WO2024156288A1 - Dnmt1 inhibitors, pharmaceutical compositions, and therapeutic applications - Google Patents

Dnmt1 inhibitors, pharmaceutical compositions, and therapeutic applications Download PDF

Info

Publication number
WO2024156288A1
WO2024156288A1 PCT/CN2024/074266 CN2024074266W WO2024156288A1 WO 2024156288 A1 WO2024156288 A1 WO 2024156288A1 CN 2024074266 W CN2024074266 W CN 2024074266W WO 2024156288 A1 WO2024156288 A1 WO 2024156288A1
Authority
WO
WIPO (PCT)
Prior art keywords
methyl
dicyano
optionally substituted
thio
ethyl
Prior art date
Application number
PCT/CN2024/074266
Other languages
French (fr)
Inventor
Shibing TANG
Xiangqian KONG
Cheng Luo
Kehao Zhao
Zhihai Li
Jian Chen
Yufang Shi
Yong Zhang
Original Assignee
Shanghai Kygent Pharmaceutical Co., Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Kygent Pharmaceutical Co., Ltd filed Critical Shanghai Kygent Pharmaceutical Co., Ltd
Publication of WO2024156288A1 publication Critical patent/WO2024156288A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412—Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
    • C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
    • C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
    • C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D213/78—Carbon atoms having three bonds to hetero atoms, with at the most one bond to halogen, e.g. ester or nitrile radicals
    • C07D213/84—Nitriles
    • C07D213/85—Nitriles in position 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links

Definitions

  • DNMT1 inhibitors and pharmaceutical compositions thereof. Also provided herein are methods of their use for treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition.
  • DNA methyltransferase 1 is an enzyme that preferentially methylates newly replicated hemi-methylated DNA to ensure methylation maintenance of the whole genome through cell divisions.
  • the failure of this DNMT1 maintenance function leads to aberrant DNA methylation and contributes to the pathogenesis of cancer. Pathania et al., Nat. Commun. 2015, 6, 6910; Zhang and Xu, Biomark. Res. 2017, 5, 1; Pappalardi et al., Nat. Cancer 2021, 2, 1002-17.
  • DNMT1 overexpression correlates well with aberrant DNA methylation in solid tumors and poor prognosis in cancer patients as well.
  • A is –C (O) –, –S (O) –, or –S (O 2 ) –;
  • E is C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene;
  • E’ is C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl;
  • L is a bond, N (R 1 ) , or heterocyclylene
  • Z is C 1-6 alkylene
  • R 1 and R 5 are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ;
  • R 2 is halo, C 1-6 haloalkyl, C 1-6 haloheteroalkyl, C 2-6 alkenyl, or C 2-6 alkynyl; wherein the halogen in C 1-6 haloalkyl is Cl and/or Br;
  • R 2’ is C 2-6 alkenyl, or C 2-6 alkynyl
  • R 6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , —OR 1a , –OC (O) R 1a , –OC (O) OR 1a , –OC (O) NR 1b R 1c , –OC (
  • R 7a and R 7b are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ; or R
  • R 7b’ is C 1-6 alkylene, C 1-6 heteroalkylene, C 2-6 alkenylene, C 2-6 alkynylene, C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene; R 7b’ is substituted with -L-A-R 2’ ;
  • each R 1a , R 1b , R 1c , and R 1d is independently hydrogen, deuterium, C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl;
  • each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three
  • each Q a is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) R e , –C (O) OR e , –C (O) NR f R g , –C (O) SR e , –C (NR e ) NR f R g , –C (S) R e , –C (S) OR e , –C (S) NR f R g , –OR e , –OC (O) R e , –OC (O) OR e , –OC (O) NR
  • A is –C (O) –, –S (O) –, or –S (O 2 ) –;
  • E is C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene;
  • L is a bond, –N (R 1 ) –, or heterocyclylene
  • U is –O–, –S–, or –N (R 5 ) –;
  • Z is C 1-6 alkylene
  • R 1 and R 5 are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ;
  • R 2 is halo, C 1-6 haloheteroalkyl, C 2-6 alkenyl, or C 2-6 alkynyl;
  • R 6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , —OR 1a , –OC (O) R 1a , –OC (O) OR 1a , –OC (O) NR 1b R 1c , –OC (
  • R 7a and R 7b are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ; or R
  • each R 1a , R 1b , R 1c , and R 1d is independently hydrogen, deuterium, C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl;
  • each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three
  • each Q a is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) R e , –C (O) OR e , –C (O) NR f R g , –C (O) SR e , –C (NR e ) NR f R g , –C (S) R e , –C (S) OR e , –C (S) NR f R g , –OR e , –OC (O) R e , –OC (O) OR e , –OC (O) NR
  • composition comprising a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; and a pharmaceutically acceptable excipient.
  • a method of treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition in a subject comprising administering to the subject in need thereof a therapeutically effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a method of treating, preventing, or ameliorating one or more symptoms of a proliferative disease in a subject comprising administering to the subject in need thereof a therapeutically effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a method of inhibiting the growth of a cell comprising contacting the cell with an effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound of Formula (I) or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a method of inhibiting the activity of a DNMT1 comprising contacting the DNMT1 with an effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound of Formula (I) or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • subject refers to an animal, including, but not limited to, a primate (e.g., human) , cow, pig, sheep, goat, horse, dog, cat, rabbit, rat, or mouse.
  • primate e.g., human
  • subject and patient are used interchangeably herein in reference, for example, to a mammalian subject, such as a human subject. In one embodiment, the subject is a human.
  • treat, ” “treating, ” and “treatment” are meant to include alleviating or abrogating a disorder, disease, or condition, or one or more of the symptoms associated with the disorder, disease, or condition; or alleviating or eradicating the cause (s) of the disorder, disease, or condition itself.
  • prevent, ” and “prevention” are meant to include a method of delaying and/or precluding the onset of a disorder, disease, or condition, and/or its attendant symptoms; barring a subject from acquiring a disorder, disease, or condition; or reducing a subject’s risk of acquiring a disorder, disease, or condition.
  • alleviate and “alleviating” refer to easing or reducing one or more symptoms (e.g., pain) of a disorder, disease, or condition.
  • the terms can also refer to reducing adverse effects associated with an active ingredient.
  • the beneficial effects that a subject derives from a prophylactic or therapeutic agent do not result in a cure of the disorder, disease, or condition.
  • contacting or “contact” is meant to refer to bringing together of a therapeutic agent and a biological molecule (e.g., a protein, enzyme, RNA, or DNA) , cell, or tissue such that a physiological and/or chemical effect takes place as a result of such contact. Contacting can take place in vitro, ex vivo, or in vivo.
  • a therapeutic agent is contacted with a biological molecule in vitro to determine the effect of the therapeutic agent on the biological molecule.
  • a therapeutic agent is contacted with a cell in cell culture (in vitro) to determine the effect of the therapeutic agent on the cell.
  • the contacting of a therapeutic agent with a biological molecule, cell, or tissue includes the administration of a therapeutic agent to a subject having the biological molecule, cell, or tissue to be contacted.
  • terapéuticaally effective amount or “effective amount” is meant to include the amount of a compound that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disorder, disease, or condition being treated.
  • therapeutically effective amount or “effective amount” also refers to the amount of a compound that is sufficient to elicit a biological or medical response of a biological molecule (e.g., a protein, enzyme, RNA, or DNA) , cell, tissue, system, animal, or human, which is being sought by a researcher, veterinarian, medical doctor, or clinician.
  • a biological molecule e.g., a protein, enzyme, RNA, or DNA
  • IC 50 refers to an amount, concentration, or dosage of a compound that is required for 50%inhibition of a maximal response in an assay that measures such a response.
  • pharmaceutically acceptable carrier refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material.
  • each component is “pharmaceutically acceptable” in the sense of being compatible with the other ingredients of a pharmaceutical formulation, and suitable for use in contact with the tissue or organ of a subject (e.g., a human) without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, and commensurate with a reasonable benefit/risk ratio.
  • the term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within 1, 2, or 3 standard deviations. In certain embodiments, the term “about” or “approximately” means within 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05%of a given value or range.
  • alkyl refers to a linear or branched saturated monovalent hydrocarbon radical, wherein the alkyl is optionally substituted with one or more substituents Q as described herein.
  • C 1-6 alkyl refers to a linear saturated monovalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated monovalent hydrocarbon radical of 3 to 6 carbon atoms.
  • the alkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C 1-20 ) , 1 to 15 (C 1-15 ) , 1 to 10 (C 1-10 ) , or 1 to 6 (C 1-6 ) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • linear C 1-6 and branched C 3-6 alkyl groups are also referred as “lower alkyl.
  • alkyl groups include, but are not limited to, methyl, ethyl, propyl (including all isomeric forms, e.g., n-propyl and isopropyl) , butyl (including all isomeric forms, e.g., n-butyl, isobutyl, sec-butyl, and t-butyl) , pentyl (including all isomeric forms, e.g., n-pentyl, isopentyl, sec-pentyl, neopentyl, and tert-pentyl) , and hexyl (including all isomeric forms, e.g., n-hexyl, isohexyl, and sec-hexyl) .
  • alkylene and “alkanediyl” are used interchangeably herein in reference to a linear or branched saturated divalent hydrocarbon radical, wherein the alkanediyl is optionally be substituted with one or more substituents Q as described herein.
  • C 1-6 alkanediyl refers to a linear saturated divalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated divalent hydrocarbon radical of 3 to 6 carbon atoms.
  • the alkanediyl is a linear saturated divalent hydrocarbon radical that has 1 to 30 (C 1-30 ) , 1 to 20 (C 1-20 ) , 1 to 15 (C 1-15 ) , 1 to 10 (C 1-10 ) , or 1 to 6 (C 1-6 ) carbon atoms, or branched saturated divalent hydrocarbon radical of 3 to 30 (C 3-30 ) , 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • linear C 1-6 and branched C 3-6 alkanediyl groups are also referred as “lower alkanediyl. ”
  • alkanediyl groups include, but are not limited to, methanediyl, ethanediyl (including all isomeric forms, e.g., ethane-1, 1-diyl and ethane-1, 2-diyl) , propanediyl (including all isomeric forms, e.g., propane-1, 1-diyl, propane-1, 2-diyl, and propane-1, 3-diyl) , butanediyl (including all isomeric forms, e.g., butane-1, 1-diyl, butane-1, 2-diyl, butane-1, 3-diyl, and butane-1, 4-diyl) , pentanediyl (including all isomeric forms, e.g.,
  • substituted alkanediyl groups include, but are not limited to, –C (O) CH 2 –, –C (O) (CH 2 ) 2 –, –C (O) (CH 2 ) 3 –, –C (O) (CH 2 ) 4 –, –C (O) (CH 2 ) 5 –, –C (O) (CH 2 ) 6 –, –C (O) (CH 2 ) 7 –, –C (O) (CH 2 ) 8 –, –C (O) (CH 2 ) 9 –, –C (O) (CH 2 ) 10 –, –C (O) CH 2 C (O) –, –C (O) (CH 2 ) 2 C (O) –, –C (O) (CH 2 ) 3 C (O) –, –C (O) (CH 2 ) 4 C (O) –, or —C (O) (CH 2 ) 5 C (O)
  • haloalkyl refers to a monovalent alkyl group substituted with one or more halo groups.
  • the haloalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C 1-20 ) , 1 to 15 (C 1-15 ) , 1 to 10 (C 1-10 ) , or 1 to 6 (C 1-6 ) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • the haloalkyl is optionally substituted with one or more substituents Q as described herein.
  • heteroalkyl refers to a linear or branched saturated monovalent hydrocarbon radical that contains one or more heteroatoms on its main chain, each independently selected from O, S, and N.
  • the heteroalkyl is optionally substituted with one or more substituents Q as described herein.
  • C 1-6 heteroalkyl refers to a linear saturated monovalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated monovalent hydrocarbon radical of 3 to 6 carbon atoms.
  • the heteroalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C 1-20 ) , 1 to 15 (C 1-15 ) , 1 to 10 (C 1-10 ) , or 1 to 6 (C 1-6 ) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • linear C 1-6 and branched C 3-6 heteroalkyl groups are also referred as “lower heteroalkyl.
  • heteroalkyl groups include, but are not limited to, –OCH 3 , –OCH 2 CH 3 , –CH 2 OCH 3 , –NHCH 3 , –ONHCH 3 , –NHOCH 3 , –SCH 3 , –CH 2 NHCH 2 CH 3 , and –NHCH 2 CH 2 CH 3 .
  • substituted heteroalkyl groups include, but are not limited to, –CH 2 NHC (O) CH 3 and –NHC (O) CH 2 CH 3 .
  • haloheteroalkyl refers to a monovalent heteroalkyl group substituted with one or more halo groups.
  • the haloheteroalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C 1-20 ) , 1 to 15 (C 1-15 ) , 1 to 10 (C 1-10 ) , or 1 to 6 (C 1-6 ) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • the haloheteroalkyl is optionally substituted with one or more substituents Q as described herein.
  • alkenyl refers to a linear or branched monovalent hydrocarbon radical, which contains one or more, in one embodiment, one, two, three, or four, in another embodiment, one, carbon-carbon double bond (s) .
  • the alkenyl is optionally substituted with one or more substituents Q as described herein.
  • alkenyl embraces radicals having a “cis” or “trans” configuration or a mixture thereof, or alternatively, a “Z” or “E” configuration or a mixture thereof, as appreciated by those of ordinary skill in the art.
  • C 2-6 alkenyl refers to a linear unsaturated monovalent hydrocarbon radical of 2 to 6 carbon atoms or a branched unsaturated monovalent hydrocarbon radical of 3 to 6 carbon atoms.
  • the alkenyl is a linear monovalent hydrocarbon radical of 2 to 20 (C 2-20 ) , 2 to 15 (C 2-15 ) , 2 to 10 (C 2-10 ) , or 2 to 6 (C 2-6 ) carbon atoms, or a branched monovalent hydrocarbon radical of 3 to 20 (C 3-20 ) , 3 to 15 (C 3-15 ) , 3 to 10 (C 3-10 ) , or 3 to 6 (C 3-6 ) carbon atoms.
  • alkenyl groups include, but are not limited to, ethenyl, propenyl (including all isomeric forms, e.g., propen-1-yl, propen-2-yl, and allyl) , and butenyl (including all isomeric forms, e.g., buten-1-yl, buten-2-yl, buten-3-yl, and 2-buten-1-yl) .
  • alkynyl refers to a linear or branched monovalent hydrocarbon radical, which contains one or more, in one embodiment, one, two, three, or four, in another embodiment, one, carbon-carbon triple bond (s) .
  • An alkynyl group does not contain a carbon-carbon double bond.
  • the alkynyl is optionally substituted with one or more substituents Q as described herein.
  • C 2-6 alkynyl refers to a linear unsaturated monovalent hydrocarbon radical of 2 to 6 carbon atoms or a branched unsaturated monovalent hydrocarbon radical of 4 to 6 carbon atoms.
  • the alkynyl is a linear monovalent hydrocarbon radical of 2 to 20 (C 2-20 ) , 2 to 15 (C 2-15 ) , 2 to 10 (C 2-10 ) , or 2 to 6 (C 2-6 ) carbon atoms, or a branched monovalent hydrocarbon radical of 4 to 20 (C 4-20 ) , 4 to 15 (C 4-15 ) , 4 to 10 (C 4-10 ) , or 4 to 6 (C 4-6 ) carbon atoms.
  • alkynyl groups include, but are not limited to, ethynyl (–C ⁇ CH) , propynyl (including all isomeric forms, e.g., 1-propynyl (–C ⁇ CCH 3 ) and propargyl (–CH 2 C ⁇ CH) ) , butynyl (including all isomeric forms, e.g., 1-butyn-1-yl and 2-butyn-1-yl) , pentynyl (including all isomeric forms, e.g., 1-pentyn-1-yl and 1-methyl-2-butyn-1-yl) , and hexynyl (including all isomeric forms, e.g., 1-hexyn-1-yl and 2-hexyn-1-yl) .
  • cycloalkyl refers to a cyclic monovalent hydrocarbon radical, which is optionally substituted with one or more substituents Q as described herein.
  • the cycloalkyl is a saturated or unsaturated but non-aromatic, and/or bridged or non-bridged, and/or fused bicyclic group.
  • the cycloalkyl has from 3 to 20 (C 3-20 ) , from 3 to 15 (C 3-15 ) , from 3 to 10 (C 3-10 ) , or from 3 to 7 (C 3-7 ) carbon atoms.
  • the cycloalkyl is monocyclic.
  • the cycloalkyl is bicyclic.
  • the cycloalkyl is tricyclic. In still another embodiment, the cycloalkyl is polycyclic. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cycloheptenyl, bicyclo [1.1.1] pentyl, bicyclo [2.1.1] hexyl, bicyclo [2.2.1] heptyl, bicyclo [2.2.2] octyl, decalinyl, and adamantyl.
  • cycloalkylene and “cycloalkanediyl” are used interchangeably herein in reference to a cyclic divalent hydrocarbon radical, which may be optionally substituted with one or more substituents Q as described herein.
  • cycloalkanediyl groups may be saturated or unsaturated but non-aromatic, and/or bridged, and/or non-bridged, and/or fused bicyclic groups.
  • the cycloalkanediyl has from 3 to 30 (C 3-30 ) , 3 to 20 (C 3-20 ) , from 3 to 15 (C 3-15 ) , from 3 to 10 (C 3-10 ) , or from 3 to 7 (C 3-7 ) carbon atoms.
  • cycloalkanediyl groups include, but are not limited to, cyclopropanediyl (including all isomeric forms, e.g., cyclopropane-1, 1-diyl and cyclopropane-1, 2-diyl) , cyclobutanediyl (including all isomeric forms, e.g., cyclobutane-1, 1-diyl, cyclobutane-1, 2-diyl, and cyclobutane-1, 3-diyl) , cyclopentanediyl (including all isomeric forms, e.g., cyclopentane-1, 1-diyl, cyclopentane-1, 2-diyl, and cyclopentane-1, 3-diyl) , cyclohexanediyl (including all isomeric forms, e.g., cyclohexane-1, 1-diyl, cyclo
  • aryl refers to a monovalent monocyclic aromatic hydrocarbon radical and/or monovalent polycyclic aromatic hydrocarbon radical that contain at least one aromatic carbon ring. In certain embodiments, the aryl has from 6 to 20 (C 6-20 ) , from 6 to 15 (C 6-15 ) , or from 6 to 10 (C 6-10 ) ring carbon atoms. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl.
  • the aryl also refers to bicyclic or tricyclic carbon rings, where one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl) .
  • the aryl is monocyclic.
  • the aryl is bicyclic.
  • the aryl is tricyclic.
  • the aryl is polycyclic.
  • the aryl is optionally substituted with one or more substituents Q as described herein.
  • arylene and “arenediyl” are used interchangeably herein in reference to a divalent monocyclic aromatic hydrocarbon radical or divalent polycyclic aromatic hydrocarbon radical that contains at least one aromatic hydrocarbon ring.
  • the arylene has from 6 to 20 (C 6-20 ) , from 6 to 15 (C 6-15 ) , or from 6 to 10 (C 6-10 ) ring atoms.
  • arylene groups include, but are not limited to, phenylene (including all isomeric forms, e.g., phen-1, 2-diyl, phen-1, 3-diyl, and phen-1, 4-diyl) , naphthylene (including all isomeric forms, e.g., naphth-1, 2-diyl, naphth-1, 3-diyl, and naphth-1, 8-diyl) , fluorenylene (including all isomeric forms, e.g., fluoren-1, 2-diyl, fluoren-1, 3-diyl, and fluoren-1, 8-diyl) , azulenylene (including all isomeric forms, e.g., azulen-1, 2-diyl, azulen-1, 3-diyl, and azulen-1, 8-diyl) , anthrylene (including all isomeric forms, e.
  • Arylene also refers to bicyclic or tricyclic carbon rings, where one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthylene (including all isomeric forms, e.g., dihydronaphth-1, 2-diyl and dihydronaphth-1, 8-diyl) , indenylene (including all isomeric forms, e.g., inden-1, 2-diyl, inden-1, 5-diyl, and inden-1, 7-diyl) , indanylene (including all isomeric forms, e.g., indan-1, 2-diyl, indan-1, 5-diyl, and indan-1, 7-diyl) , or tetrahydronaphthylene (tetralinylene) (including all isomeric forms, e.g., tetrahydronaphth-1, 2-di
  • aralkyl or “arylalkyl” refers to a monovalent alkyl group substituted with one or more aryl groups. In certain embodiments, the aralkyl has from 7 to 30 (C 7-30 ) , from 7 to 20 (C 7-20 ) , or from 7 to 16 (C 7-16 ) carbon atoms.
  • aralkyl groups include, but are not limited to, benzyl, phenylethyl (including all isomeric forms, e.g., 1-phenylethyl and 2-phenylethyl) , and phenylpropyl (including all isomeric forms, e.g., 1-phenylpropyl, 2-phenylpropyl, and 3-phenylpropyl) .
  • the aralkyl is optionally substituted with one or more substituents Q as described herein.
  • aralkylene or “arylalkylene” refers to a divalent alkyl group substituted with one or more aryl groups. In certain embodiments, the aralkylene has from 7 to 30 (C 7-30 ) , from 7 to 20 (C 7-20 ) , or from 7 to 16 (C 7-16 ) carbon atoms.
  • aralkylene groups include, but are not limited to, benzylene (including all isomeric forms, e.g., phenylmethdiyl) , phenylethylene (including all isomeric forms, e.g., 2-phenyl-ethan-1, 1-diyl and 2-phenyl-ethan-1, 2-diyl) , and phenylpropylene (including all isomeric forms, e.g., 3-phenyl-propan-1, 1-diyl, 3-phenyl-propan-1, 2-diyl, and 3-phenyl-propan-1, 3-diyl) .
  • the aralkylene is optionally substituted with one or more substituents Q as described herein.
  • heteroaryl refers to a monovalent monocyclic aromatic group or monovalent polycyclic aromatic group that contain at least one aromatic ring, wherein at least one aromatic ring contains one or more heteroatoms, each independently selected from O, S, and N, in the ring.
  • heteroaryl group containing a heteroaromatic ring and a nonaromatic heterocyclic ring the heteroaryl group is not bonded to the rest of a molecule through its nonaromatic heterocyclic ring.
  • Each ring of a heteroaryl group can contain one or two O atoms, one or two S atoms, and/or one to four N atoms; provided that the total number of heteroatoms in each ring is four or less and each ring contains at least one carbon atom.
  • the heteroaryl has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms.
  • the heteroaryl is monocyclic.
  • heteroaryl groups examples include, but are not limited to, furanyl, imidazolyl, isothiazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolyl, thiadiazolyl, thiazolyl, thienyl, tetrazolyl, triazinyl, and triazolyl.
  • the heteroaryl is bicyclic.
  • bicyclic heteroaryl groups include, but are not limited to, benzofuranyl, benzimidazolyl, benzoisoxazolyl, benzopyranyl, benzothiadiazolyl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, furopyrindyl (including all isomeric forms, e.g., furo [2, 3-b] pyridinyl, furo [2, 3-c] pyridinyl, furo [3, 2-b] -pyridinyl, furo [3, 2-c] pyridinyl, furo [3, 4-b] pyridinyl, and furo [3, 4-c] pyridinyl) , imidazopyridinyl (including all isomeric forms, e.g., imidazo [1, 2-a] pyridinyl, imidazo [4, 5-b] pyridinyl, and imidazo [4, 5-c] pyridiny
  • the heteroaryl is tricyclic.
  • tricyclic heteroaryl groups include, but are not limited to, acridinyl, benzindolyl, carbazolyl, dibenzo-furanyl, perimidinyl, phenanthrolinyl, phenanthridinyl (including all isomeric forms, e.g., 1, 5-phenanthrolinyl, 1, 6-phenanthrolinyl, 1, 7-phenanthrolinyl, 1, 9-phenanthrolinyl, and 2, 10-phenanthrolinyl) , phenarsazinyl, phenazinyl, phenothiazinyl, phenoxazinyl, and xanthenyl.
  • the heteroaryl is optionally substituted with one or more substituents Q as described herein.
  • heteroarylene and “heteroarenediyl” are used interchangeably herein in reference to a divalent monocyclic aromatic group or divalent polycyclic aromatic group that contains at least one aromatic ring, wherein at least one aromatic ring contains one or more heteroatoms in the ring, each of which is independently selected from O, S, and N.
  • heteroarylene group containing a heteroaromatic ring and a nonaromatic heterocyclic ring the heteroarylene group is not bonded to the rest of a molecule via its nonaromatic heterocyclic ring.
  • Each ring of a heteroarylene group can contain one or two O atoms, one or two S atoms, and/or one to four N atoms, provided that the total number of heteroatoms in each ring is four or less and each ring contains at least one carbon atom.
  • the heteroarylene has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms.
  • Examples of monocyclic heteroarylene groups include, but are not limited to, furandiyl, imidazoldiyl, isothiazoldiyl, isoxazoldiyl, oxadiazoldiyl, oxazoldiyl, pyrazindiyl, pyrazoldiyl, pyridazindiyl, pyridindiyl, pyrimidindiyl, pyrroldiyl, thiadiazoldiyl, thiazoldiyl, thiendiyl, tetrazoldiyl, triazinediyl, and triazoldiyl.
  • bicyclic heteroarylene groups include, but are not limited to, benzofurandiyl, benzimidazoldiyl, benzoisoxazoldiyl, benzopyrandiyl, benzothiadiazoldiyl, benzothiazoldiyl, benzothiendiyl, benzotriazoldiyl, benzoxazoldiyl, furopyridindiyl (including all isomeric forms, e.g., furo [2, 3-b] pyridindiyl, furo [2, 3-c] pyridindiyl, furo [3, 2-b] pyridindiyl, furo [3, 2-c] -pyridindiyl, furo [3, 4-b] pyridindiyl, and furo [3, 4-c] pyridindiyl) , imidazopyridindiyl (including all isomeric forms, e.g., imidazo [1, 2-a] pyrid
  • tricyclic heteroarylene groups include, but are not limited to, acridindiyl, benzindoldiyl, carbazoldiyl, dibenzofurandiyl, perimidindiyl, phenanthrolindiyl (including all isomeric forms, e.g., 1, 5-phenanthrolindiyl, 1, 6-phenanthrolindiyl, 1, 7-phenanthrolindiyl, 1, 9-phenanthrolindiyl, and 2, 10-phenanthrolindiyl) , phenanthridindiyl, phenarsazindiyl, phenazindiyl, phenothiazindiyl, phenoxazindiyl, and xanthendiyl.
  • heteroarylene is optionally substituted with one or more substituents Q as described herein.
  • heterocyclyl refers to a monovalent monocyclic non-aromatic ring system or monovalent polycyclic ring system that contains at least one non-aromatic ring, wherein one or more of the non-aromatic ring atoms are heteroatoms, each independently selected from O, S, and N; and the remaining ring atoms are carbon atoms.
  • heterocyclyl group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heterocyclyl group is not bonded to the rest of a molecule through the heteroaromatic ring.
  • the heterocyclyl or heterocyclic group has from 3 to 20, from 3 to 15, from 3 to 10, from 3 to 8, from 4 to 7, or from 5 to 6 ring atoms.
  • the heterocyclyl is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may be fused or bridged, and in which nitrogen or sulfur atoms may be optionally oxidized, nitrogen atoms may be optionally quaternized, and some rings may be partially or fully saturated, or aromatic.
  • the heterocyclyl may be attached to the main structure at any heteroatom or carbon atom which results in the creation of a stable compound.
  • heterocyclyls and heterocyclic groups include, but are not limited to, azepinyl, benzodioxanyl, benzodioxolyl, benzofuranonyl, chromanyl, decahydroisoquinolinyl, dihydrobenzofuranyl, dihydrobenzisothiazolyl, dihydrobenzisoxazinyl (including all isomeric forms, e.g., 1, 4-dihydrobenzo [d] [1, 3] oxazinyl, 3, 4-dihydrobenzo [c] [1, 2] -oxazinyl, and 3, 4-dihydrobenzo [d] [1, 2] oxazinyl) , dihydrobenzothienyl, dihydroisobenzofuranyl, dihydrobenzo [c] thienyl, dihydrofuryl, dihydroisoindolyl, dihydropyranyl, dihydropyrazoly
  • heterocyclylene refers to a divalent monocyclic non-aromatic ring system or divalent polycyclic ring system that contains at least one non-aromatic ring, wherein one or more of the non-aromatic ring atoms are heteroatoms independently selected from O, S, and N; and the remaining ring atoms are carbon atoms.
  • the heterocyclylene group For a heterocyclylene group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heterocyclylene group has at least one bond to the rest of a molecule via its nonaromatic heterocyclic ring.
  • the heterocyclylene group has from 3 to 20, from 3 to 15, from 3 to 10, from 3 to 8, from 4 to 7, or from 5 to 6 ring atoms.
  • the heterocyclylene is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may be fused or bridged, and in which nitrogen or sulfur atoms may be optionally oxidized, nitrogen atoms may be optionally quaternized, and some rings may be partially or fully saturated, or aromatic.
  • the heterocyclylene may be attached to the main structure at any heteroatom or carbon atom which results in the creation of a stable compound.
  • heterocyclylene groups include, but are not limited to, azepindiyl, benzodioxandiyl, benzodioxoldiyl, benzofuranondiyl, chromandiyl, decahydroisoquinolindiyl, dihydrobenzofurandiyl, dihydrobenzisothiazoldiyl, dihydrobenzisoxazindiyl (including all isomeric forms, e.g., 1, 4-dihydrobenzo [d] [1, 3] oxazindiyl, 3, 4-dihydrobenzo [c] [1, 2] oxazindiyl, and 3, 4-dihydrobenzo [d] [1, 2] oxazindiyl) , dihydrobenzothiendiyl, dihydroisobenzofurandiyl, dihydrobenzo [c] thiendiyl, dihydrofurdiyl, dihydroisoiso
  • halogen refers to fluoro, chloro, bromo, and/or iodo.
  • each Q a is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) R e , –C (O) OR e , –C (O) NR f R g , –C (O) SR e , –C (NR e ) NR f R g , –C (S) R e , –C (S) OR e , –C (S) NR f R g , –OR e , –OC (O) R e , –OC (O) OR e , –OC (O)
  • optically active and ” enantiomerically active refer to a collection of molecules, which has an enantiomeric excess of no less than about 80%, no less than about 90%, no less than about 91%, no less than about 92%, no less than about 93%, no less than about 94%, no less than about 95%, no less than about 96%, no less than about 97%, no less than about 98%, no less than about 99%, no less than about 99.5%, or no less than about 99.8%.
  • an optically active compound comprises about 95%or more of one enantiomer and about 5%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question.
  • an optically active compound comprises about 98%or more of one enantiomer and about 2%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question. In certain embodiments, an optically active compound comprises about 99%or more of one enantiomer and about 1%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question.
  • the prefixes R and S are used to denote the absolute configuration of the compound about its chiral center (s) .
  • the (+) and (-) are used to denote the optical rotation of the compound, that is, the direction in which a plane of polarized light is rotated by the optically active compound.
  • the (-) prefix indicates that the compound is levorotatory, that is, the compound rotates the plane of polarized light to the left or counterclockwise.
  • the (+) prefix indicates that the compound is dextrorotatory, that is, the compound rotates the plane of polarized light to the right or clockwise.
  • the sign of optical rotation, (+) and (-) is not related to the absolute configuration of the compound, R and S.
  • isotopically enriched refers to a compound that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a compound.
  • an isotopically enriched compound contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen ( 1 H) , deuterium ( 2 H) , tritium ( 3 H) , carbon-11 ( 11 C) , carbon-12 ( 12 C) , carbon-13 ( 13 C) , carbon-14 ( 14 C) , nitrogen-13 ( 13 N) , nitrogen-14 ( 14 N) , nitrogen-15 ( 15 N) , oxygen-14 ( 14 O) , oxygen-15 ( 15 O) , oxygen-16 ( 16 O) , oxygen-17 ( 17 O) , oxygen-18 ( 18 O) , fluorine-17 ( 17 F) , fluorine-18 ( 18 F) , phosphorus-31 ( 31 P) , phosphorus-32 ( 32 P) , phosphorus-33 ( 33 P) , sulfur-
  • an isotopically enriched compound is in a stable form, that is, non-radioactive.
  • an isotopically enriched compound contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen ( 1 H) , deuterium ( 2 H) , carbon-12 ( 12 C) , carbon-13 ( 13 C) , nitrogen-14 ( 14 N) , nitrogen-15 ( 15 N) , oxygen-16 ( 16 O) , oxygen-17 ( 17 O) , oxygen-18 ( 18 O) , fluorine-17 ( 17 F) , phosphorus-31 ( 31 P) , sulfur-32 ( 32 S) , sulfur-33 ( 33 S) , sulfur-34 ( 34 S) , sulfur-36 ( 36 S) , chlorine-35 ( 35 Cl) , chlorine-37 ( 37 Cl) , bromine-79 ( 79 Br) , bromine-81 ( 81 Br) , and iodine-127 ( 127 I) .
  • an isotopically enriched compound is in an unstable form, that is, radioactive.
  • an isotopically enriched compound contains unnatural proportions of one or more isotopes, including, but not limited to, tritium ( 3 H) , carbon-11 ( 11 C) , carbon-14 ( 14 C) , nitrogen-13 ( 13 N) , oxygen-14 ( 14 O) , oxygen-15 ( 15 O) , fluorine-18 ( 18 F) , phosphorus-32 ( 32 P) , phosphorus-33 ( 33 P) , sulfur-35 ( 35 S) , chlorine-36 ( 36 Cl) , iodine-123 ( 123 I) , iodine-125 ( 125 I) , iodine-129 ( 129 I) , and iodine-131 ( 131 I) .
  • any hydrogen can be 2 H, as example, or any carbon can be 13 C, as example, or any nitrogen can be 15 N, as example, or any oxygen can be 18 O, as example, where feasible according to the judgment of one of ordinary skill in the art.
  • isotopic enrichment refers to the percentage of incorporation of a less prevalent isotope (e.g., D for deuterium or hydrogen-2) of an element at a given position in a molecule in the place of a more prevalent isotope (e.g., 1 H for protium or hydrogen-1) of the element.
  • a less prevalent isotope e.g., D for deuterium or hydrogen-2
  • a more prevalent isotope e.g., 1 H for protium or hydrogen-1
  • isotopic enrichment factor refers the ratio between the isotopic abundance in an isotopically enriched compound and the natural abundance of a specific isotope.
  • hydrogen refers to the composition of naturally occurring hydrogen isotopes, which include protium ( 1 H) , deuterium ( 2 H or D) , and tritium ( 3 H) , in their natural abundances.
  • Protium is the most common hydrogen isotope having a natural abundance of more than 99.98%.
  • Deuterium is a less prevalent hydrogen isotope having a natural abundance of about 0.0156%.
  • deuterium enrichment refers to the percentage of incorporation of deuterium at a given position in a molecule in the place of hydrogen. For example, deuterium enrichment of 1%at a given position means that 1%of molecules in a given sample contain deuterium at the specified position. Because the naturally occurring distribution of deuterium is about 0.0156%on average, deuterium enrichment at any position in a compound synthesized using non-enriched starting materials is about 0.0156%on average. As used herein, when a particular position in an isotopically enriched compound is designated as having deuterium, it is understood that the abundance of deuterium at that position in the compound is substantially greater than its natural abundance (0.0156%) .
  • carbon or the symbol “C” refers to the composition of naturally occurring carbon isotopes, which include carbon-12 ( 12 C) and carbon-13 ( 13 C) in their natural abundances.
  • Carbon-12 is the most common carbon isotope having a natural abundance of more than 98.89%.
  • Carbon-13 is a less prevalent carbon isotope having a natural abundance of about 1.11%.
  • carbon-13 enrichment or “ 13 C enrichment” refers to the percentage of incorporation of carbon-13 at a given position in a molecule in the place of carbon.
  • carbon-13 enrichment of 10% at a given position means that 10%of molecules in a given sample contain carbon-13 at the specified position. Because the naturally occurring distribution of carbon-13 is about 1.11%on average, carbon-13 enrichment at any position in a compound synthesized using non-enriched starting materials is about 1.11%on average.
  • when a particular position in an isotopically enriched compound is designated as having carbon-13, it is understood that the abundance of carbon-13 at that position in the compound is substantially greater than its natural abundance (1.11%) .
  • substantially pure and substantially homogeneous mean, when referred to a substance, sufficiently homogeneous to appear free of readily detectable impurities as determined by a standard analytical method used by one of ordinary skill in the art, including, but not limited to, thin layer chromatography (TLC) , gel electrophoresis, high performance liquid chromatography (HPLC) , gas chromatography (GC) , nuclear magnetic resonance (NMR) , and mass spectrometry (MS) ; or sufficiently pure such that further purification would not detectably alter the physical, chemical, biological, and/or pharmacological properties, such as enzymatic and biological activities, of the substance.
  • TLC thin layer chromatography
  • HPLC high performance liquid chromatography
  • GC gas chromatography
  • NMR nuclear magnetic resonance
  • MS mass spectrometry
  • substantially pure or “substantially homogeneous” refers to a collection of molecules, wherein at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5%by weight of the molecules are a single compound, including a single enantiomer, a racemic mixture, or a mixture of enantiomers, as determined by standard analytical methods.
  • a molecule that contains other than the designated isotope at the specified position is an impurity with respect to the isotopically enriched compound.
  • a deuterated compound that has an atom at a particular position designated as deuterium a compound that contains a protium at the same position is an impurity.
  • solvate refers to a complex or aggregate formed by one or more molecules of a solute, e.g., a compound provided herein, and one or more molecules of a solvent, which are present in a stoichiometric or non-stoichiometric amount.
  • Suitable solvents include, but are not limited to, water, methanol, ethanol, n-propanol, isopropanol, and acetic acid.
  • the solvent is pharmaceutically acceptable.
  • the complex or aggregate is in a crystalline form.
  • the complex or aggregate is in a noncrystalline form.
  • the solvent is water
  • the solvate is a hydrate. Examples of hydrates include, but are not limited to, a hemihydrate, monohydrate, dihydrate, trihydrate, tetrahydrate, and pentahydrate.
  • an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof” has the same meaning as the phrase “ (i) an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant of the compound referenced therein; (ii) a pharmaceutically acceptable salt, solvate, hydrate, or prodrug of the compound referenced therein; or (iii) a pharmaceutically acceptable salt, solvate, hydrate, or prodrug of an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of a
  • A is –C (O) –, –S (O) –, or –S (O 2 ) –;
  • E is C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene; wherein the C 3-10 cycloalkylene, the C 6-14 arylene, the C 7-15 aralkylene, the heteroarylene, and the heterocyclylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C 1-6 alkyl, C 1-6 alkoxy, and C 1-6 haloalkyl;
  • L is a bond, N (R 1 ) , or heterocyclylene
  • R 1 is hydrogen or C 1-6 alkyl
  • R 5 is independently hydrogen or C 1-6 alkyl
  • Z is C 1-6 alkylene; wherein the C 1-6 alkylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C 1-6 alkyl, and –C (O) NR b R c ;
  • R 2 is halogen, C 1-6 haloalkyl, C 1-6 haloheteroalkyl, C 2-6 alkenyl, or C 2-6 alkynyl; wherein the halogen in C 1-6 haloalkyl is Cl and/or Br; wherein the C 2-6 alkenyl, and the C 2-6 alkynyl is optionally substituted with one, two, three, or four group (s) independently selected from halogen; and –NR b R c ;
  • R 6 is independently C 1-6 alkyl, C 1-6 heteroalkyl, C 3-10 cycloalkyl or C 6-14 aryl; wherein the C 1-6 alkyl, the C 1-6 heteroalkyl, and the C 3-10 cycloalkyl is optionally substituted with one, two, three, or four halogen;
  • R 7a is hydrogen, or C 1-6 alkyl
  • R 7b is hydrogen, C 1-6 alkyl, or C 1-6 heteroalkyl; wherein the C 1-6 alkyl, and the C 1-6 heteroalkyl is optionally substituted with one, two, three, or four group (s) independently selected from oxo, and heterocyclyl;
  • R 7a and R 7b together with the N atom to which they are attached form heterocyclyl, wherein the heterocyclyl is optionally substituted with one, two, three, or four Q, and Q is C 1-6 alkyl, heterocyclyl, –NR b R c , –NHC (O) OR a , –NHC (O) R a and –OR a ; wherein C 1-6 alkyl is optionally substituted with one, two, three, or four group (s) independently selected from –OH; and
  • each R a , R b , R c is independently (i) hydrogen or deuterium; or (ii) C 1-6 alkyl optionally substituted with one –NH 2 .
  • A is –C (O) –, –S (O) –, or –S (O 2 ) –;
  • E is C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene;
  • L is a bond, N (R 1 ) , or heterocyclylene
  • U is –O–, –S–, or –N (R 5 ) –;
  • Z is C 1-6 alkylene
  • R 1 and R 5 are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2- 6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ;
  • R 2 is halo, C 1-6 haloheteroalkyl, C 2-6 alkenyl, or C 2-6 alkynyl;
  • R 6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , —OR 1a , –OC (O) R 1a , –OC (O) OR 1a , –OC (O) NR 1b R 1c , –OC (
  • R 7a and R 7b are each independently (i) hydrogen; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –S (O) R 1a , –S (O) 2 R 1a , –S (O) NR 1b R 1c , or —S (O) 2 NR 1b R 1c ; or R
  • each R 1a , R 1b , R 1c , and R 1d is independently hydrogen, deuterium, C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl;
  • each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three
  • each Q a is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) R e , –C (O) OR e , –C (O) NR f R g , –C (O) SR e , –C (NR e ) NR f R g , –C (S) R e , –C (S) OR e , –C (S) NR f R g , –OR e , –OC (O) R e , –OC (O) OR e , –OC (O) NR
  • L is a bond. In certain embodiments, in Formula (I) , L is –N (R 1 ) –, wherein R 1 is as defined herein. In certain embodiments, in Formula (I) , L is –N (R 1 ) –, wherein R 1 is hydrogen or C 1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in Formula (I) , L is –N (H) –. In certain embodiments, in Formula (I) , L is –N (CH 3 ) –. In certain embodiments, in Formula (I) , L is heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • L is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • L is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 3-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 4-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 5-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is piperazindiyl, optionally substituted with one, two, or three substituents Q.
  • L is piperazin-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
  • Z is C 1-6 alkylene, optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, ethanediyl, or propanediyl, each optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl, each optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, fluoromethanediyl, difluoromethanediyl, aminocarbonylmethanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl.
  • R 4a and R 4b are each independently (i) hydrogen, deuterium, cyano, or halo; (ii) C 1-6 alkyl, C 1- 6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , –OR 1a , –OC (O) R 1a , –OC (O) OR 1a ,
  • R 1 , R 2 , R 6 , R 1a , R 1b , R 1c , R 1d , R 7a , R 7b , A, E, and U are each as defined herein.
  • E is C 3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q.
  • E is monocyclic C 3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q.
  • E is cyclohexanediyl, optionally substituted with one, two, or three substituents Q.
  • E is cyclohexane-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
  • E is C 6-14 arylene, optionally substituted with one, two, or three substituents Q.
  • E is phendiyl, optionally substituted with one, two, or three substituents Q.
  • E is phendiyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C 1-6 alkyl or C 1-6 heteroalkyl, each further optionally substituted with one or more substituents Q a .
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents Q.
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently C 1-6 alkyl or C 1-6 heteroalkyl, each further optionally substituted with one or more substituents Q a .
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently fluoro, methyl, trifluoromethyl, or methoxy.
  • E is phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methylphen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, or 2-methoxyphen-1, 4-diyl.
  • E is C 7-15 aralkylene, optionally substituted with one, two, or three substituents Q.
  • E is monocyclic C 7-15 aralkylene, optionally substituted with one, two, or three substituents Q.
  • E is phendiyl-methandiyl, optionally substituted with one, two, or three substituents Q.
  • E is phen-1, 4-diylmethandiyl, optionally substituted with one, two, or three substituents Q.
  • E is heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is monocyclic heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 5-or 6-membered heteroarylene, each optionally substituted with one, two, or three substituents Q.
  • E is 5-membered heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 6-membered heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is pyridindiyl, optionally substituted with one, two, or three substituents Q.
  • E is pyridin-2, 5-diyl, optionally substituted with one, two, or three substituents Q.
  • E is heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • E is 3-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 4-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 5-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 6-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 7-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is piperidindiyl, optionally substituted with one, two, or three substituents Q.
  • E is piperidin-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
  • E is bicyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is bridged, fused, or spiro heteroarylene, each optionally substituted with one, two, or three substituents Q.
  • E is bridged heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is fused heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is spiro heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 1, 2, 3, 4-tetrahydroquinolindiyl, optionally substituted with one, two, or three substituents Q.
  • E is 1, 2, 3, 4-tetrahydroquinolin-1, 6-diyl, optionally substituted with one, two, or three substituents Q.
  • E is cyclohexane-1, 4-diyl, phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methylphen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, 2-methoxyphen-1, 4-diyl, phen-1, 4-diylmethandiyl, pyridin-2, 5-diyl, piperidin-1, 4-diyl, or 1, 2, 3, 4-tetrahydro-quinolin-1, 6-diyl.
  • E is phen-1, 4-diyl.
  • E is pyridin-2, 5-diyl.
  • X is N or C (R 3a ) ;
  • each R 3 is independently (i) deuterium, cyano, halo, or nitro; (ii) C 1-6 alkyl, C 1-6 heteroalkyl, C 2-6 alkenyl, C 2-6 alkynyl, C 3-10 cycloalkyl, C 6-14 aryl, C 7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R 1a , –C (O) OR 1a , –C (O) NR 1b R 1c , –C (O) SR 1a , –C (NR 1a ) NR 1b R 1c , –C (S) R 1a , –C (S) OR 1a , –C (S) NR 1b R 1c , —OR 1a , –OC (O) R 1a , –OC (O) OR 1a , –OC (O
  • R 3a is hydrogen or R 3 ;
  • n is an integer of 0, 1, 2, or 3;
  • each R 1 , R 2 , R 6 , R 1a , R 1b , R 1c , R 1d , R 4a , R 4b , R 7a , R 7b , A, and U is as defined herein.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , A, U, X, and m are each as defined herein.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , A, U, X, and m are each as defined herein.
  • A in any one of Formulae (I) to (V) , A is –C (O) –or –S (O 2 ) –. In certain embodiments, in any one of Formulae (I) to (V) , A is –C (O) –. In certain embodiments, in any one of Formulae (I) to (V) , A is –S (O 2 ) –.
  • U is –S–or –N (R 5 ) –, wherein R 5 is as defined herein.
  • U in any one of Formulae (I) to (V) , U is –S–.
  • U in any one of Formulae (I) to (V) , U is –N (R 5 ) –, wherein R 5 is as defined herein.
  • U in any one of Formulae (I) to (V) , U is –N (R 5 ) –, wherein R 5 is hydrogen or C 1-6 alkyl optionally substituted with one, two, or three substituents Q.
  • U in any one of Formulae (I) to (V) , U is –N (R 5 ) –, wherein R 5 is hydrogen, methyl, or ethyl. In certain embodiments, in any one of Formulae (I) to (V) , U is –N (H) –or –N (CH 3 ) –.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 2 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 2 in any one of Formulae (I) to (IX) , is (i) halo; or (ii) C 1-6 haloalkyl or C 1-6 haloheteroalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is halo. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is fluoro. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is C 1-6 haloalkyl, optionally substituted with one, two, or three substituents Q.
  • R 2 in any one of Formulae (I) to (IX) , is chloromethyl. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is C 1-6 haloheteroalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is (2-bromoethoxy) methyl.
  • R 2 is C 2-6 alkenyl or C 2-6 alkynyl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is C 2-6 alkenyl, optionally substituted with one, two, or three substituents Q.
  • R 2 is C 2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2 is C 2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino.
  • R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q.
  • R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino.
  • R 2 is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl.
  • R 2 in any one of Formulae (I) to (IX) , is C 2-6 alkynyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R 2 is ethynyl or prop-1-ynyl.
  • R 2 is fluoro, chloromethyl, 2-bromoethoxymethyl, ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, (E) -3-piperidin-1-ylprop-1-enyl, ethynyl, or prop-1-ynyl.
  • R 2 is ethenyl, 1-cyano-ethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, (E) -3-piperidin-1-ylprop-1-enyl, ethynyl, or prop-1-ynyl.
  • R 2a , R 2a , and R 2c are each independently (i) hydrogen, deuterium, cyano, or halo; or (ii) C 1-6 alkyl or C 1-6 heteroalkyl, each optionally substituted with one or more substituents Q; and
  • R 1 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2a , R 2a , R 2c , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2a , R 2a , R 2c , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2a , R 2a , R 2c , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 2a is hydrogen, deuterium, cyano, or halo. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is deuterium. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is cyano. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is halo. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is fluoro. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is hydrogen, cyano, or fluoro.
  • R 2b is (i) hydrogen or deuterium; or (ii) C 1-6 alkyl, optionally substituted with one or more substituents Q.
  • R 2b is hydrogen.
  • R 2b is deuterium.
  • R 2b is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q.
  • R 2b is C 1- 6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –NR 1b R 1c ; wherein R 1b and R 1c are each as defined herein.
  • R 2b is C 1-6 alkyl, optionally substituted with monocyclic heterocyclyl or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is C 1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is methyl, optionally substituted with one, two, or three substituents Q.
  • R 2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –NR 1b R 1c ; wherein R 1b and R 1c are each as defined herein.
  • R 2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is dimethylaminomethyl or piperidin-1-ylmethyl.
  • R 2c is hydrogen or deuterium. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2c is hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2c is deuterium.
  • R 2a is cyano; and R 2b and R 2c are each hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is halo; and R 2b and R 2c are each hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R 2a is fluoro; and R 2b and R 2c are each hydrogen.
  • R 2a and R 2c are each hydrogen; and R 2b is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q.
  • R 2a and R 2c are each hydrogen; and R 2b is methyl, optionally substituted with one, two, or three substituents Q.
  • R 2a and R 2c are each hydrogen; and R 2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –NR 1b R 1c ; wherein R 1b and R 1c are each as defined herein.
  • R 2a and R 2c are each hydrogen; and R 2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2a and R 2c are each hydrogen; and R 2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2a and R 2c are each hydrogen; and R 2b is dimethylaminomethyl or piperidin-1-ylmethyl.
  • R 2d is (i) hydrogen or deuterium; or (ii) C 1-6 alkyl or C 1-6 heteroalkyl, each optionally substituted with one or more substituents Q; and wherein R 1 , R 3 , R 6 , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2d , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2d , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 1 , R 3 , R 6 , R 2d , R 4a , R 4b , R 7a , R 7b , X, and m are each as defined herein.
  • R 2d is (i) hydrogen or deuterium; or (ii) C 1-6 alkyl, optionally substituted with one or more substituents Q.
  • R 2d is hydrogen.
  • R 2d is deuterium.
  • R 2d is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q.
  • R 2d is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R 2d is hydrogen or methyl.
  • R 1 is hydrogen or C 1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R 1 is hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R 1 is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R 1 is methyl.
  • R 6 is C 1-6 alkyl, C 1-6 heteroalkyl, C 3-10 cycloalkyl, or C 6-14 aryl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is methyl, ethyl, propyl, or butyl, each optionally substituted with one, two, or three substituents Q.
  • R 6 is C 1-6 heteroalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is C 1-6 alkoxy, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is methoxy or ethoxy. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is C 3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q.
  • R 6 is monocyclic C 3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 6 is C 6-14 aryl, optionally substituted with one, two, or three substituents Q.
  • R 6 is phenyl, optionally substituted with one, two, or three substituents Q.
  • R 6 is methyl, ethyl, 2, 2, 2-trifluoroethyl, butyl, cyclopropyl, cyclopentyl, methoxy, ethoxy, or phenyl.
  • R 6 is ethyl.
  • R 4a is (i) hydrogen, deuterium, or halo; (ii) C 1-6 alkyl, optionally substituted with one or more substituents Q; or (iii) –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a in any one of Formulae (II) to (XVII) , R 4a is hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is deuterium.
  • R 4a in any one of Formulae (II) to (XVII) , R 4a is halo. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is methyl.
  • R 4a in any one of Formulae (II) to (XVII) , R 4a is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is –C (O) NH 2 . In certain embodiments, R 4a is hydrogen, fluoro, methyl, or aminocarbonyl.
  • R 4b is (i) hydrogen, deuterium, or halo; (ii) C 1-6 alkyl, optionally substituted with one or more substituents Q; or (iii) –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is hydrogen.
  • R 4b is deuterium.
  • R 4b in any one of Formulae (II) to (XVII) , R 4b is halo. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4b is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4b is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4b is methyl.
  • R 4b is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4n is –C (O) NH 2 .
  • R 4b is hydrogen, fluoro, methyl, or aminocarbonyl.
  • R 4a and R 4b are each hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is hydrogen and R 4b is fluoro, methyl, aminocarbonyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is hydrogen and R 4b is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is hydrogen and R 4b is methyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a is hydrogen and R 4b is aminocarbonyl.
  • R 4a and R 4b are each fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R 4a and R 4b are each methyl.
  • R 7a is hydrogen or C 1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7a is hydrogen. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7a is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7a is methyl or ethyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7a is methyl. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7a is ethyl.
  • R 7b is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R 7b is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q.
  • R 7b is C 1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –OR 1a or –NR 1b R 1c ; wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7b is C 1-6 alkyl, optionally substituted with monocyclic heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is C 1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1- 6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with one, two, or three substituents Q.
  • R 7b is ethyl or propyl, each substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –OR 1a or –NR 1b R 1c ; wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7b is ethyl or propyl, each substituted with monocyclic heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with 5-or 6-membered heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with pyrrolin-1-yl, 2-methoxy, methylamino, dimethylamino, or diethylamino.
  • R 7b is hydrogen, methyl, dimethylaminocarbonylmethyl, 2-methoxyethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethylaminoethyl, 2-pyrrolin-1-ylethyl, or 3-dimethylaminopropyl.
  • R 7a and R 7b together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 3-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 4-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 5-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 6-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 7-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form piperidin-1-yl, piperazin-1-yl, or 1, 4-diazepan-1-yl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bicyclic heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bridged, fused, or spiro heterocyclyl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bridged heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form fused heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 3, 5-fused heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexanyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexan-3-yl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 4-aminopiperidin-1-yl, 4-dimethyl-aminopiperidin-1-yl, 4-methylpiperazin-1-yl, 4-methyl-1, 4-diazepan-1-yl, 4- (2-hydroxyethyl) -1, 4-diazepan-1-yl, 6-amino-3-azabicyclo [3.1.0] hexan-3-yl, (1R, 5S, 6r) -6-amino-3-azabicyclo- [3.1.0] hexan-3-yl, (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl, 6-acetamido-3-aza-bicyclo [3.1.0] hexan-3-yl, (1R, 5S, 6r) -6-acetamido-3-aza-bicyclo [3.1.0] hexan-3-yl, (1R, 5S,
  • X is N. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R 3a ) , wherein R 3a is as defined herein. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R 3a ) , wherein R 3a is (i) halo; or (ii) C 1-6 alkyl or C 1-6 heteroalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R 3a ) , wherein R 3a is hydrogen, fluoro, methyl, trifluoromethyl, or methoxy.
  • m is an integer of 0.
  • R 1 is hydrogen. In certain embodiments, R 1 is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 1 is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is trifluoromethyl. In certain embodiments, R 1 is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 1 is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 1 is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 1 is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 1 is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 1 is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 1 is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 1 is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 1 is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 1 is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 1 is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 1 is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 1 is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 1 is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 1 is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2 is halo. In certain embodiments, R 2 is fluoro. In certain embodiments, R 2 is C 1-6 haloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2 is chloromethyl. In certain embodiments, R 2 is C 1-6 haloheteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2 is (2-bromo-ethoxy) methyl. In certain embodiments, R 2 is C 2-6 alkenyl, optionally substituted with one or more substituents Q.
  • R 2 is C 2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2 is C 2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino.
  • R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino.
  • R 2 is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl.
  • R 2 is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 2 is ethynyl or prop-1-ynyl.
  • R 2’ is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2’ is C 2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2’ is C 2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, R 2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q.
  • R 2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Q a ; or (iii) –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino.
  • R 2’ is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl.
  • R 2’ is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 2 is ethynyl or prop-1-ynyl.
  • R 3 is deuterium. In certain embodiments, R 3 is cyano. In certain embodiments, R 3 is halo. In certain embodiments, R 3 is fluoro or chloro. In certain embodiments, R 3 is nitro. In certain embodiments, R 3 is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 3 is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 3 is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 3 is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 3 is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 3 is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 3 is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 3 is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 3 is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –OR 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (O) R 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (O) OR 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –OC (O) SR 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –OC (S) R 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (S) OR 1a , wherein R 1a is as defined herein.
  • R 3 is –OC (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –OS (O) R 1a , wherein R 1a is as defined herein.
  • R 3 is –OS (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 3 is –OS (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –OS (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –NR 1a C (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a C (O) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a C (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –NR 1a C (O) SR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a C (NR 1d ) NR 1b R 1c , wherein R 1a , R 1b , R 1c , and R 1d are each as defined herein.
  • R 3 is –NR 1a C (S) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a C (S) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a C (S) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –NR 1a S (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a S (O) 2 R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3 is –NR 1a S (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –NR 1a S (O) 2 NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3 is –SR 1a , wherein R 1a is as defined herein.
  • R 3 is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 3 is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 3 is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3 is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 5 is hydrogen. In certain embodiments, R 5 is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is methyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is trifluoromethyl. In certain embodiments, R 5 is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 5 is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 5 is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 5 is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 5 is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 5 is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 5 is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 5 is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 5 is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 5 is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 5 is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 5 is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 5 is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 5 is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 5 is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 6 is hydrogen. In certain embodiments, R 6 is deuterium. In certain embodiments, R 6 is cyano. In certain embodiments, R 6 is halo. In certain embodiments, R 6 is fluoro, chloro, or bromo. In certain embodiments, R 6 is fluoro. In certain embodiments, R 6 is chloro. In certain embodiments, R 6 is bromo. In certain embodiments, R 6 is nitro. In certain embodiments, R 6 is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is methyl, ethyl, propyl, or butyl, each optionally substituted with one or more substituents Q.
  • R 6 is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is C 1-6 alkoxy, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 6 is trifluoromethyl, 2, 2, 2-trifluoroethyl, methoxy, or ethoxy. In certain embodiments, R 6 is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 6 is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is monocyclic C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bicyclic C 4-10 cycloalkyl, optionally substituted with one or more substituents Q.
  • R 6 is bridged, fused, or spiro C 4-10 cycloalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bridged C 4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is fused C 4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is spiro C 4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is C 6- 14 aryl, optionally substituted with one or more substituents Q.
  • R 6 is phenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bicyclic C 8-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is monocyclic heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 5-or 6-membered heteroaryl, each optionally substituted with one or more substituents Q.
  • R 6 is 5-membered heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 6-membered heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bicyclic heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 5, 5-, 5, 6-, or 6, 6-fused heteroaryl, each optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 5, 5-fused heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 5, 6-fused heteroaryl, optionally substituted with one or more substituents Q.
  • R 6 is 6, 6-fused heteroaryl, optionally substituted with one or more substituents Q.
  • R 6 is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 6 is monocyclic heterocyclyl, optionally substituted with one or more substituents Q.
  • R 6 is 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one or more substituents Q.
  • R 6 is 3-membered heterocyclyl, optionally substituted with one or more substituents Q.
  • R 6 is 4-membered heterocyclyl, optionally substituted with one or more substituents Q.
  • R 6 is 5-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 6-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is 7-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bicyclic heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bridged, fused, or spiro heterocyclyl, each optionally substituted with one or more substituents Q. In certain embodiments, R 6 is bridged heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is fused heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is fused heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 6 is spiro heterocyclyl,
  • R 6 is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 6 is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 6 is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 6 is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 6 is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 6 is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 6 is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 6 is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 6 is –OR 1a , wherein R 1a is as defined herein.
  • R 6 is C 1-6 alkoxy, optionally substituted with one or more substituents Q.
  • R 6 is methoxy or ethoxy.
  • R 6 is –OC (O) R 1a , wherein R 1a is as defined herein.
  • R 6 is –OC (O) OR 1a , wherein R 1a is as defined herein.
  • R 6 is –OC (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 6 is –OC (O) SR 1a , wherein R 1a is as defined herein.
  • R 6 is –OC (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 6 is –OC (S) R 1a , wherein R 1a is as defined herein.
  • R 6 is –OC (S) OR 1a , wherein R 1a is as defined herein.
  • R 6 is –OC (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 6 is –OS (O) R 1a , wherein R 1a is as defined herein.
  • R 6 is –OS (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 6 is –OS (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 6 is –OS (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 6 is –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 6 is –NR 1a C (O) R 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 6 is –NR 1a C (O) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 6 is –NR 1a C (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 6 is –NR 1a C (O) SR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 6 is –NR 1a C (NR 1d ) NR 1b R 1c , wherein R 1a , R 1b , R 1c , and R 1d are each as defined herein.
  • R 6 is –NR 1a C (S) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 6 is –NR 1a C (S) OR 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 6 is –NR 1a C (S) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein. In certain embodiments, R 6 is –NR 1a S (O) R 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 6 is –NR 1a S (O) 2 R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 6 is –NR 1a S (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein. In certain embodiments, R 6 is –NR 1a S (O) 2 NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein. In certain embodiments, R 6 is —SR 1a , wherein R 1a is as defined herein. In certain embodiments, R 6 is –S (O) R 1a , wherein R 1a is as defined herein. In certain embodiments, R 6 is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 6 is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 6 is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 2a is hydrogen. In certain embodiments, R 2a is deuterium. In certain embodiments, R 2a is cyano. In certain embodiments, R 2a is halo. In certain embodiments, R 2a is fluoro. In certain embodiments, R 2a is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2a is methyl. In certain embodiments, R 2a is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2a is trifluoromethyl.
  • R 2b is hydrogen. In certain embodiments, R 2b is deuterium. In certain embodiments, R 2b is cyano. In certain embodiments, R 2b is halo. In certain embodiments, R 2b is fluoro. In certain embodiments, R 2b is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2b is C 1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –NR 1b R 1c ; wherein R 1b and R 1c are each as defined herein.
  • R 2b is C 1-6 alkyl, optionally substituted with monocyclic heterocyclyl or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is C 1-6 alkyl, optionally substituted with 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is C 1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is methyl, optionally substituted with one, two, or three substituents Q.
  • R 2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –NR 1b R 1c ; wherein R 1b and R 1c are each as defined herein.
  • R 2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is methyl, optionally substituted with 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 2b is dimethylaminomethyl or piperidin-1-ylmethyl.
  • R 2b is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q.
  • R 2c is hydrogen. In certain embodiments, R 2c is deuterium. In certain embodiments, R 2c is cyano. In certain embodiments, R 2c is halo. In certain embodiments, R 2c is fluoro. In certain embodiments, R 2c is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2c is methyl. In certain embodiments, R 2c is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2c is trifluoromethyl.
  • R 2d is hydrogen. In certain embodiments, R 2d is deuterium. In certain embodiments, R 2d is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2d is methyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2d is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 2d is trifluoromethyl.
  • R 3a is hydrogen. In certain embodiments, R 3a is deuterium. In certain embodiments, R 3a is cyano. In certain embodiments, R 3a is halo. In certain embodiments, R 3a is fluoro. In certain embodiments, R 3a is nitro. In certain embodiments, R 3a is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3a is methyl. In certain embodiments, R 3a is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 3a is C 1-6 alkoxy, optionally substituted with one or more substituents Q.
  • R 3a is trifluoromethyl or methoxy.
  • R 3a is C 2-6 alkenyl, optionally substituted with one or more substituents Q.
  • R 3a is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 3a is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q.
  • R 3a is C 6-14 aryl, optionally substituted with one or more substituents Q.
  • R 3a is C 7-15 aralkyl, optionally substituted with one or more substituents Q.
  • R 3a is heteroaryl, optionally substituted with one or more substituents Q.
  • R 3a is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 3a is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 3a is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 3a is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 3a is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 3a is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 3a is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –OR 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (O) R 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (O) OR 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –OC (O) SR 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –OC (S) R 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (S) OR 1a , wherein R 1a is as defined herein.
  • R 3a is –OC (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –OS (O) R 1a , wherein R 1a is as defined herein.
  • R 3a is –OS (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 3a is –OS (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –OS (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –NR 1a C (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a C (O) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a C (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –NR 1a C (O) SR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a C (NR 1d ) NR 1b R 1c , wherein R 1a , R 1b , R 1c , and R 1d are each as defined herein.
  • R 3a is –NR 1a C (S) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a C (S) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a C (S) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –NR 1a S (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a S (O) 2 R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 3a is –NR 1a S (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –NR 1a S (O) 2 NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 3a is –SR 1a , wherein R 1a is as defined herein.
  • R 3a is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 3a is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 3a is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 3a is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a is hydrogen. In certain embodiments, R 4a is deuterium. In certain embodiments, R 4a is cyano. In certain embodiments, R 4a is halo. In certain embodiments, R 4a is fluoro. In certain embodiments, R 4a is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is methyl. In certain embodiments, R 4a is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is C 2-6 alkenyl, optionally substituted with one or more substituents Q.
  • R 4a is C 2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is monocyclic C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 4a is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 4a is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 4a is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 4a is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a is aminocarbonyl.
  • R 4a is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 4a is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4a is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 4a is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 4a is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a is –OR 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (O) R 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (O) OR 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a is –OC (O) SR 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4a is – OC (S) R 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (S) OR 1a , wherein R 1a is as defined herein.
  • R 4a is –OC (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a is –OS (O) R 1a , wherein R 1a is as defined herein.
  • R 4a is –OS (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 4a is –OS (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4a is –OS (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4a is –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4a is –NR 1a C (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4a is –NR 1a C (O) OR 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 4a is –NR 1a C (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein. In certain embodiments, R 4a is –NR 1a C (O) SR 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 4a is –NR 1a C (NR 1d ) NR 1b R 1c , wherein R 1a , R 1b , R 1c , and R 1d are each as defined herein.
  • R 4a is –NR 1a C (S) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4a is –NR 1a C (S) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4a is –NR 1a C (S) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4a is –NR 1a S (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4a is –NR 1a S (O) 2 R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4a is –NR 1a S (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4a is –NR 1a S (O) 2 NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4a is –SR 1a , wherein R 1a is as defined herein.
  • R 4a is –S (O) R 1a , wherein R 1a is as defined herein. In certain embodiments, R 4a is –S (O) 2 R 1a , wherein R 1a is as defined herein. In certain embodiments, R 4a is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4a is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is hydrogen. In certain embodiments, R 4b is deuterium. In certain embodiments, R 4b is cyano. In certain embodiments, R 4b is halo. In certain embodiments, R 4b is fluoro. In certain embodiments, R 4b is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is methyl. In certain embodiments, R 4b is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is C 2-6 alkenyl, optionally substituted with one or more substituents Q.
  • R 4b is C 2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is monocyclic C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 4b is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 4b is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 4b is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 4b is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is aminocarbonyl.
  • R 4b is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 4b is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4b is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 4b is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 4b is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is –OR 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (O) R 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (O) OR 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is –OC (O) SR 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4b is –OC (S) R 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (S) OR 1a , wherein R 1a is as defined herein.
  • R 4b is –OC (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4b is –OS (O) R 1a , wherein R 1a is as defined herein.
  • R 4b is –OS (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 4b is –OS (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4b is –OS (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4b is –NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4b is –NR 1a C (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4b is –NR 1a C (O) OR 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 4b is –NR 1a C (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein. In certain embodiments, R 4b is –NR 1a C (O) SR 1d , wherein R 1a and R 1d are each as defined herein. In certain embodiments, R 4b is –NR 1a C (NR 1d ) NR 1b R 1c , wherein R 1a , R 1b , R 1c , and R 1d are each as defined herein.
  • R 4b is –NR 1a C (S) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4b is –NR 1a C (S) OR 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4b is –NR 1a C (S) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4b is –NR 1a S (O) R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4b is –NR 1a S (O) 2 R 1d , wherein R 1a and R 1d are each as defined herein.
  • R 4b is –NR 1a S (O) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4b is –NR 1a S (O) 2 NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 4b is –SR 1a , wherein R 1a is as defined herein.
  • R 4b is –S (O) R 1a , wherein R 1a is as defined herein. In certain embodiments, R 4b is –S (O) 2 R 1a , wherein R 1a is as defined herein. In certain embodiments, R 4b is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 4b is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 4a and R 4b together with the C atom to which they are attached form C 3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, R 4a and R 4b together with the C atom to which they are attached form monocyclic C 3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, R 4a and R 4b together with the C atom to which they are attached form cycloprop-1, 1-diyl, cyclobut-1, 1-diyl, or cyclopenta-1, 1-diyl, each optionally substituted with one or more substituents Q.
  • R 4a and R 4b together with the C atom to which they are attached form bicyclic C 4-10 cycloalkylene, optionally substituted with one or more substituents Q.
  • R 4a and R 4b together with the C atom to which they are attached form bridged, fused, or spiro C 4-10 cycloalkylene, each optionally substituted with one or more substituents Q.
  • R 7a is hydrogen. In certain embodiments, R 7a is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is methyl or ethyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is trifluoromethyl. In certain embodiments, R 7a is C 2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 7a is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is C 6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is C 7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 7a is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 7a is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 7a is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7a is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 7a is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7a is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 7a is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 7a is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7a is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 7a is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 7a is –S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 7a is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7b is hydrogen. In certain embodiments, R 7b is C 1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7b is C 1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 7b is C 1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –OR 1a or –NR 1b R 1c ; wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7b is C 1-6 alkyl, optionally substituted with monocyclic heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which optionally substituted with one or more substituents Q a .
  • R 7b is C 1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R 7b is ethyl or propyl, each substituted with (i) heterocyclyl, optionally substituted with one or more substituents Q a ; or (ii) –OR 1a or –NR 1b R 1c ; wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7b is ethyl or propyl, each substituted with monocyclic heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with 5-or 6-membered heterocyclyl, C 1-6 alkoxy, C 1-6 alkylamino, or di- (C 1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Q a .
  • R 7b is ethyl or propyl, each optionally substituted with pyrrolin-1-yl, 2-methoxy, methylamino, dimethylamino, or diethylamino.
  • R 7b is hydrogen, methyl, ethyl, dimethylaminocarbonylmethyl, 2-methoxyethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethylaminoethyl, 2-pyrrolin-1-ylethyl, or 3-dimethylaminopropyl.
  • R 7b’ is C 1-6 alkylene. In certain embodiments, R 7b’ is ethylidene.
  • R 7b is C 1-6 heteroalkyl, optionally substituted with one or more substituents Q.
  • R 7b is C 2-6 alkenyl, optionally substituted with one or more substituents Q.
  • R 7b is C 2-6 alkynyl, optionally substituted with one or more substituents Q.
  • R 7b is C 3-10 cycloalkyl, optionally substituted with one or more substituents Q.
  • R 7b is C 6-14 aryl, optionally substituted with one or more substituents Q.
  • R 7b is C 7-15 aralkyl, optionally substituted with one or more substituents Q.
  • R 7b is heteroaryl, optionally substituted with one or more substituents Q.
  • R 7b is heterocyclyl, optionally substituted with one or more substituents Q.
  • R 7b is –C (O) R 1a , wherein R 1a is as defined herein.
  • R 7b is –C (O) OR 1a , wherein R 1a is as defined herein.
  • R 7b is –C (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7b is –C (O) SR 1a , wherein R 1a is as defined herein.
  • R 7b is –C (NR 1a ) NR 1b R 1c , wherein R 1a , R 1b , and R 1c are each as defined herein.
  • R 7b is –C (S) R 1a , wherein R 1a is as defined herein.
  • R 7b is –C (S) OR 1a , wherein R 1a is as defined herein.
  • R 7b is –C (S) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7b is –S (O) R 1a , wherein R 1a is as defined herein.
  • R 7b is –S (O) 2 R 1a , wherein R 1a is as defined herein.
  • R 7b is – S (O) NR 1b R 1c , wherein R 1b and R 1c are each as defined herein. In certain embodiments, R 7b is –S (O) 2 NR 1b R 1c , wherein R 1b and R 1c are each as defined herein.
  • R 7a and R 7b together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R 7a and R 7b together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 7a and R 7b together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 3-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 4-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 5-membered heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 6-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 7a and R 7b together with the N atom to which they are attached form 7-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R 7a and R 7b together with the N atom to which they are attached form piperidin-1-yl, piperazin-1-yl, or 1, 4-diazepan-1-yl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 4-aminopiperidin-1-yl, 4-dimethylaminopiperidin-1-yl, 4-methylpiperazin-1-yl, 4-methyl-1, 4-diazepan-1-yl, or 4- (2-hydroxyethyl) -1, 4-diazepan-1-yl.
  • R 7a and R 7b’ together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b’ together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bicyclic heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bridged, fused, or spiro heterocyclyl, each optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form bridged heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form fused heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form 3, 5-fused heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexanyl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexan-3-yl, optionally substituted with one, two, or three substituents Q.
  • R 7a and R 7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q.
  • A is –C (O) –. In certain embodiments, A is –S (O) –. In certain embodiments, A is –S (O 2 ) –.
  • E is C 3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is monocyclic C 3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is cyclopropanediyl, cyclobutanediyl, cyclopentanediyl, cyclohexanediyl, or cycloheptanediyl, each optionally substituted with one or more substituents Q. In certain embodiments, E is cyclohexanediyl, optionally substituted with one or more substituents Q.
  • E is cyclcohexane-1, 4-diyl, optionally substituted with one or more substituents Q.
  • E is bicyclic C 4-10 cycloalkylene, optionally substituted with one or more substituents Q.
  • E is bridged, fused, or spiro C 4-10 cycloalkylene, each optionally substituted with one or more substituents Q.
  • E is bridged C 4-10 cycloalkylene, optionally substituted with one or more substituents Q.
  • E is fused C 4-10 cycloalkylene, optionally substituted with one or more substituents Q.
  • E is spiro C 4-10 cycloalkylene, optionally substituted with one or more substituents Q.
  • E is C 6-14 arylene, optionally substituted with one or more substituents Q.
  • E is phendiyl, optionally substituted with one, two, or three substituents Q.
  • E is phendiyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C 1-6 alkyl or C 1-6 heteroalkyl, each further optionally substituted with one or more substituents Q a .
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents Q.
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently C 1-6 alkyl or C 1-6 heteroalkyl, each further optionally substituted with one or more substituents Q a .
  • E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently fluoro, methyl, trifluoromethyl, or methoxy.
  • E is phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methyl-phen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, or 2-methoxyphen-1, 4-diyl.
  • E is bicyclic C 8-14 arylene, optionally substituted with one, two, or three substituents Q.
  • E’ is C 6-14 aryl, optionally substituted with one or more substituents Q.
  • E’ is phenyl, optionally substituted with one, two, or three substituents Q.
  • E’ is phenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C 1-6 alkyl or C 1-6 heteroalkyl, each further optionally substituted with one or more substituents Q a .
  • E is C 7-15 aralkylene, optionally substituted with one or more substituents Q.
  • E is monocyclic C 7-15 aralkylene, optionally substituted with one, two, or three substituents Q.
  • E is phendiyl-methandiyl, optionally substituted with one, two, or three substituents Q.
  • E is phen-1, 4-diylmethandiyl, optionally substituted with one, two, or three substituents Q.
  • E is bicyclic C 7-15 aralkylene, optionally substituted with one, two, or three substituents Q.
  • E is heteroarylene, optionally substituted with one or more substituents Q.
  • E is monocyclic heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 5-or 6-membered heteroarylene, each optionally substituted with one, two, or three substituents Q.
  • E is 5-membered heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 6-membered heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is pyridindiyl, optionally substituted with one, two, or three substituents Q.
  • E is pyridin-2, 5-diyl, optionally substituted with one, two, or three substituents Q.
  • E is bicyclic heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 5, 5-, 5, 6-, or 6, 6-fused heteroarylene, each optionally substituted with one, two, or three substituents Q.
  • E is 5, 5-fused heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 5, 6-fused heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 6, 6-fused heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is heterocyclylene, optionally substituted with one or more substituents Q.
  • E is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 5-or 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • E is 5-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is 6-membered heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • E is piperidindiyl, optionally substituted with one, two, or three substituents Q.
  • E is piperidin-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
  • E is bicyclic heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is bridged, fused, or spiro heteroarylene, each optionally substituted with one, two, or three substituents Q.
  • E is bridged heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is fused heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is spiro heteroarylene, optionally substituted with one, two, or three substituents Q.
  • E is 1, 2, 3, 4-tetrahydroquinolindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 1, 2, 3, 4-tetrahydroquinolin-1, 6-diyl, optionally substituted with one, two, or three substituents Q.
  • L is a bond. In certain embodiments, L is –N (R 1 ) –, wherein R 1 is as defined herein. In certain embodiments, L is –N (R 1 ) –, wherein R 1 is hydrogen or C 1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, L is –N (H) –. In certain embodiments, L is –N (CH 3 ) –. In certain embodiments, L is heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • L is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 3-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 4-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 5-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is piperazindiyl, optionally substituted with one, two, or three substituents Q.
  • L is piperazin-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
  • L is bicyclic heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • L is bridged, fused, or spiro heterocyclylene, each optionally substituted with one, two, or three substituents Q.
  • L is bridged heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is fused heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is spiro heterocyclylene, optionally substituted with one, two, or three substituents Q.
  • U is –O–. In certain embodiments, U is –S–. In certain embodiments, U is –N (R 5 ) –, wherein R 5 is as defined herein. In certain embodiments, U is –N (R 5 ) –, wherein R 5 is hydrogen or C 1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, U is –N (H) –or –N (CH 3 ) –.
  • X is N. In certain embodiments, X is C (R 3a ) , wherein R 3a is as defined herein. In certain embodiments, X is C (R 3a ) , wherein R 3a is (i) halo; or (ii) C 1-6 alkyl or C 1-6 heteroalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, X is C (H) , C (F) , C (CH 3 ) , C (CF 3 ) , or C (OCH 3 ) .
  • Z is C 1-6 alkylene, optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, ethanediyl, or propanediyl, each optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl, each optionally substituted with one, two, or three substituents Q.
  • Z is methanediyl, fluoromethanediyl, difluoromethanediyl, aminocarbonylmethanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl.
  • m is an integer of 0. In certain embodiments, m is an integer of 1. In certain embodiments, m is an integer of 2. In certain embodiments, m is an integer of 3.
  • A is –C (O) –, or –S (O 2 ) –.
  • E is C 3-10 cycloalkylene, C 6-14 arylene, C 7-15 aralkylene, heteroarylene, or heterocyclylene; wherein the C 3-10 cycloalkylene, the C 6-14 arylene, the C 7-15 aralkylene, the heteroarylene, and the heterocyclylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C 1-6 alkyl, C 1-6 alkoxy, and C 1-6 haloalkyl.
  • E’ is C 6-14 aryl.
  • Z is C 1-6 alkylene; wherein the C 1-6 alkylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C 1-6 alkyl, and –C (O) NR b R c .
  • R 1 is hydrogen or C 1-6 alkyl. In certain embodiments, R 1 is hydrogen or -CH 3 .
  • R 5 is independently hydrogen or C 1-6 alkyl. In certain embodiments, R 5 is independently hydrogen or -CH 3 .
  • R 2 is halogen, C 1-6 haloalkyl, C 1-6 haloheteroalkyl, C 2-6 alkenyl, or C 2- 6 alkynyl; wherein the halogen in C 1-6 haloalkyl is Cl and/or Br; wherein the C 2-6 alkenyl, and the C 2-6 alkynyl is optionally substituted with one, two, three, or four group (s) independently selected from halogen; and –NR b R c .
  • R 2’ is C 2-6 alkenyl. In certain embodiments, R 2’ is
  • R 6 is independently C 1-6 alkyl, C 1-6 heteroalkyl, C 3-10 cycloalkyl or C 6- 14 aryl; wherein the C 1-6 alkyl, the C 1-6 heteroalkyl, and the C 3-10 cycloalkyl is optionally substituted with one, two, three, or four halogen.
  • R 7a is independently hydrogen, or C 1-6 alkyl. In certain embodiments, R 7a is independently -CH 3 .
  • R 7b is hydrogen, C 1-6 alkyl, or C 1-6 heteroalkyl; wherein the C 1-6 alkyl, and the C 1-6 heteroalkyl is optionally substituted with one, two, three, or four group (s) independently selected from oxo, and heterocyclyl.
  • R 7a and R 7b together with the N atom to which they are attached form heterocyclyl, wherein the heterocyclyl is optionally substituted with one, two, three, or four Q, and Q is C 1-6 alkyl, heterocyclyl, –NR b R c , –NHC (O) OR a , –NHC (O) R a and –OR a ; wherein C 1-6 alkyl is optionally substituted with one, two, three, or four group (s) independently selected from –OH.
  • each R a , R b , R c is independently (i) hydrogen or deuterium; or (ii) C 1- 6 alkyl optionally substituted with one –NH 2 .
  • the heteroarylene in E is a heteroarylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heteroarylene in E is the a heteroarylene having 1 heteroatom selected from N.
  • the heteroarylene in E is a 5-12 membered heteroarylene, preferably the heteroarylene in E is a 5-6 membered heteroarylene.
  • the heterocyclylene in E is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O or S, preferably the heterocyclylene in E is a heterocyclylene having 1 heteroatom selected from N.
  • the heterocyclylene in E is a 5-12 membered heterocyclylene, preferably the heterocyclylene in E is a 5-6 membered heterocyclylene.
  • the heterocyclylene in L is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclylene in L is heterocyclylene having 2 heteroatoms selected from N.
  • the heterocyclylene in L is a 5-12 membered heterocyclylene, preferably the heterocyclylene in L is a 5-6 membered heterocyclylene.
  • the C 1-6 haloheteroalkyl in the R 2 is a C 1-6 haloheteroalkyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C 1-6 haloheteroalkyl in the R 2 is a C 1-6 haloheteroalkyl having 1 heteroatom selected from O.
  • the C 1-6 heteroalkyl in the R 6 is a C 1-6 heteroalky having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C 1-6 heteroalkyl in the R 6 is a C 1-6 heteroalky having 1 heteroatom selected from O.
  • the C 1-6 heteroalkyl in the R 7b is a C 1-6 heteroalkyl, having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C 1-6 heteroalkyl in the R 7b is a C 1-6 heteroalkyl having 2 heteroatoms selected from N, and O.
  • R 7a and R 7b together with the N atom to which they are attached form a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably R 7a and R 7b together with the N atom to which they are attached form a heterocyclyl having 1 or 2 heteroatoms selected from N.
  • R 7a and R 7b together with the N atom to which they are attached form a 5-12 membered heterocyclyl, preferably R 7a and R 7b together with the N atom to which they are attached form a 5-membered heterocyclyl, 6-membered heterocyclyl, or 7-membered heterocyclyl.
  • the heterocyclyl in Q is a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclyl in Q is a heterocyclyl having having 1 heteroatom selected from N.
  • the heterocyclyl in Q is a 5-12 membered heterocyclyl, preferably the heterocyclyl in Q is a 5-6 membered heterocyclyl.
  • E is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-phenyl
  • E’ is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • L is a bond, -N (CH 3 ) -, -NH-, or
  • U is -S-, -S (O) -, -S (O 2 ) -, -NH-, -CH 2 -, -O-, or -N (CH 3 ) -.
  • Z is -CH 2 -, CH (CH 3 ) -, -CH 2 CH 2 -, -C (CH 3 ) 2 -, -CHF-, or -CF 2 -; preferably Z is -CH 2 -, -CH (CH 3 ) -, -CH 2 CH 2 -.
  • R 2 is -CH 2 Cl, F,
  • R 6 is methyl, ethyl, butyl, methoxy, ethoxy, phenyl, or -CH 2 CF 3 ; preferably R 6 is methyl, ethyl, phenyl, or -CH 2 CF 3 .
  • -NR 7a R 7b is
  • -NR 7a R 7b’ is
  • a compound provided herein is deuterium-enriched. In certain embodiments, a compound provided herein is carbon-13 enriched. In certain embodiments, a compound provided herein is carbon-14 enriched. In certain embodiments, a compound provided herein contains one or more less prevalent isotopes for other elements, including, but not limited to, 15 N for nitrogen; 17 O or 18 O for oxygen, and 34 S, 35 S, or 36 S for sulfur.
  • a compound provided herein has an isotopic enrichment factor of no less than about 5, no less than about 10, no less than about 20, no less than about 50, no less than about 100, no less than about 200, no less than about 500, no less than about 1, 000, no less than about 2, 000, no less than about 5,000, or no less than about 10, 000.
  • an isotopic enrichment factor for a specified isotope is no greater than the maximum isotopic enrichment factor for the specified isotope, which is the isotopic enrichment factor when a compound at a given position is 100%enriched with the specified isotope.
  • the maximum isotopic enrichment factor is different for different isotopes.
  • the maximum isotopic enrichment factor is 6, 410 for deuterium and 90 for carbon-13.
  • a compound provided herein has a deuterium enrichment factor of no less than about 64 (about 1%deuterium enrichment) , no less than about 130 (about 2%deuterium enrichment) , no less than about 320 (about 5%deuterium enrichment) , no less than about 640 (about 10%deuterium enrichment) , no less than about 1,300 (about 20%deuterium enrichment) , no less than about 3,200 (about 50%deuterium enrichment) , no less than about 4,800 (about 75%deuterium enrichment) , no less than about 5,130 (about 80%deuterium enrichment) , no less than about 5, 450 (about 85%deuterium enrichment) , no less than about 5,770 (about 90%deuterium enrichment) , no less than about 6, 090 (about 95%deuterium enrichment) , no less than about 6,220 (about 97%deuterium enrichment) , no less than about 6,280 (about 98%deuterium enrichment) , no less than
  • the deuterium enrichment can be determined using conventional analytical methods known to one of ordinary skill in the art, including mass spectrometry and nuclear magnetic resonance spectroscopy.
  • at least one of the atoms of a compound provided herein, as specified as deuterium-enriched has deuterium enrichment of no less than about 50%, no less than about 70%, no less than about 80%, no less than about 90%, or no less than about 98%.
  • a compound provided herein is isolated or purified. In certain embodiments, a compound provided herein has a purity of at least about 90%, at least about 95%, at least about 98%, at least about 99%, or at least about 99.5%by weight.
  • the compounds provided herein are intended to encompass all possible stereoisomers unless a particular stereochemistry is specified.
  • a compound provided herein contains an alkenyl group
  • the compound may exist as one or mixture of geometric cis/trans (or Z/E) isomers.
  • structural isomers are interconvertible
  • the compound may exist as a single tautomer or a mixture of tautomers. This can take the form of proton tautomerism in the compound that contains, for example, an imino, keto, or oxime group; or so-called valence tautomerism in the compound that contains an aromatic moiety. It follows that a single compound may exhibit more than one type of isomerism.
  • a compound provided herein can be enantiomerically pure, such as a single enantiomer or a single diastereomer, or be stereoisomeric mixtures, such as a mixture of enantiomers, e.g., a racemic mixture of two enantiomers; or a mixture of two or more diastereomers.
  • a compound in its (R) form is equivalent, for the compound that undergoes epimerization in vivo, to administration of the compound in its (S) form.
  • Conventional techniques for the preparation/isolation of individual enantiomers include synthesis from a suitable optically pure precursor, asymmetric synthesis from achiral starting materials, or resolution of an enantiomeric mixture, for example, chiral chromatography, recrystallization, resolution, diastereomeric salt formation, or derivatization into diastereomeric adducts followed by separation.
  • a compound provided herein contains an acidic or basic moiety, it can also be provided as a pharmaceutically acceptable salt. See, Berge et al., J. Pharm. Sci. 1977, 66, 1-19; Handbook of Pharmaceutical Salts: Properties, Selection, and Use, 2nd ed. ; Stahl and Wermuth Eds. ; John Wiley &Sons, 2011.
  • a pharmaceutically acceptable salt of a compound provided herein is a solvate.
  • a pharmaceutically acceptable salt of a compound provided herein is a hydrate.
  • Suitable acids for use in the preparation of pharmaceutically acceptable salts of a compound provided herein include, but are not limited to, acetic acid, 2, 2-dichloroacetic acid, acylated amino acids, adipic acid, alginic acid, ascorbic acid, L-aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, boric acid, (+) -camphoric acid, camphorsulfonic acid, (+) - (1S) -camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, cinnamic acid, citric acid, cyclamic acid, cyclohexanesulfamic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxy-ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid
  • Suitable bases for use in the preparation of pharmaceutically acceptable salts of a compound provided herein include, but are not limited to, inorganic bases, such as magnesium hydroxide, calcium hydroxide, potassium hydroxide, zinc hydroxide, or sodium hydroxide; and organic bases, such as primary, secondary, tertiary, and quaternary, aliphatic and aromatic amines, including, but not limited to, L-arginine, benethamine, benzathine, choline, deanol, diethanolamine, diethylamine, dimethylamine, dipropylamine, diisopropylamine, 2- (diethylamino) -ethanol, ethanolamine, ethylamine, ethylenediamine, isopropylamine, N-methyl-glucamine, hydrabamine, 1H-imidazole, L-lysine, morpholine, 4- (2-hydroxyethyl) -morpholine, methylamine, piperidine, piperazine, propy
  • a compound provided herein may also be provided as a prodrug, which is a functional derivative of the compound and is readily convertible into the parent compound in vivo.
  • Prodrugs are often useful because, in some situations, they may be easier to administer than the parent compound. They may, for instance, be bioavailable by oral administration whereas the parent compound is not.
  • the prodrug may also have enhanced solubility in pharmaceutical compositions over the parent compound.
  • a prodrug may be converted into the parent drug by various mechanisms, including enzymatic processes and metabolic hydrolysis.
  • a pharmaceutical composition comprising a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; and a pharmaceutically acceptable excipient.
  • a compound provided herein e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; and a pharmaceutically acceptable excipient.
  • the pharmaceutical composition provided herein can be formulated in various dosage forms, including, but not limited to, dosage forms for oral, parenteral, and topical administration.
  • the pharmaceutical composition can also be formulated as modified release dosage forms, including delayed-, extended-, prolonged-, sustained-, pulsatile-, controlled-, accelerated-, fast-, targeted-, programmed-release, and gastric retention dosage forms.
  • These dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art. See, e.g., Remington: The Science and Practice of Pharmacy, supra; Modified-Release Drug Delivery Technology, 2nd ed. ; Rathbone et al., Eds. ; Drugs and the Pharmaceutical Sciences 184; CRC Press: Boca Raton, FL, 2008.
  • the pharmaceutical composition provided herein is formulated in a dosage form for oral administration. In another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for parenteral administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for intravenous administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for intramuscular administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for subcutaneous administration. In still another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for topical administration.
  • the pharmaceutical composition provided herein can be provided in a unit-dosage form or multiple-dosage form.
  • a unit-dosage form refers to physically discrete a unit suitable for administration to a subject, and packaged individually as is known in the art. Each unit-dose contains a predetermined quantity of an active ingredient (s) (e.g., a compound provided herein) sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical excipient (s) .
  • an active ingredient e.g., a compound provided herein
  • Examples of a unit-dosage form include, but are not limited to, an ampoule, syringe, and individually packaged tablet and capsule.
  • a unit-dosage form may be administered in fractions or multiples thereof.
  • a multiple-dosage form is a plurality of identical unit-dosage forms packaged in a single container to be administered in a segregated unit-dosage form.
  • Examples of a multiple-dosage form include, are not limited to, a vial, bottle of tablets or capsules, or bottle of pints or gallons.
  • the pharmaceutical composition provided herein can be administered at once or multiple times at intervals of time. It is understood that the precise dosage and duration of treatment may vary with the age, weight, and condition of the subject being treated, and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test or diagnostic data. It is further understood that for any particular individual, specific dosage regimens should be adjusted over time according to the subject’s need and the professional judgment of the person administering or supervising the administration of the pharmaceutical composition.
  • oral administration can be provided in solid, semisolid, or liquid dosage forms for oral administration.
  • oral administration also includes buccal, lingual, and sublingual administration.
  • Suitable oral dosage forms include, but are not limited to, tablets, fastmelts, chewable tablets, capsules, pills, strips, troches, lozenges, pastilles, cachets, pellets, medicated chewing gum, bulk powders, effervescent or non-effervescent powders or granules, oral mists, solutions, emulsions, suspensions, wafers, sprinkles, elixirs, and syrups.
  • the pharmaceutical composition can contain one or more pharmaceutically acceptable carriers or excipients, including, but not limited to, binders, fillers, diluents, disintegrants, wetting agents, lubricants, glidants, coloring agents, dye-migration inhibitors, sweetening agents, flavoring agents, emulsifying agents, suspending and dispersing agents, preservatives, solvents, non-aqueous liquids, organic acids, and sources of carbon dioxide.
  • pharmaceutically acceptable carriers or excipients including, but not limited to, binders, fillers, diluents, disintegrants, wetting agents, lubricants, glidants, coloring agents, dye-migration inhibitors, sweetening agents, flavoring agents, emulsifying agents, suspending and dispersing agents, preservatives, solvents, non-aqueous liquids, organic acids, and sources of carbon dioxide.
  • Binders or granulators impart cohesiveness to a tablet to ensure the tablet remaining intact after compression.
  • Suitable binders or granulators include, but are not limited to, starches, such as corn starch, potato starch, and pre-gelatinized starch (e.g., STARCH ) ; gelatin; sugars, such as sucrose, glucose, dextrose, molasses, and lactose; natural and synthetic gums, such as acacia, alginic acid, alginates, extract of Irish moss, Panwar gum, Ghatti gum, mucilage of isabgol husks, carboxymethylcellulose, methylcellulose, polyvinylpyrrolidone (PVP) , larch arabinogalactan, powdered tragacanth, and guar gum; celluloses, such as ethyl cellulose, cellulose acetate, carboxymethyl cellulose calcium, sodium carboxymethyl cellulose, methyl cellulose, hydroxyethy
  • Suitable fillers include, but are not limited to, talc, calcium carbonate, microcrystalline cellulose, powdered cellulose, dextrates, kaolin, mannitol, silicic acid, sorbitol, starch, and pre-gelatinized starch.
  • the amount of a binder or filler in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art.
  • the binder or filler may be present from about 50 to about 99%by weight in the pharmaceutical composition provided herein.
  • Suitable diluents include, but are not limited to, dicalcium phosphate, calcium sulfate, lactose, sorbitol, sucrose, inositol, cellulose, kaolin, mannitol, sodium chloride, dry starch, and powdered sugar.
  • Certain diluents, such as mannitol, lactose, sorbitol, sucrose, and inositol when present in sufficient quantity, can impart properties to some compressed tablets that permit disintegration in the mouth by chewing. Such compressed tablets can be used as chewable tablets.
  • the amount of a diluent in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art.
  • Suitable disintegrants include, but are not limited to, agar; bentonite; celluloses, such as methylcellulose and carboxymethylcellulose; wood products; natural sponge; cation-exchange resins; alginic acid; gums, such as guar gum and HV; citrus pulp; cross-linked celluloses, such as croscarmellose; cross-linked polymers, such as crospovidone; cross-linked starches; calcium carbonate; microcrystalline cellulose, such as sodium starch glycolate; polacrilin potassium; starches, such as corn starch, potato starch, tapioca starch, and pre-gelatinized starch; clays; and algins.
  • the amount of a disintegrant in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art.
  • the pharmaceutical composition provided herein may contain from about 0.5 to about 15%or from about 1 to about 5%by weight of a disintegrant.
  • Suitable lubricants include, but are not limited to, calcium stearate; magnesium stearate; mineral oil; light mineral oil; glycerin; sorbitol; mannitol; glycols, such as glycerol behenate and polyethylene glycol (PEG) ; stearic acid; sodium lauryl sulfate; talc; hydrogenated vegetable oil, such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil; zinc stearate; ethyl oleate; ethyl laureate; agar; starch; lycopodium; and silica or silica gels, such as 200 and
  • the amount of a lubricant in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art.
  • the pharmaceutical compositions provided herein may contain about 0.1 to about 5%by weight of a lubricant.
  • Suitable glidants include, but are not limited to, colloidal silicon dioxide, and asbestos-free talc.
  • Suitable coloring agents include, but are not limited to, any of the approved, certified, water soluble FD&C dyes, and water insoluble FD&C dyes suspended on alumina hydrate, and color lakes.
  • a color lake is a combination by adsorption of a water-soluble dye to a hydrous oxide of a heavy metal, resulting in an insoluble form of the dye.
  • Suitable flavoring agents include, but are not limited to, natural flavors extracted from plants, such as fruits, and synthetic blends of compounds which produce a pleasant taste sensation, such as peppermint and methyl salicylate.
  • Suitable sweetening agents include, but are not limited to, sucrose, lactose, mannitol, syrups, glycerin, and artificial sweeteners, such as saccharin and aspartame.
  • Suitable emulsifying agents include, but are not limited to, gelatin, acacia, tragacanth, bentonite, and surfactants, such as polyoxyethylene sorbitan monooleate ( 20) , polyoxyethylene sorbitan monooleate 80 ( 80) , and triethanolamine oleate.
  • Suitable suspending and dispersing agents include, but are not limited to, sodium carboxy-methylcellulose, pectin, tragacanth, acacia, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone.
  • Suitable preservatives include, but are not limited to, glycerin, methyl and propylparaben, benzoic add, and sodium benzoate and alcohol.
  • Suitable wetting agents include, but are not limited to, propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate, and polyoxyethylene lauryl ether.
  • Suitable solvents include, but are not limited to, glycerin, sorbitol, ethyl alcohol, and syrup.
  • Suitable non-aqueous liquids utilized in emulsions include, but are not limited to, mineral oil and cottonseed oil.
  • Suitable organic acids include, but are not limited to, citric and tartaric acid.
  • Suitable sources of carbon dioxide include, but are not limited to, sodium bicarbonate and sodium carbonate.
  • the pharmaceutical composition provided herein for oral administration can be provided as compressed tablets, tablet triturates, chewable lozenges, rapidly dissolving tablets, multiple compressed tablets, or enteric-coating tablets, sugar-coated, or film-coated tablets.
  • Enteric-coated tablets are compressed tablets coated with substances that resist the action of stomach acid but dissolve or disintegrate in the intestine, thus protecting the active ingredient (s) from the acidic environment of the stomach.
  • Enteric-coatings include, but are not limited to, fatty acids, fats, phenyl salicylate, waxes, shellac, ammoniated shellac, and cellulose acetate phthalates.
  • Sugar-coated tablets are compressed tablets surrounded by a sugar coating, which may be beneficial in covering up objectionable tastes or odors and in protecting the tablets from oxidation.
  • Film-coated tablets are compressed tablets that are covered with a thin layer or film of a water-soluble material.
  • Film coatings include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000, and cellulose acetate phthalate. Film coating imparts the same general characteristics as sugar coating.
  • Multiple compressed tablets are compressed tablets made by more than one compression cycle, including layered tablets, and press-coated or dry-coated tablets.
  • the tablet dosage forms can be prepared from an active ingredient (s) in powdered, crystalline, or granular forms, alone or in combination with one or more carriers or excipients described herein, including binders, disintegrants, controlled-release polymers, lubricants, diluents, and/or colorants. Flavoring and sweetening agents are especially useful in the formation of chewable tablets and lozenges.
  • the pharmaceutical composition provided herein for oral administration can be provided as soft or hard capsules, which can be made from gelatin, methylcellulose, starch, or calcium alginate.
  • the hard gelatin capsule also known as the dry-filled capsule (DFC) , consists of two sections, one slipping over the other, thus completely enclosing the active ingredient (s) .
  • the soft elastic capsule (SEC) is a soft, globular shell, such as a gelatin shell, which is plasticized by the addition of glycerin, sorbitol, or a similar polyol.
  • the soft gelatin shells may contain a preservative to prevent the growth of microorganisms.
  • Suitable preservatives are those as described herein, including methyl-and propyl-parabens, and sorbic acid.
  • the liquid, semisolid, and solid dosage forms provided herein may be encapsulated in a capsule.
  • Suitable liquid and semisolid dosage forms include solutions and suspensions in propylene carbonate, vegetable oils, or triglycerides. Capsules containing such solutions can be prepared as described in U.S. Pat. Nos. 4,328,245; 4,409,239; and 4,410,545.
  • the capsules may also be coated as known by those of skill in the art in order to modify or sustain dissolution of the active ingredient (s) .
  • the pharmaceutical composition provided herein for oral administration can be provided in liquid and semisolid dosage forms, including emulsions, solutions, suspensions, elixirs, and syrups.
  • An emulsion is a two-phase system, in which one liquid is dispersed in the form of small globules throughout another liquid, which can be oil-in-water or water-in-oil.
  • Emulsions may include a pharmaceutically acceptable non-aqueous liquid or solvent, emulsifying agent, and preservative.
  • Suspensions may include a pharmaceutically acceptable suspending agent and preservative.
  • Aqueous alcoholic solutions may include a pharmaceutically acceptable acetal, such as a di (lower alkyl) acetal of a lower alkyl aldehyde, e.g., acetaldehyde diethyl acetal; and a water-miscible solvent having one or more hydroxyl groups, such as propylene glycol and ethanol.
  • Elixirs are clear, sweetened, and hydroalcoholic solutions.
  • Syrups are concentrated aqueous solutions of a sugar, for example, sucrose, and may also contain a preservative.
  • a solution in a polyethylene glycol may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid carrier, e.g., water, to be measured conveniently for administration.
  • liquid and semisolid dosage forms include, but are not limited to, those containing an active ingredient (s) , and a dialkylated mono-or poly-alkylene glycol, including, 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550, and 750 refer to the approximate average molecular weight of the polyethylene glycol.
  • a dialkylated mono-or poly-alkylene glycol including, 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550, and 750 refer to the approximate average molecular weight of the polyethylene glycol.
  • These dosage forms can further comprise one or more antioxidants, such as butylated hydroxytoluene (BHT) , butylated hydroxyanisole (BHA) , propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulfite, sodium metabisulfite, thiodipropionic acid and its esters, and dithiocarbamates.
  • antioxidants such as butylated hydroxytoluene (BHT) , butylated hydroxyanisole (BHA) , propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulfite, sodium metabisulfite, thiodipropionic acid and its esters, and dithiocarba
  • composition provided herein for oral administration can be also provided in the forms of liposomes, micelles, microspheres, or nanosystems.
  • Micellar dosage forms can be prepared as described in U.S. Pat. No. 6,350,458.
  • the pharmaceutical composition provided herein for oral administration can be provided as non-effervescent or effervescent, granules and powders, to be reconstituted into a liquid dosage form.
  • Pharmaceutically acceptable carriers and excipients used in the non-effervescent granules or powders may include diluents, sweeteners, and wetting agents.
  • Pharmaceutically acceptable carriers and excipients used in the effervescent granules or powders may include organic acids and a source of carbon dioxide.
  • Coloring and flavoring agents can be used in all of the dosage forms described herein.
  • compositions provided herein for oral administration can be formulated as immediate or modified release dosage forms, including delayed-, sustained, pulsed-, controlled, targeted-, and programmed-release forms.
  • compositions provided herein can be administered parenterally by injection, infusion, or implantation, for local or systemic administration.
  • Parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial, intravesical, and subcutaneous administration.
  • the pharmaceutical composition provided herein for parenteral administration can be formulated in any dosage forms that are suitable for parenteral administration, including, but not limited to, solutions, suspensions, emulsions, micelles, liposomes, microspheres, nanosystems, and solid forms suitable for solutions or suspensions in liquid prior to injection.
  • dosage forms can be prepared according to conventional methods known to those skilled in the art of pharmaceutical science. See, e.g., Remington: The Science and Practice of Pharmacy, supra.
  • the pharmaceutical composition provided herein for parenteral administration can include one or more pharmaceutically acceptable carriers and excipients, including, but not limited to, aqueous vehicles, water-miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives against the growth of microorganisms, stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emulsifying agents, complexing agents, sequestering or chelating agents, cryoprotectants, lyoprotectants, thickening agents, pH adjusting agents, and inert gases.
  • aqueous vehicles water-miscible vehicles
  • non-aqueous vehicles non-aqueous vehicles
  • antimicrobial agents or preservatives against the growth of microorganisms stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or
  • Suitable aqueous vehicles include, but are not limited to, water, saline, physiological saline or phosphate buffered saline (PBS) , sodium chloride injection, Ringer’s injection, isotonic dextrose injection, sterile water injection, dextrose and lactated Ringer’s injection.
  • Suitable non-aqueous vehicles include, but are not limited to, fixed oils of vegetable origin, castor oil, corn oil, cottonseed oil, olive oil, peanut oil, peppermint oil, safflower oil, sesame oil, soybean oil, hydrogenated vegetable oils, hydrogenated soybean oil, and medium-chain triglycerides of coconut oil, and palm seed oil.
  • Suitable water-miscible vehicles include, but are not limited to, ethanol, 1, 3-butanediol, liquid polyethylene glycol (e.g., polyethylene glycol 300 and polyethylene glycol 400) , propylene glycol, glycerin, N-methyl-2-pyrrolidone, N, N-dimethylacetamide, and dimethyl sulfoxide.
  • liquid polyethylene glycol e.g., polyethylene glycol 300 and polyethylene glycol 400
  • propylene glycol e.g., propylene glycol, glycerin, N-methyl-2-pyrrolidone, N, N-dimethylacetamide, and dimethyl sulfoxide.
  • Suitable antimicrobial agents or preservatives include, but are not limited to, phenols, cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoates, thimerosal, benzalkonium chloride (e.g., benzethonium chloride) , methyl-and propyl-parabens, and sorbic acid.
  • Suitable isotonic agents include, but are not limited to, sodium chloride, glycerin, and dextrose.
  • Suitable buffering agents include, but are not limited to, phosphate and citrate.
  • Suitable antioxidants include those described herein, such as bisulfite and sodium metabisulfite.
  • Suitable local anesthetics include, but are not limited to, procaine hydrochloride.
  • Suitable suspending and dispersing agents include those described herein, such as sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone.
  • Suitable emulsifying agents include those described herein, such as polyoxyethylene sorbitan monolaurate, polyoxyethylene sorbitan monooleate 80, and triethanolamine oleate.
  • Suitable sequestering or chelating agents include, but are not limited to, EDTA.
  • Suitable pH adjusting agents include, but are not limited to, sodium hydroxide, hydrochloric acid, citric acid, and lactic acid.
  • Suitable complexing agents include, but are not limited to, cyclodextrins, including ⁇ -cyclodextrin, ⁇ -cyclodextrin, hydroxypropyl- ⁇ -cyclodextrin, sulfobutylether- ⁇ -cyclodextrin, and sulfobutylether 7- ⁇ -cyclodextrin
  • multiple dosage parenteral formulations must contain an antimicrobial agent at bacteriostatic or fungistatic concentrations. All parenteral formulations must be sterile, as known and practiced in the art.
  • the pharmaceutical composition for parenteral administration is provided as a ready-to-use sterile solution.
  • the pharmaceutical composition is provided as a sterile dry soluble product, including a lyophilized powder and hypodermic tablet, to be reconstituted with a vehicle prior to use.
  • the pharmaceutical composition is provided as a ready-to-use sterile suspension.
  • the pharmaceutical composition is provided as a sterile dry insoluble product to be reconstituted with a vehicle prior to use.
  • the pharmaceutical composition is provided as a ready-to-use sterile emulsion.
  • compositions provided herein for parenteral administration can be formulated as immediate or modified release dosage forms, including delayed-, sustained, pulsed-, controlled, targeted-, and programmed-release forms.
  • the pharmaceutical composition provided herein for parenteral administration can be formulated as a suspension, solid, semi-solid, or thixotropic liquid, for administration as an implanted depot.
  • the pharmaceutical composition provided herein are dispersed in a solid inner matrix, which is surrounded by an outer polymeric membrane that is insoluble in body fluids but allows the active ingredient (s) in the pharmaceutical composition to diffuse through.
  • Suitable inner matrixes include, but are not limited to, polymethylmethacrylate, polybutylmethacrylate, plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, silicone carbonate copolymers, hydrophilic polymers (such as hydrogels of esters of acrylic and methacrylic acid) , collagen, cross-linked polyvinyl alcohol, and cross-linked partially hydrolyzed polyvinyl acetate.
  • Suitable outer polymeric membranes include, but are not limited to, polyethylene, polypropylene, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, neoprene rubber, chlorinated polyethylene, polyvinylchloride, vinyl chloride copolymers with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl alcohol terpolymer, and ethylene/vinyloxyethanol copolymer.
  • the pharmaceutical composition provided herein can be administered topically to the skin, orifices, or mucosa.
  • the topical administration includes (intra) dermal, conjunctival, intracorneal, intraocular, ophthalmic, auricular, transdermal, nasal, vaginal, urethral, respiratory, and rectal administration.
  • the pharmaceutical composition provided herein can be formulated in any dosage forms that are suitable for topical administration for local or systemic effect, including, but not limited to, emulsions, solutions, suspensions, creams, gels, hydrogels, ointments, dusting powders, dressings, elixirs, lotions, suspensions, tinctures, pastes, foams, films, aerosols, irrigations, sprays, suppositories, bandages, and dermal patches.
  • the topical formulations of the pharmaceutical composition provided herein can also comprise liposomes, micelles, microspheres, and nanosystems.
  • Pharmaceutically acceptable carriers and excipients suitable for use in the topical formulations include, but are not limited to, aqueous vehicles, water-miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives against the growth of microorganisms, stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emulsifying agents, complexing agents, sequestering or chelating agents, penetration enhancers, cryoprotectants, lyoprotectants, thickening agents, and inert gases.
  • the pharmaceutical composition can also be administered topically by electroporation, iontophoresis, phonophoresis, sonophoresis, or microneedle or needle-free injection, such as POWDERJECT TM and BIOJECT TM .
  • Suitable ointment vehicles include oleaginous or hydrocarbon vehicles, including lard, benzoinated lard, olive oil, cottonseed oil, and other oils, white petrolatum; emulsifiable or absorption vehicles, such as hydrophilic petrolatum, hydroxystearin sulfate, and anhydrous lanolin; water-removable vehicles, such as hydrophilic ointment; water-soluble ointment vehicles, including polyethylene glycols of varying molecular weight; emulsion vehicles, either water-in-oil (W/O) emulsions or oil-in-water (O/W) emulsions, including cetyl alcohol, glyceryl monostearate, lanolin, and stearic acid. See, e.g., Remington: The Science and Practice of Pharmacy, supra. These vehicles are emollient but generally require
  • Suitable cream base can be oil-in-water or water-in-oil.
  • Suitable cream vehicles may be water-washable, and contain an oil phase, an emulsifier, and an aqueous phase.
  • the oil phase is also called the “internal” phase, which is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol.
  • the aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a humectant.
  • the emulsifier in a cream formulation may be a nonionic, anionic, cationic, or amphoteric surfactant.
  • Gels are semisolid, suspension-type systems. Single-phase gels contain organic macromolecules distributed substantially uniformly throughout the liquid carrier.
  • Suitable gelling agents include, but are not limited to, crosslinked acrylic acid polymers, such as carbomers, carboxypolyalkylenes, and hydrophilic polymers, such as polyethylene oxides, polyoxyethylene-polyoxypropylene copolymers, and polyvinylalcohol; cellulosic polymers, such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and methylcellulose; gums, such as tragacanth and xanthan gum; sodium alginate; and gelatin.
  • dispersing agents such as alcohol or glycerin can be added, or the gelling agent can be dispersed by trituration, mechanical mixing, and/or stirring.
  • the pharmaceutical composition provided herein can be administered rectally, urethrally, vaginally, or perivaginally in the forms of suppositories, pessaries, bougies, poultices or cataplasm, pastes, powders, dressings, creams, plasters, contraceptives, ointments, solutions, emulsions, suspensions, tampons, gels, foams, sprays, or enemas.
  • These dosage forms can be manufactured using conventional processes as described in Remington: The Science and Practice of Pharmacy, supra.
  • Rectal, urethral, and vaginal suppositories are solid bodies for insertion into body orifices, which are solid at ordinary temperatures but melt or soften at body temperature to release the active ingredient (s) inside the orifices.
  • Pharmaceutically acceptable carriers utilized in rectal and vaginal suppositories include bases or vehicles, such as stiffening agents, which produce a melting point in the proximity of body temperature, when formulated with an active ingredient (s) ; and antioxidants as described herein, including bisulfite and sodium metabisulfite.
  • Suitable vehicles include, but are not limited to, cocoa butter (theobroma oil) , glycerin-gelatin, carbowax (polyoxyethylene glycol) , spermaceti, paraffin, white and yellow wax, and appropriate mixtures of mono-, di-and triglycerides of fatty acids, and hydrogels, such as polyvinyl alcohol, hydroxyethyl methacrylate, and polyacrylic acid. Combinations of the various vehicles can also be used. Rectal and vaginal suppositories may be prepared by compressing or molding. The typical weight of a rectal and vaginal suppository is about 2 to about 3 g.
  • compositions provided herein can be administered ophthalmically in the forms of solutions, suspensions, ointments, emulsions, gel-forming solutions, powders for solutions, gels, ocular inserts, and implants.
  • the pharmaceutical composition provided herein can be administered intranasally or by inhalation to the respiratory tract.
  • the pharmaceutical composition can be provided in the form of an aerosol or solution for delivery using a pressurized container, pump, spray, atomizer, such as an atomizer using electrohydrodynamics to produce a fine mist, or nebulizer, alone or in combination with a suitable propellant, such as 1, 1, 1, 2-tetrafluoroethane or 1, 1, 1, 2, 3, 3, 3-hepta-fluoropropane.
  • atomizer such as an atomizer using electrohydrodynamics to produce a fine mist, or nebulizer, alone or in combination with a suitable propellant, such as 1, 1, 1, 2-tetrafluoroethane or 1, 1, 1, 2, 3, 3, 3-hepta-fluoropropane.
  • the pharmaceutical composition can also be provided as a dry powder for insufflation, alone or in combination with an inert carrier such as lactose or phospholipids; and nasal drops.
  • Solutions or suspensions for use in a pressurized container, pump, spray, atomizer, or nebulizer can be formulated to contain ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilizing, or extending release of an active ingredient (s) ; a propellant as solvent; and/or a surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid.
  • the pharmaceutical composition provided herein can be micronized to a size suitable for delivery by inhalation, such as about 50 micrometers or less, or about 10 micrometers or less.
  • Particles of such sizes can be prepared using a comminuting method known to those skilled in the art, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization, or spray drying.
  • Capsules, blisters, and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mix of the pharmaceutical composition provided herein; a suitable powder base, such as lactose or starch; and a performance modifier, such as l-leucine, mannitol, or magnesium stearate.
  • the lactose may be anhydrous or in the form of the monohydrate.
  • Other suitable excipients or carriers include, but are not limited to, dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose, and trehalose.
  • the pharmaceutical composition provided herein for inhaled/intranasal administration can further comprise a suitable flavor, such as menthol and levomenthol; and/or sweeteners, such as saccharin and saccharin sodium.
  • composition provided herein for topical administration can be formulated to be immediate release or modified release, including delayed-, sustained-, pulsed-, controlled-, targeted, and programmed release.
  • modified release refers to a dosage form in which the rate or place of release of an active ingredient (s) is different from that of an immediate dosage form when administered by the same route.
  • Modified release dosage forms include, but are not limited to, delayed-, extended-, prolonged-, sustained-, pulsatile-, controlled-, accelerated-and fast-, targeted-, programmed-release, and gastric retention dosage forms.
  • the pharmaceutical composition in modified release dosage forms can be prepared using a variety of modified release devices and methods known to those skilled in the art, including, but not limited to, matrix-controlled release devices, osmotic controlled release devices, multiparticulate controlled release devices, ion-exchange resins, enteric coatings, multilayered coatings, microspheres, liposomes, and combinations thereof.
  • the release rate of the active ingredient (s) can also be modified by varying the particle sizes and polymorphism of the active ingredient (s) .
  • the pharmaceutical composition provided herein in a modified release dosage form can be fabricated using a matrix-controlled release device known to those skilled in the art. See, e.g., Takada et al. in Encyclopedia of Controlled Drug Delivery, Mathiowitz Ed. ; Wiley, 1999; Vol. 2.
  • the pharmaceutical composition provided herein in a modified release dosage form is formulated using an erodible matrix device, which is water-swellable, erodible, or soluble polymers, including, but not limited to, synthetic polymers, and naturally occurring polymers and derivatives, such as polysaccharides and proteins.
  • an erodible matrix device which is water-swellable, erodible, or soluble polymers, including, but not limited to, synthetic polymers, and naturally occurring polymers and derivatives, such as polysaccharides and proteins.
  • Materials useful in forming an erodible matrix include, but are not limited to, chitin, chitosan, dextran, and pullulan; gum agar, gum arabic, gum karaya, locust bean gum, gum tragacanth, carrageenans, gum Ghatti, guar gum, xanthan gum, and scleroglucan; starches, such as dextrin and maltodextrin; hydrophilic colloids, such as pectin; phosphatides, such as lecithin; alginates; propylene glycol alginate; gelatin; collagen; cellulosics, such as ethyl cellulose (EC) , methylethyl cellulose (MEC) , carboxymethyl cellulose (CMC) , CMEC, hydroxyethyl cellulose (HEC) , hydroxypropyl cellulose (HPC) , cellulose acetate (CA) , cellulose propionate (CP) ,
  • the pharmaceutical composition provided herein is formulated with a non-erodible matrix device.
  • the active ingredient (s) is dissolved or dispersed in an inert matrix and is released primarily by diffusion through the inert matrix once administered.
  • Materials suitable for use as a non-erodible matrix device include, but are not limited to, insoluble plastics, such as polyethylene, polypropylene, polyisoprene, polyisobutylene, polybutadiene, polymethylmethacrylate, polybutylmethacrylate, chlorinated polyethylene, polyvinylchloride, methyl acrylate-methyl methacrylate copolymers, ethylene-vinyl acetate copolymers, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, vinyl chloride copolymers with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubbers, epichlorohydrin
  • the desired release kinetics can be controlled, for example, via the polymer type employed, the polymer viscosity, the particle sizes of the polymer and/or the active ingredient (s) , the ratio of the active ingredient (s) versus the polymer, and other excipients or carriers in the compositions.
  • composition provided herein in a modified release dosage form can be prepared by methods known to those skilled in the art, including direct compression, dry or wet granulation followed by compression, and melt-granulation followed by compression.
  • the pharmaceutical composition provided herein in a modified release dosage form can be fabricated using an osmotic controlled release device, including, but not limited to, one-chamber system, two-chamber system, asymmetric membrane technology (AMT) , and extruding core system (ECS) .
  • an osmotic controlled release device including, but not limited to, one-chamber system, two-chamber system, asymmetric membrane technology (AMT) , and extruding core system (ECS) .
  • AMT asymmetric membrane technology
  • ECS extruding core system
  • such devices have at least two components: (a) a core which contains an active ingredient; and (b) a semipermeable membrane with at least one delivery port, which encapsulates the core.
  • the semipermeable membrane controls the influx of water to the core from an aqueous environment of use so as to cause drug release by extrusion through the delivery port (s) .
  • the core of the osmotic device optionally includes an osmotic agent, which creates a driving force for transport of water from the environment of use into the core of the device.
  • an osmotic agent is water-swellable hydrophilic polymers, which are also referred to as “osmopolymers” and “hydrogels.
  • Suitable water-swellable hydrophilic polymers as osmotic agents include, but are not limited to, hydrophilic vinyl and acrylic polymers, polysaccharides such as calcium alginate, polyethylene oxide (PEO) , polyethylene glycol (PEG) , polypropylene glycol (PPG) , poly (2-hydroxyethyl methacrylate) , poly (acrylic) acid, poly (methacrylic) acid, polyvinylpyrrolidone (PVP) , crosslinked PVP, polyvinyl alcohol (PVA) , PVA/PVP copolymers, PVA/PVP copolymers with hydrophobic monomers such as methyl methacrylate and vinyl acetate, hydrophilic polyurethanes containing large PEO blocks, sodium croscarmellose, carrageenan, hydroxyethyl cellulose (HEC) , hydroxypropyl cellulose (HPC) , hydroxypropyl methyl cellulose (HPMC) , carboxymethyl me
  • osmogens which are capable of imbibing water to affect an osmotic pressure gradient across the barrier of the surrounding coating.
  • Suitable osmogens include, but are not limited to, inorganic salts, such as magnesium sulfate, magnesium chloride, calcium chloride, sodium chloride, lithium chloride, potassium sulfate, potassium phosphates, sodium carbonate, sodium sulfite, lithium sulfate, potassium chloride, and sodium sulfate; sugars, such as dextrose, fructose, glucose, inositol, lactose, maltose, mannitol, raffinose, sorbitol, sucrose, trehalose, and xylitol; organic acids, such as ascorbic acid, benzoic acid, fumaric acid, citric acid, maleic acid, sebacic acid, sorbic acid, adipic acid, edetic acid, gluta
  • Osmotic agents of different dissolution rates can be employed to influence how rapidly the active ingredient (s) is initially delivered from the dosage form.
  • amorphous sugars such as MANNOGEM TM EZ can be used to provide faster delivery during the first couple of hours to promptly produce the desired therapeutic effect, and gradually and continually release of the remaining amount to maintain the desired level of therapeutic or prophylactic effect over an extended period of time.
  • the active ingredient (s) is released at such a rate to replace the amount of the active ingredient metabolized and excreted.
  • the core can also include a wide variety of other excipients and carriers as described herein to enhance the performance of the dosage form or to promote stability or processing.
  • Materials useful in forming the semipermeable membrane include various grades of acrylics, vinyls, ethers, polyamides, polyesters, and cellulosic derivatives that are water-permeable and water-insoluble at physiologically relevant pHs or are susceptible to being rendered water-insoluble by chemical alteration, such as crosslinking.
  • Suitable polymers useful in forming the coating include plasticized, unplasticized, and reinforced cellulose acetate (CA) , cellulose diacetate, cellulose triacetate, CA propionate, cellulose nitrate, cellulose acetate butyrate (CAB) , CA ethyl carbamate, CAP, CA methyl carbamate, CA succinate, cellulose acetate trimellitate (CAT) , CA dimethylaminoacetate, CA ethyl carbonate, CA chloroacetate, CA ethyl oxalate, CA methyl sulfonate, CA butyl sulfonate, CA p-toluene sulfonate, agar acetate, amylose triacetate, beta glucan acetate, beta glucan triacetate, acetaldehyde dimethyl acetate, triacetate of locust bean gum, hydroxylated ethylene-vinylacetate, EC, PEG, PPG, P
  • Semipermeable membrane can also be a hydrophobic microporous membrane, wherein the pores are substantially filled with a gas and are not wetted by the aqueous medium but are permeable to water vapor, as disclosed in U.S. Pat. No. 5,798,119.
  • Such hydrophobic but water-vapor permeable membrane are typically composed of hydrophobic polymers such as polyalkenes, polyethylene, polypropylene, polytetrafluoroethylene, polyacrylic acid derivatives, polyethers, polysulfones, polyethersulfones, polystyrenes, polyvinyl halides, polyvinylidene fluoride, polyvinyl esters and ethers, natural waxes, and synthetic waxes.
  • the delivery port (s) on the semipermeable membrane can be formed post-coating by mechanical or laser drilling. Delivery port (s) can also be formed in situ by erosion of a plug of water-soluble material or by rupture of a thinner portion of the membrane over an indentation in the core. In addition, delivery ports can be formed during coating process, as in the case of asymmetric membrane coatings of the type disclosed in U.S. Pat. Nos. 5,612,059 and 5,698,220.
  • the total amount of the active ingredient (s) released and the release rate can substantially by modulated via the thickness and porosity of the semipermeable membrane, the composition of the core, and the number, size, and position of the delivery ports.
  • the pharmaceutical composition in an osmotic controlled-release dosage form can further comprise additional conventional excipients or carriers as described herein to promote performance or processing of the formulation.
  • the osmotic controlled-release dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art. See, e.g., Remington: The Science and Practice of Pharmacy, supra; Santus and Baker, J. Controlled Release, 1995, 35, 1-21; Verma et al., Drug Dev. Ind. Pharm., 2000, 26, 695-708; Verma et al., J. Controlled Release, 2002, 79, 7-27.
  • the pharmaceutical composition provided herein is formulated as an AMT controlled-release dosage form, which comprises an asymmetric osmotic membrane that coats a core comprising the active ingredient (s) and other pharmaceutically acceptable excipients or carriers.
  • AMT controlled-release dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art, including direct compression, dry granulation, wet granulation, and a dip-coating method.
  • the pharmaceutical composition provided herein is formulated as an ESC controlled-release dosage form, which comprises an osmotic membrane that coats a core comprising the active ingredient (s) , a hydroxyethyl cellulose, and other pharmaceutically acceptable excipients or carriers.
  • the pharmaceutical composition provided herein in a modified release dosage form can be fabricated as a multiparticulate controlled release device, which comprises a multiplicity of particles, granules, or pellets, ranging from about 10 ⁇ m to about 3 mm, about 50 ⁇ m to about 2.5 mm, or from about 100 ⁇ m to about 1 mm in diameter.
  • Such multiparticulates can be made by the processes known to those skilled in the art, including wet-and dry-granulation, extrusion/spheronization, roller-compaction, melt-congealing, and by spray-coating seed cores. See, e.g., Multiparticulate Oral Drug Delivery; Ghebre-Sellassie Eds. ; Drugs and the Pharmaceutical Sciences 65; CRC Press: 1994; and Pharmaceutical Palletization Technology; Ghebre-Sellassie Eds.; Drugs and the Pharmaceutical Sciences 37; CRC Press: 1989.
  • excipients or carriers as described herein can be blended with the pharmaceutical composition to aid in processing and forming the multiparticulates.
  • the resulting particles can themselves constitute the multiparticulate device or can be coated by various film-forming materials, such as enteric polymers, water-swellable, and water-soluble polymers.
  • the multiparticulates can be further processed as a capsule or a tablet.
  • compositions provided herein can also be formulated to be targeted to a particular tissue, receptor, or other area of the body of the subject to be treated, including liposome-, resealed erythrocyte-, and antibody-based delivery systems.
  • examples include, but are not limited to, those disclosed in U.S. Pat. Nos. 6,316,652; 6,274,552; 6,271,359; 6,253,872; 6,139,865; 6,131,570; 6,120,751; 6,071,495; 6,060,082; 6,048,736; 6,039,975; 6,004,534; 5,985,307; 5,972,366; 5,900,252; 5,840,674; 5,759,542; and 5,709,874.
  • a method of treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition in a subject comprising administering to the subject in need thereof a therapeutically effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound provided herein e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or
  • the DNMT1-mediated disorder, disease, or condition is a proliferative disease.
  • a method of treating, preventing, or ameliorating one or more symptoms of a proliferative disease in a subject comprising administering to the subject in need thereof a therapeutically effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound provided herein e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt,
  • the proliferative disease is cancer.
  • the cancer is refractory and/or relapsed.
  • the cancer is refractory.
  • the cancer is relapsed.
  • the cancer is metastatic.
  • the cancer is unresectable.
  • the cancer is drug-resistant. In certain embodiment, the cancer is multidrug-resistant. In certain embodiments, the cancer is resistant to a chemotherapy. In certain embodiments, the cancer is resistant to an immunotherapy. In certain embodiments, the cancer is resistant to a standard therapy for the cancer.
  • the subject is a mammal. In certain embodiments, the subject is a human.
  • the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 100 mg/kg/day, from about 0.1 to about 50 mg/kg/day, from about 0.1 to about 60 mg/kg/day, from about 0.1 to about 50 mg/kg/day, from about 0.1 to about 25 mg/kg/day, from about 0.1 to about 20 mg/kg/day, from about 0.1 to about 15 mg/kg/day, from about 0.1 to about 10 mg/kg/day, or from about 0.1 to about 5 mg/kg/day. In one embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 100 mg/kg/day.
  • the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 50 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 60 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 50 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 25 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 20 mg/kg/day.
  • the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 15 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 10 mg/kg/day. In still another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 5 mg/kg/day.
  • a compound provided herein may be administered by oral, parenteral (e.g., intramuscular, intraperitoneal, intravenous, CIV, intracisternal injection or infusion, subcutaneous injection, or implant) , inhalation, nasal, vaginal, rectal, sublingual, or topical (e.g., transdermal or local) routes of administration.
  • parenteral e.g., intramuscular, intraperitoneal, intravenous, CIV, intracisternal injection or infusion, subcutaneous injection, or implant
  • inhalation nasal, vaginal, rectal, sublingual, or topical (e.g., transdermal or local) routes of administration.
  • a compound provided herein may be formulated in suitable dosage unit with a pharmaceutically acceptable excipient, carrier, adjuvant, or vehicle, appropriate for each route of administration.
  • a compound provided herein is administered orally. In another embodiment, a compound provided herein is administered parenterally. In yet another embodiment, a compound provided herein is administered intravenously. In yet another embodiment, a compound provided herein is administered intramuscularly. In yet another embodiment, a compound provided herein is administered subcutaneously. In still another embodiment, a compound provided herein is administered topically.
  • a compound provided herein can be delivered as a single dose such as, e.g., a single bolus injection, or oral tablets or pills; or over time such as, e.g., continuous infusion over time or divided bolus doses over time.
  • a compound provided herein can be administered repetitively, if necessary, for example, until the subject experiences stable disease or regression, or until the patient experiences disease progression or unacceptable toxicity.
  • a compound provided herein can be administered once daily (QD) or divided into multiple daily doses such as twice daily (BID) , and three times daily (TID) .
  • the administration can be continuous, i.e., every day, or intermittently.
  • the term “intermittent” or “intermittently” as used herein is intended to mean stopping and starting at either regular or irregular intervals.
  • intermittent administration of a compound provided herein is administration for one to six days per week, administration in cycles (e.g., daily administration for two to eight consecutive weeks, then a rest period with no administration for up to one week) , or administration on alternate days.
  • a compound provided herein is cyclically administered to a subject. Cycling therapy involves the administration of an active agent for a period of time, followed by a rest for a period of time, and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improves the efficacy of the treatment.
  • a compound provided herein can also be combined or used in combination with other therapeutic agents useful in the treatment and/or prevention of a condition, disorder, or disease described herein.
  • the term “in combination” includes the use of more than one therapy (e.g., one or more prophylactic and/or therapeutic agents) .
  • the use of the term “in combination” does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a disease or disorder.
  • a first therapy e.g., a prophylactic or therapeutic agent such as a compound provided herein
  • a first therapy can be administered prior to (e.g., 5 minutes, 15 minutes, 50 minutes, 65 minutes, 1 hour, 2 hours, 6 hours, 6 hours, 12 hours, 26 hours, 68 hours, 72 hours, 96 hours, 1 week, 2 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before) , concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 50 minutes, 65 minutes, 1 hour, 2 hours, 6 hours, 12 hours, 26 hours, 68 hours, 72 hours, 96 hours, 1 week, 2 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., a prophylactic or therapeutic agent) to the subject.
  • a second therapy e.g., a prophylactic or therapeutic agent
  • a compound provided herein is administered orally.
  • a compound provided herein is administered intravenously.
  • the second therapy can be administered orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraocularly, via local delivery by catheter or stent, subcutaneously, intraadiposally, intraarticularly, intrathecally, or in a slow release dosage form.
  • a compound provided herein and a second therapy are administered by the same mode of administration, orally or by IV.
  • a compound provided herein is administered by one mode of administration, e.g., by IV, whereas the second agent (an anticancer agent) is administered by another mode of administration, e.g., orally.
  • a method of inhibiting the growth of a cell comprising contacting the cell with an effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound provided herein e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • the cell is a cancerous cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a human cancerous cell.
  • a method of inhibiting the activity of a DNMT1 comprising contacting the DNMT1 with an effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound provided herein e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
  • a compound provided herein can also be provided as an article of manufacture using packaging materials well known to those of skill in the art. See, e.g., U.S. Pat. Nos. 5,525,907; 5,052,558; and 5,055,252.
  • packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
  • kits which, when used by a medical practitioner, can simplify the administration of an appropriate amount of a compound provided herein as an active ingredient to a subject.
  • the kit provided herein includes a container and a dosage form of a compound provided herein.
  • Kits provided herein can further include devices that are used to administer the active ingredients. Examples of such devices include, but are not limited to, syringes, needle-less injectors drip bags, patches, and inhalers. The kits provided herein can also include condoms for administration of the active ingredients.
  • Kits provided herein can further include pharmaceutically acceptable vehicles that can be used to administer one or more active ingredients.
  • the kit can comprise a sealed container of a suitable vehicle in which the active ingredient can be dissolved to form a particulate-free sterile solution that is suitable for parenteral administration.
  • Examples of pharmaceutically acceptable vehicles include, but are not limited to: aqueous vehicles, including, but not limited to, water for injection USP, sodium chloride injection, Ringer’s injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer’s injection; water-miscible vehicles, including, but not limited to, ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non-aqueous vehicles, including, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
  • aqueous vehicles including, but not limited to, water for injection USP, sodium chloride injection, Ringer’s injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer’s injection
  • water-miscible vehicles including, but not limited to, ethyl alcohol, polyethylene glycol, and polypropylene
  • tert-butyl (2- ( (6- ( (4- (aminomethyl) benzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 3.5 To a solution of tert-butyl (2- ( (6-chloro-3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 1.3 (150 mg, 0.4 mmol) and K 2 CO 3 (110 mg, 0.80 mmol) in DMF (5 mL) was added compound 3.4 (165 mg, 4.4 mmol) .
  • tert-butyl (4- (chloromethyl) phenyl) carbamate 4.1 To a solution of tert-butyl (4- (hydroxymethyl) phenyl) carbamate (2.5 g, 11.2 mmol) in DCM (50 mL) at 0 °C were added TEA (3.1 mL, 22.4 mmol) and MsCl (1.92 g, 16.8 mmol) . After stirred overnight, the reaction mixture was diluted with water and extracted with DCM (3 ⁇ 50 mL) .
  • A58a MS m/z (ESI) : 435.3 [M+H] + .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Provided herein are DNMT1 inhibitors, for example, a compound of Formula (I), and pharmaceutical compositions thereof. Also provided herein are methods of their use for treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition.

Description

DNMT1 INHIBITORS, PHARMACEUTICAL COMPOSITIONS, AND THERAPEUTIC APPLICATIONS
The present invention claims the priority of the PCT/CN2023/073678, filed on January 29, 2023, the contents of which are incorporated herein by its entirety.
Field
Provided herein are DNMT1 inhibitors and pharmaceutical compositions thereof. Also provided herein are methods of their use for treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition.
BACKGROUND
DNA methyltransferase 1 (DNMT1) is an enzyme that preferentially methylates newly replicated hemi-methylated DNA to ensure methylation maintenance of the whole genome through cell divisions. Song et al., Science 2012, 335, 709-12; Turpin and Salbert, Front. Mol. Biosc. 2022, 9, 976862. The failure of this DNMT1 maintenance function leads to aberrant DNA methylation and contributes to the pathogenesis of cancer. Pathania et al., Nat. Commun. 2015, 6, 6910; Zhang and Xu, Biomark. Res. 2017, 5, 1; Pappalardi et al., Nat. Cancer 2021, 2, 1002-17. DNMT1 overexpression correlates well with aberrant DNA methylation in solid tumors and poor prognosis in cancer patients as well. Saito et al., Int. J. Cancer 2003, 105, 527-32; Peng et al., Carcinogenesis 2006, 27, 1160-8; Zhao et al., Dis. Esophagus 2011, 24, 601-10; Zhang and Xu, Biomark. Res. 2017, 5, 1.
Currently, there are two DNA hypomethylating agents approved by the FDA, azacytidine and decitabine. Stomper et al., Leukemia 2021, 35, 1873-89. The two DNA demethylating agents inhibit DNA methyltransferases, including DNMT1. Agrawal et al., Pharmacol. Ther. 2018, 188, 45-79. However, both azacytidine and decitabine carry drug label warnings for genotoxicity and cytotoxicity. Gilmartin et al., Haematologica 2021, 106, 1979-87.
Despite the advances in cancer treatment, cancer remains a major worldwide public health problem. It was estimated that there will be 1, 918, 030 new cancer cases diagnosed and 609, 360 cancer deaths in the US alone in 2022. Cancer Facts &Figures 2022. Therefore, there is a need for an effective therapy for cancer treatment. Bohl et al., Expert Rev. Hermatol. 2018, 11, 361-71; Pappalardi et al., Nat. Cancer 2021, 2, 1002-17.
SUMMARY OF THE DISCLOSURE
In one embodiment, provided herein is a compound of Formula (I) or Formula (I-1) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
A is –C (O) –, –S (O) –, or –S (O2) –;
E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene;
E’ is C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
L is a bond, N (R1) , or heterocyclylene;
U is –O–, –S–, –S (O) –, –S (O2) –, -C (R5) 2-or –N (R5) –;
Z is C1-6 alkylene;
or, -U-Z is -CH=CH-;
R1 and R5 are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2- 6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R2 is halo, C1-6 haloalkyl, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl; wherein the halogen in C1-6 haloalkyl is Cl and/or Br;
R2’ is C2-6 alkenyl, or C2-6 alkynyl;
R6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R7a and R7b are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R7a and R7b together with  the N atom to which they are attached form heterocyclyl; and
R7b’ is C1-6 alkylene, C1-6 heteroalkylene, C2-6 alkenylene, C2-6 alkynylene, C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene; R7b’ is substituted with -L-A-R2’ ;
or R7a and R7b’ together with the N atom to which they are attached form heterocyclyl substituted with -L-A-R2’ ; and
each R1a, R1b, R1c, and R1d is independently hydrogen, deuterium, C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
wherein each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7- 15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa;
wherein each Qa is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg, –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached  form heterocyclyl.
Provided herein is a compound of Formula (I) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
A is –C (O) –, –S (O) –, or –S (O2) –;
E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene;
L is a bond, –N (R1) –, or heterocyclylene;
U is –O–, –S–, or –N (R5) –;
Z is C1-6 alkylene;
R1 and R5 are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2- 6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R2 is halo, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl;
R6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R7a and R7b are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R7a and R7b together with the N atom to which they are attached form heterocyclyl; and
each R1a, R1b, R1c, and R1d is independently hydrogen, deuterium, C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
wherein each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7- 15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa;
wherein each Qa is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg, –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached form heterocyclyl.
Also provided herein is a pharmaceutical composition comprising a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate,  hydrate, or prodrug thereof; and a pharmaceutically acceptable excipient.
Additionally, provided herein is a method of treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
Furthermore, provided herein is a method of treating, preventing, or ameliorating one or more symptoms of a proliferative disease in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
Provided herein is a method of inhibiting the growth of a cell, comprising contacting the cell with an effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
Provided herein is a method of inhibiting the activity of a DNMT1, comprising contacting the DNMT1 with an effective amount of a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
Detailed Description
To facilitate understanding of the disclosure set forth herein, a number of terms are defined below.
Generally, the nomenclature used herein and the laboratory procedures in organic chemistry, medicinal chemistry, biochemistry, biology, and pharmacology described herein are those well-known and commonly employed in the art. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.
The term “subject” refers to an animal, including, but not limited to, a primate (e.g., human) , cow, pig, sheep, goat, horse, dog, cat, rabbit, rat, or mouse. The terms “subject” and “patient” are used  interchangeably herein in reference, for example, to a mammalian subject, such as a human subject. In one embodiment, the subject is a human.
The terms “treat, ” “treating, ” and “treatment” are meant to include alleviating or abrogating a disorder, disease, or condition, or one or more of the symptoms associated with the disorder, disease, or condition; or alleviating or eradicating the cause (s) of the disorder, disease, or condition itself.
The terms “prevent, ” “preventing, ” and “prevention” are meant to include a method of delaying and/or precluding the onset of a disorder, disease, or condition, and/or its attendant symptoms; barring a subject from acquiring a disorder, disease, or condition; or reducing a subject’s risk of acquiring a disorder, disease, or condition.
The terms “alleviate” and “alleviating” refer to easing or reducing one or more symptoms (e.g., pain) of a disorder, disease, or condition. The terms can also refer to reducing adverse effects associated with an active ingredient. Sometimes, the beneficial effects that a subject derives from a prophylactic or therapeutic agent do not result in a cure of the disorder, disease, or condition.
The term “contacting” or “contact” is meant to refer to bringing together of a therapeutic agent and a biological molecule (e.g., a protein, enzyme, RNA, or DNA) , cell, or tissue such that a physiological and/or chemical effect takes place as a result of such contact. Contacting can take place in vitro, ex vivo, or in vivo. In one embodiment, a therapeutic agent is contacted with a biological molecule in vitro to determine the effect of the therapeutic agent on the biological molecule. In another embodiment, a therapeutic agent is contacted with a cell in cell culture (in vitro) to determine the effect of the therapeutic agent on the cell. In yet another embodiment, the contacting of a therapeutic agent with a biological molecule, cell, or tissue includes the administration of a therapeutic agent to a subject having the biological molecule, cell, or tissue to be contacted.
The term “therapeutically effective amount” or “effective amount” is meant to include the amount of a compound that, when administered, is sufficient to prevent development of, or alleviate to some extent, one or more of the symptoms of the disorder, disease, or condition being treated. The term “therapeutically effective amount” or “effective amount” also refers to the amount of a compound that is sufficient to elicit a biological or medical response of a biological molecule (e.g., a protein, enzyme, RNA, or DNA) , cell, tissue, system, animal, or human, which is being sought by a researcher, veterinarian, medical doctor, or clinician.
The term “IC50” or “EC50” refers to an amount, concentration, or dosage of a compound that is required for 50%inhibition of a maximal response in an assay that measures such a response.
The term “pharmaceutically acceptable carrier, ” “pharmaceutically acceptable excipient, ” “physiologically acceptable carrier, ” or “physiologically acceptable excipient” refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material. In one embodiment, each component is “pharmaceutically acceptable” in the sense of being compatible with the other ingredients of a pharmaceutical formulation, and suitable for use in contact with the tissue or organ of a subject (e.g., a human) without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, and commensurate with a reasonable benefit/risk ratio. See, e.g., Remington: The Science and Practice of Pharmacy, 23rd ed. ; Adejare Ed. ; Academic Press, 2020; Handbook of Pharmaceutical Excipients, 9th ed. ; Sheskey et al., Eds. ; Pharmaceutical Press, 2020; Handbook of Pharmaceutical Additives, 3rd ed. ; Ash and Ash Eds. ; Synapse Information Resources, 2007; Pharmaceutical Preformulation and Formulation, 2nd ed. ; Gibson Ed. ; CRC Press, 2009.
The term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within 1, 2, or 3 standard deviations. In certain embodiments, the term “about” or “approximately” means within 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, or 0.05%of a given value or range.
The term “alkyl” refers to a linear or branched saturated monovalent hydrocarbon radical, wherein the alkyl is optionally substituted with one or more substituents Q as described herein. For example, C1-6 alkyl refers to a linear saturated monovalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated monovalent hydrocarbon radical of 3 to 6 carbon atoms. In certain embodiments, the alkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C1-20) , 1 to 15 (C1-15) , 1 to 10 (C1-10) , or 1 to 6 (C1-6) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. As used herein, linear C1-6 and branched C3-6 alkyl groups are also referred as “lower alkyl. ” Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl (including all isomeric forms, e.g., n-propyl and isopropyl) , butyl (including all isomeric forms, e.g., n-butyl, isobutyl, sec-butyl, and t-butyl) , pentyl (including all isomeric forms, e.g., n-pentyl, isopentyl, sec-pentyl, neopentyl, and tert-pentyl) , and hexyl (including all isomeric forms, e.g., n-hexyl, isohexyl, and sec-hexyl) .
The terms “alkylene” and “alkanediyl” are used interchangeably herein in reference to a linear or branched saturated divalent hydrocarbon radical, wherein the alkanediyl is optionally be substituted with one or more substituents Q as described herein. For example, C1-6 alkanediyl refers to a linear saturated divalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated divalent hydrocarbon radical of 3 to 6 carbon atoms. In certain embodiments, the alkanediyl is a linear saturated divalent hydrocarbon radical that has 1 to 30 (C1-30) , 1 to 20 (C1-20) , 1 to 15 (C1-15) , 1 to 10 (C1-10) , or 1 to 6 (C1-6) carbon atoms, or branched saturated divalent  hydrocarbon radical of 3 to 30 (C3-30) , 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. As used herein, linear C1-6 and branched C3-6 alkanediyl groups are also referred as “lower alkanediyl. ” Examples of alkanediyl groups include, but are not limited to, methanediyl, ethanediyl (including all isomeric forms, e.g., ethane-1, 1-diyl and ethane-1, 2-diyl) , propanediyl (including all isomeric forms, e.g., propane-1, 1-diyl, propane-1, 2-diyl, and propane-1, 3-diyl) , butanediyl (including all isomeric forms, e.g., butane-1, 1-diyl, butane-1, 2-diyl, butane-1, 3-diyl, and butane-1, 4-diyl) , pentanediyl (including all isomeric forms, e.g., pentane-1, 1-diyl, pentane-1, 2-diyl, pentane-1, 3-diyl, and pentane-1, 5-diyl) , and hexanediyl (including all isomeric forms, e.g., hexane-1, 1-diyl, hexane-1, 2-diyl, hexane-1, 3-diyl, and hexane-1, 6-diyl) . Examples of substituted alkanediyl groups include, but are not limited to, –C (O) CH2–, –C (O) (CH2) 2–, –C (O) (CH2) 3–, –C (O) (CH2) 4–, –C (O) (CH2) 5–, –C (O) (CH2) 6–, –C (O) (CH2) 7–, –C (O) (CH2) 8–, –C (O) (CH2) 9–, –C (O) (CH2) 10–, –C (O) CH2C (O) –, –C (O) (CH2) 2C (O) –, –C (O) (CH2) 3C (O) –, –C (O) (CH2) 4C (O) –, or –C (O) (CH2) 5C (O) –.
The term “haloalkyl” refers to a monovalent alkyl group substituted with one or more halo groups. In certain embodiments, the haloalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C1-20) , 1 to 15 (C1-15) , 1 to 10 (C1-10) , or 1 to 6 (C1-6) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. In certain embodiments, the haloalkyl is optionally substituted with one or more substituents Q as described herein.
The term “heteroalkyl” refers to a linear or branched saturated monovalent hydrocarbon radical that contains one or more heteroatoms on its main chain, each independently selected from O, S, and N. The heteroalkyl is optionally substituted with one or more substituents Q as described herein. For example, C1-6 heteroalkyl refers to a linear saturated monovalent hydrocarbon radical of 1 to 6 carbon atoms or a branched saturated monovalent hydrocarbon radical of 3 to 6 carbon atoms. In certain embodiments, the heteroalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C1-20) , 1 to 15 (C1-15) , 1 to 10 (C1-10) , or 1 to 6 (C1-6) carbon atoms, or branched saturated monovalent hydrocarbon radical of 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. As used herein, linear C1-6 and branched C3-6 heteroalkyl groups are also referred as “lower heteroalkyl. ” Examples of heteroalkyl groups include, but are not limited to, –OCH3, –OCH2CH3, –CH2OCH3, –NHCH3, –ONHCH3, –NHOCH3, –SCH3, –CH2NHCH2CH3, and –NHCH2CH2CH3. Examples of substituted heteroalkyl groups include, but are not limited to, –CH2NHC (O) CH3 and –NHC (O) CH2CH3.
The term “haloheteroalkyl” refers to a monovalent heteroalkyl group substituted with one or more halo groups. In certain embodiments, the haloheteroalkyl is a linear saturated monovalent hydrocarbon radical that has 1 to 20 (C1-20) , 1 to 15 (C1-15) , 1 to 10 (C1-10) , or 1 to 6 (C1-6) carbon atoms, or branched saturated  monovalent hydrocarbon radical of 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. In certain embodiments, the haloheteroalkyl is optionally substituted with one or more substituents Q as described herein.
The term “alkenyl” refers to a linear or branched monovalent hydrocarbon radical, which contains one or more, in one embodiment, one, two, three, or four, in another embodiment, one, carbon-carbon double bond (s) . The alkenyl is optionally substituted with one or more substituents Q as described herein. The term “alkenyl” embraces radicals having a “cis” or “trans” configuration or a mixture thereof, or alternatively, a “Z” or “E” configuration or a mixture thereof, as appreciated by those of ordinary skill in the art. For example, C2-6 alkenyl refers to a linear unsaturated monovalent hydrocarbon radical of 2 to 6 carbon atoms or a branched unsaturated monovalent hydrocarbon radical of 3 to 6 carbon atoms. In certain embodiments, the alkenyl is a linear monovalent hydrocarbon radical of 2 to 20 (C2-20) , 2 to 15 (C2-15) , 2 to 10 (C2-10) , or 2 to 6 (C2-6) carbon atoms, or a branched monovalent hydrocarbon radical of 3 to 20 (C3-20) , 3 to 15 (C3-15) , 3 to 10 (C3-10) , or 3 to 6 (C3-6) carbon atoms. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl (including all isomeric forms, e.g., propen-1-yl, propen-2-yl, and allyl) , and butenyl (including all isomeric forms, e.g., buten-1-yl, buten-2-yl, buten-3-yl, and 2-buten-1-yl) .
The term “alkynyl” refers to a linear or branched monovalent hydrocarbon radical, which contains one or more, in one embodiment, one, two, three, or four, in another embodiment, one, carbon-carbon triple bond (s) . An alkynyl group does not contain a carbon-carbon double bond. The alkynyl is optionally substituted with one or more substituents Q as described herein. For example, C2-6 alkynyl refers to a linear unsaturated monovalent hydrocarbon radical of 2 to 6 carbon atoms or a branched unsaturated monovalent hydrocarbon radical of 4 to 6 carbon atoms. In certain embodiments, the alkynyl is a linear monovalent hydrocarbon radical of 2 to 20 (C2-20) , 2 to 15 (C2-15) , 2 to 10 (C2-10) , or 2 to 6 (C2-6) carbon atoms, or a branched monovalent hydrocarbon radical of 4 to 20 (C4-20) , 4 to 15 (C4-15) , 4 to 10 (C4-10) , or 4 to 6 (C4-6) carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl (–C≡CH) , propynyl (including all isomeric forms, e.g., 1-propynyl (–C≡CCH3) and propargyl (–CH2C≡CH) ) , butynyl (including all isomeric forms, e.g., 1-butyn-1-yl and 2-butyn-1-yl) , pentynyl (including all isomeric forms, e.g., 1-pentyn-1-yl and 1-methyl-2-butyn-1-yl) , and hexynyl (including all isomeric forms, e.g., 1-hexyn-1-yl and 2-hexyn-1-yl) .
The term “cycloalkyl” refers to a cyclic monovalent hydrocarbon radical, which is optionally substituted with one or more substituents Q as described herein. In one embodiment, the cycloalkyl is a saturated or unsaturated but non-aromatic, and/or bridged or non-bridged, and/or fused bicyclic group. In certain embodiments, the cycloalkyl has from 3 to 20 (C3-20) , from 3 to 15 (C3-15) , from 3 to 10 (C3-10) , or from 3 to 7 (C3-7) carbon atoms. In one embodiment, the cycloalkyl is monocyclic. In another embodiment, the cycloalkyl is bicyclic. In yet another embodiment, the cycloalkyl is tricyclic. In still another embodiment, the cycloalkyl  is polycyclic. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cycloheptenyl, bicyclo [1.1.1] pentyl, bicyclo [2.1.1] hexyl, bicyclo [2.2.1] heptyl, bicyclo [2.2.2] octyl, decalinyl, and adamantyl.
The terms “cycloalkylene” and “cycloalkanediyl” are used interchangeably herein in reference to a cyclic divalent hydrocarbon radical, which may be optionally substituted with one or more substituents Q as described herein. In one embodiment, cycloalkanediyl groups may be saturated or unsaturated but non-aromatic, and/or bridged, and/or non-bridged, and/or fused bicyclic groups. In certain embodiments, the cycloalkanediyl has from 3 to 30 (C3-30) , 3 to 20 (C3-20) , from 3 to 15 (C3-15) , from 3 to 10 (C3-10) , or from 3 to 7 (C3-7) carbon atoms. Examples of cycloalkanediyl groups include, but are not limited to, cyclopropanediyl (including all isomeric forms, e.g., cyclopropane-1, 1-diyl and cyclopropane-1, 2-diyl) , cyclobutanediyl (including all isomeric forms, e.g., cyclobutane-1, 1-diyl, cyclobutane-1, 2-diyl, and cyclobutane-1, 3-diyl) , cyclopentanediyl (including all isomeric forms, e.g., cyclopentane-1, 1-diyl, cyclopentane-1, 2-diyl, and cyclopentane-1, 3-diyl) , cyclohexanediyl (including all isomeric forms, e.g., cyclohexane-1, 1-diyl, cyclohexane-1, 2-diyl, cyclohexane-1, 3-diyl, and cyclohex-1, 4-diyl) , cycloheptanediyl (including all isomeric forms, e.g., cycloheptane-1, 1-diyl, cycloheptane-1, 2-diyl, cycloheptane-1, 3-diyl, and cycloheptane-1, 4-diyl) , decalinediyl (including all isomeric forms, e.g., decaline-1, 1-diyl, decaline-1, 2-diyl, and decaline-1, 8-diyl) , and adamantdiyl (including all isomeric forms, e.g., adamant-1, 2-diyl, adamant-1, 3-diyl, and adamant-1, 8-diyl) .
The term “aryl” refers to a monovalent monocyclic aromatic hydrocarbon radical and/or monovalent polycyclic aromatic hydrocarbon radical that contain at least one aromatic carbon ring. In certain embodiments, the aryl has from 6 to 20 (C6-20) , from 6 to 15 (C6-15) , or from 6 to 10 (C6-10) ring carbon atoms. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The aryl also refers to bicyclic or tricyclic carbon rings, where one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl) . In one embodiment, the aryl is monocyclic. In another embodiment, the aryl is bicyclic. In yet another embodiment, the aryl is tricyclic. In still another embodiment, the aryl is polycyclic. In certain embodiments, the aryl is optionally substituted with one or more substituents Q as described herein.
The terms “arylene” and “arenediyl” are used interchangeably herein in reference to a divalent monocyclic aromatic hydrocarbon radical or divalent polycyclic aromatic hydrocarbon radical that contains at least one aromatic hydrocarbon ring. In certain embodiments, the arylene has from 6 to 20 (C6-20) , from 6 to 15 (C6-15) , or from 6 to 10 (C6-10) ring atoms. Examples of arylene groups include, but are not limited to, phenylene (including all isomeric forms, e.g., phen-1, 2-diyl, phen-1, 3-diyl, and phen-1, 4-diyl) , naphthylene (including all isomeric forms, e.g., naphth-1, 2-diyl, naphth-1, 3-diyl, and naphth-1, 8-diyl) , fluorenylene (including all isomeric  forms, e.g., fluoren-1, 2-diyl, fluoren-1, 3-diyl, and fluoren-1, 8-diyl) , azulenylene (including all isomeric forms, e.g., azulen-1, 2-diyl, azulen-1, 3-diyl, and azulen-1, 8-diyl) , anthrylene (including all isomeric forms, e.g., anthr-1, 2-diyl, anthr-1, 3-diyl, and anthr-1, 8-diyl) , phenanthrylene (including all isomeric forms, e.g., phenanthr-1, 2-diyl, phenanthr-1, 3-diyl, and phenanthr-1, 8-diyl) , pyrenylene (including all isomeric forms, e.g., pyren-1, 2-diyl, pyren-1, 3-diyl, and pyren-1, 8-diyl) , biphenylene (including all isomeric forms, e.g., biphen-2, 3-diyl, biphen-3, 4’ -diyl, and biphen-4, 4’ -diyl) , and terphenylene (including all isomeric forms, e.g., terphen-2, 3-diyl, terphen-3, 4’ -diyl, and terphen-4, 4’ -diyl) . Arylene also refers to bicyclic or tricyclic carbon rings, where one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthylene (including all isomeric forms, e.g., dihydronaphth-1, 2-diyl and dihydronaphth-1, 8-diyl) , indenylene (including all isomeric forms, e.g., inden-1, 2-diyl, inden-1, 5-diyl, and inden-1, 7-diyl) , indanylene (including all isomeric forms, e.g., indan-1, 2-diyl, indan-1, 5-diyl, and indan-1, 7-diyl) , or tetrahydronaphthylene (tetralinylene) (including all isomeric forms, e.g., tetrahydronaphth-1, 2-diyl, tetrahydronaphth-1, 5-diyl, and tetrahydronaphth-1, 8-diyl) . In certain embodiments, arylene is optionally substituted with one or more substituents Q as described herein.
The term “aralkyl” or “arylalkyl” refers to a monovalent alkyl group substituted with one or more aryl groups. In certain embodiments, the aralkyl has from 7 to 30 (C7-30) , from 7 to 20 (C7-20) , or from 7 to 16 (C7-16) carbon atoms. Examples of aralkyl groups include, but are not limited to, benzyl, phenylethyl (including all isomeric forms, e.g., 1-phenylethyl and 2-phenylethyl) , and phenylpropyl (including all isomeric forms, e.g., 1-phenylpropyl, 2-phenylpropyl, and 3-phenylpropyl) . In certain embodiments, the aralkyl is optionally substituted with one or more substituents Q as described herein.
The term “aralkylene” or “arylalkylene” refers to a divalent alkyl group substituted with one or more aryl groups. In certain embodiments, the aralkylene has from 7 to 30 (C7-30) , from 7 to 20 (C7-20) , or from 7 to 16 (C7-16) carbon atoms. Examples of aralkylene groups include, but are not limited to, benzylene (including all isomeric forms, e.g., phenylmethdiyl) , phenylethylene (including all isomeric forms, e.g., 2-phenyl-ethan-1, 1-diyl and 2-phenyl-ethan-1, 2-diyl) , and phenylpropylene (including all isomeric forms, e.g., 3-phenyl-propan-1, 1-diyl, 3-phenyl-propan-1, 2-diyl, and 3-phenyl-propan-1, 3-diyl) . In certain embodiments, the aralkylene is optionally substituted with one or more substituents Q as described herein.
The term “heteroaryl” refers to a monovalent monocyclic aromatic group or monovalent polycyclic aromatic group that contain at least one aromatic ring, wherein at least one aromatic ring contains one or more heteroatoms, each independently selected from O, S, and N, in the ring. For a heteroaryl group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heteroaryl group is not bonded to the rest of a molecule through its nonaromatic heterocyclic ring. Each ring of a heteroaryl group can contain one or  two O atoms, one or two S atoms, and/or one to four N atoms; provided that the total number of heteroatoms in each ring is four or less and each ring contains at least one carbon atom. In certain embodiments, the heteroaryl has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms. In one embodiment, the heteroaryl is monocyclic. Examples of monocyclic heteroaryl groups include, but are not limited to, furanyl, imidazolyl, isothiazolyl, isoxazolyl, oxadiazolyl, oxazolyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolyl, thiadiazolyl, thiazolyl, thienyl, tetrazolyl, triazinyl, and triazolyl. In another embodiment, the heteroaryl is bicyclic. Examples of bicyclic heteroaryl groups include, but are not limited to, benzofuranyl, benzimidazolyl, benzoisoxazolyl, benzopyranyl, benzothiadiazolyl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, furopyrindyl (including all isomeric forms, e.g., furo [2, 3-b] pyridinyl, furo [2, 3-c] pyridinyl, furo [3, 2-b] -pyridinyl, furo [3, 2-c] pyridinyl, furo [3, 4-b] pyridinyl, and furo [3, 4-c] pyridinyl) , imidazopyridinyl (including all isomeric forms, e.g., imidazo [1, 2-a] pyridinyl, imidazo [4, 5-b] pyridinyl, and imidazo [4, 5-c] pyridinyl) , imidazothiazolyl (including all isomeric forms, e.g., imidazo [2, 1-b] -thiazolyl and imidazo [4, 5-d] thiazolyl) , indazolyl, indolizinyl, indolyl, isobenzofuranyl, isobenzothienyl (i.e., benzo [c] thienyl) , isoindolyl, isoquinolinyl, naphthyridinyl (including all isomeric forms, e.g., 1, 5-naphthyridinyl, 1, 6-naphthyridinyl, 1, 7-naphthyridinyl, and 1, 8-naphthyridinyl) , oxazolopyridinyl (including all isomeric forms, e.g., oxazolo [4, 5-b] pyridinyl, oxazolo [4, 5-c] -pyridinyl, oxazolo [5, 4-b] pyridinyl, and oxazolo [5, 4-c] pyridinyl) , phthalazinyl, pteridinyl, purinyl, pyrrolopyridyl (including all isomeric forms, e.g., pyrrolo [2, 3-b] pyridinyl, pyrrolo [2, 3-c] pyridinyl, pyrrolo [3, 2-b] pyridinyl, and pyrrolo [3, 2-c] pyridinyl) , quinolinyl, quinoxalinyl, quinazolinyl, thiadiazolopyrimidyl (including all isomeric forms, e.g., [1, 2, 5] thiadiazolo [3, 4-d] -pyrimidinyl and [1, 2, 3] thiadiazolo [4, 5-d] pyrimidinyl) , and thienopyridyl (including all isomeric forms, e.g., thieno [2, 3-b] pyridinyl, thieno [2, 3-c] pyridinyl, thieno [3, 2-b] pyridinyl, and thieno- [3, 2-c] pyridinyl) . In yet another embodiment, the heteroaryl is tricyclic. Examples of tricyclic heteroaryl groups include, but are not limited to, acridinyl, benzindolyl, carbazolyl, dibenzo-furanyl, perimidinyl, phenanthrolinyl, phenanthridinyl (including all isomeric forms, e.g., 1, 5-phenanthrolinyl, 1, 6-phenanthrolinyl, 1, 7-phenanthrolinyl, 1, 9-phenanthrolinyl, and 2, 10-phenanthrolinyl) , phenarsazinyl, phenazinyl, phenothiazinyl, phenoxazinyl, and xanthenyl. In certain embodiments, the heteroaryl is optionally substituted with one or more substituents Q as described herein.
The terms “heteroarylene” and “heteroarenediyl” are used interchangeably herein in reference to a divalent monocyclic aromatic group or divalent polycyclic aromatic group that contains at least one aromatic ring, wherein at least one aromatic ring contains one or more heteroatoms in the ring, each of which is independently selected from O, S, and N. For a heteroarylene group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heteroarylene group is not bonded to the rest of a molecule via its nonaromatic heterocyclic ring. Each ring of a heteroarylene group can contain one or two O atoms, one or two S atoms, and/or one to four N atoms, provided that the total number of heteroatoms in each ring is four or less and each ring contains at least one carbon atom. In certain embodiments, the heteroarylene has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms. Examples of monocyclic heteroarylene groups include, but are not limited to,  furandiyl, imidazoldiyl, isothiazoldiyl, isoxazoldiyl, oxadiazoldiyl, oxazoldiyl, pyrazindiyl, pyrazoldiyl, pyridazindiyl, pyridindiyl, pyrimidindiyl, pyrroldiyl, thiadiazoldiyl, thiazoldiyl, thiendiyl, tetrazoldiyl, triazinediyl, and triazoldiyl. Examples of bicyclic heteroarylene groups include, but are not limited to, benzofurandiyl, benzimidazoldiyl, benzoisoxazoldiyl, benzopyrandiyl, benzothiadiazoldiyl, benzothiazoldiyl, benzothiendiyl, benzotriazoldiyl, benzoxazoldiyl, furopyridindiyl (including all isomeric forms, e.g., furo [2, 3-b] pyridindiyl, furo [2, 3-c] pyridindiyl, furo [3, 2-b] pyridindiyl, furo [3, 2-c] -pyridindiyl, furo [3, 4-b] pyridindiyl, and furo [3, 4-c] pyridindiyl) , imidazopyridindiyl (including all isomeric forms, e.g., imidazo [1, 2-a] pyridindiyl, imidazo [4, 5-b] pyridindiyl, and imidazo [4, 5-c] -pyridindiyl) , imidazothiazoldiyl (including all isomeric forms, e.g., imidazo [2, 1-b] thiazoldiyl and imidazo [4, 5-d] thiazoldiyl) , indazoldiyl, indolizindiyl, indoldiyl, isobenzofurandiyl, isobenzothiendiyl (i.e., benzo [c] thiendiyl) , isoindoldiyl, isoquinolindiyl, naphthyridindiyl (including all isomeric forms, e.g., 1, 5-naphthyridindiyl, 1, 6-naphthyridindiyl, 1, 7-naph-thyridindiyl, and 1, 8-naphthyridindiyl) , oxazolopyridindiyl (including all isomeric forms, e.g., oxazolo [4, 5-b] pyridindiyl, oxazolo [4, 5-c] pyridindiyl, oxazolo [5, 4-b] pyridindiyl, and oxazolo [5, 4-c] pyridindiyl) , phthalazindiyl, pteridindiyl, purindiyl, pyrrolopyridindiyl (including all isomeric forms, e.g., pyrrolo [2, 3-b] pyridindiyl, pyrrolo [2, 3-c] pyridindiyl, pyrrolo [3, 2-b] -pyridindiyl, and pyrrolo [3, 2-c] pyridindiyl) , quinolindiyl, quinoxalindiyl, quinazolindiyl, thiadiazolopyrimidindiyl (including all isomeric forms, e.g., [1, 2, 5] thiadiazolo [3, 4-d] -pyrimidindiyl and [1, 2, 3] thiadiazolo [4, 5-d] pyrimidindiyl) , and thienopyridindiyl (including all isomeric forms, e.g., thieno [2, 3-b] pyridindiyl, thieno [2, 3-c] pyridindiyl, thieno [3, 2-b] pyridindiyl, and thieno [3, 2-c] pyridindiyl) . Examples of tricyclic heteroarylene groups include, but are not limited to, acridindiyl, benzindoldiyl, carbazoldiyl, dibenzofurandiyl, perimidindiyl, phenanthrolindiyl (including all isomeric forms, e.g., 1, 5-phenanthrolindiyl, 1, 6-phenanthrolindiyl, 1, 7-phenanthrolindiyl, 1, 9-phenanthrolindiyl, and 2, 10-phenanthrolindiyl) , phenanthridindiyl, phenarsazindiyl, phenazindiyl, phenothiazindiyl, phenoxazindiyl, and xanthendiyl. In certain embodiments, heteroarylene is optionally substituted with one or more substituents Q as described herein.
The term “heterocyclyl” or “heterocyclic” refers to a monovalent monocyclic non-aromatic ring system or monovalent polycyclic ring system that contains at least one non-aromatic ring, wherein one or more of the non-aromatic ring atoms are heteroatoms, each independently selected from O, S, and N; and the remaining ring atoms are carbon atoms. For a heterocyclyl group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heterocyclyl group is not bonded to the rest of a molecule through the heteroaromatic ring. In certain embodiments, the heterocyclyl or heterocyclic group has from 3 to 20, from 3 to 15, from 3 to 10, from 3 to 8, from 4 to 7, or from 5 to 6 ring atoms. In certain embodiments, the heterocyclyl is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may be fused or bridged, and in which nitrogen or sulfur atoms may be optionally oxidized, nitrogen atoms may be optionally quaternized, and some rings may be partially or fully saturated, or aromatic. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom which results in the creation of a stable compound. Examples of heterocyclyls  and heterocyclic groups include, but are not limited to, azepinyl, benzodioxanyl, benzodioxolyl, benzofuranonyl, chromanyl, decahydroisoquinolinyl, dihydrobenzofuranyl, dihydrobenzisothiazolyl, dihydrobenzisoxazinyl (including all isomeric forms, e.g., 1, 4-dihydrobenzo [d] [1, 3] oxazinyl, 3, 4-dihydrobenzo [c] [1, 2] -oxazinyl, and 3, 4-dihydrobenzo [d] [1, 2] oxazinyl) , dihydrobenzothienyl, dihydroisobenzofuranyl, dihydrobenzo [c] thienyl, dihydrofuryl, dihydroisoindolyl, dihydropyranyl, dihydropyrazolyl, dihydropyrazinyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dioxolanyl, 1, 4-dithianyl, furanonyl, imidazolidinyl, imidazolinyl, indolinyl, isochromanyl, isoindolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, oxazolidinonyl, oxazolidinyl, oxiranyl, piperazinyl, piperidinyl, 4-piperidonyl, pyrazolidinyl, pyrazolinyl, pyrrolidinyl, pyrrolinyl, quinuclidinyl, tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydropyranyl, tetrahydrothienyl, thiamorpholinyl, thiazolidinyl, thiochromanyl, tetrahydroquinolinyl, and 1, 3, 5-trithianyl. In certain embodiments, the heterocyclyl is optionally substituted with one or more substituents Q as described herein.
The term “heterocyclylene” refers to a divalent monocyclic non-aromatic ring system or divalent polycyclic ring system that contains at least one non-aromatic ring, wherein one or more of the non-aromatic ring atoms are heteroatoms independently selected from O, S, and N; and the remaining ring atoms are carbon atoms. For a heterocyclylene group containing a heteroaromatic ring and a nonaromatic heterocyclic ring, the heterocyclylene group has at least one bond to the rest of a molecule via its nonaromatic heterocyclic ring. In certain embodiments, the heterocyclylene group has from 3 to 20, from 3 to 15, from 3 to 10, from 3 to 8, from 4 to 7, or from 5 to 6 ring atoms. In certain embodiments, the heterocyclylene is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may be fused or bridged, and in which nitrogen or sulfur atoms may be optionally oxidized, nitrogen atoms may be optionally quaternized, and some rings may be partially or fully saturated, or aromatic. The heterocyclylene may be attached to the main structure at any heteroatom or carbon atom which results in the creation of a stable compound. Examples of such heterocyclylene groups include, but are not limited to, azepindiyl, benzodioxandiyl, benzodioxoldiyl, benzofuranondiyl, chromandiyl, decahydroisoquinolindiyl, dihydrobenzofurandiyl, dihydrobenzisothiazoldiyl, dihydrobenzisoxazindiyl (including all isomeric forms, e.g., 1, 4-dihydrobenzo [d] [1, 3] oxazindiyl, 3, 4-dihydrobenzo [c] [1, 2] oxazindiyl, and 3, 4-dihydrobenzo [d] [1, 2] oxazindiyl) , dihydrobenzothiendiyl, dihydroisobenzofurandiyl, dihydrobenzo [c] thiendiyl, dihydrofurdiyl, dihydroisoindoldiyl, dihydropyrandiyl, dihydro-pyrazoldiyl, dihydropyrazindiyl, dihydropyridindiyl, dihydropyrimidindiyl, dihydropyrroldiyl, dioxolandiyl, 1, 4-dithiandiyl, furanondiyl, imidazolidindiyl, imidazolindiyl, indolindiyl, isochromandiyl, isoindolindiyl, isothiazolidindiyl, isoxazolidindiyl, morpholindiyl, octahydro-indoldiyl, octahydroisoindoldiyl, oxazolidinondiyl, oxazolidindiyl, oxirandiyl, piperazindiyl, piperidindiyl, 4-piperidondiyl, pyrazolidindiyl, pyrazolindiyl, pyrrolidindiyl, pyrrolindiyl, quinuclidindiyl, tetrahydrofurdiyl, tetrahydroisoquinolindiyl, tetrahydropyrandiyl, tetrahydro-thiendiyl, thiamorpholindiyl, thiazolidindiyl, thiochromandiyl, tetrahydroquinolindiyl, and 1, 3, 5-trithiandiyl. In certain embodiments, the heterocyclylene is optionally substituted with one or more substituents Q as described  herein.
The term “halogen” , “halide, ” or “halo” refers to fluoro, chloro, bromo, and/or iodo.
The term “optionally substituted” is intended to mean that a group or substituent, such as an alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, or heterocyclylene group, may be substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, each of which is independently selected from, e.g., (a) deuterium (–D) , cyano (–CN) , halo, imino (=NH) , nitro (–NO2) , and oxo (=O) ; (b) C1-6 alkyl, C1- 6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa. As used herein, all groups that can be substituted are “optionally substituted. ” 
In one embodiment, each Qa is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg, –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached form heterocyclyl.
In certain embodiments, “optically active” and ” enantiomerically active” refer to a collection of molecules, which has an enantiomeric excess of no less than about 80%, no less than about 90%, no less than about 91%, no less than about 92%, no less than about 93%, no less than about 94%, no less than about 95%, no less than about 96%, no less than about 97%, no less than about 98%, no less than about 99%, no less than about 99.5%, or no less than about 99.8%. In certain embodiments, an optically active compound comprises about 95%or more of one enantiomer and about 5%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question. In certain embodiments, an optically active compound comprises about 98%or more of one enantiomer and about 2%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question. In certain embodiments, an optically active compound comprises about 99%or more of one enantiomer and about 1%or less of the other enantiomer based on the total weight of the enantiomeric mixture in question.
In describing an optically active compound, the prefixes R and S are used to denote the absolute configuration of the compound about its chiral center (s) . The (+) and (-) are used to denote the optical rotation of the compound, that is, the direction in which a plane of polarized light is rotated by the optically active compound. The (-) prefix indicates that the compound is levorotatory, that is, the compound rotates the plane of polarized light to the left or counterclockwise. The (+) prefix indicates that the compound is dextrorotatory, that is, the compound rotates the plane of polarized light to the right or clockwise. However, the sign of optical rotation, (+) and (-) , is not related to the absolute configuration of the compound, R and S.
The term “isotopically enriched” refers to a compound that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a compound. In certain embodiments, an isotopically enriched compound contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (1H) , deuterium (2H) , tritium (3H) , carbon-11 (11C) , carbon-12 (12C) , carbon-13 (13C) , carbon-14 (14C) , nitrogen-13 (13N) , nitrogen-14 (14N) , nitrogen-15 (15N) , oxygen-14 (14O) , oxygen-15 (15O) , oxygen-16 (16O) , oxygen-17 (17O) , oxygen-18 (18O) , fluorine-17 (17F) , fluorine-18 (18F) , phosphorus-31 (31P) , phosphorus-32 (32P) , phosphorus-33 (33P) , sulfur-32 (32S) , sulfur-33 (33S) , sulfur-34 (34S) , sulfur-35 (35S) , sulfur-36 (36S) , chlorine-35 (35Cl) , chlorine-36 (36Cl) , chlorine-37 (37Cl) , bromine-79 (79Br) , bromine-81 (81Br) , iodine-123 (123I) , iodine-125 (125I) , iodine-127 (127I) , iodine-129 (129I) , and iodine-131 (131I) . In certain embodiments, an isotopically enriched compound is in a stable form, that is, non-radioactive. In certain embodiments, an isotopically enriched compound contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (1H) , deuterium (2H) , carbon-12 (12C) , carbon-13 (13C) , nitrogen-14 (14N) , nitrogen-15 (15N) , oxygen-16 (16O) , oxygen-17 (17O) , oxygen-18 (18O) , fluorine-17 (17F) , phosphorus-31 (31P) , sulfur-32 (32S) , sulfur-33 (33S) , sulfur-34 (34S) , sulfur-36 (36S) , chlorine-35 (35Cl) , chlorine-37 (37Cl) , bromine-79 (79Br) , bromine-81 (81Br) , and iodine-127 (127I) . In certain embodiments, an isotopically enriched compound is in an unstable form, that is, radioactive. In certain embodiments, an isotopically enriched compound contains unnatural proportions of one or more  isotopes, including, but not limited to, tritium (3H) , carbon-11 (11C) , carbon-14 (14C) , nitrogen-13 (13N) , oxygen-14 (14O) , oxygen-15 (15O) , fluorine-18 (18F) , phosphorus-32 (32P) , phosphorus-33 (33P) , sulfur-35 (35S) , chlorine-36 (36Cl) , iodine-123 (123I) , iodine-125 (125I) , iodine-129 (129I) , and iodine-131 (131I) . It will be understood that, in a compound as provided herein, any hydrogen can be 2H, as example, or any carbon can be 13C, as example, or any nitrogen can be 15N, as example, or any oxygen can be 18O, as example, where feasible according to the judgment of one of ordinary skill in the art.
The term “isotopic enrichment” refers to the percentage of incorporation of a less prevalent isotope (e.g., D for deuterium or hydrogen-2) of an element at a given position in a molecule in the place of a more prevalent isotope (e.g., 1H for protium or hydrogen-1) of the element. As used herein, when an atom at a particular position in a molecule is designated as a particular less prevalent isotope, it is understood that the abundance of that isotope at that position is substantially greater than its natural abundance.
The term “isotopic enrichment factor” refers the ratio between the isotopic abundance in an isotopically enriched compound and the natural abundance of a specific isotope.
The term “hydrogen” or the symbol “H” refers to the composition of naturally occurring hydrogen isotopes, which include protium (1H) , deuterium (2H or D) , and tritium (3H) , in their natural abundances. Protium is the most common hydrogen isotope having a natural abundance of more than 99.98%. Deuterium is a less prevalent hydrogen isotope having a natural abundance of about 0.0156%.
The term “deuterium enrichment” refers to the percentage of incorporation of deuterium at a given position in a molecule in the place of hydrogen. For example, deuterium enrichment of 1%at a given position means that 1%of molecules in a given sample contain deuterium at the specified position. Because the naturally occurring distribution of deuterium is about 0.0156%on average, deuterium enrichment at any position in a compound synthesized using non-enriched starting materials is about 0.0156%on average. As used herein, when a particular position in an isotopically enriched compound is designated as having deuterium, it is understood that the abundance of deuterium at that position in the compound is substantially greater than its natural abundance (0.0156%) .
The term “carbon” or the symbol “C” refers to the composition of naturally occurring carbon isotopes, which include carbon-12 (12C) and carbon-13 (13C) in their natural abundances. Carbon-12 is the most common carbon isotope having a natural abundance of more than 98.89%. Carbon-13 is a less prevalent carbon isotope having a natural abundance of about 1.11%.
The term “carbon-13 enrichment” or “13C enrichment” refers to the percentage of incorporation of carbon-13 at a given position in a molecule in the place of carbon. For example, carbon-13 enrichment of 10% at a given position means that 10%of molecules in a given sample contain carbon-13 at the specified position. Because the naturally occurring distribution of carbon-13 is about 1.11%on average, carbon-13 enrichment at any position in a compound synthesized using non-enriched starting materials is about 1.11%on average. As used herein, when a particular position in an isotopically enriched compound is designated as having carbon-13, it is understood that the abundance of carbon-13 at that position in the compound is substantially greater than its natural abundance (1.11%) .
The terms “substantially pure” and “substantially homogeneous” mean, when referred to a substance, sufficiently homogeneous to appear free of readily detectable impurities as determined by a standard analytical method used by one of ordinary skill in the art, including, but not limited to, thin layer chromatography (TLC) , gel electrophoresis, high performance liquid chromatography (HPLC) , gas chromatography (GC) , nuclear magnetic resonance (NMR) , and mass spectrometry (MS) ; or sufficiently pure such that further purification would not detectably alter the physical, chemical, biological, and/or pharmacological properties, such as enzymatic and biological activities, of the substance. In certain embodiments, “substantially pure” or “substantially homogeneous” refers to a collection of molecules, wherein at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5%by weight of the molecules are a single compound, including a single enantiomer, a racemic mixture, or a mixture of enantiomers, as determined by standard analytical methods. As used herein, when an atom at a particular position in an isotopically enriched molecule is designated as a particular less prevalent isotope, a molecule that contains other than the designated isotope at the specified position is an impurity with respect to the isotopically enriched compound. Thus, for a deuterated compound that has an atom at a particular position designated as deuterium, a compound that contains a protium at the same position is an impurity.
The term “solvate” refers to a complex or aggregate formed by one or more molecules of a solute, e.g., a compound provided herein, and one or more molecules of a solvent, which are present in a stoichiometric or non-stoichiometric amount. Suitable solvents include, but are not limited to, water, methanol, ethanol, n-propanol, isopropanol, and acetic acid. In certain embodiments, the solvent is pharmaceutically acceptable. In one embodiment, the complex or aggregate is in a crystalline form. In another embodiment, the complex or aggregate is in a noncrystalline form. Where the solvent is water, the solvate is a hydrate. Examples of hydrates include, but are not limited to, a hemihydrate, monohydrate, dihydrate, trihydrate, tetrahydrate, and pentahydrate.
For a divalent group described herein, no orientation is implied by the direction in which the divalent group is presented. For example, unless a particular orientation is specified, the formula –C (O) NH–represents both –C (O) NH–and –NHC (O) –.
The phrase “an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more  diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof” has the same meaning as the phrase “ (i) an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant of the compound referenced therein; (ii) a pharmaceutically acceptable salt, solvate, hydrate, or prodrug of the compound referenced therein; or (iii) a pharmaceutically acceptable salt, solvate, hydrate, or prodrug of an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant of the compound referenced therein. ”
Compounds
In one embodiment, provided herein is a compound of Formula (I) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
A is –C (O) –, –S (O) –, or –S (O2) –;
E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene; wherein the C3-10 cycloalkylene, the C6-14 arylene, the C7-15 aralkylene, the heteroarylene, and the heterocyclylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, C1-6 alkoxy, and C1-6 haloalkyl;
L is a bond, N (R1) , or heterocyclylene;
R1 is hydrogen or C1-6 alkyl;
U is –O–, –S–, –S (O) –, –S (O2) –, -C (R5) 2-or –N (R5) –;
R5 is independently hydrogen or C1-6 alkyl;
Z is C1-6 alkylene; wherein the C1-6 alkylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, and –C (O) NRbRc;
or, -U-Z-is -CH=CH-;
R2 is halogen, C1-6 haloalkyl, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl; wherein the halogen in C1-6 haloalkyl is Cl and/or Br; wherein the C2-6 alkenyl, and the C2-6 alkynyl is optionally substituted with one, two, three, or four group (s) independently selected from halogen; and –NRbRc;
R6 is independently C1-6 alkyl, C1-6 heteroalkyl, C3-10 cycloalkyl or C6-14 aryl; wherein the C1-6 alkyl, the C1-6 heteroalkyl, and the C3-10 cycloalkyl is optionally substituted with one, two, three, or four halogen;
R7a is hydrogen, or C1-6 alkyl;
R7b is hydrogen, C1-6 alkyl, or C1-6 heteroalkyl; wherein the C1-6 alkyl, and the C1-6 heteroalkyl is optionally substituted with one, two, three, or four group (s) independently selected from oxo, and heterocyclyl;
or R7a and R7b together with the N atom to which they are attached form heterocyclyl, wherein the heterocyclyl is optionally substituted with one, two, three, or four Q, and Q is C1-6 alkyl, heterocyclyl, –NRbRc, –NHC (O) ORa, –NHC (O) Ra and –ORa; wherein C1-6 alkyl is optionally substituted with one, two, three, or four group (s) independently selected from –OH; and
wherein each Ra, Rb, Rc is independently (i) hydrogen or deuterium; or (ii) C1-6 alkyl optionally substituted with one –NH2.
In one embodiment, provided herein is a compound of Formula (I) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
A is –C (O) –, –S (O) –, or –S (O2) –;
E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene;
L is a bond, N (R1) , or heterocyclylene;
U is –O–, –S–, or –N (R5) –;
Z is C1-6 alkylene;
R1 and R5 are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2- 6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R2 is halo, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl;
R6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d,  –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R7a and R7b are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R7a and R7b together with the N atom to which they are attached form heterocyclyl; and
each R1a, R1b, R1c, and R1d is independently hydrogen, deuterium, C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
wherein each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7- 15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa;
wherein each Qa is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg,  –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached form heterocyclyl.
In certain embodiments, in Formula (I) , L is a bond. In certain embodiments, in Formula (I) , L is –N (R1) –, wherein R1 is as defined herein. In certain embodiments, in Formula (I) , L is –N (R1) –, wherein R1 is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in Formula (I) , L is –N (H) –. In certain embodiments, in Formula (I) , L is –N (CH3) –. In certain embodiments, in Formula (I) , L is heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 3-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 4-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 5-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is piperazindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , L is piperazin-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in Formula (I) , Z is C1-6 alkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , Z is methanediyl, ethanediyl, or propanediyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , Z is methanediyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , Z is methanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) , Z is methanediyl, fluoromethanediyl, difluoromethanediyl, aminocarbonylmethanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl.
In another embodiment, provided herein is a compound of Formula (II) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
R4a and R4b are each independently (i) hydrogen, deuterium, cyano, or halo; (ii) C1-6 alkyl, C1- 6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R4a and R4b together with the C atom to which they are attached form C3-10 cycloalkylene, optionally substituted with one or more substituents Q;
R1, R2, R6, R1a, R1b, R1c, R1d, R7a, R7b, A, E, and U are each as defined herein.
In certain embodiments, in Formula (I) or (II) , E is C3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is monocyclic C3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is cyclohexanediyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is cyclohexane-1, 4-diyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in Formula (I) or (II) , E is C6-14 arylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is phendiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is phendiyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C1-6 alkyl or C1-6 heteroalkyl, each further optionally substituted with one or more substituents Qa. In certain embodiments, in Formula (I) or (II) , E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently C1-6 alkyl or C1-6 heteroalkyl, each further optionally substituted with one or more substituents Qa. In certain embodiments, in Formula (I) or (II) , E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently fluoro, methyl, trifluoromethyl, or methoxy. In certain embodiments, in Formula (I) or (II) , E is phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methylphen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, or 2-methoxyphen-1, 4-diyl.
In certain embodiments, in Formula (I) or (II) , E is C7-15 aralkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is monocyclic C7-15 aralkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is phendiyl-methandiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is phen-1, 4-diylmethandiyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in Formula (I) or (II) , E is heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is monocyclic heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 5-or 6-membered heteroarylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 5-membered heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 6-membered heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is pyridindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is pyridin-2, 5-diyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in Formula (I) or (II) , E is heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 3-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 4-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 5-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 6-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 7-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is piperidindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is piperidin-1, 4-diyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is bicyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is bridged, fused, or spiro heteroarylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is bridged heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is fused heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is spiro heteroarylene,  optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 1, 2, 3, 4-tetrahydroquinolindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in Formula (I) or (II) , E is 1, 2, 3, 4-tetrahydroquinolin-1, 6-diyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in Formula (I) or (II) , E is cyclohexane-1, 4-diyl, phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methylphen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, 2-methoxyphen-1, 4-diyl, phen-1, 4-diylmethandiyl, pyridin-2, 5-diyl, piperidin-1, 4-diyl, or 1, 2, 3, 4-tetrahydro-quinolin-1, 6-diyl. In certain embodiments, in Formula (I) or (II) , E is phen-1, 4-diyl. In certain embodiments, in Formula (I) or (II) , E is pyridin-2, 5-diyl.
In yet another embodiment, provided herein is a compound of Formula (III) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
X is N or C (R3a) ;
each R3 is independently (i) deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
R3a is hydrogen or R3;
m is an integer of 0, 1, 2, or 3; and
each R1, R2, R6, R1a, R1b, R1c, R1d, R4a, R4b, R7a, R7b, A, and U is as defined herein.
In yet another embodiment, provided herein is a compound of Formula (IV) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, A, U, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (V) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, A, U, X, and m are each as defined herein.
In certain embodiments, in any one of Formulae (I) to (V) , A is –C (O) –or –S (O2) –. In certain embodiments, in any one of Formulae (I) to (V) , A is –C (O) –. In certain embodiments, in any one of Formulae (I) to (V) , A is –S (O2) –.
In certain embodiments, in any one of Formulae (I) to (V) , U is –S–or –N (R5) –, wherein R5 is as defined herein. In certain embodiments, in any one of Formulae (I) to (V) , U is –S–. In certain embodiments, in any one of Formulae (I) to (V) , U is –N (R5) –, wherein R5 is as defined herein. In certain embodiments, in any one of Formulae (I) to (V) , U is –N (R5) –, wherein R5 is hydrogen or C1-6 alkyl optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (V) , U is –N (R5) –, wherein R5 is hydrogen, methyl, or ethyl. In certain embodiments, in any one of Formulae (I) to (V) , U is –N (H) –or –N (CH3) –.
In yet another embodiment, provided herein is a compound of Formula (VI) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (VII) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (VIII) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (IX) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R2, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In certain embodiments, in any one of Formulae (I) to (IX) , R2 is (i) halo; or (ii) C1-6 haloalkyl or C1-6 haloheteroalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, in  any one of Formulae (I) to (IX) , R2 is halo. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is fluoro. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C1-6 haloalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is chloromethyl. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C1-6 haloheteroalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is (2-bromoethoxy) methyl.
In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C2-6 alkenyl or C2-6 alkynyl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl.
In certain embodiments, in any one of Formulae (I) to (IX) , R2 is C2-6 alkynyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethynyl or prop-1-ynyl. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is fluoro, chloromethyl, 2-bromoethoxymethyl, ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, (E) -3-piperidin-1-ylprop-1-enyl, ethynyl, or prop-1-ynyl. In certain embodiments, in any one of Formulae (I) to (IX) , R2 is ethenyl, 1-cyano-ethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, (E) -3-piperidin-1-ylprop-1-enyl, ethynyl, or prop-1-ynyl.
In yet another embodiment, provided herein is a compound of Formula (X) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
R2a, R2a, and R2c are each independently (i) hydrogen, deuterium, cyano, or halo; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q; and
R1, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (XI) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2a, R2a, R2c, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (XII) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2a, R2a, R2c, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (XIII) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2a, R2a, R2c, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is hydrogen, deuterium, cyano, or halo. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is deuterium. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is cyano. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is halo. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is fluoro. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is hydrogen, cyano, or fluoro.
In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is deuterium. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is C1- 6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –NR1bR1c; wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is C1-6 alkyl, optionally substituted with monocyclic heterocyclyl or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is C1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –NR1bR1c; wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally  substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2b is dimethylaminomethyl or piperidin-1-ylmethyl.
In certain embodiments, in any one of Formulae (X) to (XIII) , R2c is hydrogen or deuterium. In certain embodiments, in any one of Formulae (X) to (XIII) , R2c is hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R2c is deuterium.
In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is cyano; and R2b and R2c are each hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is halo; and R2b and R2c are each hydrogen. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a is fluoro; and R2b and R2c are each hydrogen.
In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –NR1bR1c; wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (X) to (XIII) , R2a and R2c are each hydrogen; and R2b is dimethylaminomethyl or piperidin-1-ylmethyl.
In yet another embodiment, provided herein is a compound of Formula (XIV) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q; and wherein R1, R3, R6, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (XV) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2d, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In yet another embodiment, provided herein is a compound of Formula (XVI) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2d, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In still another embodiment, provided herein is a compound of Formula (XVII) :
or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein R1, R3, R6, R2d, R4a, R4b, R7a, R7b, X, and m are each as defined herein.
In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is hydrogen. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is deuterium. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (XIV) to (XVII) , R2d is hydrogen or methyl.
In certain embodiments, in any one of Formulae (II) to (XVII) , R1 is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R1 is hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R1 is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R1 is methyl.
In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C1-6 alkyl, C1-6 heteroalkyl, C3-10 cycloalkyl, or C6-14 aryl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is methyl, ethyl, propyl, or butyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C1-6 heteroalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C1-6 alkoxy, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is methoxy or ethoxy. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is monocyclic C3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is C6-14 aryl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is phenyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is methyl, ethyl, 2, 2, 2-trifluoroethyl, butyl, cyclopropyl, cyclopentyl, methoxy, ethoxy, or phenyl. In certain embodiments, in any one of Formulae (I) to (XVII) , R6 is ethyl.
In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is (i) hydrogen, deuterium, or halo; (ii) C1-6 alkyl, optionally substituted with one or more substituents Q; or (iii) –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is deuterium. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is halo. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is methyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is –C (O) NH2. In certain embodiments, R4a is hydrogen, fluoro, methyl, or aminocarbonyl.
In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is (i) hydrogen, deuterium, or halo; (ii) C1-6 alkyl, optionally substituted with one or more substituents Q; or (iii) –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is deuterium. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is halo. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is methyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R4b is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, in any one of Formulae (II) to (XVII) , R4n is –C (O) NH2. In certain embodiments, R4b is hydrogen, fluoro, methyl, or aminocarbonyl.
In certain embodiments, in any one of Formulae (II) to (XVII) , R4a and R4b are each hydrogen. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is hydrogen and R4b is fluoro, methyl, aminocarbonyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is hydrogen and R4b is fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is hydrogen and R4b is methyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a is hydrogen and R4b is aminocarbonyl. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a and R4b are each fluoro. In certain embodiments, in any one of Formulae (II) to (XVII) , R4a and R4b are each methyl.
In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is hydrogen. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is methyl or ethyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is methyl. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a is ethyl.
In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is C1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –OR1a or –NR1bR1c; wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is C1-6 alkyl, optionally substituted with monocyclic heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is C1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1- 6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is ethyl or propyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is ethyl or propyl, each substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –OR1a or –NR1bR1c; wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is ethyl or propyl, each substituted with monocyclic heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is ethyl or propyl, each optionally substituted with 5-or 6-membered heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is ethyl or propyl, each optionally substituted with pyrrolin-1-yl, 2-methoxy, methylamino, dimethylamino, or diethylamino. In certain embodiments, in any one of Formulae (I) to (XVII) , R7b is hydrogen, methyl, dimethylaminocarbonylmethyl, 2-methoxyethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethylaminoethyl, 2-pyrrolin-1-ylethyl, or 3-dimethylaminopropyl.
In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 3-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 4-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 5-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 6-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 7-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form piperidin-1-yl, piperazin-1-yl, or 1, 4-diazepan-1-yl, each optionally substituted with one, two, or three substituents Q.
In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N  atom to which they are attached form bicyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form bridged, fused, or spiro heterocyclyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form bridged heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form fused heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 3, 5-fused heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexanyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexan-3-yl, optionally substituted with one, two, or three substituents Q. In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, in any one of Formulae (I) to (XVII) , R7a and R7b together with the N atom to which they are attached form 4-aminopiperidin-1-yl, 4-dimethyl-aminopiperidin-1-yl, 4-methylpiperazin-1-yl, 4-methyl-1, 4-diazepan-1-yl, 4- (2-hydroxyethyl) -1, 4-diazepan-1-yl, 6-amino-3-azabicyclo [3.1.0] hexan-3-yl, (1R, 5S, 6r) -6-amino-3-azabicyclo- [3.1.0] hexan-3-yl, (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl, 6-acetamido-3-aza-bicyclo [3.1.0] hexan-3-yl, (1R, 5S, 6r) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl, or (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl.
In certain embodiments, in any one of Formulae (III) to (XVII) , X is N. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R3a) , wherein R3a is as defined herein. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R3a) , wherein R3a is (i) halo; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, in any one of Formulae (III) to (XVII) , X is C (R3a) , wherein R3a is hydrogen, fluoro, methyl, trifluoromethyl, or methoxy.
In certain embodiments, in any one of Formulae (II) to (XVII) , m is an integer of 0.
The groups, R1, R2, R3, R5, R6, R2a, R2b, R2c, R2d, R3a, R4a, R4b, R7a, R7b, A, E, L, U, X, Z, and m in the formulae described herein, including Formulae (I) to (XVII) , are defined in the embodiments described herein. All combinations of the embodiments provided herein for such groups are within the scope of this disclosure.
In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R1 is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is trifluoromethyl. In certain embodiments, R1 is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R1 is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R1 is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R1 is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R1 is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R1 is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R1 is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R1 is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R1 is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R1 is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R1 is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R1 is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R1 is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R1 is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R2 is halo. In certain embodiments, R2 is fluoro. In certain embodiments, R2 is C1-6 haloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2 is chloromethyl. In certain embodiments, R2 is C1-6 haloheteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2 is (2-bromo-ethoxy) methyl. In certain embodiments, R2 is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R2 is ethenyl or propenyl, each optionally substituted with one,  two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, R2 is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl. In certain embodiments, R2 is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R2 is ethynyl or prop-1-ynyl.
In certain embodiments, R2’ is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R2’ is C2-6 alkenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R2’ is C2-6 alkenyl, optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, R2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently (i) cyano or halo; (ii) heterocyclyl, optionally substituted with one or more substituents Qa; or (iii) –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R2’ is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, wherein each substituent is independently cyano, fluoro, piperidin-1-yl, or dimethylamino. In certain embodiments, R2’ is ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, or (E) -3-piperidin-1-ylprop-1-enyl. In certain embodiments, R2’is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R2 is ethynyl or prop-1-ynyl.
In certain embodiments, R3 is deuterium. In certain embodiments, R3 is cyano. In certain embodiments, R3 is halo. In certain embodiments, R3 is fluoro or chloro. In certain embodiments, R3 is nitro. In certain embodiments, R3 is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R3 is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R3 is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined  herein. In certain embodiments, R3 is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –OR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –OC (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3 is –OC (S) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OC (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –OS (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OS (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –OS (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –OS (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –NR1aC (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (O) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3 is –NR1aC (O) SR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (NR1d) NR1bR1c, wherein R1a, R1b, R1c, and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (S) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (S) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aC (S) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3 is –NR1aS (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aS (O) 2R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3 is –NR1aS (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3 is –NR1aS (O) 2NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3 is –SR1a, wherein R1a is as defined herein. In certain embodiments, R3 is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R3 is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3 is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R5 is hydrogen. In certain embodiments, R5 is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is methyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is trifluoromethyl. In certain embodiments, R5 is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is C2-6 alkynyl, optionally  substituted with one or more substituents Q. In certain embodiments, R5 is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R5 is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R5 is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R5 is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R5 is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R5 is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R5 is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R5 is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R5 is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R5 is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R5 is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R5 is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R5 is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R5 is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is deuterium. In certain embodiments, R6 is cyano. In certain embodiments, R6 is halo. In certain embodiments, R6 is fluoro, chloro, or bromo. In certain embodiments, R6 is fluoro. In certain embodiments, R6 is chloro. In certain embodiments, R6 is bromo. In certain embodiments, R6 is nitro. In certain embodiments, R6 is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is methyl, ethyl, propyl, or butyl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is C1-6 alkoxy, optionally substituted with one, two, or three substituents Q. In certain embodiments, R6 is trifluoromethyl, 2, 2, 2-trifluoroethyl, methoxy, or ethoxy. In certain embodiments, R6 is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is C2-6 alkynyl, optionally substituted with one or more substituents Q.
In certain embodiments, R6 is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is monocyclic C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is bicyclic C4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is bridged, fused, or spiro C4-10 cycloalkyl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is bridged C4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is  fused C4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is spiro C4-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is C6- 14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is phenyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is bicyclic C8-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is monocyclic heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5-or 6-membered heteroaryl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5-membered heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 6-membered heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is bicyclic heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5, 5-, 5, 6-, or 6, 6-fused heteroaryl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5, 5-fused heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5, 6-fused heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 6, 6-fused heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is monocyclic heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is 3-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 4-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 5-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 6-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is 7-membered heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is bicyclic heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is bridged, fused, or spiro heterocyclyl, each optionally substituted with one or more substituents Q. In certain embodiments, R6 is bridged heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is fused heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R6 is spiro heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R6 is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –C (S) NR1bR1c, wherein R1b and  R1c are each as defined herein. In certain embodiments, R6 is –OR1a, wherein R1a is as defined herein. In certain embodiments, R6 is C1-6 alkoxy, optionally substituted with one or more substituents Q. In certain embodiments, R6 is methoxy or ethoxy. In certain embodiments, R6 is –OC (O) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OC (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OC (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –OC (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OC (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –OC (S) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OC (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OC (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –OS (O) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OS (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –OS (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –OS (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –NR1aC (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (O) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –NR1aC (O) SR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (NR1d) NR1bR1c, wherein R1a, R1b, R1c, and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (S) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (S) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aC (S) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –NR1aS (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aS (O) 2R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R6 is –NR1aS (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –NR1aS (O) 2NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R6 is –SR1a, wherein R1a is as defined herein. In certain embodiments, R6 is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R6 is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R6 is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R2a is hydrogen. In certain embodiments, R2a is deuterium. In certain embodiments, R2a is cyano. In certain embodiments, R2a is halo. In certain embodiments, R2a is fluoro. In certain embodiments, R2a is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2a is methyl. In certain embodiments, R2a is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2a is trifluoromethyl.
In certain embodiments, R2b is hydrogen. In certain embodiments, R2b is deuterium. In certain embodiments, R2b is cyano. In certain embodiments, R2b is halo. In certain embodiments, R2b is fluoro. In certain embodiments, R2b is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2b is C1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –NR1bR1c; wherein R1b and R1c are each as defined herein. In certain embodiments, R2b is C1-6 alkyl, optionally substituted with monocyclic heterocyclyl or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is C1-6 alkyl, optionally substituted with 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is C1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is methyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R2b is methyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –NR1bR1c; wherein R1b and R1c are each as defined herein. In certain embodiments, R2b is methyl, optionally substituted with monocyclic heterocyclyl or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is methyl, optionally substituted with 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is methyl, optionally substituted with 5-or 6-membered heterocyclyl, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R2b is dimethylaminomethyl or piperidin-1-ylmethyl. In certain embodiments, R2b is C1-6 heteroalkyl, optionally substituted with one or more substituents Q.
In certain embodiments, R2c is hydrogen. In certain embodiments, R2c is deuterium. In certain embodiments, R2c is cyano. In certain embodiments, R2c is halo. In certain embodiments, R2c is fluoro. In certain embodiments, R2c is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2c is methyl. In certain embodiments, R2c is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2c is trifluoromethyl.
In certain embodiments, R2d is hydrogen. In certain embodiments, R2d is deuterium. In certain embodiments, R2d is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2d is methyl, optionally substituted with one or more substituents Q. In certain embodiments, R2d is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R2d is trifluoromethyl.
In certain embodiments, R3a is hydrogen. In certain embodiments, R3a is deuterium. In certain embodiments, R3a is cyano. In certain embodiments, R3a is halo. In certain embodiments, R3a is fluoro. In  certain embodiments, R3a is nitro. In certain embodiments, R3a is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is methyl. In certain embodiments, R3a is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is C1-6 alkoxy, optionally substituted with one or more substituents Q. In certain embodiments, R3a is trifluoromethyl or methoxy. In certain embodiments, R3a is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R3a is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R3a is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –OR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –OC (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –OC (S) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OC (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –OS (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OS (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –OS (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –OS (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –NR1aC (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (O) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –NR1aC (O) SR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (NR1d) NR1bR1c, wherein R1a, R1b, R1c, and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (S) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (S) OR1d,  wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aC (S) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –NR1aS (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aS (O) 2R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R3a is –NR1aS (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –NR1aS (O) 2NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R3a is –SR1a, wherein R1a is as defined herein. In certain embodiments, R3a is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R3a is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R3a is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R4a is hydrogen. In certain embodiments, R4a is deuterium. In certain embodiments, R4a is cyano. In certain embodiments, R4a is halo. In certain embodiments, R4a is fluoro. In certain embodiments, R4a is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is methyl. In certain embodiments, R4a is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is monocyclic C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R4a is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R4a is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is aminocarbonyl. In certain embodiments, R4a is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –OR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –OC (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is – OC (S) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OC (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –OS (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OS (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –OS (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –OS (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –NR1aC (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (O) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is –NR1aC (O) SR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (NR1d) NR1bR1c, wherein R1a, R1b, R1c, and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (S) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (S) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aC (S) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is –NR1aS (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aS (O) 2R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4a is –NR1aS (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is –NR1aS (O) 2NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4a is –SR1a, wherein R1a is as defined herein. In certain embodiments, R4a is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R4a is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4a is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R4b is hydrogen. In certain embodiments, R4b is deuterium. In certain embodiments, R4b is cyano. In certain embodiments, R4b is halo. In certain embodiments, R4b is fluoro. In certain embodiments, R4b is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is methyl. In certain embodiments, R4b is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is monocyclic C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R4b is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R4b is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is aminocarbonyl. In certain embodiments, R4b is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –OR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –OC (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –OC (S) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OC (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –OS (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OS (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –OS (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –OS (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –NR1aC (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (O) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –NR1aC (O) SR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (NR1d) NR1bR1c, wherein R1a, R1b, R1c, and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (S) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (S) OR1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aC (S) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –NR1aS (O) R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aS (O) 2R1d, wherein R1a and R1d are each as defined herein. In certain embodiments, R4b is –NR1aS (O) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –NR1aS (O) 2NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R4b is –SR1a, wherein R1a is as defined herein. In certain embodiments, R4b is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R4b is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R4b is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R4a and R4b together with the C atom to which they are attached form  C3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, R4a and R4b together with the C atom to which they are attached form monocyclic C3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, R4a and R4b together with the C atom to which they are attached form cycloprop-1, 1-diyl, cyclobut-1, 1-diyl, or cyclopenta-1, 1-diyl, each optionally substituted with one or more substituents Q. In certain embodiments, R4a and R4b together with the C atom to which they are attached form bicyclic C4-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, R4a and R4b together with the C atom to which they are attached form bridged, fused, or spiro C4-10 cycloalkylene, each optionally substituted with one or more substituents Q.
In certain embodiments, R7a is hydrogen. In certain embodiments, R7a is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is methyl or ethyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is trifluoromethyl. In certain embodiments, R7a is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R7a is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R7a is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R7a is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R7a is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7a is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R7a is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R7a is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R7a is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R7a is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7a is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R7a is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R7a is –S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7a is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R7b is hydrogen. In certain embodiments, R7b is C1-6 alkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7b is C1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –OR1a or –NR1bR1c; wherein R1a,  R1b, and R1c are each as defined herein. In certain embodiments, R7b is C1-6 alkyl, optionally substituted with monocyclic heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which optionally substituted with one or more substituents Qa. In certain embodiments, R7b is C1-6 alkyl, optionally substituted with 5-or 6-membered heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R7b is ethyl or propyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R7b is ethyl or propyl, each substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –OR1a or –NR1bR1c; wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R7b is ethyl or propyl, each substituted with monocyclic heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R7b is ethyl or propyl, each optionally substituted with 5-or 6-membered heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa. In certain embodiments, R7b is ethyl or propyl, each optionally substituted with pyrrolin-1-yl, 2-methoxy, methylamino, dimethylamino, or diethylamino. In certain embodiments, R7b is hydrogen, methyl, ethyl, dimethylaminocarbonylmethyl, 2-methoxyethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethylaminoethyl, 2-pyrrolin-1-ylethyl, or 3-dimethylaminopropyl.
In certain embodiments, R7b’ is C1-6 alkylene. In certain embodiments, R7b’ is ethylidene.
In certain embodiments, R7b is C1-6 heteroalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C2-6 alkenyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C2-6 alkynyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C3-10 cycloalkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is C7-15 aralkyl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is heteroaryl, optionally substituted with one or more substituents Q. In certain embodiments, R7b is heterocyclyl, optionally substituted with one or more substituents Q.
In certain embodiments, R7b is –C (O) R1a, wherein R1a is as defined herein. In certain embodiments, R7b is –C (O) OR1a, wherein R1a is as defined herein. In certain embodiments, R7b is –C (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7b is –C (O) SR1a, wherein R1a is as defined herein. In certain embodiments, R7b is –C (NR1a) NR1bR1c, wherein R1a, R1b, and R1c are each as defined herein. In certain embodiments, R7b is –C (S) R1a, wherein R1a is as defined herein. In certain embodiments, R7b is –C (S) OR1a, wherein R1a is as defined herein. In certain embodiments, R7b is –C (S) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7b is –S (O) R1a, wherein R1a is as defined herein. In certain embodiments, R7b is –S (O) 2R1a, wherein R1a is as defined herein. In certain embodiments, R7b is – S (O) NR1bR1c, wherein R1b and R1c are each as defined herein. In certain embodiments, R7b is –S (O) 2NR1bR1c, wherein R1b and R1c are each as defined herein.
In certain embodiments, R7a and R7b together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 3-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 4-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 5-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 6-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 7-membered heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form piperidin-1-yl, piperazin-1-yl, or 1, 4-diazepan-1-yl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form 4-aminopiperidin-1-yl, 4-dimethylaminopiperidin-1-yl, 4-methylpiperazin-1-yl, 4-methyl-1, 4-diazepan-1-yl, or 4- (2-hydroxyethyl) -1, 4-diazepan-1-yl.
In certain embodiments, R7a and R7b’ together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b’ together with the N atom to which they are attached form 3-, 4-, 5-, 6-, or 7-membered heterocyclyl, each optionally substituted with one, two, or three substituents Q.
In certain embodiments, R7a and R7b together with the N atom to which they are attached form bicyclic heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form bridged, fused, or spiro heterocyclyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form bridged heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form fused heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they  are attached form 3, 5-fused heterocyclyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexanyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form azabicyclo [3.1.0] hexan-3-yl, optionally substituted with one, two, or three substituents Q. In certain embodiments, R7a and R7b together with the N atom to which they are attached form spiro heterocyclyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, A is –C (O) –. In certain embodiments, A is –S (O) –. In certain embodiments, A is –S (O2) –.
In certain embodiments, E is C3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is monocyclic C3-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is cyclopropanediyl, cyclobutanediyl, cyclopentanediyl, cyclohexanediyl, or cycloheptanediyl, each optionally substituted with one or more substituents Q. In certain embodiments, E is cyclohexanediyl, optionally substituted with one or more substituents Q. In certain embodiments, E is cyclcohexane-1, 4-diyl, optionally substituted with one or more substituents Q. In certain embodiments, E is bicyclic C4-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is bridged, fused, or spiro C4-10 cycloalkylene, each optionally substituted with one or more substituents Q. In certain embodiments, E is bridged C4-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is fused C4-10 cycloalkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is spiro C4-10 cycloalkylene, optionally substituted with one or more substituents Q.
In certain embodiments, E is C6-14 arylene, optionally substituted with one or more substituents Q. In certain embodiments, E is phendiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is phendiyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C1-6 alkyl or C1-6 heteroalkyl, each further optionally substituted with one or more substituents Qa. In certain embodiments, E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently C1-6 alkyl or C1-6 heteroalkyl, each further optionally substituted with one or more substituents Qa. In certain embodiments, E is phen-1, 3-diyl or phen-1, 4-diyl, each optionally substituted with one, two, or three substituents; wherein each substituent is independently fluoro, methyl, trifluoromethyl, or methoxy. In certain embodiments, E is phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methyl-phen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, or 2-methoxyphen-1, 4-diyl. In certain embodiments, E is bicyclic C8-14 arylene, optionally substituted with one, two, or three substituents Q.
In certain embodiments, E’ is C6-14 aryl, optionally substituted with one or more substituents Q. In certain embodiments, E’ is phenyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E’ is phenyl, optionally substituted with one, two, or three substituents; wherein each substituent is independently C1-6 alkyl or C1-6 heteroalkyl, each further optionally substituted with one or more substituents Qa.
In certain embodiments, E is C7-15 aralkylene, optionally substituted with one or more substituents Q. In certain embodiments, E is monocyclic C7-15 aralkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is phendiyl-methandiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is phen-1, 4-diylmethandiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is bicyclic C7-15 aralkylene, optionally substituted with one, two, or three substituents Q.
In certain embodiments, E is heteroarylene, optionally substituted with one or more substituents Q. In certain embodiments, E is monocyclic heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5-or 6-membered heteroarylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5-membered heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 6-membered heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is pyridindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is pyridin-2, 5-diyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is bicyclic heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5, 5-, 5, 6-, or 6, 6-fused heteroarylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5, 5-fused heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5, 6-fused heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 6, 6-fused heteroarylene, optionally substituted with one, two, or three substituents Q.
In certain embodiments, E is heterocyclylene, optionally substituted with one or more substituents Q. In certain embodiments, E is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5-or 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 5-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 6-membered heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is piperidindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is piperidin-1, 4-diyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is bicyclic heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E  is bridged, fused, or spiro heteroarylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, E is bridged heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is fused heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is spiro heteroarylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 1, 2, 3, 4-tetrahydroquinolindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, E is 1, 2, 3, 4-tetrahydroquinolin-1, 6-diyl, optionally substituted with one, two, or three substituents Q.
In certain embodiments, L is a bond. In certain embodiments, L is –N (R1) –, wherein R1 is as defined herein. In certain embodiments, L is –N (R1) –, wherein R1 is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, L is –N (H) –. In certain embodiments, L is –N (CH3) –. In certain embodiments, L is heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 3-, 4-, 5-, 6-, or 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 3-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 4-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 5-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 6-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is 7-membered heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is piperazindiyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is piperazin-1, 4-diyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is bicyclic heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is bridged, fused, or spiro heterocyclylene, each optionally substituted with one, two, or three substituents Q. In certain embodiments, L is bridged heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is fused heterocyclylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, L is spiro heterocyclylene, optionally substituted with one, two, or three substituents Q.
In certain embodiments, U is –O–. In certain embodiments, U is –S–. In certain embodiments, U is –N (R5) –, wherein R5 is as defined herein. In certain embodiments, U is –N (R5) –, wherein R5 is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q. In certain embodiments, U is –N (H) –or –N (CH3) –.
In certain embodiments, X is N. In certain embodiments, X is C (R3a) , wherein R3a is as defined herein. In certain embodiments, X is C (R3a) , wherein R3a is (i) halo; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each  optionally substituted with one or more substituents Q. In certain embodiments, X is C (H) , C (F) , C (CH3) , C (CF3) , or C (OCH3) .
In certain embodiments, Z is C1-6 alkylene, optionally substituted with one, two, or three substituents Q. In certain embodiments, Z is methanediyl, ethanediyl, or propanediyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, Z is methanediyl, optionally substituted with one, two, or three substituents Q. In certain embodiments, Z is methanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl, each optionally substituted with one, two, or three substituents Q. In certain embodiments, Z is methanediyl, fluoromethanediyl, difluoromethanediyl, aminocarbonylmethanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl.
In certain embodiments, m is an integer of 0. In certain embodiments, m is an integer of 1. In certain embodiments, m is an integer of 2. In certain embodiments, m is an integer of 3.
In certain embodiments, A is –C (O) –, or –S (O2) –.
In certain embodiments, E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene; wherein the C3-10 cycloalkylene, the C6-14 arylene, the C7-15 aralkylene, the heteroarylene, and the heterocyclylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, C1-6 alkoxy, and C1-6 haloalkyl.
In certain embodiments, E’ is C6-14 aryl.
In certain embodiments, Z is C1-6 alkylene; wherein the C1-6 alkylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, and –C (O) NRbRc.
In certain embodiments, R1 is hydrogen or C1-6 alkyl. In certain embodiments, R1 is hydrogen or -CH3.
In certain embodiments, R5 is independently hydrogen or C1-6 alkyl. In certain embodiments, R5 is independently hydrogen or -CH3.
In certain embodiments, R2 is halogen, C1-6 haloalkyl, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2- 6 alkynyl; wherein the halogen in C1-6 haloalkyl is Cl and/or Br; wherein the C2-6 alkenyl, and the C2-6 alkynyl is optionally substituted with one, two, three, or four group (s) independently selected from halogen; and –NRbRc.
In certain embodiments, R2’ is C2-6 alkenyl. In certain embodiments, R2’ is
In certain embodiments, R6 is independently C1-6 alkyl, C1-6 heteroalkyl, C3-10 cycloalkyl or C6- 14 aryl; wherein the C1-6 alkyl, the C1-6 heteroalkyl, and the C3-10 cycloalkyl is optionally substituted with one, two, three, or four halogen.
In certain embodiments, R7a is independently hydrogen, or C1-6 alkyl. In certain embodiments, R7a is independently -CH3.
In certain embodiments, R7b is hydrogen, C1-6 alkyl, or C1-6 heteroalkyl; wherein the C1-6 alkyl, and the C1-6 heteroalkyl is optionally substituted with one, two, three, or four group (s) independently selected from oxo, and heterocyclyl.
In certain embodiments, R7a and R7b together with the N atom to which they are attached form heterocyclyl, wherein the heterocyclyl is optionally substituted with one, two, three, or four Q, and Q is C1-6 alkyl, heterocyclyl, –NRbRc, –NHC (O) ORa, –NHC (O) Ra and –ORa; wherein C1-6 alkyl is optionally substituted with one, two, three, or four group (s) independently selected from –OH.
In certain embodiments, each Ra, Rb, Rc is independently (i) hydrogen or deuterium; or (ii) C1- 6 alkyl optionally substituted with one –NH2.
In certain embodiments, the heteroarylene in E is a heteroarylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heteroarylene in E is the a heteroarylene having 1 heteroatom selected from N.
In certain embodiments, the heteroarylene in E is a 5-12 membered heteroarylene, preferably the heteroarylene in E is a 5-6 membered heteroarylene.
In certain embodiments, the heterocyclylene in E is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O or S, preferably the heterocyclylene in E is a heterocyclylene having 1 heteroatom selected from N.
In certain embodiments, the heterocyclylene in E is a 5-12 membered heterocyclylene, preferably the heterocyclylene in E is a 5-6 membered heterocyclylene.
In certain embodiments, the heterocyclylene in L is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclylene in L is heterocyclylene having 2 heteroatoms selected from N.
In certain embodiments, the heterocyclylene in L is a 5-12 membered heterocyclylene, preferably the heterocyclylene in L is a 5-6 membered heterocyclylene.
In certain embodiments, the C1-6 haloheteroalkyl in the R2 is a C1-6 haloheteroalkyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 haloheteroalkyl in the R2 is a C1-6 haloheteroalkyl having 1 heteroatom selected from O.
In certain embodiments, the C1-6 heteroalkyl in the R6 is a C1-6 heteroalky having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 heteroalkyl in the R6 is a C1-6 heteroalky having 1 heteroatom selected from O.
In certain embodiments, the C1-6 heteroalkyl in the R7b is a C1-6 heteroalkyl, having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 heteroalkyl in the R7b is a C1-6 heteroalkyl having 2 heteroatoms selected from N, and O.
In certain embodiments, R7a and R7b together with the N atom to which they are attached form  a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably R7a and R7b together with the N atom to which they are attached form a heterocyclyl having 1 or 2 heteroatoms selected from N.
In certain embodiments, R7a and R7b together with the N atom to which they are attached form a 5-12 membered heterocyclyl, preferably R7a and R7b together with the N atom to which they are attached form a 5-membered heterocyclyl, 6-membered heterocyclyl, or 7-membered heterocyclyl.
In certain embodiments, the heterocyclyl in Q is a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclyl in Q is a heterocyclyl having having 1 heteroatom selected from N.
In certain embodiments, the heterocyclyl in Q is a 5-12 membered heterocyclyl, preferably the heterocyclyl in Q is a 5-6 membered heterocyclyl.
In certain embodiments, E is
“*” represents the position where E is connected with L.
In certain embodiments, E’ is
In certain embodiments, L is a bond, -N (CH3) -, -NH-, or
In certain embodiments, U is -S-, -S (O) -, -S (O2) -, -NH-, -CH2-, -O-, or -N (CH3) -.
In certain embodiments, Z is -CH2-, CH (CH3) -, -CH2CH2-, -C (CH3) 2-, -CHF-,  or -CF2-; preferably Z is -CH2-, -CH (CH3) -, -CH2CH2-.
In certain embodiments, R2 is-CH2Cl,  F,
In certain embodiments, R6 is methyl, ethyl, butyl, methoxy, ethoxy, phenyl,  or -CH2CF3; preferably R6 is methyl, ethyl, phenyl, or -CH2CF3.
In certain embodiments, -NR7aR7b is
In certain embodiments, -NR7aR7b’ is
In certain embodiments, is
is
In one embodiment, provided herein is:
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacrylamide A1;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A2;
2-chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A3;
1-chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylmethanesulfonamide A4;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylpropiolamide A5;
2- (2-bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A6;
(E) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -4- (dimethylamino) -N-methylbut-2-enamide A7;
(4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) -thio) methyl) phenyl) (methyl) sulfamoylfluoride A8;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A9;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) ethenesulfonamide A10;
2- (2-bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acetamide A11;
N- (3- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A12;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) benzyl) acrylamide A13;
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -phenyl) acrylamide A14;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4- (2-hydroxyethyl) -1, 4-diazepan-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A15;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -methyl) phenyl) acrylamide A16;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A17;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methylpiperazin-1-yl) pyridine-2-yl) thio) -methyl) phenyl) acrylamide A18;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A19;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A20;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-phenyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A21;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (ethyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A22;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (diethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A23;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) -2-oxoethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A24;
N- (4- (1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) ethyl) phenyl) acrylamide A25;
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) acrylamide A26;
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -acrylamide A27;
N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A28;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- ( (2-methoxyethyl) (methyl) amino) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A29;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A30;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A31;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A32;
2- ( (2- (1-acryloylpiperidin-4-yl) ethyl) thio) -6- ( (2- (dimethylamino) ethyl) (methyl) -amino) -4-ethylpyridine-3, 5-dicarbonitrile A33;
N- ( (1r, 4r) -4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) cyclohexyl) acrylamide A34;
2- ( (4- (4-acryloylpiperazin-1-yl) benzyl) thio) -6- ( (2- (dimethylamino) ethyl) - (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A35;
N- (4- ( ( (3, 5-dicyano-4-cyclopentyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A101;
N- (4- ( ( (4-butyl-3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A102;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A103;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A104;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A105;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A106;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A107;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (3- (dimethylamino) propyl) (methyl) -amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A108;
N- (4- ( ( (3, 5-dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A109;
N- (4- ( ( (3, 5-dicyano-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -4- (2, 2, 2-trifluoro-ethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A110;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A111;
N- (4- ( ( (3, 5-dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A112;
N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A113;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A114;
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A115;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A116;
N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A117;
N- (4- (2- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) acrylamide A118;
N- (4- (2- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) but-2-ynamide A119;
N- (4- (2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) acrylamide A120;
N- (4- (2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) but-2-ynamide A121;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2- (trifluoromethyl) phenyl) acrylamide A123;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A124;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methylphenyl) acrylamide A125;
N- (5- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) pyridin-2-yl) acrylamide A126;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A127;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A128;
N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A129;
2- ( ( (1-acryloyl-1, 2, 3, 4-tetrahydroquinolin-6-yl) methyl) thio) -6- ( (2- (dimethyl-amino) ethyl) (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A130;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A131;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A133;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) fluoromethyl) phenyl) acrylamide A134;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) difluoromethyl) phenyl) acrylamide A135;
N- (4- ( ( (6- (6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A136;
N- (4- ( ( (6- (6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A137;
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A138;
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A139;
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A140; or
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A141;
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A36;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A37;
Tert-butyl ( (1R, 5S, 6s) -3- (6- ( (4-acrylamidobenzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) -3-azabicyclo [3.1.0] hexan-6-yl) carbamate A38;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A39;
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A40;
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A41;
(E) -N- (4- (2- (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl)vinyl) phenyl) acrylamide A42;
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A43;
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) -2-fluoroacrylamide A44;
N- (4- ( ( (6- (4- (2-aminoacetamido) piperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A45;
N- (6- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) pyridin-3-yl) acrylamide A46;
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A47;
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2, 5-difluorophenyl) acrylamide A48;
N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A49;
N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) -2-fluoroacrylamide A50;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-hydroxypiperidin-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A51;
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A52
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A53;
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) oxy) methyl) phenyl) acrylamide A54;
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfinyl) methyl) phenyl) acrylamide A56;
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfonyl) methyl) phenyl) acrylamide A57;
(R) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58a;
(S) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58b;
2- ( (3, 5-Dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A59;
2- ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A60;
2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A61;
2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A62;
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A63;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A64;
N- (4- (1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) ethyl) -2-fluorophenyl) acrylamide A65;
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) but-2-ynamide A66;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) but-2-ynamide A67;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A68;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) amino) -2-oxoethyl) -2-fluorophenyl) acrylamide A69;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-fluorophenyl) acrylamide A70;
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4- (pyrrolidin-1-yl) piperidin-1-yl) pyridin-2-yl) oxy) methyl) phenyl) acrylamide A71;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A72;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A73;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methoxyphenyl) acrylamide A74;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A75;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A76;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A77;
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) -N-methylacrylamide A78;
N- (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (N-methylmethylsulfonamido) benzyl) thio) pyridin-2-yl) (methyl) amino) ethyl) -N-methylacrylamide A79;
N- (1- (6- ( (2-amino-2-oxo-1-phenylethyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) piperidin-4-yl) acrylamide A80; 2- ( (3, 5-dicyano-4-ethyl-6- (4- (vinylsulfonamido) piperidin-1-yl) pyridin-2-yl) thio) -2-phenylacetamide A81; or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
In certain embodiments, a compound provided herein is deuterium-enriched. In certain embodiments, a compound provided herein is carbon-13 enriched. In certain embodiments, a compound provided herein is carbon-14 enriched. In certain embodiments, a compound provided herein contains one or more less prevalent isotopes for other elements, including, but not limited to, 15N for nitrogen; 17O or 18O for oxygen, and 34S, 35S, or 36S for sulfur.
In certain embodiments, a compound provided herein has an isotopic enrichment factor of no less than about 5, no less than about 10, no less than about 20, no less than about 50, no less than about 100, no less than about 200, no less than about 500, no less than about 1, 000, no less than about 2, 000, no less than about 5,000, or no less than about 10, 000. In any events, however, an isotopic enrichment factor for a specified isotope is no greater than the maximum isotopic enrichment factor for the specified isotope, which is the isotopic enrichment factor when a compound at a given position is 100%enriched with the specified isotope. Thus, the maximum isotopic enrichment factor is different for different isotopes. The maximum isotopic enrichment factor is 6, 410 for deuterium and 90 for carbon-13.
In certain embodiments, a compound provided herein has a deuterium enrichment factor of no less than about 64 (about 1%deuterium enrichment) , no less than about 130 (about 2%deuterium enrichment) , no less than about 320 (about 5%deuterium enrichment) , no less than about 640 (about 10%deuterium enrichment) , no less than about 1,300 (about 20%deuterium enrichment) , no less than about 3,200 (about 50%deuterium enrichment) , no less than about 4,800 (about 75%deuterium enrichment) , no less than about 5,130 (about 80%deuterium enrichment) , no less than about 5, 450 (about 85%deuterium enrichment) , no less than about 5,770 (about 90%deuterium enrichment) , no less than about 6, 090 (about 95%deuterium enrichment) , no less than about 6,220 (about 97%deuterium enrichment) , no less than about 6,280 (about 98%deuterium enrichment) , no less than about 6, 350 (about 99%deuterium enrichment) , or no less than about 6, 380 (about 99.5%deuterium enrichment) . The deuterium enrichment can be determined using conventional analytical methods known to one of ordinary skill in the art, including mass spectrometry and nuclear magnetic resonance spectroscopy. In certain embodiments, at least one of the atoms of a compound provided herein, as specified as deuterium-enriched, has deuterium enrichment of no less than about 50%, no less than about 70%, no less than about 80%, no less than about 90%, or no less than about 98%.
In certain embodiments, a compound provided herein is isolated or purified. In certain  embodiments, a compound provided herein has a purity of at least about 90%, at least about 95%, at least about 98%, at least about 99%, or at least about 99.5%by weight.
The compounds provided herein are intended to encompass all possible stereoisomers unless a particular stereochemistry is specified. Where a compound provided herein contains an alkenyl group, the compound may exist as one or mixture of geometric cis/trans (or Z/E) isomers. Where structural isomers are interconvertible, the compound may exist as a single tautomer or a mixture of tautomers. This can take the form of proton tautomerism in the compound that contains, for example, an imino, keto, or oxime group; or so-called valence tautomerism in the compound that contains an aromatic moiety. It follows that a single compound may exhibit more than one type of isomerism.
A compound provided herein can be enantiomerically pure, such as a single enantiomer or a single diastereomer, or be stereoisomeric mixtures, such as a mixture of enantiomers, e.g., a racemic mixture of two enantiomers; or a mixture of two or more diastereomers. As such, one of ordinary skill in the art will recognize that administration of a compound in its (R) form is equivalent, for the compound that undergoes epimerization in vivo, to administration of the compound in its (S) form. Conventional techniques for the preparation/isolation of individual enantiomers include synthesis from a suitable optically pure precursor, asymmetric synthesis from achiral starting materials, or resolution of an enantiomeric mixture, for example, chiral chromatography, recrystallization, resolution, diastereomeric salt formation, or derivatization into diastereomeric adducts followed by separation.
When a compound provided herein contains an acidic or basic moiety, it can also be provided as a pharmaceutically acceptable salt. See, Berge et al., J. Pharm. Sci. 1977, 66, 1-19; Handbook of Pharmaceutical Salts: Properties, Selection, and Use, 2nd ed. ; Stahl and Wermuth Eds. ; John Wiley &Sons, 2011. In certain embodiments, a pharmaceutically acceptable salt of a compound provided herein is a solvate. In certain embodiments, a pharmaceutically acceptable salt of a compound provided herein is a hydrate.
Suitable acids for use in the preparation of pharmaceutically acceptable salts of a compound provided herein include, but are not limited to, acetic acid, 2, 2-dichloroacetic acid, acylated amino acids, adipic acid, alginic acid, ascorbic acid, L-aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, boric acid, (+) -camphoric acid, camphorsulfonic acid, (+) - (1S) -camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, cinnamic acid, citric acid, cyclamic acid, cyclohexanesulfamic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxy-ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, D-gluconic acid, D-glucuronic acid, L-glutamic acid, α-oxoglutaric acid, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, hydroiodic acid, (+) -L-lactic acid, (±) -DL-lactic acid, lactobionic acid, lauric acid, maleic acid, (-) -L-malic acid, malonic acid, (±) -DL-mandelic acid, methanesulfonic acid, naphthalene-2-sulfonic acid, naphthalene-1, 5-disulfonic acid, 1-hydroxy- 2-naphthoic acid, nicotinic acid, nitric acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, perchloric acid, phosphoric acid, L-pyroglutamic acid, saccharic acid, salicylic acid, 4-amino-salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, tannic acid, (+) -L-tartaric acid, thiocyanic acid, p-toluenesulfonic acid, undecylenic acid, and valeric acid.
Suitable bases for use in the preparation of pharmaceutically acceptable salts of a compound provided herein include, but are not limited to, inorganic bases, such as magnesium hydroxide, calcium hydroxide, potassium hydroxide, zinc hydroxide, or sodium hydroxide; and organic bases, such as primary, secondary, tertiary, and quaternary, aliphatic and aromatic amines, including, but not limited to, L-arginine, benethamine, benzathine, choline, deanol, diethanolamine, diethylamine, dimethylamine, dipropylamine, diisopropylamine, 2- (diethylamino) -ethanol, ethanolamine, ethylamine, ethylenediamine, isopropylamine, N-methyl-glucamine, hydrabamine, 1H-imidazole, L-lysine, morpholine, 4- (2-hydroxyethyl) -morpholine, methylamine, piperidine, piperazine, propylamine, pyrrolidine, 1- (2-hydroxyethyl) -pyrrolidine, pyridine, quinuclidine, quinoline, isoquinoline, triethanolamine, trimethylamine, triethylamine, N-methyl-D-glucamine, 2-amino-2- (hydroxymethyl) -1, 3-propanediol, and tromethamine.
A compound provided herein may also be provided as a prodrug, which is a functional derivative of the compound and is readily convertible into the parent compound in vivo. Prodrugs are often useful because, in some situations, they may be easier to administer than the parent compound. They may, for instance, be bioavailable by oral administration whereas the parent compound is not. The prodrug may also have enhanced solubility in pharmaceutical compositions over the parent compound. A prodrug may be converted into the parent drug by various mechanisms, including enzymatic processes and metabolic hydrolysis.
Pharmaceutical Compositions
In one embodiment, provided herein is a pharmaceutical composition, comprising a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; and a pharmaceutically acceptable excipient.
The pharmaceutical composition provided herein can be formulated in various dosage forms, including, but not limited to, dosage forms for oral, parenteral, and topical administration. The pharmaceutical composition can also be formulated as modified release dosage forms, including delayed-, extended-, prolonged-, sustained-, pulsatile-, controlled-, accelerated-, fast-, targeted-, programmed-release, and gastric retention dosage forms. These dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art. See, e.g., Remington: The Science and Practice of Pharmacy, supra; Modified-Release  Drug Delivery Technology, 2nd ed. ; Rathbone et al., Eds. ; Drugs and the Pharmaceutical Sciences 184; CRC Press: Boca Raton, FL, 2008.
In one embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for oral administration. In another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for parenteral administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for intravenous administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for intramuscular administration. In yet another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for subcutaneous administration. In still another embodiment, the pharmaceutical composition provided herein is formulated in a dosage form for topical administration.
The pharmaceutical composition provided herein can be provided in a unit-dosage form or multiple-dosage form. A unit-dosage form, as used herein, refers to physically discrete a unit suitable for administration to a subject, and packaged individually as is known in the art. Each unit-dose contains a predetermined quantity of an active ingredient (s) (e.g., a compound provided herein) sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical excipient (s) . Examples of a unit-dosage form include, but are not limited to, an ampoule, syringe, and individually packaged tablet and capsule. A unit-dosage form may be administered in fractions or multiples thereof. A multiple-dosage form is a plurality of identical unit-dosage forms packaged in a single container to be administered in a segregated unit-dosage form. Examples of a multiple-dosage form include, are not limited to, a vial, bottle of tablets or capsules, or bottle of pints or gallons.
The pharmaceutical composition provided herein can be administered at once or multiple times at intervals of time. It is understood that the precise dosage and duration of treatment may vary with the age, weight, and condition of the subject being treated, and may be determined empirically using known testing protocols or by extrapolation from in vivo or in vitro test or diagnostic data. It is further understood that for any particular individual, specific dosage regimens should be adjusted over time according to the subject’s need and the professional judgment of the person administering or supervising the administration of the pharmaceutical composition.
A. Oral Administration
The pharmaceutical composition provided herein for oral administration can be provided in solid, semisolid, or liquid dosage forms for oral administration. As used herein, oral administration also includes buccal, lingual, and sublingual administration. Suitable oral dosage forms include, but are not limited to, tablets, fastmelts, chewable tablets, capsules, pills, strips, troches, lozenges, pastilles, cachets, pellets, medicated  chewing gum, bulk powders, effervescent or non-effervescent powders or granules, oral mists, solutions, emulsions, suspensions, wafers, sprinkles, elixirs, and syrups. In addition to the active ingredient (s) , the pharmaceutical composition can contain one or more pharmaceutically acceptable carriers or excipients, including, but not limited to, binders, fillers, diluents, disintegrants, wetting agents, lubricants, glidants, coloring agents, dye-migration inhibitors, sweetening agents, flavoring agents, emulsifying agents, suspending and dispersing agents, preservatives, solvents, non-aqueous liquids, organic acids, and sources of carbon dioxide.
Binders or granulators impart cohesiveness to a tablet to ensure the tablet remaining intact after compression. Suitable binders or granulators include, but are not limited to, starches, such as corn starch, potato starch, and pre-gelatinized starch (e.g., STARCH) ; gelatin; sugars, such as sucrose, glucose, dextrose, molasses, and lactose; natural and synthetic gums, such as acacia, alginic acid, alginates, extract of Irish moss, Panwar gum, Ghatti gum, mucilage of isabgol husks, carboxymethylcellulose, methylcellulose, polyvinylpyrrolidone (PVP) , larch arabinogalactan, powdered tragacanth, and guar gum; celluloses, such as ethyl cellulose, cellulose acetate, carboxymethyl cellulose calcium, sodium carboxymethyl cellulose, methyl cellulose, hydroxyethylcellulose (HEC) , hydroxypropylcellulose (HPC) , hydroxypropyl methyl cellulose (HPMC) ; and microcrystalline celluloses, such asPH-101, PH-103, PH-105, andRC-581. Suitable fillers include, but are not limited to, talc, calcium carbonate, microcrystalline cellulose, powdered cellulose, dextrates, kaolin, mannitol, silicic acid, sorbitol, starch, and pre-gelatinized starch. The amount of a binder or filler in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art. The binder or filler may be present from about 50 to about 99%by weight in the pharmaceutical composition provided herein.
Suitable diluents include, but are not limited to, dicalcium phosphate, calcium sulfate, lactose, sorbitol, sucrose, inositol, cellulose, kaolin, mannitol, sodium chloride, dry starch, and powdered sugar. Certain diluents, such as mannitol, lactose, sorbitol, sucrose, and inositol, when present in sufficient quantity, can impart properties to some compressed tablets that permit disintegration in the mouth by chewing. Such compressed tablets can be used as chewable tablets. The amount of a diluent in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art.
Suitable disintegrants include, but are not limited to, agar; bentonite; celluloses, such as methylcellulose and carboxymethylcellulose; wood products; natural sponge; cation-exchange resins; alginic acid; gums, such as guar gum andHV; citrus pulp; cross-linked celluloses, such as croscarmellose; cross-linked polymers, such as crospovidone; cross-linked starches; calcium carbonate; microcrystalline cellulose, such as sodium starch glycolate; polacrilin potassium; starches, such as corn starch, potato starch, tapioca starch, and pre-gelatinized starch; clays; and algins. The amount of a disintegrant in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary  skill in the art. The pharmaceutical composition provided herein may contain from about 0.5 to about 15%or from about 1 to about 5%by weight of a disintegrant.
Suitable lubricants include, but are not limited to, calcium stearate; magnesium stearate; mineral oil; light mineral oil; glycerin; sorbitol; mannitol; glycols, such as glycerol behenate and polyethylene glycol (PEG) ; stearic acid; sodium lauryl sulfate; talc; hydrogenated vegetable oil, such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil; zinc stearate; ethyl oleate; ethyl laureate; agar; starch; lycopodium; and silica or silica gels, such as200 andThe amount of a lubricant in the pharmaceutical composition provided herein varies upon the type of formulation, and is readily discernible to those of ordinary skill in the art. The pharmaceutical compositions provided herein may contain about 0.1 to about 5%by weight of a lubricant.
Suitable glidants include, but are not limited to, colloidal silicon dioxide, and asbestos-free talc. Suitable coloring agents include, but are not limited to, any of the approved, certified, water soluble FD&C dyes, and water insoluble FD&C dyes suspended on alumina hydrate, and color lakes. A color lake is a combination by adsorption of a water-soluble dye to a hydrous oxide of a heavy metal, resulting in an insoluble form of the dye. Suitable flavoring agents include, but are not limited to, natural flavors extracted from plants, such as fruits, and synthetic blends of compounds which produce a pleasant taste sensation, such as peppermint and methyl salicylate. Suitable sweetening agents include, but are not limited to, sucrose, lactose, mannitol, syrups, glycerin, and artificial sweeteners, such as saccharin and aspartame. Suitable emulsifying agents include, but are not limited to, gelatin, acacia, tragacanth, bentonite, and surfactants, such as polyoxyethylene sorbitan monooleate (20) , polyoxyethylene sorbitan monooleate 80 (80) , and triethanolamine oleate. Suitable suspending and dispersing agents include, but are not limited to, sodium carboxy-methylcellulose, pectin, tragacanth, acacia, sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone. Suitable preservatives include, but are not limited to, glycerin, methyl and propylparaben, benzoic add, and sodium benzoate and alcohol. Suitable wetting agents include, but are not limited to, propylene glycol monostearate, sorbitan monooleate, diethylene glycol monolaurate, and polyoxyethylene lauryl ether. Suitable solvents include, but are not limited to, glycerin, sorbitol, ethyl alcohol, and syrup. Suitable non-aqueous liquids utilized in emulsions include, but are not limited to, mineral oil and cottonseed oil. Suitable organic acids include, but are not limited to, citric and tartaric acid. Suitable sources of carbon dioxide include, but are not limited to, sodium bicarbonate and sodium carbonate.
It should be understood that many carriers and excipients may serve several functions, even within the same formulation.
The pharmaceutical composition provided herein for oral administration can be provided as compressed tablets, tablet triturates, chewable lozenges, rapidly dissolving tablets, multiple compressed tablets,  or enteric-coating tablets, sugar-coated, or film-coated tablets. Enteric-coated tablets are compressed tablets coated with substances that resist the action of stomach acid but dissolve or disintegrate in the intestine, thus protecting the active ingredient (s) from the acidic environment of the stomach. Enteric-coatings include, but are not limited to, fatty acids, fats, phenyl salicylate, waxes, shellac, ammoniated shellac, and cellulose acetate phthalates. Sugar-coated tablets are compressed tablets surrounded by a sugar coating, which may be beneficial in covering up objectionable tastes or odors and in protecting the tablets from oxidation. Film-coated tablets are compressed tablets that are covered with a thin layer or film of a water-soluble material. Film coatings include, but are not limited to, hydroxyethylcellulose, sodium carboxymethylcellulose, polyethylene glycol 4000, and cellulose acetate phthalate. Film coating imparts the same general characteristics as sugar coating. Multiple compressed tablets are compressed tablets made by more than one compression cycle, including layered tablets, and press-coated or dry-coated tablets.
The tablet dosage forms can be prepared from an active ingredient (s) in powdered, crystalline, or granular forms, alone or in combination with one or more carriers or excipients described herein, including binders, disintegrants, controlled-release polymers, lubricants, diluents, and/or colorants. Flavoring and sweetening agents are especially useful in the formation of chewable tablets and lozenges.
The pharmaceutical composition provided herein for oral administration can be provided as soft or hard capsules, which can be made from gelatin, methylcellulose, starch, or calcium alginate. The hard gelatin capsule, also known as the dry-filled capsule (DFC) , consists of two sections, one slipping over the other, thus completely enclosing the active ingredient (s) . The soft elastic capsule (SEC) is a soft, globular shell, such as a gelatin shell, which is plasticized by the addition of glycerin, sorbitol, or a similar polyol. The soft gelatin shells may contain a preservative to prevent the growth of microorganisms. Suitable preservatives are those as described herein, including methyl-and propyl-parabens, and sorbic acid. The liquid, semisolid, and solid dosage forms provided herein may be encapsulated in a capsule. Suitable liquid and semisolid dosage forms include solutions and suspensions in propylene carbonate, vegetable oils, or triglycerides. Capsules containing such solutions can be prepared as described in U.S. Pat. Nos. 4,328,245; 4,409,239; and 4,410,545. The capsules may also be coated as known by those of skill in the art in order to modify or sustain dissolution of the active ingredient (s) .
The pharmaceutical composition provided herein for oral administration can be provided in liquid and semisolid dosage forms, including emulsions, solutions, suspensions, elixirs, and syrups. An emulsion is a two-phase system, in which one liquid is dispersed in the form of small globules throughout another liquid, which can be oil-in-water or water-in-oil. Emulsions may include a pharmaceutically acceptable non-aqueous liquid or solvent, emulsifying agent, and preservative. Suspensions may include a pharmaceutically acceptable suspending agent and preservative. Aqueous alcoholic solutions may include a pharmaceutically acceptable  acetal, such as a di (lower alkyl) acetal of a lower alkyl aldehyde, e.g., acetaldehyde diethyl acetal; and a water-miscible solvent having one or more hydroxyl groups, such as propylene glycol and ethanol. Elixirs are clear, sweetened, and hydroalcoholic solutions. Syrups are concentrated aqueous solutions of a sugar, for example, sucrose, and may also contain a preservative. For a liquid dosage form, for example, a solution in a polyethylene glycol may be diluted with a sufficient quantity of a pharmaceutically acceptable liquid carrier, e.g., water, to be measured conveniently for administration.
Other useful liquid and semisolid dosage forms include, but are not limited to, those containing an active ingredient (s) , and a dialkylated mono-or poly-alkylene glycol, including, 1, 2-dimethoxymethane, diglyme, triglyme, tetraglyme, polyethylene glycol-350-dimethyl ether, polyethylene glycol-550-dimethyl ether, polyethylene glycol-750-dimethyl ether, wherein 350, 550, and 750 refer to the approximate average molecular weight of the polyethylene glycol. These dosage forms can further comprise one or more antioxidants, such as butylated hydroxytoluene (BHT) , butylated hydroxyanisole (BHA) , propyl gallate, vitamin E, hydroquinone, hydroxycoumarins, ethanolamine, lecithin, cephalin, ascorbic acid, malic acid, sorbitol, phosphoric acid, bisulfite, sodium metabisulfite, thiodipropionic acid and its esters, and dithiocarbamates.
The pharmaceutical composition provided herein for oral administration can be also provided in the forms of liposomes, micelles, microspheres, or nanosystems. Micellar dosage forms can be prepared as described in U.S. Pat. No. 6,350,458.
The pharmaceutical composition provided herein for oral administration can be provided as non-effervescent or effervescent, granules and powders, to be reconstituted into a liquid dosage form. Pharmaceutically acceptable carriers and excipients used in the non-effervescent granules or powders may include diluents, sweeteners, and wetting agents. Pharmaceutically acceptable carriers and excipients used in the effervescent granules or powders may include organic acids and a source of carbon dioxide.
Coloring and flavoring agents can be used in all of the dosage forms described herein.
The pharmaceutical composition provided herein for oral administration can be formulated as immediate or modified release dosage forms, including delayed-, sustained, pulsed-, controlled, targeted-, and programmed-release forms.
B. Parenteral Administration
The pharmaceutical composition provided herein can be administered parenterally by injection, infusion, or implantation, for local or systemic administration. Parenteral administration, as used herein, include intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intraurethral, intrasternal, intracranial, intramuscular, intrasynovial, intravesical, and subcutaneous administration.
The pharmaceutical composition provided herein for parenteral administration can be formulated in any dosage forms that are suitable for parenteral administration, including, but not limited to, solutions, suspensions, emulsions, micelles, liposomes, microspheres, nanosystems, and solid forms suitable for solutions or suspensions in liquid prior to injection. Such dosage forms can be prepared according to conventional methods known to those skilled in the art of pharmaceutical science. See, e.g., Remington: The Science and Practice of Pharmacy, supra.
The pharmaceutical composition provided herein for parenteral administration can include one or more pharmaceutically acceptable carriers and excipients, including, but not limited to, aqueous vehicles, water-miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives against the growth of microorganisms, stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emulsifying agents, complexing agents, sequestering or chelating agents, cryoprotectants, lyoprotectants, thickening agents, pH adjusting agents, and inert gases.
Suitable aqueous vehicles include, but are not limited to, water, saline, physiological saline or phosphate buffered saline (PBS) , sodium chloride injection, Ringer’s injection, isotonic dextrose injection, sterile water injection, dextrose and lactated Ringer’s injection. Suitable non-aqueous vehicles include, but are not limited to, fixed oils of vegetable origin, castor oil, corn oil, cottonseed oil, olive oil, peanut oil, peppermint oil, safflower oil, sesame oil, soybean oil, hydrogenated vegetable oils, hydrogenated soybean oil, and medium-chain triglycerides of coconut oil, and palm seed oil. Suitable water-miscible vehicles include, but are not limited to, ethanol, 1, 3-butanediol, liquid polyethylene glycol (e.g., polyethylene glycol 300 and polyethylene glycol 400) , propylene glycol, glycerin, N-methyl-2-pyrrolidone, N, N-dimethylacetamide, and dimethyl sulfoxide.
Suitable antimicrobial agents or preservatives include, but are not limited to, phenols, cresols, mercurials, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoates, thimerosal, benzalkonium chloride (e.g., benzethonium chloride) , methyl-and propyl-parabens, and sorbic acid. Suitable isotonic agents include, but are not limited to, sodium chloride, glycerin, and dextrose. Suitable buffering agents include, but are not limited to, phosphate and citrate. Suitable antioxidants include those described herein, such as bisulfite and sodium metabisulfite. Suitable local anesthetics include, but are not limited to, procaine hydrochloride. Suitable suspending and dispersing agents include those described herein, such as sodium carboxymethylcellulose, hydroxypropyl methylcellulose, and polyvinylpyrrolidone. Suitable emulsifying agents include those described herein, such as polyoxyethylene sorbitan monolaurate, polyoxyethylene sorbitan monooleate 80, and triethanolamine oleate. Suitable sequestering or chelating agents include, but are not limited to, EDTA. Suitable pH adjusting agents include, but are not limited to, sodium hydroxide, hydrochloric acid, citric acid, and lactic acid. Suitable complexing agents include, but are not limited to, cyclodextrins, including α-cyclodextrin, β-cyclodextrin, hydroxypropyl-β-cyclodextrin, sulfobutylether-β-cyclodextrin, and  sulfobutylether 7-β-cyclodextrin
When the pharmaceutical composition provided herein is formulated for multiple dosage administration, multiple dosage parenteral formulations must contain an antimicrobial agent at bacteriostatic or fungistatic concentrations. All parenteral formulations must be sterile, as known and practiced in the art.
In one embodiment, the pharmaceutical composition for parenteral administration is provided as a ready-to-use sterile solution. In another embodiment, the pharmaceutical composition is provided as a sterile dry soluble product, including a lyophilized powder and hypodermic tablet, to be reconstituted with a vehicle prior to use. In yet another embodiment, the pharmaceutical composition is provided as a ready-to-use sterile suspension. In yet another embodiment, the pharmaceutical composition is provided as a sterile dry insoluble product to be reconstituted with a vehicle prior to use. In still another embodiment, the pharmaceutical composition is provided as a ready-to-use sterile emulsion.
The pharmaceutical composition provided herein for parenteral administration can be formulated as immediate or modified release dosage forms, including delayed-, sustained, pulsed-, controlled, targeted-, and programmed-release forms.
The pharmaceutical composition provided herein for parenteral administration can be formulated as a suspension, solid, semi-solid, or thixotropic liquid, for administration as an implanted depot. In one embodiment, the pharmaceutical composition provided herein are dispersed in a solid inner matrix, which is surrounded by an outer polymeric membrane that is insoluble in body fluids but allows the active ingredient (s) in the pharmaceutical composition to diffuse through.
Suitable inner matrixes include, but are not limited to, polymethylmethacrylate, polybutylmethacrylate, plasticized or unplasticized polyvinylchloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, polyisoprene, polyisobutylene, polybutadiene, polyethylene, ethylene-vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, silicone carbonate copolymers, hydrophilic polymers (such as hydrogels of esters of acrylic and methacrylic acid) , collagen, cross-linked polyvinyl alcohol, and cross-linked partially hydrolyzed polyvinyl acetate.
Suitable outer polymeric membranes include, but are not limited to, polyethylene, polypropylene, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, ethylene/vinyl acetate copolymers, silicone rubbers, polydimethylsiloxanes, neoprene rubber, chlorinated polyethylene, polyvinylchloride, vinyl chloride copolymers with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubber epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl alcohol terpolymer, and ethylene/vinyloxyethanol copolymer.
C. Topical Administration
The pharmaceutical composition provided herein can be administered topically to the skin, orifices, or mucosa. The topical administration, as used herein, includes (intra) dermal, conjunctival, intracorneal, intraocular, ophthalmic, auricular, transdermal, nasal, vaginal, urethral, respiratory, and rectal administration.
The pharmaceutical composition provided herein can be formulated in any dosage forms that are suitable for topical administration for local or systemic effect, including, but not limited to, emulsions, solutions, suspensions, creams, gels, hydrogels, ointments, dusting powders, dressings, elixirs, lotions, suspensions, tinctures, pastes, foams, films, aerosols, irrigations, sprays, suppositories, bandages, and dermal patches. The topical formulations of the pharmaceutical composition provided herein can also comprise liposomes, micelles, microspheres, and nanosystems.
Pharmaceutically acceptable carriers and excipients suitable for use in the topical formulations include, but are not limited to, aqueous vehicles, water-miscible vehicles, non-aqueous vehicles, antimicrobial agents or preservatives against the growth of microorganisms, stabilizers, solubility enhancers, isotonic agents, buffering agents, antioxidants, local anesthetics, suspending and dispersing agents, wetting or emulsifying agents, complexing agents, sequestering or chelating agents, penetration enhancers, cryoprotectants, lyoprotectants, thickening agents, and inert gases.
The pharmaceutical composition can also be administered topically by electroporation, iontophoresis, phonophoresis, sonophoresis, or microneedle or needle-free injection, such as POWDERJECTTM and BIOJECTTM.
The pharmaceutical composition provided herein can be provided in the forms of ointments, creams, and gels. Suitable ointment vehicles include oleaginous or hydrocarbon vehicles, including lard, benzoinated lard, olive oil, cottonseed oil, and other oils, white petrolatum; emulsifiable or absorption vehicles, such as hydrophilic petrolatum, hydroxystearin sulfate, and anhydrous lanolin; water-removable vehicles, such as hydrophilic ointment; water-soluble ointment vehicles, including polyethylene glycols of varying molecular weight; emulsion vehicles, either water-in-oil (W/O) emulsions or oil-in-water (O/W) emulsions, including cetyl alcohol, glyceryl monostearate, lanolin, and stearic acid. See, e.g., Remington: The Science and Practice of Pharmacy, supra. These vehicles are emollient but generally require addition of antioxidants and preservatives.
Suitable cream base can be oil-in-water or water-in-oil. Suitable cream vehicles may be water-washable, and contain an oil phase, an emulsifier, and an aqueous phase. The oil phase is also called the “internal” phase, which is generally comprised of petrolatum and a fatty alcohol such as cetyl or stearyl alcohol. The aqueous phase usually, although not necessarily, exceeds the oil phase in volume, and generally contains a  humectant. The emulsifier in a cream formulation may be a nonionic, anionic, cationic, or amphoteric surfactant.
Gels are semisolid, suspension-type systems. Single-phase gels contain organic macromolecules distributed substantially uniformly throughout the liquid carrier. Suitable gelling agents include, but are not limited to, crosslinked acrylic acid polymers, such as carbomers, carboxypolyalkylenes, and hydrophilic polymers, such as polyethylene oxides, polyoxyethylene-polyoxypropylene copolymers, and polyvinylalcohol; cellulosic polymers, such as hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and methylcellulose; gums, such as tragacanth and xanthan gum; sodium alginate; and gelatin. In order to prepare a uniform gel, dispersing agents such as alcohol or glycerin can be added, or the gelling agent can be dispersed by trituration, mechanical mixing, and/or stirring.
The pharmaceutical composition provided herein can be administered rectally, urethrally, vaginally, or perivaginally in the forms of suppositories, pessaries, bougies, poultices or cataplasm, pastes, powders, dressings, creams, plasters, contraceptives, ointments, solutions, emulsions, suspensions, tampons, gels, foams, sprays, or enemas. These dosage forms can be manufactured using conventional processes as described in Remington: The Science and Practice of Pharmacy, supra.
Rectal, urethral, and vaginal suppositories are solid bodies for insertion into body orifices, which are solid at ordinary temperatures but melt or soften at body temperature to release the active ingredient (s) inside the orifices. Pharmaceutically acceptable carriers utilized in rectal and vaginal suppositories include bases or vehicles, such as stiffening agents, which produce a melting point in the proximity of body temperature, when formulated with an active ingredient (s) ; and antioxidants as described herein, including bisulfite and sodium metabisulfite. Suitable vehicles include, but are not limited to, cocoa butter (theobroma oil) , glycerin-gelatin, carbowax (polyoxyethylene glycol) , spermaceti, paraffin, white and yellow wax, and appropriate mixtures of mono-, di-and triglycerides of fatty acids, and hydrogels, such as polyvinyl alcohol, hydroxyethyl methacrylate, and polyacrylic acid. Combinations of the various vehicles can also be used. Rectal and vaginal suppositories may be prepared by compressing or molding. The typical weight of a rectal and vaginal suppository is about 2 to about 3 g.
The pharmaceutical composition provided herein can be administered ophthalmically in the forms of solutions, suspensions, ointments, emulsions, gel-forming solutions, powders for solutions, gels, ocular inserts, and implants.
The pharmaceutical composition provided herein can be administered intranasally or by inhalation to the respiratory tract. The pharmaceutical composition can be provided in the form of an aerosol or solution for delivery using a pressurized container, pump, spray, atomizer, such as an atomizer using  electrohydrodynamics to produce a fine mist, or nebulizer, alone or in combination with a suitable propellant, such as 1, 1, 1, 2-tetrafluoroethane or 1, 1, 1, 2, 3, 3, 3-hepta-fluoropropane. The pharmaceutical composition can also be provided as a dry powder for insufflation, alone or in combination with an inert carrier such as lactose or phospholipids; and nasal drops. For intranasal use, the powder can comprise a bioadhesive agent, including chitosan or cyclodextrin.
Solutions or suspensions for use in a pressurized container, pump, spray, atomizer, or nebulizer can be formulated to contain ethanol, aqueous ethanol, or a suitable alternative agent for dispersing, solubilizing, or extending release of an active ingredient (s) ; a propellant as solvent; and/or a surfactant, such as sorbitan trioleate, oleic acid, or an oligolactic acid.
The pharmaceutical composition provided herein can be micronized to a size suitable for delivery by inhalation, such as about 50 micrometers or less, or about 10 micrometers or less. Particles of such sizes can be prepared using a comminuting method known to those skilled in the art, such as spiral jet milling, fluid bed jet milling, supercritical fluid processing to form nanoparticles, high pressure homogenization, or spray drying.
Capsules, blisters, and cartridges for use in an inhaler or insufflator can be formulated to contain a powder mix of the pharmaceutical composition provided herein; a suitable powder base, such as lactose or starch; and a performance modifier, such as l-leucine, mannitol, or magnesium stearate. The lactose may be anhydrous or in the form of the monohydrate. Other suitable excipients or carriers include, but are not limited to, dextran, glucose, maltose, sorbitol, xylitol, fructose, sucrose, and trehalose. The pharmaceutical composition provided herein for inhaled/intranasal administration can further comprise a suitable flavor, such as menthol and levomenthol; and/or sweeteners, such as saccharin and saccharin sodium.
The pharmaceutical composition provided herein for topical administration can be formulated to be immediate release or modified release, including delayed-, sustained-, pulsed-, controlled-, targeted, and programmed release.
D. Modified Release
The pharmaceutical composition provided herein can be formulated as a modified release dosage form. As used herein, the term “modified release” refers to a dosage form in which the rate or place of release of an active ingredient (s) is different from that of an immediate dosage form when administered by the same route. Modified release dosage forms include, but are not limited to, delayed-, extended-, prolonged-, sustained-, pulsatile-, controlled-, accelerated-and fast-, targeted-, programmed-release, and gastric retention dosage forms. The pharmaceutical composition in modified release dosage forms can be prepared using a variety  of modified release devices and methods known to those skilled in the art, including, but not limited to, matrix-controlled release devices, osmotic controlled release devices, multiparticulate controlled release devices, ion-exchange resins, enteric coatings, multilayered coatings, microspheres, liposomes, and combinations thereof. The release rate of the active ingredient (s) can also be modified by varying the particle sizes and polymorphism of the active ingredient (s) .
1. Matrix Controlled Release Devices
The pharmaceutical composition provided herein in a modified release dosage form can be fabricated using a matrix-controlled release device known to those skilled in the art. See, e.g., Takada et al. in Encyclopedia of Controlled Drug Delivery, Mathiowitz Ed. ; Wiley, 1999; Vol. 2.
In certain embodiments, the pharmaceutical composition provided herein in a modified release dosage form is formulated using an erodible matrix device, which is water-swellable, erodible, or soluble polymers, including, but not limited to, synthetic polymers, and naturally occurring polymers and derivatives, such as polysaccharides and proteins.
Materials useful in forming an erodible matrix include, but are not limited to, chitin, chitosan, dextran, and pullulan; gum agar, gum arabic, gum karaya, locust bean gum, gum tragacanth, carrageenans, gum Ghatti, guar gum, xanthan gum, and scleroglucan; starches, such as dextrin and maltodextrin; hydrophilic colloids, such as pectin; phosphatides, such as lecithin; alginates; propylene glycol alginate; gelatin; collagen; cellulosics, such as ethyl cellulose (EC) , methylethyl cellulose (MEC) , carboxymethyl cellulose (CMC) , CMEC, hydroxyethyl cellulose (HEC) , hydroxypropyl cellulose (HPC) , cellulose acetate (CA) , cellulose propionate (CP) , cellulose butyrate (CB) , cellulose acetate butyrate (CAB) , CAP, CAT, hydroxypropyl methyl cellulose (HPMC) , HPMCP, HPMCAS, hydroxypropyl methyl cellulose acetate trimellitate (HPMCAT) , and ethyl hydroxyethyl cellulose (EHEC) ; polyvinyl pyrrolidone; polyvinyl alcohol; polyvinyl acetate; glycerol fatty acid esters; polyacrylamide; polyacrylic acid; copolymers of ethacrylic acid or methacrylic acidpoly (2-hydroxyethyl-methacrylate) ; polylactides; copolymers of L-glutamic acid and ethyl-L-glutamate; degradable lactic acid-glycolic acid copolymers; poly-D- (-) -3-hydroxybutyric acid; and other acrylic acid derivatives, such as homopolymers and copolymers of butylmethacrylate, methyl methacrylate, ethyl methacrylate, ethylacrylate, (2-dimethylaminoethyl) methacrylate, and (trimethylaminoethyl) methacrylate chloride.
In certain embodiments, the pharmaceutical composition provided herein is formulated with a non-erodible matrix device. The active ingredient (s) is dissolved or dispersed in an inert matrix and is released primarily by diffusion through the inert matrix once administered. Materials suitable for use as a non-erodible matrix device include, but are not limited to, insoluble plastics, such as polyethylene, polypropylene,  polyisoprene, polyisobutylene, polybutadiene, polymethylmethacrylate, polybutylmethacrylate, chlorinated polyethylene, polyvinylchloride, methyl acrylate-methyl methacrylate copolymers, ethylene-vinyl acetate copolymers, ethylene/propylene copolymers, ethylene/ethyl acrylate copolymers, vinyl chloride copolymers with vinyl acetate, vinylidene chloride, ethylene and propylene, ionomer polyethylene terephthalate, butyl rubbers, epichlorohydrin rubbers, ethylene/vinyl alcohol copolymer, ethylene/vinyl acetate/vinyl alcohol terpolymer, ethylene/vinyloxyethanol copolymer, polyvinyl chloride, plasticized nylon, plasticized polyethylene terephthalate, natural rubber, silicone rubbers, polydimethylsiloxanes, and silicone carbonate copolymers; hydrophilic polymers, such as ethyl cellulose, cellulose acetate, crospovidone, and cross-linked partially hydrolyzed polyvinyl acetate; and fatty compounds, such as carnauba wax, microcrystalline wax, and triglycerides.
In a matrix-controlled release system, the desired release kinetics can be controlled, for example, via the polymer type employed, the polymer viscosity, the particle sizes of the polymer and/or the active ingredient (s) , the ratio of the active ingredient (s) versus the polymer, and other excipients or carriers in the compositions.
The pharmaceutical composition provided herein in a modified release dosage form can be prepared by methods known to those skilled in the art, including direct compression, dry or wet granulation followed by compression, and melt-granulation followed by compression.
2. Osmotic Controlled Release Devices
The pharmaceutical composition provided herein in a modified release dosage form can be fabricated using an osmotic controlled release device, including, but not limited to, one-chamber system, two-chamber system, asymmetric membrane technology (AMT) , and extruding core system (ECS) . In general, such devices have at least two components: (a) a core which contains an active ingredient; and (b) a semipermeable membrane with at least one delivery port, which encapsulates the core. The semipermeable membrane controls the influx of water to the core from an aqueous environment of use so as to cause drug release by extrusion through the delivery port (s) .
In addition to the active ingredient (s) , the core of the osmotic device optionally includes an osmotic agent, which creates a driving force for transport of water from the environment of use into the core of the device. One class of osmotic agents is water-swellable hydrophilic polymers, which are also referred to as “osmopolymers” and “hydrogels. ” Suitable water-swellable hydrophilic polymers as osmotic agents include, but are not limited to, hydrophilic vinyl and acrylic polymers, polysaccharides such as calcium alginate, polyethylene oxide (PEO) , polyethylene glycol (PEG) , polypropylene glycol (PPG) , poly (2-hydroxyethyl methacrylate) , poly (acrylic) acid, poly (methacrylic) acid, polyvinylpyrrolidone (PVP) , crosslinked PVP,  polyvinyl alcohol (PVA) , PVA/PVP copolymers, PVA/PVP copolymers with hydrophobic monomers such as methyl methacrylate and vinyl acetate, hydrophilic polyurethanes containing large PEO blocks, sodium croscarmellose, carrageenan, hydroxyethyl cellulose (HEC) , hydroxypropyl cellulose (HPC) , hydroxypropyl methyl cellulose (HPMC) , carboxymethyl cellulose (CMC) and carboxyethyl, cellulose (CEC) , sodium alginate, polycarbophil, gelatin, xanthan gum, and sodium starch glycolate.
The other class of osmotic agents is osmogens, which are capable of imbibing water to affect an osmotic pressure gradient across the barrier of the surrounding coating. Suitable osmogens include, but are not limited to, inorganic salts, such as magnesium sulfate, magnesium chloride, calcium chloride, sodium chloride, lithium chloride, potassium sulfate, potassium phosphates, sodium carbonate, sodium sulfite, lithium sulfate, potassium chloride, and sodium sulfate; sugars, such as dextrose, fructose, glucose, inositol, lactose, maltose, mannitol, raffinose, sorbitol, sucrose, trehalose, and xylitol; organic acids, such as ascorbic acid, benzoic acid, fumaric acid, citric acid, maleic acid, sebacic acid, sorbic acid, adipic acid, edetic acid, glutamic acid, p-toluenesulfonic acid, succinic acid, and tartaric acid; urea; and mixtures thereof.
Osmotic agents of different dissolution rates can be employed to influence how rapidly the active ingredient (s) is initially delivered from the dosage form. For example, amorphous sugars, such as MANNOGEMTM EZ can be used to provide faster delivery during the first couple of hours to promptly produce the desired therapeutic effect, and gradually and continually release of the remaining amount to maintain the desired level of therapeutic or prophylactic effect over an extended period of time. In this case, the active ingredient (s) is released at such a rate to replace the amount of the active ingredient metabolized and excreted.
The core can also include a wide variety of other excipients and carriers as described herein to enhance the performance of the dosage form or to promote stability or processing.
Materials useful in forming the semipermeable membrane include various grades of acrylics, vinyls, ethers, polyamides, polyesters, and cellulosic derivatives that are water-permeable and water-insoluble at physiologically relevant pHs or are susceptible to being rendered water-insoluble by chemical alteration, such as crosslinking. Examples of suitable polymers useful in forming the coating, include plasticized, unplasticized, and reinforced cellulose acetate (CA) , cellulose diacetate, cellulose triacetate, CA propionate, cellulose nitrate, cellulose acetate butyrate (CAB) , CA ethyl carbamate, CAP, CA methyl carbamate, CA succinate, cellulose acetate trimellitate (CAT) , CA dimethylaminoacetate, CA ethyl carbonate, CA chloroacetate, CA ethyl oxalate, CA methyl sulfonate, CA butyl sulfonate, CA p-toluene sulfonate, agar acetate, amylose triacetate, beta glucan acetate, beta glucan triacetate, acetaldehyde dimethyl acetate, triacetate of locust bean gum, hydroxylated ethylene-vinylacetate, EC, PEG, PPG, PEG/PPG copolymers, PVP, HEC, HPC, CMC, CMEC, HPMC, HPMCP, HPMCAS, HPMCAT, poly (acrylic) acids and esters and poly- (methacrylic) acids and esters and copolymers thereof, starch, dextran, dextrin, chitosan, collagen, gelatin, polyalkenes, polyethers, polysulfones,  polyethersulfones, polystyrenes, polyvinyl halides, polyvinyl esters and ethers, natural waxes, and synthetic waxes.
Semipermeable membrane can also be a hydrophobic microporous membrane, wherein the pores are substantially filled with a gas and are not wetted by the aqueous medium but are permeable to water vapor, as disclosed in U.S. Pat. No. 5,798,119. Such hydrophobic but water-vapor permeable membrane are typically composed of hydrophobic polymers such as polyalkenes, polyethylene, polypropylene, polytetrafluoroethylene, polyacrylic acid derivatives, polyethers, polysulfones, polyethersulfones, polystyrenes, polyvinyl halides, polyvinylidene fluoride, polyvinyl esters and ethers, natural waxes, and synthetic waxes.
The delivery port (s) on the semipermeable membrane can be formed post-coating by mechanical or laser drilling. Delivery port (s) can also be formed in situ by erosion of a plug of water-soluble material or by rupture of a thinner portion of the membrane over an indentation in the core. In addition, delivery ports can be formed during coating process, as in the case of asymmetric membrane coatings of the type disclosed in U.S. Pat. Nos. 5,612,059 and 5,698,220.
The total amount of the active ingredient (s) released and the release rate can substantially by modulated via the thickness and porosity of the semipermeable membrane, the composition of the core, and the number, size, and position of the delivery ports.
The pharmaceutical composition in an osmotic controlled-release dosage form can further comprise additional conventional excipients or carriers as described herein to promote performance or processing of the formulation.
The osmotic controlled-release dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art. See, e.g., Remington: The Science and Practice of Pharmacy, supra; Santus and Baker, J. Controlled Release, 1995, 35, 1-21; Verma et al., Drug Dev. Ind. Pharm., 2000, 26, 695-708; Verma et al., J. Controlled Release, 2002, 79, 7-27.
In certain embodiments, the pharmaceutical composition provided herein is formulated as an AMT controlled-release dosage form, which comprises an asymmetric osmotic membrane that coats a core comprising the active ingredient (s) and other pharmaceutically acceptable excipients or carriers. See, e.g., U.S. Pat. No. 5,612,059 and WO 2002/17918. The AMT controlled-release dosage forms can be prepared according to conventional methods and techniques known to those skilled in the art, including direct compression, dry granulation, wet granulation, and a dip-coating method.
In certain embodiments, the pharmaceutical composition provided herein is formulated as an  ESC controlled-release dosage form, which comprises an osmotic membrane that coats a core comprising the active ingredient (s) , a hydroxyethyl cellulose, and other pharmaceutically acceptable excipients or carriers.
3. Multiparticulate Controlled Release Devices
The pharmaceutical composition provided herein in a modified release dosage form can be fabricated as a multiparticulate controlled release device, which comprises a multiplicity of particles, granules, or pellets, ranging from about 10 μm to about 3 mm, about 50 μm to about 2.5 mm, or from about 100 μm to about 1 mm in diameter. Such multiparticulates can be made by the processes known to those skilled in the art, including wet-and dry-granulation, extrusion/spheronization, roller-compaction, melt-congealing, and by spray-coating seed cores. See, e.g., Multiparticulate Oral Drug Delivery; Ghebre-Sellassie Eds. ; Drugs and the Pharmaceutical Sciences 65; CRC Press: 1994; and Pharmaceutical Palletization Technology; Ghebre-Sellassie Eds.; Drugs and the Pharmaceutical Sciences 37; CRC Press: 1989.
Other excipients or carriers as described herein can be blended with the pharmaceutical composition to aid in processing and forming the multiparticulates. The resulting particles can themselves constitute the multiparticulate device or can be coated by various film-forming materials, such as enteric polymers, water-swellable, and water-soluble polymers. The multiparticulates can be further processed as a capsule or a tablet.
4. Targeted Delivery
The pharmaceutical composition provided herein can also be formulated to be targeted to a particular tissue, receptor, or other area of the body of the subject to be treated, including liposome-, resealed erythrocyte-, and antibody-based delivery systems. Examples include, but are not limited to, those disclosed in U.S. Pat. Nos. 6,316,652; 6,274,552; 6,271,359; 6,253,872; 6,139,865; 6,131,570; 6,120,751; 6,071,495; 6,060,082; 6,048,736; 6,039,975; 6,004,534; 5,985,307; 5,972,366; 5,900,252; 5,840,674; 5,759,542; and 5,709,874.
Methods of Use
In one embodiment, provided herein is a method of treating, preventing, or ameliorating one or more symptoms of a DNMT1-mediated disorder, disease, or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
In certain embodiments, the DNMT1-mediated disorder, disease, or condition is a proliferative disease.
In another embodiment, provided herein is a method of treating, preventing, or ameliorating one or more symptoms of a proliferative disease in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
In certain embodiments, the proliferative disease is cancer. In certain embodiments, the cancer is refractory and/or relapsed. In certain embodiments, the cancer is refractory. In certain embodiments, the cancer is relapsed. In certain embodiments, the cancer is metastatic. In certain embodiments, the cancer is unresectable.
In certain embodiments, the cancer is drug-resistant. In certain embodiment, the cancer is multidrug-resistant. In certain embodiments, the cancer is resistant to a chemotherapy. In certain embodiments, the cancer is resistant to an immunotherapy. In certain embodiments, the cancer is resistant to a standard therapy for the cancer.
In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human.
In certain embodiments, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 100 mg/kg/day, from about 0.1 to about 50 mg/kg/day, from about 0.1 to about 60 mg/kg/day, from about 0.1 to about 50 mg/kg/day, from about 0.1 to about 25 mg/kg/day, from about 0.1 to about 20 mg/kg/day, from about 0.1 to about 15 mg/kg/day, from about 0.1 to about 10 mg/kg/day, or from about 0.1 to about 5 mg/kg/day. In one embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 100 mg/kg/day. In another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 50 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 60 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 50 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 25 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 20 mg/kg/day. In yet another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 15 mg/kg/day. In yet another embodiment, the therapeutically effective  amount of a compound provided herein is ranging from about 0.1 to about 10 mg/kg/day. In still another embodiment, the therapeutically effective amount of a compound provided herein is ranging from about 0.1 to about 5 mg/kg/day.
Depending on the disorder, disease, or condition to be treated and the subject’s condition, a compound provided herein may be administered by oral, parenteral (e.g., intramuscular, intraperitoneal, intravenous, CIV, intracisternal injection or infusion, subcutaneous injection, or implant) , inhalation, nasal, vaginal, rectal, sublingual, or topical (e.g., transdermal or local) routes of administration. A compound provided herein may be formulated in suitable dosage unit with a pharmaceutically acceptable excipient, carrier, adjuvant, or vehicle, appropriate for each route of administration.
In one embodiment, a compound provided herein is administered orally. In another embodiment, a compound provided herein is administered parenterally. In yet another embodiment, a compound provided herein is administered intravenously. In yet another embodiment, a compound provided herein is administered intramuscularly. In yet another embodiment, a compound provided herein is administered subcutaneously. In still another embodiment, a compound provided herein is administered topically.
A compound provided herein can be delivered as a single dose such as, e.g., a single bolus injection, or oral tablets or pills; or over time such as, e.g., continuous infusion over time or divided bolus doses over time. A compound provided herein can be administered repetitively, if necessary, for example, until the subject experiences stable disease or regression, or until the patient experiences disease progression or unacceptable toxicity.
A compound provided herein can be administered once daily (QD) or divided into multiple daily doses such as twice daily (BID) , and three times daily (TID) . In addition, the administration can be continuous, i.e., every day, or intermittently. The term “intermittent” or “intermittently” as used herein is intended to mean stopping and starting at either regular or irregular intervals. For example, intermittent administration of a compound provided herein is administration for one to six days per week, administration in cycles (e.g., daily administration for two to eight consecutive weeks, then a rest period with no administration for up to one week) , or administration on alternate days.
In certain embodiments, a compound provided herein is cyclically administered to a subject. Cycling therapy involves the administration of an active agent for a period of time, followed by a rest for a period of time, and repeating this sequential administration. Cycling therapy can reduce the development of resistance to one or more of the therapies, avoid or reduce the side effects of one of the therapies, and/or improves the efficacy of the treatment.
A compound provided herein can also be combined or used in combination with other therapeutic agents useful in the treatment and/or prevention of a condition, disorder, or disease described herein.
As used herein, the term “in combination” includes the use of more than one therapy (e.g., one or more prophylactic and/or therapeutic agents) . However, the use of the term “in combination” does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject with a disease or disorder. A first therapy (e.g., a prophylactic or therapeutic agent such as a compound provided herein) can be administered prior to (e.g., 5 minutes, 15 minutes, 50 minutes, 65 minutes, 1 hour, 2 hours, 6 hours, 6 hours, 12 hours, 26 hours, 68 hours, 72 hours, 96 hours, 1 week, 2 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before) , concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 50 minutes, 65 minutes, 1 hour, 2 hours, 6 hours, 12 hours, 26 hours, 68 hours, 72 hours, 96 hours, 1 week, 2 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., a prophylactic or therapeutic agent) to the subject. Triple therapy is also contemplated herein.
The route of administration of a compound provided herein is independent of the route of administration of a second therapy. In one embodiment, a compound provided herein is administered orally. In another embodiment, a compound provided herein is administered intravenously. Thus, in accordance with these embodiments, a compound provided herein is administered orally or intravenously, and the second therapy can be administered orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraocularly, via local delivery by catheter or stent, subcutaneously, intraadiposally, intraarticularly, intrathecally, or in a slow release dosage form. In one embodiment, a compound provided herein and a second therapy are administered by the same mode of administration, orally or by IV. In another embodiment, a compound provided herein is administered by one mode of administration, e.g., by IV, whereas the second agent (an anticancer agent) is administered by another mode of administration, e.g., orally.
In one embodiment, provided herein is a method of inhibiting the growth of a cell, comprising contacting the cell with an effective amount of a compound provided herein, e.g., a compound of Formula (I) , or an enantiomer, a mixture of enantiomers, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
In certain embodiments, the cell is a cancerous cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a human cancerous cell.
In another embodiment, provided herein is a method of inhibiting the activity of a DNMT1, comprising contacting the DNMT1 with an effective amount of a compound provided herein, e.g., a compound  of Formula (I) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof.
A compound provided herein can also be provided as an article of manufacture using packaging materials well known to those of skill in the art. See, e.g., U.S. Pat. Nos. 5,525,907; 5,052,558; and 5,055,252. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.
In certain embodiments, provided herein is a kit which, when used by a medical practitioner, can simplify the administration of an appropriate amount of a compound provided herein as an active ingredient to a subject. In certain embodiments, the kit provided herein includes a container and a dosage form of a compound provided herein.
Kits provided herein can further include devices that are used to administer the active ingredients. Examples of such devices include, but are not limited to, syringes, needle-less injectors drip bags, patches, and inhalers. The kits provided herein can also include condoms for administration of the active ingredients.
Kits provided herein can further include pharmaceutically acceptable vehicles that can be used to administer one or more active ingredients. For example, if an active ingredient is provided in a solid form that must be reconstituted for parenteral administration, the kit can comprise a sealed container of a suitable vehicle in which the active ingredient can be dissolved to form a particulate-free sterile solution that is suitable for parenteral administration. Examples of pharmaceutically acceptable vehicles include, but are not limited to: aqueous vehicles, including, but not limited to, water for injection USP, sodium chloride injection, Ringer’s injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer’s injection; water-miscible vehicles, including, but not limited to, ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non-aqueous vehicles, including, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
The disclosure will be further understood by the following non-limiting examples.
EXAMPLES
As used herein, the symbols and conventions used in these processes, schemes and examples, regardless of whether a particular abbreviation is specifically defined, are consistent with those used in the contemporary scientific literature, for example, the Journal of the American Chemical Society, the Journal of  Medicinal Chemistry, or the Journal of Biological Chemistry. Specifically, but without limitation, the following abbreviations may be used in the examples and throughout the specification: g (grams) ; mg (milligrams) ; mL (milliliters) ; μL (microliters) ; mM (millimolar) ; μM (micromolar) ; mmol (millimoles) ; h (hour or hours) ; min (minute or minutes) ; Boc (tert-butoxycarbonyl) ; CDI (carbonyldiimidazole) ; DCM (dichloro-methane) ; DIPEA (diisopropylethylamine) ; DMF (dimethylformamide) ; DMSO (dimethyl sulfoxide) ; EtOAc (ethyl acetate) ; EtOH (ethanol) ; Fmoc (fluorenylmethoxycarbonyl) ; KSAc (potassium thioacetate) ; MeOH (methanol) ; Ms (methanesulfonyl) ; MsCl (methanesulfonyl chloride) ; NaOEt (sodium ethoxide) ; PE (petroleum ether) ; TEA (triethylamine) ; TFA (trifluoro-acetic acid) ; THF (tetrahydrofuran) ; MS (mass spectrometry) ; and NMR (nuclear magnetic resonance) .
For all of the following examples, standard work-up and purification methods known to those skilled in the art can be utilized. Unless otherwise indicated, all temperatures are expressed in ℃ (degrees Centigrade) . All reactions are conducted at room temperature unless otherwise specified. Synthetic methodologies illustrated herein are intended to exemplify the applicable chemistry through the use of specific examples and are not indicative of the scope of the disclosure.
Example 1
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) -methyl) phenyl) -N-methylacrylamide A1
Compound A1 was synthesized as shown in Schemes 1A and 1B.
Preparation of ammonium 3, 5-dicyano-4-ethyl-6-hydroxypyridin-2-olate 1.1. To a solution of 2-cyanoacetamide (20 g, 0.238 mol) in water (360 mL) were added 25%aqueous ammonium hydroxide (7 mL) and propionaldehyde (7 g, 0.119 mol) . The reaction mixture was stirred overnight. The resulting precipitates were collected by filtration, washed with cold MeOH, and dried under vacuum to afford compound 1.1 (8 g) in 30%yield.
Preparation of 2, 6-dichloro-4-ethylpyridine-3, 5-dicarbonitrile 1.2. Compound 1.1 (6.8 g, 38.2  mmol) was added slowly to POCl3 (25 mL) . After stirred at 150 ℃ for 15 h, the reaction mixture was concentrated under vacuum and poured into ice-water. The resulting precipitates were collected by filtration, washed with cold water and the cold MeOH, and dried to afford compound 1.2 (5.2 g) in 76%. 1H NMR (500 MHz, CDCl3) δ 3.12 (q, J = 7.6 Hz, 2H) , 1.42 (t, J = 7.6 Hz, 3H) .
Preparation of tert-butyl (2- ( (6-chloro-3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) -amino) ethyl) (methyl) carbamate 1.3. To a solution of compound 1.2 (1 g, 4.44 mmol) in THF (30 mL) at 0 ℃ were added tert-butyl methyl (2- (methylamino) ethyl) carbamate (0.84 g, 4.44 mmol) and TEA (0.74 mL, 5.33 mmol) . After stirred at 0 ℃ for 2 h, the reaction mixture was diluted with water and extracted with EtOAc (2 × 30 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.3 (1.44 g) in 86%yield. 1H NMR (500 MHz, CDCl3) δ 3.89 (m, 2H) , 3.50 (m, 5H) , 2.95 (m, 2H) , 2.92 (s, 3H) , 1.42-1.31 (m, 12H) .
Preparation of (4- (methylamino) phenyl) methanol 1.4. To a solution of 4- (N-methylamino) benzoic acid (5 g, 33 mmol) in THF (25 mL) at 0 ℃ was added 1M BH3·THF in THF (100 mL, 100 mmol) dropwise over 30 min. After stirred for 5 h, the reaction was quenched with 3M NaOH (30 mL) at 0 ℃. The mixture was stirred for another 12 h. The aqueous phase was saturated with K2CO3 and extracted with EtOAc (3 × 50 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound 1.4 (2.36 g) in 52%yield. 1H NMR (500 MHz, DMSO-d6) δ7.04 (d, J = 7.9 Hz, 2H) , 6.50 (d, J = 7.9 Hz, 2H) , 5.48 (d, J = 4.5 Hz, 1H) , 4.80 (t, J = 5.5 Hz, 1H) , 4.32 (d, J = 5.5 Hz, 2H) , 2.66 (d, J = 5.0 Hz, 2H) .
Preparation of tert-butyl (4- (hydroxymethyl) phenyl) (methyl) carbamate 1.5. To a solution of compound 1.4 (1.3 g, 9.5 mmol) in dioxane (25 mL) and H2O (5 mL) at 0 ℃ was added di-tert-butyl dicarbonate (3.2 g, 14.2 mmol) . After stirred overnight, the reaction mixture was diluted with water (30 mL) and extracted with EtOAc (3 × 50 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.5 (1.82 g) in 81%yield.
Preparation of 4- ( (tert-butoxycarbonyl) (methyl) amino) benzyl methanesulfonate 1.6. To a solution of compound 1.5 (1.31 g, 5.5 mmol) in DCM (30 mL) at 0 ℃ were added TEA (1.68 mL, 11 mmol) and MsCl (0.95 g, 8.25 mmol) . After stirred overnight, the reaction was diluted with water and extracted with DCM (3 × 50 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound 1.6 (1.3 g) in 76%yield, which was used directly in the next step without further purification.
Preparation of S- (4- ( (tert-butoxycarbonyl) (methyl) amino) benzyl) ethanethioate 1.7. To a solution of compound 1.6 (1.3 g, 4.13 mmol) in DMF (5 mL) was added KSAc (0.565 g, 4.95 mmol) . After stirred for 2 h, the reaction mixture was diluted with water (20 mL) and extracted with EtOAc (3 × 30 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.7 (1.16 g) in 95%yield. 1H NMR (400 MHz, CDCl3) δ 7.27 (d, J = 8.3 Hz, 2H) , 7.19 (d, J = 8.3 Hz, 2H) , 4.13 (s, 2H) , 3.26 (s, 3H) , 2.38 (s, 3H) , 1.48 (s, 9H) .
Preparation of tert-butyl (4- (mercaptomethyl) phenyl) (methyl) carbamate 1.8. To a mixture of compound 1.7 (500 mg, 1.69 mmol) in MeOH (30 mL) at 0℃ was added 20%NaOEt in EtOH (630 mg, 1.86 mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was neutralized with 1N HCl, concentrated, diluted with EtOAc and water, and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.8 (368 mg) in 86%yield.
Preparation of (4- (methylamino) phenyl) methanethiol 1.9. To a solution of compound 1.8 (220 mg, 0.87 mmol) in EtOAc (1.0 mL) at 0 ℃ was added 4N HCl in dioxane (1 mL) . After stirred at 0 ℃ for 2 h, the reaction mixture was neutralized with saturated NaHCO3 and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound 1.9 (130 mg) in 97%yield. 1H NMR (500 MHz, CDCl3) δ 7.16 (d, J = 8.8 Hz, 2H) , 6.57 (d, J = 8.3 Hz, 2H) , 3.69 (d, J = 7.1 Hz, 2H) , 2.83 (s, 3H) .
Preparation of tert-butyl (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (methylamino) benzyl) -thio) pyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 1.10. To a solution of compound 1.3 (265 mg, 0.7 mmol) and K2CO3 (194 mg, 1.4 mmol) in DMF (5 mL) was added compound 1.9 (130 mg, 0.85 mmol) . After stirred for 16 h, the reaction mixture was diluted with water and extracted with EtOAc (3 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.10 (283 mg) in 82%yield. 1H NMR (500 MHz, CDCl3) δ 7.15 (d, J = 7.0 Hz, 2H) , 6.55 (d, J = 8.5 Hz, 2H) , 4.35 (brs, 2H) , 3.93-3.88 (m, 2H) , 3.43-. 341 (m, 2H) , 3.43 (m, 3H) , 2.91-2.85 (m, 5H) , 2.82 (s, 3H) , 1.42 (m, 9H) , 1.30 (t, J = 7.5 Hz, 3H) .
Preparation of tert-butyl (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (N-methylacrylamido) benzyl) thio) pyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 1.11. To a solution of compound 1.10 (100 mg, 0.2 mmol) and DIPEA (52 mg, 0.4 mmol) in THF (5 mL) at 0 ℃ was added acryloyl chloride (36 mg, 0.4 mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was neutralized with saturated NaHCO3 and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous  Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 1.11 (99 mg) in 91%yield. 1H NMR (500 MHz, CDCl3) δ 7.40 (d, J = 6.4 Hz, 2H) , 7.13 (d, J = 7.2 Hz, 2H) , 6.37 (dd, J = 16.8, 1.2 Hz, 1H) , 6.07 (m, 1H) , 5.53 (d, J = 10.3 Hz, 1H) , 4.46 (m, 2H) , 3.92 (m, 2H) , 3.49 (br, 2H) , 3.41 (s, 3H) , 3.32 (s, 3H) , 2.92 (m, 2H) , 2.86 (s, 3H) , 1.40 (s, 9H) , 1.36 (t, J = 7.5 Hz, 3H) .
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacrylamide A1. To a solution of compound 1.11 (99 mg, 0.18 mmol) in DCM (3 mL) at 0 ℃ was added TFA (0.5 mL) . After stirred for 3 h, the reaction mixture was neutralized with saturated NaHCO3 at 0 ℃ and extracted with DCM (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound A1 (68 mg) in 85%yield. MS (ESI) m/z: 448.9 [M+H] +; 1H NMR (400 MHz, CDCl3) δ 7.44 (d, J = 8.1 Hz, 2H) , 7.17 (d, J = 8.1 Hz, 2H) , 6.41 (dd, J = 16.9, 2.0 Hz, 1H) , 6.11 (m, 1H) , 5.58 (d, J = 10.3 Hz, 1H) , 4.49 (s, 2H) , 3.92 (t, J = 6.8 Hz, 2H) , 3.45 (s, 3H) , 3.38 (s, 3H) , 2.96 (m, 4H) , 2.50 (s, 3H) , 1.36 (t, J = 7.6 Hz, 3H) .
Example 2
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A2
Compound A2 was synthesized as shown in Scheme 2.
Preparation of tert-butyl (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (N–methylvinylsulfon-amido) benzyl) thio) pyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 2.1. To a solution of tert-butyl (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (methylamino) benzyl) thio) pyridine-2-yl) (methyl) -amino) ethyl) (methyl) carbamate 1.10 (100 mg, 0.2 mmol) and 4-methylmorpholine (61 mg, 0.6 mmol) in DCM (5 mL) at 0 ℃ was added 2-chloroethanesulfonylchloride (42 mg, 0.26 mmol) . After stirred overnight, the reaction mixture was neutralized with saturated NaHCO3 and extracted with DCM (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 2.1 (115 mg) in 97%yield. 1H NMR (400 MHz, CDCl3) δ 7.39 (d, J = 8.1 Hz, 2H) , 7.31 (d, J = 8.1 Hz, 2H) , 6.46 (dd, J = 16.6, 9.9 Hz, 1H) , 6.23 (d, J = 16.6 Hz, 1H) , 6.05 (d, J = 9.9 Hz, 1H) , 4.46 (s, 2H) , 3.93 (br , 2H) , 3.51 (br, 2H) , 3.44 (s, 3H) , 3.26 (s, 3H) , 2.96 (q, J = 7.8 Hz, 2H) , 2.90 (s, 3H) , 1.45 (s, 9H) , 1.36 (t, J = 7.5 Hz, 3H) .
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A2. A mixture of compound 2.1 and 1M HCl in EtOAc (1.5 mL) was stirred overnight. The reaction mixture was then diluted with Et2O (2 mL) . After stand for 40 min, the resulting precipitates were collected, washed with Et2O, and dried to afford compound A2 as a HCl salt (52 mg) in 84%yield. MS (ESI) m/z: 485.0 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 8.94 (br s, 2H) , 7.45 (d, J = 8.2 Hz, 2H) , 7.32 (d, J = 8.2 Hz, 2H) , 6.85 (dd, J = 16.4, 10.0 Hz, 1H) , 6.15 (d, J = 9.9 Hz, 1H) , 6.04 (d, J =16.4 Hz, 1H) , 4.56 (s, 2H) , 4.05 (m, 2H) , 3.47 (s, 3H) , 3.17 (m, 3H) , 2.80 (q, J = 7.5 Hz, 2H) , 2.53 (s, 3H) , 1.23 (t, J = 7.6 Hz, 3H) .
Example 3
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) benzyl) acrylamide A13
Compound A13 was synthesized as shown in Scheme 3.
Preparation of (9H-fluoren-9-yl) methyl (4- (hydroxymethyl) benzyl) carbamate 3.1. To a solution of 4- ( ( ( ( (9H-fluoren-9-yl) methoxy) carbonyl) amino) methyl) benzoic acid (2.5 g, 6.7 mmol) in THF (25 mL) was added CDI (1.52 g, 9.38 mmol) . After 10 min, the mixture was cooled to 0 ℃ and NaBH4 (0.46 g, 12.06 mmol) in H2O (12 mL) was added. The reaction mixture was stirred for 30 min, neutralized with 1N HCl  (50 mL) , and extracted with EtOAc (2 x 100 mL) . The combined organic layers were washed with saturated NaHCO3 and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 3.1 (0.564 g) in 24%yield. 1H NMR (500 MHz, DMSO-d6) δ 7.90 (d, J = 7.5 Hz, 2H) , 7.82 (t, J = 6.0 Hz, 1H) , 7.70 (d, J = 7.4 Hz, 2H) , 7.43 (t, J = 7.4 Hz, 2H) , 7.34 (t, J = 7.4 Hz, 2H) , 7.25 (d, J = 7.9 Hz, 2H) , 7.17 (d, J = 7.9 Hz, 2H) , 5.18 (t, J = 5.7 Hz, 1H) , 4.47 (d, J = 5.7 Hz, 2H) , 4.35 (d, J = 6.9 Hz, 2H) , 4.22 (t, J = 6.7 Hz, 1H) , 4.16 (d, J = 6.1 Hz, 2H) .
Preparation of 4- ( ( ( ( (9H-fluoren-9-yl) methoxy) carbonyl) amino) methyl) benzyl methanesulfonate 3.2. To a solution of compound 3.1 (564 mg, 1.57 mmol) in DCM (20 mL) at 0 ℃ were added TEA (0.44 mL, 3.14 mmol) and MsCl (270 mg, 2.36 mmol) . After stirred overnight, the reaction mixture was diluted with water and extracted with DCM (2 × 30 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound 3.2 (710 mg) in a quantitative yield, which was used directly in the next step without further purification.
Preparation of S- (4- ( ( ( ( (9H-fluoren-9-yl) methoxy) carbonyl) amino) methyl) benzyl) ethanethioate 3.3. To a solution of compound 3.2 (710 mg, 1.57 mmol) in DMF (50 mL) was added KSAc (270 mg, 2.36 mmol) . After stirred for 2 h, the reaction mixture was diluted with water (20 mL) and extracted with  EtOAc (3 × 30 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 3.3 (470 mg) in 72%yield. 1H NMR (500 MHz, CDCl3) δ 7.77 (d, J = 7.5 Hz, 2H) , 7.59 (d, J = 7.4 Hz, 2H) , 7.40 (t, J = 7.4 Hz, 2H) , 7.30 (t, J = 7.4 Hz, 2H) , 7.27 (d, J = 6.8 Hz, 2H) , 7.20 (d, J = 7.2 Hz, 2H) , 5.04 (br, 1H) , 4.46 (d, J = 6.8 Hz, 2H) , 4.35 (d, J = 5.9 Hz, 2H) , 4.22 (t, J = 6.8 Hz, 1H) , 4.10 (s, 2H) , 2.35 (s, 3H) .
Preparation of (9H-fluoren-9-yl) methyl (4- (mercaptomethyl) benzyl) carbamate 3.4. To a mixture of compound 3.3 (470 mg, 1.13 mmol) in MeOH (100 mL) at 0 ℃ was added 20%NaOEt in EtOH (422 mg, 1.24 mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was neutralized with 1N HCl, concentrated, diluted with EtOAc and water, and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 3.4 (322 mg) in 76%yield. 1H NMR (500 MHz, CDCl3) δ 7.77 (d, J = 7.3 Hz, 2H) , 7.60 (d, J = 7.3 Hz, 2H) , 7.40 (t, J = 7.3 Hz, 2H) , 7.32-7.26 (m, 4H) , 7.23 (d, J = 7.5 Hz, 2H) , 5.06 (br, 1H) , 4.47 (d, J = 6.7 Hz, 2H) , 4.37 (d, J = 5.6 Hz, 2H) , 4.23 (t, J = 6.7 Hz, 1H) , 3.74 (d, J = 7.5 Hz , 2H) , 7.75 (t, J = 7.5 Hz, 1H) .
Preparation of tert-butyl (2- ( (6- ( (4- (aminomethyl) benzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 3.5. To a solution of tert-butyl (2- ( (6-chloro-3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 1.3 (150 mg, 0.4 mmol) and K2CO3 (110 mg, 0.80 mmol) in DMF (5 mL) was added compound 3.4 (165 mg, 4.4 mmol) . After stirred for 16 h. the reaction mixture was diluted with water and extracted with EtOAc (3 × 20 mL) . The combined organic layers were washed with water (3 x 40 mL) and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound 3.5 (160 mg) in 81%yield. 1H NMR (500 MHz, CDCl3) δ 7.30 (m, 2H) , 7.27 (d, J = 6.4 Hz, 2H) , 4.42 (br s, 2H) , 3.90 (m, 2H) , 3.85 (s, 2H) , 3.49 (m, 2H) , 3.41 (m, 3H) , 2.91 (q, J = 7.1 Hz, 2H) , 2.85 (s, 3H) , 1.42 (m, 9H) , 1.31 (t, J = 7.5 Hz, 3H) .
Preparation of tert-butyl (2- ( (6- ( (4- (acrylamidomethyl) benzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) (methyl) amino) ethyl) (methyl) carbamate 3.6. To a solution of compound 3.5 (160 mg, 0.33 mmol) and DIPEA (84 mg, 0.66 mmol) in THF (10 mL) at 0 ℃ was added acryloyl chloride (44 mg, 0.49 mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was treated with saturated NaHCO3 and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound 3.6 (156 mg) in 86%yield. 1H NMR (500 MHz, CDCl3) δ7.31 (m, 2H) , 7.25 (d, J = 8.0 Hz, 2H) , 6.34 (d, J = 16.9 Hz, 1H) , 6.14 (m, 1H) , 6.09-5.90 (m, 1H) , 5.68 (d, J =  11.3 Hz, 1H) , 4.50 (d, J = 5.8 Hz, 2H) , 4.41 (m, 2H) , 3.88 (m, 2H) , 3.48 (m, 2H) , 3.40 (m, 3H) , 2.91 (q, J = 6.9 Hz, 2H) , 2.84 (m, 3H) , 1.40 (m, 9H) , 1.30 (t, J = 7.6 Hz, 3H) .
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) benzyl) acrylamide A13. To a solution of compound 3.6 (156 mg, 0.28 mmol) in DCM (4 mL) at 0 ℃ was added TFA (1 mL) . After stirred at 0 ℃ for 2 h, the reaction mixture was neutralized with saturated NaHCO3 and extracted with DCM (2 × 20mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound A13 (105 mg) in 83%yield. MS (ESI) m/z: 449.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.33 (d, J = 7.8 Hz, 2H) , 7.25 (d, J = 7.6 Hz, 2H) , 6.32 (d, J = 17.0 Hz, 1H) , 6.11 (dd, J = 17.0, 10.3 Hz, 1H) , 6.05 (br, 1H) , 5.68 (d, J = 10.3 Hz, 1H) , 4.49 (d, J = 5.8 Hz, 2H) , 4.41 (s, 2H) , 3.85 (t, J = 6.8 Hz, 2H) , 3.40 (s, 3H) , 2.91 (q, J = 7.6 Hz, 2H) , 2.83 (t, J = 6.8 Hz, 2H) , 2.42 (s, 3H) , 1.31 (t, J = 7.6 Hz, 3H) .
Example 4
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methylpiperazin-1-yl) pyridine-2-yl) thio) -methyl) phenyl) acrylamide A18
Compound A18 was synthesized as shown in Scheme 4.
Preparation of tert-butyl (4- (chloromethyl) phenyl) carbamate 4.1. To a solution of tert-butyl (4- (hydroxymethyl) phenyl) carbamate (2.5 g, 11.2 mmol) in DCM (50 mL) at 0 ℃ were added TEA (3.1 mL, 22.4 mmol) and MsCl (1.92 g, 16.8 mmol) . After stirred overnight, the reaction mixture was diluted with water and extracted with DCM (3 × 50 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound 4.1 (2.6 g) in 96%yield) , which was used directly in the next step without further purification. 1H NMR (500 MHz, CDCl3) δ 7.34 (d, J = 8.6 Hz, 2H) , 7.31 (d, J = 8.6 Hz, 2H) , 6.49 (br, 1H) , 4.55 (s, 2H) , 1.51 (s, 9H) .
Preparation of S- (4- ( (tert-butoxycarbonyl) amino) benzyl) ethanethioate 4.2. To a solution of compound 4.1 (2.6 g, 10.72 mmol) in DMF (40 mL) was added KSAc (1.83 g, 16.08 mmol) . After stirred for 16 h, the reaction mixture was diluted with water (100 mL) and extracted with EtOAc (3 × 60 mL) . The combined organic layers were washed with water (3 x 100 mL) and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 4.2 (1.6 g) in 53%yield.
Preparation of tert-butyl (4- (mercaptomethyl) phenyl) carbamate 4.3. To a mixture of compound 4.2 (1.6 g, 5.67 mmol) in MeOH (50 mL) at 0 ℃ was added NaOEt in EtOH (20%, 2.3 mg, 6.80  mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was neutralized with 1N HCl, concentrated, diluted with EtOAc and water, and extracted with EtOAc (2 × 50 mL) . The combined organic layers were washed with water (3 x 100 mL) and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 4.3 (1.1 g) in 81%yield.
Preparation of tert-butyl (4- ( ( (6-chloro-3, 5-dicyano-4-ethylpyridin-2-yl) thio) -methyl) phenyl) carbamate 4.4. To a solution of 2, 6-dichloro-4-ethylpyridine-3, 5-dicarbonitrile 1.2 (470 mg, 2.09 mmol) in THF (80 mL) at 0 ℃ were added compound 4.3 (500 mg, 2.09 mmol) and TEA (0.32 mL, 2.30 mmol) . After stirred at 0 ℃ for 4 h, the reaction mixture was diluted with water and extracted with EtOAc (2 × 50 mL) . The combined organic layers were washed with water (3 x 100 mL) and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with EtOAc in PE to afford compound 4.4 (644 mg) in 72%yield. 1H NMR (500 MHz, CDCl3) δ 7.35 (d, J = 8.7 Hz, 2H) , 7.32 (d, J = 8.6 Hz, 2H) , 6.46 (br, 1H) , 4.53 (s, 2H) , 2.97 (q, J = 7.6 Hz, 2H) , 1.55 (s, 9H) , 1.31 (t, J = 7.6 Hz, 3H) .
Preparation of tert-butyl (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methylpiperazin-1-yl) -pyridine-2-yl) thio) methyl) phenyl) carbamate 4.5. To a solution of compound 4.4 (150 mg, 0.35 mmol) and K2CO3 (97 mg, 0.7 mmol) in DMF (3.0 mL) was added 1-methylpiperazine (70 mg, 0.7 mmol) . After stirred for 3 h, the reaction mixture was diluted with water and extracted with EtOAc (3 × 20 mL) . The combined organic layers were washed with water (3 x 50 mL) and then brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound 4.5 (149 mg) in 93%yield. 1H NMR (500 MHz, CDCl3) δ 7.31 (d, J = 8.2 Hz, 2H) , 7.27 (d, J = 9.1 Hz, 2H) , 6.46 (br, 1H) , 4.34 (s, 2H) , 3.90 (br, 4H) , 2.88 (q, J = 7.5 Hz, 2H) , 2.52 (br, 4H) , 2.34 (s, 3H) , 1.55 (s, 9H) , 1.30 (t, J = 7.6 Hz, 3H) .
Preparation of 2- ( (4-aminobenzyl) thio) -4-ethyl-6- (4-methylpiperazin-1-yl) -pyridine-3, 5-dicarbonitrile 4.6. To a solution of compound 4.5 (149 mg, 0.3 mmol) in DCM (4 mL) at 0 ℃ was added TFA (2 mL) . After stirred at 0 ℃ for 2 h, the reaction mixture was neutralized with saturated Na2CO3 and extracted with DCM (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to afford compound 4.6 (115 mg) in 97%yield. 1H NMR (500 MHz, CDCl3) δ 7.13 (d, J = 8.1 Hz, 2H) , 6.62 (d, J = 8.2 Hz, 2H) , 4.31 (s, 2H) , 3.93 (br, 4H) , 3.67 (br, 2H) , 2.89 (q, J = 7.6 Hz, 2H) , 2.55 (br, 4H) , 2.36 (s, 3H) , 1.29 (t, J = 7.6 Hz, 3H) .
Preparation of N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methylpiperazin-1-yl) pyridine-2-yl) thio) -methyl) phenyl) acrylamide A18. To a solution of compound 4.6 (115 mg, 0.29 mmol) and DIPEA (76 mg, 0.59 mmol) in THF (20 mL) at 0 ℃ was added acryloyl chloride (42 mg, 0.59 mmol) . After stirred at 0 ℃ for 30  min, the reaction mixture was treated with saturated NaHCO3 and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, dried over anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound A18 (107 mg) in 83%yield. MS (ESI) m/z: 447.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ7.54 (d, J = 8.1 Hz, 2H) , 7.32 (d, J = 8.2 Hz, 2H) , 7.28 (br, 1H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.23 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.37 (s, 2H) , 3.90 (br, 4H) , 2.89 (q, J = 7.6 Hz, 2H) , 2.52 (br, 4H) , 2.34 (s, 3H) , 1.30 (t, J = 7.6 Hz, 3H) .
Example 5
Preparation of N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A30
Compound A30 was synthesized as shown in Scheme 5.
Preparation of 2-chloro-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridine-3, 5-dicarbonitrile 5.2. To a solution of 2, 6-dichloro-4-ethylpyridine-3, 5-dicarbonitrile (40 mg, 0.185 mmol) in THF (30 mL) at 0 ℃ was added N, N, N'-trimethylethylenediamine (35 mg, 0.185 mmol) and TEA (0.03 mL, 0.222 mmol) . After stirred at 0 ℃ for 2 h, the reaction mixture was diluted with water and extracted with EtOAc (2 × 10 mL) . The combined organic layers were washed with brine, anhydrous Na2SO4, filtered, and concentrated to afford compound 5.2 (60 mg) in a quantitative yield, which was used directly in the next step without further purification.
Preparation of 2- ( (4-aminobenzyl) (methyl) amino) -6- ( (2- (dimethylamino) ethyl) - (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile 5.3. To a solution of compound 5.2 (60 mg, 0.2 mmol) and K2CO3 (34 mg, 0.24 mmol) in DMF (3 mL) at room temperature was added 4- ( (methylamino) methyl) aniline (130 mg, 0.85 mmol) . After stirred at room temperature for 3 h, the reaction mixture was diluted with water and extracted with EtOAc (3 × 10 mL) . The combined organic layers were washed with brine, anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound 5.3 (40.8 mg) in 50%yield. 1H NMR (500 MHz, CDCl3) δ6.98 (d, J = 8.0 Hz, 2H) , 6.64 (d, J = 8.4 Hz, 2H) , 4.79 (s, 2H) , 3.73 (t, J = 7.4 Hz, 2H) , 3.32 (s, 3H) , 3.24 (s, 3H) , 2.93 (q, J = 7.6 Hz, 2H) , 2.56 (t, J = 7.4 Hz, 2H) , 2.22 (s, 6H) , 1.32 (t, J = 7.5 Hz, 3H) .
Preparation of N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A30. To a solution of compound 5.3 (40 mg, 0.1 mmol) and DIPEA (30 mg, 0.2 mmol) in THF (10 mL) at 0 ℃ was added acryloyl chloride (21 mg, 0.15 mmol) . After stirred at 0 ℃ for 30 min, the reaction mixture was treated with saturated NaHCO3 and extracted with EtOAc (2 × 20 mL) . The combined organic layers were washed with brine, anhydrous Na2SO4, filtered, and concentrated to yield a crude product, which was purified by silica-gel column chromatography eluting with MeOH in DCM to afford compound A30 (30 mg) in 60%yield. MS (ESI) m/z: 446.4 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.56 (d, J = 8.1 Hz, 2H) , 7.39 (brs, 1H) , 7.16 (d, J = 8.2 Hz, 2H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.77 (dd, J = 10.2, 1.3 Hz, 1H) , 4.87 (s, 2H) , 3.68 (t, J = 7.3 Hz, 2H) , 3.30 (s, 3H) , 3.26 (s, 3H) , 2.93 (q, J = 7.6 Hz, 2H) , 2.49 (t, J = 7.3 Hz, 2H) , 2.17 (s, 6H) , 1.32 (t, J = 7.5 Hz, 3H) .
The following compounds were prepared similarly according to the synthetic procedures or methodologies exemplified herein.
2-Chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A3 as a hydrochloride salt. MS (ESI) m/z: 470.9 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 9.05 (br, 2H) , 7.54 (d, J = 7.9 Hz, 2H) , 7.39 (d, J = 7.8 Hz, 2H) , 4.62 (s, 2H) , 4.07 (m, 4H) , 3.49 (s, 3H) , 3.20 (br, 5H) , 2.80 (q, J = 7.5 Hz, 2H) , 2.55 (s, 3H) , 1.25 (t, J = 7.5 Hz, 3H) .
1-Chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylmethanesulfonamide A4 as a hydrochloride salt. MS (ESI) m/z: 507.1 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 8.92 (br, 2H) , 7.48 (d, J = 8.5 Hz, 2H) , 7.41 (d, J = 8.5 Hz, 2H) , 5.19 (s, 2H) , 4.58 (s, 2H) , 4.10-4.03 (m, 2H) , 3.47 (s, 3H) , 3.34 (s, 3H) , 3.16 (m, 2H) , 2.81 (q, J = 7.5 Hz, 2H) , 2.53 (s, 3H) , 1.23 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylpropiolamide A5 as a hydrochloride salt. 1H NMR (500 MHz, DMSO-d6) δ8.90 (br, 2H) , 7.50 (m, 2H) , 7.30 (m, 2H) , 4.28 (m, 2H) , 4.05 (m, 2H) , 3.47 (s, 3H) , 3.23 (s, 3H) , 3.18 (br, 2H) , 2.81 (q, J = 7.6 Hz, 2H) , 2.51 (3H, overlapped with the peak of DMSO-d6) , 1.99 (s, 1H) , 1.23 (t, J = 7.6 Hz, 3H) .
2- (2-Bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A6 as a hydrochloride salt. MS (ESI) m/z: 559.2, 561.1 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 9.77 (s, 1H) , 8.56 (br, 2H) , 7.63 (d, J = 8.3 Hz, 2H) , 7.37 (d, J = 8.3 Hz, 2H) , 4.49 (s, 2H) , 4.14 (s, 2H) , 4.02 (m, 2H) , 3.87 (t, J = 5.7 Hz, 2H) , 3.69 (t, J = 5.7 Hz, 2H) , 3.46 (s, 3H) , 3.31 (s, 3H) , 3.17 (m, 2H) , 2.81 (q, J = 7.5 Hz, 2H) , 2.56 (s, 3H) , 1.23 (t, J = 7.4 Hz, 3H) .
(E) -N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -4- (dimethylamino) -N-methylbut-2-enamide A7 as a dihydrochloride salt. MS (ESI) m/z: 506.2 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 10.87 (br, 1H) , 9.29 (br, 2H) , 7.54 (d, J = 8.1 Hz, 2H) , 7.30 (d, J = 8.3 Hz, 2H) , 6.71 (dt, J = 14.8, 7.2 Hz, 1H) , 6.13 (m, 1H) , 4.62 (s, 2H) , 4.10 (t, J = 6.3 Hz, 2H) , 3.76 (br, 2H) , 3.49 (s, 3H) , 3.25 (s, 3H) , 3.18 (m, 2H) , 2.81 (m, 2H) , 2.66 (d, J = 7.6 Hz , 6H) , 2.51 (s, 3H) , 1.23 (t, J = 7.6 Hz, 3H) .
(4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) -thio) methyl) phenyl) (methyl) sulfamoylfluoride A8 as a hydrochloride salt. MS (ESI) m/z: 477.0 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 8.98 (br, 2H) , 7.58 (d, J = 8.4 Hz, 2H) , 7.50 (d, J = 8.4 Hz, 2H) , 4.61 (s, 2H) , 4.05 (t, J = 6.3 Hz, 2H) , 3.47 (s, 3H) , 3.43 (s, 3H) , 3.15 (m, 2H) , 2.81 (q, J = 7.6 Hz, 2H) , 2.51 (3H, overlapped with the peak of DMSO-d6) , 1.23 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A9. MS (ESI) m/z: 435.1 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.54 (d, J = 8.1 Hz, 2H) , 7.40 (br, 1H) , 7.33 (d, J = 8.2 Hz, 2H) , 6.43 (dd, J = 16.9, 1.2 Hz, 1H) , 6.25 (dd, J = 16.9, 10.2 Hz, 1H) , 5.78 (dd, J = 10.3, 1.3 Hz, 1H) , 4.40 (s, 2H) , 3.86 (t, J = 6.8 Hz, 2H) , 3.40 (s, 3H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.86 (t, J = 6.8 Hz, 2H) , 2.43 (s, 3H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) ethenesulfonamide A10 as a hydrochloride salt. MS (ESI) m/z: 471.0 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 10.08 (s, 1H) , 8.89 (br, 2H) , 7.38 (d, J = 8.3 Hz, 2H) , 7.14 (d, J = 8.3 Hz, 2H ) , 6.79 (dd, J = 16.4, 10.0 Hz, 1H) , 6.12 (d, J = 16.4 Hz, 1H) , 6.05 (d, J = 9.9 Hz, 1H) , 4.51 (s, 2H) , 4.06 (m, 2H) , 3.48 (s, 3H) , 3.17 (m, 2H) , 2.82 (q, J = 7.5 Hz, 2H) , 2.55 (m, 2H) , 1.24 (t, J = 7.6 Hz, 3H) .
2- (2-Bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acetamide A11 as a hydrochloride salt. MS (ESI) m/z: 545.2, 547.1 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 8.93 (br, 2H) , 7.51 (t, J = 8.0 Hz, 2H) , 7.35 (br, 1H) , 4.59 (d, J = 7.8 Hz, 2H) , 4.05 (m, 3H) , 3.80-3.60 (m, 3H) , 3.47 (m, 6H) , 3.16 (br, 4H) , 2.79 (m, 3H) , 2.55 (m, 2H) , 1.27-1.20 (m, 3H) .
N- (3- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A12. MS (ESI) m/z: 435.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.90 (s, 1H) , 7.66 (s, 1H) , 7.49 (d, J = 7.8 Hz, 1H) , 7.27 (m, 1H) , 7.13 (d, J = 7.3 Hz, 1H) , 6.47-6.34 (m, 1H) , 6.32-6.24 (m, 1H) , 5.77 (d, J = 10.2 Hz, 1H) , 4.40 (s, 1H) , 3.88 (m, 2H) , 3.41 (s, 1H) , 2.90 (m, 4H) , 2.46 (s, 1H) , 1.36-1.27 (m, 3H) .
N- (4- ( ( (6- (4-Aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -phenyl) acrylamide A14. MS (ESI) m/z: 447.1 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.54 (d, J = 8.0 Hz, 2H) , 7.33 (d, J = 8.6 Hz, 2H) , 7.32 (br, 1H) , 6.43 (d, J = 16.9 Hz, 1H) , 6.24 (dd, J = 16.9, 10.2 Hz, 1H) , 5.78 (d, J =10.2 Hz, 1H) , 4.51 (d, J = 13.4 Hz, 2H) , 4.38 (s, 2H) , 3.29-3.14 (m, 2H) , 3.02 (m, 1H) , 2.89 (q, J = 7.6 Hz, 2H) , 1.95 (dd, J = 13.7, 3.8 Hz, 2H) , 1.44-1.34 (m, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (4- (2-hydroxyethyl) -1, 4-diazepan-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A15. MS (ESI) m/z: 491.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.55 (d, J = 8.0 Hz, 2H) , 7.50 (br, 1H) , 7.32 (d, J = 8.0 Hz, 2H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.26 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.38 (s, 2H) , 3.94 (m, 4H) , 3.62 (s, 2H) , 2.92 (m, 2H) , 2.81 (br, 4H) , 2.69 (br, 2H) , 2.10 (br, 2H) , 1.32 (t, J = 7.7 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -methyl) phenyl) acrylamide A16. MS (ESI) m/z: 461.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.56 (d, J = 8.0 Hz, 2H) , 7.45 (br, 1H) , 7.32 (d, J = 8.2 Hz, 2H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.25 (dd, J = 16.9, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.37 (s, 2H) , 4.01 (br, 2H) , 3.92 (t, J = 6.1 Hz, 2H) , 2.92 (q, J = 7.6 Hz, 2H) , 2.84-2.70 (m, 4H) , 2.46 (s, 3H) , 2.21 (m, 2H) , 1.32 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A17. MS (ESI) m/z: 449.2 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.55 (d, J = 7.9 Hz, 2H) , 7.54 (br, 1H) , 7.30 (d, J = 8.1 Hz, 2H) , 6.42 (d, J = 16.7 Hz, 1H) , 6.25 (dd, J = 16.8, 10.2 Hz, 1H) , 5.75 (d, J = 10.1 Hz, 1H) , 4.39 (s, 2H) , 3.84 (t, J = 7.0 Hz, 2H) , 3.40 (s, 3H) , 2.89 (q, J = 7.6 Hz, 2H) , 2.58 (t, J = 7.0 Hz, 2H) , 2.24 (s, 6H) , 1.30 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A19 as a mesylate salt. MS (ESI) m/z: 435.02 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 10.21 (s, 1H) , 8.55-8.29 (m, 2H) , 7.66 (d, J = 8.2 Hz, 2H) , 7.38 (d, J = 8.3 Hz, 2H) , 6.44 (dd, J =17.0, 10.1 Hz, 1H) , 6.26 (dd, J = 17.0, 2.0 Hz, 1H) , 5.76 (dd, J = 10.1, 2.0 Hz, 1H) , 4.49 (s, 2H) , 4.01 (t, J = 6.2 Hz, 2H) , 3.46 (s, 3H) , 3.19 (t, J = 6.4 Hz, 2H) , 2.81 (q, J = 7.5 Hz, 2H) , 2.58 (t, J = 5.3 Hz, 3H) , 2.33 (s, 3H) , 1.24 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A20. MS (ESI) m/z: 435.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.37 (br, 1H) , 7.31 (d, J = 8.1 Hz, 2H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.40 (s, 2H) , 3.84 (t, J = 7.0 Hz, 2H) , 3.41 (s, 3H) , 2.57 (m, 5H) , 2.25 (s, 6H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-phenyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A21. MS (ESI) m/z: 497.2 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.56 (d, J = 8.1 Hz, 2H) , 7.51 (m, 3H) , 7.45 (m, 3H) , 7.34 (d, J = 8.5 Hz, 2H) , 6.43 (dd, J = 16.8, 1.3 Hz, 1H) , 6.23 (dd, J = 16.8, 10.2 Hz, 1H) , 5.76 (dd, J = 10.2, 1.3 Hz, 1H) , 4.46 (s, 2H) , 3.90 (t, J = 7.0 Hz, 2H) , 3.44 (s, 3H) , 2.63 (t, J = 7.0 Hz, 2H) , 2.27 (s, 6H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (ethyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A22. MS (ESI) m/z: 463.1 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.58 (d, J = 8.0 Hz, 2H) , 7.50 (br, 1H) , 7.33 (d, J = 8.2 Hz, 2H) , 6.46 (dd, J = 16.9, 1.2 Hz, 1H) , 6.28 (dd, J = 16.9, 10.2 Hz, 1H) , 5.79 (dd, J = 10.1, 1.3 Hz, 1H) , 4.43 (s, 2H) , 3.85 (m, 4H) , 2.93 (q, J = 7.6 Hz, 2H) , 2.65 (t, J = 7.2 Hz, 2H) , 2.30 (s, 6H) , 1.33 (t, J = 7.5 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (diethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A23. MS (ESI) m/z: 477.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.79 (br, 1H) , 7.59 (d, J = 8.0 Hz, 2H) , 7.31 (d, J = 8.1 Hz, 2H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.30 (dd, J = 16.9, 10.1 Hz, 1H) , 5.77 (d, J = 10.1 Hz, 1H) , 4.42 (s, 2H) , 3.89 (t, J = 6.9 Hz, 2H) , 3.42 (s, 3H) , 2.92 (q, J = 7.5 Hz, 2H) , 2.74 (t, J = 6.8 Hz, 2H) , 2.57 (q, J = 7.1 Hz, 4H) , 1.33 (t, J = 7.6 Hz, 3H) , 1.01 (t, J = 7.2 Hz, 6H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) -2-oxoethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A24. MS (ESI) m/z: 477.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.56 (d, J = 7.8 Hz, 2H) , 7.43 (br, 1H) , 7.29 (d, J = 9.4 Hz, 2H) , 6.46 (d, J = 16.7 Hz, 1H) , 6.27 (dd, J = 16.8, 10.1 Hz, 1H) , 5.80 (d, J = 10.1 Hz, 1H) , 4.48 (s, 2H) , 4.34 (s, 2H) , 3.50 (s, 3H) , 3.09-2.61 (m, 8H) , 1.33 (t, J = 7.6 Hz, 3H) .
N- (4- (1- ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) ethyl) phenyl) acrylamide A25. MS (ESI) m/z: 463.0 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 10.20 (s, 1H) , 7.66 (d, J = 8.6 Hz, 2H) , 7.43 (d, J = 8.6 Hz, 2H) , 6.43 (dd, J = 16.9, 10.1 Hz, 1H) , 6.26 (dd, J = 17.0, 2.0 Hz, 1H) , 5.76 (dd, J = 10.1, 2.0 Hz, 1H) , 5.12 (q, J = 7.0 Hz, 1H) , 3.88 (m, 2H) , 3.39 (s, 3H) , 2.77 (q, J = 7.6 Hz, 2H) , 2.54 (m, 2H) , 2.21 (s, 6H) , 1.72 (d, J = 7.0 Hz, 3H) , 1.21 (t, J = 7.7 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) acrylamide A26. MS (ESI) m/z: 475.3 [M+H] +; 1H NMR (500 MHz, DMSO-d6) δ 10.19 (br s, 1H) , 7.64 (d, J = 8.1 Hz, 2H) , 7.37 (d, J = 8.2 Hz, 2H) , 6.43 (dd, J = 17.0, 10.1 Hz, 1H) , 6.25 (dd, J = 17.1, 2.0 Hz, 1H) , 5.76 (dd, J = 10.1, 2.0 Hz, 1H) , 4.56 (d, J = 13.4 Hz, 2H) , 4.47 (s, 2H) , 3.20 (t, J = 12.7 Hz, 2H) , 2.77 (q, J = 7.6 Hz, 2H) , 2.21 (s, 6H) , 2.06-1.95 (m, 1H) , 1.88 (d, J = 11.9 Hz, 2H) , 1.45-1.40 (m, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -acrylamide A27. MS (ESI) m/z: 392.2 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.54 (d, J = 8.1 Hz, 2H) , 7.33 (d, J = 8.2 Hz, 2H) , 7.29 (brs, 1H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.41 (s, 2H) , 3.36 (s, 6H) , 2.90 (q, J = 7.6 Hz, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A28. MS (ESI) m/z: 463.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.55 (d, J = 8.1 Hz, 2H) , 7.33 (d, J = 8.2 Hz, 2H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.79 (d, J = 10.3 Hz, 1H) , 4.40 (s, 2H) , 3.80-3.72 (m, 2H) , 3.37 (s, 3H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.26 (t, J = 7.1 Hz, 2H) , 2.21 (s, 6H) , 1.84 (p, J = 7.2 Hz, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- ( (2-methoxyethyl) (methyl) amino) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A29. MS (ESI) m/z: 436.2 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.55 (d, J =8.1 Hz, 2H) , 7.32 (d, J = 8.2 Hz, 2H) , 7.30 (br s, 1H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.38 (s, 2H) , 3.92 (t, J = 5.3 Hz, 2H) , 3.60 (t, J = 5.3 Hz, 2H) , 3.44 (s, 3H) , 3.33 (s, 3H) , 2.91 (q, J = 7.6 Hz, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A31. MS (ESI) m/z: 461.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.54 (d, J = 8.1 Hz, 2H) , 7.31 (d, J = 8.2 Hz, 2H) , 7.28 (brs, 1H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.8, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.40 (s, 2H) , 3.83 (t, J = 7.1 Hz, 2H) , 3.39 (s, 3H) , 2.58 (t, J = 7.0 Hz, 2H) , 2.24 (s, 6H) , 2.05 (tt, J = 9.0, 5.8 Hz, 1H) , 1.32-1.23 (m, 2H) , 1.15-1.03 (m, 2H) .
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A32. MS (ESI) m/z: 473.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.58-7.53 (m, 3H) , 7.29 (d, J = 8.1 Hz, 2H) , 6.43 (d, J = 16.8 Hz, 1H) , 6.25 (dd, J = 16.9, 10.2 Hz, 1H) , 5.76 (d, J = 10.2 Hz, 1H) , 4.36 (s, 2H) , 3.96-3.90 (m, 2H) , 3.88 (t, J = 6.0 Hz, 2H) , 2.72 (t, J = 4.7 Hz, 2H) , 2.61-2.50 (m, 2H) , 2.36 (s, 3H) , 2.08-2.01 (m, 3H) , 1.32-1.23 (m, 2H) , 1.15 –1.03 (m, 2H) .
2- ( (2- (1-Acryloylpiperidin-4-yl) ethyl) thio) -6- ( (2- (dimethylamino) ethyl) (methyl) -amino) -4-ethylpyridine-3, 5-dicarbonitrile A33. MS (ESI) m/z: 455.2 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 6.57 (dd, J = 16.8, 10.6 Hz, 1H) , 6.26 (dd, J = 16.9, 1.9 Hz, 1H) , 5.67 (dd, J = 10.6, 1.9 Hz, 1H) , 4.67 (d, J = 13.3 Hz, 1H) , 4.00 (d, J = 13.6 Hz, 1H) , 3.93-3.84 (m, 2H) , 3.41 (s, 3H) , 3.20 (q, J = 7.7 Hz, 2H) , 3.05 (t, J = 12.9 Hz, 1H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.65 (t, J = 7.1 Hz, 2H) , 2.62-2.58 (m , 1H) , 2.31 (s, 6H) , 1.82-1.57 (m, 5H) , 1.30 (t, J = 7.6 Hz, 3H) , 1.20-1.11 (m, 2H) .
N- ( (1r, 4r) -4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) cyclohexyl) acrylamide A34. MS (ESI) m/z: 455.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 6.27 (d, J = 16.9 Hz, 1H) , 6.04 (dd, J = 16.9, 10.3 Hz, 1H) , 5.63 (d, J = 10.3 Hz, 1H) , 5.34 (d, J = 8.0 Hz, 1H) , 3.87 (t, J = 7.1 Hz, 2H) , 3.82 (brs , 1H) , 3.42 (s, 3H) , 3.10 (d, J = 6.9 Hz, 2H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.62 (t, J =7.1 Hz, 2H) , 2.31 (s, 6H) , 2.10-2.05 (m , 2H) , 2.00-1.95 (m , 2H) , 1.57 (brs, 1H) , 1.31 (t, J = 7.6 Hz, 3H) , 1.16 (q, J = 12.1, 11.7 Hz, 4H) .
2- ( (4- (4-Acryloylpiperazin-1-yl) benzyl) thio) -6- ( (2- (dimethylamino) ethyl) - (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A35. MS (ESI) m/z: 518.3 [M+H] +; 1H NMR (500 MHz, CDCl3) δ 7.25 (d, J =7.4 Hz, 2H) , 6.86 (d, J = 8.4 Hz, 2H) , 6.60 (dd, J = 16.8, 10.5 Hz, 1H) , 6.33 (dd, J = 16.9, 1.8 Hz, 1H) , 5.74 (dd, J = 10.5, 1.8 Hz, 1H) , 4.37 (s, 2H) , 3.91-3.80 (m, 4H) , 3.72 (brs, 2H) , 3.42 (s, 3H) , 3.18 (t, J = 5.2 Hz, 4H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.60 (t, J = 7.1 Hz, 2H) , 2.26 (s, 6H) , 1.31 (t, J = 7.6 Hz, 3H) .
The following compounds are prepared similarly according to the synthetic procedures or methodologies exemplified herein.
N- (4- ( ( (3, 5-Dicyano-4-cyclopentyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A101.
N- (4- ( ( (4-Butyl-3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A102.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A103.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A104.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A105.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A106.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A107.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- ( (3- (dimethylamino) propyl) (methyl) -amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A108.
N- (4- ( ( (3, 5-Dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A109.
N- (4- ( ( (3, 5-Dicyano-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -4- (2, 2, 2-trifluoro-ethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A110.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A111.
N- (4- ( ( (3, 5-Dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A112.
N- (4- ( ( (3, 5-Dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A113.
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A114.
N- (4- ( ( (3, 5-Dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A115.
N- (4- ( ( (3, 5-Dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A116.
N- (4- ( ( (3, 5-Dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A117.
N- (4- (2- ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) acrylamide A118.
N- (4- (2- ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) but-2-ynamide A119.
N- (4- (2- ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) acrylamide A120.
N- (4- (2- ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) but-2-ynamide A121.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A122.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2- (trifluoromethyl) phenyl) acrylamide A123.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A124.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methylphenyl) acrylamide A125.
N- (5- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) pyridin-2-yl) acrylamide A126.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A127.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A128.
N- (4- ( ( (3, 5-Dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A129.
2- ( ( (1-Acryloyl-1, 2, 3, 4-tetrahydroquinolin-6-yl) methyl) thio) -6- ( (2- (dimethyl-amino) ethyl) (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A130.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A131.
N- (4- (2-Amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A132.
N- (4- (2-Amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A133.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) fluoromethyl) phenyl) acrylamide A134.
N- (4- ( ( (3, 5-Dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) difluoromethyl) phenyl) acrylamide A135.
N- (4- ( ( (6- (6-Amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A136.
N- (4- ( ( (6- (6-Acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A137.
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-Amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A138.
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-Acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A139.
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-Amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A140.
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-Acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A141.
The following compounds were prepared similarly according to the synthetic procedure or methodologies exemplified herein.
N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A36. MS m/z (ESI) : 467.27 [M+H] +. 1H NMR (500 MHz, CDCl3) δ 8.37 (t, J = 8.0 Hz, 1H) , 7.46 (br s, 1H) , 7.18 –7.09 (m, 2H) , 6.45 (dd, J = 16.8, 1.2 Hz, 1H) , 6.28 (dd, J = 16.8, 10.3 Hz, 1H) , 5.89 –5.76 (m, 1H) , 4.39 (s, 2H) , 3.83 (t, J = 7.1 Hz, 2H) , 3.40 (s, 3H) , 2.91 (q, J = 7.6 Hz, 2H) , 2.58 (t, J = 7.0 Hz, 2H) , 2.25 (s, 6H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A37. MS m/z (ESI) : 492.30 [M+H] +. 1H NMR (500 MHz, CDCl3) δ 7.77 (br s, 1H) , 7.60 (d, J = 8.1 Hz, 2H) , 7.51 (s, 1H) , 7.42 (d, J = 8.2 Hz, 2H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.26 (dd, J = 16.9, 10.2 Hz, 1H) , 5.79 (d, J = 10.2 Hz, 1H) , 5.59 (br s, 1H) , 5.42 (s, 1H) , 4.26 –4.21 (m, 1H) , 3.57 –3.49 (m, 1H) , 3.47 (s, 3H) , 2.90 (q, J = 7.6 Hz, 2H) , 2.79 (td, J = 11.0, 9.4, 4.0 Hz, 1H) , 2.58 (q, J = 9.6 Hz, 1H) , 2.31 (s, 6H) , 1.33 –1.27 (m, 3H) .
Tert-butyl ( (1R, 5S, 6s) -3- (6- ( (4-acrylamidobenzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) -3-azabicyclo [3.1.0] hexan-6-yl) carbamate A38. MS m/z (ESI) : 567.25 [M+Na] +. 1H NMR (500 MHz, CDCl3) δ7.54 (d, J = 8.1 Hz, 2H) , 7.37 (br s, 1H) , 7.33 (d, J = 8.1 Hz, 2H) , 6.44 (d, J = 16.8 Hz, 1H) , 6.24 (dd, J = 16.9, 10.2 Hz, 1H) , 5.78 (d, J = 10.2 Hz, 1H) , 4.82 (br s, 1H) , 4.37 (s, 2H) , 4.25 (d, J = 11.9 Hz, 2H) , 3.88 (d, J = 11.7 Hz, 2H) , 2.87 (q, J = 7.5 Hz, 2H) , 2.22 (s, 1H) , 1.89 (s, 2H) , 1.44 (s, 9H) , 1.28 (t, J = 7.5 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A39. MS m/z (ESI) : 457.18 [M+Na] +. 1H NMR (500 MHz, DMSO-d6) δ 10.23 (s, 1H) , 7.89 (s, 1H) , 7.66 (d, J = 8.2 Hz, 2H) , 7.46 (d, J = 8.2 Hz, 2H) , 7.32 (s, 1H) , 6.44 (dd, J = 17.0, 10.1 Hz, 1H) , 6.27 (d, J = 16.9 Hz, 1H) , 5.77 (d, J = 10.2 Hz, 1H) , 5.56 (s, 1H) , 2.76 (q, J = 7.6 Hz, 2H) , 1.21 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2- yl) thio) methyl) phenyl) acrylamide A40. MS m/z (ESI) : 445.23 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.19 (s, 1H) , 7.63 (d, J = 8.2 Hz, 2H) , 7.36 (d, J = 8.2 Hz, 2H) , 6.43 (dd, J = 17.0, 10.0 Hz, 1H) , 6.26 (dd, J = 17.0, 1.9 Hz, 1H) , 5.76 (dd, J = 10.1, 2.0 Hz, 1H) , 4.47 (s, 2H) , 4.07 (d, J = 11.7 Hz, 2H) , 3.87 (d, J = 11.5 Hz, 2H) , 2.74 (q, J = 7.6 Hz, 2H) , 2.10 (br, 2H) , 2.00 (s, 1H) , 1.65 (s, 2H) , 1.20 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (6- ( (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A41. MS m/z (ESI) : 487.28 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.19 (s, 1H) , 8.08 (d, J = 3.7 Hz, 1H) , 7.63 (d, J = 8.1 Hz, 2H) , 7.37 (d, J = 8.1 Hz, 2H) , 6.44 (dd, J = 16.9, 10.1 Hz, 1H) , 6.26 (d, J = 16.9 Hz, 1H) , 5.76 (d, J = 9.8 Hz, 1H) , 4.48 (s, 2H) , 4.20 (d, J = 11.7 Hz, 2H) , 3.93 (d, J = 11.6 Hz, 2H) , 2.75 (q, J = 7.6 Hz, 2H) , 2.44 –2.38 (m, 1H) , 1.86 (s, 2H) , 1.79 (s, 3H) , 1.20 (t, J = 7.6 Hz, 3H) . 
(E) -N- (4- (2- (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) vinyl) phenyl) acrylamide A42. MS m/z (ESI) : 429.33 [M+H] +. 1H NMR (500 MHz, CDCl3) δ 7.87 (d, J =15.3 Hz, 1H) , 7.66 (d, J = 8.2 Hz, 2H) , 7.59 (d, J = 8.3 Hz, 2H) , 7.37 (s, 1H) , 7.34 (d, J = 15.2 Hz, 1H) , 6.47 (d, J = 16.8 Hz, 1H) , 6.26 (dd, J = 16.8, 10.3 Hz, 1H) , 5.82 (d, J = 10.2 Hz, 1H) , 3.93 (t, J = 7.4 Hz, 2H) , 3.47 (s, 3H) , 2.99 (q, J = 7.6 Hz, 2H) , 2.66 (t, J = 7.2 Hz, 2H) , 2.35 (s, 6H) , 1.35 (t, J = 7.7 Hz, 3H) .
N- (4- ( ( (6- ( (1R, 5S, 6r) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A43. MS m/z (ESI) : 445.20 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.18 (s, 1H) , 7.63 (d, J = 8.1 Hz, 2H) , 7.37 (d, J = 8.1 Hz, 2H) , 6.44 (dd, J = 16.9, 10.1 Hz, 1H) , 6.26 (dd, J = 16.9, 2.1 Hz, 1H) , 5.81 –5.74 (m, 1H) , 4.48 (s, 2H) , 4.02 (br, 2H) , 3.93 (d, J = 11.1 Hz, 2H) , 2.75 (q, J = 7.6 Hz, 2H) , 2.41 (t, J = 6.7 Hz, 1H) , 1.75 (br, 4H) , 1.20 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) -2-fluoroacrylamide A44. MS m/z (ESI) : 465.4 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.34 (br s, 1H) , 7.68 (d, J = 8.1 Hz, 2H) , 7.39 (d, J = 8.0 Hz, 2H) , 5.71 (d, J = 46.7 Hz, 1H) , 5.44 (d, J = 15.0 Hz, 1H) , 4.48 (s, 2H) , 4.42 (d, J = 13.2 Hz, 2H) , 2.98 (br s, 1H) , 2.77 (d, J = 8.2 Hz, 2H) , 1.87 (d, J = 12.6 Hz, 2H) , 1.35 (d, J = 11.2 Hz, 2H) , 1.26 –1.17 (m, 3H) .
N- (4- ( ( (6- (4- (2-aminoacetamido) piperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A45. MS m/z (ESI) : 504.4 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.19  (s, 1H) , 7.81 (d, J = 8.0 Hz, 1H) , 7.64 (d, J = 8.0 Hz, 2H) , 7.37 (d, J = 8.0 Hz, 2H) , 6.43 (dd, J = 16.9, 10.1 Hz, 1H) , 6.26 (d, J = 16.9 Hz, 1H) , 5.76 (d, J = 10.0 Hz, 1H) , 4.50 –4.38 (m, 4H) , 3.96 (br s, 1H) , 3.08 (s, 2H) , 2.78 (d, J = 7.9 Hz, 2H) , 2.09 –1.81 (m, 4H) , 1.53 (q, J = 11.9 Hz, 2H) , 1.23 –1.20 (d, J = 8.1 Hz, 3H) .
N- (6- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) pyridin-3-yl) acrylamide A46. MS m/z (ESI) : 448.4 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.40 (s, 1H) , 8.73 (s, 1H) , 8.09 (d, J =8.4 Hz, 1H) , 7.47 (d, J = 8.5 Hz, 1H) , 6.44 (dd, J = 16.9, 10.1 Hz, 1H) , 6.30 (d, J = 16.9 Hz, 1H) , 5.81 (d, J =10.1 Hz, 1H) , 4.57 (s, 2H) , 4.38 (d, J = 13.5 Hz, 2H) , 2.91 (br s, 1H) , 2.77 (q, J = 7.7 Hz, 2H) , 1.98 (br, 2H) , 1.82 (d, J = 12.8 Hz, 2H) , 1.32 –1.20 (m, 5H) .
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A47. MS m/z (ESI) : 477.4 [M+H] +. 1H NMR (500 MHz, CDCl3) δ 8.39 (d, J = 8.3 Hz, 1H) , 7.85 (br s, 1H) , 6.96 (d, J = 8.4 Hz, 1H) , 6.90 (s, 1H) , 6.41 (d, J = 16.9 Hz, 1H) , 6.27 (dd, J = 16.9, 10.1 Hz, 1H) , 5.76 (d, J = 10.1 Hz, 1H) , 4.52 (d, J = 13.7 Hz, 2H) , 4.37 (d, J = 5.6 Hz, 2H) , 3.89 (s, 3H) , 3.24 (t, J = 12.4 Hz, 2H) , 3.03 (q, J = 5.7, 5.2 Hz, 1H) , 2.89 (q, J = 7.7 Hz, 2H) , 1.96 (d, J = 13.1 Hz, 2H) , 1.42 (q, J = 10.1, 9.6 Hz, 2H) , 1.31 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2, 5-difluorophenyl) acrylamide A48. MS m/z (ESI) : 483.2 [M+H] +. 1H NMR (500 MHz, CDCl3) δ 8.28 (dd, J = 11.4, 6.5 Hz, 1H) , 7.48 (s, 1H) , 7.18 (dd, J = 11.1, 6.5 Hz, 1H) , 6.47 (d, J = 16.7 Hz, 1H) , 6.26 (dd, J = 16.8, 10.3 Hz, 1H) , 5.85 (d, J = 10.2 Hz, 1H) , 4.47 (d, J = 13.6 Hz, 2H) , 4.38 (s, 2H) , 3.22 (t, J = 12.3 Hz, 2H) , 3.06 –3.00 (m, 1H) , 2.90 (q, J = 7.6 Hz, 2H) , 1.98 –1.92 (m, 2H) , 1.40 –1.35 (m, 2H) , 1.31 (t, J = 7.7 Hz, 3H) .
N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A49. MS m/z (ESI) : 490.4 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.22 (s, 1H) , 7.89 (s, 1H) , 7.66 (d, J = 8.2 Hz, 2H) , 7.46 (d, J = 8.2 Hz, 2H) , 7.31 (s, 1H) , 6.43 (dd, J = 16.9, 10.1 Hz, 1H) , 6.26 (d, J = 16.9 Hz, 1H) , 5.77 (d, J = 10.1 Hz, 1H) , 5.50 (s, 1H) , 4.42 (d, J = 13.5 Hz, 2H) , 2.94 (p, J =5.1 Hz, 1H) , 2.75 (q, J = 7.6 Hz, 2H) , 1.86 (d, J = 13.0 Hz, 2H) , 1.33 –1.28 (m, 2H) , 1.21 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) -2-fluoroacrylamide A50. MS m/z (ESI) : 508.3 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.37 (br s, 1H) , 7.90 (s, 1H) , 7.71 (d, J = 8.2 Hz, 2H) , 7.48 (d, J = 8.3 Hz, 2H) , 7.33 (s, 1H) , 5.72 (dd, J = 47.6, 3.7 Hz, 1H) , 5.52 (s, 1H) , 5.44 (dd, J = 15.6, 3.6 Hz, 1H) , 4.41 (d, J = 13.6 Hz, 2H) , 2.94 (br, 1H) , 2.75 (q, J = 7.7 Hz, 2H) , 2.02 (br, 2H) , 1.86 (d, J = 12.4 Hz, 2H) , 1.37 –1.28 (m, 2H) , 1.21 (t, J = 7.6 Hz, 3H) .
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-hydroxypiperidin-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A51. MS m/z (ESI) : 448.3 [M+H] +. 1H NMR (500 MHz, DMSO-d6) δ 10.19 (s, 1H) , 7.63 (d, J = 8.1 Hz, 2H) , 7.36 (d, J = 8.2 Hz, 2H) , 6.44 (dd, J = 17.0, 10.1 Hz, 1H) , 6.26 (dd, J = 17.0, 2.0 Hz, 1H) , 5.80 –5.71 (m, 1H) , 4.84 (br, 1H) , 4.46 (s, 2H) , 4.17 (dt, J = 14.4, 4.2 Hz, 2H) , 3.81 (br, 1H) , 3.58 (t, J = 8.9, Hz, 2H) , 2.77 (q, J = 7.6 Hz, 2H) , 1.87 (dt, J = 13.6, 3.8 Hz, 2H) , 1.49 (dtd, J = 12.0, 8.3, 3.3 Hz, 2H) , 1.22 (t, J = 7.6 Hz, 3H) .
Example 6
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A52
Compound A52 was synthesized as shown in Scheme 6.
Scheme 6
Preparation of 2- (dimethylamino) -4-ethyl-6-mercaptopyridine-3, 5-dicarbonitrile 6.1. To a solution of compound 1.2 (20.0 g, 88.47 mmol) in DMF (200 mL) was added slowly dimethylamine THF solution (44.3 mL, 88.46 mmol) and TEA (12.3 mL, 88.46 mmol) at 0 ℃. Then potassium thioacetate (23.69 mL, 221 mmol) was added, the mixture was stirred at room temperature for 2 hours. LCMS showed the reaction was completed. Hydrochloric acid solution (180 mL, 1 M) and water (360 mL) were added to quench the reaction, stirring for 30 minutes. The mixture was filtered, the cake was washed with water (150 mL) , dried and concentrated under reduced pressure. The crude product was dissolved in ethyl acetate (200 mL) , stirred for 30 minutes, and filtered. The filter cake was washed with ethyl acetate (20 mL) , dried, and the solid was collected and concentrated under reduced pressure to obtain compound 6.1 (18.3 g, Y: 89.1%) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) δ 3.28 (s, 6H) , 2.73-2.63 (m, 2H) , 1.25-1.18 (m, 3H) . MS m/z (ESI) : 233.1 [M+H] +.
Preparation of N- (4- (hydroxymethyl) phenyl) acrylamide 6.3. To a solution of p-amino benzyl alcohol (2.0 g, 16.24 mmol) and sodium bicarbonate (2.73 g, 32.48 mmol) in THF (24 mL) and water (8 mL) was added acryloyl chloride (1.47 g, 16.24 mmol) , the mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The mixture was diluted with water (50 mL) , and extracted with EtOAc (40 mL×3) , the combined organics were washed with brine (100 mL) , dried over anhydrous Na2SO4, and concentrated to afford compound 6.3 (2.8 g, Y: 97.3%) as a white solid. MS m/z (ESI) : 178.2 [M+H] +.
Preparation of 4-acrylamidobenzyl methanesulfonate 6.4. To a solution of compound 6.3 (300 mg, 1.69 mmol) and TEA (256.97 mg, 2.54 mmol) in DCM (6 mL) was added dropwise (203.63 mg, 1.78 mmol) at 0 ℃. The mixture was stirred at 0 ℃ for 2 hours. TLC showed the reaction was completed. The reaction was quenched with saturated NaHCO3 solution, extracted with DCM (20 mL×3) , the combined organics were washed with brine (50 mL) , dried over anhydrous Na2SO4, and concentrated to afford compound 6.4 (350 mg, Y: 81.1%) as a yellow solid.
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A52. To a solution of compound 6.4 (350 mg, 1.37 mmol) and compound 6.1 (318.5 mg, 1.37 mmol) in DCM (6 mL) was added TEA (145.6 mg, 1.44 mmol) at 0 ℃. The mixture was stirred at 25 ℃ for 1 hour. LCMS showed the reaction was completed. The mixture was diluted with water (20 mL) , and extracted with DCM (20 mLx3) , the combined organics were washed with brine (50 mL) , dried over anhydrous Na2SO4, and concentrated. The crude was purified by preparative HPLC to afford compound A52 as  a white solid. MS m/z (ESI) : 392.2 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.16 (s, 1H) , 7.62 (d, J = 8.5 Hz, 2H) , 7.36 (d, J = 8.5 Hz, 2H) , 6.42 (dd, J = 17.0, 10.2 Hz, 1H) , 6.25 (dd, J = 16.8, 1.9 Hz, 1H) , 5.75 (dd, J =10.0, 2.1 Hz, 1H) , 4.48 (s, 2H) , 3.36 (s, 6H) , 2.77 (q, J = 7.6 Hz, 3H) , 1.21 (t, J = 7.6 Hz, 3H) .
The following compounds were prepared similarly according to the synthetic procedure or methodologies exemplified herein.
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A53.1H NMR (400 MHz, DMSO-d6) δ1H-NMR (400 MHz, DMSO-D6) δ 7.42 (d, J = 8.2 Hz, 2H) , 7.29 (d, J = 8.5 Hz, 2H) , 6.83 (dd, J = 16.5, 10.2 Hz, 1H) , 6.13 (d, J = 10.2 Hz, 1H) , 6.03 (d, J =16.2 Hz, 1H) , 4.52 (s, 2H) , 3.29 (s, 6H) , 3.15 (s, 3H) , 2.77 (q, J = 7.5 Hz, 2H) , 1.21 (t, J = 7.6 Hz, 3H) . LC-MS m/z (ESI) : 442.1 [M+H] +.
N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) oxy) methyl) phenyl) acrylamide A54. MS m/z (ESI) : 376.2 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.20 (s, 1H) , 7.77-7.59 (m, 2H) , 7.48-7.33 (m, 2H) , 6.53-6.34 (m, 1H) , 6.31-6.20 (m, 1H) , 5.74-5.68 (m, 1H) , 5.42 (s, 2H) , 3.32 (s, 6H) , 2.84-2.71 (m, 2H) , 1.26-1.18 (m, 3H) .
Example 8
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfinyl) methyl) phenyl) acrylamide A56
Compound A56 was synthesized as shown in Scheme 8.
Scheme 8
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfinyl) methyl) phenyl) acrylamide A56. To a solution of compound A52 (150 mg, 0.38 mmol) in Dichloromethane (3 ml) was added 3-chloroperoxybenzoic acid (82 mg, 0.38 mmol, 80wt%) at 0 ℃. The  reaction mixture was stirred at 0 ℃ for 1 hour. LCMS showed the reaction was completed. The mixture was quenched with saturated Na2SO3 aqueous solution (20 mL) , then extracted with DCM (20 mL×2) . The combined organicss were washed with saturated NaHCO3 aqueous solution (20 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by preparative HPLC to obtain compound A56 (52.9 mg, Y: 33.9%) as a white solid. MS m/z (ESI) : 408.2 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.15 (s, 1H) , 7.56 (d, J = 8.5 Hz, 2H) , 7.03 (d, J = 8.5 Hz, 2H) , 6.41 (dd, J = 17.0, 10.2 Hz, 1H) , 6.24 (dd, J = 16.9, 2.1 Hz, 1H) , 5.74 (dd, J = 10.0, 2.1 Hz, 1H) , 4.34 (s, 2H) , 3.37 (s, 6H) , 2.77 (q, J = 7.6 Hz, 2H) , 1.11 (t, J = 7.6 Hz, 3H) .
Example 9
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfonyl) methyl) phenyl) acrylamide A57
Compound A57 was synthesized as shown in Scheme 9.
Scheme 9
Preparation of tert-butyl (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfonyl) methyl) phenyl) carbamate 9.1. To a solution of compound 7.1 (200 mg, 0.46 mmol) in DCM (5 mL) was added 3-chloroperoxybenzoic acid (346 mg, 1.6 mmol, 80wt%) . The reaction mixture was stirred at 25 ℃ for 16 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated Na2SO3 aqueous solution (50 mL) , then extracted with DCM (50 mL×2) . The combined organics were washed with saturated NaHCO3 aqueous solution (30 mL×2) , dried over anhydrous Na2SO4 and filtered. The filtrate was concentrate and purified by reverse phase to obtain compound 9.1 (100 mg, Y: 46.9%) as a white solid. MS m/z (ESI) : 492.3 [M+Na] +.
Preparation of 2- ( (4-aminobenzyl) sulfonyl) -6- (dimethylamino) -4-ethylpyridine-3, 5-dicarbonitrile 9.2. To a solution of compound 9.1 (90 mg, 0.19 mmol) in DCM (2 mL) under a nitrogen atmosphere was added hydrochloric acid in 1, 4-dioxane (2 mL, 4.0 M) . The reaction mixture was stirred at 25 ℃ for 1 hour. LCMS showed the reaction was completed. The reaction mixture was concentrated to obtain compound 9.2 (65 mg, Y:  91.8%) as a yellow solid. MS m/z (ESI) : 392.1 [M+Na] +.
Preparation of N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfonyl) methyl) phenyl) acrylamide A61. To a solution of compound 9.2 (65 mg, 0.18 mmol) in THF (1 mL) was added sodium bicarbonate (22 mg, 0.26 mmol) in water (0.5 mL) at 0 ℃, then acryloyl chloride (19 mg, 0.21 mmol) was added slowly. The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was extracted with DCM (20 mL × 3) . The combined organics were washed with saturated NaHCO3 aqueous solution (50 mL) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by by preparative HPLC to obtain compound A57 (67 mg, Y: 89.9%) as a white solid. MS m/z (ESI) : 424.3 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.24 (s, 1H) , 7.66 (d, J = 8.5 Hz, 2H) , 7.29 (d, J = 8.5 Hz, 2H) , 6.43 (dd, J = 16.9, 10.0 Hz, 1H) , 6.26 (dd, J = 16.9, 2.1 Hz, 1H) , 5.77 (dd, J = 10.2, 1.9 Hz, 1H) , 4.92 (s, 2H) , 3.41 (s, 6H) , 2.89 (q, J = 7.6 Hz, 2H) , 1.20 (t, J = 7.6 Hz, 3H) .
Example 10
Preparation of (R) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58a and (S) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58b
Compound A58a and A58b was synthesized as shown in Scheme 10.
Scheme 10
Preparation of 2-hydroxy-2- (4-nitrophenyl) acetonitrile 10.1. To a solution of 4-nitrobenzaldehyde  (12.0 g, 79.5 mmol) in DCM (120 ml) in a nitrogen atmosphere was added trimethylsilylcyanide (7.9 g, 79.5 mmol) and zinc diiodide (12.7 g, 40.0 mol) . The reaction mixture was stirred at 25 ℃ for 16 hours. TLC showed the reaction was completed. The reaction was quenched with saturated NaHCO3 aqueous solution (200 mL) , and then extracted with DCM (100 mL×3) . The combined organics were washed with brine (250 mL× 2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel to obtain compound 10.1 (7.8 g, Y: 55.3%) as a yellow solid. 1H-NMR (400 MHz, DMSO-d6) δ 8.31 (dd, J = 6.9, 2.2 Hz, 2H) , 7.77 (dd, J = 7.0, 1.5 Hz, 2H) , 7.40 (d, J = 6.3 Hz, 1H) , 5.99 (d, J = 6.6 Hz, 1H) .
Preparation of 2- (4-aminophenyl) -2-hydroxyacetonitrile 10.2. To a solution of compound 10.1 (8.0 g, 45.0 mmol) in MeOH (80 mL) and water (16 mL) was added ammonium chloride (2.4 g, 225.0 mol) and Fe powder (12.6 g, 225.0 mol) . The reaction mixture was stirred at 40 ℃ for 2 hours. TLC showed the reaction was completed. The reaction mixture was extracted with EtOAc (150 mL×3) . The combined organics were washed with brine (100 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel to obtain compound 10.2 (2.5 g, Y: 37.9%) as a yellow solid. MS m/z (ESI) : 149.1 [M+H] +.
Preparation of tert-butyl (4- (cyano (hydroxy) methyl) phenyl) carbamate 10.3. To a solution of compound 10.2 (2.3 g, 15.5 mmol) in THF (25 ml) in a nitrogen atmosphere was added di-tert-butyl dicarbonate (4.1 g, 18.6 mmol) and TEA (4.7 g, 46.5 mol) . The reaction mixture was stirred at 25 ℃ for 16 hours. TLC showed the reaction was completed. The reaction mixture was concentrated and purified by column chromatography on silica gel to obtain compound 10.3 (1.9 g, Y: 50%) as a shallow yellow solid.
Preparation of tert-butyl (4- (2-amino-1-hydroxy-2-oxoethyl) phenyl) carbamate 10.4. To a solution of compound 10.3 (1.9 g, 7.7 mmol) in DMSO (20 mL) was added potassium carbonate (5.3 g, 38.5 mmol) and hydrogen peroxide solution (4 mL, 25%wt) . The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated ammonium chloride aqueous solution (50 mL) , and then extracted with EtOAc (100 mL×2) . The combined organics were washed with brine (100 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel to obtain compound 10.4 (1.2 g, Y: 60%) as a yellow solid. MS m/z (ESI) : 289.2 [M+Na] +.
Preparation of 2-amino-1- (4- ( (tert-butoxycarbonyl) amino) phenyl) -2-oxoethyl methanesulfonate 10.5. To a solution of compound 10.4 (1.2 g, 4.5 mmol) in DCM (12 mL) in a nitrogen atmosphere was added TEA (0.9 g, 9.0 mmol) . After cooled to 0 ℃, to the reaction mixture was slowly added methanesulfonyl chloride (0.5 g, 4.5 mmol) . The reaction mixture was stirred at 25 ℃ for 2 hours. TLC showed the reaction was completed. The reaction was quenched with saturated ammonium chloride aqueous solution (20 mL) , and then extracted with DCM (30 mL×3) . The combined organics were washed with brine (50 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to obtain compound 10.5 (1.3 g, crude) as a yellow oil.
Preparation of tert-butyl (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) carbamate 10.6. To a solution of compound 6.1 (0.75 g, 3.8 mmol) in DCM (15 mL) in a nitrogen atmosphere was added triethylamine (0.9 g, 9.0 mmol) . After cooled to 0 ℃, crude compound 10.5 (1.3 g, 3.8 mmol) was added. The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction was quenched with saturated ammonium chloride aqueous solution (50 mL) , and then extracted with DCM (50 mL×3) . The combined organics were washed with brine (50 mL× 2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel to obtain compound 10.6 (310 mg, Y: 18%) as a yellow solid. MS m/z (ESI) : 481.4 [M+H] +.
Preparation of 2- (4-aminophenyl) -2- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) acetamide 10.7. To a solution of compound 10.6 (310 mg, 0.65 mmol) in DCM (2 mL) in a nitrogen atmosphere was added hydrochloric acid in 1, 4-dioxane (5 mL, 4.0 M) . The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was concentrated to obtain compound 10.7 (240 mg, Y: 98%) as a yellow solid. MS m/z (ESI) : 402.9 [M+Na] +.
Preparation of N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide 10.8. To a solution of compound 10.7 (240 mg, 0.64 mmol) in THF (2 mL) was added water (1 mL) and NaHCO3 (106 mg, 1.28 mmol) . After cooled to 0 ℃, acryloyl chloride (58 mg, 0.64 mmol) was slowly added. The reaction mixture was stirred at 25 ℃ for 16 hours. LCMS showed the reaction was completed. The reaction mixture was extracted with DCM (30 mL×3) . The combined organics were washed with brine (50 mL× 2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by preparative HPLC to obtain compound 10.8 (100 mg, Y: 36.5%) as a white solid. LC-MS m/z (ESI) : 435.1 [M+H] +.
Preparation of (R) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58a and (S) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58b. Compound 10.8 (100 mg) was separated by chiral preparative column chromatography (Chiral preparative column type and size: Cellulose-SZ 100x4.6mmx5.0um; Elution: Methanol (with 20 mM ammonia) /Dichloromethane = 1: 1; Column temperature: 35 ℃; Flow rate: 20.0 mL/min) to obtain compound A58a (33.2 mg, Y: 33%) as a white solid and its isomer A58b (32.9 mg, Y: 33%) . RT = 1.74 min for A58a and RT = 1.61 min for A58b under the chiral analytical condition (Chiral analytical column type and size: Cellulose-SZ 50x3.0mmx3.0um; Elution: Dichloromethane/ (Methanol + Ammonia (20 mM) ) =1: 1; Flow rate: 3 mL/min; Run time: 3 min) . A58a: MS m/z (ESI) : 435.3 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.20 (s, 1H) , 7.86 (s, 1H) , 7.64 (d, J = 8.5 Hz, 2H) , 7.44 (d, J = 8.5 Hz, 2H) , 7.29 (s, 1H) , 6.45-6.22 (m, 2H) , 5.75 (dd, J = 10.2, 1.9 Hz, 1H) , 5.54 (s, 1H) , 3.33 (s, 6H) , 2.74 (q, J = 7.6 Hz, 2H) , 1.20 (t, J = 7.2 Hz, 3H) . A58b: MS m/z (ESI) : 435.2 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ1H-NMR (400 MHz, DMSO-D6) δ 10.20 (s, 1H) , 7.86 (s, 1H) , 7.64 (d, J = 8.5 Hz, 2H) , 7.44 (d, J = 8.5 Hz, 2H) , 7.29 (s, 1H) , 6.45-6.22 (m, 2H) , 5.75 (dd, J = 10.0, 2.1 Hz, 1H) ,  5.54 (s, 1H) , 3.32 (s, 6H) , 2.74 (q, J = 7.6 Hz, 2H) , 1.20 (t, J = 7.2 Hz, 3H) .
The following compounds were prepared similarly according to the synthetic procedure or methodologies exemplified herein.
2- ( (3, 5-Dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A59. MS m/z (ESI) : 485.1 [M+H] +. 1H NMR (400 MHz, DMSO-d6) : δ 7.93 (s, 1H) , 7.52 (d, J = 8.5 Hz, 2H) , 7.36-7.33 (m, 3H) , 6.85 (dd, J = 16.5, 9.9 Hz, 1H) , 6.16-6.05 (m, 2H) , 5.61 (s, 1H) , 3.33 (s, 6H) , 3.16 (s, 3H) , 2.75 (q, J = 7.7 Hz, 2H) , 1.20 (t, J = 7.6 Hz, 3H) .
2- ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A60. MS m/z (ESI) : 554.3 [M+H] +. 1H NMR (400 MHz, DMSO-d6) : δ 8.13 (s, 1H) , 7.95 (s, 1H) , 7.51 (d, J = 8.5 Hz, 2H) , 7.39-7.33 (m, 3H) , 6.84 (dd, J = 16.5, 10.2 Hz, 1H) , 6.15 (d, J = 10.2 Hz, 1H) , 6.07 (d, J = 16.5 Hz, 1H) , 5.52 (s, 1H) , 4.01-3.89 (m, 4H) , 3.29-3.23 (m, 2H) , 3.16 (s, 3H) , 3.10-2.75 (m, 5H) , 2.65-2.53 (m, 2H) , 2.13-2.01 (m, 2H) , 1.22 (t, J = 7.6 Hz, 3H) .
Example 11
Preparation of 2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A61
Compound A61 was synthesized as shown in Scheme 11.
Scheme 11
Preparation of 2-amino-6-chloro-4-ethylpyridine-3, 5-dicarbonitrile 11.1. To a solution of compound 1.2 (2.0 g, 8.85 mmol) in THF (20 mL) was added ammonia in MeOH (20 mL, 7 M) . The mixture was stirred at 25 ℃ for 16 hours. LCMS showed the reaction was completed. The reaction was concentrated to afford compound 11.1 (1.8 g, crude) as a yellow solid. MS m/z (ESI) : 205.0 [M-H] +.
Preparation of 2-amino-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridine-3, 5-dicarbonitrile 11.2. To a solution of compound 11.1 (1.5 g, 7.26 mmol) in THF (20 mL) was added 1-methyl-1, 4-diazepane (912 mg, 8.0 mmol) . The mixture was stirred at 50 ℃ for 16 hours. LCMS showed the reaction was completed. The reaction was concentrated to afford compound 11.2 (1.2 g, Y: 57.9%) as a brown solid. MS m/z (ESI) : 283.1 [M-H] +.
Preparation of tert-butyl (4-formylphenyl) carbamate 11.3. To the solution of N-boc-4-aminobenzyl alcohol (4.0 g, 17.9 mmol) in DCM (50 mL) in a nitrogen atmosphere was added manganese dioxide (14.2 g, 179.3 mmol) . The reaction mixture was stirred at 40 ℃ for 16 hours. TLC showed the reaction was completed. The reaction mixture was filtered with diatomite. The filtrate was concentrated to obtain compound 11.3 (3.5 g, Y: 77.5%) as a colorless oil.
Preparation of tert-butyl (4-formylphenyl) (methyl) carbamate 11.4. To a solution of compound 11.3 (3.3 g, 14.9 mmol) in DMF (30 mL) in a nitrogen atmosphere was added sodium hydride (716 mg, 60wt%, 19.7 mmol) at 0 ℃. Methyl iodide (3.2 g, 22.4 mol) was added, the reaction mixture was stirred at 25 ℃for 2 hours. LCMS showed the reaction was completed. The reaction was quenched with saturated  ammonium chloride aqueous solution (100 mL) , and then extracted with DCM (50 mL×3) . The combined organics were washed with brine (50 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel to obtain compound 11.4 (2.5 g, Y: 71.6%) as a yellow oil. MS m/z (ESI) : 180.1 [M+H-56] +.
Preparation of tert-butyl (4- (cyano (hydroxy) methyl) phenyl) (methyl) carbamate 11.5. To a solution of compound 11.4 (2.0 g, 8.5 mmol) in DCM (20 mL) in a nitrogen atmosphere was added trimethylsilylcyanide (990 mg, 10.0 mmol) and zinc diiodide (542 mg, 1.7 mmol) . The reaction mixture was stirred at 40 ℃ for 16 hours. TLC showed the reaction was completed. The reaction was quenched with saturated ammonium chloride aqueous solution (30 mL) , and then extracted with DCM (30 mL×3) . The combined organics were washed with brine (30 mL× 2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to obtain compound 11.5 (1.3 g, Y: 46.7%) as a yellow oil.
Preparation of tert-butyl (4- (2-amino-1-hydroxy-2-oxoethyl) phenyl) (methyl) carbamate 11.6. To a solution of compound 11.5 (2.0 g, 7.62 mmol) in DMSO (20 mL) was added potassium carbonate (5.2 g, 38.0 mmol) and hydrogen peroxide solution (4.3 mL, 30%wt, 38.0 mmol) . The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated ammonium chloride aqueous solution (80 mL) , and then extracted with DCM (30 mL×3) . The combined organics were washed with saturated brine (40 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated and purified by column chromatography on silica gel (eluted by EA/PE = 1: 1) to obtain compound 11.6 (1.2 g, Y: 56.1%) as a white solid. MS m/z (ESI) : 303.1 [M+Na] +.
Preparation of 2-amino-1- (4- ( (tert-butoxycarbonyl) (methyl) amino) phenyl) -2-oxoethyl methanesulfonate 11.7. To a solution of compound 11.6 (200 mg, 0.71 mmol) in DCM (2 mL) in a nitrogen atmosphere was added TEA (144 mg, 1.43 mmol) . After cooled to 0 ℃, methanesulfonyl chloride (122 mg, 1.07 mmol) was added slowly. The reaction mixture was stirred at 25 ℃ for 2 hours. TLC showed the reaction was completed. The reaction was quenched with saturated NaHCO3 aqueous solution (5 mL) , and then extracted with DCM (5 mL×3) . The combined organic phases were washed with brine (50 mL×2) , dried over anhydrous sodium sulfate and filtered. The filtrate was concentrated to obtain compound 11.7 (200 mg, Y: 79.8%) as a white solid.
Preparation of tert-butyl (4- (2-amino-1- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2-oxoethyl) phenyl) (methyl) carbamate 11.8. To a solution of compound 11.7 (180 mg, 0.52 mmol) in THF (2mL) was added triethylamine (123 mg, 1.20 mmol) and compound 11.2 (174 mg, 0.52 mmol) at 0 ℃. The mixture was stirred at 25℃ for 2 hours under nitrogen protection. TLC showed the reaction was completed. The reaction mixture was quenched with saturated NaHCO3 aqueous solution (10 mL) , and extracted with DCM (10 mL×3) . The combined organics were washed with brine (50 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography to obtain compound 11.8 (103 mg, Y: 37.5%) as a white solid. MS m/z (ESI) : 547.5 [M+H] +.
Preparation of 2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4-(methylamino) phenyl) acetamide 11.9. To a solution of compound 11.8 (103 mg, 0.18 mmol) in DCM (2mL) , hydrochloric acid in dioxane (1mL, 4 M) was added. The mixture was stirred at 25℃ for 2 hours. TLC showed the reaction was completed. The reaction mixture was quenched with saturated NaHCO3 aqueous solution (20 mL) , and extracted with DCM (20 mL×3) . The combined organics were washed with brine (10 mL×3) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain compound 11.9 (70 mg, 86.4%) a brown solid.
Preparation of 2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A61. To a solution of compound 11.9 (70 mg, 0.15 mmol) in DCM (1mL) was added TEA (29.4 mg, 0.29 mmol) and 2-chloroethanesulfonyl chloride (35.5 mg, 0.21 mmol) . The mixture was stirred at 25℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated ice ammonium chloride (5 mL) solution and extracted with EtOAc (5 mL×3) . The combined organics were washed with brine (5 mL) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by preparative HPLC to obtain compound A61 (16.1 mg, Y: 16.9%) as a white solid. MS m/z (ESI) : 537.3 [M+H] +. 1H-NMR (400 MHz, DMSO-d6) δ 8.13 (s, 1H) , 7.81 (s, 1H) , 7.49 (d, J = 8.5 Hz, 2H) , 7.44 (s, 1H) , 7.33 (d, J = 8.5 Hz, 2H) , 7.19 (d, J = 5.5 Hz, 1H) , 6.83 (dd, J = 16.4, 10.0 Hz, 1H) , 6.16-6.04 (m, 2H) , 5.44 (d, J = 5.8 Hz, 1H) , 3.85-3.73 (m, 4H) , 3.46-3.29 (m, 2H) , 3.15 (s, 3H) , 2.98-2.65 (m, 5H) , 2.43-2.37 (m, 2H) , 2.03-1.87 (m, 2H) , 1.21 (t, J = 7.6 Hz, 3H) .
Example 12
Preparation of 2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A62
Compound A62 was synthesized as shown in Scheme 12.
Scheme 12
Preparation of 2-chloro-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridine-3, 5-dicarbonitrile 12.1. To a solution compound 1.2 (3.0 g, 13.33 mmol) in THF (30 mL) was added 1-methyl-1, 4-diazepane (1.5 g, 13.33 mmol) and TEA (1.4 g, 13.33 mmol) at 0 ℃. The mixture was stirred at 25℃ for 2 hours. TLC showed the reaction was completed. The reaction mixture was quenched with hydrochloric acid aqueous solution (15 mL, 1 M) , and stirred for 0.5 hour, extracted with EtOAc (15 mL×3) . The combined organics were washed with brine (10 mL) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain compound 12.1 (1.8 g, Y: 44.6%) as a yellow solid.
Preparation of ethyl 2- (4-nitrophenyl) acrylate 12.2. To a solution of 4-nitrophenylethyl acetate (1.0 g, 4.78 mmol) in DMSO (10 mL) was added bis (dimethylamino) methane (732 mg, 7.17 mmol) and acetic anhydride (1.6 g, 15.70 mmol) at 0 ℃. The mixture was stirred at 25℃ for 2 hours under nitrogen protection. TLC showed the reaction was completed. The reaction mixture was quenched with saturated NaHCO3 aqueous solution (30 mL) , and extracted with DCM (30 mL×3) . The combined organics were washed with brine (30 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain compound 12.2 (700 mg, Y:66.0%) as a white solid. 1H-NMR (400 MHz, DMSO-d6) δ 8.23 (d, J = 8.8 Hz, 2H) , 7.73 (d, J = 8.8 Hz, 2H) , 6.45 (s, 1H) , 6.24 (s, 1H) , 4.25 (q, J = 7.1 Hz, 2H) , 1.26 (t, J = 7.1 Hz, 3H) .
Preparation of ethyl (Z) -3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -2- (4-nitrophenyl) acrylate 12.3. To a solution compound 12.2 (1.4 g, 6.60 mmol) and compound 12.1 (1.0 g, 3.28 mmol) in anhydrous DMF (10 mL) was added palladium acetate (74 mg, 0.32 mmol) , 4, 5-diphenylphosphine-9, 9-dimethyloxanthracene (370 mg, 0.64 mmol) and TEA (664 mg, 6.56 mmol) under nitrogen protection. The  mixture was stirred at 100 ℃ for 12 hours. LCMS showed the reaction was completed. The reaction was quenched with saturated ammonium chloride aqueous solution (30 mL) and extracted with DCM (20 mL×3) . The combined organics were washed with brine (20 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography to obtain compound 12.3 (420 mg, Y: 24.9%) as a yellow solid. MS m/z (ESI) : 488.9 [M+H] +.
Preparation of (Z) -3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -2- (4-nitrophenyl) acrylic acid 12.4. To a solution of compound 12.3 (400 mg, 0.82 mmol) in THF (4 mL) and water (0.4 mL) was added NaOH (102 mg, 2.46 mmol) . The reaction mixture was stirred at 25 ℃ for 4 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated ammonium chloride aqueous solution (20 mL) and extracted with DCM (10 mL×3) . The combined organics were washed with brine (10 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated to obtain compound 12.4 (350 mg, Y: 92.8%) as a yellow solid. MS m/z (ESI) : 461.1 [M+H] +.
Preparation of (Z) -3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -2- (4-nitrophenyl) acrylamide 12.5. To a solution of compound 12.4 (350 mg, 0.76 mmol) in DCM (5 mL) was added DMF (6 mg, 0.08 mmol) and oxalyl chloride (97 mg, 0.76 mmol) . The reaction mixture was reacted at 25 ℃ for 1 hour. Then ammonia methanol solution (5 mL, 7M) was added. The mixture was stirred at 25 ℃ for 1 hour. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated ammonium chloride aqueous solution (10 mL) and extracted with DCM (10 mL×3) . The combined organics were washed with brine (10 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography to obtain compound 12.5 (205 mg, Y: 58.7%) as a yellow solid. MS m/z (ESI) : 459.8 [M+H] +.
Preparation of 2- (4-aminophenyl) -3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) propanamide 12.6. To a solution of compound 12.5 (185 mg, 0.40 mmol) in anhydrous MeOH (10 mL) , platinum dioxide (19 mg) were added under nitrogen protection. The reaction mixture was degassed under vacuum and replaced hydrogen gas three times. The reaction mixture was stirred under a hydrogen balloon at 25 ℃ for 16 hours. LCMS showed the reaction was completed. The reaction mixture was filtered with celite, and the filter cake was washed with methanol (10 mL × 2) . The filtrate was concentrated to obtain compound 12.6 (136 mg, Y: 78.2%) as a yellow solid. MS m/z (ESI) : 432.4 [M+H] +.
Preparation of 3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -2- (4-(methylamino) phenyl) propanamide 12.7. To a solution of compound 12.6 (100 mg, 0.23 mmol) in i-PrOH (1 mL) was added methyl trifluoromethanesulfonate (42 mg, 0.25 mmol) under nitrogen protection. The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated NaHCO3 aqueous solution (10 mL) and extracted with DCM (10 mL×3) . The combined organics were washed with brine (10 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by silica gel column chromatography to obtain compound 12.7 (25 mg, Y: 24.2%) as a yellow solid. MS m/z (ESI) : 445.9 [M+H] +.
Preparation of N- (4- (1-amino-3- (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -1-oxopropan-2-yl) phenyl) -N-methylacrylamide A62. To a solution of compound 12.7 (25 mg, 0.06 mmol) in THF (1 mL) was added TEA (11 mg, 0.11 mmol) and acryloyl chloride (6 mg, 0.06 mmol) under nitrogen protection. The reaction mixture was stirred at 25 ℃ for 2 hours. LCMS showed the reaction was completed. The reaction mixture was quenched with saturated NaHCO3 aqueous solution (5 mL) and extracted with DCM (5 mL×3) . The combined organics were washed with brine (5 mL×2) , dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated and purified by preparative HPLC to obtain compound A62 (1.75 mg, Y: 6.2%) as a white solid. MS m/z (ESI) : 500.4 [M+H] +. 1H-NMR (400 MHz, DMSO-d6) δ 7.58 (s, 1H) , 7.41 (d, J = 8.2 Hz, 2H) , 7.23 (d, J = 8.2 Hz, 2H) , 6.92 (s, 1H) , 6.17-5.95 (m, 2H) , 5.57 (d, J = 12.4 Hz, 1H) , 4.19-4.13 (m, 1H) , 3.94-3.82 (m, 4H) , 3.58-3.50 (m, 1H) , 3.22 (s, 3H) , 3.14 (dd, J = 16.5, 5.5 Hz, 1H) , 2.85-2.77 (m, 2H) , 2.72-2.66 (m, 2H) , 2.27 (s, 3H) , 2.02-1.91 (m, 2H) , 1.29-1.23 (m, 3H) , 1.22-1.17 (m, 2H) .
The following compounds were prepared similarly according to the synthetic procedure or methodologies exemplified herein.
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A63. MS m/z (ESI) : 493.1 [M+H] +. 1H NMR (400 MHz, CDCl3) δ 8.34 (t, J = 7.6 Hz, 1H) , 7.57 (s, 1H) , 7.15 (d, J = 10.3 Hz, 2H) , 6.45 (d, J = 16.8 Hz, 1H) , 6.33 –6.27 (m, 1H) , 5.82 (d, J = 10.2 Hz, 1H) , 4.62 (d, J = 13.3 Hz, 2H) , 4.36 (s, 2H) , 3.12 (t, J = 12.3 Hz, 2H) , 2.90 (q, J = 7.5 Hz, 2H) , 2.54 –2.48 (m, 1H) , 2.32 (s, 6H) , 2.02 –1.93 (m, 2H) , 1.58 –1.48 (m, 2H) , 1.32 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A64. MS m/z (ESI) : 536.1 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ10.02 (s, 1H) , 8.24 (s, 2H) , 8.05 –7.95 (m, 2H) , 7.50 –7.29 (m, 3H) , 6.61 (dd, J = 17.2, 10.0 Hz, 1H) , 6.27 (dd, J = 17.2, 2.0 Hz, 1H) , 5.78 (dd, J = 10.0, 2.0 Hz, 1H) , 5.56 (s, 1H) , 4.56 (d, J = 12.8 Hz, 2H) , 3.25-3.16 (m, 2H) , 2.79 –2.73 (m, 2H) , 2.48-2.41 (m, 1H) , 2.20 (s, 6H) , 1.87 (d, J = 11.6 Hz, 2H) , 1.46 –1.30 (m, 2H) , 1.21 (t, J =7.6 Hz, 3H) .
N- (4- (1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) ethyl) -2-fluorophenyl) acrylamide A65. MS m/z (ESI) : 507.1 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 9.97 (s, 1H) , 7.99 (t, J = 8.0 Hz, 1H) , 7.43 (d, J = 12.0 Hz, 1H) , 7.30 (d, J = 8.0 Hz, 1H) , 6.68 -6.54 (m, 1H) , 6.32 -6.22 (m, 1H) , 5.81 -5.73 (m, 1H) , 5.14 -5.06 (m, 1H) , 4.56 -4.46 (m, 2H) , 3.26 -3.13 (m, 2H) , 2.79 -2.69 (m, 2H) , 2.46  -2.37 (m, 1H) , 2.17 (s, 6H) , 1.92 -1.80 (m, 2H) , 1.70 (d, J = 8.0 Hz, 3H) , 1.51 -1.30 (m, 2H) , 1.20 (t, J = 8.0 Hz, 3H) .
N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) but-2-ynamide A66. MS m/z (ESI) : 505.1 [M+H] +. 1H NMR (400 MHz, CDCl3) δ 8.22 (t, J = 8.3 Hz, 1H) , 7.60 (s, 1H) , 7.18 –7.06 (m, 2H) , 4.61 (d, J = 13.2 Hz, 2H) , 4.33 (d, J = 19.7 Hz, 2H) , 3.12 (t, J = 12.1 Hz, 2H) , 2.90 (q, J = 7.5 Hz, 2H) , 2.53 –2.47 (m, 1H) , 2.32 (s, 6H) , 2.02 (s, 3H) , 1.97 (d, J = 12.0 Hz, 2H) , 1.60 –1.49 (m, 2H) , 1.32 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) but-2-ynamide A67. MS m/z (ESI) : 548.1 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ9.85 (s, 1H) , 8.25 (s, 1H) , 7.96 (t, J = 8.2 Hz, 2H) , 7.45 –7.35 (m, 2H) , 7.32 (d, J = 8.4 Hz, 1H) , 6.18 (t, J = 6.5 Hz, 1H) , 5.56 (s, 1H) , 5.43 (d, J = 6.5 Hz, 2H) , 4.55 (d, J = 9.5 Hz, 2H) , 3.25 –3.13 (m, 3H) , 2.75 (q, J = 7.4 Hz, 2H) , 2.20 (s, 6H) , 2.08 –1.95 (m, 1H) , 1.91 –1.80 (m, 2H) , 1.49 –1.33 (m, 2H) , 1.20 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A68. MS m/z (ESI) : 510.3 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ10.00 (s, 1H) , 8.14 (s, 1H) , 8.05-7.96 (m, 2H) , 7.42 (s, 1H) , 7.41-7.30 (m, 2H) , 6.61-6.55 (m, 1H) , 6.27 (d, J =19.0 Hz, 1H) , 5.78 (dd, J = 10.3, 1.8 Hz, 1H) , 5.55 (s, 1H) , 3.95-3.78 (m, 2H) , 3.31 (s, 3H) , 2.76 (q, J = 7.6 Hz, 2H) , 2.56-2.51 (m, 2H) , 2.19 (s, 6H) , 1.20 (t, J = 7.7 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) amino) -2-oxoethyl) -2-fluorophenyl) acrylamide A69. MS m/z (ESI) : 493.4 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ9.94 (s, 1H) , 7.94 (t, J = 8.1 Hz, 1H) , 7.83 (s, 1H) , 7.48 (s, 1H) , 7.38 (d, J = 11.8 Hz, 1H) , 7.26 (d, J = 8.5 Hz, 1H) , 7.20 (d, J = 6.6 Hz, 1H) , 6.63-6.56 (m, 1H) , 6.26 (dd, J = 17.0, 1.9 Hz, 1H) , 5.77 (dd, J = 10.2, 1.9 Hz, 1H) , 5.43 (d, J = 6.0 Hz, 1H) , 3.80-3.72 (m, 1H) , 3.62-3.53 (m, 1H) , 3.21 (s, 3H) , 2.77-2.65 (m, 2H) , 2.41-2.32 (m,  2H) , 2.15 (s, 6H) , 1.20 (t, J = 7.6 Hz, 3H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-fluorophenyl) acrylamide A70. MS m/z (ESI) : 510.4 [M+H] +. 1H NMR (400 MHz, DMSO-d6) : δ10.45 (s, 1H) , 8.13 (s, 1H) , 7.91 (s, 1H) , 7.78 (d, J = 12.6 Hz, 1H) , 7.48 (d, J = 6.3 Hz, 1H) , 7.44 (d, J = 8.8 Hz, 1H) , 7.35-7.30 (m, 1H) , 6.42 (dd, J = 17.0, 10.2 Hz, 1H) , 6.30 (dd, J = 16.9, 2.1 Hz, 1H) , 5.80 (dd, J = 9.9, 1.9 Hz, 1H) , 5.73 (s, 1H) , 4.02-3.88 (m, 2H) , 3.36 (s, 3H) , 2.82-2.73 (m, 4H) , 2.35 (s, 6H) , 1.22 (t, J = 7.7 Hz, 3H) . 
N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4- (pyrrolidin-1-yl) piperidin-1-yl) pyridin-2-yl) oxy) methyl) phenyl) acrylamide A71. MS m/z (ESI) : 485.4 [M+H] +. 1H NMR (400 MHz, DMSO-d6) δ 10.21 (s, 1H) , 7.69 (d, J = 8.5 Hz, 2H) , 7.40 (d, J = 8.5 Hz, 2H) , 6.44 (dd, J = 17.0, 10.2 Hz, 1H) , 6.26 (dd, J = 16.9, 2.1 Hz, 1H) , 5.76 (dd, J = 10.2, 1.9 Hz, 1H) , 5.41 (s, 2H) , 4.62-4.30 (m, 2H) , 3.30-3.25 (m, 3H) , 2.78 (q, J = 7.5 Hz, 2H) , 2.02-1.92 (m, 2H) , 1.82-1.65 (m, 4H) , 1.55-1.38 (m, 2H) , 1.29-1.20 (m, 7H) .
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A72. MS m/z (ESI) : 506.4 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A73. MS m/z (ESI) : 506.4 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methoxyphenyl) acrylamide A74. MS m/z (ESI) : 522.4 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A75. MS m/z (ESI) : 532.5 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A76. MS m/z (ESI) : 532.5 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A77. MS m/z (ESI) : 449.3 [M+H] +.
N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) -N-methylacrylamide A78. MS m/z (ESI) : 449.3 [M+H] +.
N- (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (N-methylmethylsulfonamido) benzyl) thio) pyridin-2-yl) (methyl) amino) ethyl) -N-methylacrylamide A79. MS m/z (ESI) : 527.5 [M+H] +.
N- (1- (6- ( (2-amino-2-oxo-1-phenylethyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) piperidin-4-yl) acrylamide A80. MS m/z (ESI) : 475.4 [M+H] +.
2- ( (3, 5-dicyano-4-ethyl-6- (4- (vinylsulfonamido) piperidin-1-yl) pyridin-2-yl) thio) -2-phenylacetamide A81. MS m/z (ESI) : 511.4 [M+H] +.
The above Example are specifically implemented according to the following methods.
Example B1
Cell-based Reporter Assay for DNA Methylation Inhibition
A compound provided herein is evaluated using a recombinant reporter assay by monitoring the reactivation of endogenously DNA hypermethylated tumor suppressor gene UCHL1 (PMID: 30956060) upon inhibition of DNA methylation, according to the procedures described in Cui et al., Cancer Res. 2014, 74, 3834-43. Briefly, the recombinant construct containing 800 bp both 5’a nd 3’ homologous arms flanking the exon 4 of UCHL1 gene, LoxP sites flanking a TK-NeoR cassette, and IRES sequences preceding the NanoLuc (Nluc) gene, were assembled by usingHiFi DNA Assembly (NEB #E2621) . The recombinant construct, as well as the CRISPR/Cas9 construct (Addgene: 1110403) with sgRNA targeting the exon 4 of UCHL1, were co-transfected into HCT116 cells using Lipofectamine 2000. Cells were then neomycin selected to be PCR screened for clones positive for proper recombinants, and the homologous recombinant clones were infected with adenovirus containing Cre recombinase to remove TK-NeoR cassette. The resulting cells exhibited little basal bioluminescent signal from NanoLuc prior to any drug treatment. The treatment of the reporter cells with DNA demethylating agents reactivated the UCHL1-Nluc allele concomitantly with the DNA demethylation of UCHL1 promoter.
To determine the effects of compounds in reactivating the DNA hypermethylation silenced UCHL1-Nluc allele, the UCHL1-Nluc reporter cells were seeded in 96-well plates (5, 500 cells/well) and were incubated at 37 ℃ in a humidified atmosphere at 5 %CO2 for 24 h then dosed with the test compounds. After 3 days of culture, the Nano-Glo Luciferase Assay Reagent (Promega) was used to measure the bioluminescent signal, and data were processed using GraphPad Prism 6.
Example B2
Cell Viability Assay
The non-Hodgkin's lymphoma cell line Farage is plated in 96-well cell culture plates (10, 000 cells/well) and treated with a compound provided herein at predetermined concentrations for 8 days. A cell counting kit-8 (CCK-8) solution is then added in the dark and the 96-well plate is incubated for 3 h. The absorbance at 450 nm of each well of the 96-well plate is recorded using a multifunctional microplate reader.
Example B3
MS Identification of Covalently Modifying Sites
A DNMT1 protein is expressed in Spodoptera frugiperda (Sf9) cells. A DNMT1-DNA complex is prepared by incubating purified DNMT1, hemi-methylated DNA (Seq-F: ACTTA/i5MedC/GGAAGG (SEQ ID NO: 1) ; Seq-R: CCTTCCGTAAGT (SEQ ID NO: 2) , and S-adenosyl-L-homocysteine (SAH) in a molar ratio of 1: 5: 10 for 1 h at 4 ℃. Before mass spectrometry analysis, the DNMT1-DNA complex is incubated for 2 h at 4 ℃ with a compound provided herein in a 1: 6 molar ratio. The protein-DNA-compound complex is stored in 20 mM Tris pH 7.4, 75 mM NaCl. The compound conjugate site analysis is performed by LC-MS/MS spectrometry technology according to the procedures described in Fan et al., Angew. Chem. Int. Ed. Engl. 2021, 60, 26105-114. Briefly, the complex sample of DNMT1-DNA-compound was precipitated by acetone at -20 ℃ for 30 min to remove unbound drug compounds. Precipitated protein complex was dried in air and resuspended in 100 mM ammonium bicarbonate. Sequencing-grade modified trypsin was added (at a final concentration of 10 ng/μL) to each sample and incubated at 37 ℃ for 16 h. The digested solution containing peptide mixture was centrifugated at 12000×g for 30 min. the supernatant was desalted by C18 tip and then dried in air. Before MS experiment, the Enzyme digests of peptide mixture was dissolved in solvent containing 0.1%formic acid and were analyzed using liquid chromatography (LC) with tandem MS (LC-MS/MS) based sequencing (Q Exactive) . The MS raw data were searched against a protein sequence database with pFind (version 3.1.5) to identify the location of covalent labeling. As examples, A14, A16 and A17 were mainly detected the formation of covalent bond with C1226 residue of DNMT1.
Example B4
In vitro DNMT1 Inhibition Assay
The in vitro enzymatic activity of DNMT1 is determined using an MTASE-GLO assay according to the procedures described in Hsiao et al., Epigenomics 2016, 8, 321-39; and Horton et al., Structure 2022, 30, 793-802.
Example B5
Xenograft Mouse Model
NOD-SCID mice (5-6 weeks old) are injected subcutaneously in the right flank with 3～9 × 106 viable SU-DHL-4 or Farage cells in 0.1 mL of a cell culture medium with MATRIGEL (1: 1) . When palpable tumors are discerned, the mice are randomized and treated with a compound provided herein (20-40 mg/kg) or a vehicle by IP injection daily. Tumor volumes are measured every week using a digital caliper and calculated.
Example B6
Thermal Shift Assay:
The Thermal Shift assay technique was used to determine the binding activity of compounds to the DNMT1 (740-1632) : DNA complex. To do so, 10 μM of hemi-methylated double-stranded DNA (Seq-F: ACTTA/i5MedC/GGAAGG (SEQ ID NO: 1) ; Seq-R: CCTTCCGTAAGT (SEQ ID NO: 2) ) , 20 μM of SAH, and 2 μM of purified DNMT1 were pre-incubated in a reaction microplate containing 20 mM HEPES pH 6.8 and 100 mM NaCl at room temperature for 30 minutes. Compounds with final concentration of 10μM or 20 μM were added and incubated at room temperature for another 30 minutes. A diluted solution of SYPRO orange (Applied Biosystems (Thermo Fisher, Cat#4461146) was then added to the reaction system and mixed thoroughly. The mixture was centrifuged at 1000 rpm for 1 minute and then placed on ice. The PCR plate was then placed in a fluorescent real-time quantitative PCR machine (Applied Biosystems, 4453536) . The temperature of the reaction system was raised from 25 ℃ to 95 ℃ at a rate of 0.05 ℃ per second, and real-time fluorescence values were recorded. The shift of the melting temperature (ΔTm) of the protein in the presence of the compound was calculated in relative to the protein contains the buffer and dimethyl sulfoxide (DMSO) . Table below listed the ΔTm value of a few compounds when binding to DNMT1.
Example B7
Glutathione (GSH) Reactivity of compound
5 μM compound was incubated with or without GSH (Adamas life, P2248421) 5 mM at pH 7.4 and at 37℃. Sample was taken at different time points to assess the remaining amount of the compound in the reaction system. 5μL of reaction mixture was injected into a chromatography column (Atlantis T3 5μm 3.0x50mm) and analyzed with a SCIEX Triple Quad 6500 mass spectrometer. The percentage of the compound remaining to the original amount of compound at the 0min reaction time were calculated to measure the T1/2, the reactivity of compound to GSH. The ln compound remaining (%) (the compound ratio as a percentage of the 0 minute time point) is plotted against time and the gradient of the line determined. The following equations are used when analyzing data from this assay: Elimination ratio constant (k) =-gradient, and the Half life (T1/2) (min) =1n2/k. Table below listed examples of GSH reaction T1/2 of selected compounds.
Example B8
Radioactive DNMT1 enzymatic inhibition activity of compound
Compound stored in DMSO was diluted into the reaction buffer (50 mM Tris-HCl (pH 8.0) , 1 mM DTT, 1mM EDTA, 5 %Glycerol, 0.01 %BSA) so that the final concentration of DMSO was 1 %in the final reaction system. DNMT1 enzyme (BPS Bioscience, Cat#51101) , 40-mer hemi-methylated DNA (F sequence-CCTCTTCTAACTGCCAT/i5Me-dC/CGATCCTGATAGCAGGTGCATGC (SEQ ID NO: 3) , R sequence-GCATGCACCTGCTATCAGGATCGATGGCAGTTAGAAGAGG (SEQ ID NO: 4) ) , and 3H-SAM are prepared at appropriate concentrations in 384 well microplate. 10μl of DNMT1 and 10 μl of DNA substrate were added to the reaction system so that the final concentrations were 1.5 nM and 50 nM, respectively. The mixture was centrifugated at 1000 rpm for 1 minute, and incubated at room temperature for 30 minutes. 10 μl of 3H-SAM (PerkinElmer Inc., USA, Lot. No. 2146246) prepared with reaction buffer was added to the reaction system to a final concentration of 100 nM. The plate was centrifugated at 1000 rpm for 1 minute and incubated at 37 ℃ for 3 hours. 10 μL of cold SAM solution (Sigma, Cat#: A7007, final concentration 100 μM) was added to the reaction wells to a final concentration of 100 μM to stop the reaction. Plate was centrifugated at 1000rpm for 1 minute. 30 μL solution was then transferred from the 384-well reaction plate to a 0.5 %PEI solution pre-treated 96-well detection plate (MultiScreen HTS-FB Plate) . The plate was washed three times with ultrapure water, then its membrane was transferred to a new 96-well reading plate (Isoplate 96 Microplate) . 240 μL of scintillation liquid was added, the plate was shaked and mixed at 450 rpm for 20 minutes. CPM values were obtained on a MicroBeta machine (PerkinElmer) . The percentage inhibition rate (inh %) was calculated using Excel, and the inh %data was used to fit the data with the four-parameter dose-response equation in XLFit excel add-in version 5.4.0.8 to calculate IC50 values.
The results of the above Examples are listed as follows:



In Example B6,
Category A: ΔTm (℃) ≤1;
Category B: 1<ΔTm (℃) ≤3;
Category C: 3<ΔTm (℃) ≤10;
Category D: ΔTm (℃) >10.
In Example B8:
Category A: IC50 (nM) ≤100;
Category B: 100< IC50 (nM) ≤300, ;
Category C: 300< IC50 (nM) ≤1000;
Category D: IC50 (nM) >1000.
In Example B1:
Category A: EC50 (nM) ≤30;
Category B: 30< EC50 (nM) ≤100;
Category C: 100< EC50 (nM) ≤300;
Category D: EC50 (nM) >300.
* * * * *
The examples set forth above are provided to give those of ordinary skill in the art with a complete disclosure and description of how to make and use the claimed embodiments and are not intended to limit the scope of what is disclosed herein. Modifications that are obvious to persons of skill in the art are intended to be within the scope of the following claims. All publications, patents, and patent applications cited in this specification are incorporated herein by reference as if each such publication, patent or patent application were specifically and individually indicated to be incorporated herein by reference.

Claims (18)

  1. A compound of Formula (I) or Formula (I-1) :
    or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof; wherein:
    A is –C (O) –, –S (O) –, or –S (O2) –;
    E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene;
    E’ is C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
    L is a bond, N (R1) , or heterocyclylene;
    U is –O–, –S–, –S (O) –, –S (O2) –, -C (R5) 2-or –N (R5) –;
    Z is C1-6 alkylene;
    or, -U-Z is -CH=CH-;
    R1 and R5 are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2- 6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
    R2 is halo, C1-6 haloalkyl, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl; wherein the halogen in C1-6 haloalkyl is Cl and/or Br;
    R2’ is C2-6 alkenyl, or C2-6 alkynyl;
    R6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
    R7a and R7b are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a,  –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R7a and R7b together with the N atom to which they are attached form heterocyclyl; and
    R7b’ is C1-6 alkylene, C1-6 heteroalkylene, C2-6 alkenylene, C2-6 alkynylene, C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene; R7b’ is substituted with -L-A-R2’;
    or R7a and R7b’ together with the N atom to which they are attached form heterocyclyl substituted with -L-A-R2’; and
    each R1a, R1b, R1c, and R1d is independently hydrogen, deuterium, C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
    wherein each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7- 15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa;
    wherein each Qa is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg, –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl,  C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached form heterocyclyl.
  2. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 1:
    wherein:
    A is –C (O) –, –S (O) –, or –S (O2) –;
    E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene;
    L is a bond, –N (R1) –, or heterocyclylene;
    U is –O–, –S–, or –N (R5) –;
    Z is C1-6 alkylene;
    R1 and R5 are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2- 6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
    R2 is halo, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl;
    R6 is (i) hydrogen, deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
    R7a and R7b are each independently (i) hydrogen; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R7a and R7b together with the N atom to which they are attached form heterocyclyl; and
    each R1a, R1b, R1c, and R1d is independently hydrogen, deuterium, C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl;
    wherein each alkyl, alkylene, haloalkyl, heteroalkyl, haloheteroalkyl, alkenyl, alkynyl, cycloalkyl, cycloalkylene, aryl, arylene, aralkyl, aralkylene, heteroaryl, heteroarylene, heterocyclyl, and heterocyclylene is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Q, wherein each Q is independently selected from: (a) deuterium, cyano, halo, imino, nitro, and oxo;  (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl, each of which is further optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; and (c) –C (O) Ra, –C (O) ORa, –C (O) NRbRc, –C (O) SRa, –C (NRa) NRbRc, –C (S) Ra, –C (S) ORa, –C (S) NRbRc, –ORa, –OC (O) Ra, –OC (O) ORa, –OC (O) NRbRc, –OC (O) SRa, –OC (NRa) NRbRc, –OC (S) Ra, –OC (S) ORa, –OC (S) NRbRc, –OP (O) (ORb) ORc, –OS (O) Ra, –OS (O) 2Ra, –OS (O) NRbRc, –OS (O) 2NRbRc, –NRbRc, –NRaC (O) Rd, –NRaC (O) ORd, –NRaC (O) NRbRc, –NRaC (O) SRd, –NRaC (NRd) NRbRc, –NRaC (S) Rd, –NRaC (S) ORd, –NRaC (S) NRbRc, –NRaS (O) Rd, –NRaS (O) 2Rd, –NRaS (O) NRbRc, –NRaS (O) 2NRbRc, –SRa, –S (O) Ra, –S (O) 2Ra, –S (O) NRbRc, and –S (O) 2NRbRc, wherein each Ra, Rb, Rc, and Rd is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7- 15 aralkyl, heteroaryl, or heterocyclyl, each of which is optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa; or (iii) Rb and Rc together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more, in one embodiment, one, two, three, or four, substituents Qa;
    wherein each Qa is independently selected from: (a) deuterium, cyano, halo, nitro, imino, and oxo; (b) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, and heterocyclyl; and (c) –C (O) Re, –C (O) ORe, –C (O) NRfRg, –C (O) SRe, –C (NRe) NRfRg, –C (S) Re, –C (S) ORe, –C (S) NRfRg, –ORe, –OC (O) Re, –OC (O) ORe, –OC (O) NRfRg, –OC (O) SRe, –OC (NRe) NRfRg, –OC (S) Re, –OC (S) ORe, –OC (S) NRfRg, –OP (O) (ORf) ORg, –OS (O) Re, –OS (O) 2Re, –OS (O) NRfRg, –OS (O) 2NRfRg, –NRfRg, –NReC (O) Rh, –NReC (O) ORf, –NReC (O) NRfRg, –NReC (O) SRf, –NReC (NRh) NRfRg, –NReC (S) Rh, –NReC (S) ORf, –NReC (S) NRfRg, –NReS (O) Rh, –NReS (O) 2Rh, –NReS (O) NRfRg, –NReS (O) 2NRfRg, –SRe, –S (O) Re, –S (O) 2Re, –S (O) NRfRg, and –S (O) 2NRfRg; wherein each Re, Rf, Rg, and Rh is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl; or (iii) Rf and Rg together with the N atom to which they are attached form heterocyclyl.
  3. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claims 1 or 2, which satisfies one or more of the following conditions:
    (I) L is selected from:
    (i) L is –N (R1) –; and
    (ii) L is heterocyclylene, optionally substituted with one, two, or three substituents Q; preferably L is monocyclic heterocyclylene, optionally substituted with one, two, or three substituents Q; (II) E is selected from:
    (i) E is C3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q;  preferably monocyclic C3-10 cycloalkylene, optionally substituted with one, two, or three substituents Q;
    (ii) E is C6-14 arylene, optionally substituted with one, two, or three substituents Q; preferably E is phendiyl, optionally substituted with one, two, or three substituents Q;
    (iii) E is C6-15 aralkylene, optionally substituted with one, two, or three substituents Q; preferably E is phendiyl-methandiyl, optionally substituted with one, two, or three substituents Q;
    (iv) E is heteroarylene, optionally substituted with one, two, or three substituents Q; preferably E is monocyclic heteroarylene, optionally substituted with one, two, or three substituents Q; more preferably E is pyridindiyl, optionally substituted with one, two, or three substituents Q; and
    (v) wherein E is heterocyclylene, optionally substituted with one or more substituents Q; preferably E is monocyclic or bicyclic heterocyclylene, each optionally substituted with one, two, or three substituents Q; more preferably E is piperidindiyl or 1, 2, 3, 4-tetrahydroquinolindiyl, each optionally substituted with one, two, or three substituents Q;
    (III) U is –S–or –N (R5) –;
    (IV) R2 is selected from:
    (i) R2 is halo; C1-6 haloalkyl or C1-6 haloheteroalkyl, each optionally substituted with one, two, or three substituents Q;
    (ii) R2 is C2-6 alkenyl, optionally substituted with one, two, or three substituents Q; preferably R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, each of which is independently cyano, halo, heterocyclyl, or –NR1bR1c; more preferably R2 is ethenyl or propenyl, each optionally substituted with one, two, or three substituents, each of which is independently cyano, fluoro, piperidin-1-yl, or dimethylamino; and
    (iii) R2 is C2-6 alkynyl, optionally substituted with one, two, or more substituents Q;
    (V) R1 is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q;
    (VI) R6 is selected from:
    (i) R6 is C1-6 alkyl, optionally substituted with one, two, or three substituents Q;
    (ii) R6 is C1-6 heteroalkyl, optionally substituted with one, two, or three substituents Q; preferably R6 is C1-6 alkoxy, optionally substituted with one, two, or three substituents Q; and
    (iii) R6 is C3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q; preferably R6 is monocyclic C3-10 cycloalkyl, optionally substituted with one, two, or three substituents Q; and
    (iv) R6 is C6-14 aryl, optionally substituted with one, two, or three substituents Q;
    (VII) R4a is selected from:
    (i) hydrogen or halo;
    (ii) C1-6 alkyl optionally substituted with one or more substituents Q; and
    (iii) –C (O) NR1bR1c;
    (VIII) R4b is selected from:
    (i) hydrogen or halo;
    (ii) C1-6 alkyl optionally substituted with one or more substituents Q; and
    (iii) –C (O) NR1bR1c;
    (IX) R7a is hydrogen or C1-6 alkyl optionally substituted with one or more substituents Q; and
    (X) R7b is C1-6 alkyl, optionally substituted with one, two, or three substituents Q; preferably R7b is C1-6 alkyl, optionally substituted with (i) heterocyclyl, optionally substituted with one or more substituents Qa; or (ii) –OR1a or –NR1bR1c; more preferably R7b is C1-6 alkyl, optionally substituted with monocyclic heterocyclyl, C1-6 alkoxy, C1-6 alkylamino, or di- (C1-6 alkyl) amino, each of which is optionally substituted with one or more substituents Qa;
    or R7a and R7b together with the N atom to which they are attached form heterocyclyl, optionally substituted with one or more substituents Q; more preferably R7a and R7b together with the N atom to which they are attached form monocyclic heterocyclyl, optionally substituted with one, two, or three substituents Q; more preferably R7a and R7b together with the N atom to which they are attached form piperidin-1-yl, piperazin-1-yl, or 1, 4-diazepan-1-yl, each optionally substituted with one, two, or three substituents Q.
  4. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claims 1 or 2, wherein which satisfies one or more of the following conditions:
    (I) L is (i) a bond, –N (H) –, or –N (CH3) –; or (ii) piperazin-1, 4-diyl, optionally substituted with one, two, or three substituents Q;
    (II) Z is methanediyl, ethanediyl, or propanediyl, each optionally substituted with one, two, or three substituents Q; preferably Z is methanediyl, fluoromethanediyl, difluoromethanediyl, aminocarbonylmethanediyl, ethane-1, 1-diyl, ethane-1, 2-diyl, or propane-2, 2-diyl;
    (III) E is cyclohexane-1, 4-diyl, phen-1, 3-diyl, phen-1, 4-diyl, 2-fluorophen-1, 4-diyl, 2-methylphen-1, 4-diyl, 2-trifluoromethylphen-1, 4-diyl, 2-methoxyphen-1, 4-diyl, phen-1, 4-diylmethandiyl, pyridin-2, 5-diyl, piperidin-1, 4-diyl, or 1, 2, 3, 4-tetrahydroquinolin-1, 6-diyl;
    (IV) A is –C (O) –or –S (O2) –;
    (V) R2 is fluoro, chloromethyl, 2-bromo-ethoxymethyl, ethenyl, 1-cyanoethenyl, 1-fluoroethenyl, (E) -3-dimethylaminoprop-1-enyl, (E) -3-piperidin-1-ylprop-1-enyl, ethynyl, or prop-1-ynyl
    (VI) R1 is hydrogen or methyl;
    (VII) R6 is methyl, ethyl, 2, 2, 2-trifluoroethyl, butyl, cyclopropyl, cyclopentyl, methoxy, ethoxy, or phenyl; preferably R6 is ethyl;
    (VIII) R4a is hydrogen, fluoro, methyl, or aminocarbonyl;
    (IX) R4b is hydrogen, fluoro, methyl, or aminocarbonyl; and
    (X) R7a is methyl or ethyl;
    R7b is ethyl or propyl, each optionally substituted with pyrrolin-1-yl, 2-methoxy, methylamino,  dimethylamino, or diethylamino; more preferably R7b is methyl, dimethyl-aminocarbonylmethyl, 2-methoxyethyl, 2-methylaminoethyl, 2-dimethylaminoethyl, 2-diethyl-aminoethyl, 2-pyrrolin-1-ylethyl, or 3-dimethylaminopropyl;
    or R7a and R7b together with the N atom to which they are attached form 4-aminopiperidin-1-yl, 4-dimethyl-aminopiperidin-1-yl, 4-methylpiperazin-1-yl, 4-methyl-1, 4-diazepan-1-yl, or 4- (2-hydroxyethyl) -1, 4-diazepan-1-yl.
  5. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claims 1 or 2, wherein the compound has the structure of Formula (II) :
    wherein R1, R2, R6, R7a, R7b, A, E, U are as defined in any one of claims 1-4;
    R4a and R4b are each independently (i) hydrogen, deuterium, cyano, or halo; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c; or R4a and R4b together with the C atom to which they are attached form C3- 10 cycloalkylene, optionally substituted with one or more substituents Q.
  6. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 5, wherein the compound has the structure of Formula (III) :
    wherein:
    R1, R2, R6, R7a, R7b, A, U are as defined in any one of claims 1-4; and
    R4a and R4b are as defined in claim 5;
    X is N or C (R3a) ;
    each R3 is independently (i) deuterium, cyano, halo, or nitro; (ii) C1-6 alkyl, C1-6 heteroalkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, C6-14 aryl, C7-15 aralkyl, heteroaryl, or heterocyclyl, each optionally substituted with one or more substituents Q; or (iii) –C (O) R1a, –C (O) OR1a, –C (O) NR1bR1c, –C (O) SR1a, –C (NR1a) NR1bR1c, –C (S) R1a, –C (S) OR1a, –C (S) NR1bR1c, –OR1a, –OC (O) R1a, –OC (O) OR1a, –OC (O) NR1bR1c, –OC (O) SR1a, –OC (NR1a) NR1bR1c, –OC (S) R1a, –OC (S) OR1a, –OC (S) NR1bR1c, –OS (O) R1a, –OS (O) 2R1a, –OS (O) NR1bR1c, –OS (O) 2NR1bR1c, –NR1bR1c, –NR1aC (O) R1d, –NR1aC (O) OR1d, –NR1aC (O) NR1bR1c, –NR1aC (O) SR1d, –NR1aC (NR1d) NR1bR1c, –NR1aC (S) R1d, –NR1aC (S) OR1d, –NR1aC (S) NR1bR1c, –NR1aS (O) R1d, –NR1aS (O) 2R1d, –NR1aS (O) NR1bR1c, –NR1aS (O) 2NR1bR1c, –SR1a, –S (O) R1a, –S (O) 2R1a, –S (O) NR1bR1c, or –S (O) 2NR1bR1c;
    R3a is hydrogen or R3; and
    m is an integer of 0, 1, 2, or 3.
  7. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 6,
    wherein the compound has the structure of Formula (IV) , or Formula (V) :
    wherein:
    R1, R2, R6, R7a, R7b, A, and U are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    preferably, which satisfies one or more of the following conditions:
    (I) the compound has the structure of Formula (VI) :
    wherein:
    R1, R2, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    (II) the compound has the structure of Formula (VII) :
    wherein:
    R1, R2, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    (III) the compound has the structure of Formula (VIII) :
    wherein:
    R1, R2, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    (IV) the compound has the structure of Formula (IX) :
    wherein:
    R1, R2, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6.
  8. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 7, wherein the compound is as defined in Scheme 1, 2, 3, or 4:
    Scheme 1
    the compound has the structure of Formula (X) :
    wherein:
    R1, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    wherein R2a, R2a, and R2c are each independently (i) hydrogen, deuterium, cyano, or halo; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q;
    preferably, which satisfies one or more of the following conditions:
    (I) R2a is hydrogen, deuterium, cyano, or halo; preferably R2a is hydrogen, cyano, or fluoro;
    (II) R2b is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one, two, or three substituents Q; preferably R2b is hydrogen, dimethylaminomethyl, or piperidin-1-ylmethyl;
    (III) wherein R2c is hydrogen;
    Scheme 2
    the compound has the structure of Formula (XII) :
    wherein:
    R1, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    wherein R2a, R2a, and R2c are each independently (i) hydrogen, deuterium, cyano, or halo; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q;
    preferably, which satisfies one or more of the following conditions:
    (I) R2a is hydrogen, deuterium, cyano, or halo; preferably R2a is hydrogen, cyano, or fluoro;
    (II) R2b is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one, two, or three substituents Q; preferably R2b is hydrogen, dimethylaminomethyl, or piperidin-1-ylmethyl;
    (III) wherein R2c is hydrogen;
    Scheme 3
    the compound has the of Formula (XIV) :
    wherein:
    R1, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    wherein R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q;
    preferably, R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one, two, or three substituents Q; more preferably, wherein R2d is hydrogen or methyl;
    Scheme 4
    the compound has the of Formula (XVI) :
    wherein:
    R1, R6, R7a, and R7b are as defined in any one of claims 1-4; R4a and R4b are as defined in claim 5; X, R3, and m are as defined in claim 6;
    wherein R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q;
    preferably, R2d is (i) hydrogen or deuterium; or (ii) C1-6 alkyl, optionally substituted with one, two, or three substituents Q; more preferably, wherein R2d is hydrogen or methyl.
  9. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of any one of claims 6-8, which satisfies one or more of the following conditions:
    (I) X is selected from:
    (i) X is N; and
    (ii) X is C (R3a) ;
    (II) R3a is selected from:
    (i) halo; or C1-6 alkyl or C1-6 heteroalkyl, each optionally substituted with one or more substituents Q; and
    (ii) R3a is hydrogen, fluoro, methyl, trifluoromethyl, or methoxy; and
    (III) m is an integer of 0.
  10. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claims 1 or 2, which satisfies one or more of the following conditions:
    (I) A is –C (O) –, or –S (O2) –;
    (II) E is C3-10 cycloalkylene, C6-14 arylene, C7-15 aralkylene, heteroarylene, or heterocyclylene; wherein the C3-10 cycloalkylene, the C6-14 arylene, the C7-15 aralkylene, the heteroarylene, and the heterocyclylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, C1- 6 alkoxy, and C1-6 haloalkyl;
    (III) E’ is C6-14 aryl;
    (IV) Z is C1-6 alkylene; wherein the C1-6 alkylene is optionally substituted with one, two, three, or four group (s) independently selected from halogen, C1-6 alkyl, and –C (O) NRbRc;
    (V) R1 is hydrogen or C1-6 alkyl; preferably R1 is hydrogen or -CH3;
    (VI) R5 is independently hydrogen or C1-6 alkyl; preferably R5 is independently hydrogen or -CH3;
    (VII) R2 is halogen, C1-6 haloalkyl, C1-6 haloheteroalkyl, C2-6 alkenyl, or C2-6 alkynyl; wherein the halogen in C1-6 haloalkyl is Cl and/or Br; wherein the C2-6 alkenyl, and the C2-6 alkynyl is optionally substituted with one, two, three, or four group (s) independently selected from halogen; and –NRbRc;
    (VIII) R2’ is C2-6 alkenyl; preferably R2’ is
    (VIII) R6 is C1-6 alkyl, C1-6 heteroalkyl, C3-10 cycloalkyl or C6-14 aryl; wherein the C1-6 alkyl, the C1-6 heteroalkyl, the C3-10 cycloalkyl and the C6-14 aryl is optionally substituted with one, two, three, or four halogen;
    (IX) R7a is independently hydrogen, or C1-6 alkyl. In certain embodiments, R7a is independently -CH3;
    R7b is hydrogen, C1-6 alkyl, or C1-6 heteroalkyl; wherein the C1-6 alkyl, and the C1-6 heteroalkyl is optionally substituted with one, two, three, or four group (s) independently selected from oxo, and heterocyclyl;
    or R7a and R7b together with the N atom to which they are attached form heterocyclyl, wherein the heterocyclyl is optionally substituted with one, two, three, or four Q, and Q is C1-6 alkyl, heterocyclyl, –NRbRc, –NHC (O) ORa, –NHC (O) Ra and –ORa; wherein C1-6 alkyl is optionally substituted with one, two, three, or four group (s) independently selected from –OH; and
    (X) each Ra, Rb, Rc is independently (i) hydrogen or deuterium; (ii) C1-6 alkyl optionally substituted with –NH2.
  11. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an  isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claims 1 or 2, which satisfies one or more of the following conditions:
    (I) the heteroarylene in E is a heteroarylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heteroarylene in E is the a heteroarylene having 1 heteroatom selected from N;
    (II) the heteroarylene in E is a 5-12 membered heteroarylene, preferably the heteroarylene in E is a 5-6 membered heteroarylene;
    (III) the heterocyclylene in E is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O or S, preferably the heterocyclylene in E is a heterocyclylene having 1 heteroatom selected from N;
    (IV) the heterocyclylene in E is a 5-12 membered heterocyclylene, preferably the heterocyclylene in E is a 5-6 membered heterocyclylene;
    (V) the heterocyclylene in L is a heterocyclylene having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclylene in L is heterocyclylene having 2 heteroatoms selected from N;
    (VI) the heterocyclylene in L is a 5-12 membered heterocyclylene, preferably the heterocyclylene in L is a 5-6 membered heterocyclylene;
    (VII) the C1-6 haloheteroalkyl in the R2 is a C1-6 haloheteroalkyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 haloheteroalkyl in the R2 is a C1-6 haloheteroalkyl having 1 heteroatom selected from O;
    (VIII) the C1-6 heteroalkyl in the R6 is a C1-6 heteroalky having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 heteroalkyl in the R6 is a C1-6 heteroalky having 1 heteroatom selected from O;
    (IX) the C1-6 heteroalkyl in the R7b is a C1-6 heteroalkyl, having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the C1-6 heteroalkyl in the R7b is a C1-6 heteroalkyl having 2 heteroatoms selected from N, and O;
    (X) R7a and R7b together with the N atom to which they are attached form a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably R7a and R7b together with the N atom to which they are attached form a heterocyclyl having 1 or 2 heteroatoms selected from N;
    (XI) R7a and R7b together with the N atom to which they are attached form a 5-12 membered heterocyclyl, preferably R7a and R7b together with the N atom to which they are attached form a 5-membered heterocyclyl, 6-membered heterocyclyl, or 7-membered heterocyclyl;
    (XII) the heterocyclyl in Q is a heterocyclyl having 1, 2, 3 or 4 heteroatoms independently selected from the group consisting N, O and S, preferably the heterocyclyl in Q is a heterocyclyl having having 1 heteroatom selected from N; and
    (XIII) the heterocyclyl in Q is a 5-12 membered heterocyclyl, preferably the heterocyclyl in Q is a 5-6  membered heterocyclyl.
  12. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 1, which satisfies one or more of the following conditions:
    (I) E is “*” represents the position where E is connected with L;
    (II) E’ is
    (III) L is a bond, -N (CH3) -, -NH-, or
    (IV) U is -S-, -S (O) -, -S (O2) -, -NH-, -CH2-, -O-, or -N (CH3) -;
    (V) Z is -CH2-, -CH (CH3) -, -CH2CH2-, -C (CH3) 2-, -CHF-, or -CF2-; preferably Z is -CH2-, -CH (CH3) -, -CH2CH2-;
    (VI) R2 is-CH2Cl, 
    (VII) R6 is methyl, ethyl, butyl, methoxy, ethoxy, phenyl, or -CH2CF3; preferably R6 is methyl, ethyl, phenyl, or -CH2CF3;
    (VIII) -NR7aR7b is
    (IX) -NR7aR7b’ is
    more preferably, which satisfies one or more of the following conditions:
    (I) is


    (II) is
  13. The compound of Formula (I) or Formula (I-1) , or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, hydrate, or prodrug thereof of claim 1, wherein the compound is
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacrylamide A1;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A2;
    2-chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A3;
    1-chloro-N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) -N-methylmethanesulfonamide A4;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylpropiolamide A5;
    2- (2-bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -N-methylacetamide A6;
    (E) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) -4- (dimethylamino) -N-methylbut-2-enamide A7;
    (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) -thio) methyl) phenyl) (methyl) sulfamoylfluoride A8;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A9;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) ethenesulfonamide A10;
    2- (2-bromoethoxy) -N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) -ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acetamide A11;
    N- (3- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2- yl) thio) methyl) phenyl) acrylamide A12;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) -amino) pyridin-2-yl) thio) methyl) benzyl) acrylamide A13;
    N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -phenyl) acrylamide A14;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4- (2-hydroxyethyl) -1, 4-diazepan-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A15;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -methyl) phenyl) acrylamide A16;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A17;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-methylpiperazin-1-yl) pyridine-2-yl) thio) -methyl) phenyl) acrylamide A18;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (methylamino) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A19;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A20;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-phenyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A21;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (ethyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A22;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (diethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A23;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) -2-oxoethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A24;
    N- (4- (1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) ethyl) phenyl) acrylamide A25;
    N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) acrylamide A26;
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -acrylamide A27;
    N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A28;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- ( (2-methoxyethyl) (methyl) amino) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A29;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2- yl) (methyl) amino) methyl) phenyl) acrylamide A30;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A31;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) acrylamide A32;
    2- ( (2- (1-acryloylpiperidin-4-yl) ethyl) thio) -6- ( (2- (dimethylamino) ethyl) (methyl) -amino) -4-ethylpyridine-3, 5-dicarbonitrile A33;
    N- ( (1r, 4r) -4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) cyclohexyl) acrylamide A34;
    2- ( (4- (4-acryloylpiperazin-1-yl) benzyl) thio) -6- ( (2- (dimethylamino) ethyl) - (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A35;
    N- (4- ( ( (3, 5-dicyano-4-cyclopentyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A101;
    N- (4- ( ( (4-butyl-3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A102;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A103;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A104;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A105;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A106;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A107;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (3- (dimethylamino) propyl) (methyl) -amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A108;
    N- (4- ( ( (3, 5-dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) acrylamide A109;
    N- (4- ( ( (3, 5-dicyano-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) -4- (2, 2, 2-trifluoro-ethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A110;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4- (2, 2, 2-trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A111;
    N- (4- ( ( (3, 5-dicyano-6- (4-methyl-1, 4-diazepan-1-yl) -4- (2, 2, 2-trifluoroethyl) -pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A112;
    N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4- (2, 2, 2- trifluoroethyl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A113;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) acrylamide A114;
    N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) -thio) methyl) phenyl) but-2-ynamide A115;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (methyl (2- (pyrrolidin-1-yl) ethyl) amino) pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A116;
    N- (4- ( ( (3, 5-dicyano-6- ( (3- (dimethylamino) propyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) methyl) phenyl) but-2-ynamide A117;
    N- (4- (2- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) acrylamide A118;
    N- (4- (2- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethyl-pyridin-2-yl) thio) propan-2-yl) phenyl) but-2-ynamide A119;
    N- (4- (2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) acrylamide A120;
    N- (4- (2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -propan-2-yl) phenyl) but-2-ynamide A121;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2- (trifluoromethyl) phenyl) acrylamide A123;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A124;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-methylphenyl) acrylamide A125;
    N- (5- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) pyridin-2-yl) acrylamide A126;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A127;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) acrylamide A128;
    N- (4- ( ( (3, 5-dicyano-4-cyclopropyl-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -pyridin-2-yl) (methyl) amino) methyl) phenyl) but-2-ynamide A129;
    2- ( ( (1-acryloyl-1, 2, 3, 4-tetrahydroquinolin-6-yl) methyl) thio) -6- ( (2- (dimethyl-amino) ethyl) (methyl) amino) -4-ethylpyridine-3, 5-dicarbonitrile A130;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-methoxy-pyridin-2-yl) thio) methyl) phenyl) acrylamide A131;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2- oxoethyl) phenyl) acrylamide A133;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) fluoromethyl) phenyl) acrylamide A134;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) difluoromethyl) phenyl) acrylamide A135;
    N- (4- ( ( (6- (6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A136;
    N- (4- ( ( (6- (6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethyl-pyridin-2-yl) thio) methyl) phenyl) acrylamide A137;
    N- (4- ( ( (6- ( (1R, 5S, 6r) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A138;
    N- (4- ( ( (6- ( (1R, 5S, 6r) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A139;
    N- (4- ( ( (6- ( (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A140; or
    N- (4- ( ( (6- ( (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A141;
    N- (4- ( ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A36;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A37;
    Tert-butyl ( (1R, 5S, 6s) -3- (6- ( (4-acrylamidobenzyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) -3-azabicyclo [3.1.0] hexan-6-yl) carbamate A38;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A39;
    N- (4- ( ( (6- ( (1R, 5S, 6s) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A40;
    N- (4- ( ( (6- ( (1R, 5S, 6s) -6-acetamido-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A41;
    (E) -N- (4- (2- (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) vinyl) phenyl) acrylamide A42;
    N- (4- ( ( (6- ( (1R, 5S, 6r) -6-amino-3-azabicyclo [3.1.0] hexan-3-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A43;
    N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) phenyl) -2-fluoroacrylamide A44;
    N- (4- ( ( (6- (4- (2-aminoacetamido) piperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2- yl) thio) methyl) phenyl) acrylamide A45;
    N- (6- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) pyridin-3-yl) acrylamide A46;
    N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2-methoxyphenyl) acrylamide A47;
    N- (4- ( ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) methyl) -2, 5-difluorophenyl) acrylamide A48;
    N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A49;
    N- (4- (2-amino-1- ( (6- (4-aminopiperidin-1-yl) -3, 5-dicyano-4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) -2-fluoroacrylamide A50;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4-hydroxypiperidin-1-yl) pyridin-2-yl) thio) methyl) phenyl) acrylamide A51;
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) acrylamide A52
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) methyl) phenyl) -N-methylethenesulfonamide A53;
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) oxy) methyl) phenyl) acrylamide A54;
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfinyl) methyl) phenyl) acrylamide A56;
    N- (4- ( ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) sulfonyl) methyl) phenyl) acrylamide A57;
    (R) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58a;
    (S) -N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) phenyl) acrylamide A58b;
    2- ( (3, 5-Dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A59;
    2- ( (3, 5-Dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) thio) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A60;
    2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A61;
    2- ( (3, 5-dicyano-4-ethyl-6- (4-methyl-1, 4-diazepan-1-yl) pyridin-2-yl) amino) -2- (4- (N-methylvinylsulfonamido) phenyl) acetamide A62;
    N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) acrylamide A63;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A64;
    N- (4- (1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) ethyl) -2-fluorophenyl) acrylamide A65;
    N- (4- ( ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) methyl) -2-fluorophenyl) but-2-ynamide A66;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) but-2-ynamide A67;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-fluorophenyl) acrylamide A68;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) amino) -2-oxoethyl) -2-fluorophenyl) acrylamide A69;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-fluorophenyl) acrylamide A70;
    N- (4- ( ( (3, 5-dicyano-4-ethyl-6- (4- (pyrrolidin-1-yl) piperidin-1-yl) pyridin-2-yl) oxy) methyl) phenyl) acrylamide A71;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A72;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A73;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- ( (2- (dimethylamino) ethyl) (methyl) amino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methoxyphenyl) acrylamide A74;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A75;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (4- (dimethylamino) piperidin-1-yl) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -3-methylphenyl) acrylamide A76;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) acrylamide A77;
    N- (4- (2-amino-1- ( (3, 5-dicyano-6- (dimethylamino) -4-ethylpyridin-2-yl) thio) -2-oxoethyl) -2-methylphenyl) -N-methylacrylamide A78;
    N- (2- ( (3, 5-dicyano-4-ethyl-6- ( (4- (N-methylmethylsulfonamido) benzyl) thio) pyridin-2-yl) (methyl) amino) ethyl) -N-methylacrylamide A79;
    N- (1- (6- ( (2-amino-2-oxo-1-phenylethyl) thio) -3, 5-dicyano-4-ethylpyridin-2-yl) piperidin-4-yl) acrylamide A80;
    2- ( (3, 5-dicyano-4-ethyl-6- (4- (vinylsulfonamido) piperidin-1-yl) pyridin-2-yl) thio) -2-phenylacetamide A81.
  14. A pharmaceutical composition comprising the compound of any one of claims 1 to 13, or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; and a pharmaceutically acceptable excipient, preferably which satisfies one or more of the following conditions:
    (I) the composition is in single dosage form; and
    (II) the composition is in an oral, parenteral, or intravenous dosage form; preferably the composition is formulated in an oral dosage form; more preferably the oral dosage form is a tablet or capsule.
  15. A method of treating, preventing, or ameliorating one or more symptoms of DNMT1-mediated disorder, disease, or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound of any one of claims 1 to 13, or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; or a pharmaceutical composition of claim 14; preferably which satisfies one or more of the following conditions:
    (I) the DNMT1-mediated disorder, disease, or condition is a proliferative disease; and
    (II) the subject is a human.
  16. A method of treating, preventing, or ameliorating one or more symptoms of a proliferative disease in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound of any one of claims 1 to 13, or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; or a pharmaceutical composition of claim 14; preferably which satisfies one or more of the following conditions:
    (I) the proliferative disease is cancer; preferably the cancer is relapsed or refractory; more preferably the cancer is metastatic; more preferably the cancer is drug-resistant; and
    (II) the subject is a human.
  17. A method of inhibiting the growth of a cell, comprising contacting the cell with an effective amount of a compound of any one of claims 1 to 13, or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; or a pharmaceutical composition of claim 14, preferably the cell is a cancerous cell.
  18. A method of inhibiting the activity of a DNMT1, comprising contacting the DNMT1 with an effective amount of a compound of any one of claims 1 to 13, or an enantiomer, a mixture of enantiomers, a diastereomer, a mixture of two or more diastereomers, a tautomer, a mixture of two or more tautomers, or an isotopic variant thereof; or a pharmaceutically acceptable salt, solvate, or hydrate thereof; or a pharmaceutical composition of claim 14.
PCT/CN2024/074266 2023-01-29 2024-01-26 Dnmt1 inhibitors, pharmaceutical compositions, and therapeutic applications WO2024156288A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CNPCT/CN2023/073678 2023-01-29
CN2023073678 2023-01-29

Publications (1)

Publication Number Publication Date
WO2024156288A1 true WO2024156288A1 (en) 2024-08-02

Family

ID=91969929

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2024/074266 WO2024156288A1 (en) 2023-01-29 2024-01-26 Dnmt1 inhibitors, pharmaceutical compositions, and therapeutic applications

Country Status (1)

Country Link
WO (1) WO2024156288A1 (en)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006078752A2 (en) * 2005-01-21 2006-07-27 Methylgene, Inc. Inhibitors of dna methyltransferase
WO2012000945A1 (en) * 2010-06-30 2012-01-05 Bayer Pharma Aktiengesellschaft Substituted dicyanopyridines and use thereof
CN106977425A (en) * 2017-04-01 2017-07-25 清华大学深圳研究生院 Hydroxamic acid derivs with dnmt rna and histon deacetylase (HDAC) inhibitory activity and preparation method and application
CN109563043A (en) * 2016-06-13 2019-04-02 葛兰素史密斯克莱知识产权发展有限公司 The substituted pyridine of inhibitor as DNMT1
WO2020132653A1 (en) * 2018-12-20 2020-06-25 Amgen Inc. Heteroaryl amides useful as kif18a inhibitors
WO2020132651A1 (en) * 2018-12-20 2020-06-25 Amgen Inc. Kif18a inhibitors
WO2022268230A1 (en) * 2021-06-25 2022-12-29 杭州英创医药科技有限公司 Compound as kif18a inhibitor
WO2023192629A1 (en) * 2022-04-01 2023-10-05 Herophilus, Inc. Induction of mecp2 expression by dna methyl transferase inhibitors

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006078752A2 (en) * 2005-01-21 2006-07-27 Methylgene, Inc. Inhibitors of dna methyltransferase
WO2012000945A1 (en) * 2010-06-30 2012-01-05 Bayer Pharma Aktiengesellschaft Substituted dicyanopyridines and use thereof
CN109563043A (en) * 2016-06-13 2019-04-02 葛兰素史密斯克莱知识产权发展有限公司 The substituted pyridine of inhibitor as DNMT1
CN106977425A (en) * 2017-04-01 2017-07-25 清华大学深圳研究生院 Hydroxamic acid derivs with dnmt rna and histon deacetylase (HDAC) inhibitory activity and preparation method and application
WO2020132653A1 (en) * 2018-12-20 2020-06-25 Amgen Inc. Heteroaryl amides useful as kif18a inhibitors
WO2020132651A1 (en) * 2018-12-20 2020-06-25 Amgen Inc. Kif18a inhibitors
WO2022268230A1 (en) * 2021-06-25 2022-12-29 杭州英创医药科技有限公司 Compound as kif18a inhibitor
WO2023192629A1 (en) * 2022-04-01 2023-10-05 Herophilus, Inc. Induction of mecp2 expression by dna methyl transferase inhibitors

Similar Documents

Publication Publication Date Title
US20240025863A1 (en) Sos1 protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
AU2022292649A1 (en) Sos1 protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
WO2022087335A1 (en) Kras protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
AU2021250904B2 (en) Pyridinethiones, pharmaceutical compositions thereof, and their therapeutic use for treating a proliferative, inflammatory, neurodegenerative, or immune-mediated disease
WO2023178130A1 (en) Sos1 protein degraders, pharmaceutical compositions, and therapeutic applications
WO2023023531A1 (en) Estrogen receptor degraders, pharmaceutical compositions, and therapeutic applications
US20240190883A1 (en) Kras protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
WO2023185920A1 (en) Fak degraders, pharmaceutical compositions, and therapeutic applications
WO2024017178A1 (en) Substituted hydantoin compounds, pharmaceutical compositions, and therapeutic applications
WO2021007474A1 (en) Phenyl compounds and pharmaceutical compositions thereof, and their therapeutic applications
WO2023207875A1 (en) Cdk inhibitors, pharmaceutical compositions, and therapeutic applications
US20230293702A1 (en) Quinazolines, pharmaceutical compositions, and therapeutic applications
WO2022242582A1 (en) Indene compounds, pharmaceutical compositions thereof, and their therapeutic applications
US10045972B2 (en) Hydroxypyridone derivatives, pharmaceutical compositions thereof, and their therapeutic use for treating inflammatory, neurodegenerative, or immune-mediated diseases
WO2022197862A1 (en) Sos1 protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
WO2024156288A1 (en) Dnmt1 inhibitors, pharmaceutical compositions, and therapeutic applications
US9637460B2 (en) Isotopically enriched arylsulfonamide CCR3 antagonists
WO2021007478A1 (en) Sulfone compounds and pharmaceutical compositions thereof, and their therapeutic applications for the treatment of neurodegenerative diseases
WO2021047672A1 (en) Triterpenoid compounds, pharmaceutical compositions thereof, and their use for treating nuclear receptor subfamily 4 group member 1-mediated disease
DK2542542T3 (en) ISOTOPIC ENRICHED ARYL SULPHONAMIDE CCR3 ANTAGONISTS
WO2024120442A1 (en) Pak4 protein degraders, pharmaceutical compositions, and therapeutic applications
WO2024104422A1 (en) Phosphorus-containing compounds for treating inflammatory bowel diesease
WO2024012557A1 (en) Anti-apoptotic bcl-2 family protein degraders, pharmaceutical compositions, and therapeutic applications
WO2022212611A1 (en) Kras protein degraders, pharmaceutical compositions thereof, and their therapeutic applications
WO2023143476A1 (en) Deuterated rock inhibitors, pharmaceutical compositions, and therapeutic applications

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24746995

Country of ref document: EP

Kind code of ref document: A1