) through the chip, flowing a solution comprising a primary antibody specific for repeating VR protein through the chip, flowing a wash solution through the chip, and then detecting the presence of the primary antibody. [0132] In one embodiment the detection comprises passing light of a selected wavelength through the chamber, followed by measuring the intensity of fluorescence emitted, wherein the primary antibody comprises a fluorescent tag which is excited by the selected wavelength. [0133] In another embodiment, the detection comprises flowing a solution comprising a secondary antibody through the chip, flowing a wash solution through the chip, passing light of a selected wavelength through the chamber, and measuring an intensity of fluorescence emitted, wherein the secondary antibody is selective for the primary antibody and comprises a fluorescent tag and the fluorescent tag is excited by the selected wavelength. [0134] In another embodiment, the detection comprises optically measuring an amount of the primary antibody bound to ssDNA on the surface of the chip using surface plasmon resonance. [0135] In some embodiments, the sample (e.g., serum) is treated with DNase and/or RNase prior to use the chip-based assay to free any repeating VR protein bound to ssDNA or RNA in the sample. In some embodiments, the sample (e.g., serum) is treated with trypsin prior to use in the chip-based assay to degrade proteins other than repeating VR protein. Multiplex bead-based assays [0136] In some embodiments, a biological sample (e.g., from a human or animal subject) is tested for levels of VR and or GL dipeptide repeat proteins using small amounts of sample (e.g., 12.5 to 25 microliters) and dye-infused magnetic beads. Examples of magnetic beads include but not be limited to Mag Plex Microspheres from Luminex Inc, or Bio-Plex pro magnetic COOH beads from Bio-Rad. [0137] In some embodiments, the assay is a sandwich bead-based assay. The presence and concentration of the repeating VR protein or repeating GL protein in fluids, such as serum or plasma may be measured with specific antibodies to the repeating VR protein or repeating GL Attorney Docket No.035052/607414 protein and beads to which the antibodies are attached. Analysis may involve activation of specific dyes via lasers in a liquid flow optical system. These methods are often referred to as sandwich assays because two antibodies (same or different) are employed. This parallels the ELISA sandwich assay but is carried out using magnetic beads and a flow system and optics capable of detecting multiple fluorescent dyes including ones embedded in the magnetic beads and ones attached to the specific antibodies. [0138] As shown in Figure 13, in the sandwich bead-based assay, an antibody (polyclonal or monoclonal) specific for the GL or VR dipeptide repeat protein is covalently attached to magnetic beads (e.g., magnetic microspheres) which have been infused with a dye that can be excited by illumination by a laser, such as in the red spectrum. The antibodies may be attached to the beads through any method known in the art. For example, amine coupling chemistry may be used for attachment, such as with the Bio-Plex amine coupling kit. The beads are mixed with the sample (e.g., 12.5 microliters in a 96 well plate) followed by washing steps to remove material not captured by the antibodies. The beads are then incubated with a second antibody that also recognizes the target protein. This can be the same antibody as in the first step or an antibody specific for a different epitope on the target protein. The second antibody is labelled with a fluorescent tag excited by a different wavelength in the flow system. Alternatively, the second antibody contains an added tag such as biotin which is recognized by streptavidin conjugated with a specific fluorescent tag, such as phycoerythin. For example, the Bio-Rad EZ-link^TM micro NHS-PEG4 biotinylation kit may be used to covalently attach biotin to the second antibody. The sample is passed through an optical flow system, such as a Bio-Rad Bio-Plex or Luminex multiplex system able to identify single beads passing through the optical path and the amount of signal in the region of the bead generated by the second fluorescent coupled antibody is measured. An example of fluorescence data based on the concentration of a VR10 repeating dipeptide is shown in Figure 14. This provides a readout of the amount of target protein bound to each bead. Data reduction based on calibration curves for known concentrations of GL or VR protein provide a concentration of the target protein in the sample. Assays for VR and GL proteins based on their amyloid properties [0139] Both the VR and GL dipeptide repeat proteins form long filaments with amyloid-like properties. These may have a cross-beta sheet structure as revealed by the binding of commercial Attorney Docket No.035052/607414 monoclonal antibodies specific for the cross-beta structure. In serum, the bulk of the VR and GL proteins may be present in the form of filaments which can be as short as 50 nm or microns long. [0140] In some embodiments, monoclonal antibodies or polyclonal antibodies to the GL or VR proteins are labelled with either a fluorescence resonance energy transfer acceptor dye or a fluorescence resonance energy transfer donor dye. For examples, Cy3 and Cy5 pairs may be used. Equal amounts of the donor and acceptor labelled antibodies are mixed with the solution (e.g., cleared serum) and allowed to bind to the VR or GL amyloid rods. The close proximity of the donor and acceptor dyes generated by side-by-side binding on the filaments will elicit a new fluorescent wavelength light signal which is measured optically and can be used as a measure of the presence and amount of the VR or GL rods in the liquid. [0141] In one embodiment, a monoclonal antibody specific to the cross-beta structure will be attached to the magnetic beads such as but not limited to the Mag Plex Microspheres from Luminex, or Bio-Plex pro magnetic COOH beads by Bio-Rad. The beads are incubated with a biological sample to capture VR or GL proteins in the solution. A second antibody specific for VR or GL protein is added which can be identified optically due to the presence of a fluorescent tag attached to the second antibody using an optical flow system as described herein. [0142] In one embodiment, a monoclonal antibody along with another monoclonal or polyclonal antibody to VR or GL proteins are used in a microplate-based assay. One of the pairs of antibodies is covalently attached to the bottom surface of the plastic microplate (e.g., a 96 well plate). The solution containing VR or GL protein is added to the well (e.g, 25 microliters) allowing the antibody to capture the VR and GL proteins. Washing steps then remove any unbound material. The second antibody is then added in solution to the plate and incubated to allow it to bind to VR or GL protein captured by the first antibody and then washed to remove unbound antibody. The presence of the second antibody can be detected by a variety of means known in the art such as a fluorescent dye or HRP. Optical imaging of each well on the plate would provide a measure of the strength of the signal generated by the tagged antibodies. ssDNA Bead-based Assay [0143] In some embodiments, paramagnetic beads coated with ssDNA are used for the detection of repeating VR protein. In one embodiment, paramagnetic beads containing streptavidin on their Attorney Docket No.035052/607414 surface (e.g., commercially available Dynabeads from Invitrogen or microbeads from Miltenyi Biotec) are incubated with biotin-tagged ssDNA to coat the beads with ssDNA. [0144] In some embodiments, the ssDNA-coated beads are incubated with a small volume of the sample (e.g. serum) to allow any repeating VR protein to bind to the beads. Following protocols well-known in the art, the beads are held in a magnetic field and washed with a wash solution (e.g. saline) to remove any unbound material. The beads are then incubated with an antibody specific for repeating VR protein, and washed again. The antibody may be directly tagged with a fluorescent tag or may be biotin-labeled to allow binding by a streptavidin-fluorescent reporter (e.g., phycoerythin). Following washing the beads are passed through the path of an optical flow instrument in which the amount of fluorescent signal is used to determine the amount of VR protein bound to the beads and therefore in the original solution. Identification of a Subject Having a Disease Associated with Telomere Dysfunction [0145] Without wishing to be bound by theory or mechanism, it is believed that as cells age and telomeres shorten, more telomeric TERRA RNA is expressed and subsequently more repeating VR protein and repeating GL protein is expressed. In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured as a marker to monitor the health of the genome of a subject and/or monitor biological age. Without wishing to be bound by theory or mechanism, it is believed that PCR based assays for telomere length do not provide information on whether the telomeres are stable, unstable, or whether the cells may be entering senescence. In contrast, an assay measuring the level of VR (and or GL) in serum or plasma offers an active measure of telomere status. It was found that VR levels are higher in cells exhibiting the ALT phenotype, in cells in which the telomeres have been damaged and in cells from a known telomere biology disease. As humans age, more and more cells enter senescence and not wishing to be bound by theory or mechanism our hypothesis is that this will result in higher levels of VR (and likely GL) in cells which are likely extruded from cells into the blood. Thus a plot of VR/GL in serum verses age will show a steady increase with age as VR and GL are shed from cells into the serum (Figure 11). While changes in telomere lengths due to age alone would be expected to be slow and irreversible, spikes above the steady age profile could signal deleterious telomere insult, disease, cancer, underlying telomere biology disease or inflammation and their detection could point to the importance of further clinical investigation. Attorney Docket No.035052/607414 [0146] Without wishing to be bound by theory or mechanism, it is believed that elevated levels of telomere-encoded dipeptide repeat proteins are associated with biological aging, cancer, inflammation, and other diseases associated with telomere dysfunction. As disclosed herein, telomere-encoded dipeptide repeat proteins comprising repeating VR protein and repeating GL protein can be detected by standard methods well-known in the art, and correlated to a disease or condition. In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured as a marker to monitor the health of a subject and to detect disease. In some embodiments a level of repeating VR protein and/or repeating GL protein is detected for a medical diagnosis of a subject. Subjects [0147] Aspects of this disclosure relate to the identification and treatment of a subject, such as a human, with a disease related to telomere dysfunction. In some embodiments, a subject may have cancer, such as sarcoma. In some embodiments, the subject may have systemic inflammation. In some embodiments, a subject may have a genetic disease associated with telomere dysfunction, such as Idiopathic pulmonary fibrosis (IPF) or Immunodeficiency, Centromeric region instability, Facial anomalies syndrome (ICF) syndrome. [0148] Other aspects of this disclosure relate to the identification of a disease related to telomere dysfunction in non-human subjects. In some embodiments a subject is a non-human vertebrate animal. In some embodiments, a subject is a domesticated non-human vertebrate animal. In some embodiments, the domesticated animal subject is a companion animal and the identification of a disease related to telomere dysfunction is used in a clinical veterinary setting. In some embodiments, the domesticated animal subject is a bird or livestock raised for agricultural purposes and the identification of a disease related to telomere dysfunction aids in the care or breeding of the agricultural animal. Detection of Disease [0149] In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured in a blood (e.g., serum) sample of a subject in a clinical laboratory test. In other embodiments, a level of repeating VR protein and/or repeating GL protein is measured in a sample of cells or tissue (e.g., biopsy, such as a skin punch) of a subject in a pathology Attorney Docket No.035052/607414 laboratory test. Examples of tissue samples stained for repeating VR protein are provided in Figures 12A-12F. [0150] Without wishing to be bound by theory or mechanism, it is believed that as cells age and telomeres shorten, more telomeric TERRA RNA is expressed and subsequently more repeating VR protein and repeating GL protein is expressed. In one embodiment, a level of repeating VR protein and/or repeating GL protein is measured as a marker to monitor the health of the genome of a subject and/or monitor biological age. [0151] As described here it, was found that samples of sarcoma cancer cells and tissue contained significantly higher levels of repeating VR protein compared to normal samples. Accordingly, aspects of this disclosure relate to detecting telomere-encoded dipeptide repeat proteins in samples from subjects for cancer diagnosis. In one embodiment, a level of repeating VR protein and/or repeating GL protein is measured to detect cancer and/or monitor the progression of cancer in a subject. [0152] Without wishing to be bound by theory or mechanism, it is believed that there is a direct link between exposure of cells to telomere-encoded dipeptide repeat proteins and an increase in inflammatory pathways. In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured to detect and/or monitor systemic inflammation. In some embodiments, the systemic inflammation is caused by infection by pathogens, exposure to allergens, exposure to toxic substances, or other diseases. [0153] Telomere biology diseases (TBD) are inherited genetic diseases characterized by unusually short and unstable telomeres. This can result from mutations in telomerase, or any of the components which maintain telomeres and ensure their proper replication. Mutations in RTEL1, a telomeric helicase can lead to short unstable telomeres. Dyskeratosis Congenita (CD) is characterized by mutations in telomerase, and other TBDs present with mutations in TRF1,2, Pot1 and other telomere proteins or genes encoding the RNA component of telomerase. Roughly half the individuals presenting with idiopathic pulmonary fibrosis (IPF) have mutations in telomere-related genes. These mutations lead to early organ or tissue failure with severity depending on the protein involved, and penetrance of the mutation. In addition to IPF and DC, known TBDs include but are not limited to Facial Anomalies Syndrome, Coats-Plus Syndrome, Revesz Syndrome, and Hoyeraal-Hreidarsson Syndrome. Not to be bound by theory, it is expected TBDs will result in higher levels of VR and possibly GL proteins in the serum of the Attorney Docket No.035052/607414 individual with the disease and hence measurement of VR and or GL levels in the serum can be used as a means of early detection of these diseases prior to presentation. TBDs include any inherited genetic disease due to mutations related to telomere maintenance and may be detected by the methods disclosed herein. Additionally, cells from a patient with Immunodeficiency, Centromeric region instability, Facial anomalies (ICF) syndrome showed elevated levels of repeating VR protein compared to cells from a healthy individual. ICF syndrome involves a genetic mutation affecting hypomethylation of subtelomeric regions and is known to result in elevated expression of TERRA RNA. In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured to detect a genetic disease associated with telomere dysfunction (e.g., ICF syndrome or IPF). [0154] Without wishing to be bound by theory or mechanism, it is believed that agriculturally important animals (e.g., birds and livestock) may develop diseases in which the expression of repeating VR protein and/or repeating GL protein is significantly elevated. Accordingly, aspects of the disclosure relate to the detection of one or more telomere-encoded dipeptide repeat proteins for the diagnosis of disease in agricultural animals. In some embodiments, an infectious disease is detected in an agricultural animal by measuring a level of repeating VR protein and/or repeating GL protein. In some embodiments, a level of repeating VR protein and/or repeating GL protein is measured to detect a genetic disease associated with telomere dysfunction, which might result from inbreeding. [0155] Without wishing to be bound by theory or mechanism, it is believed that military personnel serving in the armed forces abroad may be subject to a broad spectrum of illnesses and afflictions of unknown nature. A blood test for levels of VR and/or GL proteins would aid in screening members of the armed forces, particularly for those serving in remote locations. Thus, a simple blood test can be used to rapidly identify personnel in need of referral to more advanced medical facilities. Treatment of a Disease Associated with Telomere Dysfunction [0156] Without wishing to be bound by theory or mechanism, it is believed that levels of repeating VR protein dramatically spike when cells divide and chromosomes separate (Figure 9A-9E). When the nuclear membrane breaks down during cell division, telomeric TERRA RNA, becomes available in the former cytoplasm for ribosomes to bind and initiate translation. Then Attorney Docket No.035052/607414 the newly synthesized repeating VR protein may bind to ribosomes to shut down protein production during mitosis. Once the new nuclear membranes are formed, the amount of repeating VR protein then returns to very low levels. Accordingly, aspects of the disclosure relate to using antibodies or small molecule drugs selective for repeating VR protein or repeating GL protein to target and kill cells undergoing rapid nuclear division, such as cancer cells. Since rapidly dividing cells are a hallmark of transformed cancer cells, this therapeutic could be highly specific for cancer while at the same time not exposing normal cells in the body to mutational agents such as the currently used chemotherapeutic drugs that target DNA replication. [0157] Without wishing to be bound by theory or mechanism, it is believed that telomere- encoded repeat proteins may accumulate in cancerous tissue and be transmitted from cell to cell via extracellular vesicles (e.g, exosomes), which may result in the spread of pathological changes to surrounding tissue. Accordingly, aspects of the disclosure relate to treating a subject with cancer by administering a composition as described herein for decreasing or preventing an increase of a level of one or more telomere-encoded dipeptide repeat protein. [0158] Furthermore, the presence of elevated levels of telomere-encoded dipeptide repeat proteins may contribute to the pathology of disease. Expression of telomere-encoded dipeptide repeat proteins when TERRA is translocated to the cytoplasm could impact cellular pathways involving nucleic acid metabolism and repair, general protein synthesis, and induce genomic instability and inflammation. [0159] Accordingly, aspects of the disclosure relate to the treatment of a subject with a disease by administering a composition as described herein for decreasing or stabilizing levels of telomere-encoded dipeptide repeat proteins in the subject. [0160] In some embodiments, a subject is treated for a disease by decreasing or preventing an increase of a level of telomere-encoded dipeptide repeat proteins comprising repeating VR protein and/or repeating GL protein in the subject. In some embodiments, decreasing or preventing an increase of the level of one or more telomere-encoded dipeptide repeat proteins comprises the therapeutic use an antibody which specifically binds to repeating VR protein and/or repeating GL protein. In some embodiments, decreasing or preventing an increase of a level of telomere-encoded dipeptide repeat proteins comprises the therapeutic use of a small molecule which binds to and disrupt VR and/or GL protein structures. Attorney Docket No.035052/607414 [0161] In some embodiments, a treatment of a subject with cancer comprises administering a composition described herein for decreasing or stabilizing a level of repeating VR protein and/or repeating GL protein in the subject. In some embodiments, the treatment of a subject with cancer comprises the therapeutic use an antibody or small molecule which specifically binds to repeating VR protein and/or repeating GL protein. In some embodiments, an antibody or small molecule which specifically binds to repeating VR protein and/or repeating GL protein protects against a pathological spread of repeating VR protein and/or repeating GL protein. In some embodiments, an antibody which specifically binds to repeating VR protein and/or repeating GL protein targets and kills cells expressing repeating VR protein and/or repeating GL protein at a high level (e.g., cancerous cells such as sarcoma). [0162] Administration of repeating VR protein and/or repeating GL protein to cells in culture has been shown to activate pathways of the innate immune system and has shown an increase in known markers for inflammation, including Caspase production and IL-1β release. In particular, repeating VR protein has been shown to be cytotoxic, causing cell death upon administration to cells in culture. Accordingly, aspects of the disclosure relate to treating a subject with inflammation by decreasing or preventing an increase of a level of one or more telomere- encoded dipeptide repeat protein. In some embodiments, the treatment of a subject with inflammation comprises decreasing or stabilizing a level of repeating VR protein and/or repeating GL protein in the subject. In some embodiments, the treatment of a subject with inflammation comprises the therapeutic use an antibody which specifically binds to repeating VR protein and/or repeating GL protein. EXAMPLES Example 1: GL, GA, and VR dipeptide repeat proteins form long filaments and amyloids-like networks [0163] A peptide consisting of 9 GL repeats (GL)₉ (SEQ ID NO:4) and another containing 7 GA repeats (GA)7 (SEQ ID NO:6) were chemically synthesized. Both were incubated in a low salt buffer and prepared for visualization by transmission electron microscopy (TEM) using metal shadow casting (Figures 1A, 1C, and 1E), cryoEM (Figure 1B) and negative staining (Figures 1D and 1F). Examination of fields of molecules formed by (GL)₉ (SEQ ID NO:4) (Figure 1A) revealed long, stiff filaments, often measuring several microns in length, frequently associating Attorney Docket No.035052/607414 into large networks. Images of the (GL)9 (SEQ ID NO:4) filaments by negative staining closely resembled those obtained by cryoEM in ice (Figure 1B). (GA)7 (SEQ ID NO:6) formed nearly identical filaments and also large, dense aggregates (Figure 1C and 1D). (GL)₉ (SEQ ID NO:4) mean filament diameters of 7.8 nm +/- 1.1 (n=80) were obtained from negative staining and 7.9 +/-1.3 nm (n=18) from cryoEM images. (GA)7 (SEQ ID NO:6) filament diameters (negative staining) had mean value of 7.3 nm +/-0.95, (n= 35). [0164] Metal shadow casting and TEM were used to monitor filament formation and it was observed that the GL (SEQ ID NO:4) filaments formed very rapidly in solution at 2 mg/mL of peptide. Once formed they remained partially dispersed with some networks forming over days incubation. GA (SEQ ID NO:6) filaments also formed quickly in solution at high peptide concentration but increased in filament length over periods of hours and upon extended incubation most of the filaments were in dense amyloid-like networks as shown in Figures 1C and 1D. Both the GL (SEQ ID NO:4) and GA (SEQ ID NO:6) filaments were stable to dilution to a few µg/mL in low salt buffers but freezing led to insoluble aggregates. [0165] Several preparations of repeating VR dipeptides were synthesized, one of which is 20 amino acids long with biotin at the N terminus ((VR)₁₀-bio, SEQ ID NO:1), and another consisting of 15 VR repeats (VR)₁₅ (SEQ ID NO:3). When these were taken up at 2 mg/mL in low salt buffer poorly, structured aggregates and short rods were observed by TEM, but they dissociated upon a 100-fold dilution. However, when the VR preparations were taken up in phosphate buffered saline (PBS) at 2 mg/mL, long filaments and filament networks were seen both by metal shadow casting and negative staining (Figures 1E and 1F) and these were stable upon 1000-fold dilution in PBS. The mean diameter of the VR filaments determined from negative staining was 7.5 ± 1.0 nm (n=50) nm. Thus, masking arginine residues in the VR dipeptide with phosphate appears to allow them to form structures similar to those formed by GL and GA dipeptides. [0166] Disclosed herein, telomeric GL dipeptide repeat proteins have similar structural characteristics to GA dipeptides, and form amyloid-like structures with beta sheet properties. The GA and GL filaments may share similarities with structures formed by human lysozyme and islet amyloid polypeptide, both of which generate filaments and amyloids, are stabilized by cross beta sheet formation, and induce inflammation via NLRP3 and inflammasome formation (7, 8). These findings suggest that GL and GA dipeptide protein filaments likely induce inflammatory Attorney Docket No.035052/607414 responses in cells. However, the observation of filaments and amyloid-like networks formed by VR dipeptides in the presence of PBS was unexpected. Without wishing to be bound by any theory or mechanism, it is believed that VR dipeptide proteins might disrupt nucleic acid pathways as do PR and GR, but also activate inflammatory pathways typically seen in aging cells. Example 2: VR dipeptide repeat protein avidly binds ssDNA and RNA [0167] The highly charged nature of repeating VR protein points to its binding nucleic acids. To examine the binding of (VR)₁₀-bio (SEQ ID NO:1) to nucleic acids, it was diluted in low salt buffer to disperse aggregates and aliquots from incubations with RNA or DNA were prepared for TEM by rotary metal shadow casting as in Figure 1. Examination of M13 ssDNA (SEQ ID NO:13) revealed previously described bush-like structures (Figure 1G) and incubation with (VR)₁₀-bio (SEQ ID NO:1) at ratios of 0.1 to 1.0 micrograms of (VR)₁₀-bio (SEQ ID NO:1) per microgram of ssDNA resulted in progressive compaction with highly condensed structures present at a 1:1 mass ratio (Figure 1H). The (VR)10-bio (SEQ ID NO:1) molecules alone were too small to be seen by shadow casting. TERRA molecules (156 nt) (SEQ ID NO:12) were barely visible as small dots (Figure 1I) but upon incubation with (VR)₁₀-bio (SEQ ID NO:1) at a 1:1 mass ratio clearly visible dense aggregates were observed (Figure 1J). As seen by EM, incubation of a mixture of supercoiled and relaxed plasmid species at a 1:1 mass ratio of (VR)₁₀- bio (SEQ ID NO:1) to DNA (Figure 1K) resulted in a fraction of the supertwisted molecules appearing collapsed, but others and the relaxed species appeared unchanged. [0168] To explore this further, a plasmid digest consisting of 3 DNA fragments (1937, 1018, and 558 bp) was incubated with increasing amounts of (VR)₁₀-bio (SEQ ID NO:1) and electrophoresed on a 0.7% agarose gel (Figure 1L). As the ratio of (VR)10-bio (SEQ ID NO:1) to DNA increased (lanes 2-8) the fragments showed a shift to slower migrating species and the appearance of increasing amounts of DNA at the top of the gel such that at the highest ratio of peptide all of the DNA was present at the top. [0169] These observations demonstrate that the repeating VR protein has a strong affinity for nucleic acids with preference for ssDNA and RNA over duplex DNA. This may suggest that the greater flexibility of ssDNA and RNA over dsDNA facilitates binding of the arginine and Attorney Docket No.035052/607414 phosphate residues. Further studies with RNAs of different sizes and base composition will be required to determine if the VR peptide has any higher preference for TERRA over other RNAs. Example 3: VR dipeptide repeat protein localizes to DNA replication forks and Holliday junctions [0170] The high affinity of (VR)10-bio (SEQ ID NO:1) for ssDNA suggested that it might localize to ssDNA gaps or unpaired structures in duplex DNA. To test this, we used a circular 3 kb plasmid (SEQ ID NO:16) containing a single replication fork with a 400 bp displaced duplex tail at a defined site. The DNAs contain gaps of either 1, 5, or 15 nt at the base of the fork on the displaced arm. The DNA was sequentially incubated with (VR)10-bio (SEQ ID NO:1) and then streptavidin to identify its location and prepared for TEM. DNAs with a 5 nt gap at the fork are shown in Figures 1M-1P. [0171] In the absence of (VR)10-bio (SEQ ID NO:1), scoring 100 DNAs with a replication fork, none had a streptavidin particle bound at the fork or elsewhere on the DNA. In the presence of (VR)10-bio (SEQ ID NO:1), streptavidin tagging showed a high preference for (VR)10-bio (SEQ ID NO:1) at the fork with similar affinity for DNAs containing 1, 5, or 15 nt gaps. For DNA with a 1 nt gap, 82% had a single streptavidin particle bound, and of these, 84% were localized to the fork, while the remaining 16% were either at the end of the displaced arm or along the plasmid circle. With a 5 nt gap, 91% of the streptavidin particles were localized to the fork, and with a 15 nt gap, 85% were at the fork. The ends of the displaced arm may have some ss character resulting in localization at that site. This represents a very high preference for the replication fork junction. [0172] The fork in the molecule shown in Figure 1P had regressed to generate a 4-stranded chicken foot structure in which there is no ss gap at the junction. Such structures were frequently bound by (VR)10-bio (SEQ ID NO:1) as seen by streptavidin tagging. To examine this further, a pure Holliday junction DNA (J-12 junction with 200 bp arms) was incubated with (VR)10 -bio (SEQ ID NO:1) and streptavidin. Of 83 Holliday junction DNAs scored, 46% showed a streptavidin particle bound and of those, 82% were at the junction as contrasted to being along or at the ends of the arms. Thus, (VR)10 -bio (SEQ ID NO:1) not only has a strong affinity for ssDNA or RNA, but can target small unpaired regions in DNA such as those present at a Holliday junction. To ask whether the nucleic acid binding properties of VR dipeptide repeat Attorney Docket No.035052/607414 protein are unique to this sequence or rather due to the presence of the charged arginine residues, a biotin tagged 18 amino acid poly arginine peptide (R18-bio) (SEQ ID NO:8) was synthesized, along with a biotin tagged 17 amino acid repeating dipeptide in which the arginine residues were replaced with lysine ((VK)9-bio) (SEQ ID NO: 9). These were employed in experiments with the replication fork DNA containing a 15 nt gap at the fork and at the same ratios of the peptides to DNA as above. Results with (VK)9-bio (SEQ ID NO: 9) showed only slightly less specificity for the fork than (VR)10-bio (SEQ ID NO:1) with 78% of the streptavidin particles localized to the fork as contrasted to elsewhere on the DNA. Scoring 112 replication fork DNAs incubated with R₁₈-bio (SEQ ID NO:8), half (49%) showed one or more streptavidin particles bound along the circle or on the displaced arm, and the other half (51%) at the junction (18% of the DNAs were not tagged by streptavidin). Overall, this peptide showed significantly lower specificity for the fork junction. These experiments revealed that the family of dipeptide repeat proteins that includes VR, and most likely PR and GR may be "tuned" to bind tightly not only to ssDNA and RNA but also to perturbations in duplex DNA such as ss gaps, replication forks and Holliday junctions. Pure poly-arginine or poly-lysine peptides may bind so indiscriminately to nucleic acids that any preference for perturbations in duplex DNA may be mostly lost and hence in vivo would bind primarily along the bulk of the nucleic acids. The alternation of charged and neutral amino acids may help in arranging the charged amino acids in their interaction with the phosphate groups along the nucleic acid backbone generating a higher specificity for gaps and junctions in DNA. Clearly, in vivo effects of these dipeptide repeat proteins would become more pronounced as their length increases. Example 4: Generation of an antibody specific for the VR dipeptide repeat protein [0173] A rabbit polyclonal antibody was raised to repeating VR protein (SEQ ID NO:2). The specificity of the antibody was confirmed by dot blot analysis, which showed specific staining with increasing amounts of (VR)₁₅ (SEQ ID NO:3) but no signal against (GL)₉ (SEQ ID NO:4) (Figure 2A). To evaluate the VR antibody specificity in human cells, a DNA construct containing the cytomegalovirus (CMV) promoter and a 3X Flag tag, followed by 60 in-frame VR repeats was synthesized (SEQ ID NO:7) (Figure 2B) and transfected into U2OS cells, which exhibit an ALT phenotype and were shown to have elevated levels of TERRA due to the presence of hypomethylated subtelomeric regions (9, 10). Thus, U2OS cells may exhibit a higher Attorney Docket No.035052/607414 level of endogenous VR dipeptide proteins. Thirty-six hours after transfection, cells were fixed and co-stained with VR (red) and Flag (green) antisera and counterstained with DAPI. Laser scanning confocal microscopy revealed distinct Flag and VR foci. Both the Flag epitope (Figure 2C, top) and the VR staining material (Figure 2C, middle) were present in punctate foci ranging from small spots to larger bodies. The VR antibody also stained large bodies in the nuclei suggesting that the VR dipeptide protein is prone to aggregation (Figure 2C). [0174] Colocalization of the signals from the VR antibody and the Flag tag in 50 cells was used to determine whether the foci detected by the VR antibody represent VR dipeptides expressed from the plasmid or off-target proteins in U2OS cells. Yellow signals indicate foci where both VR and Flag antigens are in close proximity and the presence of frequent yellow signals in the merged image (Figure 2C, bottom panel) demonstrate positive spatial correlation between images in the two channels. Some separate red signals were detected by the VR antibody that did not colocalize with Flag (Figure 2C, white arrow, bottom panel) suggesting detection of endogenous VR dipeptide proteins. [0175] Colocalization coefficient analysis was performed to translate the yellow overlap signals into quantitative information reflecting the correlation of the two targets (11). As shown in Figure 2D, 98% of the red pixels overlapped with the green pixels and 81% of the green pixels overlapped with the red pixels. This high degree of overlap suggests that the VR antibody is specific and binds its target (VR) in this case, fused to Flag. Example 5: SDS-PAGE and Western blot analysis validate the specificity of the VR antibody [0176] The results from laser scanning confocal microscopy pointed to cell-specific staining with the VR antibody (Figure 2C arrows). Thus, VR dipeptide proteins should be detected in a Western analysis using the VR antibody. It was also important to determine if any general cellular proteins contribute a background of staining. If so, they should be seen as a specific band or bands upon probing the gels. Arguments for the specificity of the VR antibody which was generated using a (VR)4 peptide (SEQ ID NO:2) and affinity purified using a (VR)15 peptide (SEQ ID NO:3) came from a Blast search of the database of human proteins. This failed to uncover any protein with a run of 4 VR repeats and only one (OS-9 isoform precursor) with 3, arguing that this particular amino acid arrangement may have been selected against, possibly for structural or other reasons. Attorney Docket No.035052/607414 [0177] Previous studies of the behavior of the dipeptide repeat proteins GA, GP, and GR(12) on SDS PAGE gels revealed that even though they were of relatively low molecular weight, none entered the gel proper but were detected at the boundary of the stacking gel and similar results were reported upon transfecting HEK293 cells with constructs expressing GA, GP and GR peptides, indicating that those dipeptides are also in SDS-insoluble aggregates (13). They also noted that the properties of these proteins appear to partially inhibit or lower their electro-transfer efficiency to PVDF membranes. [0178] Thus, dot blot analysis provides a more accurate and reliable measure of this class of proteins than Western analysis. When the (VR)15 dipeptide (SEQ ID NO:3) was boiled in 10% SDS and electrophoresed on an 8-16% polyacrylamide gel, Western analysis using the VR antibody revealed that the peptide also remained at the boundary of the stacking gel (Figure 3A) paralleling the results with the ALS/FTD dipeptide proteins. [0179] To probe for any cellular proteins that might be contributing a background to the signals observed in the light microscopy studies (Figure 2C), extracts were prepared from 80% confluent U2OS cells, U2OS cells overexpressing (VR)60 (SEQ ID NO:7), and cells from a primary human foreskin fibroblast cell line (FSK) established in the laboratory. Staining with Ponceau-S (Figure 3B) revealed that comparable amounts of protein were present on the membrane for all three samples. Probing the gel with the VR antibody (Figure 3C) revealed distinct bands at the boundary of the gel and stacking gel for the U2OS,U2OS-RV60, cells, and the synthetic VR₁₅ (SEQ ID NO:3) dipeptide protein and a very dim signal was present from the FSK cells. The lack of any bands within the 8-16% gel for any of the three cell extracts provided evidence that the VR antibody used is not broadly detecting other cellular species. This analysis also indicated that there are higher levels of VR dipeptide protein aggregates present in the ALT line U2OS as contrasted to the primary foreskin line FSK. Example 6: Detection of repeating VR protein expression in U2OS, ICF, and primary human cells [0180] Cells from a primary human foreskin fibroblast cell line (FSK) established in the laboratory were compared to those derived from two cell lines known to have high endogenous levels of TERRA: U2OS, and the telomerase positive fibroblast line (GM08747) derived from a female patient afflicted with the Immunodeficiency, Centromeric region instability, Facial Attorney Docket No.035052/607414 anomalies syndrome (ICF) in which high levels of TERRA have been reported also due to hypomethylation of subtelomeric regions (14, 15). [0181] High resolution confocal microscopy was used to explore the presence of repeating VR proteins in the three cell lines. Leaving out the primary VR antibody was included as a negative control. A goat anti-rabbit Alexa 488 secondary antibody conjugate was used to detect VR signals in the cells and phalloidin-rhodamine and DAPI respectively were used to stain filamentous F-actin and nuclei. Initial imaging was carried out to optimize the specificity of staining and quality of the images. To do so, each individual cell was identified by detecting DAPI-stained nuclei, followed by laser scanning for VR signals (any signal with pixel values above the background level). This was done for cells selected in each of the three cell lines. The U2OS cells with the best signal-to-noise ratio were used to optimize the acquisition parameters for each fluorescence channel for the three cell lines. Endogenous VR signals were detected and appeared as punctate spots and discrete foci which varied in size and intensity in the three cell lines (Figure 4A, left top, middle, and bottom panels). No VR signals were detected in the negative control (no primary antibody) confirming that the VR primary antibody binding is specific. [0182] A total of 684 cycling cells were randomly imaged in 3 independent experiments. To avoid any bias, the images were acquired blindly to the VR signals. To analyze the data, the threshold was set to discriminate the positive signals from the negative signals using CellProfiler software (16). The number of cycling cells with 5 or more VR foci were scored the in the three cell lines. The results indicate that approximately 37% of U2OS and 33% of the ICF cells contain ≥ 5 VR foci. By comparison, only 11% of the primary FSK cells had ≥ 5 VR foci (Figures 4A and 4C). These results reveal that U2OS and ICF cells exhibit a 3-fold (P < 0.001, P < 0.01), greater number of VR foci compared to the FSK cells pointing to the conclusion that cells with hypomethylated subtelomeres and elevated TERRA produce more telomeric VR dipeptide proteins. [0183] F-actin and nuclei were counterstained with phalloidin and DAPI, respectively (Figure 4B). Scoring VR puncta was restricted to cells with ≥ 5 VR foci and localization analysis in the three cell lines demonstrated that 76%, 75%, and 69 % of VR staining material showed preferential nuclear localization in U2OS, ICF and the primary FSK line, respectively (P < 0.01, Attorney Docket No.035052/607414 P < 0.0001, and P < 0.0001). The arginine-rich nature of the VR dipeptide proteins resembles nuclear localization signals in the enrichment of arginine and lysine amino acids. [0184] High resolution laser scanning microscopy demonstrated increased levels of VR dipeptide staining in cells with higher TERRA levels. The staining was preferentially localized to the nuclei and, in cells with higher TERRA levels, VR staining was more commonly present in larger aggregates as contrasted to the human primary line. Moreover, the two high TERRA lines contained 3-fold more staining material, consistent with the production VR dipeptide protein through RAN translation from TERRA molecules. Example 7: Altering TERRA levels in U2OS cells results in large solid nuclear VR aggregates [0185] Ideally, it would be valuable to stably reduce TERRA levels to background and determine if VR dipeptide proteins are depleted. However, achieving efficient suppression of TERRA in cells has been difficult despite multiple approaches. TERRA as a key structural component of the telomere cannot be eliminated without concomitant loss of telomere integrity. This is further confounded by the binding of RNA polymerase II to promoters within the subtelomeric sequences at multiple chromosomes ends where it initiates transcription of TERRA (1, 17, 18) and Feretzaki et al (19) reported their failure to efficiently suppress TERRA levels utilizing Crispr/Cas9 technology due to TERRA being produced from multiple chromosomes. [0186] One approach to transiently reduce TERRA levels employed by several authors involves treating cells with small oligonucleotides termed Locked Nucleic Acid (LNA) GapmeRs. These can be tailored to bind TERRA and induce its degradation by RNaseH. Such treatment has been shown to generate Telomere-dysfunctional foci (TIFs) as seen by light microscopy (20, 21) . [0187] Studies from Chu et al (20) and González-Vasconcellos et al (21) employing an LNA GapmeR approach in U2OS cells reported a brief depletion of TERRA using 8 mM or 100 nM LNA GapmeR (SEQ ID NO:10) respectively. However, TERRA levels were restored to normal levels within 24 h. Although this limitation prevented measurement of VR levels in cells stably depleted for TERRA, VR levels and localization in U2OS cells were studied upon transient alteration of TERRA. U2OS cells were treated with 8 mM LNA GapmeRs (SEQ ID NO:10), including one of the same length but with a scrambled nucleic acid sequence (control-LNA GapmeR) (SEQ ID NO:11). However this resulted in nearly complete death of the cells within Attorney Docket No.035052/607414 the first 24 h. Thus the treatment was reduced to 100 nM for 24 h, the cells were fixed, and RNA-FISH was performed to detect TERRA foci (Figure 5A). [0188] TERRA foci in a total of 643 cells from 3 independent experiments were scored. To generate unbiased data, images from each condition were acquired randomly and blindly to TERRA signals. The threshold of the positive signals was determined and quantification performed using CellProfiler software (16). The results revealed a 40% reduction (P < 0.05) in TERRA in the LNA GapmeR treated cells as contrasted to the control (Figure 5B). This is consistent with the observations of González-Vasconcellos et al. (21) who reported a ∼50% depletion under similar treatment conditions in the same cell line. [0189] The LNA GapmeR (SEQ ID NO:10) and control-LNA GapmeR (SEQ ID NO:11) treated U2OS cells were stained with the VR primary and the Alexa Fluor 488 secondary antibodies followed by imaging by confocal microscopy to determine whether reduction of TERRA levels alters the expression of the VR dipeptides (Figure 5C). Strikingly, in cells with lowered TERRA and thus dysfunctional telomeres, the VR dipeptide was seen in large solid nuclear aggregates compared to the distinct small spherical signals detected in cells treated with the control-LNA GapmeR (SEQ ID NO:11) (Figure 5C) or untreated U2OS cells (Figure 4A). Scoring 726 U2OS cells in 2 independent experiments revealed that 19% of the U2OS cells displayed large solid nuclear VR aggregates (Figure 5D) upon partial depletion of TERRA. This phenotype was completely absent in the scored U2OS cells treated with the scrambled GapmeR (SEQ ID NO:11) (Figure 5D). [0190] In summary, transient reduction of TERRA levels by 40% as seen by RNA-FISH resulted in the appearance of large aggregate forms of VR in the nuclei. The formation of these large solid nuclear VR aggregates was in contrast to the distinct small spherical signals detected in cells treated with the control-LNA GapmeR (SEQ ID NO:11). Their appearance is suggestive of phase transitions in cellular proteins, in particular droplet liquid-state to reversible amyloid cross-β fibrils that has been described in cancer and neurodegenerative diseases (22, 23). Proteins known to bind TERRA include FUS and the hnRNPs (24–26) which are RNA binding proteins that contain prion-like domains and glycine-arginine rich (RGG) domains (27). It had been shown that reduction of the levels of noncoding RNA and the presence of arginine rich dipeptides strengthens the electrostatic interaction between the arginines and FUS leading to the formation of solid dense aggregates (23, 28, 29). Based on these observations repeating VR Attorney Docket No.035052/607414 protein may play a key role in accelerating an aberrant phase transition via its possible direct electrostatic interaction with FUS and hnRNPs. Example 8: Lentivirus shRNA knockdown of TRF2 leads to higher levels of cytoplasmic VR dipeptide protein [0191] Previously, Cesare et al (30) utilized two lentivirus constructs expressing antisense RNAs, shTRF2-1488 (SEQ ID NO:14) and shTRF2-18358 (SEQ ID NO:15), to knockdown TRF2 protein. Recently, using these same constructs and approach, Nassour et al (5) observed a significant increase in cytoplasmic TERRA upon infecting IMR90E6E7 cells with shTRF2- 18358 (SEQ ID NO:15), indicating that accumulation of TERRA in the cytoplasm is associated with telomere dysfunction. Thus, it is possible that this would result in an increase in cytoplasmic VR dipeptides in U2OS cells. If so, this would provide additional evidence linking dysfunctional telomeres to the production of VR dipeptide proteins. U2OS cells were infected with lentiviruses expressing shTRF2-1488 (SEQ ID NO:14) and shTRF2-18358 (SEQ ID NO:15) RNAs and selected for puromycin resistance (2 mg/ml for 14 days). Cell extracts were prepared for Western analysis using SDS-PAGE gels. As shown (Figure 6A), infection with either lentivirus construct resulted in near complete reduction of TRF2 with shTRF2-18358 (SEQ ID NO:15) being most potent. The pooled U2OS cells infected with shTRF2-18358 (SEQ ID NO:15) were seeded on slides, fixed, and stained with the VR antibody as described above. The percentage of cells with 5 or more aggregates per cell was determined by randomly scoring 657 cells in two independent experiments. Unbiased scoring was carried out as described above. Analysis revealed a significant increase (22%) in the number of cells expressing 5 or more VR aggregates per cell P< 0.05 (Figures 6B and 6C) in the population with depleted TRF2. Because TRF2 depletion in IMR90E6E7 cells resulted in higher levels of cytoplasmic TERRA, cells were also scored for 5 or more VR aggregates localized to the cytoplasm as contrasted to the nucleus (Figures 6B and 6D). This revealed an even greater increase (27%) relative to untreated cells P< 0.05. In summary, lentivirus knockdown of TRF2 resulted in an increase of TERRA in the cytoplasm (5), which also results in an increase in cytoplasmic VR aggregates. Attorney Docket No.035052/607414 Example 9: Detection of repeating VR protein in tumor microarray (TMA) slides [0192] Tumor microarray (TMA) slides, light microscope slides containing many small punches of fixed human tissue embedded in paraffin, comprising over 200 sarcoma cancer samples and 50 normal tissues samples were stained with the rabbit polyclonal antibody for repeating VR protein as a means of probing human cancer samples for elevated levels of the repeating VR protein. The data showed a 3-to-4-fold higher frequency of high-level staining with the VR antibody in the cancer samples as contrasted to the normal samples. Example 10: Lentivirus shRNA knockdown of TRF2 in IMR90 ^E6/E7 cells leads to high levels of cytoplasmic VR dipeptide protein [0193] Using the same approach as described in Example 8 but with a non-transformed cell line, IMR90^E6E7 the cells were treated with the shTRF2-18358 (SEQ ID NO:15) lentivirus and the cells examined by light microscopy for the levels of VR protein (Figures 8A-8B). The percentage of cells with 5 or more aggregates per cell was determined by randomly scoring 817 cells in two independent experiments. Unbiased scoring was carried out as described above. Analysis revealed a two-fold increase in the number of cells expressing 5 or more VR aggregates per cell P< 0.05 (Figure 8C) in the population with depleted TRF2. In summary, lentivirus knockdown of TRF2 resulted in an increase of TERRA in the cytoplasm of non- transformed cells which also results in an increase in cytoplasmic VR aggregates. Example 11: Cells undergoing cell division express high levels of the VR protein [0194] Upon staining U2OS and primary cells with the VR antibody, instances were noted in which cells in mitosis stained strongly with the VR antibody, while the adjacent cells which were not mitotic did not (Figure 9A). Thus, TERRA may be normally sequestered away from ribosomes in the cytoplasm so that neither VR nor GL are produced in any significant amounts unless TERRA is transported to the cytoplasm due to dysfunctional telomeres. However, during mitosis when the nuclear membrane breaks down, TERRA is exposed to a large concentration of ribosomes and resulting in a burst of VR and GL production. A role for VR may be suggested from the ALS/FTD studies of the PR protein, which was shown to inhibit ribosome biogenesis, inhibit DEAD box RNA helicases and to promote paraspeckle formation (31–33). It is known that protein synthesis drops to low levels during mitosis but all of the Attorney Docket No.035052/607414 factors responsible have not been fully elucidated. Thus, a burst of VR could directly contribute to quenching protein synthesis during mitosis. These events would be followed by a reformation of the nuclear membrane, sequestering TERRA again away in the nucleus, and an active or passive reduction in VR levels. This observation was examined by synchronizing cells in metaphase with a drug (RO-3306) which inhibits the cdk1 protein needed for progression through cell division. [0195] U2OS cells at 60% confluency were treated with 9uM RO-3306 for 20 hr to enrich cells in G2 phase. Cells were then washed to remove the drug and release the cells into mitosis. Fresh media was added, and the cells were incubated for another 30 min. Mitotic cells were isolated by mechanical shake-off. The isolated mitotic cells were then seeded in a chamber slide for staining and microscopic analysis. Examples are shown in Figures 9B-9E. Examination of 620 mitotic cells showed that 100% of cells stained strongly with the VR antibody. As a therapeutic implication of the strong expression of VR in mitotic cells, it is proposed that the disruption and targeting of VR peptides in tumor tissue may lead to cellular stress, activation of cell death pathways and ultimately the elimination of cancer cells. One way to do that is to generate a specific monoclonal antibody that recognizes VR. The same monoclonal can be tagged with Ubiquitin and this can serve as a signal for recognition by the cellular proteasome. In this scenario, the proteasome unfolds and translocates VR, cleaving them into smaller peptides. Continuous ubiquitination and proteasomal degradation result in a reduction in the levels of the targeted VR within the cell. Example 12: Treatment of U2OS cells with a telomere-specific drug BRACO-19 leads to the appearance of large spherical VR bodies in the cell nuclei [0196] A tri-substituted acridine drug, BRACO-19 binds tightly to the G quartets in the ssDNA telomere overhang, stabilizing them in the quadruplex form. It has significantly lower affinity for G quadruplexes in RNA. Cells with metastable telomeres (ALT lines or lines with very short telomeres) when exposed to BRACO-19 rapidly enter senescence at 1-5 micromolar treatment for 72 hr. This is 20-40 times less than levels which begin to show effects in cells with long stable telomeres. U2OS cells were treated with 0.25 to 2 micromolar BRACO-19 for 6, 12, and 24 hr and examined for expression of VR using scanning confocal microscopy and staining with the rabbit VR antibody. As shown in Figure 10A at 6 hr, and 2 micromolar drug, the cells showed Attorney Docket No.035052/607414 only a low level of the VR aggregates while at 12 hr and 2 micromolar drug a modest increase was observed (Figure 10B). At 24 hr treatment with 2 micromolar BRACO-19 a striking 5-fold increase in cells with large spherical VR inclusions (Figure 10C) which appear like liquid droplets or phase separated bodies was observed. Figure 10D summarizes the VR aggregates detected after 6, 12 and 24 hrs. These results suggest a strong link between the generation of dysfunctional telomeres (blocking the telomeric overhang) and the expression of the VR protein in large amounts and provides a tool for examining cellular binding partners for the VR protein. Example 13: Staining human tumor microarray slides with the antibody to VR protein reveals strong staining in a variety of cancer and non-cancer cells [0197] Tumor microarray slides containing small (~ 2mm) circular punches of human tissues fixed and embedded in paraffin were obtained from US BioMax Inc (Derwood Maryland). Graded by a pathologist, each circular sample were identified as to tissue type, from normal tissue or tissue exhibiting cancer or another disease, and frequently age and sex of the donor. These slides were stained by the staff of the UNC Pathology Core Facility using the polyclonal antibody to VR protein and then counter stained with an anti-rabbit antibody tagged with Horse Radish Peroxidase (HRP) followed by development of the brown colored deposit generated by HRP. The slides were imaged in a Leica ScanScope 2 using Imagescope software at 20X magnification. Figure 12A shows an image of normal human stomach lining tissue. Little brown staining for VR is observed. In Figure 12B, stomach lining tissue from an individual suffering from chronic superficial gastritis is shown and exhibited strong brown staining, indicating high expression of VR protein in cells involved in an inflammatory response. Accordingly, assays for VR have potential to detect general inflammatory disease. [0198] The image in Figure 12C shows an example of brain tissue from a 22-year-old male stained with the VR antibody and Figure 12D is an image of brain tissue from a 50 year old male stained with the VR antibody. Strong staining of pyramidal neurons by the VR antibody was observed much more frequently in brain tissue taken from older individuals as contrasted to those in their 20's. This observation suggests an increase in VR expression in cells in the brain as individuals age, due to cells reaching senescence or exhibiting damage to their genomes due to radiation, or toxic insult. Figure 12E which showed little or no staining for VR is an example of blood vesicle tissue graded by a pathologist to be adjacent to a blood vesicle tumor but not cancerous. This is in Attorney Docket No.035052/607414 contrast to the image in Figure 12F in which a nearby adjacent low malignant glomus tumor in the blood vessel of the 67-year-old patient was also stained with the antibody to the VR protein. The latter image (Figure 12F) shows several clusters of cells staining strongly for the VR protein. This observation indicates that detection of elevated levels of VR in tissue or blood can be used as a marker for cancer. These results indicate that chronic inflammation, advanced age, and cancer are correlated to elevated telomere-encoded dipeptide repeat protein levels. Materials and Methods Production of Polyclonal Antibodies [0199] The rabbit polyclonal antibodies were generated by Vivitide Inc. (now BioSynth Inc). Antiseri were raised to repeating VR protein using SEQ ID NO:2 and purified on affinity columns containing SEQ ID NO:3. Additional antibodies were raised using SEQ ID NO:5 followed by purification on a column containing SEQ ID NO:2 (Table 1). Affinities for each were very high with titers of 61,000 and 115,000 obtained. Preparation of TERRA RNA [0200] In one embodiment, a pGEM-based plasmid, pRST5 plasmid (SEQ ID NO:16) was linearized with NotI so that one end contains a T7 RNA polymerase promoter followed by a long TTAGGG repeat block. The DNA was transcribed with T7 RNA polymerase (MAXIscript T7 transcription Kit, Invitrogen) using conditions described by the vendor, and the RNA purified using an RNA Clean & Concentrator kit (Zymo Research). Transmission Electron Microscopy (TEM) [0201] For TEM examination of the protein filaments and nucleic acids, supports were prepared consisting of 400 mesh copper disks (EM Sciences Inc) covered by thin pure carbon films (~2 nm thick) which had been treated with a glow discharge for 1 min at 300 torr. GL (SEQ ID NO:4) and GA (SEQ ID NO:6) filaments were diluted to 20 µg/mL and DNAs diluted to 1 µg/mL in a buffer of 10 mM Tris HCl (pH)7.5, 0.1 mM EDTA. VR solutions (SEQ ID NOs:1&3) were diluted in PBS to 20 µg/mL. Samples were mixed with a concentrated buffer to achieve a final salt concentration of 10 mM Tris (pH 7.5), 75 mM NaCl, 50 mM KCl, 2 mM MgCl2 and 2 mM spermidine HCl and immediately applied to the supports for 3 min followed by Attorney Docket No.035052/607414 washing with a series of water-ethanol solutions (1, 20, 50, 75, 100% ethanol) for 5 min each. The samples were air dried and rotary shadow cast with a thin film of tungsten at 1x10-6 torr in a modified Denton DV502 evaporator (Denton Vacuum,) equipped with a quartz thin film monitor (Inficon Inc). The samples were imaged at 40 kV in a T12 TEM (FEI/Thermo-Fisher) equipped with a 4Kx4K Orius camera (Gatan Inc.). Samples to be imaged by negative staining were adsorbed to the glow discharge treated films in buffer (above) for 3 min followed by washing with 2% uranyl acetate and air drying. Imaging in the T12 TEM was at 80 kV. CryoEM analysis was carried out by placing 3 microliters of the GL peptide filaments (SEQ ID NO:4) (100 µg/mL) on Quantifoil R1.2/1.3 grids (EM Sciences) followed by cryo-freezing using an FEI/Thermo-Fisher Vitrobot Mark V. The samples were imaged in a Thermo-Fisher Talos Arctica G3 Cryo TEM equipped with a Gatan K3 direct electron detector at 200 kV. Preparation of DNA-protein samples for TEM [0202] The replication fork DNAs with streptavidin tagging were prepared by incubating the DNA together with the (VR)10-bio (SEQ ID NO:1) peptide for 20 min at room temperature followed by addition of streptavidin (Thermo-Fisher Inc.) for another 20 min. The samples were then fixed with 0.6 % glutaraldehyde for 5 min at room temperature and the sample passed over a 2 ml gel filtration column of 6% agarose beads (Agarose Bead Technologies Inc.) equilibrated in 10 mM Tris (pH 7.5), 0.1 mM EDTA and the fractions containing the DNA collected and pooled for EM preparation. SDS-PAGE and Western Blotting Analysis [0203] U2OS, U2OS-VR₆₀, U2OS expressing shTRF2, and FSK cells (80% confluent) in 10 cm dishes were washed twice with cold 1X PBS and scraped into a pre-chilled tube. Cells were then pelleted at 1500 rpm for 10 min at 4 °C and the PBS removed. The cells were lysed by resuspension in 300 microliters of Radioimmunoprecipitation assay (RIPA) buffer (Thermos scientific, 89900) containing protease (Roche 11873580001) and phosphatase (Roche 04906845001) inhibitors for 40 min at 4 °C. The whole cell lysate was centrifuged at 16,000 g for 20 min at 4 °C. After the final centrifugation, the supernatant was collected, and a colorimetric Bradford assay was performed to determine the protein concentration. To prepare protein samples for SDS-PAGE analysis, 100 micrograms (VR detection) or 50 micrograms Attorney Docket No.035052/607414 (TRF2 detection) of lysates were diluted in water and 5X Laemmli buffer in a final volume of 30 microliters per sample. The protein samples were boiled for 5 min, loaded into 8-16 % Mini- protean TGX gels (Bio-Rad, 4568104) and subjected to SDS-PAGE electrophoresis followed by Coomassie staining or electrophoretic transfer into PVDF membranes. For SDS-PAGE gel analysis, gels were fixed in 40% methanol, 10% acetic acid for 30 min and stained with 0.025% w/v Coomassie Blue G-250, in 10% acetic acid for 1 hr at room temperature. The gels were then destained in 10% acetic acid. [0204] For Western Blot analysis, the separated proteins were transferred onto 0.45 μm PVDF membranes. Briefly, the blotting sandwich was submerged in (1X) transfer buffer and transfer carried out at 20 V for 20 hr at 4 °C. After transfer, the membranes were stained in reversable Ponceau S stain for 15 min and washed in water. The membrane was blocked in 5% Non-Fat Dry Milk (NFDM) in TBS-T (0.1% (v/v) Tween-20 in TBS) for 1 hr at room temperature, followed by overnight incubation with the rabbit polyclonal VR antibody diluted in the blocking solution (1:1000) or 1:1000 TRF2 antibody (13579 Abcam). Membranes were washed 3X in 1X TBST, for 5 min each with shaking. The blot was then probed with the anti-rabbit secondary antibody (1:3000)(NA934V Cytiva) or 1:5000 anti-mouse secondary antibody (1706516 Bio-Rad diluted in the blocking solution for 1 h at room temperature and washed three times in 1X TBST, 5 min each with shaking. After the last wash, the HRP-secondary antibody was detected using the Enhanced Chemiluminescence (ECL) detection reagents (1705061 Bio-Rad). Western blots were imaged using the ChemiDoc XRS+ Gel Imaging System (Bio-Rad). Cell lines, cell culture, and transfection [0205] U2OS cells were grown in Dulbecco’s modified Eagle medium (DMEM, Gibco) supplemented with 10% FBS and 1X Glutamax. Primary human foreskin fibroblasts (FSK) previously established in the laboratory were cultured in Alpha-MEM (Gibco) supplemented with 10% (V/V) Fetal Bovine Serum FBS, 55 µg/mL of gentamicin and 0.15% (V/V) non- essential amino acids. Primary fibroblasts from a female ICF patients (GM08747) (obtained from the Coriell institute), were cultured in DMEM supplemented with 15% (V/V) FBS. The three cell lines were seeded into 4 well chamber slides (Millipore) and incubated at 37° C with 5% CO₂ for 24 h. Cells were then fixed for Immunofluorescence staining. For DNA transfection, U2OS cells were seeded on 4 well chamber slides and transfected with 0.5 µg of 3X Flag-VR60 plasmid Attorney Docket No.035052/607414 (SEQ ID NO:7) at 75-80% confluency using Lipofectamine 2000 (Life Technology). Thirty-six hr post transfection, U2OS cells were fixed for double immunofluorescence staining. [0206] For experiments with the LNA GapmeR, U2OS cells were grown to 75% confluency in 4 wells chamber slides. Cells were transfected with LNA TERRA-GapmeR (TAACCCTAACCCTAACCCTA) (SEQ ID NO:10) or control LNA GapmeR (GCGACGTAAACGGCCACAAG) (SEQ ID NO:11). In brief, 100 micromolar LNA GapmeR oligos were added into a tube containing 250 microliters of Opti-MEM. A second tube contained an equal amount of Opti-MEM and 1 microliter of lipofectamine reagent (lipofectamine 2000, Invitrogen). The two tubes were mixed in a 1:1 ratio and incubated at room temperature for 20 min. The oligo-lipid complex was added dropwise to each well. The medium was changed 8 h later and 24 h after transfection cells were fixed for immuno RNA-FISH. To generate pooled cells with depleted TRF2, U2OS cells were seeded at 70% confluency in 6 well plate. A day later, cells were infected with two lentiviral particle constructs shTRF2 (1488 and 18358) (SEQ ID NOs:14&15) at an MOI of 10 in Opti-MEM media containing 8 micrograms/ml polybrene in total of 1.5 ml/ well. Infected cells were spun at 1500 RPM for 2 h. Cells were then cultured in complete medium overnight. Twenty four h later, selection began, and cells were expanded in the presence of 2 micrograms/ml puromycin for 14 days. Samples were then collected for Western blot analysis. Immunofluorescence Staining [0207] Cells were rinsed with CSK buffer (300 mM sucrose, 100 mM NaCl, 10 mM PIPES ( pH 6.8), and 3 mM MgCl2)and fixed with 4% paraformaldehyde (PFA) in 1X PBS for 10 min and then permeabilized with 0.2% Triton X-100 in CSK buffer for 12 min. Next, cells were incubated with blocking solution containing 10% Normal Goat Serum (NGS) in 1X PBS for 1 h at room temperature. The cells on the slide were then incubated with the primary polyclonal VR antibody raised in rabbits (dilution 1:50) in blocking solution at 4 °C for 16-18 h. Following incubation with the primary antibody, the slides were washed 3X (10 min each) in 1X PBS. Binding of the VR antibody was visualized by staining cells with AlexaFluor 488 conjugated secondary antibody (Invitrogen A11034, dilution 1:750) for 40 min at room temperature and washing 3X (10 min each) in 1X PBS. F-actin staining was performed by incubating cells with Rh-Phalloidin conjugated to TRITC (Invitrogen R415, dilution 1:1000) at 4 °C overnight and Attorney Docket No.035052/607414 rinsing cells twice in 1X PBS. Finally, cells were stained and mounted with prolong Gold Antifade mountant containing DAPI (Invitrogen P36931). Immuno RNA FISH [0208] U2OS cells transfected with the LNA GapmeR (either TERRA or control) (SEQ ID NOs:14&15), were washed with cold CSK buffer containing 200 mM vanadyl for 30 sec. U2OS cells were fixed in 4% PFA in PBS and permeabilized in 0.5% Triton X-100 containing 200 mM vanadyl for 10 min at 4 °C. U2OS cells were then washed with 70% ethanol and dehydrated in an ethanol series (85%, 95%, and 100%). To detect TERRA repeat sequences (UUAGGG), 2 microliters of 50 micromolar Peptide Nucleic Acid (Alexa 647-CCCTAA) probe (Bio PNA 1013) was added to the hybridization buffer [50% (v/v) formamide, 25% (v/v) 20X saline sodium citrate (SSC)] with 200 mM vanadyl in total of 200 microliters. The hybridization buffer was heated at 85 °C for 10 min to denature the C-rich probe. Then 200 microliters of hybridization buffer was added to each slide. Each slide was covered with a small piece of parafilm and slides were incubated at 37 °C for 6 hr in a humidified chamber. The slides were then washed twice in 50% formamide in 2X SSC, and twice in 4X SSC, and once in 2X SSC + 0.1% NP-40 at 42 °C for 5 min each. To detect VR signals, the washed slides were blocked in 5% NGS in 1X PBS for one hr in room temperature. The VR peptides and nuclei were fluorescently stained as described above (Immunofluorescence Staining). Confocal Microscopy, Image acquisition and analysis [0209] Three dimensional Images (Z-stacks) were acquired with an Olympus FV-1000 confocal microscope equipped with a 60X oil immersion objective. The multi-channel sequential and simultaneous images acquisition were taken under optimized laser and detector settings. Excitation of Alexa 488 was achieved using an argon-ion laser. DAPI signals were detected with the 405 nm laser line and phalloidin was detected with the 532 nm laser line. The Alexa 647 signals were detected with a far-red detector. The sequential laser scanning (one laser line active at a time) was used to eliminate any possibility of bleeding through from channel to channel. A cell with the best Signal-to-Noise Ratio (SNR) were used to optimize the acquisition parameters for each fluorescence channel in each microscopy experiment. The applied PMT voltage, amplifier and the offset levels were also set to improve the SNR. These acquisition settings were Attorney Docket No.035052/607414 applied to each independent experiment. To avoid photobleaching and reduce any signal saturation, all images were acquired at a laser power less than 7% and the PMT HV set to less than 700. The Z-slices were acquired with a step size of 0.40 μm. The acquisition settings were saved for imaging each independent confocal experiment with minor changes. The acquired stacked images were compressed into maximum and average intensity projection Images using Fiji. The projected images generated were analyzed using Cellprofiler software (16) and a pipeline was created. Briefly, the pipeline detects the nuclei based on DAPI staining. Each nucleus was identified as an object using the global Otsu two classes thresholding strategy (value that separates the nucleus from the background), any clumped object was distinguished and excluded based on the shape. The detection of VR and TERRA signals was based on Alexa 488 and staining. We then applied the Otsu thresholding method to distinguish the positive signals from the background. VR localization (in the nucleus and subsequently in the cytoplasm) was determined via applying the MaskImage module. In this module, the identified DAPI images were binarized. The created binarized images were used to mask the positively identified VR signals. [0210] For the (Flag-VR) colocalization analysis experiment, ImageJ and JACoP plugin within the Region of Interest (ROI) and applying Costes’ automatic threshold and Mander’s Overlap Coefficient (MOC) were applied. Double Immunofluorescence Staining [0211] For double immunofluorescence staining, the fixed and permeabilized U2OS cells expressing 3X Flag-VR₆₀ (SEQ ID NO:7) were fixed with 4% PFA in 1X PBS for 10 min and then permeabilized with 0.2% Triton X-100 in CSK buffer for 12 min and blocked for 1 h with 10% NGS. A mouse monoclonal antibody (Sigma M2 F1804, dilution 1;2000) was used to detect the Flag tag and a rabbit polyclonal antibody (dilution 1:50) was used to detect VR peptides. Cells were incubated with a cocktail of the two antibodies at 4°C overnight. Cells were then stained with a cocktail of goat anti-mouse AlexaFluor 488 conjugated secondary antibody (Invitrogen A32723, dilution 1:750) and goat anti-rabbit 568 (Invitrogen A11011, dilution 1:750) for 40 min at room temperature. Cells were then stained and mounted with prolong Gold Antifade mountant containing DAPI (Invitrogen P36931). Attorney Docket No.035052/607414 Statistical Analysis. [0212] All confocal experimental results are presented as standard error. Statistical analysis was performed using Excel. Data presented are the ± of the mean of two or three independent experiments. Two-tailed, Unpaired Two-tailed t-test were conducted; *P < 0.05, **P < 0.01, ***P < 0.01, ****P < 0.0001 Plasmids and DNAs [0213] cDNA encoding 3xFLAG-tagged VR60 was synthesized and subcloned into pcDNA3.1(+) vector (GenScript Inc) to express 3x Flag-tagged VR₆₀. The insert was expressed under the control of the CMV promotor and two stop codons. [0214] DNA insert: CCACCATGGATTACAAGGACGACGACGATAAGGATTACAAGGACGACGACGATAAG GATTACAAGGACGACGACGATAAGAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGG GTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTT AGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG GGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTTGATAA. [0215] 100 bp Bubble DNA top strand: 5'Phos/ GTC GAC GGA ATT CTG AAG TAG GAT TAA TAG TAG CCA ACC AAC CAA CCA CCA CCA CAG AGA AGA ACA TTT GAC CCG GGT AAA GCT AAT AAC AAG TAA TC TGG TCC TGG TC 3’ [0216] 100 bp bubble DNA bottom strand: 3’ – C TGG TCC TGG TC CAG CTG CCT TAA GAC TTC ATC CT AAT CCC AAT CCC AAT CCC AAT ATT ATC ATC CCC CCC CCC CGT GTC TCT TCT TGT AAA CTG GGC CCA TTT CGA TTA TTG TTC ATT A/5' Phos [0217] Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which the inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to Attorney Docket No.035052/607414 be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation. BIBLIOGRAPHY 1. C. M. Azzalin, P. Reichenbach, L. Khoriauli, E. Giulotto, J. Lingner, Telomeric repeat- containing RNA and RNA surveillance factors at mammalian chromosome ends. Science (1979) 318 (2007). 2. C. A. Perez-Romero, M. Lalonde, P. Chartrand, E. Cusanelli, Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Curr Genet 64 (2018). 3. Z. Wang, et al., Telomeric repeat-containing RNA (TERRA) constitutes a nucleoprotein component of extracellular inflammatory exosomes. Proc Natl Acad Sci U S A 112, E6293-300 (2015). 4. R. Arora, C. M. Azzalin, Telomere elongation chooses TERRA ALTernatives. RNA Biol 12 (2015). 5. J. Nassour, et al., Telomere-to-mitochondria signalling by ZBP1 mediates replicative crisis. Nature (2023) https:/doi.org/10.1038/s41586-023-05710-8. 6. T. Zu, et al., Non-ATG-initiated translation directed by microsatellite expansions. Proc Natl Acad Sci U S A 108 (2011). 7. A. Gustot, et al., Activation of innate immunity by lysozyme fibrils is critically dependent on cross-β sheet structure. Cellular and Molecular Life Sciences 70 (2013). 8. C. Westwell-Roper, H. C. Denroche, J. A. Ehses, C. B. Verchere, Differential activation of innate immune pathways by distinct islet amyloid polypeptide (IAPP) aggregates. Journal of Biological Chemistry 291 (2016). 9. L. J. Ng, J. E. Cropley, H. A. Pickett, R. R. Reddel, C. M. Suter, Telomerase activity is associated with an increase in DNA methylation at the proximal subtelomere and a reduction in telomeric transcription. Nucleic Acids Res 37 (2009). Attorney Docket No.035052/607414 R. Arora, et al., RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat Commun 5 (2014). E. M. M. MANDERS, F. J. VERBEEK, J. A. ATEN, Measurement of co‐localization of objects in dual‐colour confocal images. J Microsc 169 (1993). K. Mori, et al., The C9orf72 GGGGCC repeat is translated into aggregating dipeptide- repeat proteins in FTLD/ALS. Science (1979) 339 (2013). Q. Zhou, et al., Antibodies inhibit transmission and aggregation of C9orf72 poly‐ GA dipeptide repeat proteins . EMBO Mol Med 9 (2017). S. Yehezkel, Y. Segev, E. Viegas-Péquignot, K. Skorecki, S. Selig, Hypomethylation of subtelomeric regions in ICF syndrome is associated with abnormally short telomeres and enhanced transcription from telomeric regions. Hum Mol Genet 17 (2008). S. Sagie, et al., Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids. Nat Commun 8 (2017). A. E. Carpenter, et al., CellProfiler: Image analysis software for identifying and quantifying cell phenotypes. Genome Biol 7 (2006). N. Arnoult, A. van Beneden, A. Decottignies, Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1α. Nat Struct Mol Biol 19 (2012). A. Porro, et al., Functional characterization of the TERRA transcriptome at damaged telomeres. Nat Commun 5 (2014). M. Feretzaki, P. R. Nunes, J. Lingner, Expression and differential regulation of human TERRA at several chromosome ends. RNA 25 (2019). H. P. Chu, et al., TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell 170 (2017). I. González-Vasconcellos, M. A. Cobos-Fernández, M. J. Atkinson, J. Fernandez- Piqueras, J. Santos, Quantifying telomeric lncRNAs using PNA-labelled RNA-Flow FISH (RNA-Flow). Commun Biol 5, 513 (2022). S. Boyko, K. Surewicz, W. K. Surewicz, Regulatory mechanisms of tau protein fibrillation under the conditions of liquid-liquid phase separation. Proc Natl Acad Sci U S A 117 (2020). Attorney Docket No.035052/607414 D. A. Solomon, R. Smikle, M. J. Reid, S. Mizielinska, Altered Phase Separation and Cellular Impact in C9orf72-Linked ALS/FTD. Front Cell Neurosci 15 (2021). S. Yehezkel, et al., Characterization and rescue of telomeric abnormalities in ICF syndrome type I fibroblasts. Front Oncol 3 FEB (2013). D. Yang, et al., FTD/ALS-associated poly(GR) protein impairs the Notch pathway and is recruited by poly(GA) into cytoplasmic inclusions. Acta Neuropathol 130 (2015). B. D. Freibaum, J. P. Taylor, The role of dipeptide repeats in C9ORF72-related ALS- FTD. Front Mol Neurosci 10 (2017). E. N. Guerrero, et al., TDP-43/FUS in motor neuron disease: Complexity and challenges. Prog Neurobiol 145–146 (2016). N. Hamad, et al., Non-coding RNA suppresses FUS aggregation caused by mechanistic shear stress on pipetting in a sequence-dependent manner. Sci Rep 11 (2021). S. Maharana, et al., RNA buffers the phase separation behavior of prion-like RNA binding proteins. Science (1979) 360 (2018). A. J. Cesare, M. T. Hayashi, L. Crabbe, J. Karlseder, The Telomere deprotection response is functionally distinct from the Genomic DNA damage response. Mol Cell 51 (2013).

Attorney Docket No.035052/607414 Described herein are the following embodiments: 1. A telomere-encoded dipeptide repeat protein comprising a sequence of alternating repeating amino acids, the repeating amino acids consisting of: (a) valine (V), arginine (R); or (b) glycine (G), leucine (L), wherein the protein is 4-400 amino acids in length; and wherein the N-terminus or C-terminus of the protein comprises a synthetic chemical handle for the isolation, purification, or detection of the peptide. 2. An isolated antibody that binds a telomere-encoded dipeptide repeat protein, the protein comprising a sequence of alternating repeating amino acids, the repeating amino acids consisting of: (a) valine (V), arginine (R); or (b) glycine (G), leucine (L), wherein the protein is 4-400 amino acids in length; and wherein the N-terminus or C-terminus of the peptide comprises a synthetic chemical handle for the isolation, purification, or detection of the peptide. 3. A method of producing the antibody of embodiment 2 comprising: administering to a subject the repeating valine-arginine (VR) protein or the repeating glycine-leucine (GL) protein; and isolating the antibody from the subject. 4. A method of detecting a telomere-encoded dipeptide repeat protein comprising: determining a level of a repeating valine-arginine (VR) protein or a repeating glycine- leucine (GL) protein in a biological sample; and comparing the level of the repeating VR protein or the repeating GL protein in the biological sample to a control sample, wherein the control sample has normal levels of the repeating VR protein or the repeating GL protein, wherein the level of repeating VR protein or repeating GL protein in the sample is used to determine or detect one or more of: Attorney Docket No.035052/607414 (i) biological age; (ii) telomere health; (iii) cancer or cancer progression; (iv) genetic diseases associated with telomere dysfunction; and (v) systemic inflammation. 5. The method of embodiment 4, wherein the biological sample comprises blood from a vertebrate animal. 6. The method of embodiment 4, wherein the biological sample comprises cells or tissue from a vertebrate animal. 7. The method of embodiment 5 or 6, wherein the vertebrate animal is a human. 8. The method of embodiment 5 or 6, wherein the vertebrate animal is chosen from the group consisting of non-human mammals, reptiles, amphibians, birds or fish. 9. The method of embodiment 4, wherein the determining the level of the telomere-encoded dipeptide repeat protein comprises an assay. 10. The method of embodiment 4, wherein the determining the level of the telomere-encoded dipeptide repeat protein comprises the use of an antibody specific for the repeating VR protein or the repeating GL protein. 11. The method of embodiment 9, wherein the assay comprises an immunoassay using an antibody that binds the repeating VR protein or the repeating GL protein. 12. The method of embodiment 11, wherein the immunoassay is a continuous flow assay. Attorney Docket No.035052/607414 13. The method of embodiment 5, wherein the level of the repeating VR protein or the repeating GL protein that is elevated in the blood of the subject compared to a control level indicates that the subject has a disease associated with telomere dysfunction. 14. The method of embodiment 6, wherein the method of detection comprises cytological or histological analysis, wherein the level of the repeating VR protein or the repeating GL protein that is elevated in the cells or the tissue compared to a control level indicates that the subject has a disease associated with telomere dysfunction. 15. A method of treatment of a subject having a disease associated with telomere dysfunction, wherein a treatment comprises administering a composition for decreasing or preventing increase of a level of a repeating VR protein or a repeating GL protein in the subject. 16. The method of embodiment 15, wherein the treatment comprises administering an antibody binds the repeating VR protein or the repeating GL protein. 17. The telomere-encoded dipeptide repeat protein of claim 1, as shown in Table 1. 18. The method of embodiment 12 wherein the continuous flow assay is a chip assay comprising: flowing the biological sample through a chip, wherein the chip comprises a central enclosed chamber that is optically transparent through the top and bottom surface; flowing a solution comprising a primary antibody through the chip; and detecting the presence of the primary antibody.

Claims

Attorney Docket No.035052/607414 CLAIMS 1. A chemically modified dipeptide repeat protein comprising an alternating repeating amino acid sequence and a synthetic chemical handle for isolation, purification, or detection, wherein the alternating repeating amino acid sequence consists of (VR)n or (GL)n, wherein n is greater than 2; and wherein the synthetic chemical handle is on an N-terminus or a C-terminus of the alternating repeating amino acid sequence. 2. The chemically modified dipeptide repeat protein of claim 1, wherein the synthetic chemical handle comprises biotin, a polyhistidine tag, a polylysine tag, a FLAG tag, an HA tag, a c-Myc tag, a V5 tag, or a C-terminal amide. 3. The chemically modified dipeptide repeat protein of claim 2, wherein: the amino acid sequence of the polyhistindine tag is HHHHHH (SEQ ID NO: 17); the amino acid sequence of the polylysine tag is CKKKK (SEQ ID NO: 18); the amino acid sequence of the FLAG tag is DYKDDDD (SEQ ID NO: 19), DYKDDDDK (SEQ ID NO: 20), or DYKDDDK (SEQ ID NO: 21); the amino acid sequence of the HA tag is YPYDVPDYA (SEQ ID NO: 22), YAYDVPDYA (SEQ ID NO: 23), or YDVPDYASL (SEQ ID NO: 24); the amino acid sequence of the c-Myc tag is EQKLISEEDL (SEQ ID NO: 25); or the amino acid sequence of the V5 tag is GKPIPNPLLGLDST (SEQ ID NO: 26). 4. The chemically modified dipeptide repeat protein of any one of claims 1-3, wherein the dipeptide repeat protein comprises an amino acid sequence set forth in any one of SEQ ID NOs: 1-4. 5. An isolated antibody that binds a dipeptide repeat protein, the dipeptide repeat protein comprising an alternating repeating amino acid sequence, the alternating repeating amino acid sequence consisting of (VR)_n or (GL)_n, wherein n is greater than 2. Attorney Docket No.035052/607414 6. An antibody for use in determining telomere health, wherein the antibody selectively binds to a dipeptide repeat protein, the dipeptide repeat protein comprising an alternating repeating amino acid sequence, the alternating repeating amino acid sequence consisting of (VR)n or (GL)n, wherein n is greater than 2. 7. A method of producing the antibody of claim 6, the method comprising: administering to a subject the dipeptide repeat protein; and isolating antibodies from the subject; and identifying an antibody that selectively binds to the dipeptide repeat protein. 8. A method of preparing a detectable dipeptide repeat protein, wherein the method comprises: contacting a dipeptide repeat protein in a biological sample with an antibody that specifically binds to an epitope of (VR)n or (GL)n to prepare a dipeptide repeat protein bound to the antibody, wherein the antibody can be detected; detecting the dipeptide repeat protein bound to the antibody; and determining the level of the dipeptide repeat protein in the biological sample. 9. The method of claim 8, wherein the level of the dipeptide repeat protein in the biological sample is used to: determine biological age; diagnose cancer or cancer progression; diagnose a genetic disease associated with telomere dysfunction; or diagnose inflammation, wherein the level of the dipeptide repeat protein that is elevated in the biological sample compared to an age-appropriate control level indicates that the subject has elevated biological age, cancer, a genetic disease associated with telomere dysfunction, or inflammation. 10. The method of claim 9, wherein the genetic disease associated with telomere dysfunction is idiopathic pulmonary fibrosis (IPF) or Immunodeficiency, centromeric region instability, Attorney Docket No.035052/607414 facial anomalies syndrome (ICF), Dyskeratosis Congenita (DC), Coats-Plus syndrome, Revesz syndrome, and Hoyeraal-Hreidarsson Syndrome. 11. The method of any one of claims 8-10, wherein the biological sample comprises blood, plasma, or serum from a vertebrate animal. 12. The method of any one of claims 8-10, wherein the biological sample comprises cells or tissue from a vertebrate animal. 13. The method of claim 11 or 12, wherein the vertebrate animal is a human. 14. The method of claim 11 or 12, wherein the vertebrate animal is selected from the group consisting of non-human mammals, reptiles, amphibians, birds and fish. 15. The method of any one of claims 12-14, wherein the level of the dipeptide repeat protein in the cells or tissue is determined by cytological or histological analysis. 16. The method of any one of claims 8-14, wherein the level of the dipeptide repeat protein is determined by an assay, wherein the assay measures the level of the dipeptide repeat protein in the biological sample with a detection apparatus. 17. The method of any one of claims 8-16, wherein the level of the dipeptide repeat protein is measured with an antibody that binds the dipeptide repeat protein. 18. The method of claim 17, wherein the assay is an enzyme-linked immunosorbent assay (ELISA). 19. The method of claim 17 or 18, wherein the assay further comprises use of a second antibody that binds the dipeptide repeat protein. 20. The method of claim 19, wherein the second antibody binds β-amyloid aggregates. Attorney Docket No.035052/607414 21. The method of any one of claims 16-20, wherein one or more antibody that binds the dipeptide repeat protein is fluorescently labeled and the detection apparatus measures fluorescence. 22. The method of claim 21, wherein the assay comprises two antibodies that bind the dipeptide repeat protein, wherein the two antibodies are a fluorescence energy transfer (FRET) pair. 23. The method of any one of claims 16-21, wherein the assay further comprises single- stranded DNA (ssDNA) to bind the dipeptide repeat protein. 24. The method of any one of claims 16-23, wherein the assay comprises beads coated with ssDNA or an antibody that binds the dipeptide repeat protein. 25. The method of claim 24, wherein the beads are magnetic. 26. The method of claim 24 or 25, wherein the beads comprise one or more fluorescent dyes and the detection apparatus measures fluorescence. 27. The method of any one of claims 16-26, wherein the assay comprises flowing a solution comprising the biological sample through the detection apparatus. 28. The method of claim 27, wherein the detection apparatus comprises a chip, wherein the chip comprises a central enclosed chamber that is optically transparent through the top and bottom surface. 29. The method of claim 28, wherein the detection apparatus measures the level of dipeptide repeat protein by surface plasmon resonance. Attorney Docket No.035052/607414 30. A device for determining telomere health of a subject, the device comprising an isolated antibody fixed to a surface, wherein the isolated antibody selectively binds a dipeptide repeat protein, the dipeptide repeat protein comprising an alternating repeating amino acid sequence, the alternating repeating amino acid sequence consisting of (VR)n or (GL)n, wherein n is greater than 2. 31. The device of claim 30, wherein the antibody is fixed on a plate. 32. The device of claim 30, wherein the antibody is fixed on a bead. 33. The device of claim 30, wherein the antibody is fixed on a chip. 34. The device of claim 30, wherein the antibody is labeled for detection. 35. The device of claim 34, wherein the antibody is labeled with a fluorescent molecule or a reporter enzyme.