WO2024153675A1 - Rna formulations for pharmaceutical use - Google Patents

Rna formulations for pharmaceutical use Download PDF

Info

Publication number
WO2024153675A1
WO2024153675A1 PCT/EP2024/050983 EP2024050983W WO2024153675A1 WO 2024153675 A1 WO2024153675 A1 WO 2024153675A1 EP 2024050983 W EP2024050983 W EP 2024050983W WO 2024153675 A1 WO2024153675 A1 WO 2024153675A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
nucleotide sequence
seq
composition
nucleotides
Prior art date
Application number
PCT/EP2024/050983
Other languages
French (fr)
Inventor
Ugur Sahin
Katalin Karikó
Sergey BESSONOV
Thomas ZIEGENHALS
Stephanie FESSER
Anna ERNST
Gábor BOROS
Jonas REINHOLZ
Irena VLATKOVIC
Azita MAHINY
Original Assignee
BioNTech SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BioNTech SE filed Critical BioNTech SE
Publication of WO2024153675A1 publication Critical patent/WO2024153675A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/5123—Organic compounds, e.g. fats, sugars
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing

Definitions

  • RNA comprising one or more miRNA binding sequences, wherein the one or more miRNA binding sequences bind to miRNA that is present in cells in which expression of the RNA is not desired.
  • Delivering the RNA to cells after administration, in particular after intramuscular or intravenous administration allows expression of a polypeptide encoded by the RNA in certain cells while expression in other cells is repressed.
  • such cells comprise endothelial cells.
  • RNA compositions described herein allow expression of a pharmaceutically active peptide or polypeptide by the RNA in a subject while reducing or avoiding the risks of undesired effects resulting from expression of the pharmaceutically active peptide or polypeptide in certain cells or tissues.
  • the present disclosure also relates to methods for delivering RNA to cells of a subject or for treating or preventing a disease or disorder in a subject, wherein the methods comprise administering to a subject a composition of the present disclosure.
  • the RNA compositions in some embodiments comprise single-stranded RNA such as mRNA which encodes a peptide or polypeptide of interest, such as a pharmaceutically active peptide or polypeptide.
  • the RNA is taken up by cells of a subject treated and the RNA is translated into the encoded peptide or polypeptide, which may exhibit its physiological activity.
  • the present disclosure also relates to methods for delivering a pharmaceutically active peptide or polypeptide to a subject or for treating or preventing a disease or disorder in a subject, wherein the methods comprise administering to a subject an RNA composition of the present disclosure, wherein the RNA encodes the pharmaceutically active peptide or polypeptide.
  • RNA offers an attractive alternative to DNA in order to circumvent the potential safety risks connected with the therapeutic use of DNA.
  • IVT-RNA v/tro-transcribed RNA
  • the advantages of a therapeutic use of RNA include transient expression and a non-transforming character. RNA does not need to enter the nucleus in order to be expressed and moreover cannot integrate into the host genome, thereby eliminating the risk of oncogenesis.
  • injection of RNA can induce both cellular and humoral immune responses in vivo.
  • a prerequisite for the effectiveness of RNA-based therapeutics is high stability and translation efficiency of the RNA.
  • RNA molecules are intrinsically unstable and their intracellular kinetics depend on the untranslated regions (UTRs) embracing the coding sequence, in particular the 3' UTR elements.
  • RNA with a 3' UTR comprising segments from the amino-terminal enhancer of split (AES) mRNA (also referred to herein as "F element”; SEQ ID NO: 1) and the mitochondrially encoded 12S ribosomal RNA (mtRNRl) (also referred to herein as "I element”; SEQ ID NO: 2) confers RNA stability and high total protein expression.
  • AES-mtRNRl 3' UTRs were profoundly superior compared to other 3' UTRs (Orlandini von Niessen, A. G. et al. (2019) Molecular therapy: the journal of the American Society of Gene Therapy, 27(4), 824-836; WO 2017/060314).
  • RNA is not expressed in certain cells and tissues.
  • the expression product may be harmful to certain cells and tissues.
  • RNA expression in certain cells and tissues by incorporating one or more miRNA binding sequences into the RNA that are specific for miRNA expressed in the cells and tissues in which RNA expression is to be prevented.
  • the one or more miRNA binding sequences function to recruit one or more miRNA molecules expressed, e.g., selectively expressed, in one or more cell or tissue types in which expression of the RNA is not desired.
  • the one or more miRNA molecules target the RNA thereby inhibiting the translation of the target RNA or destabilizing the target RNA.
  • the object of the present invention was to provide RNA that can be used to achieve high levels of expression in target cells and tissues while suppressing expression in non-target cells and tissues, e.g., to prevent toxic effects.
  • the present study investigated whether inhibition of expression by incorporation of miRNA binding sites is also effective in RNA molecules that have been artificially modified to achieve profoundly increased stability and expression compared to naturally occurring RNA, e.g., by incorporating an AES-mtRNRl 3' UTR.
  • RNA comprising an AES-mtRNRl 3' UTR in non-target cells or tissue can be achieved by the incorporation into the RNA of one or more miRNA target sites (miRNA binding sequences) that are specific for miRNAs exclusively expressed in non-target cells or tissue.
  • miRNA target sites miRNA binding sequences
  • the RNA comprising one or more miRNA binding sequences described herein functions to recruit one or more miRNA molecules in one or more cell or tissue types in which expression of the RNA is not desired, wherein the one or more miRNA molecules target the RNA thereby modulating (e.g., inhibiting) the translation of the target RNA or destabilizing the target RNA.
  • one or more selected endogenous miRNAs can modulate (e.g., silence) gene expression of target RNA possessing one or more binding sites for these miRNAs.
  • the selected endogenous miRNAs are expressed or selectively expressed in one or more cell or tissue types in which expression of the RNA is not desired.
  • the disclosed RNA allows for cell type-specific or tissue-specific gene modulation (e.g., silencing) by recruitment of one or more miRNAs that are cell type-specific or tissue-specific (e.g., miR-126 which is specific for endothelial cells).
  • RNA formulations which are useful for RNA delivery in vivo, such as for pharmaceutical application, and methods comprising the administration of RNA to a subject.
  • the RNA described herein comprises one or more miRNA binding sequences binding to miRNA that is present in cells in which expression of the RNA is not desired.
  • such cells comprise endothelial cells.
  • the RNA described herein allows expression of a pharmaceutically active peptide or polypeptide by the RNA in a subject while reducing or avoiding the risks uf undesired effects resulting from expression of the pharmaceutically active peptide or polypeptide in certain cells or tissues.
  • the present disclosure provides a composition or medical preparation comprising RNA, wherein the RNA comprises:
  • a 3' UTR sequence comprising a first sequence comprising the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:
  • the RNA comprises at least one of the one or more miRNA binding sequences upstream of the first and second sequences, downstream of the first and second sequences, or downstream of the first sequence and upstream of the second sequence.
  • the first sequence is located upstream of the second sequence.
  • the 3' UTR sequence comprises the nucleotide sequence of SEQ ID NO:
  • the RNA comprises at least one of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
  • the RNA comprises each of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
  • the RNA comprises a nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence.
  • the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence (Xl)nCGAX2, wherein XI is any nucleotide, n is 0 to 10, and X2 is G or U. In some embodiments, n is 1 to 6, e.g., 2 or 5.
  • the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence CUCGAG or GGAUCCGAU.
  • At least one of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired. In some embodiments, each of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired.
  • the RNA comprises three or more miRNA binding sequences, wherein the three or more miRNA binding sequences bind to the same or different miRNAs.
  • the RNA comprises two or more miRNA binding sequences, wherein the two or more miRNA binding sequences bind to the same or different miRNAs.
  • the RNA comprises one miRNA binding sequence.
  • the one or more miRNA binding sequences comprise a nucleotide sequence that is an exact Watson-Crick complement of the miRNA.
  • the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence gagaccugguccagagucgcuagccgcgucgcu or CUXGAGCUAGC, wherein X is G, C, A, or U.
  • the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence CUXGAGCUAGC, wherein X is C, A, or U.
  • the nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprises the sequence CUCGAGCUAGC.
  • the RNA comprises in the 5’ to 3' direction the 5' UTR, the coding sequence that encodes a polypeptide, the miRNA binding sequence(s), optionally the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence, the 3' UTR sequence, optionally the nucleotide sequence linking the 3' UTR sequence and the poly- A sequence, and the poly-A sequence.
  • the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • the poly-A sequence is an interrupted sequence of A nucleotides.
  • the poly-A sequence comprises at least 100 nucleotides.
  • the poly-A sequence comprises or consists of the nucleotide sequence Ax-L-Ay, wherein Ax is a sequence of at least 20 A nucleotides, Ay is a sequence of at least 60 A nucleotides and L is a linker of 1 to 20 nucleotides which may include nucleotides other than A.
  • the poly-A sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 4.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1X2X3X4AACUAGU, wherein XI is any nucleotide, preferably A or C, X2 is any nucleotide, preferably A or C, X3 is any nucleotide, preferably C, U or G, and X4 is A or is missing.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGACGAACUAGU.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1AX3AAACUAGU, wherein XI is any nucleotide, preferably A or C, and X3 is any nucleotide, preferably C or U.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGAAUAAACUAGU.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGCACAAACUAGU.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 12.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 10.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 9.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
  • the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9.
  • At least 90% is at least 95%, 96%, 97%, 98%, or 99%.
  • the RNA comprises two or more coding sequences encoding two or more polypeptides.
  • the polypeptide is a pharmaceutically active polypeptide.
  • the RNA comprises a modified nucleoside in place of uridine.
  • the RNA comprises a modified nucleoside in place of each uridine.
  • the modified nucleoside is pseudouridine (ip) and/or Nl-methyl- pseudouridine (mlip).
  • the modified nucleoside is Nl-methyl-pseudouridine (mlip).
  • the RNA comprises a 5' cap.
  • the RNA comprises a capl structure.
  • the RNA comprises the 5' cap m2 7 ' 3 ’’ 0 Gppp(mi 2 ' ⁇ °)ApG.
  • the RNA is single-stranded RNA.
  • the RNA is mRNA.
  • the RNA is formulated in a delivery vehicle.
  • the RNA is formulated in lipid nanoparticles (LNP).
  • LNP lipid nanoparticles
  • lipids that form the lipid nanoparticles comprise a cationic lipid, a polymer-conjugated lipid, a neutral lipid, and a steroid.
  • the cationic lipid comprises a cationically ionizable lipid.
  • the polymer-conjugated lipid comprises a PEG-conjugated lipid.
  • the neutral lipid comprises a phospholipid
  • the steroid comprises cholesterol.
  • the cationic lipid is present in about 35-65 mol% of the total lipids; b. the polymer-conjugated lipid is present in about 1-5 mol% of the total lipids; c. the neutral lipid is present in about 5-15 mol% of the total lipids; and d. the steroid is present in about 30-50 mol% of the total lipids.
  • the lipid nanoparticles have an average size of about 50-150 nm.
  • the composition is a pharmaceutical composition.
  • the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and/or excipients.
  • the medical preparation is a kit.
  • the RNA and optionally the particle forming components are in separate vials.
  • the composition or medical preparation is for parenteral administration. In some embodiments, the composition or medical preparation is for intramuscular administration. In some embodiments, the composition or medical preparation is for intravenous administration.
  • At least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in endothelial cells.
  • the miRNA is miR-126, optionally miR-126-5p or miR-126-3p.
  • at least one, optionally each, of the miRNA binding sequences comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p).
  • At least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hematopoietic cells, e.g., immune cells.
  • the immune cells comprise dendritic cells and/or macrophages, e.g., Kupffer cells.
  • the miRNA is miR-142, optionally miR-142-3p.
  • at least one, optionally each, of the miRNA binding sequences comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p).
  • At least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hepatic cells.
  • the miRNA is miR-122.
  • at least one, optionally each, of the miRNA binding sequences comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122).
  • an RNA described herein comprises in the 5' to 3' direction:
  • nucleotide sequence of SEQ ID NO: 3 downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5' to 3' direction:
  • nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5' to 3' direction:
  • nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5' to 3' direction:
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
  • nucleotide sequence of SEQ ID NO: 3 downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5’ to 3 1 direction: (a) a 5' UTR,
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
  • nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5’ to 3' direction:
  • a poly-A sequence wherein the 3' UTR comprises: (i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
  • nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5 1 to 3' direction:
  • a poly-A sequence wherein the 3' UTR comprises: (i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of SEQ ID NO: 3 downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5 1 to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides I to 317 of SEQ ID NO: 9 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides I to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5 1 to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and, (ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
  • nucleotide sequence of SEQ ID NO: 3 downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
  • nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5' to 3 1 direction:
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
  • nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5' to 3' direction: (a) a 5' UTR,
  • a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of SEQ ID NO: 3 downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and, (ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides I to 295 of SEQ ID NO: 10 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides I to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides I to 298 of SEQ ID NO: 11 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides I to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5 1 to 3' direction:
  • a poly-A sequence wherein the 3' UTR comprises: (i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of SEQ ID NO: 3 downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
  • an RNA described herein comprises in the 5 1 to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
  • an RNA described herein comprises in the 5' to 3' direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
  • an RNA described herein comprises in the 5’ to 3 1 direction:
  • a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
  • nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12 downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
  • the present disclosure provides a method of controlling expression of a polypeptide in a subject in a cell type and/or tissue specific manner, the method comprising administering to the subject the composition described herein, wherein the one or more miRNA binding sequences bind to miRNA that is present in one or more cells or tissues of the subject in which expression of the polypeptide is not desired.
  • the miRNA is not present in one or more cells or tissues otherthan the one or more cells or tissues in which expression of the polypeptide is not desired or is present in one or more cells or tissues other than the one or more cells or tissues in which expression of the polypeptide is not desired in a lower amount compared to the one or more cells or tissues in which expression of the polypeptide is not desired.
  • the present disclosure provides a method for treating a subject comprising administering to the subject the composition described herein for expressing the polypeptide in cells of the subject while avoiding expression of the polypeptide in selected cells of the subject, wherein the one or more miRNA binding sequences bind to miRNA that is present in the selected cells.
  • the miRNA is not present in cells other than the selected cells or is present in cells other than the selected cells in a lower amount compared to the selected cells.
  • administration is by parenteral administration.
  • administration is by intramuscular administration.
  • administration is by intravenous administration.
  • Figure 1 Expression of miR-126-BS mRNAs in HEK293 cells. mRNAs containing miR-126-5p and miR-126-3p binding site were trasfected in HEK293 cells together with correcponding miRNA mimics or non-specific miRNA. The expression of the encoded protein was analyzed by FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
  • FIG. 2 Expression of miR-126-BS mRNAs in HUVEC cells. 126-5p-BS and 126-3p-BS mRNAs together with miRNA mimics were transfected in HUVECs and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
  • FIG. 3 Expression of miR-BS mRNAs containning miR-208b, miR-216a and miR-217 binding sites in HEK293 cells. miR-BS mRNAs together with miRNA mimics were transfected in HEK293 cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
  • FIG. 4 Expression of miR-BS mRNAs containning miR-208b, miR-216a and miR-217 binding sites in HUVEC cells. miR-BS mRNAs together with miRNA mimics were transfected in HUVEC cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
  • FIG. 5 Expression of miR-BS mRNAs containning 1-3 miR-126-5P binding sites at different positions in HEK293 cells. 126-5p-BS mRNAs (1-9, see table in Example 1 for the reference) together with miRNA mimics were transfected in HEK293 cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (top panel) and their mean fluorecence intensity (bottom panel).
  • FIG. 6 Expression of miR-BS mRNAs containning 1-3 miR-126-5P binding sites at different positions in HUVEC cells. miR-BS mRNAs were transfected in HUVEC cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
  • FIG. 7 - (A) Luciferase activity in CHO cells at 24 hours after transfection (by TransIT or lipofectamine) of luciferase-encoding mRNA either with ("luc-miRT-142-3p) or without ("luc") insertion of 4 x miRT-142-3p sequences in the 3'UTR.
  • EPO levels were measured in the supernatant of human primary cells (hepatocytes (h H EP), dendritic cells (hDCs) or Kupffer cells (hKupffer)) at 24 h after cell transfection with LNP-formulated EPO mRNA containing either 4 tandem repeats of miRT-142-3p (miRT142-3p) or 4 tandem repeats of a scrambled version of the miRT142-3p sequence (miRT-142-3p mix) in the 3'UTR.
  • human primary cells hepatocytes (h H EP), dendritic cells (hDCs) or Kupffer cells (hKupffer)
  • EPO levels (pg/ml) were measured in the supernatant of different cell cultures (HEK293, CHO, Huh7, hHEP, hDC or hKupffer) at 24 h after cell transfection with LNP-formulated EPO mRNA (Backbone B) containing either 4 x miRT-142-3p (miRT-142-3p) or 4 x scrambled version of the miRT-142-3p sequence (miRT-142-3p mix) in the 3'UTR.
  • EPO levels were measured in the supernatant of human primary cells (hepatocytes (hHEP), dendritic cells (hDC) or Kupffer cells (hKupffer)) at 24 h after cell transfection with LNP-formulated EPO mRNA containing either 4 tandem repeats of miRT-122 (miRT-122) or 4 tandem repeats of a scrambled version of the miRT-122 sequence (miRT-122 mix) in the 3'UTR.
  • hHEP hepatocytes
  • hDC dendritic cells
  • hKupffer Kupffer cells
  • EPO levels (pg/ml) were measured in the supernatant of different cell cultures (HEK293, CHO, Huh7, l'Hep, hDC or l'Kupffer) at 24 h after cell transfection with LNP-formulated EPO mRNA (Backbone B) containing either 4 x miRT-122 (miRT-122) or 4 x scrambled version of the miRT-122 sequence (miRT-122 mix) in the 3'UTR.
  • FIG 9 Luciferase-encoding IVT mRNA (unmodified (U) or modified (lmtp)), either with or without 4 x miRT-122 in the 3'-UTR, was formulated in LNP and administered to mice by intramuscular injection to deliver the indicated concentrations of mRNA. Luciferase expression levels (Radiance (p/sec/cm 3 /sr) in the mice were measured 6 hours (6h) and 24 hours (24h) after administration, at two different exposure levels.
  • Figure 10 - EPO levels were measured in the supernatant of human primary hepatocytes (hHEP) (A) or primary human Kupffer (hKupffer) (B) cells at 24 h after cell transfection with LNP-A formulated EPO-encoding IVT mRNAs containing 4 x miRT-122 or miRT-142-3p, or corresponding scrambled sequences (mix) in the 3'-UTR.
  • hHEP human primary hepatocytes
  • hKupffer primary human Kupffer
  • Figure 11 shows that EPO mRNA transcribed from Backbone C is superior to Backbone A but inferior to that derived from Backbone B / Backbone D cassette in vivo.
  • Figure 12 shows a comparison of mRNA translation derived from Backbones B, C and D with different coding sequences and demonstrates that the differences in performance between Backbone C and Backbone B/D is independent of the coding sequence.
  • A Firelfly Luciferase mRNAs in Backbones B (•), C(B) and D ( A ) were electroporated two times (solid and dashed lines) in hiDCs. Bright-Glo assay was performed at the times indicated.
  • B eGFP mRNAs in Backbones C( «) and D (A ) were electroporated in hiDCs twice (solid and dashed lines). Cells were harvested and assayed with FACS for eGFP expression at the times indicated.
  • Figure 13 shows the translation of Firefly Luciferase mRNAs derived from Backbones B and C containing different nucleotides at position -9 upstream of polyA in hiDCs and demonstrates that the 3' UTR end sequence impacts long-term translation in vitro.
  • Firefly Luciferase mRNAs from Backbones B (panel A) and C (Panel B) having A(A), G( «), T( A ) or C( «) at the position -9 upstream of polyA sequence were electroporated in hiDCs in two separate experiments and Luciferase expression was assayed at the indicated time points.
  • Figure 14 shows that the 3' UTR end sequence significantly impacts long-term translation in vivo using Backbone B.
  • Figure 15 shows that the 3' UTR end sequence significantly impacts long-term translation in vivo using Backbone D.
  • Figure 16 -LUC activity Relative Light Units (RLU)
  • RLU Relative Light Units
  • the term "about” denotes an interval of accuracy that the person of ordinary skill will understand to still ensure the technical effect of the feature in question.
  • the term typically indicates deviation from the indicated numerical value by ⁇ 10%, ⁇ 5%, ⁇ 4%, ⁇ 3%, ⁇ 2%, ⁇ 1%, ⁇ 0.9%, ⁇ 0.8%, ⁇ 0.7%, ⁇ 0.6%, ⁇ 0.5%, ⁇ 0.4%, ⁇ 0.3%, ⁇ 0.2%, ⁇ 0.1%, ⁇ 0.05%, and for example ⁇ 0.01%.
  • "about” indicates deviation from the indicated numerical value by ⁇ 10%.
  • “about” indicates deviation from the indicated numerical value by ⁇ 5%.
  • “about” indicates deviation from the indicated numerical value by ⁇ 4%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 3%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 2%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 1%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.9%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.8%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.7%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.6%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.5%.
  • “about” indicates deviation from the indicated numerical value by ⁇ 0.4%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.3%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.2%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.1%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.05%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.01%. As will be appreciated by the person of ordinary skill, the specific such deviation for a numerical value for a given technical effect will depend on the nature of the technical effect. For example, a natural or biological technical effect may generally have a larger such deviation than one for a man-made or engineering technical effect.
  • sequences described herein, in particular in the sequence listing refer to DNA molecules
  • nucleotide sequence as described herein in particular in the sequence listing
  • the nucleotide sequence referred to is actually identical to the base-sequence of the DNA molecule described herein, in particular in the sequence listing, e.g., represented in a SEQ ID NO referred to, except that thymine is replaced by uracil.
  • Physiological pH refers to a pH of about 7.4. In some embodiments, physiological pH is from 7.3 to 7.5. In some embodiments, physiological pH is from 7.35 to 7.45. In some embodiments, physiological pH is 7.3, 7.35, 7.4, 7.45, or 7.5.
  • % w/v refers to weight by volume percent, which is a unit of concentration measuring the amount of solute in grams (g) expressed as a percent of the total volume of solution in milliliters (mL).
  • % by weight refers to weight percent, which is a unit of concentration measuring the amount of a substance in grams (g) expressed as a percent of the total weight of the total composition in grams (g).
  • mol % is defined as the ratio of the number of moles of one component to the total number of moles of all components, multiplied by 100.
  • mol % of the total lipid is defined as the ratio of the number of moles of one lipid component to the total number of moles of all lipids, multiplied by 100.
  • total lipid includes lipids and lipid- like material.
  • ionic strength refers to the mathematical relationship between the number of different kinds of ionic species in a particular solution and their respective charges.
  • ionic strength I is represented mathematically by the formula: in which c is the molar concentration of a particular ionic species and z the absolute value of its charge. The sum 1 is taken over all the different kinds of ions (i) in solution.
  • the term "ionic strength" in some embodiments relates to the presence of monovalent ions.
  • divalent ions in particular divalent cations
  • their concentration or effective concentration (presence of free ions) due to the presence of chelating agents is, in some embodiments, sufficiently low so as to prevent degradation of the nucleic acid.
  • the concentration or effective concentration of divalent ions is below the catalytic level for hydrolysis of the phosphodiester bonds between nucleotides such as RNA nucleotides.
  • the concentration of free divalent ions is 20 pM or less. In some embodiments, there are no or essentially no free divalent ions.
  • Oleality refers to the concentration of a particular solute expressed as the number of osmoles of solute per kilogram of solvent.
  • lyophilizing refers to the freeze-drying of a substance by freezing it and then reducing the surrounding pressure (e.g., below 15 Pa, such as below 10 Pa, below 5 Pa, or 1 Pa or less) to allow the frozen medium in the substance to sublimate directly from the solid phase to the gas phase.
  • surrounding pressure e.g., below 15 Pa, such as below 10 Pa, below 5 Pa, or 1 Pa or less
  • spray-drying refers to spray-drying a substance by mixing (heated) gas with a fluid that is atomized (sprayed) within a vessel (spray dryer), where the solvent from the formed droplets evaporates, leading to a dry powder.
  • reconstitute relates to adding a solvent such as water to a dried product to return it to a liquid state such as its original liquid state.
  • recombinant in the context of the present disclosure means "made through genetic engineering”. In some embodiments, a "recombinant object" in the context of the present disclosure is not occurring naturally.
  • naturally occurring refers to the fact that an object can be found in nature.
  • a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring.
  • found in nature means "present in nature” and includes known objects as well as objects that have not yet been discovered and/or isolated from nature, but that may be discovered and/or isolated in the future from a natural source.
  • room temperature and “ambient temperature” are used interchangeably herein and refer to temperatures from at least about 15°C, e.g., from about 15°C to about 35°C, from about 15°C to about 30°C, from about 15°C to about 25°C, or from about 17°C to about 22°C. Such temperatures will include 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C and 22°C.
  • EDTA refers to ethylenediaminetetraacetic acid disodium salt. All concentrations are given with respect to the EDTA disodium salt.
  • cryoprotectant relates to a substance that is added to a formulation in order to protect the active ingredients during the freezing stages.
  • lyoprotectant relates to a substance that is added to a formulation in order to protect the active ingredients during the drying stages.
  • peptide refers to substances which comprise about two or more, about 3 or more, about 4 or more, about 6 or more, about 8 or more, about 10 or more, about 13 or more, about 16 or more, about 20 or more, and up to about 50, about 100 or about 150, consecutive amino acids linked to one another via peptide bonds.
  • polypeptide refers to large peptides, in particular peptides having at least about 151 amino acids.
  • peptides and polypeptides are both protein molecules, and, therefore, the terms “peptide”, “protein” and “polypeptide” are generally used interchangeably herein.
  • polypeptide when used herein generally covers peptides and polypeptides of any length.
  • biological activity means the response of a biological system to a molecule. Such biological systems may be, for example, a cell or an organism. In some embodiments, such response is therapeutically or pharmaceutically useful.
  • portion refers to a fraction. With respect to a particular structure such as an amino acid sequence or protein the term “portion” thereof may designate a continuous or a discontinuous fraction of said structure.
  • part and fragment are used interchangeably herein and refer to a continuous element.
  • a part of a structure such as an amino acid sequence or protein refers to a continuous element of said structure.
  • the term “part” means a portion of the composition.
  • a part of a composition may be any portion from 0.1% to 99.9% (such as 0.1%, 0.5%, 1%, 5%, 10%, 50%, 90%, or 99%) of said composition.
  • “Fragment” with reference to an amino acid sequence (peptide or polypeptide), relates to a part of an amino acid sequence, i.e. a sequence which represents the amino acid sequence shortened at the N-terminus and/or C-terminus.
  • a fragment shortened at the C-terminus is obtainable, e.g., by translation of a truncated open reading frame that lacks the 3'-end of the open reading frame.
  • a fragment shortened at the N-terminus (C- terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame comprises a start codon that serves to initiate translation.
  • a fragment of an amino acid sequence comprises, e.g., at least 50 %, at least 60 %, at least 70 %, at least 80%, at least 90% of the amino acid residues from an amino acid sequence.
  • a fragment of an amino acid sequence comprises, e.g., at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from an amino acid sequence.
  • a fragment of an amino acid sequence comprises, e.g., a sequence of up to 8, in particular up to 10, up to 12, up to 15, up to 20, up to 30 or up to 55, consecutive amino acids of the amino acid sequence.
  • Variant as used herein and with reference to an amino acid sequence (peptide or polypeptide), is meant an amino acid sequence that differs from a parent amino acid sequence by virtue of at least one amino acid (e.g., a different amino acid, or a modification of the same amino acid).
  • the parent amino acid sequence may be a naturally occurring or wild type (WT) amino acid sequence, or may be a modified version of a wild type amino acid sequence.
  • the variant amino acid sequence has at least one amino acid difference as compared to the parent amino acid sequence, e.g., from 1 to about 20 amino acid differences, such as from 1 to about 10 or from 1 to about 5 amino acid differences compared to the parent.
  • wild type or “WT” or “native” herein is meant an amino acid sequence that is found in nature, including allelic variations.
  • a wild type amino acid sequence, peptide or polypeptide has an amino acid sequence that has not been intentionally modified.
  • variants of an amino acid sequence may comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and/or amino acid substitution variants.
  • variant includes all mutants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants, and species homologs, in particular those which are naturally occurring.
  • variant includes, in particular, fragments of an amino acid sequence.
  • Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible.
  • Amino acid addition variants comprise amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids.
  • Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein.
  • Amino acid deletion variants that comprise the deletion at the N-terminal and/or C-terminal end of the protein are also called N-terminal and/or C- terminal truncation variants.
  • Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid sequence which are not conserved between homologous peptides or polypeptides and/or to replacing amino acids with other ones having similar properties.
  • amino acid changes in peptide and polypeptide variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids.
  • a conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains.
  • Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
  • the degree of similarity such as identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence, will be at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • the degree of similarity or identity is given for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence.
  • the degree of similarity or identity is given, e.g., for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, in some embodiments continuous amino acids.
  • the degree of similarity or identity is given for the entire length of the reference amino acid sequence.
  • the alignment for determining sequence similarity, such as sequence identity can be done with art known tools, such as using the best sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.
  • Sequence similarity indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions.
  • Sequence identity between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences.
  • Sequnce identity between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.
  • % identical and % identity are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or "window of comparison", in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math. 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J.
  • percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website (e.g., at blast. ncbi.nlm. nih.gov/Blast.
  • NCBI National Center for Biotechnology Information
  • the algorithm parameters used for BLASTN algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 28; (iii) Max matches in a query range set to 0; (iv) Match/Mismatch Scores set to 1, -2; (v) Gap Costs set to Linear; and (vi) the filter for low complexity regions being used.
  • the algorithm parameters used for BLASTP algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 3; (iii) Max matches in a query range set to 0; (iv) Matrix set to BLOSUM62; (v) Gap Costs set to Existence: 11 Extension: 1; and (vi) conditional compositional score matrix adjustment.
  • Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100.
  • the degree of similarity or identity is given for a region which is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference sequence.
  • the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, in some embodiments continuous nucleotides.
  • the degree of similarity or identity is given for the entire length of the reference sequence.
  • Homologous amino acid sequences exhibit according to the disclosure at least 40%, in particular at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and, e.g., at least 95%, at least 98 or at least 99% identity of the amino acid residues.
  • the amino acid sequence variants described herein may readily be prepared by the skilled person, for example, by recombinant DNA manipulation. The manipulation of DNA sequences for preparing peptides or polypeptides having substitutions, additions, insertions or deletions, is described in detail in Molecular Cloning: A Laboratory Manual, 4 th Edition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012, for example. Furthermore, the peptides, polypeptides and amino acid variants described herein may be readily prepared with the aid of known peptide synthesis techniques such as, for example, by solid phase synthesis and similar methods.
  • a fragment or variant of an amino acid sequence is a "functional fragment” or “functional variant”.
  • the term "functional fragment” or “functional variant” of an amino acid sequence relates to any fragment or variant exhibiting one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, i.e., it is functionally equivalent.
  • one particular function is one or more immunogenic activities displayed by the amino acid sequence from which the fragment or variant is derived.
  • the modifications in the amino acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence.
  • the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., function of the functional fragment or functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the parent molecule or sequence.
  • function of the functional fragment or functional variant may be enhanced compared to the parent molecule or sequence.
  • amino acid sequence (peptide or polypeptide) "derived from” a designated amino acid sequence (peptide or polypeptide) refers to the origin of the first amino acid sequence.
  • the amino acid sequence which is derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof.
  • Amino acid sequences derived from a particular amino acid sequence may be variants of that particular sequence or a fragment thereof.
  • the antigens suitable for use herein may be altered such that they vary in sequence from the naturally occurring or native sequences from which they were derived, while retaining the desirable activity of the native sequences.
  • isolated means removed (e.g., purified) from the natural state or from an artificial composition, such as a composition from a production process.
  • a nucleic acid, peptide or polypeptide naturally present in a living animal is not “isolated”, but the same nucleic acid, peptide or polypeptide partially or completely separated from the coexisting materials of its natural state is “isolated”.
  • An isolated nucleic acid, peptide or polypeptide can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
  • transfection relates to the introduction of nucleic acids, in particular RNA, into a cell.
  • the term “transfection” also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell may be present in a subject, e.g., a patient, or the cell may be in vitro, e.g., outside of a patient.
  • a cell for transfection of a nucleic acid described herein can be present in vitro or in vivo, e.g. the cell can form part of an organ, a tissue and/or the body of a patient.
  • transfection can be transient or stable.
  • RNA can be transfected into cells to transiently express its coded protein. Since the nucleic acid introduced in the transfection process is usually not integrated into the nuclear genome, the foreign nucleic acid will be diluted through mitosis or degraded. Cells allowing episomal amplification of nucleic acids greatly reduce the rate of dilution. If it is desired that the transfected nucleic acid actually remains in the genome of the cell and its daughter cells, a stable transfection must occur. Such stable transfection can be achieved by using virus-based systems or transposon-based systems for transfection, for example. Generally, nucleic acid encoding antigen is transiently transfected into cells. RNA can be transfected into cells to transiently express its coded protein.
  • an analog of a peptide or polypeptide is a modified form of said peptide or polypeptide from which it has been derived and has at least one functional property of said peptide or polypeptide.
  • a pharmacological active analog of a peptide or polypeptide has at least one of the pharmacological activities of the peptide or polypeptide from which the analog has been derived.
  • modifications include any chemical modification and comprise single or multiple substitutions, deletions and/or additions of any molecules associated with the peptide or polypeptide, such as carbohydrates, lipids and/or peptides or polypeptides.
  • analogs of peptides or polypeptides include those modified forms resulting from glycosylation, acetylation, phosphorylation, amidation, palmitoylation, myristoylation, isoprenylation, lipidation, alkylation, derivatization, introduction of protective/blocking groups, proteolytic cleavage or binding to an antibody or to another cellular ligand.
  • the term “analog” also extends to all functional chemical equivalents of said peptides and polypeptides.
  • endogenous refers to any material from or produced inside an organism, cell, tissue or system.
  • exogenous refers to any material introduced from or produced outside an organism, cell, tissue or system.
  • a nucleic acid such as RNA encoding a peptide or polypeptide is taken up by or introduced, i.e. transfected or transduced, into a cell which cell may be present in vitro or in a subject, resulting in expression of said peptide or polypeptide.
  • the cell may, e.g., express the encoded peptide or polypeptide intracellularly (e.g. in the cytoplasm and/or in the nucleus), may secrete the encoded peptide or polypeptide, and/or may express it on the surface.
  • the cell secretes the encoded peptide or polypeptide.
  • nucleic acid expressing and “nucleic acid encoding” or similar terms are used interchangeably herein and with respect to a particular peptide or polypeptide mean that the nucleic acid, if present in the appropriate environment, e.g. within a cell, can be expressed to produce said peptide or polypeptide.
  • the term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an RNA (in particular, mRNA), to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
  • a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system.
  • Both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
  • An "open reading frame” or “ORF” is a continuous stretch of codons beginning with a start codon and ending with a stop codon.
  • expression includes the transcription and/or translation of a particular nucleotide sequence.
  • transcription relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA (especially mRNA). Subsequently, the RNA may be translated into peptide or polypeptide.
  • RNA With respect to RNA, the term "expression” or “translation” relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or polypeptide.
  • a medical preparation, in particular kit, described herein may comprise instructional material or instructions.
  • "instructional material” or “instructions” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure.
  • the instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the compositions/formulations of the present disclosure or be shipped together with a container which contains the compositions/formulations. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compositions be used cooperatively by the recipient.
  • Prodrugs of a particular compound described herein are those compounds that upon administration to an individual undergo chemical conversion under physiological conditions to provide the particular compound. Additionally, prodrugs can be converted to the particular compound by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the particular compound when, for example, placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent. Exemplary prodrugs are esters (using an alcohol or a carboxy group contained in the particular compound) or amides (using an amino or a carboxy group contained in the particular compound) which are hydrolyzable in vivo. Specifically, any amino group which is contained in the particular compound and which bears at least one hydrogen atom can be converted into a prodrug form. Typical N-prodrug forms include carbamates, Mannich bases, enamines, and enaminones.
  • a structural formula of a compound may represent a certain isomer of said compound. It is to be understood, however, that the present disclosure includes all isomers such as geometrical isomers, optical isomers based on an asymmetrical carbon, stereoisomers, tautomers and the like which occur structurally and isomer mixtures and is not limited to the description of the formula. Furthermore, in the present specification, a structural formula of a compound may represent a specific salt and/or solvate of said compound. It is to be understood, however, that the present disclosure includes all salts (e.g., pharmaceutically acceptable salts) and solvates (e.g., hydrates) and is not limited to the description of the specific salt and/or solvate.
  • salts e.g., pharmaceutically acceptable salts
  • solvates e.g., hydrates
  • “Isomers” are compounds having the same molecular formula but differ in structure (“structural isomers”) or in the geometrical (spatial) positioning of the functional groups and/or atoms (“stereoisomers”).
  • “Enantiomers” are a pair of stereoisomers which are non- superimposable mirror-images of each other.
  • a “racemic mixture” or “racemate” contains a pair of enantiomers in equal amounts and is denoted by the prefix ( ⁇ ).
  • “Diastereomers” are stereoisomers which are non-superimposable and which are not mirror-images of each other.
  • Tautomers are structural isomers of the same chemical substance that spontaneously and reversibly interconvert into each other, even when pure, due to the migration of individual atoms or groups of atoms; i.e., the tautomers are in a dynamic chemical equilibrium with each other.
  • An example of tautomers are the isomers of the keto-enol-tautomerism.
  • Conformers are stereoisomers that can be interconverted just by rotations about formally single bonds, and include - in particular - those leading to different 3-dimentional forms of (hetero)cyclic rings, such as chair, half-chair, boat, and twist-boat forms of cyclohexane.
  • solvate refers to an addition complex of a dissolved material in a solvent (such as an organic solvent (e.g., an aliphatic alcohol (such as methanol, ethanol, n- propanol, isopropanol), acetone, acetonitrile, ether, and the like), water or a mixture of two or more of these liquids), wherein the addition complex exists in the form of a crystal or mixed crystal.
  • a solvent such as an organic solvent (e.g., an aliphatic alcohol (such as methanol, ethanol, n- propanol, isopropanol), acetone, acetonitrile, ether, and the like), water or a mixture of two or more of these liquids), wherein the addition complex exists in the form of a crystal or mixed crystal.
  • the amount of solvent contained in the addition complex may be stoichiometric or non-stoichiometric.
  • a “hydrate” is a solvate wherein the solvent is
  • isotopically labeled compounds one or more atoms are replaced by a corresponding atom having the same number of protons but differing in the number of neutrons.
  • a hydrogen atom may be replaced by a deuterium or tritium atom.
  • Exemplary isotopes which can be used in the present disclosure include deuterium, tritium, n C, 13 C, 14 C, 15 N, 18 F, 32 P, 32 S, 35 S, 36 CI, and 125 l.
  • average diameter refers to the mean hydrodynamic diameter of particles as measured by dynamic light scattering (DLS) with data analysis using the so-called cumulant algorithm, which provides as results the so-called Zaverage with the dimension of a length, and the polydispersity index (PDI), which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321).
  • PDI polydispersity index
  • the "polydispersity index” is calculated based on dynamic light scattering measurements by the so-called cumulant analysis as mentioned in the definition of the "average diameter". Under certain prerequisites, it can be taken as a measure of the size distribution of an ensemble of nanoparticles.
  • the "radius of gyration" (abbreviated herein as R g ) of a particle about an axis of rotation is the radial distance of a point from the axis of rotation at which, if the whole mass of the particle is assumed to be concentrated, its moment of inertia about the given axis would be the same as with its actual distribution of mass.
  • R g is the root mean square distance of the particle's components from either its center of mass or a given axis.
  • R g is the square-root of the mass average of Si 2 over all mass elements and can be calculated as follows:
  • the radius of gyration can be determined or calculated experimentally, e.g., by using light scattering.
  • the structure function S is defined as follows: wherein N is the number of components (Guinier's law).
  • the "hydrodynamic radius” (which is sometimes called “Stokes radius” or “Stokes-Einstein radius”) of a particle is the radius of a hypothetical hard sphere that diffuses at the same rate as said particle.
  • the hydrodynamic radius is related to the mobility of the particle, taking into account not only size but also solvent effects. For example, a smaller charged particle with stronger hydration may have a greater hydrodynamic radius than a larger charged particle with weaker hydration. This is because the smaller particle drags a greater number of water molecules with it as it moves through the solution.
  • the hydrodynamic radius may be defined by the Stokes-Einstein equation: wherein k& is the Boltzmann constant; T is the temperature; ⁇ is the viscosity of the solvent; and D is the diffusion coefficient.
  • the diffusion coefficient can be determined experimentally, e.g., by using dynamic light scattering (DLS).
  • one procedure to determine the hydrodynamic radius of a particle or a population of particles is to measure the DLS signal of said particle or population of particles (such as DLS signal of particles contained in a sample or control composition as disclosed herein or the DLS signal of a particle peak obtained from subjecting such a sample or control composition to field-flow fractionation).
  • light scattering refers to the physical process where light is forced to deviate from a straight trajectory by one or more paths due to localized non- uniformities in the medium through which the light passes.
  • UV means ultraviolet and designates a band of the electromagnetic spectrum with a wavelength from 10 nm to 400 nm, i.e., shorter than that of visible light but longer than X- rays.
  • multi-angle light scattering or “MALS” as used herein relates to a technique for measuring the light scattered by a sample into a plurality of angles.
  • Multi-angle means in this respect that scattered light can be detected at different discrete angles as measured, for example, by a single detector moved over a range including the specific angles selected or an array of detectors fixed at specific angular locations.
  • the light source used in MALS is a laser source (MALLS: multi-angle laser light scattering).
  • the Zimm plot is a graphical presentation using the following equation: wherein c is the mass concentration of the particles in the solvent (g/mL); A2 is the second virial coefficient (mol-mL/g 2 ); P(&) is a form factor relating to the dependence of scattered light intensity on angle; Ro is the excess Rayleigh ratio (cm 1 ); and K* is an optical constant that is equal to 4n 2 q 0 (dn/dc) 2 Xo' 4 A/A -1 , where q 0 is the refractive index of the solvent at the incident radiation (vacuum) wavelength, Ao is the incident radiation (vacuum) wavelength (nm), N& is Avogadro's number (mol 1 ), and dn/dc is the differential refractive index increment (mL/g) (cf., e.g., Buchholz et al.
  • the Berry plot is calculated using the following term or the reciprocal thereof: wherein c, Ro and K* are as defined above.
  • the Debye plot is calculated using the following term or the reciprocal thereof: wherein c, Ro and K* are as defined above.
  • DLS dynamic light scattering
  • a monochromatic light source usually a laser
  • the scattered light then goes through a second polarizer where it is detected and the resulting image is projected onto a screen.
  • the particles in the solution are being hit with the light and diffract the light in all directions.
  • the diffracted light from the particles can either interfere constructively (light regions) or destructively (dark regions). This process is repeated at short time intervals and the resulting set of speckle patterns are analyzed by an autocorrelator that compares the intensity of light at each spot over time.
  • SLS static light scattering
  • MALS multi-angle light scattering
  • MALLS multi-angle laser light scattering
  • microRNA refers to the class of naturally occurring, small, non-coding RNA molecules, about 19-25 such as about 21-25 nucleotides in length, that bind to a polynucleotide, e.g., RNA, comprising one or more miRNA binding sequences and function to modulate gene expression in a variety of ways, including translational repression, RNA cleavage, and deadenylation.
  • miRNA binding sequence refers to a sequence in a polynucleotide, e.g., an oligoribonucleotide sequence in RNA, e.g., mRNA, or analogue thereof, having a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of a miRNA.
  • a miRNA binding sequence may be present in the 5' UTR, 3'UTR, or a combination thereof.
  • a miRNA binding sequence is present in the 3'UTR.
  • a miRNA binding sequence has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA.
  • a miRNA binding sequence has sufficient complementarity to a miRNA to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide.
  • a miRNA binding sequence having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RlSC)-mediated cleavage of RNA, e.g., mRNA.
  • RlSC miRNA-guided RNA-induced silencing complex
  • oligonucleotide refers to a polymer of nucleotides comprising naturally occurring nucleotides, non-naturally occurring nucleotides, derivatized nucleotides, or a combination thereof.
  • Non-limiting examples of nucleotides, and derivatives thereof, are set forth herein.
  • oligoribonucleotide refers to a polymer of nucleotides comprising naturally occurring ribonucleotides, non-naturally occurring ribonucleotides, derivatized ribonucleotides, or a combination thereof.
  • ribonucleotides, and derivatives thereof are set forth herein.
  • complementary refers to the ability of nucleotides, or analogues thereof, to form Watson-Crick base pairs. Complementary nucleotide sequences will form Watson-Crick base pairs and non-complementary nucleotide sequences will not.
  • upstream is used herein to refer to a location which is toward the 5' end of a polynucleotide from a specific reference point.
  • downstream is used herein to refer to a location which is toward the 3' end of a polynucleotide from a specific reference point.
  • nucleic acid comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), combinations thereof, and modified forms thereof.
  • the term comprises genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules.
  • a nucleic acid is DNA.
  • a nucleic acid is RNA.
  • a nucleic acid is a mixture of DNA and RNA.
  • a nucleic acid may be present as a single-stranded or double-stranded and linear or covalently circularly closed molecule.
  • a nucleic acid can be isolated.
  • isolated nucleic acid means, according to the present disclosure, that the nucleic acid (i) was amplified in vitro, for example via polymerase chain reaction (PCR) for DNA or in vitro transcription (using, e.g., an RNA polymerase) for RNA, (ii) was produced recombinantly by cloning, (iii) was purified, for example, by cleavage and separation by gel electrophoresis, or (iv) was synthesized, for example, by chemical synthesis.
  • PCR polymerase chain reaction
  • RNA polymerase RNA polymerase
  • purified for example, by cleavage and separation by gel electrophoresis
  • iv was synthesized, for example, by chemical synthesis.
  • N nucleoside
  • nucleoside is a nucleobase linked to a sugar (e.g., ribose or deoxyribose)
  • a nucleotide is composed of a nucleoside and one or more phosphate groups.
  • nucleosides include cytidine, uridine, pseudouridine, adenosine, and guanosine.
  • the five standard nucleosides which usually make up naturally occurring nucleic acids are uridine, adenosine, thymidine, cytidine and guanosine.
  • the five nucleosides are commonly abbreviated to their one letter codes U, A, T, C and G, respectively.
  • thymidine is more commonly written as “dT” ("d” represents “deoxy”) as it contains a 2'-deoxyribofuranose moiety rather than the ribofuranose ring found in uridine.
  • d deoxyribonucleic acid
  • RNA ribonucleic acid
  • uridine is found in RNA and not DNA. The remaining three nucleosides may be found in both RNA and DNA. In RNA, they would be represented as A, C and G, whereas in DNA they would be represented as dA, dC and dG.
  • a modified purine (A or G) or pyrimidine (C, T, or U) base moiety is, in some embodiments, modified by one or more alkyl groups, e.g., one or more C1-4 alkyl groups, e.g., one or more methyl groups.
  • modified purine or pyrimidine base moieties include N 7 -alkyl-guanine, N 6 -alkyl-adenine, 5-alkyl-cytosine, 5-alkyl-uracil, and N(l)-alkyl-uracil, such as N 7 -CI-4 alkyl-guanine, N 6 -CI-4 aikyl-adenine, 5-C1-4 alkyl-cytosine, 5-C1-4 alkyl-u raci I, and N (1)- C1-4 alkyl-uracil, preferably N 7 -methyl-guanine, N 6 -methyl-adenine, 5-methyl-cytosine, 5- methyl-uracil, and N(l)-methyl-uracil.
  • DNA relates to a nucleic acid molecule which is entirely or at least substantially composed of deoxyribonucleotide residues.
  • the DNA contains all or a majority of deoxyribonucleotide residues.
  • deoxyribonucleotide refers to a nucleotide which lacks a hydroxyl group at the 2'-position of a p-D-ribofuranosyl group.
  • DNA encompasses without limitation, double stranded DNA, single stranded DNA, isolated DNA such as partially purified DNA, essentially pure DNA, synthetic DNA, recombinantly produced DNA, as well as modified DNA that differs from naturally occurring DNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal DNA nucleotides or to the end(s) of DNA. It is also contemplated herein that nucleotides in DNA may be non-standard nucleotides, such as chemically synthesized nucleotides or ribonucleotides. For the present disclosure, these altered DNAs are considered analogs of naturally-occurring DNA.
  • a molecule contains "a majority of deoxyribonucleotide residues" if the content of deoxyribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule.
  • the total number of nucleotide residues in a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard (z.e., naturally occurring) nucleotide residues or analogs thereof).
  • DNA may be recombinant DNA and may be obtained by cloning of a nucleic acid, in particular cDNA.
  • the cDNA may be obtained by reverse transcription of RNA.
  • RNA relates to a nucleic acid molecule which includes ribonucleotide residues. In preferred embodiments, the RNA contains all or a majority of ribonucleotide residues.
  • ribonucleotide refers to a nucleotide with a hydroxyl group at the 2'-position of a P- D-ribofuranosyl group.
  • RNA encompasses without limitation, double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. It is also contemplated herein that nucleotides in RNA may be non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides.
  • altered/modified nucleotides can be referred to as analogs of naturally occurring nucleotides, and the corresponding RNAs containing such altered/modified nucleotides (/.e., altered/modified RNAs) can be referred to as analogs of naturally occurring RNAs.
  • a molecule contains "a majority of ribonucleotide residues" if the content of ribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule.
  • the total number of nucleotide residues in a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard (/.e., naturally occurring) nucleotide residues or analogs thereof).
  • RNA includes mRNA, tRNA, ribosomal RNA (rRNA), small nuclear RNA (snRNA), self- amplifying RNA (saRNA), trans-amplifying RNA (taRNA), single-stranded RNA (ssRNA), dsRNA, inhibitory RNA (such as antisense ssRNA, small interfering RNA (siRNA), or microRNA (miRNA)), activating RNA (such as small activating RNA) and immunostimulatory RNA (isRNA).
  • RNA refers to mRNA.
  • IVT in vitro transcription
  • the transcription i.e., the generation of RNA
  • IVT does not use living/cultured cells but rather the transcription machinery extracted from cells (e.g., cell lysates or the isolated components thereof, including an RNA polymerase (preferably T7, T3 or SP6 polymerase)).
  • the term '"RNA includes “mRNA”.
  • mRNA means “messenger-RNA” and includes a “transcript” which may be generated by using a DNA template.
  • mRNA encodes a peptide or polypeptide.
  • mRNA is single-stranded but may contain self-complementary sequences that allow parts of the mRNA to fold and pair with itself to form double helices.
  • dsRNA means double-stranded RNA and is RNA with two partially or completely complementary strands.
  • the mRNA relates to an RNA transcript which encodes a peptide or polypeptide.
  • the mRNA which preferably encodes a peptide or polypeptide has a length of at least 45 nucleotides (such as at least 60, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000 nucleotides), preferably up to 15,000, such as up to 14,000, up to 13,000, up to 12,000 nucleotides, up to 11,000 nucleotides or up to 10,000 nucleotides.
  • nucleotides such as at least 60, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000,
  • mRNA generally contains a 5' untranslated region (5'-UTR), a peptide/polypeptide coding region and a 3' untranslated region (3'-UTR).
  • the mRNA is produced by in vitro transcription or chemical synthesis.
  • the mRNA is produced by in vitro transcription using a DNA template.
  • the in vitro transcription methodology is known to the skilled person; cf., e.g., Molecular Cloning: A Laboratory Manual, 4 th Edition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012.
  • in vitro transcription kits are commercially available, e.g., from Thermo Fisher Scientific (such as TranscriptAidTM T7 kit, MEGAscript® T7 kit, MAXIscript®), New England BioLabs Inc. (such as HiScribeTM T7 kit, HiScribeTM T7 ARCA mRNA kit), Promega (such as RiboMAXTM, HeLaScribe®, Riboprobe® systems), Jena Bioscience (such as SP6 or T7 transcription kits), and Epicentre (such as AmpliScribeTM).
  • Thermo Fisher Scientific such as TranscriptAidTM T7 kit, MEGAscript® T7 kit, MAXIscript®), New England BioLabs Inc.
  • HiScribeTM T7 kit such as HiScribeTM T7 kit, HiScribeTM T7 ARCA mRNA kit
  • Promega such as RiboMAXTM, HeLaScribe®, Riboprobe® systems
  • Jena Bioscience such as SP6 or T
  • correspondingly modified nucleotides such as modified naturally occurring nucleotides, non-naturally occurring nucleotides and/or modified non-naturally occurring nucleotides, can be incorporated during synthesis (preferably in vitro transcription), or modifications can be effected in and/or added to the mRNA after transcription.
  • RNA is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template.
  • the promoter for controlling transcription can be any promoter for any RNA polymerase.
  • RNA polymerases are the T7, T3, and SP6 RNA polymerases.
  • the in vitro transcription is controlled by a T7 or SP6 promoter.
  • a DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription.
  • the cDNA may be obtained by reverse transcription of RNA.
  • the RNA is "replicon RNA” or simply a “replicon”, in particular "self-replicating RNA” or “self-amplifying RNA”.
  • the replicon or self-replicating RNA is derived from or comprises elements derived from an ssRNA virus, in particular a positive-stranded ssRNA virus such as an alphavirus.
  • Alphaviruses are typical representatives of positive-stranded RNA viruses.
  • Alphaviruses replicate in the cytoplasm of infected cells (for review of the alphaviral life cycle see Jose et al., Future Microbiol., 2009, vol. 4, pp. 837-856).
  • the total genome length of many alphaviruses typically ranges between 11,000 and 12,000 nucleotides, and the genomic RNA typically has a 5'-cap, and a 3' poly(A) tail.
  • the genome of alphaviruses encodes non-structural proteins (involved in transcription, modification and replication of viral RNA and in protein modification) and structural proteins (forming the virus particle). There are typically two open reading frames (ORFs) in the genome.
  • the four non-structural proteins (nsPl-nsP4) are typically encoded together by a first ORF beginning near the 5' terminus of the genome, while alphavirus structural proteins are encoded together by a second ORF which is found downstream of the first ORF and extends near the 3' terminus of the genome.
  • the first ORF is larger than the second ORF, the ratio being roughly 2:1.
  • the genomic RNA In cells infected by an alphavirus, only the nucleic acid sequence encoding non-structural proteins is translated from the genomic RNA, while the genetic information encoding structural proteins is translatable from a subgenomic transcript, which is an RNA molecule that resembles eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol. 87 pp. 111-124). Following infection, i.e. at early stages of the viral life cycle, the (+) stranded genomic RNA directly acts like a messenger RNA for the translation of the open reading frame encoding the non-structural poly-protein (nsP1234).
  • mRNA eukaryotic messenger RNA
  • Alphavirus-derived vectors have been proposed for delivery of foreign genetic information into target cells or target organisms.
  • the open reading frame encoding alphaviral structural proteins is replaced by an open reading frame encoding a protein of interest.
  • Alphavirus-based trans-replication (trans-amplification) systems rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules: one nucleic acid molecule encodes a viral replicase, and the other nucleic acid molecule is capable of being replicated by said replicase in trans (hence the designation trans-replication system).
  • Trans- replication requires the presence of both these nucleic acid molecules in a given host cell.
  • the nucleic acid molecule capable of being replicated by the replicase in trans must comprise certain alphaviral sequence elements to allow recognition and RNA synthesis by the alphaviral replicase.
  • the RNA (in particular, mRNA) described herein contains one or more modifications, e.g., in order to increase its stability and/or increase translation efficiency and/or decrease immunogenicity and/or decrease cytotoxicity.
  • the RNA (in particular, mRNA) may be modified within the coding region, i.e., the sequence encoding the expressed peptide or polypeptide, preferably without altering the sequence of the expressed peptide or polypeptide.
  • Such modifications are described, for example, in WO 2007/036366 and PCT/EP2019/056502, and include the following: a S'-cap structure; an extension or truncation of the naturally occurring poly(A) tail; an alteration of the 5'- and/or 3'-untranslated regions (UTR) such as introduction of a UTR which is not related to the coding region of said RNA; the replacement of one or more naturally occurring nucleotides with synthetic nucleotides; and codon optimization (e.g., to alter, preferably increase, the GC content of the RNA).
  • UTR 5'- and/or 3'-untranslated regions
  • a combination of the above described modifications i.e., incorporation of a 5'-cap structure, incorporation of a poly-A sequence, unmasking of a poly-A sequence, alteration of the 5 1 - and/or 3'-UTR (such as incorporation of one or more 3'-UTRs), replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine for cytidine and/or pseudouridine (tp) or N(l)-methylpseudouridine (mlip) or 5-methyluridine (m5U) for uridine), and codon optimization, has a synergistic influence on the stability of RNA (preferably mRNA) and increase in translation efficiency.
  • synthetic nucleotides e.g., 5-methylcytidine for cytidine and/or pseudouridine (tp) or N(l)-methylpseudouridine (mlip) or 5-methyluridine (m5U) for ur
  • the RNA (in particular, mRNA) described in the present disclosure contains a combination of at least two, at least three, at least four or all five of the above-mentioned modifications, i.e., (i) incorporation of a 5'-cap structure, (ii) incorporation of a poly-A sequence, unmasking of a poly-A sequence; (iii) alteration of the 5'- and/or 3'-UTR (such as incorporation of one or more 3'-UTRs); (iv) replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine for cytidine and/or pseudouridine (U>) or N(l)-methylpseudouridine (ml ⁇ P) or 5-methyluridine (m5U) for uridine), and (v) codon optimization.
  • synthetic nucleotides e.g., 5-methylcytidine for cytidine and/or pseudouridine (U>
  • the RNA (in particular, mRNA) described herein comprises a 5'-cap structure. In some embodiments, the RNA does not have uncapped 5'-triphosphates. In some embodiments, the RNA (in particular, mRNA) may comprise a conventional 5'-cap and/or a 5'- cap analog.
  • inventional 5'-cap refers to a cap structure found on the 5'-end of an RNA molecule and generally comprises a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'-end of the next nucleotide of the RNA (i.e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the RNA).
  • Gppp guanosine 5'-triphosphate
  • the guanosine may be methylated at position N 7 (resulting in the cap structure m 7 Gppp).
  • 5'-cap analog includes a 5'-cap which is based on a conventional 5'-cap but which has been modified at either the 2'- or 3'-position of the m 7 guanosine structure in order to avoid an integration of the 5'-cap analog in the reverse orientation (such 5'-cap analogs are also called anti-reverse cap analogs (ARCAs)).
  • ARCAs anti-reverse cap analogs
  • Particularly preferred 5'-cap analogs are those having one or more substitutions at the bridging and non-bridging oxygen in the phosphate bridge, such as phosphorothioate modified 5'-cap analogs at the P-phosphate (such as rna 7 ' 2 ' 0 G(5')ppSp(5')G (referred to as beta-S-ARCA or P-S-ARCA)), as described in PCT/EP2019/056502.
  • phosphorothioate modified 5'-cap analogs at the P-phosphate such as rna 7 ' 2 ' 0 G(5')ppSp(5')G (referred to as beta-S-ARCA or P-S-ARCA)
  • RNA in particular, mRNA
  • a 5'-cap structure as described herein may be achieved by in vitro transcription of a DNA template in presence of a corresponding 5'-cap compound, wherein said 5'-cap structure is co-transcriptionally incorporated into the generated RNA (in particular, mRNA) strand, or the RNA (in particular, mRNA) may be generated, for example, by in vitro transcription, and the 5'-cap structure may be attached to the RNA post-transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus.
  • capping enzymes for example, capping enzymes of vaccinia virus.
  • the RNA comprises a 5'-cap structure selected from the group consisting of m2 7 ' 2 O G(5')ppSp(5')G (in particular its DI diastereomer), m2 7 ' 3 O G(5')ppp(5')G, and m2 7 ' 3 O Gppp(mi 2 ' o )ApG.
  • RNA comprises m2 7,2 O G(5')ppSp(5')G (in particular its DI diastereomer) as 5'-cap structure.
  • RNA comprises m2 7 ' 3 O Gppp(mi 2 ' °)ApG as 5'-cap structure.
  • the RNA comprises a capO, capl, or cap2, preferably capl or cap2.
  • capO means the structure "m 7 GpppN", wherein N is any nucleoside bearing an OH moiety at position 2'.
  • capl means the structure "m 7 GpppNm”, wherein Nm is any nucleoside bearing an OCH3 moiety at position 2'.
  • cap2 means the structure "m 7 GpppNmNm", wherein each Nm is independently any nucleoside bearing an OCH3 moiety at position 2'.
  • the 5'-cap analog beta-S-ARCA (p-S-ARCA) has the following structure:
  • the "DI diastereomer of beta-S-ARCA" or “beta-S-ARCA(Dl)” is the diastereomer of beta-S- ARCA which elutes first on an HPLC column compared to the D2 diastereomer of beta-S-ARCA (beta-S-ARCA(D2)) and thus exhibits a shorter retention time.
  • the HPLC preferably is an analytical HPLC.
  • a Supelcosil LC-18-T RP column preferably of the format: 5 pm, 4.6 x 250 mm is used for separation, whereby a flow rate of 1.3 ml/min can be applied.
  • VWD UV-detection
  • FLD fluorescence detection
  • the 5'-cap analog m2 7,3 ' 0 Gppp(mi 2 ’ 0 )ApG (also referred to as m2 7 ' 3 O G(5 , )ppp(5')m 2 ' °ApG) which is a building block of a capl has the following structure:
  • An exemplary capO mRNA comprising [3-S-ARCA and mRNA has the following structure:
  • An exemplary capO mRNA comprising m2 7,3 ' 0 G(5 , )ppp(5 l )G and mRNA has the following structure:
  • An exemplary capl mRNA comprising m2 7,3 0 Gppp(mi 2 ' 0 )ApG and mRNA has the following structure:
  • poly-A tail or "poly-A sequence” refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA (in particular, mRNA) molecule.
  • Poly-A tails or poly-A sequences are known to those of skill in the art and may follow the 3'-UTR in the RNAs (in particular, mRNAs) described herein.
  • An uninterrupted poly-A tail is characterized by consecutive adenylate residues. In nature, an uninterrupted poly-A tail is typical.
  • RNAs in particular, mRNAs
  • RNAs can have a poly-A tail attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly-A tail encoded by DNA and transcribed by a template-dependent RNA polymerase.
  • a poly-A tail of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of protein that is translated from an open reading frame that is present upstream (5') of the poly-A tail (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017).
  • the poly-A tail may be of any length.
  • a poly-A tail comprises, essentially consists of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides.
  • nucleotides in the poly-A tail typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly-A tail are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate).
  • consists of means that all nucleotides in the poly-A tail, i.e., 100% by number of nucleotides in the poly-A tail, are A nucleotides.
  • a nucleotide or “A” refers to adenylate.
  • a poly-A tail is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand.
  • the DNA sequence encoding a poly-A tail (coding strand) is referred to as poly(A) cassette.
  • the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
  • a cassette is disclosed in WO 2016/005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016/005324 Al may be used in the present disclosure.
  • a poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed.
  • the poly-A tail contained in an RNA (in particular, mRNA) molecule described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
  • the poly(A) tail comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence of 10 nucleotides.
  • no nucleotides other than A nucleotides flank a poly-A tail at its 3'- end, i.e., the poly-A tail is not masked or followed at its 3'-end by a nucleotide other than A.
  • a poly-A tail may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly-A tail may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly-A tail may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides.
  • the poly-A tail comprises the poly-A tail shown in SEQ ID NO: 4. In some embodiments, the poly-A tail comprises at least 100 nucleotides. In some embodiments, the poly-A tail comprises about 150 nucleotides. In some embodiments, the poly-A tail comprises about 120 nucleotides.
  • RNA comprises a a poly-A tail comprising the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 4.
  • the term "untranslated region" or “UTR” relates to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA molecule, such as an mRNA molecule.
  • An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and/or 3' (downstream) of an open reading frame (3'-UTR).
  • a 5'-UTR if present, is located at the 5'-end, upstream of the start codon of a protein-encoding region.
  • a 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap.
  • a 3'-UTR if present, is located at the 3'-end, downstream of the termination codon of a protein-encoding region, but the term "3'-UTR" does generally not include the poly-A sequence.
  • the 3'-UTR is upstream of the poly-A sequence (if present), e.g., directly adjacent to the poly-A sequence.
  • Incorporation of a 3'-UTR into the 3'- non translated region of an RNA (preferably mRNA) molecule can result in an enhancement in translation efficiency.
  • a synergistic effect may be achieved by incorporating two or more of such 3'-UTRs (which are preferably arranged in a head-to-tail orientation; cf., e.g., Holtkamp et al., Blood 108, 4009-4017 (2006)).
  • the 3'-UTRs may be autologous or heterologous to the RNA (e.g., mRNA) into which they are introduced.
  • a 5'-UTR is or comprises a modified human alpha-globin 5'-UTR.
  • a particularly preferred 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 5.
  • a 3'-UTR comprises a first sequence from the amino terminal enhancer of split (AES) messenger RNA and a second sequence from the mitochondrial encoded 12S ribosomal RNA.
  • a particularly preferred 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3.
  • a 3'-UTR comprises a first sequence comprising, or consisting of, the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising, or consisting of, the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 2.
  • RNA comprises a 5'-UTR comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 5.
  • RNA comprises a 3'-UTR comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 3.
  • RNA in particular, mRNA
  • RNA may have modified ribonucleotides in order to increase its stability and/or decrease immunogenicity and/or decrease cytotoxicity.
  • uridine in the RNA (in particular, mRNA) described herein is replaced (partially or completely, preferably completely) by a modified nucleoside.
  • the modified nucleoside is a modified uridine.
  • the modified uridine replacing uridine is selected from the group consisting of pseudouridine (ip), Nl-methyl-pseudouridine (mlip), 5-methyl-uridine (m5U), and combinations thereof.
  • the modified nucleoside replacing (partially or completely, preferably completely) uridine in the RNA may be any one or more of 3-methyl-uridine (m3U), 5- methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl- uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5
  • RNA preferably mRNA which is modified by pseudouridine (replacing partially or completely, preferably completely, uridine) is referred to herein as "UJ-modified", whereas the term “mltP-modified” means that the RNA (preferably mRNA) contains N(l)- methylpseudouridine (replacing partially or completely, preferably completely, uridine). Furthermore, the term “m5U-modified” means that the RNA (preferably mRNA) contains 5- methyluridine (replacing partially or completely, preferably completely, uridine).
  • RNA preferably mRNA
  • N(l)-methylpseudouridine replacing completely uridine
  • the codons of the RNA (in particular, mRNA) described in the present disclosure may further be optimized, e.g., to increase the GC content of the RNA and/or to replace codons which are rare in the cell (or subject) in which the peptide or polypeptide of interest is to be expressed by codons which are synonymous frequent codons in said cell (or subject).
  • the amino acid sequence encoded by the RNA (in particular, mRNA) described in the present disclosure is encoded by a coding sequence which is codon-optimized and/or the G/C content of which is increased compared to wild type coding sequence.
  • This also includes embodiments, wherein one or more sequence regions of the coding sequence are codon-optimized and/or increased in the G/C content compared to the corresponding sequence regions of the wild type coding sequence.
  • the codon- optimization and/or the increase in the G/C content preferably does not change the sequence of the encoded amino acid sequence.
  • coding regions may be codon-optimized for optimal expression in a subject to be treated using the RNA (in particular, mRNA) described herein. Codon-optimization is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, the sequence of RNA (in particular, mRNA) may be modified such that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons".
  • the guanosine/cytosine (G/C) content of the coding region of the RNA (in particular, mRNA) described herein is increased compared to the G/C content of the corresponding coding sequence of the wild type RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence encoded by the wild type RNA.
  • This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that RNA. Sequences having an increased G (guanosine)/C (cytosine) content are more stable than sequences having an increased A (adenosine)/U (uracil) content.
  • codons which contain A and/or U nucleotides can be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and/or U or contain a lower content of A and/or U nucleotides.
  • the G/C content of the coding region of the RNA (in particular, mRNA) described herein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, or even more compared to the G/C content of the coding region of the wild type RNA.
  • the RNA in particular, mRNA
  • RNA encoding vaccine antigen described in the present disclosure is non-immunogenic.
  • RNA encoding an immunostimulant may be administered according to the present disclosure to provide an adjuvant effect.
  • the RNA encoding an immunostimulant may be standard RNA or non-immunogenic RNA.
  • non-immunogenic RNA refers to RNA that does not induce a response by the immune system upon administration, e.g., to a mammal, or induces a weaker response than would have been induced by the same RNA that differs only in that it has not been subjected to the modifications and treatments that render the non-immunogenic RNA non-immunogenic, i.e., than would have been induced by standard RNA (stdRNA).
  • stdRNA standard RNA
  • non-immunogenic RNA is rendered non- immunogenic by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and/or limiting the amount of double-stranded RNA (dsRNA), e.g., by limiting the formation of double-stranded RNA (dsRNA), e.g., during in vitro transcription, and/or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription.
  • dsRNA double-stranded RNA
  • non-immunogenic RNA is rendered non-immunogenic by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and/or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription.
  • dsRNA double-stranded RNA
  • any modified nucleoside may be used as long as it lowers or suppresses immunogenicity of the RNA.
  • Particularly preferred are modified nucleosides that suppress RNA-mediated activation of innate immune receptors.
  • the modified nucleosides comprise a replacement of one or more uridines with a nucleoside comprising a modified nucleobase.
  • the modified nucleobase is a modified uracil.
  • the nucleoside comprising a modified nucleobase is selected from the group consisting of 3-methyl-uridine (m 3 U), 5-methoxy- uridine (mo 5 U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio- uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5- aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5- oxyacetic acid (cmo 5 U), uridine 5-oxyacetic acid methyl
  • 3-methyl-pseudouridine (m 3 i
  • the nucleoside comprising a modified nucleobase is pseudouridine (ip), Nl-methyl-pseudouridine (mlip) or 5-methyl-uridine (m5U), in particular Nl-methyl- pseudouridine.
  • the replacement of one or more uridines with a nucleoside comprising a modified nucleobase comprises a replacement of at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the uridines.
  • dsRNA double-stranded RNA
  • IVT in vitro transcription
  • dsRNA double-stranded RNA
  • formation of dsRNA can be limited during synthesis of mRNA by in vitro transcription (IVT), for example, by limiting the amount of uridine triphosphate (UTP) during synthesis.
  • UTP may be added once or several times during synthesis of mRNA.
  • dsRNA can be removed from RNA such as IVT RNA, for example, by ion-pair reversed phase HPLC using a non-porous or porous C-18 polystyrene- divinylbenzene (PS-DVB) matrix.
  • PS-DVB polystyrene- divinylbenzene
  • an enzymatic based method using E. coli RNaselll that specifically hydrolyzes dsRNA but not ssRNA, thereby eliminating dsRNA contaminants from IVT RNA preparations can be used.
  • dsRNA can be separated from ssRNA by using a cellulose material.
  • an RNA preparation is contacted with a cellulose material and the ssRNA is separated from the cellulose material under conditions which allow binding of dsRNA to the cellulose material and do not allow binding of ssRNA to the cellulose material.
  • Suitable methods for providing ssRNA are disclosed, for example, in WO 2017/182524.
  • remove or “removal” refers to the characteristic of a population of first substances, such as non-immunogenic RNA, being separated from the proximity of a population of second substances, such as dsRNA, wherein the population of first substances is not necessarily devoid of the second substance, and the population of second substances is not necessarily devoid of the first substance.
  • a population of first substances characterized by the removal of a population of second substances has a measurably lower content of second substances as compared to the non-separated mixture of first and second substances.
  • the amount of double-stranded RNA is limited, e.g., dsRNA (especially dsmRNA) is removed from non-immunogenic RNA , such that less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.3%, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, or less than 0.0005% of the RNA in the non-immunogenic RNA composition is dsRNA.
  • dsRNA double-stranded RNA
  • the non- immunogenic RNA is free or essentially free of dsRNA.
  • the non-immunogenic RNA (especially mRNA) composition comprises a purified preparation of single-stranded nucleoside modified RNA.
  • the non-immunogenic RNA (especially mRNA) composition comprises single-stranded nucleoside modified RNA (especially mRNA) and is substantially free of double stranded RNA (dsRNA).
  • the non-immunogenic RNA (especially mRNA) composition comprises at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, at least 99.991%, at least 99.992%, , at least 99.993%,, at least 99.994%, , at least 99.995%, at least 99.996%, at least 99.997%, or at least 99.998% single stranded nucleoside modified RNA, relative to all other nucleic acid molecules (DNA, dsRNA, etc.).
  • RNA may be taken as a measure for the amount of dsRNA in the sample.
  • a sample containing a known amount of dsRNA may be used as a reference.
  • RNA may be spotted onto a membrane, e.g., nylon blotting membrane.
  • the membrane may be blocked, e.g., in TBS-T buffer (20 mM TRIS pH 7.4, 137 mM NaCI, 0.1% (v/v) TWEEN-20) containing 5% (w/v) skim milk powder.
  • the membrane may be incubated with dsRNA-specific antibody, e.g., dsRNA-specific mouse mAb (English & Scientific Consulting, Szirak, Hungary).
  • the membrane After washing, e.g., with TBS-T, the membrane may be incubated with a secondary antibody, e.g., HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, Cat #715-035-150), and the signal provided by the secondary antibody may be detected.
  • a secondary antibody e.g., HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, Cat #715-035-150
  • the non-immunogenic RNA is translated in a cell more efficiently than standard RNA with the same sequence.
  • translation is enhanced by a factor of 2-fold relative to its unmodified counterpart.
  • translation is enhanced by a 3-fold factor.
  • translation is enhanced by a 4-fold factor.
  • translation is enhanced by a 5-fold factor.
  • translation is enhanced by a 6-fold factor. In some embodiments, translation is enhanced by a 7-fold factor. In some embodiments, translation is enhanced by an 8-fold factor. In some embodiments, translation is enhanced by a 9-fold factor. In some embodiments, translation is enhanced by a 10-fold factor. In some embodiments, translation is enhanced by a 15-fold factor. In some embodiments, translation is enhanced by a 20-fold factor. In some embodiments, translation is enhanced by a 50-fold factor. In some embodiments, translation is enhanced by a 100-fold factor. In some embodiments, translation is enhanced by a 200-fold factor. In some embodiments, translation is enhanced by a 500-fold factor. In some embodiments, translation is enhanced by a 1000-fold factor.
  • translation is enhanced by a 2000-fold factor.
  • the factor is 10-1000-fold. In some embodiments, the factor is 10-100-fold. In some embodiments, the factor is 10-200-fold. In some embodiments, the factor is 10-300-fold. In some embodiments, the factor is 10-500-fold. In some embodiments, the factor is 20-1000-fold. In some embodiments, the factor is 30-1000-fold. In some embodiments, the factor is 50-1000-fold. In some embodiments, the factor is 100-1000-fold. In some embodiments, the factor is 200- 1000-fold. In some embodiments, translation is enhanced by any other significant amount or range of amounts.
  • the non-immunogenic RNA exhibits significantly less innate immunogenicity than standard RNA with the same sequence. In some embodiments, the non-immunogenic RNA (especially mRNA) exhibits an innate immune response that is 2- fold less than its unmodified counterpart. In some embodiments, innate immunogenicity is reduced by a 3-fold factor. In some embodiments, innate immunogenicity is reduced by a 4- fold factor. In some embodiments, innate immunogenicity is reduced by a 5-fold factor. In some embodiments, innate immunogenicity is reduced by a 6-fold factor. In some embodiments, innate immunogenicity is reduced by a 7-fold factor. In some embodiments, innate immunogenicity is reduced by an 8-fold factor.
  • innate immunogenicity is reduced by a 9-fold factor. In some embodiments, innate immunogenicity is reduced by a 10-fold factor. In some embodiments, innate immunogenicity is reduced by a 15-fold factor. In some embodiments, innate immunogenicity is reduced by a 20-fold factor. In some embodiments, innate immunogenicity is reduced by a 50-fold factor. In some embodiments, innate immunogenicity is reduced by a 100-fold factor. In some embodiments, innate immunogenicity is reduced by a 200-fold factor. In some embodiments, innate immunogenicity is reduced by a 500-fold factor. In some embodiments, innate immunogenicity is reduced by a 1000-fold factor. In some embodiments, innate immunogenicity is reduced by a 2000-fold factor.
  • the term "exhibits significantly less innate immunogenicity" refers to a detectable decrease in innate immunogenicity.
  • the term refers to a decrease such that an effective amount of the non-immunogenic RNA (especially mRNA) can be administered without triggering a detectable innate immune response.
  • the term refers to a decrease such that the non-immunogenic RNA (especially mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to detectably reduce production of the protein encoded by the non-immunogenic RNA.
  • the decrease is such that the non-immunogenic RNA (especially mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to eliminate detectable production of the protein encoded by the non-immunogenic RNA.
  • Immunogenicity is the ability of a foreign substance, such as RNA, to provoke an immune response in the body of a human or other animal.
  • the innate immune system is the component of the immune system that is relatively unspecific and immediate. It is one of two main components of the vertebrate immune system, along with the adaptive immune system.
  • RNA (in particular, mRNA) described in the present disclosure comprises a nucleic acid sequence encoding a peptide or polypeptide such as a peptide or polypeptide having biological activity, e.g., a pharmaceutically active peptide or polypeptide.
  • RNA (in particular, mRNA) described in the present disclosure comprises a nucleic acid sequence encoding a peptide or polypeptide, preferably a pharmaceutically active peptide or polypeptide, and is capable of expressing said peptide or polypeptide, in particular if transferred into a cell or subject.
  • the RNA (in particular, mRNA) described in the present disclosure contains a coding sequence or region (open reading frame (ORF)) encoding a peptide or polypeptide, e.g., encoding a pharmaceutically active peptide or polypeptide.
  • a coding sequence or region open reading frame (ORF)
  • Such nucleic acid encoding a pharmaceutically active peptide or polypeptide is also referred to herein as "pharmaceutically active nucleic acid”.
  • such RNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as “pharmaceutically active RNA” and such mRNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as "pharmaceutically active mRNA”.
  • RNA used in the present disclosure comprises a nucleic acid sequence encoding more than one peptide or polypeptide, e.g., two, three, four or more peptides or polypeptides.
  • the term "pharmaceutically active peptide or polypeptide” means a peptide or polypeptide that can be used in the treatment of an individual where the expression of the peptide or polypeptide would be of benefit, e.g., in ameliorating the symptoms of a disease.
  • a pharmaceutically active peptide or polypeptide has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease.
  • a pharmaceutically active peptide or polypeptide has a positive or advantageous effect on the condition or disease state of an individual when administered to the individual in a therapeutically effective amount.
  • a pharmaceutically active peptide or polypeptide may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease.
  • pharmaceutically active peptide or “pharmaceutically active polypeptide” includes entire peptides or polypeptides, and can also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active variants and/or analogs of a peptide or polypeptide.
  • pharmaceutically active peptides and polypeptides include, but are not limited to, immunostimulants, e.g., cytokines, hormones, adhesion molecules, immunoglobulins, immunologically active compounds, growth factors, protease inhibitors, enzymes, receptors, apoptosis regulators, transcription factors, tumor suppressor proteins, structural proteins, reprogramming factors, genomic engineering proteins, and blood proteins.
  • immunostimulants e.g., cytokines, hormones, adhesion molecules, immunoglobulins, immunologically active compounds, growth factors, protease inhibitors, enzymes, receptors, apoptosis regulators, transcription factors, tumor suppressor proteins, structural proteins, reprogramming factors, genomic engineering proteins, and blood proteins.
  • the pharmaceutically active peptide and polypeptide includes a replacement protein.
  • an “immunostimulant” is any substance that stimulates the immune system by inducing activation or increasing activity of any of the immune system's components, in particular immune effector cells.
  • the immunostimulant may be pro-inflammatory (e.g., when treating infections or cancer), or anti-inflammatory (e.g., when treating autoimmune diseases).
  • the immunostimulant is a cytokine or a variant thereof.
  • cytokines include interferons, such as interferon-alpha (IFN-a) or interferon-gamma (IFN-y), interleukins, such as IL2, IL7, 1 L12, 1 L15 and IL23, colony stimulating factors, such as M-CSF and GM-CSF, and tumor necrosis factor.
  • the immunostimulant includes an adjuvant-type immunostimulatory agent such as APC Toll-like Receptor agonists or costimulatory/cell adhesion membrane proteins.
  • Toll-like Receptor agonists include costimulatory/adhesion proteins such as CD80, CD86, and ICAM-1.
  • cytokines relates to proteins which have a molecular weight of about 5 to 60 kDa and which participate in cell signaling (e.g., paracrine, endocrine, and/or autocrine signaling). In particular, when released, cytokines exert an effect on the behavior of cells around the place of their release. Examples of cytokines include lymphokines, interleukins, chemokines, interferons, and tumor necrosis factors (TNFs). According to the present disclosure, cytokines do not include hormones or growth factors.
  • Cytokines differ from hormones in that (i) they usually act at much more variable concentrations than hormones and (ii) generally are made by a broad range of cells (nearly all nucleated cells can produce cytokines).
  • cytokines include erythropoietin (EPO), colony stimulating factor (CSF), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), tumor necrosis factor (TNF), bone morphogenetic protein (BMP), interferon alfa (IFNot), interferon beta (IFNfi), interferon gamma (INFy), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 10 (IL- 10), interleukin 11 (IL-11), interleukin 12 (IL-12), interleukin 15 (IL-15), and interleukin 21 (IL-21), as well as variants and derivatives thereof.
  • EPO erythropoi
  • a cytokine may be a naturally occurring cytokine or a functional fragment or variant thereof.
  • a cytokine may be human cytokine and may be derived from any vertebrate, especially any mammal.
  • One particularly preferred cytokine is interferon-a.
  • Immunostimulants may be provided to a subject by administering to the subject RNA encoding an immunostimulant in a formulation for preferential delivery of RNA to liver or liver tissue.
  • RNA encoding an immunostimulant in a formulation for preferential delivery of RNA to liver or liver tissue.
  • the delivery of RNA to such target organ or tissue is preferred, in particular, if it is desired to express large amounts of the immunostimulant and/or if systemic presence of the immunostimulant, in particular in significant amounts, is desired or required.
  • RNA delivery systems such as lipid-based particles, cationic and neutral nanoparticles, in particular lipid nanoparticles, may be used for delivery to the liver.
  • cytokines involved in T cell proliferation and/or maintenance.
  • suitable cytokines include IL2 or IL7, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
  • RNA encoding an immunostimulant may be administered in a formulation for preferential delivery of RNA to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen.
  • the delivery of an immunostimulant to such target tissue is preferred, in particular, if presence of the immunostimulant in this organ or tissue is desired (e.g., for inducing an immune response, in particular in case immunostimulants such as cytokines are required during T-cell priming or for activation of resident immune cells), while it is not desired that the immunostimulant is present systemically, in particular in significant amounts (e.g., because the immunostimulant has systemic toxicity).
  • suitable immunostimulants are cytokines involved in T cell priming.
  • suitable cytokines include IL12, IL15, IFN-a, or IFN-P, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
  • Interferons are a group of signaling proteins made and released by host cells in response to the presence of several pathogens, such as viruses, bacteria, parasites, and also tumor cells. In a typical scenario, a virus-infected cell will release interferons causing nearby cells to heighten their anti-viral defenses. Interferons are usually characterized by antiviral, antiproliferative and immunomodulatory activities. Interferons are proteins that alter and regulate the transcription of genes within a cell by binding to interferon receptors on the regulated cell's surface, thereby preventing viral replication within the cells.
  • interferons are typically divided among three classes: type I interferon, type II interferon, and type III interferon.
  • IFNAR IFN-a/p receptor
  • type I interferons present in humans are IFNa, IFN £, IFNe, IFNK and IFNw.
  • type I interferons are produced when the body recognizes a virus that has invaded it. They are produced by fibroblasts and monocytes. Once released, type I interferons bind to specific receptors on target cells, which leads to expression of proteins that will prevent the virus from producing and replicating its RNA and DNA.
  • the IFNa proteins are produced mainly by plasmacytoid dendritic cells (pDCs). They are mainly involved in innate immunity against viral infection.
  • the genes responsible for their synthesis come in 13 subtypes that are called IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, IFNA21. These genes are found together in a cluster on chromosome 9.
  • the IFN(3 proteins are produced in large quantities by fibroblasts. They have antiviral activity that is involved mainly in innate immune response. Two types of IFNfi have been described, IFNpi and IFN(33. The natural and recombinant forms of IFNpl have antiviral, antibacterial, and anticancer properties.
  • Type II interferon IFNy in humans
  • IL12 Type II interferon
  • type II interferons are released by cytotoxic T cells and T helper cells.
  • Type III interferons signal through a receptor complex consisting of IL1OR2 (also called CRF2- 4) and IFNLR1 (also called CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of type III IFNs in some types of virus or fungal infections.
  • type I and II interferons are responsible for regulating and activating the immune response.
  • a type I interferon is preferably IFNa or IFNp, more preferably IFNa.
  • an interferon may be a naturally occurring interferon or a functional fragment or variant thereof.
  • An interferon may be human interferon and may be derived from any vertebrate, especially any mammal.
  • Interleukins are a group of cytokines (secreted proteins and signal molecules) that can be divided into four major groups based on distinguishing structural features. However, their amino acid sequence similarity is rather weak (typically 15-25% identity). The human genome encodes more than 50 interleukins and related proteins.
  • an interleukin may be a naturally occurring interleukin or a functional fragment or variant thereof.
  • An interleukin may be human interleukin and may be derived from any vertebrate, especially any mammal.
  • Immunostimulant polypeptides described herein can be prepared as fusion or chimeric polypeptides that include an immunostimulant portion and a heterologous polypeptide (i.e., a polypeptide that is not an immunostimulant).
  • the immunostimulant may be fused to an extended-PK group, which increases circulation half-life.
  • extended- PK groups are described infra.
  • the extended-PK group is a serum albumin domain (e.g., mouse serum albumin, human serum albumin).
  • PK is an acronym for "pharmacokinetic” and encompasses properties of a compound including, by way of example, absorption, distribution, metabolism, and elimination by a subject.
  • an "extended-PK group” refers to a protein, peptide, or moiety that increases the circulation half-life of a biologically active molecule when fused to or administered together with the biologically active molecule.
  • examples of an extended-PK group include serum albumin (e.g., HSA), Immunoglobulin Fc or Fc fragments and variants thereof, transferrin and variants thereof, and human serum albumin (HSA) binders (as disclosed in U.S. Publication Nos. 2005/0287153 and 2007/0003549).
  • extended-PK groups are disclosed in Kontermann, Expert Opin Biol Ther, 2016 Jul;16(7):903- 15 which is herein incorporated by reference in its entirety.
  • an "extended-PK" immunostimulant refers to an immunostimulant moiety in combination with an extended-PK group.
  • the extended-PK immunostimulant is a fusion protein in which an immunostimulant moiety is linked or fused to an extended-PK group.
  • the serum half-life of an extended-PK immunostimulant is increased relative to the immunostimulant alone (i.e., the immunostimulant not fused to an extended- PK group). In certain embodiments, the serum half-life of the extended-PK immunostimulant is at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 120%, at least 150%, at least 180%, at least 200%, at least 400%, at least 600%, at least 800%, or at least 1000% longer relative to the serum half-life of the immunostimulant alone.
  • the serum half-life of the extended-PK immunostimulant is at least 1.5-fold, 2- fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 10-fold, 12-fold, 13- fold, 15-fold, 17-fold, 20-fold, 22-fold, 25-fold, 27-fold, 30-fold, 35-fold, 40-fold, or 50-fold greater than the serum half-life of the immunostimulant alone.
  • the serum half-life of the extended-PK immunostimulant is at least 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 50 hours, 60 hours, 70 hours, 80 hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, 135 hours, 140 hours, 150 hours, 160 hours, or 200 hours.
  • half-life refers to the time taken for the serum or plasma concentration of a compound such as a peptide or polypeptide to reduce by 50%, in vivo, for example due to degradation and/or clearance or sequestration by natural mechanisms.
  • An extended-PK immunostimulant suitable for use herein is stabilized in vivo and its half-life increased by, e.g., fusion to serum albumin (e.g., HSA or MSA), which resist degradation and/or clearance or sequestration.
  • the half-life can be determined in any manner known per se, such as by pharmacokinetic analysis.
  • Suitable techniques will be clear to the person skilled in the art, and may for example generally involve the steps of suitably administering a suitable dose of the amino acid sequence or compound to a subject; collecting blood samples or other samples from said subject at regular intervals; determining the level or concentration of the amino acid sequence or compound in said blood sample; and calculating, from (a plot of) the data thus obtained, the time until the level or concentration of the amino acid sequence or compound has been reduced by 50% compared to the initial level upon dosing. Further details are provided in, e.g., standard handbooks, such as Kenneth, A. et al., Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and in Peters et al., Pharmacokinetic Analysis: A Practical Approach (1996). Reference is also made to Gibaldi, M. et al., Pharmacokinetics, 2nd Rev. Edition, Marcel Dekker (1982).
  • the extended-PK group includes serum albumin, or fragments thereof or variants of the serum albumin or fragments thereof (all of which for the purpose of the present disclosure are comprised by the term "albumin”).
  • Polypeptides described herein may be fused to albumin (or a fragment or variant thereof) to form albumin fusion proteins.
  • albumin fusion proteins are described in U.S. Publication No. 20070048282.
  • albumin fusion protein refers to a protein formed by the fusion of at least one molecule of albumin (or a fragment or variant thereof) to at least one molecule of a protein such as a therapeutic protein, in particular an immunostimulant.
  • the albumin fusion protein may be generated by translation of a nucleic acid in which a polynucleotide encoding a therapeutic protein is joined in-frame with a polynucleotide encoding an albumin.
  • the therapeutic protein and albumin, once part of the albumin fusion protein may each be referred to as a "portion", "region” or “moiety” of the albumin fusion protein (e.g., a "therapeutic protein portion” or an "albumin protein portion”).
  • an albumin fusion protein comprises at least one molecule of a therapeutic protein (including, but not limited to a mature form of the therapeutic protein) and at least one molecule of albumin (including but not limited to a mature form of albumin).
  • an albumin fusion protein is processed by a host cell such as a cell of the target organ for administered RIMA, e.g. a liver cell, and secreted into the circulation.
  • Processing of the nascent albumin fusion protein that occurs in the secretory pathways of the host cell used for expression of the RNA may include, but is not limited to signal peptide cleavage; formation of disulfide bonds; proper folding; addition and processing of carbohydrates (such as for example, N- and O-linked glycosylation); specific proteolytic cleavages; and/or assembly into multimeric proteins.
  • An albumin fusion protein is preferably encoded by RNA in a non- processed form which in particular has a signal peptide at its N-terminus and following secretion by a cell is preferably present in the processed form wherein in particular the signal peptide has been cleaved off.
  • albumin fusion protein refers to an albumin fusion protein product which has undergone N- terminal signal peptide cleavage, herein also referred to as a "mature albumin fusion protein".
  • albumin fusion proteins comprising a therapeutic protein have a higher plasma stability compared to the plasma stability of the same therapeutic protein when not fused to albumin.
  • Plasma stability typically refers to the time period between when the therapeutic protein is administered in vivo and carried into the bloodstream and when the therapeutic protein is degraded and cleared from the bloodstream, into an organ, such as the kidney or liver, that ultimately clears the therapeutic protein from the body. Plasma stability is calculated in terms of the half-life of the therapeutic protein in the bloodstream. The half- life of the therapeutic protein in the bloodstream can be readily determined by common assays known in the art.
  • albumin refers collectively to albumin protein or amino acid sequence, or an albumin fragment or variant, having one or more functional activities (e.g., biological activities) of albumin.
  • albumin refers to human albumin or fragments or variants thereof especially the mature form of human albumin, or albumin from other vertebrates or fragments thereof, or variants of these molecules.
  • the albumin may be derived from any vertebrate, especially any mammal, for example human, cow, sheep, or pig. Non- mammalian albumins include, but are not limited to, hen and salmon.
  • the albumin portion of the albumin fusion protein may be from a different animal than the therapeutic protein portion.
  • the albumin is human serum albumin (HSA), or fragments or variants thereof, such as those disclosed in US 5,876,969, WO 2011/124718, WO 2013/075066, and WO 2011/0514789.
  • HSA human serum albumin
  • human serum albumin HSA
  • human albumin HA
  • albumin and serum albumin are broader, and encompass human serum albumin (and fragments and variants thereof) as well as albumin from other species (and fragments and variants thereof).
  • a fragment of albumin sufficient to prolong the therapeutic activity or plasma stability of the therapeutic protein refers to a fragment of albumin sufficient in length or structure to stabilize or prolong the therapeutic activity or plasma stability of the protein so that the plasma stability of the therapeutic protein portion of the albumin fusion protein is prolonged or extended compared to the plasma stability in the non-fusion state.
  • the albumin portion of the albumin fusion proteins may comprise the full length of the albumin sequence, or may include one or more fragments thereof that are capable of stabilizing or prolonging the therapeutic activity or plasma stability.
  • Such fragments may be of 10 or more amino acids in length or may include about 15, 20, 25, 30, 50, or more contiguous amino acids from the albumin sequence or may include part or all of specific domains of albumin.
  • one or more fragments of HSA spanning the first two immunoglobulin- like domains may be used.
  • the HSA fragment is the mature form of HSA.
  • an albumin fragment or variant will be at least 100 amino acids long, preferably at least 150 amino acids long.
  • albumin may be naturally occurring albumin or a fragment or variant thereof.
  • Albumin may be human albumin and may be derived from any vertebrate, especially any mammal.
  • the albumin fusion protein comprises albumin as the N-terminal portion, and a therapeutic protein as the C-terminal portion.
  • an albumin fusion protein comprising albumin as the C-terminal portion, and a therapeutic protein as the N-terminal portion may also be used.
  • the albumin fusion protein has a therapeutic protein fused to both the N-terminus and the C-terminus of albumin.
  • the therapeutic proteins fused at the N- and C-termini are the same therapeutic proteins.
  • the therapeutic proteins fused at the N- and C- termini are different therapeutic proteins.
  • the different therapeutic proteins are both cytokines.
  • the therapeutic protein(s) is (are) joined to the albumin through (a) peptide linker(s).
  • a peptide linker between the fused portions may provide greater physical separation between the moieties and thus maximize the accessibility of the therapeutic protein portion, for instance, for binding to its cognate receptor.
  • the peptide linker may consist of amino acids such that it is flexible or more rigid.
  • the linker sequence may be cleavable by a protease or chemically.
  • Fc region refers to the portion of a native immunoglobulin formed by the respective Fc domains (or Fc moieties) of its two heavy chains.
  • Fc domain refers to a portion or fragment of a single immunoglobulin (Ig) heavy chain wherein the Fc domain does not comprise an Fv domain.
  • an Fc domain begins in the hinge region just upstream of the papain cleavage site and ends at the C-terminus of the antibody. Accordingly, a complete Fc domain comprises at least a hinge domain, a CH2 domain, and a CH3 domain.
  • an Fc domain comprises at least one of: a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, a CH4 domain, or a variant, portion, or fragment thereof.
  • a hinge e.g., upper, middle, and/or lower hinge region
  • a CH2 domain e.g., a CH2 domain, and a CH3 domain
  • an Fc domain comprises a hinge domain (or portion thereof) fused to a CH3 domain (or portion thereof).
  • an Fc domain comprises a CH2 domain (or portion thereof) fused to a CH3 domain (or portion thereof).
  • an Fc domain consists of a CH3 domain or portion thereof.
  • an Fc domain consists of a hinge domain (or portion thereof) and a CH3 domain (or portion thereof). In certain embodiments, an Fc domain consists of a CH2 domain (or portion thereof) and a CH3 domain. In certain embodiments, an Fc domain consists of a hinge domain (or portion thereof) and a CH2 domain (or portion thereof). In certain embodiments, an Fc domain lacks at least a portion of a CH2 domain (e.g., all or part of a CH2 domain).
  • An Fc domain herein generally refers to a polypeptide comprising all or part of the Fc domain of an immunoglobulin heavy-chain.
  • the Fc domain may be derived from an immunoglobulin of any species and/or any subtype, including, but not limited to, a human IgGl, lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM antibody.
  • the Fc domain encompasses native Fc and Fc variant molecules.
  • any Fc domain may be modified such that it varies in amino acid sequence from the native Fc domain of a naturally occurring immunoglobulin molecule.
  • the Fc domain has reduced effector function (e.g., FcyR binding).
  • an Fc domain of a polypeptide described herein may be derived from different immunoglobulin molecules.
  • an Fc domain of a polypeptide may comprise a CH2 and/or CH3 domain derived from an IgGl molecule and a hinge region derived from an lgG3 molecule.
  • an Fc domain can comprise a chimeric hinge region derived, in part, from an IgGl molecule and, in part, from an lgG3 molecule.
  • an Fc domain can comprise a chimeric hinge derived, in part, from an IgGl molecule and, in part, from an lgG4 molecule.
  • an extended-PK group includes an Fc domain or fragments thereof or variants of the Fc domain or fragments thereof (all of which for the purpose of the present disclosure are comprised by the term "Fc domain").
  • the Fc domain does not contain a variable region that binds to antigen.
  • Fc domains suitable for use in the present disclosure may be obtained from a number of different sources.
  • an Fc domain is derived from a human immunoglobulin.
  • the Fc domain is from a human IgGl constant region. It is understood, however, that the Fc domain may be derived from an immunoglobulin of another mammalian species, including for example, a rodent (e.g. a mouse, rat, rabbit, guinea pig) or non-human primate (e.g. chimpanzee, macaque) species.
  • rodent e.g. a mouse, rat, rabbit, guinea pig
  • non-human primate e.g. chimpanzee, mac
  • the Fc domain (or a fragment or variant thereof) may be derived from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, and any immunoglobulin isotype, including IgGl, lgG2, lgG3, and lgG4.
  • Fc domain gene sequences e.g., mouse and human constant region gene sequences
  • Constant region domains comprising an Fc domain sequence can be selected lacking a particular effector function and/or with a particular modification to reduce immunogenicity.
  • Many sequences of antibodies and antibody-encoding genes have been published and suitable Fc domain sequences (e.g. hinge, CH2, and/or CH3 sequences, or fragments or variants thereof) can be derived from these sequences using art recognized techniques.
  • the extended-PK group is a serum albumin binding protein such as those described in US2005/0287153, US2007/0003549, US2007/0178082, US2007/0269422, US2010/0113339, W02009/083804, and W02009/133208, which are herein incorporated by reference in their entirety.
  • the extended-PK group is transferrin, as disclosed in US 7,176,278 and US 8,158,579, which are herein incorporated by reference in their entirety.
  • the extended-PK group is a serum immunoglobulin binding protein such as those disclosed in US2007/0178082, US2014/0220017, and US2017/0145062, which are herein incorporated by reference in their entirety.
  • the extended-PK group is a fibronectin (Fn)-based scaffold domain protein that binds to serum albumin, such as those disclosed in US2012/0094909, which is herein incorporated by reference in its entirety. Methods of making fibronectin-based scaffold domain proteins are also disclosed in US2012/0094909.
  • Fn3-based extended-PK group is Fn3(HSA), i.e., a Fn3 protein that binds to human serum albumin.
  • the extended-PK immunostimulant can employ one or more peptide linkers.
  • peptide linker refers to a peptide or polypeptide sequence which connects two or more domains (e.g., the extended-PK moiety and an immunostimulant moiety) in a linear amino acid sequence of a polypeptide chain.
  • peptide linkers may be used to connect an immunostimulant moiety to a HSA domain.
  • Linkers suitable for fusing the extended-PK group to, e.g., an immunostimulant are well known in the art.
  • Exemplary linkers include glycine-serine-polypeptide linkers, glycine-proline- polypeptide linkers, and proline-alanine polypeptide linkers.
  • the linker is a glycine-serine-polypeptide linker, i.e., a peptide that consists of glycine and serine residues.
  • a pharmaceutically active peptide or polypeptide comprises a replacement protein.
  • the present disclosure provides a method for treatment of a subject having a disorder requiring protein replacement (e.g., protein deficiency disorders) comprising administering to the subject RNA (in particular, mRNA) as described herein encoding a replacement protein.
  • RNA in particular, mRNA
  • protein replacement refers to the introduction of a protein (including functional variants thereof) into a subject having a deficiency in such protein.
  • the term also refers to the introduction of a protein into a subject otherwise requiring or benefiting from providing a protein, e.g., suffering from protein insufficiency.
  • disorder characterized by a protein deficiency refers to any disorder that presents with a pathology caused by absent or insufficient amounts of a protein. This term encompasses protein folding disorders, i.e., conformational disorders, that result in a biologically inactive protein product. Protein insufficiency can be involved in infectious diseases, immunosuppression, organ failure, glandular problems, radiation illness, nutritional deficiency, poisoning, or other environmental or external insults.
  • hormones relates to a class of signaling molecules produced by glands, wherein signaling usually includes the following steps: (i) synthesis of a hormone in a particular tissue; (ii) storage and secretion; (iii) transport of the hormone to its target; (iv) binding of the hormone by a receptor; (v) relay and amplification of the signal; and (vi) breakdown of the hormone.
  • Hormones differ from cytokines in that (1) hormones usually act in less variable concentrations and (2) generally are made by specific kinds of cells.
  • a "hormone” is a peptide or polypeptide hormone, such as insulin, vasopressin, prolactin, adrenocorticotropic hormone (ACTH), thyroid hormone, growth hormones (such as human grown hormone or bovine somatotropin), oxytocin, atrial-natriuretic peptide (ANP), glucagon, somatostatin, cholecystokinin, gastrin, and leptins.
  • Adhesion molecules relates to proteins which are located on the surface of a cell and which are involved in binding of the cell with other cells or with the extracellular matrix (ECM).
  • Adhesion molecules are typically transmembrane receptors and can be classified as calcium-independent (e.g., integrins, immunoglobulin superfamily, lymphocyte homing receptors) and calcium-dependent (cadherins and selectins).
  • Particular examples of adhesion molecules are integrins, lymphocyte homing receptors, selectins (e.g., P-selectin), and addressins.
  • Integrins are also involved in signal transduction.
  • integrins upon ligand binding, integrins modulate cell signaling pathways, e.g., pathways of transmembrane protein kinases such as receptor tyrosine kinases (RTK).
  • RTK receptor tyrosine kinases
  • integrins include: aiPi, aipi, aspi, cuPi, 015P1, otePi, 017P1, oiLp2, otMp2, otiibp3, otvpi, otvp3, ctvPs, avPe, avPs, and aeP ⁇
  • immunoglobulins or “immunoglobulin superfamily” refers to molecules which are involved in the recognition, binding, and/or adhesion processes of cells. Molecules belonging to this superfamily share the feature that they contain a region known as immunoglobulin domain or fold.
  • immunoglobulin superfamily include antibodies (e.g., IgG), T cell receptors (TCRs), major histocompatibility complex (MHC) molecules, co-receptors (e.g., CD4, CD8, CD19), antigen receptor accessory molecules (e.g., CD-3y, CD3-6, CD-3E, CD79a, CD79b), co-stimulatory or inhibitory molecules (e.g., CD28, CD80, CD86), and other.
  • antibodies e.g., IgG
  • T cell receptors T cell receptors
  • MHC major histocompatibility complex
  • co-receptors e.g., CD4, CD8, CD19
  • antigen receptor accessory molecules e.g., CD-3y, CD3-6, CD-3E, CD79a, CD79b
  • co-stimulatory or inhibitory molecules e.g., CD28, CD80, CD86
  • immunologically active compound relates to any compound altering an immune response, e.g., by inducing and/or suppressing maturation of immune cells, inducing and/or suppressing cytokine biosynthesis, and/or altering humoral immunity by stimulating antibody production by B cells.
  • Immunologically active compounds possess potent immunostimulating activity including, but not limited to, antiviral and antitumor activity, and can also down- regulate other aspects of the immune response, for example shifting the immune response away from a TH2 immune response, which is useful for treating a wide range of TH2 mediated diseases.
  • Immunologically active compounds can be useful as vaccine adjuvants.
  • immunologically active compounds include interleukins, colony stimulating factor (CSF), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), erythropoietin, tumor necrosis factor (TNF), interferons, integrins, addressins, selectins, homing receptors, and antigens, in particular tumor- associated antigens, pathogen-associated antigens (such as bacterial, parasitic, or viral antigens), allergens, and autoantigens.
  • An immunologically active compound may be a vaccine antigen, i.e., an antigen whose inoculation into a subject induces an immune response.
  • the "peptide or polypeptide comprising an epitope for inducing an immune response against an antigen in a subject” is also designated herein as "vaccine antigen", “peptide and protein antigen” or simply "antigen”.
  • the RNA encoding the vaccine antigen is expressed in cells , e.g., muscle cells or antigen-presenting cells (APCs), of the subject to provide the vaccine antigen.
  • expression of the vaccine antigen is at the cell surface.
  • the vaccine antigen is presented in the context of MHC.
  • the RNA encoding the vaccine antigen is transiently expressed in cells of the subject.
  • the RNA encoding the vaccine antigen is administered systemically, e.g., intravenously. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in spleen occurs.
  • RNA encoding the vaccine antigen after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in antigen presenting cells, preferably professional antigen presenting cells occurs.
  • the antigen presenting cells are selected from the group consisting of dendritic cells, macrophages and B cells.
  • no or essentially no expression of the RNA encoding the vaccine antigen in lung and/or liver occurs.
  • expression of the RNA encoding the vaccine antigen in spleen is at least 5-fold the amount of expression in lung.
  • the RNA encoding the vaccine antigen is administered intramuscularly.
  • the vaccine antigen comprises an epitope for inducing an immune response against an antigen in a subject.
  • the vaccine antigen comprises an antigenic sequence for inducing an immune response against an antigen in a subject.
  • Such antigenic sequence may correspond to a target antigen or disease-associated antigen, e.g., a protein of an infectious agent (e.g., viral or bacterial antigen) or tumor antigen, or may correspond to an immunogenic variant thereof, or an immunogenic fragment of the target antigen or disease-associated antigen or the immunogenic variant thereof.
  • the antigenic sequence may comprise at least an epitope of a target antigen or disease-associated antigen or an immunogenic variant thereof.
  • the antigenic sequences e.g., epitopes, suitable for use according to the disclosure typically may be derived from a target antigen, i.e. the antigen against which an immune response is to be elicited.
  • a target antigen i.e. the antigen against which an immune response is to be elicited.
  • the antigenic sequences contained within the vaccine antigen may be a target antigen or a fragment or variant of a target antigen.
  • the antigenic sequence or a procession product thereof may bind to the antigen receptor such as TCR or CAR carried by immune effector cells.
  • the antigenic sequence is selected from the group consisting of the antigen expressed by a target cell to which the immune effector cells are targeted or a fragment thereof, or a variant of the antigenic sequence or the fragment.
  • a vaccine antigen which may be provided to a subject according to the present disclosure by administering RNA encoding the vaccine antigen preferably results in the induction of an immune response, e.g., in the stimulation, priming and/or expansion of immune effector cells, in the subject being provided the vaccine antigen.
  • Said immune response e.g., stimulated, primed and/or expanded immune effector cells, is preferably directed against a target antigen, in particular a target antigen expressed by diseased cells, tissues and/or organs, i.e., a disease- associated antigen.
  • a vaccine antigen may comprise the disease-associated antigen, or a fragment or variant thereof. In some embodiments, such fragment or variant is immunologically equivalent to the disease-associated antigen.
  • fragment of an antigen or “variant of an antigen” means an agent which results in the induction of an immune response, e.g., in the stimulation, priming and/or expansion of immune effector cells, which immune response, e.g., stimulated, primed and/or expanded immune effector cells, targets the antigen, i.e. a disease- associated antigen, in particular when presented by diseased cells, tissues and/or organs.
  • the vaccine antigen may correspond to or may comprise the disease-associated antigen, may correspond to or may comprise a fragment of the disease-associated antigen or may correspond to or may comprise an antigen which is homologous to the disease-associated antigen or a fragment thereof.
  • the vaccine antigen comprises a fragment of the disease- associated antigen or an amino acid sequence which is homologous to a fragment of the disease-associated antigen
  • said fragment or amino acid sequence may comprise an epitope of the disease-associated antigen to which the antigen receptor of the immune effector cells is targeted or a sequence which is homologous to an epitope of the disease-associated antigen.
  • a vaccine antigen may comprise an immunogenic fragment of a disease-associated antigen or an amino acid sequence being homologous to an immunogenic fragment of a disease-associated antigen.
  • an "immunogenic fragment of an antigen” preferably relates to a fragment of an antigen which is capable of inducing an immune response against, e.g., stimulating, priming and/or expanding immune effector cells carrying an antigen receptor binding to, the antigen or cells expressing the antigen.
  • the vaccine antigen (similar to the disease-associated antigen) provides the relevant epitope for binding by the antigen receptor present on the immune effector cells.
  • the vaccine antigen or a fragment thereof is expressed on the surface of a cell such as an antigen-presenting cell (optionally in the context of MHC) so as to provide the relevant epitope for binding by immune effector cells.
  • the vaccine antigen may be a recombinant antigen.
  • the RNA encoding the vaccine antigen is expressed in cells of a subject to provide the antigen or a procession product thereof for binding by the antigen receptor expressed by immune effector cells, said binding resulting in stimulation, priming and/or expansion of the immune effector cells.
  • An "antigen" according to the present disclosure covers any substance that will elicit an immune response and/or any substance against which an immune response or an immune mechanism such as a cellular response and/or humoral response is directed.
  • an antigen relates to any substance, such as a peptide or polypeptide, that reacts specifically with antibodies or T-lymphocytes (T-cells).
  • the term "antigen” may comprise a molecule that comprises at least one epitope, such as a T cell epitope.
  • an antigen is a molecule which, optionally after processing, induces an immune reaction, which may be specific for the antigen (including cells expressing the antigen).
  • an antigen is a disease-associated antigen, such as a tumor antigen, a viral antigen, or a bacterial antigen, or an epitope derived from such antigen.
  • an antigen is presented or present on the surface of cells of the immune system such as antigen presenting cells like dendritic cells or macrophages.
  • An antigen or a procession product thereof such as a T cell epitope is in some embodiments bound by an antigen receptor. Accordingly, an antigen or a procession product thereof may react specifically with immune effector cells such as T-lymphocytes (T cells).
  • autoantigen or “self-antigen” refers to an antigen which originates from within the body of a subject (i.e., the autoantigen can also be called “autologous antigen") and which produces an abnormally vigorous immune response against this normal part of the body. Such vigorous immune reactions against autoantigens may be the cause of "autoimmune diseases".
  • any suitable antigen may be used, which is a candidate for an immune response, wherein the immune response may comprise a humoral or cellular immune response, or both.
  • the antigen is presented by a cell, such as by an antigen presenting cell, in the context of MHC molecules, which results in an immune response against the antigen.
  • An antigen may be a product which corresponds to or is derived from a naturally occurring antigen.
  • Such naturally occurring antigens may include or may be derived from allergens, viruses, bacteria, fungi, parasites and other infectious agents and pathogens or an antigen may also be a tumor antigen.
  • an antigen may correspond to a naturally occurring product, for example, a viral protein, or a part thereof.
  • disease-associated antigen is used in its broadest sense to refer to any antigen associated with a disease.
  • a disease-associated antigen is a molecule which contains epitopes that will stimulate a host's immune system to make a cellular antigen-specific immune response and/or a humoral antibody response against the disease.
  • Disease-associated antigens include pathogen-associated antigens, i.e., antigens which are associated with infection by microbes, typically microbial antigens (such as bacterial or viral antigens), or antigens associated with cancer, typically tumors, such as tumor antigens.
  • the antigen is a tumor antigen, i.e., a part of a tumor cell, in particular those which primarily occur intracellularly or as surface antigens of tumor cells.
  • the antigen is a pathogen-associated antigen, i.e., an antigen derived from a pathogen, e.g., from a virus, bacterium, unicellular organism, or parasite, for example a viral antigen such as viral ribonucleoprotein or coat protein.
  • the antigen should be presented by MHC molecules which results in modulation, in particular activation of cells of the immune system, such as CD4+ and CD8+ lymphocytes, in particular via the modulation of the activity of a T-cell receptor.
  • tumor antigen refers to a constituent of cancer cells which may be derived from the cytoplasm, the cell surface or the cell nucleus. In particular, it refers to those antigens which are produced intracellularly or as surface antigens on tumor cells.
  • tumor antigens include the carcinoembryonal antigen, al-fetoprotein, isoferritin, and fetal sulphoglycoprotein, a2-H-ferroprotein and y-fetoprotein, as well as various virus tumor antigens.
  • a tumor antigen comprises any antigen which is characteristic for tumors or cancers as well as for tumor or cancer cells with respect to type and/or expression level.
  • viral antigen refers to any viral component having antigenic properties, i.e., being able to provoke an immune response in an individual.
  • the viral antigen may be a viral ribonucleoprotein or an envelope protein.
  • bacterial antigen refers to any bacterial component having antigenic properties, i.e. being able to provoke an immune response in an individual.
  • the bacterial antigen may be derived from the cell wall or cytoplasm membrane of the bacterium.
  • epipe refers to an antigenic determinant in a molecule such as an antigen, i.e., to a part in or fragment of the molecule that is recognized by the immune system, for example, that is recognized by antibodies, T cells or B cells, in particular when presented in the context of MHC molecules.
  • An epitope of a protein may comprises a continuous or discontinuous portion of said protein and, e.g., may be between about 5 and about 100, between about 5 and about 50, between about 8 and about 30, or about 10 and about 25 amino acids in length, for example, the epitope may be preferably 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.
  • the epitope in the context of the present disclosure is a T cell epitope.
  • an antigen which is, e.g., capable of eliciting an immune response against the antigen or a cell expressing or comprising and presenting the antigen.
  • the terms relate to an immunogenic portion of an antigen. In some embodiments, it is a portion of an antigen that is recognized (i.e., specifically bound) by a T cell receptor, in particular if presented in the context of MHC molecules. Certain preferred immunogenic portions bind to an MHC class I or class II molecule.
  • epitope refers to a part or fragment of a molecule such as an antigen that is recognized by the immune system.
  • the epitope may be recognized by T cells, B cells or antibodies.
  • An epitope of an antigen may include a continuous or discontinuous portion of the antigen and may be between about 5 and about 100, such as between about 5 and about 50, between about 8 and about 30, or between about 8 and about 25 amino acids in length, for example, the epitope may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, an epitope is between about 10 and about 25 amino acids in length.
  • epitope includes T cell epitopes.
  • T cell epitope refers to a part or fragment of a protein that is recognized by a T cell when presented in the context of MHC molecules.
  • major histocompatibility complex and the abbreviation "MHC” includes MHC class I and MHC class II molecules and relates to a complex of genes which is present in all vertebrates. MHC proteins or molecules are important for signaling between lymphocytes and antigen presenting cells or diseased cells in immune reactions, wherein the MHC proteins or molecules bind peptide epitopes and present them for recognition by T cell receptors on T cells.
  • the proteins encoded by the MHC are expressed on the surface of cells, and display both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to a T cell.
  • the binding peptides are typically about 8 to about 10 amino acids long although longer or shorter peptides may be effective.
  • the binding peptides are typically about 10 to about 25 amino acids long and are in particular about 13 to about 18 amino acids long, whereas longer and shorter peptides may be effective.
  • the peptide and polypeptide antigen can be 2 to 100 amino acids, including for example, 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, or 50 amino acids in length. In some embodiments, a peptide can be greater than 50 amino acids. In some embodiments, the peptide can be greater than 100 amino acids.
  • the peptide or polypeptide antigen can be any peptide or polypeptide that can induce or increase the ability of the immune system to develop antibodies and T cell responses to the peptide or polypeptide.
  • vaccine antigen i.e., an antigen whose inoculation into a subject induces an immune response
  • the vaccine antigen is recognized by an immune effector cell.
  • the vaccine antigen if recognized by an immune effector cell is able to induce in the presence of appropriate co-stimulatory signals, stimulation, priming and/or expansion of the immune effector cell carrying an antigen receptor recognizing the vaccine antigen.
  • the vaccine antigen may be, e.g., presented or present on the surface of a cell, such as an antigen presenting cell.
  • an antigen is expressed in a diseased cell (such as tumor cell or an infected cell).
  • an antigen is presented by a diseased cell (such as tumor cell or an infected cell).
  • an antigen receptor is a TCR which binds to an epitope of an antigen presented in the context of MHC.
  • binding of a TCR when expressed by T cells and/or present on T cells to an antigen presented by cells such as antigen presenting cells results in stimulation, priming and/or expansion of said T cells.
  • binding of a TCR when expressed by T cells and/or present on T cells to an antigen presented on diseased cells results in cytolysis and/or apoptosis of the diseased cells, wherein said T cells release cytotoxic factors, e.g., perforins and granzymes.
  • an antigen is expressed on the surface of a diseased cell (such as tumor cell or an infected cell).
  • an antigen receptor is a CAR which binds to an extracellular domain or to an epitope in an extracellular domain of an antigen.
  • a CAR binds to native epitopes of an antigen present on the surface of living cells.
  • binding of a CAR when expressed by T cells and/or present on T cells to an antigen present on cells results in stimulation, priming and/or expansion of said T cells.
  • binding of a CAR when expressed by T cells and/or present on T cells to an antigen present on diseased cells results in cytolysis and/or apoptosis of the diseased cells, wherein said T cells preferably release cytotoxic factors, e.g., perforins and granzymes.
  • an amino acid sequence enhancing antigen processing and/or presentation is fused, either directly or through a linker, to an antigenic peptide or polypeptide (antigenic sequence).
  • the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and/or presentation.
  • amino acid sequences enhancing antigen processing and/or presentation are preferably located at the C-terminus of the antigenic peptide or polypeptide (and optionally at the C- terminus of an amino acid sequence which breaks immunological tolerance), without being limited thereto.
  • Amino acid sequences enhancing antigen processing and/or presentation as defined herein preferably improve antigen processing and presentation.
  • the amino acid sequence enhancing antigen processing and/or presentation as defined herein includes, without being limited thereto, sequences derived from the human MHC class I complex (HLA-B51, haplotype A2, B27/B51, Cw2/Cw3), in particular a sequence comprising the amino acid sequence of SEQ ID NO: 13 or a functional variant thereof.
  • an amino acid sequence enhancing antigen processing and/or presentation comprises the amino acid sequence of SEQ. ID NO: 13, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 13, or a functional fragment of the amino acid sequence of SEQ ID NO: 13, or the amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 13.
  • an amino acid sequence enhancing antigen processing and/or presentation comprises the amino acid sequence of SEQ ID NO: 13.
  • the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and/or presentation, said amino acid sequence enhancing antigen processing and/or presentation preferably being fused to the antigenic peptide or polypeptide, more preferably to the C-terminus of the antigenic peptide or polypeptide as described herein.
  • a secretory sequence may be fused to the N-terminus of the antigenic peptide or polypeptide.
  • Amino acid sequences derived from tetanus toxoid of Clostridium tetani may be employed to overcome self-tolerance mechanisms in order to efficiently mount an immune response to self-antigens by providing T-cell help during priming.
  • an amino acid sequence which breaks immunological tolerance is fused, either directly or through a linker to the antigenic peptide or polypeptide.
  • Such amino acid sequences which break immunological tolerance are preferably located at the C-terminus of the antigenic peptide or polypeptide (and optionally at the N-terminus of the amino acid sequence enhancing antigen processing and/or presentation, wherein the amino acid sequence which breaks immunological tolerance and the amino acid sequence enhancing antigen processing and/or presentation may be fused either directly or through a linker, without being limited thereto.
  • Amino acid sequences which break immunological tolerance as defined herein preferably improve T cell responses.
  • the amino acid sequence which breaks immunological tolerance as defined herein includes, without being limited thereto, sequences derived from tetanus toxoid-derived helper sequences p2 and pl6 (P2P16), in particular a sequence comprising the amino acid sequence of SEQ ID NO: 14 or a functional variant thereof.
  • an amino acid sequence which breaks immunological tolerance comprises the amino acid sequence of SEQ ID NO: 14, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 14, or a functional fragment of the amino acid sequence of SEQ ID NO: 14, or the amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 14.
  • an amino acid sequence which breaks immunological tolerance comprises the amino acid sequence of SEQ ID NO: 14.
  • an antigen receptor is an antibody or B cell receptor which binds to an epitope in an antigen. In some embodiments, an antibody or B cell receptor binds to native epitopes of an antigen.
  • the term “expressed on the cell surface” or “associated with the cell surface” means that a molecule such as an antigen is associated with and located at the plasma membrane of a cell, wherein at least a part of the molecule faces the extracellular space of said cell and is accessible from the outside of said cell, e.g., by antibodies located outside the cell.
  • a part may be, e.g., at least 4, at least 8, at least 12, or at least 20 amino acids.
  • the association may be direct or indirect.
  • the association may be by one or more transmembrane domains, one or more lipid anchors, or by the interaction with any other protein, lipid, saccharide, or other structure that can be found on the outer leaflet of the plasma membrane of a cell.
  • a molecule associated with the surface of a cell may be a transmembrane protein having an extracellular portion or may be a protein associated with the surface of a cell by interacting with another protein that is a transmembrane protein.
  • Cell surface or “surface of a cell” is used in accordance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules.
  • An antigen is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by, e.g., antigen-specific antibodies added to the cells.
  • an antigen expressed on the surface of cells is an integral membrane protein having an extracellular portion which may be recognized by a CAR.
  • extracellular portion or “exodomain” in the context of the present disclosure refers to a part of a molecule such as a protein that is facing the extracellular space of a cell and preferably is accessible from the outside of said cell, e.g., by binding molecules such as antibodies located outside the cell.
  • the term refers to one or more extracellular loops or domains or a fragment thereof.
  • T cell and "T lymphocyte” are used interchangeably herein and include T helper cells (CD4+ T cells) and cytotoxic T cells (CTLs, CD8+ T cells) which comprise cytolytic T cells.
  • T helper cells CD4+ T cells
  • CTLs cytotoxic T cells
  • antigen-specific T cell or similar terms relate to a T cell which recognizes the antigen to which the T cell is targeted, in particular when presented on the surface of antigen presenting cells or diseased cells such as cancer cells in the context of MHC molecules and preferably exerts effector functions of T cells.
  • T cells are considered to be specific for antigen if the cells kill target cells expressing an antigen.
  • T cell specificity may be evaluated using any of a variety of standard techniques, for example, within a chromium release assay or proliferation assay. Alternatively, synthesis of lymphokines (such as interferon-y) can be measured.
  • the term "target” shall mean an agent such as a cell or tissue which is a target for an immune response such as a cellular immune response.
  • Targets include cells that present an antigen or an antigen epitope, i.e., a peptide fragment derived from an antigen.
  • the target cell is a cell expressing an antigen and presenting said antigen with class I MHC.
  • Antigen processing refers to the degradation of an antigen into processing products which are fragments of said antigen (e.g., the degradation of a polypeptide into peptides) and the association of one or more of these fragments (e.g., via binding) with MHC molecules for presentation by cells, such as antigen-presenting cells to specific T-cells.
  • Antigen-presenting cells can be distinguished in professional antigen presenting cells and non-professional antigen presenting cells.
  • the term "professional antigen presenting cells” relates to antigen presenting cells which constitutively express the Major Histocompatibility Complex class II (MHC class II) molecules required for interaction with naive T cells. If a T cell interacts with the MHC class II molecule complex on the membrane of the antigen presenting cell, the antigen presenting cell produces a co-stimulatory molecule inducing activation of the T cell.
  • Professional antigen presenting cells comprise dendritic cells and macrophages.
  • non-professional antigen presenting cells relates to antigen presenting cells which do not constitutively express MHC class II molecules, but upon stimulation by certain cytokines such as interferon-gamma.
  • exemplary, non-professional antigen presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells or vascular endothelial cells.
  • dendritic cell refers to a subtype of phagocytic cells belonging to the class of antigen presenting cells.
  • dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells initially transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T cell activation potential. Immature dendritic cells constantly sample the surrounding environment for pathogens such as viruses and bacteria. Once they have come into contact with a presentable antigen, they become activated into mature dendritic cells and begin to migrate to the spleen or to the lymph node.
  • Immature dendritic cells phagocytose pathogens and degrade their proteins into small pieces and upon maturation present those fragments at their cell surface using MHC molecules. Simultaneously, they upregulate cell-surface receptors that act as co-receptors in T cell activation such as CD80, CD86, and CD40 greatly enhancing their ability to activate T cells. They also upregulate CCR7, a chemotactic receptor that induces the dendritic cell to travel through the blood stream to the spleen or through the lymphatic system to a lymph node. Here they act as antigen-presenting cells and activate helper T cells and killer T cells as well as B cells by presenting them antigens, alongside non-antigen specific co-stimulatory signals. Thus, dendritic cells can actively induce a T cell- or B cell-related immune response. In some embodiments, the dendritic cells are splenic dendritic cells.
  • macrophage refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Macrophages which are activated by inflammation, immune cytokines or microbial products nonspecifically engulf and kill foreign pathogens within the macrophage by hydrolytic and oxidative attack resulting in degradation of the pathogen. Peptides from degraded proteins are displayed on the macrophage cell surface where they can be recognized by T cells, and they can directly interact with antibodies on the B cell surface, resulting in T and B cell activation and further stimulation of the immune response. Macrophages belong to the class of antigen presenting cells. In some embodiments, the macrophages are splenic macrophages.
  • antigen-responsive CTL is meant a CD8 + T-cell that is responsive to an antigen or a peptide derived from said antigen, which is presented with class I MHC on the surface of antigen presenting cells.
  • CTL responsiveness may include sustained calcium flux, cell division, production of cytokines such as I FN -y and TNF-a, up-regulation of activation markers such as CD44 and CD69, and specific cytolytic killing of tumor antigen expressing target cells.
  • CTL responsiveness may also be determined using an artificial reporter that accurately indicates CTL responsiveness.
  • Activation refers to the state of a cell that has been sufficiently stimulated to induce detectable cellular proliferation, such as an immune effector cell such as T cell. Activation can also be associated with initiation of signaling pathways, induced cytokine production, and detectable effector functions.
  • activated immune effector cells refers to, among other things, immune effector cells that are undergoing cell division.
  • the term "priming" refers to a process wherein an immune effector cell such as a T cell has its first contact with its specific antigen and causes differentiation into effector cells such as effector T cells.
  • expansion refers to a process wherein a specific entity is multiplied.
  • the term is used in the context of an immunological response in which immune effector cells are stimulated by an antigen, proliferate, and the specific immune effector cell recognizing said antigen is amplified.
  • expansion leads to differentiation of the immune effector cells.
  • immune response and “immune reaction” are used herein interchangeably in their conventional meaning and refer to an integrated bodily response to an antigen and may refer to a cellular immune response, a humoral immune response, or both.
  • the term "immune response to” or “immune response against” with respect to an agent such as an antigen, cell or tissue relates to an immune response such as a cellular response directed against the agent.
  • An immune response may comprise one or more reactions selected from the group consisting of developing antibodies against one or more antigens and expansion of antigen-specific T-lymphocytes, such as CD4 + and CD8 + T- lymphocytes, e.g. CD8 + T-lymphocytes, which may be detected in various proliferation or cytokine production tests in vitro.
  • the terms "inducing an immune response” and “eliciting an immune response” and similar terms in the context of the present disclosure refer to the induction of an immune response, such as the induction of a cellular immune response, a humoral immune response, or both.
  • the immune response may be protective/preventive/prophylactic and/or therapeutic.
  • the immune response may be directed against any immunogen or antigen or antigen peptide, such as against a tumor-associated antigen or a pathogen-associated antigen (e.g., an antigen of a virus (such as influenza virus (A, B, or C), CMV or RSV)).
  • inducing in this context may mean that there was no immune response against a particular antigen or pathogen before induction, but it may also mean that there was a certain level of immune response against a particular antigen or pathogen before induction and after induction said immune response is enhanced.
  • inducing the immune response in this context also includes “enhancing the immune response”.
  • after inducing an immune response in an individual said individual is protected from developing a disease such as an infectious disease or a cancerous disease or the disease condition is ameliorated by inducing an immune response.
  • cellular immune response means to include a cellular response directed to cells characterized by expression of an antigen and/or presentation of an antigen with class I or class II MHC.
  • the cellular response relates to cells called T cells or T lymphocytes which act as either "helpers” or “killers".
  • the helper T cells also termed CD4 + T cells
  • the killer cells also termed cytotoxic T cells, cytolytic T cells, CD8 + T cells or CTLs kill cells such as diseased cells.
  • the term "humoral immune response” refers to a process in living organisms wherein antibodies are produced in response to agents and organisms, which they ultimately neutralize and/or eliminate.
  • the specificity of the antibody response is mediated by T and/or B cells through membrane-associated receptors that bind antigen of a single specificity.
  • B lymphocytes divide, which produces memory B cells as well as antibody secreting plasma cell clones, each producing antibodies that recognize the identical antigenic epitope as was recognized by its antigen receptor.
  • Memory B lymphocytes remain dormant until they are subsequently activated by their specific antigen. These lymphocytes provide the cellular basis of memory and the resulting escalation in antibody response when re-exposed to a specific antigen.
  • antibody refers to an immunoglobulin molecule, which is able to specifically bind to an epitope on an antigen.
  • antibody refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • antibody includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies and combinations of any of the foregoing.
  • Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region (CH).
  • VL light chain variable region
  • CL light chain constant region
  • variable regions and constant regions are also referred to herein as variable domains and constant domains, respectively.
  • the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs).
  • CDRs complementarity determining regions
  • FRs framework regions
  • Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the CDRs of a VH are termed HCDR1, HCDR2 and HCDR3, the CDRs of a VL are termed LCDR1, LCDR2 and LCDR3.
  • variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of an antibody comprise the heavy chain constant region (CH) and the light chain constant region (CL), wherein CH can be further subdivided into constant domain CHI, a hinge region, and constant domains CH2 and CH3 (arranged from amino-terminus to carboxy-terminus in the following order: CHI, CH2, CH3).
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Antibodies may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
  • immunoglobulin relates to proteins of the immunoglobulin superfamily, such as to antigen receptors such as antibodies or the B cell receptor (BCR).
  • the immunoglobulins are characterized by a structural domain, i.e., the immunoglobulin domain, having a characteristic immunoglobulin (Ig) fold.
  • the term encompasses membrane bound immunoglobulins as well as soluble immunoglobulins.
  • Membrane bound immunoglobulins are also termed surface immunoglobulins or membrane immunoglobulins, which are generally part of the BCR. Soluble immunoglobulins are generally termed antibodies.
  • Immunoglobulins generally comprise several chains, typically two identical heavy chains and two identical light chains which are linked via disulfide bonds.
  • immunoglobulin domains such as the VL (variable light chain) domain, CL (constant light chain) domain, VH (variable heavy chain) domain, and the CH (constant heavy chain) domains CHI, CH2, CH3, and CH4.
  • immunoglobulin heavy chains There are five types of mammalian immunoglobulin heavy chains, i.e., a, 8, e, y, and p which account for the different classes of antibodies, i.e., IgA, IgD, IgE, IgG, and IgM.
  • the heavy chains of membrane or surface immunoglobulins comprise a transmembrane domain and a short cytoplasmic domain at their carboxy-terminus.
  • the immunoglobulin chains comprise a variable region and a constant region.
  • the constant region is essentially conserved within the different isotypes of the immunoglobulins, wherein the variable part is highly divers and accounts for antigen recognition.
  • vaccination and “immunization” describe the process of treating an individual for therapeutic or prophylactic reasons and relate to the procedure of administering one or more immunogen(s) or antigen(s) or derivatives thereof, in particular in the form of RNA (especially mRNA) coding therefor, as described herein to an individual and stimulating an immune response against said one or more immunogen(s) or antigen(s) or cells characterized by presentation of said one or more immunogen(s) or antigen(s).
  • RNA especially mRNA
  • cell characterized by presentation of an antigen or “cell presenting an antigen” or “MHC molecules which present an antigen on the surface of an antigen presenting cell” or similar expressions is meant a cell such as a diseased cell, in particular a tumor cell or an infected cell, or an antigen presenting cell presenting the antigen or an antigen peptide, either directly or following processing, in the context of MHC molecules, such as MHC class I and/or MHC class II molecules.
  • the MHC molecules are MHC class I molecules.
  • allergen refers to a kind of antigen which originates from outside the body of a subject (/.e., the allergen can also be called “heterologous antigen”) and which produces an abnormally vigorous immune response in which the immune system of the subject fights off a perceived threat that would otherwise be harmless to the subject.
  • allergen usually is an antigen which is able to stimulate a type-1 hypersensitivity reaction in atopic individuals through immunoglobulin E (IgE) responses.
  • IgE immunoglobulin E
  • allergens include allergens derived from peanut proteins (e.g., Ara h 2.02), ovalbumin, grass pollen proteins (e.g., Phi p 5), and proteins of dust mites (e.g., Der p 2).
  • peanut proteins e.g., Ara h 2.02
  • ovalbumin e.g., ovalbumin
  • grass pollen proteins e.g., Phi p 5
  • proteins of dust mites e.g., Der p 2
  • growth factors refers to molecules which are able to stimulate cellular growth, proliferation, healing, and/or cellular differentiation. Typically, growth factors act as signaling molecules between cells.
  • growth factors include particular cytokines and hormones which bind to specific receptors on the surface of their target cells.
  • growth factors examples include bone morphogenetic proteins (BMPs), fibroblast growth factors (FGFs), vascular endothelial growth factors (VEGFs), such as VEGFA, epidermal growth factor (EGF), insulin-like growth factor, ephrins, macrophage colony-stimulating factor, granulocyte colony- stimulating factor, granulocyte macrophage colony-stimulating factor, neuregulins, neurotrophins (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF)), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS) (anti- apoptotic survival factor), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factors (transforming growth factor alpha (TGF-a), transforming growth factor beta (TGF-0)), and tumor necrosis factor-alpha (TNF-a).
  • BMPs bone morphogenetic proteins
  • protease inhibitors refers to molecules, in particular peptides or polypeptides, which inhibit the function of proteases.
  • Protease inhibitors can be classified by the protease which is inhibited (e.g., aspartic protease inhibitors) or by their mechanism of action (e.g., suicide inhibitors, such as serpins).
  • protease inhibitors include serpins, such as alpha 1-antitrypsin, aprotinin, and bestatin.
  • enzymes refers to macromolecular biological catalysts which accelerate chemical reactions. Like any catalyst, enzymes are not consumed in the reaction they catalyze and do not alter the equilibrium of said reaction. Unlike many other catalysts, enzymes are much more specific. In some embodiments, an enzyme is essential for homeostasis of a subject, e.g., any malfunction (in particular, decreased activity which may be caused by any of mutation, deletion or decreased production) of the enzyme results in a disease. Examples of enzymes include herpes simplex virus type 1 thymidine kinase (HSV1-TK), hexosaminidase, phenylalanine hydroxylase, pseudocholinesterase, and lactase.
  • HSV1-TK herpes simplex virus type 1 thymidine kinase
  • hexosaminidase hexosaminidase
  • phenylalanine hydroxylase phenylalanine hydroxylase
  • pseudocholinesterase pseudocholineste
  • receptors refers to protein molecules which receive signals (in particular chemical signals called ligands) from outside a cell.
  • signals in particular chemical signals called ligands
  • the binding of a signal (e.g., ligand) to a receptor causes some kind of response of the cell, e.g., the intracellular activation of a kinase.
  • Receptors include transmembrane receptors (such as ion channel-linked (ionotropic) receptors, G protein-linked (metabotropic) receptors, and enzyme-linked receptors) and intracellular receptors (such as cytoplasmic receptors and nuclear receptors).
  • receptors include steroid hormone receptors, growth factor receptors, and peptide receptors (i.e., receptors whose ligands are peptides), such as P-selectin glycoprotein ligand-1 (PSGL-1).
  • PSGL-1 P-selectin glycoprotein ligand-1
  • growth factor receptors refers to receptors which bind to growth factors.
  • apoptosis regulators refers to molecules, in particular peptides or polypeptides, which modulate apoptosis, i.e., which either activate or inhibit apoptosis.
  • Apoptosis regulators can be grouped into two broad classes: those which modulate mitochondrial function and those which regulate caspases.
  • the first class includes proteins (e.g., BCL-2, BCL-xL) which act to preserve mitochondrial integrity by preventing loss of mitochondrial membrane potential and/or release of pro-apoptotic proteins such as cytochrome C into the cytosol.
  • proapoptotic proteins e.g., BAX, BAK, BIM
  • the second class includes proteins such as the inhibitors of apoptosis proteins (e.g., XIAP) or FLIP which block the activation of caspases.
  • transcription factors relates to proteins which regulate the rate of transcription of genetic information from DNA to messenger RNA, in particular by binding to a specific DNA sequence. Transcription factors may regulate cell division, cell growth, and cell death throughout life; cell migration and organization during embryonic development; and/or in response to signals from outside the cell, such as a hormone. Transcription factors contain at least one DNA-binding domain which binds to a specific DNA sequence, usually adjacent to the genes which are regulated by the transcription factors. Particular examples of transcription factors include MECP2, FOXP2, FOXP3, the STAT protein family, and the HOX protein family.
  • tumor suppressor proteins relates to molecules, in particular peptides or polypeptides, which protect a cell from one step on the path to cancer.
  • Tumor-suppressor proteins (usually encoded by corresponding tumor-suppressor genes) exhibit a weakening or repressive effect on the regulation of the cell cycle and/or promote apoptosis.
  • Their functions may be one or more of the following: repression of genes essential for the continuing of the cell cycle; coupling the cell cycle to DNA damage (as long as damaged DNA is present in a cell, no cell division should take place); initiation of apoptosis, if the damaged DNA cannot be repaired; metastasis suppression (e.g., preventing tumor cells from dispersing, blocking loss of contact inhibition, and inhibiting metastasis); and DNA repair.
  • tumor- suppressor proteins include p53, phosphatase and tensin homolog (PTEN), SWI/SNF (SWItch/Sucrose Non-Fermentable), von Hippel-Lindau tumor suppressor (pVHL), adenomatous polyposis coli (APC), CD95, suppression of tumorigenicity 5 (ST5), suppression of tumorigenicity 5 (ST5), suppression of tumorigenicity 14 (ST14), and Yippee-like 3 (YPEL3).
  • the term "structural proteins” refers to proteins which confer stiffness and rigidity to otherwise-fluid biological components.
  • Structural proteins are mostly fibrous (such as collagen and elastin) but may also be globular (such as actin and tubulin). Usually, globular proteins are soluble as monomers, but polymerize to form long, fibers which, for example, may make up the cytoskeleton.
  • Other structural proteins are motor proteins (such as myosin, kinesin, and dynein) which are capable of generating mechanical forces, and surfactant proteins.
  • Particular examples of structural proteins include collagen, surfactant protein A, surfactant protein B, surfactant protein C, surfactant protein D, elastin, tubulin, actin, and myosin.
  • reprogramming factors or "reprogramming transcription factors” relates to molecules, in particular peptides or polypeptides, which, when expressed in somatic cells optionally together with further agents such as further reprogramming factors, lead to reprogramming or de-differentiation of said somatic cells to cells having stem cell characteristics, in particular pluripotency.
  • reprogramming factors include OCT4, SOX2, c-MYC, KLF4, LIN28, and NANOG.
  • genomic engineering proteins relates to proteins which are able to insert, delete or replace DNA in the genome of a subject.
  • genomic engineering proteins include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly spaced short palindromic repeat-CRISPR-associated protein 9 (CRISPR-Cas9).
  • blood proteins relates to peptides or polypeptides which are present in blood plasma of a subject, in particular blood plasma of a healthy subject.
  • Blood proteins have diverse functions such as transport (e.g., albumin, transferrin), enzymatic activity (e.g., thrombin or ceruloplasmin), blood clotting (e.g., fibrinogen), defense against pathogens (e.g., complement components and immunoglobulins), protease inhibitors (e.g., alpha 1- antitrypsin), etc.
  • blood proteins include thrombin, serum albumin, Factor VII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator, protein C, von Willebrand factor, antithrombin III, glucocerebrosidase, erythropoietin, granulocyte colony stimulating factor (G-CSF), modified Factor VIII, and anticoagulants.
  • the pharmaceutically active peptide or polypeptide is (i) a cytokine, preferably selected from the group consisting of erythropoietin (EPO), interleukin 4 (IL-2), and interleukin 10 (IL-11), more preferably EPO; (ii) an adhesion molecule, in particular an integrin; (iii) an immunoglobulin, in particular an antibody; (iv) an immunologically active compound, in particular an antigen, such as a viral or bacterial antigen, e.g., an antigen of SARS-CoV-2, e.g., a spike (S) protein of SARS-CoV-2 or a variant thereof; (v) a hormone, in particular vasopressin, insulin or growth hormone; (vi) a growth factor, in particular VEGFA; (vii) a protease inhibitor, in particular alpha 1-antitrypsin; (viii) an enzyme, preferably selected from the group consisting of herpe
  • EPO ery
  • a pharmaceutically active peptide or polypeptide comprises one or more antigens or one or more epitopes, i.e., administration of the peptide or polypeptide to a subject elicits an immune response against the one or more antigens or one or more epitopes in a subject which may be therapeutic or partially or fully protective.
  • the RNA encodes at least one epitope, e.g., at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes.
  • the target antigen is a tumor antigen and the antigenic sequence (e.g., an epitope) is derived from the tumor antigen.
  • the tumor antigen may be a "standard” antigen, which is generally known to be expressed in various cancers.
  • the tumor antigen may also be a "neo-antigen", which is specific to an individual's tumor and has not been previously recognized by the immune system.
  • a neo-antigen or neo-epitope may result from one or more cancer-specific mutations in the genome of cancer cells resulting in amino acid changes.
  • the vaccine antigen preferably comprises an epitope or a fragment of said neo-antigen comprising one or more amino acid changes.
  • tumor antigens include, without limitation, p53, ART-4, BAGE, beta-catenin/m, Bcr-abL CAMEL, CAP-1 , CASP-8, CDC27/m, CDK4/m, CEA, the cell surface proteins of the claudin family, such as CLAUDIN-6, CLAUDIN-18.2 and CLAUDIN-12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, Gap 100, HAGE, HER-2/neu, HPV-E7, HPV-E6, HAST- 2, hTERT (or hTRT), LAGE, LDLR/FUT, MAGE-A, preferably MAGE-A1 , MAGE-A2, MAGE- A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A 10, MAGE-A 1 1, or MAGE
  • cancer mutations vary with each individual. Thus, cancer mutations that encode novel epitopes (neo-epitopes) represent attractive targets in the development of vaccine compositions and immunotherapies.
  • the efficacy of tumor immunotherapy relies on the selection of cancer-specific antigens and epitopes capable of inducing a potent immune response within a host.
  • RNA can be used to deliver patient-specific tumor epitopes to a patient.
  • Dendritic cells (DCs) residing in the spleen represent antigen-presenting cells of particular interest for RNA expression of immunogenic epitopes or antigens such as tumor epitopes.
  • the use of multiple epitopes has been shown to promote therapeutic efficacy in tumor vaccine compositions.
  • Rapid sequencing of the tumor mutanome may provide multiple epitopes for individualized vaccines which can be encoded by RNA (in particular, mRNA) described herein, e.g., as a single polypeptide wherein the epitopes are optionally separated by linkers.
  • the RNA in particular, mRNA
  • the RNA encodes at least one epitope, at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes.
  • Exemplary embodiments include RNA (in particular, mRNA) that encodes at least five epitopes (termed a "pentatope”) and RNA (in particular, mRNA) that encodes at least ten epitopes (termed a "decatope”).
  • the antigen or epitope is derived from a pathogen-associated antigen, in particular from a viral antigen.
  • the antigen or epitope is derived from a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof.
  • the RNA e.g., mRNA, used in the present disclosure encodes an amino acid sequence comprising a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof.
  • the antigen or epitope is derived from a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof.
  • the RNA (in particular, mRNA) described in the present disclosure encodes an amino acid sequence comprising a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof.
  • the coronavirus is MERS- CoV.
  • the coronavirus is SARS-CoV.
  • the coronavirus is SARS-CoV-2.
  • immunologically equivalent means that the immunologically equivalent molecule such as the immunologically equivalent amino acid sequence exhibits the same or essentially the same immunological properties and/or exerts the same or essentially the same immunological effects, e.g., with respect to the type of the immunological effect.
  • immunologically equivalent is preferably used with respect to the immunological effects or properties of antigens or antigen variants used for immunization.
  • an amino acid sequence is immunologically equivalent to a reference amino acid sequence if said amino acid sequence when exposed to the immune system of a subject induces an immune reaction having a specificity of reacting with the reference amino acid sequence.
  • a molecule which is immunologically equivalent to an antigen exhibits the same or essentially the same properties and/or exerts the same or essentially the same effects regarding the stimulation, priming and/or expansion of T cells as the antigen to which the T cells are targeted.
  • RNA described herein comprises one or more miRNA binding sequences.
  • the one or more miRNA binding sequences function to recruit one or more miRNA molecules expressed, e.g., selectively expressed, in one or more cell or tissue types in which expression of the RNA is not desired.
  • the one or more miRNA molecules target the RNA thereby modulating (e.g., inhibiting) the translation of the target RNA or destabilizing the target RNA.
  • the one or more miRNA molecules are not present or are present in a lower amount in one or more cell or tissue types in which expression of the RNA is desired.
  • one or more miRNAs endogenously present in one or more cell or tissue types in which expression of the RNA is not desired can target RNA possessing one or more binding sites for the one or more miRNAs.
  • the miRNAs are expressed or are selectively expressed in one or more cell or tissue types in which expression of the RNA is not desired.
  • MicroRNAs are small ( ⁇ 20-25 nt) noncoding RNAs that are abundant in cells and function as crucial regulators of gene expression. The canonical model of miRNA biogenesis is tightly controlled by multiple enzymes that produce three major RNA products: primary (pri- ), precursor (pre-), and mature miRNA.
  • Mature miRNA originates from the 5' arm or the 3' arm of the precursor product and is denoted with a -5p or -3p suffix, respectively. Either one of the arms is incorporated into the RNA induced silencing complex (RISC) and becomes functional, whereas the other arm is a byproduct and is degraded, or both mature miR-5p and miR-3p arms of a pre-miRNA can be associated with the RISC.
  • RISC RNA induced silencing complex
  • tissues where miRNA are known to regulate mRNA, and thereby protein expression include, but are not limited to, endothelial cells (miR-126, miR-17-92), hepatocytes (miR-122, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, miR-4783-3p), muscle (miR-208, miR-133, miR-206), hematopoietic cells (miR-142-3p, miR-142-5p, miR-16, miR-223-3p, miR-150-5p, miR-650, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).
  • endothelial cells miR-126
  • RNA can be repressed in one or more selected tissues by incorporating one or more binding sites for one or more miRNAs known to be present in the selected tissue(s).
  • the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR- 122, miR-142-3p, miR-206, miR-208, miR-216, miR-217, miR-16-5p, miR-223-3p, miR-150-5p, miR-650, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, or miR-4783-3p.
  • the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, miR-206, miR-208, miR-216, or miR-217. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, or miR-206. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR- 126-5p, miR-126-3p, miR-122, or miR-142-3p. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p or miR-126-3p.
  • Human miR-126 (also known as miR-126-3p) and its complement, miR-126* (also known as miR-126-5p) originate from the same precursor, and their locus is hosted by intron-7 of the Egfl7 (epidermal grow factor-like domain 7) gene on chromosome 9.
  • MiR-126-3p and miR- 126-5p are expressed in endothelial cells, throughout capillaries as well as larger blood vessels.
  • Human miR-122 is encoded at a single genomic locus in chromosome 18, and miR-122 (more particularly miR-122-5p) is highly expressed in the liver.
  • Human miR-142 (particularly miR-142-3p and miR-142-5p) is encoded in chromosome 17, and is highly expressed in hematopoietic cells.
  • the RNA described herein comprising one or more miRNA binding sequences comprises one or more miRNA binding sequences that are complementary to one or more miRNAs.
  • An RNA can comprise any number of miRNA binding sequences (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or more). 2 or more miRNA binding sequences may be more potent at repressing gene expression of RNA than a single miRNA binding sequence. Limitations on the size of the RNA make it practical for 1, 2 or 3 miRNA binding sequences to be present. Where the RNA contains multiple miRNA binding sequences, each of the miRNA binding sequences can bind to the same or a different miRNA, or a combination thereof.
  • the RNA described herein comprising one or more miRNA binding sequences comprises one miRNA binding sequence. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises two miRNA binding sequences. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises three miRNA binding sequences. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises four miRNA binding sequences. In some embodiments, the miRNA binding sequences bind to the same miRNA, to different miRNAs, or a combination thereof. In some embodiments, the miRNA binding sequences bind to the same miRNA. In some embodiments, the miRNA binding sequences are linked together in series in the RNA.
  • a miRNA binding sequence can be of any length sufficient to recruit the desired miRNA.
  • the miRNA binding sequence is about 5 to about 25 nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 nucleotides).
  • a miRNA binding sequence can have any amount of complementarity with its cognate miRNA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 complementary nucleotides).
  • the miRNA binding sequence is engineered to comprise specific combinations of Watson-Crick base pairs and mismatches with its cognate miRNA binding partner.
  • the miRNA binding sequence is an exact Watson-Crick complement of the miRNA, i.e., it is fully complementary with its cognate miRNA.
  • An RNA can comprise one or more miRNA binding sequences at any portion of the RNA, as long as the position of the one or more miRNA binding sequences does not interfere with proper expression of a pharmaceutically active peptide or polypeptide.
  • the one or more miRNA binding sequences are present in the 3' UTR of a target RNA. In some embodiments, the one or more miRNA binding sequences are present between the open reading frame and the 3' UTR of a target RNA.
  • the one or more cell or tissue types in which expression of the RNA is not desired comprises endothelial cells or endothelial tissues.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of mir-126, e.g., miR-126-5p and/or miR- 126-3p, miR-216a, miR-217 or a combination thereof.
  • the one or more cell or tissue types in which expression of the RNA is not desired comprises myocardial cells or myocardial tissues.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of miR-208b, miR-499a or a combination thereof.
  • the one or more cell or tissue types in which expression of the RNA is not desired comprises hematopoietic cells, e.g., immune cells, or hematopoietic tissues, e.g., immune tissues.
  • the immune cells comprise dendritic cells and/or macrophages, e.g., Kupffer cells.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of miR-142-3p, miR-16, miR-223, miR-451, miR-150 or a combination thereof.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-142- 3p.
  • the one or more cell or tissue types in which expression of the RNA is not desired comprises hepatic cells or hepatic tissues.
  • the hepatic cells comprise hepatocytes.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-122.
  • the one or more cell or tissue types in which expression of the RNA is not desired comprises muscle cells or muscle tissues.
  • the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-206.
  • the miRNA species and the corresponding binding sequences that may be used herein include species selected from the group shown in the table below.
  • an RNA described here comprises a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR-122, or a multiple thereof, e.g., a sequence wherein a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR-122 is repeated 2 times, 3 times, or even more.
  • a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR- 122, or a multiple thereof is located between the open reading frame and the 3' UTR.
  • an RNA described here comprises a binding sequence for miR-126-5p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-5p is repeated 2 times, 3 times, or even more.
  • a binding sequence for miR-126-5p or a multiple thereof is located between the open reading frame and the 3' UTR.
  • an RNA described here comprises a binding sequence for miR-126-3p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-3p is repeated 2 times, 3 times, or even more.
  • a binding sequence for miR-126-3p or a multiple thereof is located between the open reading frame and the 3' UTR.
  • an RNA described here comprises a binding sequence for miR-126-5p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-5p is repeated 2 times, 3 times, or even more, and a binding sequence for miR-126-3p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-3p is repeated 2 times, 3 times, or even more.
  • a binding sequence for miR-126-5p or a multiple thereof, and a binding sequence for miR-126-3p or a multiple thereof is located between the open reading frame and the 3' UTR.
  • RNA described herein may be delivered for therapeutic applications described herein using any appropriate methods known in the art, including, e.g., delivery as naked RNA, or delivery mediated by delivery vehicles.
  • the RNA is delivered to a target cell or target organ. In some embodiments, at least a portion of the RNA is delivered to the cytosol of the target cell.
  • the RNA is RNA (in particular, mRNA) encoding a peptide or polypeptide and the RNA is translated by the target cell to produce the peptide or polypeptide.
  • the target cell is a cell in the liver. In some embodiments, the target cell is a muscle cell. In some embodiments the target cell is a tumor cell or a cell in the tumor microenvironment.
  • the target cell is a blood cell. In some embodiments, the target cell is a cell in the lymph nodes. In some embodiments, the target cell is a cell in the lung. In some embodiments, the target cell is a cell in the skin. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen. In some embodiments, the target cell is a T cell. In some embodiments, the target cell is a B cell. In some embodiments, the target cell is a NK cell. In some embodiments, the target cell is a monocyte. Thus, RNA (in particular, mRNA) compositions/formulations described herein may be used for delivering RNA to such target cell.
  • RNA in particular, mRNA compositions/formulations described herein may be used for delivering RNA to such target cell.
  • the disclosure involves targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen.
  • Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA (in particular, mRNA) administered is RNA (in particular, mRNA) encoding an antigen or epitope for inducing an immune response.
  • the target cell is a spleen cell.
  • the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen.
  • the target cell is a dendritic cell in the spleen.
  • the "lymphatic system” is part of the circulatory system and an important part of the immune system, comprising a network of lymphatic vessels that carry lymph.
  • the lymphatic system consists of lymphatic organs, a conducting network of lymphatic vessels, and the circulating lymph.
  • the primary or central lymphoid organs generate lymphocytes from immature progenitor cells.
  • the thymus and the bone marrow constitute the primary lymphoid organs.
  • Secondary or peripheral lymphoid organs which include lymph nodes and the spleen, maintain mature naive lymphocytes and initiate an adaptive immune response.
  • RNA-based RNA delivery systems may be useful for obtaining RNA expression in the liver. Liver accumulation is caused by the discontinuous nature of the hepatic vasculature or the lipid metabolism (liposomes and lipid or cholesterol conjugates).
  • the target organ for RNA expression is liver and the target tissue is liver tissue.
  • the delivery to such target tissue is preferred, in particular, if presence of RNA or of the encoded peptide or polypeptide in this organ or tissue is desired and/or if it is desired to express large amounts of the encoded peptide or polypeptide and/or if systemic presence of the encoded peptide or polypeptide, in particular in significant amounts, is desired or required.
  • RNA may be administered with one or more delivery vehicles that protect the RNA from degradation, maximize delivery to on-target cells and minimize exposure to off-target cells.
  • RNA delivery vehicles may complex or encapsulate RNA and include a range of materials, including polymers and lipids.
  • such RNA delivery vehicles may form particles with RNA.
  • RNA in particular mRNA, described herein may be present in particles comprising (i) the RNA, and (ii) at least one cationic or cationically ionizable compound such as a polymer or lipid complexing the RNA. Electrostatic interactions between positively charged molecules such as polymers and lipids and negatively charged RNA are involved in particle formation. This results in complexation and spontaneous formation of RNA particles.
  • RNA containing particles have been described previously to be suitable for delivery of RNA in particulate form (cf., e.g., Kaczmarek, J. C. et al., 2017, Genome Medicine 9, 60).
  • nanoparticle encapsulation of RNA physically protects RNA from degradation and, depending on the specific chemistry, can aid in cellular uptake and endosomal escape.
  • the term "particle” relates to a structured entity formed by molecules or molecule complexes, in particular particle forming compounds.
  • the particle contains an envelope (e.g., one or more layers or lamellas) made of one or more types of amphiphilic substances (e.g., amphiphilic lipids).
  • amphiphilic substance means that the substance possesses both hydrophilic and lipophilic properties.
  • the envelope may also comprise additional substances (e.g., additional lipids) which do not have to be amphiphilic.
  • the particle may be a monolameliar or multilamellar structure, wherein the substances constituting the one or more layers or lamellas comprise one or more types of amphiphilic substances (in particular selected from the group consisting of amphiphilic lipids) optionally in combination with additional substances (e.g., additional lipids) which do not have to be amphiphilic.
  • the term "particle” relates to a micro- or nano-sized structure, such as a micro- or nano-sized compact structure. According to the present disclosure, the term “particle” includes nanoparticles.
  • RNA particle can be used to deliver RNA to a target site of interest (e.g., cell, tissue, organ, and the like).
  • An RNA particle may be formed from lipids comprising at least one cationic or cationically ionizable lipid. Without intending to be bound by any theory, it is believed that the cationic or cationically ionizable lipid combines together with the RNA to form aggregates, and this aggregation results in colloidally stable particles.
  • RNA particles described herein include lipid nanoparticle (LNP)-based and lipoplex (LPX)-based formulations.
  • a lipoplex (LPX) described herein is obtainable from mixing two aqueous phases, namely a phase comprising RNA and a phase comprising a dispersion of lipids.
  • the lipid phase comprises liposomes.
  • liposomes are self-closed unilamellar or multilamellar vesicular particles wherein the lamellae comprise lipid bilayers and the encapsulated lumen comprises an aqueous phase.
  • a prerequisite for using liposomes for nanoparticle formation is that the lipids in the mixture as required are able to form lamellar (bilayer) phases in the applied aqueous environment.
  • liposomes comprise unilamellar or multilamellar phospholipid bilayers enclosing an aqueous core (also referred to herein as an aqueous lumen). They may be prepared from materials possessing polar head (hydrophilic) groups and nonpolar tail (hydrophobic) groups.
  • cationic lipids employed in formulating liposomes designed for the delivery of RNA are amphiphilic in nature and consist of a positively charged (cationic) amine head group linked to a hydrocarbon chain or cholesterol derivative via glycerol.
  • lipoplexes are multilamellar liposome-based formulations that form upon electrostatic interaction of cationic liposomes with RNAs.
  • formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA-lipoplexes.
  • an LPX particle comprises an amphiphilic lipid, in particular cationic or cationically ionizable amphiphilic lipid, and RNA (especially mRNA) as described herein.
  • electrostatic interactions between positively charged liposomes made from one or more amphiphilic lipids, in particular cationic or cationically ionizable amphiphilic lipids
  • negatively charged RNA especially mRNA results in complexation and spontaneous formation of RNA lipoplex particles.
  • Positively charged liposomes may be generally synthesized using a cationic or cationically ionizable amphiphilic lipid, such as DOTMA and/or DODMA, and optionally additional lipids, such as DOPE or DSPC.
  • a cationic or cationically ionizable amphiphilic lipid such as DOTMA and/or DODMA
  • additional lipids such as DOPE or DSPC.
  • a lipid nanoparticle is typically obtainable from direct mixing of RNA in an aqueous phase with lipids in a phase comprising an organic solvent, such as ethanol.
  • lipids or lipid mixtures can be used for particle formation, which do not form lamellar (bilayer) phases in water.
  • LNPs comprise or consist of a cationic/cationically ionizable lipid and helper lipids such as phospholipids, cholesterol, and/or polymer-conjugated lipids (e.g., polyethylene glycol (PEG) lipids).
  • helper lipids such as phospholipids, cholesterol, and/or polymer-conjugated lipids (e.g., polyethylene glycol (PEG) lipids).
  • PEG polyethylene glycol
  • RNA e.g., mRNA
  • RNA e.g., mRNA
  • the RNA may be adhered to the outer surface of the particle (surface RNA (especially surface mRNA)) and/or may be contained in the particle (encapsulated RNA (especially encapsulated mRNA)).
  • the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of about 10 to about 2000 nm, such as at least about 15 nm (e.g., at least about 20 nm, at least about 25 nm, at least about 30 nm, at least about 35 nm, at least about 40 nm, at least about 45 nm, at least about 50 nm, at least about 55 nm, at least about 60 nm, at least about 65 nm, at least about 70 nm, at least about 75 nm, at least about 80 nm, at least about 85 nm, at least about 90 nm, at least about 95 nm, or at least about 100 nm) and/or at most about 1900 nm (e.g., at most about 1800 nm, at most about 1700 nm, at most about 1600 nm, at most about 1500 nm, at most about 1400
  • the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm.
  • the particles (e.g., LNPs and LPXs) described herein have an average diameter that in some embodiments ranges from about 50 nm to about 1000 nm, from about 50 nm to about 800 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 450 nm, from about 50 nm to about 400 nm, from about 50 nm to about 350 nm, from about 50 nm to about 300 nm, from about 50 nm to about 250 nm, from about 50 nm to about 200 nm, from about 100 nm to about 1000 nm, from about 100 nm to about 800 nm, from about 100 nm to about 700 nm, from about 100 nm to about 600 nm, from about 100 nm to about 500 nm, from about 100 nm to about 450
  • the particles e.g., LNPs and LPXs
  • the particles have an average diameter that in some embodiments ranges from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm.
  • RNA particles (especially mRNA particles) described herein may exhibit a polydispersity index (PDI) less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.2, less than about 0.1, or less than about 0.05.
  • PDI polydispersity index
  • the RNA particles can exhibit a polydispersity index in a range of about 0.01 to about 0.4 or about 0.1 to about 0.3.
  • the N/P ratio gives the ratio of the nitrogen groups in the lipid to the number of phosphate groups in the RNA. It is correlated to the charge ratio, as the nitrogen atoms (depending on the pH) are usually positively charged and the phosphate groups are negatively charged.
  • the N/P ratio where a charge equilibrium exists, depends on the pH. Lipid formulations may be formed at N/P ratios larger than four up to twelve, because positively charged nanoparticles can be favorable for transfection. In that case, RNA is considered to be completely bound to nanoparticles.
  • compositions comprising RNA (especially mRNA) and at least one cationic or cat ionically ionizable lipid which associates with the RNA to form RNA particles and formulations comprising such particles.
  • the RNA particles may comprise RNA which is complexed in different forms by non-covalent interactions to the particle.
  • the particles described herein are not viral particles, in particular infectious viral particles, i.e., they are not able to virally infect cells.
  • Suitable cationic or cationically ionizable lipids are those that form RNA particles and are included by the term "particle forming components" or "particle forming agents".
  • the term "particle forming components” or “particle forming agents” relates to any components which associate with RNA to form RNA particles. Such components include any component which can be part of RNA particles.
  • RNA particles (especially mRNA particles) comprise more than one type of RNA molecules, where the molecular parameters of the RNA molecules may be similar or different from each other, like with respect to molar mass or fundamental structural elements such as molecular architecture, capping, coding regions or other features,
  • each RNA species is separately formulated as an individual particulate formulation.
  • each individual particulate formulation will comprise one RNA species.
  • the individual particulate formulations may be present as separate entities, e.g. in separate containers.
  • Such formulations are obtainable by providing each RNA species separately (typically each in the form of an RNA-containing solution) together with a particle-forming agent, thereby allowing the formation of particles.
  • Respective particles will contain exclusively the specific RNA species that is being provided when the particles are formed (individual particulate formulations).
  • a composition such as a pharmaceutical composition comprises more than one individual particle formulation.
  • Respective pharmaceutical compositions are referred to as mixed particulate formulations.
  • Mixed particulate formulations according to the present disclosure are obtainable by forming, separately, individual particulate formulations, followed by a step of mixing of the individual particulate formulations.
  • a formulation comprising a mixed population of RNA-containing particles is obtainable.
  • Individual particulate populations may be together in one container, comprising a mixed population of individual particulate formulations.
  • all RNA species of the pharmaceutical composition are formulated together as a combined particulate formulation.
  • Such formulations are obtainable by providing a combined formulation (typically combined solution) of all RNA species together with a particle-forming agent, thereby allowing the formation of particles.
  • a combined particulate formulation will typically comprise particles which comprise more than one RNA species. In a combined particulate composition different RNA species are typically present together in a single particle.
  • polymers are commonly used materials for nanoparticle-based delivery.
  • cationic polymers are used to electrostatically condense the negatively charged RNA into nanoparticles.
  • These positively charged groups often consist of amines that change their state of protonation in the pH range between 5.5 and 7.5, thought to lead to an ion imbalance that results in endosomal rupture.
  • Polymers such as poly-L-lysine, polyamidoamine, protamine and polyethyleneimine, as well as naturally occurring polymers such as chitosan have all been applied to nucleic acid delivery and are suitable as cationic polymers herein.
  • some investigators have synthesized polymers specifically for nucleic acid delivery. Poly(
  • Such synthetic polymers are also suitable as cationic polymers herein.
  • a "polymer,” as used herein, is given its ordinary meaning, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds.
  • the repeat units can all be identical, or in some cases, there can be more than one type of repeat unit present within the polymer.
  • the polymer is biologically derived, i.e., a biopolymer such as a protein.
  • additional moieties can also be present in the polymer, for example targeting moieties.
  • the polymer is said to be a "copolymer.” It is to be understood that the polymer being employed herein can be a copolymer.
  • the repeat units forming the copolymer can be arranged in any fashion. For example, the repeat units can be arranged in a random order, in an alternating order, or as a "block" copolymer, i.e., comprising one or more regions each comprising a first repeat unit (e.g., a first block), and one or more regions each comprising a second repeat unit (e.g., a second block), etc.
  • Block copolymers can have two (a diblock copolymer), three (a triblock copolymer), or more numbers of distinct blocks.
  • the polymer is biocompatible.
  • Biocompatible polymers are polymers that typically do not result in significant cell death at moderate concentrations.
  • the biocompatible polymer is biodegradable, i.e., the polymer is able to degrade, chemically and/or biologically, within a physiological environment, such as within the body.
  • polymer may be protamine or polyalkyleneimine.
  • protamine refers to any of various strongly basic proteins of relatively low molecular weight that are rich in arginine and are found associated especially with DNA in place of somatic histones in the sperm cells of various animals (as fish).
  • protamine refers to proteins found in fish sperm that are strongly basic, are soluble in water, are not coagulated by heat, and yield chiefly arginine upon hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin.
  • protamine as used herein is meant to comprise any protamine amino acid sequence obtained or derived from natural or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof as well as (synthesized) polypeptides which are artificial and specifically designed for specific purposes and cannot be isolated from native or biological sources.
  • the polyalkyleneimine comprises polyethylenimine and/or polypropylenimine, preferably polyethyleneimine.
  • a preferred polyalkyleneimine is polyethyleneimine (PEI).
  • the average molecular weight of PEI is preferably 0.75-10 2 to 10 7 Da, preferably 1000 to 10 5 Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.
  • linear polyalkyleneimine such as linear polyethyleneimine (PEI).
  • Cationic polymers contemplated for use herein include any cationic polymers which are able to electrostatically bind nucleic acid.
  • cationic polymers contemplated for use herein include any cationic polymers with which nucleic acid can be associated, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.
  • Particles described herein may also comprise polymers other than cationic polymers, i.e., non- cationic polymers and/or anionic polymers. Collectively, anionic and neutral polymers are referred to herein as non-cationic polymers.
  • lipid and "lipid-like material” are broadly defined herein as molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also frequently denoted as amphiphiles. Lipids are usually insoluble or poorly soluble in water, but soluble in many organic solvents. In an aqueous environment, the amphiphilic nature allows the molecules to self-assemble into organized structures and different phases. One of those phases consists of lipid bilayers, as they are present in vesicles, multilamellar/unilamellar liposomes, or membranes in an aqueous environment.
  • Hydrophobicity can be conferred by the inclusion of apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s).
  • the hydrophilic groups may comprise polar and/or charged groups and include carbohydrates, phosphate, carboxylic, sulfate, amino, sulfhydryl, nitro, hydroxyl, and other like groups.
  • hydrophobic refers to any a molecule, moiety or group which is substantially immiscible or insoluble in aqueous solution.
  • hydrophobic group includes hydrocarbons having at least 6 carbon atoms.
  • the monovalent radical of a hydrocarbon is referred to as hydrocarbyl herein.
  • the hydrophobic group can have functional groups (e.g., ether, ester, halide, etc.) and atoms other than carbon and hydrogen as long as the group satisfies the condition of being substantially immiscible or insoluble in aqueous solution.
  • hydrocarbon includes non-cyclic, e.g., linear (straight) or branched, hydrocarbyl groups, such as alkyl, alkenyl, or alkynyl as defined herein. It should be appreciated that one or more of the hydrogen atoms in alkyl, alkenyl, or alkynyl may be substituted with other atoms, e.g., halogen, oxygen or sulfur. Unless stated otherwise, hydrocarbon groups can also include a cyclic (alkyl, alkenyl or alkynyl) group or an aryl group, provided that the overall polarity of the hydrocarbon remains relatively nonpolar.
  • alkyl refers to a saturated linear or branched monovalent hydrocarbon moiety which may have one to thirty, typically one to twenty, often six to eighteen carbon atoms.
  • exemplary nonpolar alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, hexyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl, and the like.
  • alkenyl refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon-carbon double bond in which the total carbon atoms may be six to thirty, typically six to twenty often six to eighteen.
  • the maximal number of carbon-carbon double bonds in the alkenyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenyl group by 2 and, if the number of carbon atoms in the alkenyl group is uneven, rounding the result of the division down to the next integer.
  • the maximum number of carbon-carbon double bonds is 4.
  • the alkenyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.
  • alkynyl refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon-carbon triple bond in which the total carbon atoms may be six to thirty, typically six to twenty, often six to eighteen.
  • Alkynyl groups can optionally have one or more carbon-carbon double bonds.
  • the maximal number of carbon-carbon triple bonds in the alkynyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkynyl group by 2 and, if the number of carbon atoms in the alkynyl group is uneven, rounding the result of the division down to the next integer.
  • the maximum number of carbon-carbon triple bonds is 4.
  • the alkynyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, more preferably 1 or 2 carbon-carbon triple bonds.
  • alkylene refers to a saturated linear or branched divalent hydrocarbon moiety which may have one to thirty, typically two to twenty, often four to twelve carbon atoms.
  • exemplary nonpolar alkylene groups include, but are not limited to, methylene, ethylene, trimethylene, hexamethylene, decamethylene, dodecamethylene, tetradecamethylene, hexadecamethylene, octadecmethylene, and the like.
  • alkenylene refers to a linear or branched divalent hydrocarbon moiety having at least one carbon-carbon double bond in which the total carbon atoms may be two to thirty, typically two to twenty, often four to twelve.
  • the maximal number of carbon- carbon double bonds in the alkenylene group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenylene group by 2 and, if the number of carbon atoms in the alkenylene group is uneven, rounding the result of the division down to the next integer.
  • the maximum number of carbon-carbon double bonds is 4.
  • the alkenylene group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.
  • cycloalkyl represents cyclic non-aromatic versions of “alkyl” and "alkenyl” with preferably 3 to 14 carbon atoms, such as 3 to 12 or 3 to 10 carbon atoms, i.e., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 carbon atoms (such as 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms), more preferably 3 to 7 carbon atoms.
  • Exemplary cycloalkyl groups include cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, cyclononyl, cyclononenyl, cylcodecyl, cylcodecenyl, and adamantyl.
  • the cycloalkyl group may consist of one ring (monocyclic), two rings (bicyclic), or more than two rings (polycyclic).
  • aryl refers to a monoradical of an aromatic cyclic hydrocarbon.
  • the aryl group contains 3 to 14 (e.g., 5, 6, 7, 8, 9, or 10, such as 5, 6, or 10) carbon atoms which can be arranged in one ring (e.g., phenyl) or two or more condensed rings (e.g., naphthyl).
  • exemplary aryl groups include cyclopropenylium, cyclopentadienyl, phenyl, indenyl, naphthyl, azulenyl, fluorenyl, anthryl, and phenanthryl.
  • aryl refers to a monocyclic ring containing 6 carbon atoms or an aromatic bicyclic ring system containing 10 carbon atoms. Preferred examples are phenyl and naphthyl. Aryl does not encompass fullerenes.
  • aromatic as used in the context of hydrocarbons means that the whole molecule has to be aromatic.
  • a monocyclic aryl is hydrogenated (either partially or completely) the resulting hydrogenated cyclic structure is classified as cycloalkyl for the purposes of the present disclosure.
  • a bi- or polycyclic aryl such as naphthyl
  • the resulting hydrogenated bi- or polycyclic structure is classified as cycloalkyl for the purposes of the present disclosure (even if one ring, such as in 1,2-dihydronaphthyl, is still aromatic).
  • amphiphilic refers to a molecule having both a polar portion and a non-polar portion. Often, an amphiphilic compound has a polar head attached to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the non- polar portion is insoluble in water. In addition, the polar portion may have either a formal positive charge, or a formal negative charge. Alternatively, the polar portion may have both a formal positive and a negative charge, and be a zwitterion or inner salt.
  • the amphiphilic compound can be, but is not limited to, one or a plurality of natural or non-natural lipids and lipid-like compounds.
  • lipid-like material lipid-like compound or “lipid-like molecule” relates to substances, in particular amphiphilic substances, that structurally and/or functionally relate to lipids but may not be considered as lipids in a strict sense.
  • the term includes compounds that are able to form amphiphilic layers as they are present in vesicles, multilamellar/unilamellar liposomes, or membranes in an aqueous environment and includes surfactants, or synthesized compounds with both hydrophilic and hydrophobic moieties.
  • the term includes molecules, which comprise hydrophilic and hydrophobic moieties with different structural organization, which may or may not be similar to that of lipids.
  • lipid-like compounds capable of spontaneous integration into cell membranes include functional lipid constructs such as synthetic function-spacer-lipid constructs (FSL), synthetic function-spacer-sterol constructs (FSS) as well as artificial amphipathic molecules.
  • FSL synthetic function-spacer-lipid constructs
  • FSS synthetic function-spacer-sterol constructs
  • Lipids comprising two long alkyl chains and a polar head group are generally cylindrical. The area occupied by the two alkyl chains is similar to the area occupied by the polar head group.
  • Such lipids have low solubility as monomers and tend to aggregate into planar bilayers that are water insoluble.
  • Traditional surfactant monomers comprising only one linear alkyl chain and a hydrophilic head group are generally cone shaped. The hydrophilic head group tends to occupy more molecular space than the linear alkyl chain.
  • surfactants tend to aggregate into spherical or elliptoid micelles that are water soluble. While lipids also have the same general structure as surfactants - a polar hydrophilic head group and a nonpolar hydrophobic tail - lipids differ from surfactants in the shape of the monomers, in the type of aggregates formed in solution, and in the concentration range required for aggregation. As used herein, the term "lipid” is to be construed to cover both lipids and lipid-like materials unless otherwise indicated herein or clearly contradicted by context.
  • lipids may be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides (derived from condensation of ketoacyl subunits), sterol lipids and prenol lipids (derived from condensation of isoprene subunits).
  • lipid is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides.
  • Lipids also encompass molecules such as fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as steroids, i.e., sterol-containing metabolites such as cholesterol or a derivative thereof.
  • cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.
  • Fatty acids, or fatty acid residues are a diverse group of molecules made of a hydrocarbon chain that terminates with a carboxylic acid group; this arrangement confers the molecule with a polar, hydrophilic end, and a nonpolar, hydrophobic end that is insoluble in water.
  • the carbon chain typically between four and 24 carbons long, may be saturated or unsaturated, and may be attached to functional groups containing oxygen, halogens, nitrogen, and sulfur. If a fatty acid contains a double bond, there is the possibility of either a cis or trans geometric isomerism, which significantly affects the molecule's configuration. Cis-double bonds cause the fatty acid chain to bend, an effect that is compounded with more cis double bonds in the chain.
  • Glycerolipids are composed of mono-, di-, and tri-substituted glycerols, the best-known being the fatty acid triesters of glycerol, called triglycerides.
  • triacylglycerol is sometimes used synonymously with "triglyceride”.
  • the three hydroxyl groups of glycerol are each esterified, typically by different fatty acids.
  • Additional subclasses of glycerolipids are represented by glycosylglycerols, which are characterized by the presence of one or more sugar residues attached to glycerol via a glycosidic linkage.
  • the glycerophospholipids are amphipathic molecules (containing both hydrophobic and hydrophilic regions) that contain a glycerol core linked to two fatty acid-derived "tails" by ester linkages and to one "head” group by a phosphate ester linkage.
  • Examples of glycerophospholipids usually referred to as phospholipids (though sphingomyelins are also classified as phospholipids) are phosphatidylcholine (also known as PC, GPCho or lecithin), phosphatidylethanolamine (PE or GPEtn) and phosphatidylserine (PS or GPSer).
  • Sphingolipids are a complex family of compounds that share a common structural feature, a sphingoid base backbone.
  • the major sphingoid base in mammals is commonly referred to as sphingosine.
  • Ceramides N-acyl-sphingoid bases
  • the fatty acids are typically saturated or mono- unsaturated with chain lengths from 16 to 26 carbon atoms.
  • the major phosphosphingolipids of mammals are sphingomyelins (ceramide phosphocholines), whereas insects contain mainly ceramide phosphoethanolamines and fungi have phytoceramide phosphoinositols and mannose-containing headgroups.
  • glycosphingolipids are a diverse family of molecules composed of one or more sugar residues linked via a glycosidic bond to the sphingoid base. Examples of these are the simple and complex glycosphingolipids such as cerebrosides and gangliosides.
  • Sterol lipids such as cholesterol and its derivatives, or tocopherol and its derivatives, are an important component of membrane lipids, along with the glycerophospholipids and sphingomyelins.
  • Saccharolipids describe compounds in which fatty acids are linked directly to a sugar backbone, forming structures that are compatible with membrane bilayers.
  • a monosaccharide substitutes for the glycerol backbone present in glycerolipids and glycerophospholipids.
  • the most familiar saccharolipids are the acylated glucosamine precursors of the Lipid A component of the lipopolysaccharides in Gram-negative bacteria.
  • Typical lipid A molecules are disaccharides of glucosamine, which are derivatized with as many as seven fatty-acyl chains.
  • the minimal lipopolysaccharide required for growth in E. coli is Kdo2-Lipid A, a hexa-acylated disaccharide of glucosamine that is glycosylated with two 3-deoxy-D-manno-octulosonic acid (Kdo) residues.
  • Polyketides are synthesized by polymerization of acetyl and propionyl subunits by classic enzymes as well as iterative and multimodular enzymes that share mechanistic features with the fatty acid synthases. They comprise a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal and marine sources, and have great structural diversity. Many polyketides are cyclic molecules whose backbones are often further modified by glycosylation, methylation, hydroxylation, oxidation, or other processes.
  • lipids and lipid-like materials may be cationic, anionic or neutral.
  • Neutral lipids or lipid-like materials exist in an uncharged or neutral zwitterionic form at a selected pH.
  • the RNA compositions and formulations and RNA particles described herein comprise at least one cationic or cationically ionizable lipid as particle forming agent.
  • Cationic or cationically ionizable lipids contemplated for use herein include any cationic or cationically ionizable lipids (including lipid-like materials) which are able to electrostatically bind nucleic acid.
  • cationic or cationically ionizable lipids contemplated for use herein can be associated with nucleic acid, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.
  • a "cationic lipid” refers to a lipid or lipid-like material having a net positive charge. Cationic lipids bind negatively charged nucleic acid by electrostatic interaction. Generally, cationic lipids possess a lipophilic moiety, such as a sterol, an acyl chain, a diacyl or more acyl chains, and the head group of the lipid typically carries the positive charge. In some embodiments, a cationic lipid has a net positive charge only at certain pH, in particular acidic pH, while it has preferably no net positive charge, preferably has no charge, i.e., it is neutral, at a different, preferably higher pH such as physiological pH. This ionizable behavior is thought to enhance efficacy through helping with endosomal escape and reducing toxicity as compared with particles that remain cationic at physiological pH.
  • a “cationically ionizable lipid” refers to a lipid or lipid-like material which has a net positive charge or is neutral, i.e., which is not permanently cationic. Thus, depending on the pH of the composition in which the cationically ionizable lipid is solved, the cationically ionizable lipid is either positively charged or neutral. For purposes of the present disclosure, cationically ionizable lipids are covered by the term “cationic lipid” unless contradicted by the circumstances.
  • the cationic or cationically ionizable lipid comprises a head group which includes at least one nitrogen atom (N) which is positive charged or capable of being protonated, e.g., under physiological conditions.
  • cationic or cationically ionizable lipids include, but are not limited to N,N- dimethyl-2,3-dioleyloxypropylamine (DODMA), l,2-dioleoyl-3-trimethylammonium propane (DOTAP); l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N— (N',N Z - dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB); l,2-dioleoyl-3-dimethylammonium-propane (DODAP); l,2-diacyloxy-3- dimethylammonium propanes; l,2-dialkyloxy-3-dimethylammonium propanes; dioctadecyldimethyl ammonium chloride (DODAC), l,2-disteary
  • Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4- dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin- MC3-DMA), N-(2-Hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propanaminium bromide
  • the cationic or cationically ionizable lipid is DOTMA. In some embodiments, the cationic or cationically ionizable lipid is DODMA.
  • DOTMA is a cationic lipid with a quaternary amine headgroup.
  • the structure of DOTMA may be represented as follows:
  • DODMA is an ionizable cationic lipid with a tertiary amine headgroup.
  • the structure of DODMA may be represented as follows:
  • the cationic or cationically ionizable lipid may comprise from about 10 mol % to about 95 mol %, from about 20 mol % to about 95 mol %, from about 20 mol % to about 90 mol %, from about 30 mol % to about 90 mol %, from about 40 mol % to about 90 mol %, or from about 40 mol % to about 80 mol % of the total lipid present in the particle.
  • RNA compositions and formulations and RNA particles described herein may also comprise lipids (including lipid-like materials) other than cationic or cationically ionizable lipids (also collectively referred to herein as cationic lipids), i.e., non-cationic lipids (including non- cationic or non-cationically ionizable lipids or lipid-like materials).
  • cationic lipids also collectively referred to herein as cationic lipids
  • non-cationic lipids including non-cationic or non-cationically ionizable lipids or lipid-like materials.
  • anionic and neutral lipids or lipid-like materials are referred to herein as non-cationic lipids.
  • Optimizing the formulation of RNA particles by addition of other hydrophobic moieties, such as cholesterol and lipids, in addition to a cationic or cationically ionizable lipid may enhance particle stability and efficacy of RNA delivery.
  • One or more additional lipids may or may not affect the overall charge of the RNA particles.
  • the or more additional lipids are a non-cationic lipid or lipid-like material.
  • the non-cationic lipid may comprise, e.g., one or more anionic lipids and/or neutral lipids.
  • an "anionic lipid” refers to any lipid that is negatively charged at a selected pH.
  • a "neutral lipid” refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH.
  • RNA compositions and formulations and RNA particles described herein comprise a cationic or cationically ionizable lipid and one or more additional lipids.
  • the amount of the cationic or cationically ionizable lipid compared to the amount of the one or more additional lipids may affect important RNA particle characteristics, such as charge, particle size, stability, tissue selectivity, and bioactivity of the RNA. Accordingly, in some embodiments, the molar ratio of the cationic or cationically ionizable lipid to the one or more additional lipids is from about 10:0 to about 1:9, about 4:1 to about 1:2, about 4:1 to about 1:1, about 3:1 to about 1:1, or about 3:1 to about 2:1.
  • the one or more additional lipids comprised in the RNA compositions and formulations and RNA particles described herein comprise one or more of the following: neutral lipids, steroids, and combinations thereof.
  • the one or more additional lipids comprise a neutral lipid which is a phospholipid.
  • the phospholipid is selected from the group consisting of phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines and sphingomyelins. Specific phospholipids that can be used include, but are not limited to, phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines or sphingomyelin.
  • Such phospholipids include in particular diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DM PC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-o
  • the neutral lipid is selected from the group consisting of DSPC, DOPC, DMPC, DPPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC. In some embodiments, the neutral lipid is DOPE.
  • the additional lipid comprises one of the following: (1) a phospholipid, (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof.
  • cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.
  • the RNA compositions and formulations and RNA particles described herein comprise (1) a cationic or cationically ionizable lipid, and a phospholipid such as DSPC or DOPE or (2) a cationic or cationically ionizable lipid and a phospholipid such as DSPC or DOPE and cholesterol.
  • the RNA particles (especially the particles comprising mRNA) described herein comprise (1) DOTMA and DOPE, (2) DOTMA, DOPE and cholesterol, (3) DODMA and DOPE or (4) DODMA, DOPE and cholesterol.
  • DSPC is a neutral phospholipid.
  • the structure of DSPC may be represented as follows:
  • DOPE is a neutral phospholipid.
  • the structure of DOPE may be represented as follows:
  • the structure of cholesterol may be represented as follows:
  • RNA compositions and formulations and RNA particles described herein do not include a polymer conjugated lipid such as a pegylated lipid.
  • a polymer conjugated lipid such as a pegylated lipid.
  • pegylated lipid refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.
  • the additional lipid (e.g., one or more phospholipids and/or cholesterol) may comprise from about 0 mol % to about 90 mol %, from about 0 mol % to about 80 mol %, from about 2 mol % to about 80 mol %, from about 5 mol % to about 80 mol %, from about 5 mol % to about 60 mol %, from about 5 mol % to about 50 mol %, from about 7.5 mol % to about 50 mol %, or from about 10 mol % to about 40 mol % of the total lipid present in the particle.
  • the additional lipid (e.g., one or more phospholipids and/or cholesterol) comprises about 10 mol %, about 15 mol %, or about 20 mol % of the total lipid present in the particle.
  • the additional lipid comprises a mixture of: (i) a phospholipid such as DOPE; and (ii) cholesterol or a derivative thereof.
  • the molar ratio of the phospholipid such as DOPE to the cholesterol or a derivative thereof is from about 9:0 to about 1:10, about 2:1 to about 1:4, about 1:1 to about 1:4, or about 1:1 to about 1:3.
  • RNA compositions and formulations and RNA particles described herein may comprise at least one polymer-conjugated lipid.
  • a polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto.
  • a polymer-conjugated lipid is a PEG-conjugated lipid, also referred to herein as pegylated lipid or PEG-lipid.
  • pegylated lipid refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.
  • a polymer-conjugated lipid is a polysarcosine-conjugated lipid, also referred to herein as sarcosinylated lipid or pSar-lipid.
  • the term "sarcosinylated lipid” refers to a molecule comprising both a lipid portion and a polysarcosine portion.
  • a polymer-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer.
  • a polymer-conjugated lipid can reduce its association with serum proteins and/or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.
  • RNA compositions/formulations and RNA particles described herein comprise a PEG-conjugated lipid.
  • the PEG-conjugated lipid is a lipid havingthe structure of the following general formula: or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein: each of R 12 and R 13 is each independently a straight or branched, alkyl or alkenyl chain containing from 10 to 30 carbon atoms, wherein the alkyl/alkenyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.
  • each of R 12 and R 13 is independently a straight alkyl chain containing from 10 to 18 carbon atoms, preferably from 12 to 16 carbon atoms.
  • R 12 and R 13 are identical. In some embodiments, each of R 12 and R 13 is a straight alkyl chain containing 12 carbon atoms. In some embodiments, each of R 12 and R 13 is a straight alkyl chain containing 14 carbon atoms. In some embodiments, each of R 12 and R 13 is a straight alkyl chain containing 16 carbon atoms.
  • R 12 and R 13 are different. In some embodiments, one of R 12 and R 13 is a straight alkyl chain containing 12 carbon atoms and the other of R 12 and R 13 is a straight alkyl chain containing 14 carbon atoms.
  • w has a mean value ranging from 40 to 50, such as a mean value of 45.
  • w is within a range such that the PEG portion of the pegylated lipid has an average molecular weight of from about 400 to about 6000 g/mol, such as from about 1000 to about 5000 g/mol, from about 1500 to about 4000 g/mol, or from about 2000 to about 3000 g/mol.
  • each of R 12 and R 13 is a straight alkyl chain containing 14 carbon atoms and w has a mean value of 45.
  • PEG-conjugated lipids include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2,3- dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2' ,3 '-di(tetradecanoyloxy)propyl-l-O-( ⁇ - methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as ⁇ -methoxy(polyethoxy)ethyl-N-(2,3- di(tetrade
  • the PEG-conjugated lipid is or comprises 2- [(polyethylene glycol)-2000]-N,N-ditetradecylacetamide.
  • the pegylated lipid has the following structure:
  • the PEG-conjugated lipid is DMG-PEG 2000, e.g., having the following structure:
  • the PEG-conjugated lipid has the following structure: wherein n has a mean value ranging from 30 to 60, such as about 50.
  • the PEG-conjugated lipid is PEG2000-C-DMA which preferably refers to 3-N-[(w- methoxy polyethylene glycol)2000)carbamoyl]-l,2-dimyristyloxy-propylamine (MPEG-(2 kDa)-C-DMA) or methoxy-polyethylene glycol-2,3-bis(tetradecyloxy)propylcarbamate (2000).
  • RNA compositions/formulations described herein may comprise one or more PEG-conjugated lipids or pegylated lipids as described in WO 2017/075531 and WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein.
  • the pegylated lipid comprises from about 1 mol % to about 10 mol %, preferably from about 1 mol % to about 5 mol %, more preferably from about 1 mol % to about 2.5 mol % of the total lipid present in the RNA compositions/formulations and RNA particles described herein.
  • the RNA described herein may be present in RNA lipoplex particles.
  • Lipoplexes are electrostatic complexes which are generally formed by mixing preformed cationic lipid liposomes with anionic RNA. Formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA-lipoplexes.
  • the RNA lipoplex particles include both a cationic lipid and an additional lipid.
  • the cationic lipid is DOTMA and the additional lipid is DOPE.
  • the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In specific embodiments, the molar ratio may be about 3:1, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2:1.
  • RNA lipoplex particles described herein have an average diameter that in some embodiments ranges from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 to about 700 nm, from about 400 to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm.
  • the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm.
  • the RNA lipoplex particles have an average diameter that ranges from about 250 nm to about 700 nm. In some embodiments, the RNA lipoplex particles have an average diameter that ranges from about 300 nm to about 500 nm. In an exemplary embodiment, the RNA lipoplex particles have an average diameter of about 400 nm.
  • RNA lipoplex particles and compositions comprising RNA lipoplex particles described herein are useful for delivery of RNA to a target tissue after parenteral administration, in particular after intravenous administration.
  • RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen- presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and/or RNA expression in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in the spleen. In an embodiment, after administration of the RNA lipoplex particles, no or essentially no RNA accumulation and/or RNA expression in the lung and/or liver occurs.
  • RNA lipoplex particles of the disclosure may be used for targeting RNA, e.g., RNA encoding an antigen or at least one epitope, to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen.
  • RNA e.g., RNA encoding an antigen or at least one epitope
  • target cell is a spleen cell.
  • the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen.
  • the target cell is a dendritic cell in the spleen.
  • the electric charge of the RNA lipoplex particles of the present disclosure is the sum of the electric charges present in the at least one cationic lipid and the electric charges present in the RNA.
  • the charge ratio is the ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA.
  • concentration of RNA and the at least one cationic lipid amount can be determined using routine methods by one skilled in the art.
  • the charge ratio of positive charges to negative charges in the RNA lipoplex particles is from about 1.6:2 to about 1:2, or about 1.6:2 to about 1.1:2. In specific embodiments, the charge ratio of positive charges to negative charges in the RNA lipoplex particles at physiological pH is about 1.6:2.0, about 1.5:2.0, about 1.4:2.0, about 1.3:2.0, about 1.2:2.0, about 1.1:2.0, or about 1:2.0.
  • Embodiments of Lipid nanoparticles are provided.
  • RNA described herein is present in the form of lipid nanoparticles (LNPs).
  • LNPs typically comprise four components: cationically ionizable lipid, neutral lipids such as phospholipids, a steroid such as cholesterol, and a polymer-conjugated lipid such as PEG-lipid.
  • LNPs may be prepared by mixing lipids dissolved in ethanol with RNA in an aqueous buffer.
  • the RNA in the RNA LNPs described herein the RNA is bound by cationically ionizable lipid that occupies the central core of the LNP.
  • Polymer-conjugated lipid forms the surface of the LNP, along with phospholipids.
  • cholesterol and cationically ionizable lipid can be distributed throughout the LNP.
  • the LNP comprises one or more cationically ionizable lipids, and one or more stabilizing lipids.
  • Stabilizing lipids include neutral lipids and polymer-conjugated lipids.
  • the LNP comprises a cationically ionizable lipid, a neutral lipid, a steroid, a polymer-conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.
  • the LNP comprises from 35 to 65 mol percent, 40 to 60 mol percent, 40 to 55 mol percent, from 45 to 55 mol percent, or from 45 to 50 mol percent of the cationically ionizable lipid.
  • the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent.
  • the steroid is present in a concentration ranging from 30 to 50 mol percent, from 30 to 45 mol percent, from 35 to 45 mol percent or from 35 to 43 mol percent.
  • the LNP comprises from 1 to 10 mol percent, from 1 to 5 mol percent, or from 1 to 2.5 mol percent of the polymer-conjugated lipid.
  • the LNP comprises from 45 to 55 mol percent of a cationically ionizable lipid; from 5 to 15 mol percent of a neutral lipid; from 30 to 45 mol percent of a steroid; from 1 to 5 mol percent of a polymer-conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.
  • the mol percent is determined based on total mol of lipid present in the lipid nanoparticle. In some embodiments, the mol percent is determined based on total mol of cationically ionizable lipid, neutral lipid, steroid and polymer-conjugated lipid present in the lipid nanoparticle.
  • the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC.
  • the steroid is cholesterol
  • the polymer conjugated lipid is a pegylated lipid, e.g., a pegylated lipid as described above.
  • the cationically ionizable lipid component of the LNPs has the structure of Formula (III):
  • G 1 and G 2 are each independently unsubstituted C1-C12 alkylene or C1-C12 alkenylene;
  • G 3 is C1-C24 alkylene, C1-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;
  • R a is H or C1-C12 alkyl
  • R 1 and R 2 are each independently C6-C24 alkyl or C6-C24 alkenyl;
  • R 4 is C1-C12 alkyl
  • R 5 is H or Ci-C 6 alkyl; and x is 0, 1 or 2.
  • the lipid has one of the following structures (I I IA) or (IIIB):
  • A is a 3 to 8-membered cycloalkyl or cycloalkylene ring
  • R 6 is, at each occurrence, independently H, OH or C1-C24 alkyl; n is an integer ranging from 1 to 15.
  • the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).
  • the lipid has one of the following structures (IIIC) or (HID):
  • the lipid has one of the following structures (HIE) or (HIF):
  • the lipid has one of the following structures (IIIG), (III H), (Illi), or (IIIJ):
  • n is an integer ranging from 2 to 12, for example from 2 to 8 or from 2 to 4.
  • n is 3, 4, 5 or 6.
  • n is 3.
  • n is 4.
  • n is 5.
  • n is 6.
  • y and z are each independently an integer ranging from 2 to 10.
  • y and z are each independently an integer ranging from 4 to 9 or from 4 to 6.
  • R 6 is H. In other of the foregoing embodiments, R 6 is C1-C24 alkyl. In other embodiments, R 6 is OH.
  • G 3 is unsubstituted. In other embodiments, G3 is substituted. In various different embodiments, G 3 is linear C1-C24 alkylene or linear C1-C24 alkenylene.
  • R 1 or R 2 is C6-C24 alkenyl.
  • R 1 and R 2 each, independently have the following structure: wherein:
  • R 7a and R 7b are, at each occurrence, independently H or C1-C12 alkyl; and a is an integer from 2 to 12, wherein R 7a , R 7b and a are each selected such that R 1 and R 2 each independently comprise from 6 to 20 carbon atoms.
  • a is an integer ranging from 5 to 9 or from 8 to 12.
  • At least one occurrence of R 7a is H.
  • R 7a is H at each occurrence.
  • at least one occurrence of R 7b is Ci-Cs alkyl.
  • Ci-Cg alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.
  • R 1 or R 2 has one of the following structures:
  • R 4 is methyl or ethyl.
  • the cationic lipid of Formula (III) has one of the structures set forth in the table below.
  • RNA described herein is formulated in an LNP composition
  • an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-0366, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-0315, a neutral lipid, a steroid, and a polymer conjugated lipid.
  • the neutral lipid is DSPC.
  • the steroid is cholesterol.
  • the polymer conjugated lipid is a pegylated lipid, e.g., DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, a neutral lipid, a steroid, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, a neutral lipid, a steroid, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, a neutral lipid, a steroid, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, a neutral lipid, a steroid, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-O366, a neutral lipid, a steroid, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-0315, a neutral lipid, a steroid, and a pegylated lipid.
  • the neutral lipid is DSPC.
  • the steroid is cholesterol.
  • the pegylated lipid is DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and a pegylated lipid.
  • a cationically ionizable lipid e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and a pegylated lipid.
  • RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and a pegylated lipid.
  • the pegylated lipid is DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and DMG-PEG 2000. In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and DMG-PEG 2000.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and DMG-PEG 2000. In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and DMG-PEG 2000.
  • RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and DMG-PEG 2000.
  • RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and DMG-PEG 2000.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and PEG2000-C-DMA.
  • a cationically ionizable lipid e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and PEG2000-C-DMA.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and PEG2000-C-DMA.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and PEG2000-C-DMA. In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and PEG2000-C-DMA.
  • RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and PEG2000-C-DMA.
  • RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and PEG2000-C-DMA.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and ALC-0159.
  • a cationically ionizable lipid e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and ALC-0159. In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and ALC-0159.
  • RNA described herein is formulated in an LNP composition comprising ALC-O315, DSPC, cholesterol, and ALC-0159.
  • 3D-P-DMA (6Z,16Z)-12-((Z)-dec-4-en-l-yl)docosa-6,16-dien-ll-yl 5-
  • ALC-0366 ((3-hydroxypropyl)azanediyl)bis(nonane-9,l-diyl) bis(2-butyloctanoate)
  • ALC-0315 ((4-hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate) / 6-[N-6-(2- hexyldecanoyloxy)hexyl-N-(4-hydroxybutyl)amino]hexyl 2-hexyldecanoate
  • PEG2000-C-DMA 3-N-[(w-Methoxy polyethylene glycol)2000) carbamoyl]-l,2-dimyristyloxy- propylamine (MPEG-(2 kDa)-C-DMA or Methoxy-polyethylene glycol-2,3- bis(tetradecyloxy)propylcarbamate (2000)) wherein n has a mean value ranging from 30 to 60, such as about 50.
  • ALC-0159 2-[(polyethylene glycol)-2000]-A/,A/-ditetradecylacetamide / 2-[2-(u)-methoxy
  • the N/P value is preferably at least about 4. In some embodiments, the N/P value ranges from 4 to 20, 4 to 12, 4 to 10, 4 to 8, or 5 to 7. In some embodiments, the N/P value is about 6.
  • dose refers in general to a "dose amount” which relates to the amount of RNA administered per administration, i.e., per dosing.
  • administration of RNA of the present disclosure may be performed by single administration or boosted by multiple administrations.
  • an amount the RNA described herein from 0.1 pg to 300 pg, 0.5 pg to 200 pg, or 1 pg to 100 pg, such as about 1 pg, about 3 pg, about 10 pg, about 30 pg, about 50 pg, or about 100 pg may be administered per dose.
  • a regimen described herein includes at least one dose. In some embodiments, a regimen includes a first dose and at least one subsequent dose. In some embodiments, a regimen includes a first dose and two subsequent doses. In some embodiments, the first dose is the same amount as at least one subsequent dose. In some embodiments, the first dose is the same amount as all subsequent doses. In some embodiments, the first dose is a different amount as at least one subsequent dose. In some embodiments, the first dose is a different amount than all subsequent doses. In some embodiments, a regimen comprises two doses. In some embodiments, a regimen consists of two doses. In some embodiments, a regimen comprises three doses. In some embodiments, a regimen consists of three doses.
  • the disclosure envisions administration of a single dose. In one embodiment, the disclosure envisions administration of a priming dose followed by one or more booster doses.
  • additional treatments may be administered to a patient in combination with the treatments described herein.
  • additional treatments include classical cancer therapy, e.g., radiation therapy, surgery, hyperthermia therapy and/or chemotherapy.
  • additional treatments include treatments involving immune checkpoint modulators.
  • Chemotherapy is a type of cancer treatment that uses one or more anti-cancer drugs (chemotherapeutic agents), usually as part of a standardized chemotherapy regimen.
  • chemotherapy has come to connote non-specific usage of intracellular poisons to inhibit mitosis. The connotation excludes more selective agents that block extracellular signals (signal transduction).
  • therapies with specific molecular or genetic targets, which inhibit growth-promoting signals from classic endocrine hormones (primarily estrogens for breast cancer and androgens for prostate cancer) are now called hormonal therapies.
  • other inhibitions of growth-signals like those associated with receptor tyrosine kinases are referred to as targeted therapy.
  • drugs constitutes systemic therapy for cancer in that they are introduced into the blood stream and are therefore in principle able to address cancer at any anatomic location in the body.
  • Systemic therapy is often used in conjunction with other modalities that constitute local therapy (i.e. treatments whose efficacy is confined to the anatomic area where they are applied) for cancer such as radiation therapy, surgery or hyperthermia therapy.
  • chemotherapeutic agents are cytotoxic by means of interfering with cell division (mitosis) but cancer cells vary widely in their susceptibility to these agents. To a large extent, chemotherapy can be thought of as a way to damage or stress cells, which may then lead to cell death if apoptosis is initiated.
  • Chemotherapeutic agents include alkylating agents, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic antibiotics.
  • Alkylating agents have the ability to alkylate many molecules, including proteins, RNA and DNA.
  • the subtypes of alkylating agents are the nitrogen mustards, nitrosoureas, tetrazines, aziridines, cisplatins and derivatives, and non-classical alkylating agents.
  • Nitrogen mustards include mechlorethamine, cyclophosphamide, melphalan, chlorambucil, ifosfamide and busulfan.
  • Nitrosoureas include N-Nitroso-N-methylurea (MNU), carmustine (BCNU), lomustine (CCNU) and semustine (MeCCNU), fotemustine and streptozotocin.
  • Tetrazines include dacarbazine, mitozolomide and temozolomide.
  • Aziridines include thiotepa, mytomycin and diaziquone (AZQ).
  • Cisplatin and derivatives include cisplatin, carboplatin and oxaliplatin. They impair cell function by forming covalent bonds with the amino, carboxyl, sulfhydryl, and phosphate groups in biologically important molecules.
  • Non-classical alkylating agents include procarbazine and hexamethylmelamine. In one particularly preferred embodiment, the alkylating agent is cyclophosphamide.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present disclosure relates to RNA comprising one or more miRNA binding sequences, wherein the one or more miRNA binding sequences bind to miRNA that is present in cells in which expression of the RNA is not desired. Delivering the RNA to cells after administration, in particular after intramuscular or intravenous administration, allows expression of a polypeptide encoded by the RNA in certain cells while expression in other cells is repressed. In some embodiments, such cells comprise endothelial cells. RNA compositions described herein allow expression of a pharmaceutically active peptide or polypeptide by the RNA in a subject while reducing or avoiding the risks of undesired effects resulting from expression of the pharmaceutically active peptide or polypeptide in certain cells or tissues.

Description

RNA FORMULATIONS FOR PHARMACEUTICAL USE
Technical Field
The present disclosure relates to RNA comprising one or more miRNA binding sequences, wherein the one or more miRNA binding sequences bind to miRNA that is present in cells in which expression of the RNA is not desired. Delivering the RNA to cells after administration, in particular after intramuscular or intravenous administration, allows expression of a polypeptide encoded by the RNA in certain cells while expression in other cells is repressed. In some embodiments, such cells comprise endothelial cells. RNA compositions described herein allow expression of a pharmaceutically active peptide or polypeptide by the RNA in a subject while reducing or avoiding the risks of undesired effects resulting from expression of the pharmaceutically active peptide or polypeptide in certain cells or tissues. The present disclosure also relates to methods for delivering RNA to cells of a subject or for treating or preventing a disease or disorder in a subject, wherein the methods comprise administering to a subject a composition of the present disclosure. The RNA compositions in some embodiments comprise single-stranded RNA such as mRNA which encodes a peptide or polypeptide of interest, such as a pharmaceutically active peptide or polypeptide. The RNA is taken up by cells of a subject treated and the RNA is translated into the encoded peptide or polypeptide, which may exhibit its physiological activity. Thus, the present disclosure also relates to methods for delivering a pharmaceutically active peptide or polypeptide to a subject or for treating or preventing a disease or disorder in a subject, wherein the methods comprise administering to a subject an RNA composition of the present disclosure, wherein the RNA encodes the pharmaceutically active peptide or polypeptide.
Background
The use of RNA offers an attractive alternative to DNA in order to circumvent the potential safety risks connected with the therapeutic use of DNA. In v/tro-transcribed RNA (IVT-RNA) is of particular interest in therapeutic approaches. The advantages of a therapeutic use of RNA include transient expression and a non-transforming character. RNA does not need to enter the nucleus in order to be expressed and moreover cannot integrate into the host genome, thereby eliminating the risk of oncogenesis. When used for vaccination, injection of RNA can induce both cellular and humoral immune responses in vivo. A prerequisite for the effectiveness of RNA-based therapeutics is high stability and translation efficiency of the RNA. RNA molecules are intrinsically unstable and their intracellular kinetics depend on the untranslated regions (UTRs) embracing the coding sequence, in particular the 3' UTR elements.
In previous work we have demonstrated that RNA with a 3' UTR comprising segments from the amino-terminal enhancer of split (AES) mRNA (also referred to herein as "F element"; SEQ ID NO: 1) and the mitochondrially encoded 12S ribosomal RNA (mtRNRl) (also referred to herein as "I element"; SEQ ID NO: 2) confers RNA stability and high total protein expression. AES-mtRNRl 3' UTRs were profoundly superior compared to other 3' UTRs (Orlandini von Niessen, A. G. et al. (2019) Molecular therapy: the journal of the American Society of Gene Therapy, 27(4), 824-836; WO 2017/060314).
Although high stability and expression of RNA in target cells and tissues is generally desirable, it may be equally desirable that RNA is not expressed in certain cells and tissues. For example, the expression product may be harmful to certain cells and tissues.
In principle, it is possible to prevent RNA expression in certain cells and tissues by incorporating one or more miRNA binding sequences into the RNA that are specific for miRNA expressed in the cells and tissues in which RNA expression is to be prevented. The one or more miRNA binding sequences function to recruit one or more miRNA molecules expressed, e.g., selectively expressed, in one or more cell or tissue types in which expression of the RNA is not desired. The one or more miRNA molecules target the RNA thereby inhibiting the translation of the target RNA or destabilizing the target RNA.
There is a need of providing formulations for the delivery of pharmaceutically active RNA to cells or tissues of a subject where the delivered RNA is efficiently translated into the peptide or polypeptide it codes for without inducing expression of the pharmaceutically active RNA in cells or tissue in which expression of the RNA is not desired (non-target cells or tissue).
The object of the present invention was to provide RNA that can be used to achieve high levels of expression in target cells and tissues while suppressing expression in non-target cells and tissues, e.g., to prevent toxic effects. In particular, the present study investigated whether inhibition of expression by incorporation of miRNA binding sites is also effective in RNA molecules that have been artificially modified to achieve profoundly increased stability and expression compared to naturally occurring RNA, e.g., by incorporating an AES-mtRNRl 3' UTR. The present discosure observes that suppression of expression of the protein encoded by RNA comprising an AES-mtRNRl 3' UTR in non-target cells or tissue can be achieved by the incorporation into the RNA of one or more miRNA target sites (miRNA binding sequences) that are specific for miRNAs exclusively expressed in non-target cells or tissue. The RNA comprising one or more miRNA binding sequences described herein functions to recruit one or more miRNA molecules in one or more cell or tissue types in which expression of the RNA is not desired, wherein the one or more miRNA molecules target the RNA thereby modulating (e.g., inhibiting) the translation of the target RNA or destabilizing the target RNA. In contrast, in one or more cell or tissue types in which expression of the RNA is desired and in which the one or more miRNA molecules are not present or are present in a lower amount the RNA is efficiently expressed. Thus, in some embodiments, one or more selected endogenous miRNAs can modulate (e.g., silence) gene expression of target RNA possessing one or more binding sites for these miRNAs. In some embodiments, the selected endogenous miRNAs are expressed or selectively expressed in one or more cell or tissue types in which expression of the RNA is not desired. The disclosed RNA allows for cell type-specific or tissue-specific gene modulation (e.g., silencing) by recruitment of one or more miRNAs that are cell type-specific or tissue- specific (e.g., miR-126 which is specific for endothelial cells).
Summary
The present disclosure describes RNA formulations which are useful for RNA delivery in vivo, such as for pharmaceutical application, and methods comprising the administration of RNA to a subject.
The RNA described herein comprises one or more miRNA binding sequences binding to miRNA that is present in cells in which expression of the RNA is not desired. In some embodiments, such cells comprise endothelial cells. The RNA described herein allows expression of a pharmaceutically active peptide or polypeptide by the RNA in a subject while reducing or avoiding the risks uf undesired effects resulting from expression of the pharmaceutically active peptide or polypeptide in certain cells or tissues.
In one aspect, the present disclosure provides a composition or medical preparation comprising RNA, wherein the RNA comprises:
(a) a 5' UTR, (b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) a 3' UTR sequence comprising a first sequence comprising the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO:
2, and
(ii) one or more miRNA binding sequences.
In some embodiments, the RNA comprises at least one of the one or more miRNA binding sequences upstream of the first and second sequences, downstream of the first and second sequences, or downstream of the first sequence and upstream of the second sequence.
In some embodiments, the first sequence is located upstream of the second sequence.
In some embodiments, the 3' UTR sequence comprises the nucleotide sequence of SEQ ID NO:
3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, the RNA comprises at least one of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
In some embodiments, the RNA comprises each of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
In some embodiments, the RNA comprises a nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence.
In some embodiments, the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence (Xl)nCGAX2, wherein XI is any nucleotide, n is 0 to 10, and X2 is G or U. In some embodiments, n is 1 to 6, e.g., 2 or 5.
In some embodiments, the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence CUCGAG or GGAUCCGAU.
In some embodiments, at least one of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired. In some embodiments, each of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired.
In some embodiments, the RNA comprises three or more miRNA binding sequences, wherein the three or more miRNA binding sequences bind to the same or different miRNAs.
In some embodiments, the RNA comprises two or more miRNA binding sequences, wherein the two or more miRNA binding sequences bind to the same or different miRNAs.
In some embodiments, the RNA comprises one miRNA binding sequence.
In some embodiments, the one or more miRNA binding sequences comprise a nucleotide sequence that is an exact Watson-Crick complement of the miRNA.
In some embodiments, the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence gagaccugguccagagucgcuagccgcgucgcu or CUXGAGCUAGC, wherein X is G, C, A, or U.
In some embodiments, the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence CUXGAGCUAGC, wherein X is C, A, or U.
In some embodiments, the nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprises the sequence CUCGAGCUAGC.
In some embodiments, the RNA comprises in the 5’ to 3' direction the 5' UTR, the coding sequence that encodes a polypeptide, the miRNA binding sequence(s), optionally the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence, the 3' UTR sequence, optionally the nucleotide sequence linking the 3' UTR sequence and the poly- A sequence, and the poly-A sequence.
In some embodiments, the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11. In some embodiments, the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, the poly-A sequence is an interrupted sequence of A nucleotides.
In some embodiments, the poly-A sequence comprises at least 100 nucleotides.
In some embodiments, the poly-A sequence comprises or consists of the nucleotide sequence Ax-L-Ay, wherein Ax is a sequence of at least 20 A nucleotides, Ay is a sequence of at least 60 A nucleotides and L is a linker of 1 to 20 nucleotides which may include nucleotides other than A.
In some embodiments, the poly-A sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 4.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1X2X3X4AACUAGU, wherein XI is any nucleotide, preferably A or C, X2 is any nucleotide, preferably A or C, X3 is any nucleotide, preferably C, U or G, and X4 is A or is missing.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGACGAACUAGU.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1AX3AAACUAGU, wherein XI is any nucleotide, preferably A or C, and X3 is any nucleotide, preferably C or U.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGAAUAAACUAGU.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGCACAAACUAGU.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence. In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence. In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence. In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 12.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 10.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 9.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
In some embodiments, the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9.
In some embodiments, at least 90% is at least 95%, 96%, 97%, 98%, or 99%.
In some embodiments, the RNA comprises two or more coding sequences encoding two or more polypeptides.
In some embodiments, the polypeptide is a pharmaceutically active polypeptide.
In some embodiments, the RNA comprises a modified nucleoside in place of uridine.
In some embodiments, the RNA comprises a modified nucleoside in place of each uridine.
In some embodiments, the modified nucleoside is pseudouridine (ip) and/or Nl-methyl- pseudouridine (mlip).
In some embodiments, the modified nucleoside is Nl-methyl-pseudouridine (mlip).
In some embodiments, the RNA comprises a 5' cap.
In some embodiments, the RNA comprises a capl structure.
In some embodiments, the RNA comprises the 5' cap m27'3’’0Gppp(mi2'~°)ApG.
In some embodiments, the RNA is single-stranded RNA.
In some embodiments, the RNA is mRNA.
In some embodiments, the RNA is formulated in a delivery vehicle.
In some embodiments, the RNA is formulated in lipid nanoparticles (LNP).
In some embodiments, lipids that form the lipid nanoparticles comprise a cationic lipid, a polymer-conjugated lipid, a neutral lipid, and a steroid.
In some embodiments, the cationic lipid comprises a cationically ionizable lipid.
In some embodiments, the polymer-conjugated lipid comprises a PEG-conjugated lipid.
In some embodiments, the neutral lipid comprises a phospholipid.
In some embodiments, the steroid comprises cholesterol.
In some embodiments: a. the cationic lipid is present in about 35-65 mol% of the total lipids; b. the polymer-conjugated lipid is present in about 1-5 mol% of the total lipids; c. the neutral lipid is present in about 5-15 mol% of the total lipids; and d. the steroid is present in about 30-50 mol% of the total lipids.
In some embodiments, the lipid nanoparticles have an average size of about 50-150 nm.
In some embodiments, the composition is a pharmaceutical composition.
In some embodiments, the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and/or excipients.
In some embodiments, the medical preparation is a kit.
In some embodiments, the RNA and optionally the particle forming components are in separate vials.
In some embodiments, the composition or medical preparation is for parenteral administration. In some embodiments, the composition or medical preparation is for intramuscular administration. In some embodiments, the composition or medical preparation is for intravenous administration.
In some embodiments, at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in endothelial cells. In some embodiments, the miRNA is miR-126, optionally miR-126-5p or miR-126-3p. In some embodiments, at least one, optionally each, of the miRNA binding sequences comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p). In some embodiments, at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hematopoietic cells, e.g., immune cells. In some embodiments, the immune cells comprise dendritic cells and/or macrophages, e.g., Kupffer cells. In some embodiments, the miRNA is miR-142, optionally miR-142-3p. In some embodiments, at least one, optionally each, of the miRNA binding sequences comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p).
In some embodiments, at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hepatic cells. In some embodiments, the miRNA is miR-122. In some embodiments, at least one, optionally each, of the miRNA binding sequences comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122).
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and (d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 5’ to 31 direction: (a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 5’ to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises: (i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 51 to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises: (i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 51 to 3' direction:
(a) a 5' UTR, (b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides I to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 51 to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and, (ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) one or more, such as two, three, or more than three, preferably one, two or three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the one or more miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 5' to 31 direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction: (a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126- 3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and, (ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides I to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides I to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 51 to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises: (i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
In some embodiments, an RNA described herein comprises in the 51 to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
In some embodiments, an RNA described herein comprises in the 5' to 3' direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
In some embodiments, an RNA described herein comprises in the 5’ to 31 direction:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) three miRNA binding sequences, wherein a miRNA binding sequence comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122), and,
(ii) downstream of the miRNA binding sequences, the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
In one aspect, the present disclosure provides a method of controlling expression of a polypeptide in a subject in a cell type and/or tissue specific manner, the method comprising administering to the subject the composition described herein, wherein the one or more miRNA binding sequences bind to miRNA that is present in one or more cells or tissues of the subject in which expression of the polypeptide is not desired.
In some embodiments, the miRNA is not present in one or more cells or tissues otherthan the one or more cells or tissues in which expression of the polypeptide is not desired or is present in one or more cells or tissues other than the one or more cells or tissues in which expression of the polypeptide is not desired in a lower amount compared to the one or more cells or tissues in which expression of the polypeptide is not desired.
In one aspect, the present disclosure provides a method for treating a subject comprising administering to the subject the composition described herein for expressing the polypeptide in cells of the subject while avoiding expression of the polypeptide in selected cells of the subject, wherein the one or more miRNA binding sequences bind to miRNA that is present in the selected cells.
In some embodiments, the miRNA is not present in cells other than the selected cells or is present in cells other than the selected cells in a lower amount compared to the selected cells. In some embodiments, administration is by parenteral administration. In some embodiments, administration is by intramuscular administration. In some embodiments, administration is by intravenous administration.
Brief description of the Figures
Figure 1: Expression of miR-126-BS mRNAs in HEK293 cells. mRNAs containing miR-126-5p and miR-126-3p binding site were trasfected in HEK293 cells together with correcponding miRNA mimics or non-specific miRNA. The expression of the encoded protein was analyzed by FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
Figure 2: Expression of miR-126-BS mRNAs in HUVEC cells. 126-5p-BS and 126-3p-BS mRNAs together with miRNA mimics were transfected in HUVECs and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
Figure 3: Expression of miR-BS mRNAs containning miR-208b, miR-216a and miR-217 binding sites in HEK293 cells. miR-BS mRNAs together with miRNA mimics were transfected in HEK293 cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
Figure 4: Expression of miR-BS mRNAs containning miR-208b, miR-216a and miR-217 binding sites in HUVEC cells. miR-BS mRNAs together with miRNA mimics were transfected in HUVEC cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
Figure 5: Expression of miR-BS mRNAs containning 1-3 miR-126-5P binding sites at different positions in HEK293 cells. 126-5p-BS mRNAs (1-9, see table in Example 1 for the reference) together with miRNA mimics were transfected in HEK293 cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (top panel) and their mean fluorecence intensity (bottom panel).
Figure 6: Expression of miR-BS mRNAs containning 1-3 miR-126-5P binding sites at different positions in HUVEC cells. miR-BS mRNAs were transfected in HUVEC cells and analyzed for protein expression with FACS after 18h post-transfection: percentage of protein-positive cells (left panel) and their mean fluorecence intensity (right panel).
Figure 7 - (A) Luciferase activity in CHO cells at 24 hours after transfection (by TransIT or lipofectamine) of luciferase-encoding mRNA either with ("luc-miRT-142-3p) or without ("luc") insertion of 4 x miRT-142-3p sequences in the 3'UTR. (B) EPO levels (pg/ml) were measured in the supernatant of human primary cells (hepatocytes (h H EP), dendritic cells (hDCs) or Kupffer cells (hKupffer)) at 24 h after cell transfection with LNP-formulated EPO mRNA containing either 4 tandem repeats of miRT-142-3p (miRT142-3p) or 4 tandem repeats of a scrambled version of the miRT142-3p sequence (miRT-142-3p mix) in the 3'UTR. (C) EPO levels (pg/ml) were measured in the supernatant of different cell cultures (HEK293, CHO, Huh7, hHEP, hDC or hKupffer) at 24 h after cell transfection with LNP-formulated EPO mRNA (Backbone B) containing either 4 x miRT-142-3p (miRT-142-3p) or 4 x scrambled version of the miRT-142-3p sequence (miRT-142-3p mix) in the 3'UTR.
Figure 8 - (A) Luciferase activity in three different cell lines at 24 hours after transfection by TransIT of luciferase-encoding mRNA either with ("+ miR-122T") or without ("- miR-122T") insertion of 4 x miR-122T sequences in the 3'UTR. (B) EPO levels (pg/ml) were measured in the supernatant of human primary cells (hepatocytes (hHEP), dendritic cells (hDC) or Kupffer cells (hKupffer)) at 24 h after cell transfection with LNP-formulated EPO mRNA containing either 4 tandem repeats of miRT-122 (miRT-122) or 4 tandem repeats of a scrambled version of the miRT-122 sequence (miRT-122 mix) in the 3'UTR. (C) EPO levels (pg/ml) were measured in the supernatant of different cell cultures (HEK293, CHO, Huh7, l'Hep, hDC or l'Kupffer) at 24 h after cell transfection with LNP-formulated EPO mRNA (Backbone B) containing either 4 x miRT-122 (miRT-122) or 4 x scrambled version of the miRT-122 sequence (miRT-122 mix) in the 3'UTR.
Figure 9 - Luciferase-encoding IVT mRNA (unmodified (U) or modified (lmtp)), either with or without 4 x miRT-122 in the 3'-UTR, was formulated in LNP and administered to mice by intramuscular injection to deliver the indicated concentrations of mRNA. Luciferase expression levels (Radiance (p/sec/cm3/sr) in the mice were measured 6 hours (6h) and 24 hours (24h) after administration, at two different exposure levels. Figure 10 - EPO levels (pg/ml) were measured in the supernatant of human primary hepatocytes (hHEP) (A) or primary human Kupffer (hKupffer) (B) cells at 24 h after cell transfection with LNP-A formulated EPO-encoding IVT mRNAs containing 4 x miRT-122 or miRT-142-3p, or corresponding scrambled sequences (mix) in the 3'-UTR.
Figure 11 shows that EPO mRNA transcribed from Backbone C is superior to Backbone A but inferior to that derived from Backbone B / Backbone D cassette in vivo.
Figure 12 shows a comparison of mRNA translation derived from Backbones B, C and D with different coding sequences and demonstrates that the differences in performance between Backbone C and Backbone B/D is independent of the coding sequence. A, Firelfly Luciferase mRNAs in Backbones B (•), C(B) and D ( A ) were electroporated two times (solid and dashed lines) in hiDCs. Bright-Glo assay was performed at the times indicated. B, eGFP mRNAs in Backbones C(«) and D (A ) were electroporated in hiDCs twice (solid and dashed lines). Cells were harvested and assayed with FACS for eGFP expression at the times indicated. C, primary human hepatocytes were lipofected with hlL-18 mRNAs in Backbones B (•), C(«) and D (A). Supernatants from transfected cells were collected at the indicated times and assayed for the presence of h IL-18 with ELISA.
Figure 13 shows the translation of Firefly Luciferase mRNAs derived from Backbones B and C containing different nucleotides at position -9 upstream of polyA in hiDCs and demonstrates that the 3' UTR end sequence impacts long-term translation in vitro. Firefly Luciferase mRNAs from Backbones B (panel A) and C (Panel B) having A(A), G(«), T( A ) or C(«) at the position -9 upstream of polyA sequence were electroporated in hiDCs in two separate experiments and Luciferase expression was assayed at the indicated time points.
Figure 14 shows that the 3' UTR end sequence significantly impacts long-term translation in vivo using Backbone B.
Figure 15 shows that the 3' UTR end sequence significantly impacts long-term translation in vivo using Backbone D. Figure 16 -LUC activity (Relative Light Units (RLU)) were measured in the lysates of human primary skeletal muscles (HSkMC) (48h) and human dendritic cells (hDCS)(24h) after cell transfection with TransIT formulated Luc-encoding IVT mRNA or Luc-encoding IVT mRNA containing 4 x miRT-206 in the 3'-UTR.
Description of the Sequences
The following table provides a listing of certain sequences referenced herein.
DESCRIPTION OF THE SEQUENCES
Figure imgf000033_0001
Figure imgf000034_0001
Figure imgf000035_0001
Detailed Description
Although the present disclosure is further described in more detail below, it is to be understood that this disclosure is not limited to the particular methodologies, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present disclosure which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.
In the following, the elements of the present disclosure will be described in more detail. These elements are listed with specific embodiments, however, it should be understood that they may be combined in any manner and in any number to create additional embodiments. The variously described examples and preferred embodiments should not be construed to limit the present disclosure to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed and/or preferred elements. Furthermore, any permutations and combinations of all described elements in this application should be considered disclosed by the description of the present application unless the context indicates otherwise.
The practice of the present disclosure will employ, unless otherwise indicated, conventional chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques which are explained in the literature in the field.
Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated feature, element, member, integer or step or group of features, elements, members, integers or steps but not the exclusion of any other feature, element, member, integer or step or group of features, elements, members, integers or steps. The term "consisting essentially of" limits the scope of a claim or disclosure to the specified features, elements, members, integers, or steps and those that do not materially affect the basic and novel characteristic(s) of the claim or disclosure. The term "consisting of' limits the scope of a claim or disclosure to the specified features, elements, members, integers, or steps. The term "comprising" encompasses the term "consisting essentially of" which, in turn, encompasses the term "consisting of". Thus, at each occurrence in the present application, the term "comprising" may be replaced with the term "consisting essentially of" or "consisting of". Likewise, at each occurrence in the present application, the term "consisting essentially of" may be replaced with the term "consisting of".
The terms "a", "an" and "the" and similar references used in the context of describing the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context.
All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by the context.
The use of any and all examples, or exemplary language (e.g., "such as"), provided herein is intended merely to better illustrate the present disclosure and does not pose a limitation on the scope of the present disclosure otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.
The term "optional" or "optionally" as used herein means that the subsequently described event, circumstance or condition may or may not occur, and that the description includes instances where said event, circumstance, or condition occurs and instances in which it does not occur.
Where used herein, "and/or" is to be taken as specific disclosure of each of the two specified features or components with or without the other. For example, "X and/or Y" is to be taken as specific disclosure of each of (i) X, (ii) Y, and (iii) X and Y, just as if each is set out individually herein.
In the context of the present disclosure, the term "about" denotes an interval of accuracy that the person of ordinary skill will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value by ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05%, and for example ±0.01%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±10%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±5%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±4%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±3%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±2%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±1%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.9%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.8%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.7%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.6%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.5%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.4%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.3%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.2%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.1%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.05%. In some embodiments, "about" indicates deviation from the indicated numerical value by ±0.01%. As will be appreciated by the person of ordinary skill, the specific such deviation for a numerical value for a given technical effect will depend on the nature of the technical effect. For example, a natural or biological technical effect may generally have a larger such deviation than one for a man-made or engineering technical effect.
Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.
Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
It should be noted for unambiguousness that whenever a sequence is referred to as being the sequence between the nucleotide at position x and the nucleotide at position y, the resulting sequence includes both the nucleotide at position x and the nucleotide at position y. Similarly, whenever a sequence is referred to as being the sequence between the amino acid at position x and the amino acid at position y, the resulting sequence includes both the amino acid at position x and the amino acid at position y. Moreover, while the sequences described herein, in particular in the sequence listing, refer to DNA molecules, it is clear that when it is stated in the description or the claims that an RNA comprises a nucleotide sequence as described herein, in particular in the sequence listing, the nucleotide sequence referred to is actually identical to the base-sequence of the DNA molecule described herein, in particular in the sequence listing, e.g., represented in a SEQ ID NO referred to, except that thymine is replaced by uracil.
In the following, definitions and embodiments will be provided which apply to all aspects of the present disclosure. Terms which are defined in the following have the meanings as defined, unless otherwise indicated. Any undefined terms have their art recognized meanings. Terms such as "reduce" or "inhibit" as used herein means the ability to cause an overall decrease, for example, of about 5% or greater, about 10% or greater, about 15% or greater, about 20% or greater, about 25% or greater, about 30% or greater, about 40% or greater, about 50% or greater, or about 75% or greater, in the level. The term "inhibit" or similar phrases includes a complete or essentially complete inhibition, i.e. a reduction to zero or essentially to zero.
Terms such as "enhance" as used herein means the ability to cause an overall increase, or enhancement, for example, by at least about 5% or greater, about 10% or greater, about 15% or greater, about 20% or greater, about 25% or greater, about 30% or greater, about 40% or greater, about 50% or greater, about 75% or greater, or about 100% or greater in the level. "Physiological pH" as used herein refers to a pH of about 7.4. In some embodiments, physiological pH is from 7.3 to 7.5. In some embodiments, physiological pH is from 7.35 to 7.45. In some embodiments, physiological pH is 7.3, 7.35, 7.4, 7.45, or 7.5.
As used in the present disclosure, "% w/v" refers to weight by volume percent, which is a unit of concentration measuring the amount of solute in grams (g) expressed as a percent of the total volume of solution in milliliters (mL).
As used in the present disclosure, "% by weight" refers to weight percent, which is a unit of concentration measuring the amount of a substance in grams (g) expressed as a percent of the total weight of the total composition in grams (g).
As used in the present disclosure, "mol %" is defined as the ratio of the number of moles of one component to the total number of moles of all components, multiplied by 100.
As used in the present disclosure, "mol % of the total lipid" is defined as the ratio of the number of moles of one lipid component to the total number of moles of all lipids, multiplied by 100. In this context, in some embodiments, the term "total lipid" includes lipids and lipid- like material.
The term "ionic strength" refers to the mathematical relationship between the number of different kinds of ionic species in a particular solution and their respective charges. Thus, ionic strength I is represented mathematically by the formula:
Figure imgf000040_0001
in which c is the molar concentration of a particular ionic species and z the absolute value of its charge. The sum 1 is taken over all the different kinds of ions (i) in solution.
According to the disclosure, the term "ionic strength" in some embodiments relates to the presence of monovalent ions. Regarding the presence of divalent ions, in particular divalent cations, their concentration or effective concentration (presence of free ions) due to the presence of chelating agents is, in some embodiments, sufficiently low so as to prevent degradation of the nucleic acid. In some embodiments, the concentration or effective concentration of divalent ions is below the catalytic level for hydrolysis of the phosphodiester bonds between nucleotides such as RNA nucleotides. In some embodiments, the concentration of free divalent ions is 20 pM or less. In some embodiments, there are no or essentially no free divalent ions.
"Osmolality" refers to the concentration of a particular solute expressed as the number of osmoles of solute per kilogram of solvent.
The term "lyophilizing" or "lyophilization" refers to the freeze-drying of a substance by freezing it and then reducing the surrounding pressure (e.g., below 15 Pa, such as below 10 Pa, below 5 Pa, or 1 Pa or less) to allow the frozen medium in the substance to sublimate directly from the solid phase to the gas phase. Thus, the terms "lyophilizing" and "freeze- drying" are used herein interchangeably.
The term "spray-drying" refers to spray-drying a substance by mixing (heated) gas with a fluid that is atomized (sprayed) within a vessel (spray dryer), where the solvent from the formed droplets evaporates, leading to a dry powder.
The term "reconstitute" relates to adding a solvent such as water to a dried product to return it to a liquid state such as its original liquid state. The term "recombinant" in the context of the present disclosure means "made through genetic engineering". In some embodiments, a "recombinant object" in the context of the present disclosure is not occurring naturally.
The term "naturally occurring" as used herein refers to the fact that an object can be found in nature. For example, a peptide or nucleic acid that is present in an organism (including viruses) and can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally occurring. The term "found in nature" means "present in nature" and includes known objects as well as objects that have not yet been discovered and/or isolated from nature, but that may be discovered and/or isolated in the future from a natural source.
As used herein, the terms "room temperature" and "ambient temperature" are used interchangeably herein and refer to temperatures from at least about 15°C, e.g., from about 15°C to about 35°C, from about 15°C to about 30°C, from about 15°C to about 25°C, or from about 17°C to about 22°C. Such temperatures will include 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C and 22°C.
The term "EDTA" refers to ethylenediaminetetraacetic acid disodium salt. All concentrations are given with respect to the EDTA disodium salt.
The term "cryoprotectant" relates to a substance that is added to a formulation in order to protect the active ingredients during the freezing stages.
The term "lyoprotectant" relates to a substance that is added to a formulation in order to protect the active ingredients during the drying stages.
According to the present disclosure, the term "peptide" refers to substances which comprise about two or more, about 3 or more, about 4 or more, about 6 or more, about 8 or more, about 10 or more, about 13 or more, about 16 or more, about 20 or more, and up to about 50, about 100 or about 150, consecutive amino acids linked to one another via peptide bonds. The term "polypeptide" refers to large peptides, in particular peptides having at least about 151 amino acids. However, "peptides" and "polypeptides" are both protein molecules, and, therefore, the terms "peptide", "protein" and "polypeptide" are generally used interchangeably herein. In particular, the term "polypeptide" when used herein generally covers peptides and polypeptides of any length. The term "biological activity" means the response of a biological system to a molecule. Such biological systems may be, for example, a cell or an organism. In some embodiments, such response is therapeutically or pharmaceutically useful.
The term "portion" refers to a fraction. With respect to a particular structure such as an amino acid sequence or protein the term "portion" thereof may designate a continuous or a discontinuous fraction of said structure.
The terms "part" and "fragment" are used interchangeably herein and refer to a continuous element. For example, a part of a structure such as an amino acid sequence or protein refers to a continuous element of said structure. When used in context of a composition, the term "part" means a portion of the composition. For example, a part of a composition may be any portion from 0.1% to 99.9% (such as 0.1%, 0.5%, 1%, 5%, 10%, 50%, 90%, or 99%) of said composition.
"Fragment", with reference to an amino acid sequence (peptide or polypeptide), relates to a part of an amino acid sequence, i.e. a sequence which represents the amino acid sequence shortened at the N-terminus and/or C-terminus. A fragment shortened at the C-terminus (N- terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 3'-end of the open reading frame. A fragment shortened at the N-terminus (C- terminal fragment) is obtainable, e.g., by translation of a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame comprises a start codon that serves to initiate translation. A fragment of an amino acid sequence comprises, e.g., at least 50 %, at least 60 %, at least 70 %, at least 80%, at least 90% of the amino acid residues from an amino acid sequence. A fragment of an amino acid sequence comprises, e.g., at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from an amino acid sequence. A fragment of an amino acid sequence comprises, e.g., a sequence of up to 8, in particular up to 10, up to 12, up to 15, up to 20, up to 30 or up to 55, consecutive amino acids of the amino acid sequence.
"Variant," as used herein and with reference to an amino acid sequence (peptide or polypeptide), is meant an amino acid sequence that differs from a parent amino acid sequence by virtue of at least one amino acid (e.g., a different amino acid, or a modification of the same amino acid). The parent amino acid sequence may be a naturally occurring or wild type (WT) amino acid sequence, or may be a modified version of a wild type amino acid sequence. In some embodiments, the variant amino acid sequence has at least one amino acid difference as compared to the parent amino acid sequence, e.g., from 1 to about 20 amino acid differences, such as from 1 to about 10 or from 1 to about 5 amino acid differences compared to the parent.
By "wild type" or "WT" or "native" herein is meant an amino acid sequence that is found in nature, including allelic variations. A wild type amino acid sequence, peptide or polypeptide has an amino acid sequence that has not been intentionally modified.
For the purposes of the present disclosure, "variants" of an amino acid sequence (peptide or polypeptide) may comprise amino acid insertion variants, amino acid addition variants, amino acid deletion variants and/or amino acid substitution variants. The term "variant" includes all mutants, splice variants, post-translationally modified variants, conformations, isoforms, allelic variants, species variants, and species homologs, in particular those which are naturally occurring. The term "variant" includes, in particular, fragments of an amino acid sequence.
Amino acid insertion variants comprise insertions of single or two or more amino acids in a particular amino acid sequence. In the case of amino acid sequence variants having an insertion, one or more amino acid residues are inserted into a particular site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible. Amino acid addition variants comprise amino- and/or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as by removal of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions may be in any position of the protein. Amino acid deletion variants that comprise the deletion at the N-terminal and/or C-terminal end of the protein are also called N-terminal and/or C- terminal truncation variants. Amino acid substitution variants are characterized by at least one residue in the sequence being removed and another residue being inserted in its place. Preference is given to the modifications being in positions in the amino acid sequence which are not conserved between homologous peptides or polypeptides and/or to replacing amino acids with other ones having similar properties. In some embodiments, amino acid changes in peptide and polypeptide variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains. Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.
In some embodiments the degree of similarity, such as identity between a given amino acid sequence and an amino acid sequence which is a variant of said given amino acid sequence, will be at least about 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the degree of similarity or identity is given for an amino acid region which is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is given, e.g., for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, in some embodiments continuous amino acids. In some embodiments, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. The alignment for determining sequence similarity, such as sequence identity, can be done with art known tools, such as using the best sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.
"Sequence similarity" indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences indicates the percentage of nucleotides that are identical between the sequences.
The terms "% identical" and "% identity" or similar terms are intended to refer, in particular, to the percentage of nucleotides or amino acids which are identical in an optimal alignment between the sequences to be compared. Said percentage is purely statistical, and the differences between the two sequences may be but are not necessarily randomly distributed over the entire length of the sequences to be compared. Comparisons of two sequences are usually carried out by comparing the sequences, after optimal alignment, with respect to a segment or "window of comparison", in order to identify local regions of corresponding sequences. The optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math. 2, 482, with the aid of the local homology algorithm by Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.). In some embodiments, percent identity of two sequences is determined using the BLASTN or BLASTP algorithm, as available on the United States National Center for Biotechnology Information (NCBI) website (e.g., at blast. ncbi.nlm. nih.gov/Blast. cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=blast2seq&LINK_LOC =align2seq). In some embodiments, the algorithm parameters used for BLASTN algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 28; (iii) Max matches in a query range set to 0; (iv) Match/Mismatch Scores set to 1, -2; (v) Gap Costs set to Linear; and (vi) the filter for low complexity regions being used. In some embodiments, the algorithm parameters used for BLASTP algorithm on the NCBI website include: (i) Expect Threshold set to 10; (ii) Word Size set to 3; (iii) Max matches in a query range set to 0; (iv) Matrix set to BLOSUM62; (v) Gap Costs set to Existence: 11 Extension: 1; and (vi) conditional compositional score matrix adjustment.
Percentage identity is obtained by determining the number of identical positions at which the sequences to be compared correspond, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence) and multiplying this result by 100.
In some embodiments, the degree of similarity or identity is given for a region which is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given for at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 nucleotides, in some embodiments continuous nucleotides. In some embodiments, the degree of similarity or identity is given for the entire length of the reference sequence. Homologous amino acid sequences exhibit according to the disclosure at least 40%, in particular at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and, e.g., at least 95%, at least 98 or at least 99% identity of the amino acid residues. The amino acid sequence variants described herein may readily be prepared by the skilled person, for example, by recombinant DNA manipulation. The manipulation of DNA sequences for preparing peptides or polypeptides having substitutions, additions, insertions or deletions, is described in detail in Molecular Cloning: A Laboratory Manual, 4th Edition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012, for example. Furthermore, the peptides, polypeptides and amino acid variants described herein may be readily prepared with the aid of known peptide synthesis techniques such as, for example, by solid phase synthesis and similar methods.
In some embodiments, a fragment or variant of an amino acid sequence (peptide or polypeptide) is a "functional fragment" or "functional variant". The term "functional fragment" or "functional variant" of an amino acid sequence relates to any fragment or variant exhibiting one or more functional properties identical or similar to those of the amino acid sequence from which it is derived, i.e., it is functionally equivalent. With respect to antigens or antigenic sequences, one particular function is one or more immunogenic activities displayed by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant", as used herein, in particular refers to a variant molecule or sequence that comprises an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence and that is still capable of fulfilling one or more of the functions of the parent molecule or sequence, e.g., inducing an immune response. In some embodiments, the modifications in the amino acid sequence of the parent molecule or sequence do not significantly affect or alter the characteristics of the molecule or sequence. In different embodiments, the function of the functional fragment or functional variant may be reduced but still significantly present, e.g., function of the functional fragment or functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the parent molecule or sequence. However, in other embodiments, function of the functional fragment or functional variant may be enhanced compared to the parent molecule or sequence.
An amino acid sequence (peptide or polypeptide) "derived from" a designated amino acid sequence (peptide or polypeptide) refers to the origin of the first amino acid sequence. In some embodiments, the amino acid sequence which is derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof. Amino acid sequences derived from a particular amino acid sequence may be variants of that particular sequence or a fragment thereof. For example, it will be understood by one of ordinary skill in the art that the antigens suitable for use herein may be altered such that they vary in sequence from the naturally occurring or native sequences from which they were derived, while retaining the desirable activity of the native sequences.
In some embodiments, "isolated" means removed (e.g., purified) from the natural state or from an artificial composition, such as a composition from a production process. For example, a nucleic acid, peptide or polypeptide naturally present in a living animal is not "isolated", but the same nucleic acid, peptide or polypeptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid, peptide or polypeptide can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
The term "transfection" relates to the introduction of nucleic acids, in particular RNA, into a cell. For purposes of the present disclosure, the term "transfection" also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such cell, wherein the cell may be present in a subject, e.g., a patient, or the cell may be in vitro, e.g., outside of a patient. Thus, according to the present disclosure, a cell for transfection of a nucleic acid described herein can be present in vitro or in vivo, e.g. the cell can form part of an organ, a tissue and/or the body of a patient. According to the disclosure, transfection can be transient or stable. For some applications of transfection, it is sufficient if the transfected genetic material is only transiently expressed. RNA can be transfected into cells to transiently express its coded protein. Since the nucleic acid introduced in the transfection process is usually not integrated into the nuclear genome, the foreign nucleic acid will be diluted through mitosis or degraded. Cells allowing episomal amplification of nucleic acids greatly reduce the rate of dilution. If it is desired that the transfected nucleic acid actually remains in the genome of the cell and its daughter cells, a stable transfection must occur. Such stable transfection can be achieved by using virus-based systems or transposon-based systems for transfection, for example. Generally, nucleic acid encoding antigen is transiently transfected into cells. RNA can be transfected into cells to transiently express its coded protein.
The disclosure includes analogs of a peptide or polypeptide. According to the present disclosure, an analog of a peptide or polypeptide is a modified form of said peptide or polypeptide from which it has been derived and has at least one functional property of said peptide or polypeptide. E.g., a pharmacological active analog of a peptide or polypeptide has at least one of the pharmacological activities of the peptide or polypeptide from which the analog has been derived. Such modifications include any chemical modification and comprise single or multiple substitutions, deletions and/or additions of any molecules associated with the peptide or polypeptide, such as carbohydrates, lipids and/or peptides or polypeptides. In some embodiments, "analogs" of peptides or polypeptides include those modified forms resulting from glycosylation, acetylation, phosphorylation, amidation, palmitoylation, myristoylation, isoprenylation, lipidation, alkylation, derivatization, introduction of protective/blocking groups, proteolytic cleavage or binding to an antibody or to another cellular ligand. The term "analog" also extends to all functional chemical equivalents of said peptides and polypeptides.
As used herein, the terms "linked", "fused", or "fusion" are used interchangeably. These terms refer to the joining together of two or more elements or components or domains.
As used herein "endogenous" refers to any material from or produced inside an organism, cell, tissue or system.
As used herein, the term "exogenous" refers to any material introduced from or produced outside an organism, cell, tissue or system.
According to various embodiments of the present disclosure, a nucleic acid such as RNA encoding a peptide or polypeptide is taken up by or introduced, i.e. transfected or transduced, into a cell which cell may be present in vitro or in a subject, resulting in expression of said peptide or polypeptide. The cell may, e.g., express the encoded peptide or polypeptide intracellularly (e.g. in the cytoplasm and/or in the nucleus), may secrete the encoded peptide or polypeptide, and/or may express it on the surface. In some embodiments, the cell secretes the encoded peptide or polypeptide.
According to the present disclosure, terms such as "nucleic acid expressing" and "nucleic acid encoding" or similar terms are used interchangeably herein and with respect to a particular peptide or polypeptide mean that the nucleic acid, if present in the appropriate environment, e.g. within a cell, can be expressed to produce said peptide or polypeptide.
In particular, the term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an RNA (in particular, mRNA), to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
An "open reading frame" or "ORF" is a continuous stretch of codons beginning with a start codon and ending with a stop codon.
The term "expression" as used herein includes the transcription and/or translation of a particular nucleotide sequence.
In the context of the present disclosure, the term "transcription" relates to a process, wherein the genetic code in a DNA sequence is transcribed into RNA (especially mRNA). Subsequently, the RNA may be translated into peptide or polypeptide.
With respect to RNA, the term "expression" or "translation" relates to the process in the ribosomes of a cell by which a strand of mRNA directs the assembly of a sequence of amino acids to make a peptide or polypeptide.
A medical preparation, in particular kit, described herein may comprise instructional material or instructions. As used herein, "instructional material" or "instructions" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure. The instructional material of the kit of the present disclosure may, for example, be affixed to a container which contains the compositions/formulations of the present disclosure or be shipped together with a container which contains the compositions/formulations. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compositions be used cooperatively by the recipient.
Prodrugs of a particular compound described herein are those compounds that upon administration to an individual undergo chemical conversion under physiological conditions to provide the particular compound. Additionally, prodrugs can be converted to the particular compound by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the particular compound when, for example, placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent. Exemplary prodrugs are esters (using an alcohol or a carboxy group contained in the particular compound) or amides (using an amino or a carboxy group contained in the particular compound) which are hydrolyzable in vivo. Specifically, any amino group which is contained in the particular compound and which bears at least one hydrogen atom can be converted into a prodrug form. Typical N-prodrug forms include carbamates, Mannich bases, enamines, and enaminones.
In the present specification, a structural formula of a compound may represent a certain isomer of said compound. It is to be understood, however, that the present disclosure includes all isomers such as geometrical isomers, optical isomers based on an asymmetrical carbon, stereoisomers, tautomers and the like which occur structurally and isomer mixtures and is not limited to the description of the formula. Furthermore, in the present specification, a structural formula of a compound may represent a specific salt and/or solvate of said compound. It is to be understood, however, that the present disclosure includes all salts (e.g., pharmaceutically acceptable salts) and solvates (e.g., hydrates) and is not limited to the description of the specific salt and/or solvate.
"Isomers" are compounds having the same molecular formula but differ in structure ("structural isomers") or in the geometrical (spatial) positioning of the functional groups and/or atoms ("stereoisomers"). "Enantiomers" are a pair of stereoisomers which are non- superimposable mirror-images of each other. A "racemic mixture" or "racemate" contains a pair of enantiomers in equal amounts and is denoted by the prefix (±). "Diastereomers" are stereoisomers which are non-superimposable and which are not mirror-images of each other. "Tautomers" are structural isomers of the same chemical substance that spontaneously and reversibly interconvert into each other, even when pure, due to the migration of individual atoms or groups of atoms; i.e., the tautomers are in a dynamic chemical equilibrium with each other. An example of tautomers are the isomers of the keto-enol-tautomerism. "Conformers" are stereoisomers that can be interconverted just by rotations about formally single bonds, and include - in particular - those leading to different 3-dimentional forms of (hetero)cyclic rings, such as chair, half-chair, boat, and twist-boat forms of cyclohexane.
The term "solvate" as used herein refers to an addition complex of a dissolved material in a solvent (such as an organic solvent (e.g., an aliphatic alcohol (such as methanol, ethanol, n- propanol, isopropanol), acetone, acetonitrile, ether, and the like), water or a mixture of two or more of these liquids), wherein the addition complex exists in the form of a crystal or mixed crystal. The amount of solvent contained in the addition complex may be stoichiometric or non-stoichiometric. A "hydrate" is a solvate wherein the solvent is water.
In isotopically labeled compounds one or more atoms are replaced by a corresponding atom having the same number of protons but differing in the number of neutrons. For example, a hydrogen atom may be replaced by a deuterium or tritium atom. Exemplary isotopes which can be used in the present disclosure include deuterium, tritium, nC, 13C, 14C, 15N, 18F, 32P, 32S, 35S, 36CI, and 125l.
The term "average diameter" refers to the mean hydrodynamic diameter of particles as measured by dynamic light scattering (DLS) with data analysis using the so-called cumulant algorithm, which provides as results the so-called Zaverage with the dimension of a length, and the polydispersity index (PDI), which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp 4814-4820, ISO 13321). Here "average diameter", "diameter" or "size" for particles is used synonymously with this value of the Zaverage-
In some embodiments, the "polydispersity index" is calculated based on dynamic light scattering measurements by the so-called cumulant analysis as mentioned in the definition of the "average diameter". Under certain prerequisites, it can be taken as a measure of the size distribution of an ensemble of nanoparticles.
The "radius of gyration" (abbreviated herein as Rg) of a particle about an axis of rotation is the radial distance of a point from the axis of rotation at which, if the whole mass of the particle is assumed to be concentrated, its moment of inertia about the given axis would be the same as with its actual distribution of mass. Mathematically, Rg is the root mean square distance of the particle's components from either its center of mass or a given axis. For example, for a macromolecule composed of n mass elements, of masses m, (i = 1, 2, 3, ..., n), located at fixed distances s, from the center of mass, Rg is the square-root of the mass average of Si2 over all mass elements and can be calculated as follows:
Figure imgf000051_0001
The radius of gyration can be determined or calculated experimentally, e.g., by using light scattering. In particular, for small scattering vectors q the structure function S is defined as follows:
Figure imgf000051_0002
wherein N is the number of components (Guinier's law).
The "hydrodynamic radius" (which is sometimes called "Stokes radius" or "Stokes-Einstein radius") of a particle is the radius of a hypothetical hard sphere that diffuses at the same rate as said particle. The hydrodynamic radius is related to the mobility of the particle, taking into account not only size but also solvent effects. For example, a smaller charged particle with stronger hydration may have a greater hydrodynamic radius than a larger charged particle with weaker hydration. This is because the smaller particle drags a greater number of water molecules with it as it moves through the solution. Since the actual dimensions of the particle in a solvent are not directly measurable, the hydrodynamic radius may be defined by the Stokes-Einstein equation:
Figure imgf000052_0001
wherein k& is the Boltzmann constant; T is the temperature; ή is the viscosity of the solvent; and D is the diffusion coefficient. The diffusion coefficient can be determined experimentally, e.g., by using dynamic light scattering (DLS). Thus, one procedure to determine the hydrodynamic radius of a particle or a population of particles (such as the hydrodynamic radius of particles contained in a sample or control composition as disclosed herein or the hydrodynamic radius of a particle peak obtained from subjecting such a sample or control composition to field-flow fractionation) is to measure the DLS signal of said particle or population of particles (such as DLS signal of particles contained in a sample or control composition as disclosed herein or the DLS signal of a particle peak obtained from subjecting such a sample or control composition to field-flow fractionation).
The expression "light scattering" as used herein refers to the physical process where light is forced to deviate from a straight trajectory by one or more paths due to localized non- uniformities in the medium through which the light passes.
The term "UV" means ultraviolet and designates a band of the electromagnetic spectrum with a wavelength from 10 nm to 400 nm, i.e., shorter than that of visible light but longer than X- rays.
The expression "multi-angle light scattering" or "MALS" as used herein relates to a technique for measuring the light scattered by a sample into a plurality of angles. "Multi-angle" means in this respect that scattered light can be detected at different discrete angles as measured, for example, by a single detector moved over a range including the specific angles selected or an array of detectors fixed at specific angular locations. In certain embodiments, the light source used in MALS is a laser source (MALLS: multi-angle laser light scattering). Based on the MALS signal of a composition comprising particles and by using an appropriate formalism (e.g., Zimm plot, Berry plot, or Debye plot), it is possible to determine the radius of gyration (Rg) and, thus, the size of said particles. Preferably, the Zimm plot is a graphical presentation using the following equation:
Figure imgf000053_0001
wherein c is the mass concentration of the particles in the solvent (g/mL); A2 is the second virial coefficient (mol-mL/g2); P(&) is a form factor relating to the dependence of scattered light intensity on angle; Ro is the excess Rayleigh ratio (cm 1); and K* is an optical constant that is equal to 4n2q0 (dn/dc)2Xo'4A/A -1, where q0 is the refractive index of the solvent at the incident radiation (vacuum) wavelength, Ao is the incident radiation (vacuum) wavelength (nm), N& is Avogadro's number (mol 1), and dn/dc is the differential refractive index increment (mL/g) (cf., e.g., Buchholz et al. (Electrophoresis 22 (2001), 4118-4128); B.H. Zimm (J. Chem. Phys. 13 (1945), 141; P. Debye (J. Appl. Phys. 15 (1944): 338; and W. Burchard (Anal. Chem. 75 (2003), 4279-4291). Preferably, the Berry plot is calculated using the following term or the reciprocal thereof:
Figure imgf000053_0002
wherein c, Ro and K* are as defined above. Preferably, the Debye plot is calculated using the following term or the reciprocal thereof:
Figure imgf000053_0003
wherein c, Ro and K* are as defined above.
The expression "dynamic light scattering" or "DLS" as used herein refers to a technique to determine the size and size distribution profile of particles, in particular with respect to the hydrodynamic radius of the particles. A monochromatic light source, usually a laser, is shot through a polarizer and into a sample. The scattered light then goes through a second polarizer where it is detected and the resulting image is projected onto a screen. The particles in the solution are being hit with the light and diffract the light in all directions. The diffracted light from the particles can either interfere constructively (light regions) or destructively (dark regions). This process is repeated at short time intervals and the resulting set of speckle patterns are analyzed by an autocorrelator that compares the intensity of light at each spot over time.
The expression "static light scattering" or "SLS" as used herein refers to a technique to determine the size and size distribution profile of particles, in particular with respect to the radius of gyration of the particles, and/or the molar mass of particles. A high-intensity monochromatic light, usually a laser, is launched in a solution containing the particles. One or many detectors are used to measure the scattering intensity at one or many angles. The angular dependence is needed to obtain accurate measurements of both molar mass and size for all macromolecules of radius. Hence simultaneous measurements at several angles relative to the direction of incident light, known as multi-angle light scattering (MALS) or multi-angle laser light scattering (MALLS), is generally regarded as the standard implementation of static light scattering.
As used herein, the term "microRNA" or "miRNA" refer to the class of naturally occurring, small, non-coding RNA molecules, about 19-25 such as about 21-25 nucleotides in length, that bind to a polynucleotide, e.g., RNA, comprising one or more miRNA binding sequences and function to modulate gene expression in a variety of ways, including translational repression, RNA cleavage, and deadenylation.
As used herein, the term "miRNA binding sequence" refers to a sequence in a polynucleotide, e.g., an oligoribonucleotide sequence in RNA, e.g., mRNA, or analogue thereof, having a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of a miRNA. A miRNA binding sequence may be present in the 5' UTR, 3'UTR, or a combination thereof. In some embodiments, a miRNA binding sequence is present in the 3'UTR. In some embodiments, a miRNA binding sequence has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a miRNA binding sequence has sufficient complementarity to a miRNA to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA-mediated translational repression or degradation of the polynucleotide. In some embodiments, a miRNA binding sequence having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RlSC)-mediated cleavage of RNA, e.g., mRNA.
As used herein, the term "oligonucleotide" refers to a polymer of nucleotides comprising naturally occurring nucleotides, non-naturally occurring nucleotides, derivatized nucleotides, or a combination thereof. Non-limiting examples of nucleotides, and derivatives thereof, are set forth herein.
As used herein, the term "oligoribonucleotide" refers to a polymer of nucleotides comprising naturally occurring ribonucleotides, non-naturally occurring ribonucleotides, derivatized ribonucleotides, or a combination thereof. Non-limiting examples of ribonucleotides, and derivatives thereof, are set forth herein.
As used herein, the term "complementary" refers to the ability of nucleotides, or analogues thereof, to form Watson-Crick base pairs. Complementary nucleotide sequences will form Watson-Crick base pairs and non-complementary nucleotide sequences will not.
The term "upstream" is used herein to refer to a location which is toward the 5' end of a polynucleotide from a specific reference point.
The term "downstream" is used herein to refer to a location which is toward the 3' end of a polynucleotide from a specific reference point.
Nucleic Acids
The term "nucleic acid" comprises deoxyribonucleic acid (DNA), ribonucleic acid (RNA), combinations thereof, and modified forms thereof. The term comprises genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. In some embodiments, a nucleic acid is DNA. In some embodiments, a nucleic acid is RNA. In some embodiments, a nucleic acid is a mixture of DNA and RNA. A nucleic acid may be present as a single-stranded or double-stranded and linear or covalently circularly closed molecule. A nucleic acid can be isolated. The term "isolated nucleic acid" means, according to the present disclosure, that the nucleic acid (i) was amplified in vitro, for example via polymerase chain reaction (PCR) for DNA or in vitro transcription (using, e.g., an RNA polymerase) for RNA, (ii) was produced recombinantly by cloning, (iii) was purified, for example, by cleavage and separation by gel electrophoresis, or (iv) was synthesized, for example, by chemical synthesis. The term "nucleoside" (abbreviated herein as "N") relates to compounds which can be thought of as nucleotides without a phosphate group. While a nucleoside is a nucleobase linked to a sugar (e.g., ribose or deoxyribose), a nucleotide is composed of a nucleoside and one or more phosphate groups. Examples of nucleosides include cytidine, uridine, pseudouridine, adenosine, and guanosine. The five standard nucleosides which usually make up naturally occurring nucleic acids are uridine, adenosine, thymidine, cytidine and guanosine. The five nucleosides are commonly abbreviated to their one letter codes U, A, T, C and G, respectively. However, thymidine is more commonly written as "dT" ("d" represents "deoxy") as it contains a 2'-deoxyribofuranose moiety rather than the ribofuranose ring found in uridine. This is because thymidine is found in deoxyribonucleic acid (DNA) and not ribonucleic acid (RNA). Conversely, uridine is found in RNA and not DNA. The remaining three nucleosides may be found in both RNA and DNA. In RNA, they would be represented as A, C and G, whereas in DNA they would be represented as dA, dC and dG.
A modified purine (A or G) or pyrimidine (C, T, or U) base moiety is, in some embodiments, modified by one or more alkyl groups, e.g., one or more C1-4 alkyl groups, e.g., one or more methyl groups. Particular examples of modified purine or pyrimidine base moieties include N7-alkyl-guanine, N6-alkyl-adenine, 5-alkyl-cytosine, 5-alkyl-uracil, and N(l)-alkyl-uracil, such as N7-CI-4 alkyl-guanine, N6-CI-4 aikyl-adenine, 5-C1-4 alkyl-cytosine, 5-C1-4 alkyl-u raci I, and N (1)- C1-4 alkyl-uracil, preferably N7-methyl-guanine, N6-methyl-adenine, 5-methyl-cytosine, 5- methyl-uracil, and N(l)-methyl-uracil.
DNA
Herein, the term "DNA" relates to a nucleic acid molecule which is entirely or at least substantially composed of deoxyribonucleotide residues. In preferred embodiments, the DNA contains all or a majority of deoxyribonucleotide residues. As used herein, "deoxyribonucleotide" refers to a nucleotide which lacks a hydroxyl group at the 2'-position of a p-D-ribofuranosyl group. DNA encompasses without limitation, double stranded DNA, single stranded DNA, isolated DNA such as partially purified DNA, essentially pure DNA, synthetic DNA, recombinantly produced DNA, as well as modified DNA that differs from naturally occurring DNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal DNA nucleotides or to the end(s) of DNA. It is also contemplated herein that nucleotides in DNA may be non-standard nucleotides, such as chemically synthesized nucleotides or ribonucleotides. For the present disclosure, these altered DNAs are considered analogs of naturally-occurring DNA. A molecule contains "a majority of deoxyribonucleotide residues" if the content of deoxyribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues in a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard (z.e., naturally occurring) nucleotide residues or analogs thereof).
DNA may be recombinant DNA and may be obtained by cloning of a nucleic acid, in particular cDNA. The cDNA may be obtained by reverse transcription of RNA.
RNA
The term "RNA" relates to a nucleic acid molecule which includes ribonucleotide residues. In preferred embodiments, the RNA contains all or a majority of ribonucleotide residues. As used herein, "ribonucleotide" refers to a nucleotide with a hydroxyl group at the 2'-position of a P- D-ribofuranosyl group. RNA encompasses without limitation, double stranded RNA, single stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. It is also contemplated herein that nucleotides in RNA may be non-standard nucleotides, such as chemically synthesized nucleotides or deoxynucleotides. For the present disclosure, these altered/modified nucleotides can be referred to as analogs of naturally occurring nucleotides, and the corresponding RNAs containing such altered/modified nucleotides (/.e., altered/modified RNAs) can be referred to as analogs of naturally occurring RNAs. A molecule contains "a majority of ribonucleotide residues" if the content of ribonucleotide residues in the molecule is more than 50% (such as at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%), based on the total number of nucleotide residues in the molecule. The total number of nucleotide residues in a molecule is the sum of all nucleotide residues (irrespective of whether the nucleotide residues are standard (/.e., naturally occurring) nucleotide residues or analogs thereof).
"RNA" includes mRNA, tRNA, ribosomal RNA (rRNA), small nuclear RNA (snRNA), self- amplifying RNA (saRNA), trans-amplifying RNA (taRNA), single-stranded RNA (ssRNA), dsRNA, inhibitory RNA (such as antisense ssRNA, small interfering RNA (siRNA), or microRNA (miRNA)), activating RNA (such as small activating RNA) and immunostimulatory RNA (isRNA). In some embodiments, "RNA" refers to mRNA.
The term "in vitro transcription" or "IVT" as used herein means that the transcription (i.e., the generation of RNA) is conducted in a cell-free manner. I.e., IVT does not use living/cultured cells but rather the transcription machinery extracted from cells (e.g., cell lysates or the isolated components thereof, including an RNA polymerase (preferably T7, T3 or SP6 polymerase)).
According to the present disclosure, the term '"RNA" includes "mRNA". According to the present disclosure, the term "mRNA" means "messenger-RNA" and includes a "transcript" which may be generated by using a DNA template. Generally, mRNA encodes a peptide or polypeptide. mRNA is single-stranded but may contain self-complementary sequences that allow parts of the mRNA to fold and pair with itself to form double helices.
According to the present disclosure, "dsRNA" means double-stranded RNA and is RNA with two partially or completely complementary strands.
In preferred embodiments of the present disclosure, the mRNA relates to an RNA transcript which encodes a peptide or polypeptide.
In some embodiments, the mRNA which preferably encodes a peptide or polypeptide has a length of at least 45 nucleotides (such as at least 60, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000 nucleotides), preferably up to 15,000, such as up to 14,000, up to 13,000, up to 12,000 nucleotides, up to 11,000 nucleotides or up to 10,000 nucleotides.
As established in the art, mRNA generally contains a 5' untranslated region (5'-UTR), a peptide/polypeptide coding region and a 3' untranslated region (3'-UTR). In some embodiments, the mRNA is produced by in vitro transcription or chemical synthesis. In some embodiments, the mRNA is produced by in vitro transcription using a DNA template. The in vitro transcription methodology is known to the skilled person; cf., e.g., Molecular Cloning: A Laboratory Manual, 4th Edition, M.R. Green and J. Sambrook eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 2012. Furthermore, a variety of in vitro transcription kits is commercially available, e.g., from Thermo Fisher Scientific (such as TranscriptAid™ T7 kit, MEGAscript® T7 kit, MAXIscript®), New England BioLabs Inc. (such as HiScribe™ T7 kit, HiScribe™ T7 ARCA mRNA kit), Promega (such as RiboMAX™, HeLaScribe®, Riboprobe® systems), Jena Bioscience (such as SP6 or T7 transcription kits), and Epicentre (such as AmpliScribe™). For providing modified mRNA, correspondingly modified nucleotides, such as modified naturally occurring nucleotides, non-naturally occurring nucleotides and/or modified non-naturally occurring nucleotides, can be incorporated during synthesis (preferably in vitro transcription), or modifications can be effected in and/or added to the mRNA after transcription.
In some embodiments, RNA is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription can be any promoter for any RNA polymerase. Particular examples of RNA polymerases are the T7, T3, and SP6 RNA polymerases. Preferably, the in vitro transcription is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA.
In some embodiments of the present disclosure, the RNA is "replicon RNA" or simply a "replicon", in particular "self-replicating RNA" or "self-amplifying RNA". In certain embodiments, the replicon or self-replicating RNA is derived from or comprises elements derived from an ssRNA virus, in particular a positive-stranded ssRNA virus such as an alphavirus. Alphaviruses are typical representatives of positive-stranded RNA viruses. Alphaviruses replicate in the cytoplasm of infected cells (for review of the alphaviral life cycle see Jose et al., Future Microbiol., 2009, vol. 4, pp. 837-856). The total genome length of many alphaviruses typically ranges between 11,000 and 12,000 nucleotides, and the genomic RNA typically has a 5'-cap, and a 3' poly(A) tail. The genome of alphaviruses encodes non-structural proteins (involved in transcription, modification and replication of viral RNA and in protein modification) and structural proteins (forming the virus particle). There are typically two open reading frames (ORFs) in the genome. The four non-structural proteins (nsPl-nsP4) are typically encoded together by a first ORF beginning near the 5' terminus of the genome, while alphavirus structural proteins are encoded together by a second ORF which is found downstream of the first ORF and extends near the 3' terminus of the genome. Typically, the first ORF is larger than the second ORF, the ratio being roughly 2:1. In cells infected by an alphavirus, only the nucleic acid sequence encoding non-structural proteins is translated from the genomic RNA, while the genetic information encoding structural proteins is translatable from a subgenomic transcript, which is an RNA molecule that resembles eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol. 87 pp. 111-124). Following infection, i.e. at early stages of the viral life cycle, the (+) stranded genomic RNA directly acts like a messenger RNA for the translation of the open reading frame encoding the non-structural poly-protein (nsP1234).
Alphavirus-derived vectors have been proposed for delivery of foreign genetic information into target cells or target organisms. In simple approaches, the open reading frame encoding alphaviral structural proteins is replaced by an open reading frame encoding a protein of interest. Alphavirus-based trans-replication (trans-amplification) systems rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules: one nucleic acid molecule encodes a viral replicase, and the other nucleic acid molecule is capable of being replicated by said replicase in trans (hence the designation trans-replication system). Trans- replication requires the presence of both these nucleic acid molecules in a given host cell. The nucleic acid molecule capable of being replicated by the replicase in trans must comprise certain alphaviral sequence elements to allow recognition and RNA synthesis by the alphaviral replicase.
In some embodiments of the present disclosure, the RNA (in particular, mRNA) described herein (e.g., contained in the compositions/formulations of the present disclosure and/or used in the methods of the present disclosure) contains one or more modifications, e.g., in order to increase its stability and/or increase translation efficiency and/or decrease immunogenicity and/or decrease cytotoxicity. For example, in order to increase expression of the RNA (in particular, mRNA), it may be modified within the coding region, i.e., the sequence encoding the expressed peptide or polypeptide, preferably without altering the sequence of the expressed peptide or polypeptide. Such modifications are described, for example, in WO 2007/036366 and PCT/EP2019/056502, and include the following: a S'-cap structure; an extension or truncation of the naturally occurring poly(A) tail; an alteration of the 5'- and/or 3'-untranslated regions (UTR) such as introduction of a UTR which is not related to the coding region of said RNA; the replacement of one or more naturally occurring nucleotides with synthetic nucleotides; and codon optimization (e.g., to alter, preferably increase, the GC content of the RNA). A combination of the above described modifications, i.e., incorporation of a 5'-cap structure, incorporation of a poly-A sequence, unmasking of a poly-A sequence, alteration of the 51- and/or 3'-UTR (such as incorporation of one or more 3'-UTRs), replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine for cytidine and/or pseudouridine (tp) or N(l)-methylpseudouridine (mlip) or 5-methyluridine (m5U) for uridine), and codon optimization, has a synergistic influence on the stability of RNA (preferably mRNA) and increase in translation efficiency. Thus, in some embodiments, the RNA (in particular, mRNA) described in the present disclosure contains a combination of at least two, at least three, at least four or all five of the above-mentioned modifications, i.e., (i) incorporation of a 5'-cap structure, (ii) incorporation of a poly-A sequence, unmasking of a poly-A sequence; (iii) alteration of the 5'- and/or 3'-UTR (such as incorporation of one or more 3'-UTRs); (iv) replacing one or more naturally occurring nucleotides with synthetic nucleotides (e.g., 5-methylcytidine for cytidine and/or pseudouridine (U>) or N(l)-methylpseudouridine (ml^P) or 5-methyluridine (m5U) for uridine), and (v) codon optimization.
5'-Cap
In some embodiments, the RNA (in particular, mRNA) described herein comprises a 5'-cap structure. In some embodiments, the RNA does not have uncapped 5'-triphosphates. In some embodiments, the RNA (in particular, mRNA) may comprise a conventional 5'-cap and/or a 5'- cap analog. The term "conventional 5'-cap" refers to a cap structure found on the 5'-end of an RNA molecule and generally comprises a guanosine 5'-triphosphate (Gppp) which is connected via its triphosphate moiety to the 5'-end of the next nucleotide of the RNA (i.e., the guanosine is connected via a 5' to 5' triphosphate linkage to the rest of the RNA). The guanosine may be methylated at position N7 (resulting in the cap structure m7Gppp). The term "5'-cap analog" includes a 5'-cap which is based on a conventional 5'-cap but which has been modified at either the 2'- or 3'-position of the m7guanosine structure in order to avoid an integration of the 5'-cap analog in the reverse orientation (such 5'-cap analogs are also called anti-reverse cap analogs (ARCAs)). Particularly preferred 5'-cap analogs are those having one or more substitutions at the bridging and non-bridging oxygen in the phosphate bridge, such as phosphorothioate modified 5'-cap analogs at the P-phosphate (such as rna7'2'0G(5')ppSp(5')G (referred to as beta-S-ARCA or P-S-ARCA)), as described in PCT/EP2019/056502. Providing an RNA (in particular, mRNA) with a 5'-cap structure as described herein may be achieved by in vitro transcription of a DNA template in presence of a corresponding 5'-cap compound, wherein said 5'-cap structure is co-transcriptionally incorporated into the generated RNA (in particular, mRNA) strand, or the RNA (in particular, mRNA) may be generated, for example, by in vitro transcription, and the 5'-cap structure may be attached to the RNA post-transcriptionally using capping enzymes, for example, capping enzymes of vaccinia virus.
In some embodiments, the RNA (in particular, mRNA) comprises a 5'-cap structure selected from the group consisting of m27'2 OG(5')ppSp(5')G (in particular its DI diastereomer), m27'3 OG(5')ppp(5')G, and m27'3 OGppp(mi2' o)ApG. In some embodiments, RNA comprises m27,2 OG(5')ppSp(5')G (in particular its DI diastereomer) as 5'-cap structure. In some embodiments, RNA comprises m27'3 OGppp(mi2' °)ApG as 5'-cap structure.
In some embodiments, the RNA (in particular, mRNA) comprises a capO, capl, or cap2, preferably capl or cap2. According to the present disclosure, the term "capO" means the structure "m7GpppN", wherein N is any nucleoside bearing an OH moiety at position 2'. According to the present disclosure, the term "capl" means the structure "m7GpppNm", wherein Nm is any nucleoside bearing an OCH3 moiety at position 2'. According to the present disclosure, the term "cap2" means the structure "m7GpppNmNm", wherein each Nm is independently any nucleoside bearing an OCH3 moiety at position 2'.
The 5'-cap analog beta-S-ARCA (p-S-ARCA) has the following structure:
Figure imgf000062_0001
The "DI diastereomer of beta-S-ARCA" or "beta-S-ARCA(Dl)" is the diastereomer of beta-S- ARCA which elutes first on an HPLC column compared to the D2 diastereomer of beta-S-ARCA (beta-S-ARCA(D2)) and thus exhibits a shorter retention time. The HPLC preferably is an analytical HPLC. In some embodiments, a Supelcosil LC-18-T RP column, preferably of the format: 5 pm, 4.6 x 250 mm is used for separation, whereby a flow rate of 1.3 ml/min can be applied. In some embodiments, a gradient of methanol in ammonium acetate, for example, a 0-25% linear gradient of methanol in 0.05 M ammonium acetate, pH = 5.9, within 15 min is used. UV-detection (VWD) can be performed at 260 nm and fluorescence detection (FLD) can be performed with excitation at 280 nm and detection at 337 nm.
The 5'-cap analog m27,3'0Gppp(mi2’0)ApG (also referred to as m27'3 OG(5,)ppp(5')m2' °ApG) which is a building block of a capl has the following structure:
Figure imgf000063_0001
An exemplary capO mRNA comprising [3-S-ARCA and mRNA has the following structure:
Figure imgf000063_0002
An exemplary capO mRNA comprising m27,3'0G(5,)ppp(5l)G and mRNA has the following structure:
Figure imgf000063_0003
An exemplary capl mRNA comprising m27,3 0Gppp(mi2' 0)ApG and mRNA has the following structure:
Figure imgf000064_0001
Poly-A tail
As used herein, the term "poly-A tail" or "poly-A sequence" refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA (in particular, mRNA) molecule. Poly-A tails or poly-A sequences are known to those of skill in the art and may follow the 3'-UTR in the RNAs (in particular, mRNAs) described herein. An uninterrupted poly-A tail is characterized by consecutive adenylate residues. In nature, an uninterrupted poly-A tail is typical. RNAs (in particular, mRNAs) disclosed herein can have a poly-A tail attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly-A tail encoded by DNA and transcribed by a template-dependent RNA polymerase.
It has been demonstrated that a poly-A tail of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of protein that is translated from an open reading frame that is present upstream (5') of the poly-A tail (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017).
The poly-A tail may be of any length. In some embodiments, a poly-A tail comprises, essentially consists of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides. In this context, "essentially consists of" means that most nucleotides in the poly-A tail, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly-A tail are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of" means that all nucleotides in the poly-A tail, i.e., 100% by number of nucleotides in the poly-A tail, are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.
In some embodiments, a poly-A tail is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly-A tail (coding strand) is referred to as poly(A) cassette.
In some embodiments, the poly(A) cassette present in the coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length. Such a cassette is disclosed in WO 2016/005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016/005324 Al may be used in the present disclosure. A poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on DNA level, constant propagation of plasmid DNA in E. coli and is still associated, on RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed. Consequently, in some embodiments, the poly-A tail contained in an RNA (in particular, mRNA) molecule described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.
In some embodiments, the poly(A) tail comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence of 10 nucleotides.
In some embodiments, no nucleotides other than A nucleotides flank a poly-A tail at its 3'- end, i.e., the poly-A tail is not masked or followed at its 3'-end by a nucleotide other than A.
In some embodiments, a poly-A tail may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly-A tail may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly-A tail may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly-A tail comprises the poly-A tail shown in SEQ ID NO: 4. In some embodiments, the poly-A tail comprises at least 100 nucleotides. In some embodiments, the poly-A tail comprises about 150 nucleotides. In some embodiments, the poly-A tail comprises about 120 nucleotides.
In some embodiments, RNA comprises a a poly-A tail comprising the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 4.
Untranslated regions (UTR)
In some embodiments, RNA (in particular, mRNA) described in present disclosure comprises a 5'-UTR and/or a 3'-UTR. The term "untranslated region" or "UTR" relates to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA molecule, such as an mRNA molecule. An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and/or 3' (downstream) of an open reading frame (3'-UTR). A 5'-UTR, if present, is located at the 5'-end, upstream of the start codon of a protein-encoding region. A 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap. A 3'-UTR, if present, is located at the 3'-end, downstream of the termination codon of a protein-encoding region, but the term "3'-UTR" does generally not include the poly-A sequence. Thus, the 3'-UTR is upstream of the poly-A sequence (if present), e.g., directly adjacent to the poly-A sequence. Incorporation of a 3'-UTR into the 3'- non translated region of an RNA (preferably mRNA) molecule can result in an enhancement in translation efficiency. A synergistic effect may be achieved by incorporating two or more of such 3'-UTRs (which are preferably arranged in a head-to-tail orientation; cf., e.g., Holtkamp et al., Blood 108, 4009-4017 (2006)). The 3'-UTRs may be autologous or heterologous to the RNA (e.g., mRNA) into which they are introduced.
In some embodiments, a 5'-UTR is or comprises a modified human alpha-globin 5'-UTR. A particularly preferred 5'-UTR comprises the nucleotide sequence of SEQ ID NO: 5. In some embodiments, a 3'-UTR comprises a first sequence from the amino terminal enhancer of split (AES) messenger RNA and a second sequence from the mitochondrial encoded 12S ribosomal RNA. A particularly preferred 3'-UTR comprises the nucleotide sequence of SEQ ID NO: 3. In some embodiments, a 3'-UTR comprises a first sequence comprising, or consisting of, the nucleotide sequence of SEQ ID NO: 1, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising, or consisting of, the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 2.
In some embodiments, RNA comprises a 5'-UTR comprising the nucleotide sequence of SEQ ID NO: 5, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 5.
In some embodiments, RNA comprises a 3'-UTR comprising the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 3.
Chemical modification
The RNA (in particular, mRNA) described herein may have modified ribonucleotides in order to increase its stability and/or decrease immunogenicity and/or decrease cytotoxicity. For example, in some embodiments, uridine in the RNA (in particular, mRNA) described herein is replaced (partially or completely, preferably completely) by a modified nucleoside. In some embodiments, the modified nucleoside is a modified uridine.
In some embodiments, the modified uridine replacing uridine is selected from the group consisting of pseudouridine (ip), Nl-methyl-pseudouridine (mlip), 5-methyl-uridine (m5U), and combinations thereof.
In some embodiments, the modified nucleoside replacing (partially or completely, preferably completely) uridine in the RNA may be any one or more of 3-methyl-uridine (m3U), 5- methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl- uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio- uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1- propynyl-pseudouridine, 5-taurinomethyl-uridine (rm5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine(Tm5s2U), l-taurinomethyl-4-thio-pseudouridine), 5-methyl-2- thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (mls44>)/ 4-thio-l-methyl- pseudouridine, 3-methyl-pseudouridine (m34j), 2-thio-l-methyl-pseudouridine, 1-methyl-l- deaza-pseudouridine, 2-thio-l-methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio- dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl-pseudouridine, 3-(3- amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3 i|>), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-0-methyl- uridine (s2Um), 5-methoxycarbonylmethyl-2'-0-methyl-uridine (mcm5Um), 5- carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O- methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)- 2'-0-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, 5-[3-(l-E-propenylamino)uridine, or any other modified uridine known in the art.
An RNA (preferably mRNA) which is modified by pseudouridine (replacing partially or completely, preferably completely, uridine) is referred to herein as "UJ-modified", whereas the term "mltP-modified" means that the RNA (preferably mRNA) contains N(l)- methylpseudouridine (replacing partially or completely, preferably completely, uridine). Furthermore, the term "m5U-modified" means that the RNA (preferably mRNA) contains 5- methyluridine (replacing partially or completely, preferably completely, uridine). Such tp- or mlMJ- or m5U-modified RNAs usually exhibit decreased immunogenicity compared to their unmodified forms and, thus, are preferred in applications where the induction of an immune response is to be avoided or minimized. In some embodiments, the RNA (preferably mRNA) contains N(l)-methylpseudouridine replacing completely uridine.
Codon optimization and GC enrichment
The codons of the RNA (in particular, mRNA) described in the present disclosure may further be optimized, e.g., to increase the GC content of the RNA and/or to replace codons which are rare in the cell (or subject) in which the peptide or polypeptide of interest is to be expressed by codons which are synonymous frequent codons in said cell (or subject). In some embodiments, the amino acid sequence encoded by the RNA (in particular, mRNA) described in the present disclosure is encoded by a coding sequence which is codon-optimized and/or the G/C content of which is increased compared to wild type coding sequence. This also includes embodiments, wherein one or more sequence regions of the coding sequence are codon-optimized and/or increased in the G/C content compared to the corresponding sequence regions of the wild type coding sequence. In some embodiments, the codon- optimization and/or the increase in the G/C content preferably does not change the sequence of the encoded amino acid sequence.
The term "codon-optimized" refers to the alteration of codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without preferably altering the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, coding regions may be codon-optimized for optimal expression in a subject to be treated using the RNA (in particular, mRNA) described herein. Codon-optimization is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Thus, the sequence of RNA (in particular, mRNA) may be modified such that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons".
In some embodiments, the guanosine/cytosine (G/C) content of the coding region of the RNA (in particular, mRNA) described herein is increased compared to the G/C content of the corresponding coding sequence of the wild type RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence encoded by the wild type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for efficient translation of that RNA. Sequences having an increased G (guanosine)/C (cytosine) content are more stable than sequences having an increased A (adenosine)/U (uracil) content. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favorable codons for the stability can be determined (so-called alternative codon usage). Depending on the amino acid to be encoded by the RNA, there are various possibilities for modification of the RNA sequence, compared to its wild type sequence. In particular, codons which contain A and/or U nucleotides can be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and/or U or contain a lower content of A and/or U nucleotides.
In various embodiments, the G/C content of the coding region of the RNA (in particular, mRNA) described herein is increased by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 55%, or even more compared to the G/C content of the coding region of the wild type RNA.
Non-immunogenic RNA
In some embodiments, the RNA (in particular, mRNA), e.g., RNA encoding vaccine antigen, described in the present disclosure is non-immunogenic. RNA encoding an immunostimulant may be administered according to the present disclosure to provide an adjuvant effect. The RNA encoding an immunostimulant may be standard RNA or non-immunogenic RNA.
The term "non-immunogenic RNA" (such as "non-immunogenic mRNA") as used herein refers to RNA that does not induce a response by the immune system upon administration, e.g., to a mammal, or induces a weaker response than would have been induced by the same RNA that differs only in that it has not been subjected to the modifications and treatments that render the non-immunogenic RNA non-immunogenic, i.e., than would have been induced by standard RNA (stdRNA). In certain embodiments, non-immunogenic RNA is rendered non- immunogenic by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and/or limiting the amount of double-stranded RNA (dsRNA), e.g., by limiting the formation of double-stranded RNA (dsRNA), e.g., during in vitro transcription, and/or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription. In certain embodiments, non-immunogenic RNA is rendered non-immunogenic by incorporating modified nucleosides suppressing RNA-mediated activation of innate immune receptors into the RNA and/or by removing double-stranded RNA (dsRNA), e.g., following in vitro transcription. For rendering the non-immunogenic RNA (especially mRNA) non-immunogenic by the incorporation of modified nucleosides, any modified nucleoside may be used as long as it lowers or suppresses immunogenicity of the RNA. Particularly preferred are modified nucleosides that suppress RNA-mediated activation of innate immune receptors. In some embodiments, the modified nucleosides comprise a replacement of one or more uridines with a nucleoside comprising a modified nucleobase. In some embodiments, the modified nucleobase is a modified uracil. In some embodiments, the nucleoside comprising a modified nucleobase is selected from the group consisting of 3-methyl-uridine (m3U), 5-methoxy- uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio- uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5- aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl- uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1- propynyl-pseudouridine, 5-taurinomethyl-uridine (Tm5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine(Tm5s2U), l-taurinomethyl-4-thio-pseudouridine), 5-methyl-2- thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (m1s4ip), 4-thio-l-methyl-pseudouridine,
3-methyl-pseudouridine (m3i|>), 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza- pseudouridine, 2-thio-l-methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio- dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine,
4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl-pseudouridine, 3-(3- amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3 I|J), 5-(isopentenylaminomethyl)uridine (inmsU), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O-methyl- uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5- carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O- methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5-(isopentenylaminomethyl)-2'- O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'- OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(l-E-propenylamino)uridine. In certain embodiments, the nucleoside comprising a modified nucleobase is pseudouridine (ip), Nl-methyl-pseudouridine (mlip) or 5-methyl-uridine (m5U), in particular Nl-methyl- pseudouridine.
In some embodiments, the replacement of one or more uridines with a nucleoside comprising a modified nucleobase comprises a replacement of at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the uridines.
During synthesis of mRNA by in vitro transcription (IVT) using T7 RNA polymerase significant amounts of aberrant products, including double-stranded RNA (dsRNA) are produced due to unconventional activity of the enzyme. dsRNA induces inflammatory cytokines and activates effector enzymes leading to protein synthesis inhibition. Formation of dsRNA can be limited during synthesis of mRNA by in vitro transcription (IVT), for example, by limiting the amount of uridine triphosphate (UTP) during synthesis. Optionally, UTP may be added once or several times during synthesis of mRNA. Also, dsRNA can be removed from RNA such as IVT RNA, for example, by ion-pair reversed phase HPLC using a non-porous or porous C-18 polystyrene- divinylbenzene (PS-DVB) matrix. Alternatively, an enzymatic based method using E. coli RNaselll that specifically hydrolyzes dsRNA but not ssRNA, thereby eliminating dsRNA contaminants from IVT RNA preparations can be used. Furthermore, dsRNA can be separated from ssRNA by using a cellulose material. In some embodiments, an RNA preparation is contacted with a cellulose material and the ssRNA is separated from the cellulose material under conditions which allow binding of dsRNA to the cellulose material and do not allow binding of ssRNA to the cellulose material. Suitable methods for providing ssRNA are disclosed, for example, in WO 2017/182524.
As the term is used herein, "remove" or "removal" refers to the characteristic of a population of first substances, such as non-immunogenic RNA, being separated from the proximity of a population of second substances, such as dsRNA, wherein the population of first substances is not necessarily devoid of the second substance, and the population of second substances is not necessarily devoid of the first substance. However, a population of first substances characterized by the removal of a population of second substances has a measurably lower content of second substances as compared to the non-separated mixture of first and second substances.
In some embodiments, the amount of double-stranded RNA (dsRNA) is limited, e.g., dsRNA (especially dsmRNA) is removed from non-immunogenic RNA , such that less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.3%, less than 0.1%, less than 0.05%, less than 0.03%, less than 0.01%, less than 0.005%, less than 0.004%, less than 0.003%, less than 0.002%, less than 0.001%, or less than 0.0005% of the RNA in the non-immunogenic RNA composition is dsRNA. In some embodiments, the non- immunogenic RNA (especially mRNA) is free or essentially free of dsRNA. In some embodiments, the non-immunogenic RNA (especially mRNA) composition comprises a purified preparation of single-stranded nucleoside modified RNA. In some embodiments, the non-immunogenic RNA (especially mRNA) composition comprises single-stranded nucleoside modified RNA (especially mRNA) and is substantially free of double stranded RNA (dsRNA). In some embodiments, the non-immunogenic RNA (especially mRNA) composition comprises at least 90%, at least 91%, at least 92%, at least 93 %, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, at least 99.991%, at least 99.992%, , at least 99.993%,, at least 99.994%, , at least 99.995%, at least 99.996%, at least 99.997%, or at least 99.998% single stranded nucleoside modified RNA, relative to all other nucleic acid molecules (DNA, dsRNA, etc.).
Various methods can be used to determine the amount of dsRNA. For example, a sample may be contacted with dsRNA-specific antibody and the amount of antibody binding to RNA may be taken as a measure for the amount of dsRNA in the sample. A sample containing a known amount of dsRNA may be used as a reference.
For example, RNA may be spotted onto a membrane, e.g., nylon blotting membrane. The membrane may be blocked, e.g., in TBS-T buffer (20 mM TRIS pH 7.4, 137 mM NaCI, 0.1% (v/v) TWEEN-20) containing 5% (w/v) skim milk powder. For detection of dsRNA, the membrane may be incubated with dsRNA-specific antibody, e.g., dsRNA-specific mouse mAb (English & Scientific Consulting, Szirak, Hungary). After washing, e.g., with TBS-T, the membrane may be incubated with a secondary antibody, e.g., HRP-conjugated donkey anti-mouse IgG (Jackson ImmunoResearch, Cat #715-035-150), and the signal provided by the secondary antibody may be detected. In some embodiments, the non-immunogenic RNA (especially mRNA) is translated in a cell more efficiently than standard RNA with the same sequence. In some embodiments, translation is enhanced by a factor of 2-fold relative to its unmodified counterpart. In some embodiments, translation is enhanced by a 3-fold factor. In some embodiments, translation is enhanced by a 4-fold factor. In some embodiments, translation is enhanced by a 5-fold factor. In some embodiments, translation is enhanced by a 6-fold factor. In some embodiments, translation is enhanced by a 7-fold factor. In some embodiments, translation is enhanced by an 8-fold factor. In some embodiments, translation is enhanced by a 9-fold factor. In some embodiments, translation is enhanced by a 10-fold factor. In some embodiments, translation is enhanced by a 15-fold factor. In some embodiments, translation is enhanced by a 20-fold factor. In some embodiments, translation is enhanced by a 50-fold factor. In some embodiments, translation is enhanced by a 100-fold factor. In some embodiments, translation is enhanced by a 200-fold factor. In some embodiments, translation is enhanced by a 500-fold factor. In some embodiments, translation is enhanced by a 1000-fold factor. In some embodiments, translation is enhanced by a 2000-fold factor. In some embodiments, the factor is 10-1000-fold. In some embodiments, the factor is 10-100-fold. In some embodiments, the factor is 10-200-fold. In some embodiments, the factor is 10-300-fold. In some embodiments, the factor is 10-500-fold. In some embodiments, the factor is 20-1000-fold. In some embodiments, the factor is 30-1000-fold. In some embodiments, the factor is 50-1000-fold. In some embodiments, the factor is 100-1000-fold. In some embodiments, the factor is 200- 1000-fold. In some embodiments, translation is enhanced by any other significant amount or range of amounts.
In some embodiments, the non-immunogenic RNA (especially mRNA) exhibits significantly less innate immunogenicity than standard RNA with the same sequence. In some embodiments, the non-immunogenic RNA (especially mRNA) exhibits an innate immune response that is 2- fold less than its unmodified counterpart. In some embodiments, innate immunogenicity is reduced by a 3-fold factor. In some embodiments, innate immunogenicity is reduced by a 4- fold factor. In some embodiments, innate immunogenicity is reduced by a 5-fold factor. In some embodiments, innate immunogenicity is reduced by a 6-fold factor. In some embodiments, innate immunogenicity is reduced by a 7-fold factor. In some embodiments, innate immunogenicity is reduced by an 8-fold factor. In some embodiments, innate immunogenicity is reduced by a 9-fold factor. In some embodiments, innate immunogenicity is reduced by a 10-fold factor. In some embodiments, innate immunogenicity is reduced by a 15-fold factor. In some embodiments, innate immunogenicity is reduced by a 20-fold factor. In some embodiments, innate immunogenicity is reduced by a 50-fold factor. In some embodiments, innate immunogenicity is reduced by a 100-fold factor. In some embodiments, innate immunogenicity is reduced by a 200-fold factor. In some embodiments, innate immunogenicity is reduced by a 500-fold factor. In some embodiments, innate immunogenicity is reduced by a 1000-fold factor. In some embodiments, innate immunogenicity is reduced by a 2000-fold factor.
The term "exhibits significantly less innate immunogenicity" refers to a detectable decrease in innate immunogenicity. In some embodiments, the term refers to a decrease such that an effective amount of the non-immunogenic RNA (especially mRNA) can be administered without triggering a detectable innate immune response. In some embodiments, the term refers to a decrease such that the non-immunogenic RNA (especially mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to detectably reduce production of the protein encoded by the non-immunogenic RNA. In some embodiments, the decrease is such that the non-immunogenic RNA (especially mRNA) can be repeatedly administered without eliciting an innate immune response sufficient to eliminate detectable production of the protein encoded by the non-immunogenic RNA.
"Immunogenicity" is the ability of a foreign substance, such as RNA, to provoke an immune response in the body of a human or other animal. The innate immune system is the component of the immune system that is relatively unspecific and immediate. It is one of two main components of the vertebrate immune system, along with the adaptive immune system.
Pharmaceutically active peptides or polypeptides
In some embodiments, RNA (in particular, mRNA) described in the present disclosure comprises a nucleic acid sequence encoding a peptide or polypeptide such as a peptide or polypeptide having biological activity, e.g., a pharmaceutically active peptide or polypeptide. In some embodiments, RNA (in particular, mRNA) described in the present disclosure comprises a nucleic acid sequence encoding a peptide or polypeptide, preferably a pharmaceutically active peptide or polypeptide, and is capable of expressing said peptide or polypeptide, in particular if transferred into a cell or subject. Thus, in some embodiments, the RNA (in particular, mRNA) described in the present disclosure contains a coding sequence or region (open reading frame (ORF)) encoding a peptide or polypeptide, e.g., encoding a pharmaceutically active peptide or polypeptide. Such nucleic acid encoding a pharmaceutically active peptide or polypeptide is also referred to herein as "pharmaceutically active nucleic acid". In particular, such RNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as "pharmaceutically active RNA" and such mRNA encoding a pharmaceutically active peptide or polypeptide is also referred to herein as "pharmaceutically active mRNA". In some embodiments, RNA used in the present disclosure comprises a nucleic acid sequence encoding more than one peptide or polypeptide, e.g., two, three, four or more peptides or polypeptides.
According to the present disclosure, the term "pharmaceutically active peptide or polypeptide" means a peptide or polypeptide that can be used in the treatment of an individual where the expression of the peptide or polypeptide would be of benefit, e.g., in ameliorating the symptoms of a disease. Preferably, a pharmaceutically active peptide or polypeptide has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease. In some embodiments, a pharmaceutically active peptide or polypeptide has a positive or advantageous effect on the condition or disease state of an individual when administered to the individual in a therapeutically effective amount. A pharmaceutically active peptide or polypeptide may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease. The term "pharmaceutically active peptide" or "pharmaceutically active polypeptide" includes entire peptides or polypeptides, and can also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active variants and/or analogs of a peptide or polypeptide.
Specific examples of pharmaceutically active peptides and polypeptides include, but are not limited to, immunostimulants, e.g., cytokines, hormones, adhesion molecules, immunoglobulins, immunologically active compounds, growth factors, protease inhibitors, enzymes, receptors, apoptosis regulators, transcription factors, tumor suppressor proteins, structural proteins, reprogramming factors, genomic engineering proteins, and blood proteins. In some embodiments, the pharmaceutically active peptide and polypeptide includes a replacement protein.
An "immunostimulant" is any substance that stimulates the immune system by inducing activation or increasing activity of any of the immune system's components, in particular immune effector cells. The immunostimulant may be pro-inflammatory (e.g., when treating infections or cancer), or anti-inflammatory (e.g., when treating autoimmune diseases).
According to one aspect, the immunostimulant is a cytokine or a variant thereof. Examples of cytokines include interferons, such as interferon-alpha (IFN-a) or interferon-gamma (IFN-y), interleukins, such as IL2, IL7, 1 L12, 1 L15 and IL23, colony stimulating factors, such as M-CSF and GM-CSF, and tumor necrosis factor. According to another aspect, the immunostimulant includes an adjuvant-type immunostimulatory agent such as APC Toll-like Receptor agonists or costimulatory/cell adhesion membrane proteins. Examples of Toll-like Receptor agonists include costimulatory/adhesion proteins such as CD80, CD86, and ICAM-1.
The term "cytokines" relates to proteins which have a molecular weight of about 5 to 60 kDa and which participate in cell signaling (e.g., paracrine, endocrine, and/or autocrine signaling). In particular, when released, cytokines exert an effect on the behavior of cells around the place of their release. Examples of cytokines include lymphokines, interleukins, chemokines, interferons, and tumor necrosis factors (TNFs). According to the present disclosure, cytokines do not include hormones or growth factors. Cytokines differ from hormones in that (i) they usually act at much more variable concentrations than hormones and (ii) generally are made by a broad range of cells (nearly all nucleated cells can produce cytokines). Particular examples of cytokines include erythropoietin (EPO), colony stimulating factor (CSF), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), tumor necrosis factor (TNF), bone morphogenetic protein (BMP), interferon alfa (IFNot), interferon beta (IFNfi), interferon gamma (INFy), interleukin 2 (IL-2), interleukin 4 (IL-4), interleukin 10 (IL- 10), interleukin 11 (IL-11), interleukin 12 (IL-12), interleukin 15 (IL-15), and interleukin 21 (IL-21), as well as variants and derivatives thereof.
According to the disclosure, a cytokine may be a naturally occurring cytokine or a functional fragment or variant thereof. A cytokine may be human cytokine and may be derived from any vertebrate, especially any mammal. One particularly preferred cytokine is interferon-a.
Immunostimulants may be provided to a subject by administering to the subject RNA encoding an immunostimulant in a formulation for preferential delivery of RNA to liver or liver tissue. The delivery of RNA to such target organ or tissue is preferred, in particular, if it is desired to express large amounts of the immunostimulant and/or if systemic presence of the immunostimulant, in particular in significant amounts, is desired or required. RNA delivery systems, such as lipid-based particles, cationic and neutral nanoparticles, in particular lipid nanoparticles, may be used for delivery to the liver.
Examples of suitable immunostimulants for targeting liver are cytokines involved in T cell proliferation and/or maintenance. Examples of suitable cytokines include IL2 or IL7, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
In another embodiment, RNA encoding an immunostimulant may be administered in a formulation for preferential delivery of RNA to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen. The delivery of an immunostimulant to such target tissue is preferred, in particular, if presence of the immunostimulant in this organ or tissue is desired (e.g., for inducing an immune response, in particular in case immunostimulants such as cytokines are required during T-cell priming or for activation of resident immune cells), while it is not desired that the immunostimulant is present systemically, in particular in significant amounts (e.g., because the immunostimulant has systemic toxicity).
Examples of suitable immunostimulants are cytokines involved in T cell priming. Examples of suitable cytokines include IL12, IL15, IFN-a, or IFN-P, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
Interferons (IFNs) are a group of signaling proteins made and released by host cells in response to the presence of several pathogens, such as viruses, bacteria, parasites, and also tumor cells. In a typical scenario, a virus-infected cell will release interferons causing nearby cells to heighten their anti-viral defenses. Interferons are usually characterized by antiviral, antiproliferative and immunomodulatory activities. Interferons are proteins that alter and regulate the transcription of genes within a cell by binding to interferon receptors on the regulated cell's surface, thereby preventing viral replication within the cells.
Based on the type of receptor through which they signal, interferons are typically divided among three classes: type I interferon, type II interferon, and type III interferon.
All type I interferons bind to a specific cell surface receptor complex known as the IFN-a/p receptor (IFNAR) that consists of IFNAR1 and IFNAR2 chains.
The type I interferons present in humans are IFNa, IFN £, IFNe, IFNK and IFNw. In general, type I interferons are produced when the body recognizes a virus that has invaded it. They are produced by fibroblasts and monocytes. Once released, type I interferons bind to specific receptors on target cells, which leads to expression of proteins that will prevent the virus from producing and replicating its RNA and DNA.
The IFNa proteins are produced mainly by plasmacytoid dendritic cells (pDCs). They are mainly involved in innate immunity against viral infection. The genes responsible for their synthesis come in 13 subtypes that are called IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, IFNA21. These genes are found together in a cluster on chromosome 9.
The IFN(3 proteins are produced in large quantities by fibroblasts. They have antiviral activity that is involved mainly in innate immune response. Two types of IFNfi have been described, IFNpi and IFN(33. The natural and recombinant forms of IFNpl have antiviral, antibacterial, and anticancer properties.
Type II interferon (IFNy in humans) is also known as immune interferon and is activated by IL12. Furthermore, type II interferons are released by cytotoxic T cells and T helper cells.
Type III interferons signal through a receptor complex consisting of IL1OR2 (also called CRF2- 4) and IFNLR1 (also called CRF2-12). Although discovered more recently than type I and type II IFNs, recent information demonstrates the importance of type III IFNs in some types of virus or fungal infections.
In general, type I and II interferons are responsible for regulating and activating the immune response.
According to the disclosure, a type I interferon is preferably IFNa or IFNp, more preferably IFNa.
According to the disclosure, an interferon may be a naturally occurring interferon or a functional fragment or variant thereof. An interferon may be human interferon and may be derived from any vertebrate, especially any mammal.
Interleukins (ILs) are a group of cytokines (secreted proteins and signal molecules) that can be divided into four major groups based on distinguishing structural features. However, their amino acid sequence similarity is rather weak (typically 15-25% identity). The human genome encodes more than 50 interleukins and related proteins.
According to the disclosure, an interleukin may be a naturally occurring interleukin or a functional fragment or variant thereof. An interleukin may be human interleukin and may be derived from any vertebrate, especially any mammal. Immunostimulant polypeptides described herein can be prepared as fusion or chimeric polypeptides that include an immunostimulant portion and a heterologous polypeptide (i.e., a polypeptide that is not an immunostimulant). The immunostimulant may be fused to an extended-PK group, which increases circulation half-life. Non-limiting examples of extended- PK groups are described infra. It should be understood that other PK groups that increase the circulation half-life of immunostimulants such as cytokines, or variants thereof, are also applicable to the present disclosure. In certain embodiments, the extended-PK group is a serum albumin domain (e.g., mouse serum albumin, human serum albumin).
As used herein, the term "PK" is an acronym for "pharmacokinetic" and encompasses properties of a compound including, by way of example, absorption, distribution, metabolism, and elimination by a subject. As used herein, an "extended-PK group" refers to a protein, peptide, or moiety that increases the circulation half-life of a biologically active molecule when fused to or administered together with the biologically active molecule. Examples of an extended-PK group include serum albumin (e.g., HSA), Immunoglobulin Fc or Fc fragments and variants thereof, transferrin and variants thereof, and human serum albumin (HSA) binders (as disclosed in U.S. Publication Nos. 2005/0287153 and 2007/0003549). Other exemplary extended-PK groups are disclosed in Kontermann, Expert Opin Biol Ther, 2016 Jul;16(7):903- 15 which is herein incorporated by reference in its entirety. As used herein, an "extended-PK" immunostimulant refers to an immunostimulant moiety in combination with an extended-PK group. In some embodiments, the extended-PK immunostimulant is a fusion protein in which an immunostimulant moiety is linked or fused to an extended-PK group.
In certain embodiments, the serum half-life of an extended-PK immunostimulant is increased relative to the immunostimulant alone (i.e., the immunostimulant not fused to an extended- PK group). In certain embodiments, the serum half-life of the extended-PK immunostimulant is at least 20%, at least 40%, at least 60%, at least 80%, at least 100%, at least 120%, at least 150%, at least 180%, at least 200%, at least 400%, at least 600%, at least 800%, or at least 1000% longer relative to the serum half-life of the immunostimulant alone. In certain embodiments, the serum half-life of the extended-PK immunostimulant is at least 1.5-fold, 2- fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 10-fold, 12-fold, 13- fold, 15-fold, 17-fold, 20-fold, 22-fold, 25-fold, 27-fold, 30-fold, 35-fold, 40-fold, or 50-fold greater than the serum half-life of the immunostimulant alone. In certain embodiments, the serum half-life of the extended-PK immunostimulant is at least 10 hours, 15 hours, 20 hours, 25 hours, 30 hours, 35 hours, 40 hours, 50 hours, 60 hours, 70 hours, 80 hours, 90 hours, 100 hours, 110 hours, 120 hours, 130 hours, 135 hours, 140 hours, 150 hours, 160 hours, or 200 hours.
As used herein, "half-life" refers to the time taken for the serum or plasma concentration of a compound such as a peptide or polypeptide to reduce by 50%, in vivo, for example due to degradation and/or clearance or sequestration by natural mechanisms. An extended-PK immunostimulant suitable for use herein is stabilized in vivo and its half-life increased by, e.g., fusion to serum albumin (e.g., HSA or MSA), which resist degradation and/or clearance or sequestration. The half-life can be determined in any manner known per se, such as by pharmacokinetic analysis. Suitable techniques will be clear to the person skilled in the art, and may for example generally involve the steps of suitably administering a suitable dose of the amino acid sequence or compound to a subject; collecting blood samples or other samples from said subject at regular intervals; determining the level or concentration of the amino acid sequence or compound in said blood sample; and calculating, from (a plot of) the data thus obtained, the time until the level or concentration of the amino acid sequence or compound has been reduced by 50% compared to the initial level upon dosing. Further details are provided in, e.g., standard handbooks, such as Kenneth, A. et al., Chemical Stability of Pharmaceuticals: A Handbook for Pharmacists and in Peters et al., Pharmacokinetic Analysis: A Practical Approach (1996). Reference is also made to Gibaldi, M. et al., Pharmacokinetics, 2nd Rev. Edition, Marcel Dekker (1982).
In certain embodiments, the extended-PK group includes serum albumin, or fragments thereof or variants of the serum albumin or fragments thereof (all of which for the purpose of the present disclosure are comprised by the term "albumin"). Polypeptides described herein may be fused to albumin (or a fragment or variant thereof) to form albumin fusion proteins. Such albumin fusion proteins are described in U.S. Publication No. 20070048282.
As used herein, "albumin fusion protein" refers to a protein formed by the fusion of at least one molecule of albumin (or a fragment or variant thereof) to at least one molecule of a protein such as a therapeutic protein, in particular an immunostimulant. The albumin fusion protein may be generated by translation of a nucleic acid in which a polynucleotide encoding a therapeutic protein is joined in-frame with a polynucleotide encoding an albumin. The therapeutic protein and albumin, once part of the albumin fusion protein, may each be referred to as a "portion", "region" or "moiety" of the albumin fusion protein (e.g., a "therapeutic protein portion" or an "albumin protein portion"). In a highly preferred embodiment an albumin fusion protein comprises at least one molecule of a therapeutic protein (including, but not limited to a mature form of the therapeutic protein) and at least one molecule of albumin (including but not limited to a mature form of albumin). In some embodiments, an albumin fusion protein is processed by a host cell such as a cell of the target organ for administered RIMA, e.g. a liver cell, and secreted into the circulation. Processing of the nascent albumin fusion protein that occurs in the secretory pathways of the host cell used for expression of the RNA may include, but is not limited to signal peptide cleavage; formation of disulfide bonds; proper folding; addition and processing of carbohydrates (such as for example, N- and O-linked glycosylation); specific proteolytic cleavages; and/or assembly into multimeric proteins. An albumin fusion protein is preferably encoded by RNA in a non- processed form which in particular has a signal peptide at its N-terminus and following secretion by a cell is preferably present in the processed form wherein in particular the signal peptide has been cleaved off. In a most preferred embodiment, the "processed form of an albumin fusion protein" refers to an albumin fusion protein product which has undergone N- terminal signal peptide cleavage, herein also referred to as a "mature albumin fusion protein". In preferred embodiments, albumin fusion proteins comprising a therapeutic protein have a higher plasma stability compared to the plasma stability of the same therapeutic protein when not fused to albumin. Plasma stability typically refers to the time period between when the therapeutic protein is administered in vivo and carried into the bloodstream and when the therapeutic protein is degraded and cleared from the bloodstream, into an organ, such as the kidney or liver, that ultimately clears the therapeutic protein from the body. Plasma stability is calculated in terms of the half-life of the therapeutic protein in the bloodstream. The half- life of the therapeutic protein in the bloodstream can be readily determined by common assays known in the art.
As used herein, "albumin" refers collectively to albumin protein or amino acid sequence, or an albumin fragment or variant, having one or more functional activities (e.g., biological activities) of albumin. In particular, "albumin" refers to human albumin or fragments or variants thereof especially the mature form of human albumin, or albumin from other vertebrates or fragments thereof, or variants of these molecules. The albumin may be derived from any vertebrate, especially any mammal, for example human, cow, sheep, or pig. Non- mammalian albumins include, but are not limited to, hen and salmon. The albumin portion of the albumin fusion protein may be from a different animal than the therapeutic protein portion.
In certain embodiments, the albumin is human serum albumin (HSA), or fragments or variants thereof, such as those disclosed in US 5,876,969, WO 2011/124718, WO 2013/075066, and WO 2011/0514789.
The terms, human serum albumin (HSA) and human albumin (HA) are used interchangeably herein. The terms, "albumin and "serum albumin" are broader, and encompass human serum albumin (and fragments and variants thereof) as well as albumin from other species (and fragments and variants thereof).
As used herein, a fragment of albumin sufficient to prolong the therapeutic activity or plasma stability of the therapeutic protein refers to a fragment of albumin sufficient in length or structure to stabilize or prolong the therapeutic activity or plasma stability of the protein so that the plasma stability of the therapeutic protein portion of the albumin fusion protein is prolonged or extended compared to the plasma stability in the non-fusion state.
The albumin portion of the albumin fusion proteins may comprise the full length of the albumin sequence, or may include one or more fragments thereof that are capable of stabilizing or prolonging the therapeutic activity or plasma stability. Such fragments may be of 10 or more amino acids in length or may include about 15, 20, 25, 30, 50, or more contiguous amino acids from the albumin sequence or may include part or all of specific domains of albumin. For instance, one or more fragments of HSA spanning the first two immunoglobulin- like domains may be used. In a preferred embodiment, the HSA fragment is the mature form of HSA.
Generally speaking, an albumin fragment or variant will be at least 100 amino acids long, preferably at least 150 amino acids long.
According to the disclosure, albumin may be naturally occurring albumin or a fragment or variant thereof. Albumin may be human albumin and may be derived from any vertebrate, especially any mammal.
Preferably, the albumin fusion protein comprises albumin as the N-terminal portion, and a therapeutic protein as the C-terminal portion. Alternatively, an albumin fusion protein comprising albumin as the C-terminal portion, and a therapeutic protein as the N-terminal portion may also be used. In other embodiments, the albumin fusion protein has a therapeutic protein fused to both the N-terminus and the C-terminus of albumin. In a preferred embodiment, the therapeutic proteins fused at the N- and C-termini are the same therapeutic proteins. In another preferred embodiment, the therapeutic proteins fused at the N- and C- termini are different therapeutic proteins. In some embodiments, the different therapeutic proteins are both cytokines.
In some embodiments, the therapeutic protein(s) is (are) joined to the albumin through (a) peptide linker(s). A peptide linker between the fused portions may provide greater physical separation between the moieties and thus maximize the accessibility of the therapeutic protein portion, for instance, for binding to its cognate receptor. The peptide linker may consist of amino acids such that it is flexible or more rigid. The linker sequence may be cleavable by a protease or chemically.
As used herein, the term "Fc region" refers to the portion of a native immunoglobulin formed by the respective Fc domains (or Fc moieties) of its two heavy chains. As used herein, the term "Fc domain" refers to a portion or fragment of a single immunoglobulin (Ig) heavy chain wherein the Fc domain does not comprise an Fv domain. In certain embodiments, an Fc domain begins in the hinge region just upstream of the papain cleavage site and ends at the C-terminus of the antibody. Accordingly, a complete Fc domain comprises at least a hinge domain, a CH2 domain, and a CH3 domain. In certain embodiments, an Fc domain comprises at least one of: a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, a CH4 domain, or a variant, portion, or fragment thereof. In certain embodiments, an Fc domain comprises a complete Fc domain (i.e., a hinge domain, a CH2 domain, and a CH3 domain). In certain embodiments, an Fc domain comprises a hinge domain (or portion thereof) fused to a CH3 domain (or portion thereof). In certain embodiments, an Fc domain comprises a CH2 domain (or portion thereof) fused to a CH3 domain (or portion thereof). In certain embodiments, an Fc domain consists of a CH3 domain or portion thereof. In certain embodiments, an Fc domain consists of a hinge domain (or portion thereof) and a CH3 domain (or portion thereof). In certain embodiments, an Fc domain consists of a CH2 domain (or portion thereof) and a CH3 domain. In certain embodiments, an Fc domain consists of a hinge domain (or portion thereof) and a CH2 domain (or portion thereof). In certain embodiments, an Fc domain lacks at least a portion of a CH2 domain (e.g., all or part of a CH2 domain). An Fc domain herein generally refers to a polypeptide comprising all or part of the Fc domain of an immunoglobulin heavy-chain. This includes, but is not limited to, polypeptides comprising the entire CHI, hinge, CH2, and/or CH3 domains as well as fragments of such peptides comprising only, e.g., the hinge, CH2, and CH3 domain. The Fc domain may be derived from an immunoglobulin of any species and/or any subtype, including, but not limited to, a human IgGl, lgG2, lgG3, lgG4, IgD, IgA, IgE, or IgM antibody. The Fc domain encompasses native Fc and Fc variant molecules. As set forth herein, it will be understood by one of ordinary skill in the art that any Fc domain may be modified such that it varies in amino acid sequence from the native Fc domain of a naturally occurring immunoglobulin molecule. In certain embodiments, the Fc domain has reduced effector function (e.g., FcyR binding).
The Fc domains of a polypeptide described herein may be derived from different immunoglobulin molecules. For example, an Fc domain of a polypeptide may comprise a CH2 and/or CH3 domain derived from an IgGl molecule and a hinge region derived from an lgG3 molecule. In another example, an Fc domain can comprise a chimeric hinge region derived, in part, from an IgGl molecule and, in part, from an lgG3 molecule. In another example, an Fc domain can comprise a chimeric hinge derived, in part, from an IgGl molecule and, in part, from an lgG4 molecule.
In certain embodiments, an extended-PK group includes an Fc domain or fragments thereof or variants of the Fc domain or fragments thereof (all of which for the purpose of the present disclosure are comprised by the term "Fc domain"). The Fc domain does not contain a variable region that binds to antigen. Fc domains suitable for use in the present disclosure may be obtained from a number of different sources. In certain embodiments, an Fc domain is derived from a human immunoglobulin. In certain embodiments, the Fc domain is from a human IgGl constant region. It is understood, however, that the Fc domain may be derived from an immunoglobulin of another mammalian species, including for example, a rodent (e.g. a mouse, rat, rabbit, guinea pig) or non-human primate (e.g. chimpanzee, macaque) species.
Moreover, the Fc domain (or a fragment or variant thereof) may be derived from any immunoglobulin class, including IgM, IgG, IgD, IgA, and IgE, and any immunoglobulin isotype, including IgGl, lgG2, lgG3, and lgG4.
A variety of Fc domain gene sequences (e.g., mouse and human constant region gene sequences) are available in the form of publicly accessible deposits. Constant region domains comprising an Fc domain sequence can be selected lacking a particular effector function and/or with a particular modification to reduce immunogenicity. Many sequences of antibodies and antibody-encoding genes have been published and suitable Fc domain sequences (e.g. hinge, CH2, and/or CH3 sequences, or fragments or variants thereof) can be derived from these sequences using art recognized techniques.
In certain embodiments, the extended-PK group is a serum albumin binding protein such as those described in US2005/0287153, US2007/0003549, US2007/0178082, US2007/0269422, US2010/0113339, W02009/083804, and W02009/133208, which are herein incorporated by reference in their entirety. In certain embodiments, the extended-PK group is transferrin, as disclosed in US 7,176,278 and US 8,158,579, which are herein incorporated by reference in their entirety. In certain embodiments, the extended-PK group is a serum immunoglobulin binding protein such as those disclosed in US2007/0178082, US2014/0220017, and US2017/0145062, which are herein incorporated by reference in their entirety. In certain embodiments, the extended-PK group is a fibronectin (Fn)-based scaffold domain protein that binds to serum albumin, such as those disclosed in US2012/0094909, which is herein incorporated by reference in its entirety. Methods of making fibronectin-based scaffold domain proteins are also disclosed in US2012/0094909. A non-limiting example of a Fn3-based extended-PK group is Fn3(HSA), i.e., a Fn3 protein that binds to human serum albumin.
In certain aspects, the extended-PK immunostimulant, suitable for use according to the disclosure, can employ one or more peptide linkers. As used herein, the term "peptide linker" refers to a peptide or polypeptide sequence which connects two or more domains (e.g., the extended-PK moiety and an immunostimulant moiety) in a linear amino acid sequence of a polypeptide chain. For example, peptide linkers may be used to connect an immunostimulant moiety to a HSA domain.
Linkers suitable for fusing the extended-PK group to, e.g., an immunostimulant are well known in the art. Exemplary linkers include glycine-serine-polypeptide linkers, glycine-proline- polypeptide linkers, and proline-alanine polypeptide linkers. In certain embodiments, the linker is a glycine-serine-polypeptide linker, i.e., a peptide that consists of glycine and serine residues.
In some embodiments, a pharmaceutically active peptide or polypeptide comprises a replacement protein. In these embodiments, the present disclosure provides a method for treatment of a subject having a disorder requiring protein replacement (e.g., protein deficiency disorders) comprising administering to the subject RNA (in particular, mRNA) as described herein encoding a replacement protein. The term "protein replacement" refers to the introduction of a protein (including functional variants thereof) into a subject having a deficiency in such protein. The term also refers to the introduction of a protein into a subject otherwise requiring or benefiting from providing a protein, e.g., suffering from protein insufficiency. The term "disorder characterized by a protein deficiency" refers to any disorder that presents with a pathology caused by absent or insufficient amounts of a protein. This term encompasses protein folding disorders, i.e., conformational disorders, that result in a biologically inactive protein product. Protein insufficiency can be involved in infectious diseases, immunosuppression, organ failure, glandular problems, radiation illness, nutritional deficiency, poisoning, or other environmental or external insults.
The term "hormones" relates to a class of signaling molecules produced by glands, wherein signaling usually includes the following steps: (i) synthesis of a hormone in a particular tissue; (ii) storage and secretion; (iii) transport of the hormone to its target; (iv) binding of the hormone by a receptor; (v) relay and amplification of the signal; and (vi) breakdown of the hormone. Hormones differ from cytokines in that (1) hormones usually act in less variable concentrations and (2) generally are made by specific kinds of cells. In some embodiments, a "hormone" is a peptide or polypeptide hormone, such as insulin, vasopressin, prolactin, adrenocorticotropic hormone (ACTH), thyroid hormone, growth hormones (such as human grown hormone or bovine somatotropin), oxytocin, atrial-natriuretic peptide (ANP), glucagon, somatostatin, cholecystokinin, gastrin, and leptins.
The term "adhesion molecules" relates to proteins which are located on the surface of a cell and which are involved in binding of the cell with other cells or with the extracellular matrix (ECM). Adhesion molecules are typically transmembrane receptors and can be classified as calcium-independent (e.g., integrins, immunoglobulin superfamily, lymphocyte homing receptors) and calcium-dependent (cadherins and selectins). Particular examples of adhesion molecules are integrins, lymphocyte homing receptors, selectins (e.g., P-selectin), and addressins.
Integrins are also involved in signal transduction. In particular, upon ligand binding, integrins modulate cell signaling pathways, e.g., pathways of transmembrane protein kinases such as receptor tyrosine kinases (RTK). Such regulation can lead to cellular growth, division, survival, or differentiation or to apoptosis. Particular examples of integrins include: aiPi, aipi, aspi, cuPi, 015P1, otePi, 017P1, oiLp2, otMp2, otiibp3, otvpi, otvp3, ctvPs, avPe, avPs, and aeP^
The term "immunoglobulins" or "immunoglobulin superfamily" refers to molecules which are involved in the recognition, binding, and/or adhesion processes of cells. Molecules belonging to this superfamily share the feature that they contain a region known as immunoglobulin domain or fold. Members of the immunoglobulin superfamily include antibodies (e.g., IgG), T cell receptors (TCRs), major histocompatibility complex (MHC) molecules, co-receptors (e.g., CD4, CD8, CD19), antigen receptor accessory molecules (e.g., CD-3y, CD3-6, CD-3E, CD79a, CD79b), co-stimulatory or inhibitory molecules (e.g., CD28, CD80, CD86), and other.
The term "immunologically active compound" relates to any compound altering an immune response, e.g., by inducing and/or suppressing maturation of immune cells, inducing and/or suppressing cytokine biosynthesis, and/or altering humoral immunity by stimulating antibody production by B cells. Immunologically active compounds possess potent immunostimulating activity including, but not limited to, antiviral and antitumor activity, and can also down- regulate other aspects of the immune response, for example shifting the immune response away from a TH2 immune response, which is useful for treating a wide range of TH2 mediated diseases. Immunologically active compounds can be useful as vaccine adjuvants. Particular examples of immunologically active compounds include interleukins, colony stimulating factor (CSF), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), erythropoietin, tumor necrosis factor (TNF), interferons, integrins, addressins, selectins, homing receptors, and antigens, in particular tumor- associated antigens, pathogen-associated antigens (such as bacterial, parasitic, or viral antigens), allergens, and autoantigens. An immunologically active compound may be a vaccine antigen, i.e., an antigen whose inoculation into a subject induces an immune response.
In some embodiments, RNA (in particular, mRNA) described in the present disclosure comprises a nucleic acid sequence encoding a peptide or polypeptide comprising an epitope for inducing an immune response against an antigen in a subject. The "peptide or polypeptide comprising an epitope for inducing an immune response against an antigen in a subject" is also designated herein as "vaccine antigen", "peptide and protein antigen" or simply "antigen".
In some embodiments, the RNA encoding the vaccine antigen is expressed in cells , e.g., muscle cells or antigen-presenting cells (APCs), of the subject to provide the vaccine antigen. In some embodiments, expression of the vaccine antigen is at the cell surface. In some embodiments, the vaccine antigen is presented in the context of MHC. In some embodiments, the RNA encoding the vaccine antigen is transiently expressed in cells of the subject. In some embodiments, the RNA encoding the vaccine antigen is administered systemically, e.g., intravenously. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in spleen occurs. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in antigen presenting cells, preferably professional antigen presenting cells occurs. In some embodiments, the antigen presenting cells are selected from the group consisting of dendritic cells, macrophages and B cells. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, no or essentially no expression of the RNA encoding the vaccine antigen in lung and/or liver occurs. In some embodiments, after systemic administration of the RNA encoding the vaccine antigen, expression of the RNA encoding the vaccine antigen in spleen is at least 5-fold the amount of expression in lung. In some embodiments, the RNA encoding the vaccine antigen is administered intramuscularly.
The vaccine antigen comprises an epitope for inducing an immune response against an antigen in a subject. Accordingly, the vaccine antigen comprises an antigenic sequence for inducing an immune response against an antigen in a subject. Such antigenic sequence may correspond to a target antigen or disease-associated antigen, e.g., a protein of an infectious agent (e.g., viral or bacterial antigen) or tumor antigen, or may correspond to an immunogenic variant thereof, or an immunogenic fragment of the target antigen or disease-associated antigen or the immunogenic variant thereof. Thus, the antigenic sequence may comprise at least an epitope of a target antigen or disease-associated antigen or an immunogenic variant thereof. The antigenic sequences, e.g., epitopes, suitable for use according to the disclosure typically may be derived from a target antigen, i.e. the antigen against which an immune response is to be elicited. For example, the antigenic sequences contained within the vaccine antigen may be a target antigen or a fragment or variant of a target antigen.
The antigenic sequence or a procession product thereof, e.g., a fragment thereof, may bind to the antigen receptor such as TCR or CAR carried by immune effector cells. In some embodiments, the antigenic sequence is selected from the group consisting of the antigen expressed by a target cell to which the immune effector cells are targeted or a fragment thereof, or a variant of the antigenic sequence or the fragment.
A vaccine antigen which may be provided to a subject according to the present disclosure by administering RNA encoding the vaccine antigen, preferably results in the induction of an immune response, e.g., in the stimulation, priming and/or expansion of immune effector cells, in the subject being provided the vaccine antigen. Said immune response, e.g., stimulated, primed and/or expanded immune effector cells, is preferably directed against a target antigen, in particular a target antigen expressed by diseased cells, tissues and/or organs, i.e., a disease- associated antigen. Thus, a vaccine antigen may comprise the disease-associated antigen, or a fragment or variant thereof. In some embodiments, such fragment or variant is immunologically equivalent to the disease-associated antigen.
In the context of the present disclosure, the term "fragment of an antigen" or "variant of an antigen" means an agent which results in the induction of an immune response, e.g., in the stimulation, priming and/or expansion of immune effector cells, which immune response, e.g., stimulated, primed and/or expanded immune effector cells, targets the antigen, i.e. a disease- associated antigen, in particular when presented by diseased cells, tissues and/or organs. Thus, the vaccine antigen may correspond to or may comprise the disease-associated antigen, may correspond to or may comprise a fragment of the disease-associated antigen or may correspond to or may comprise an antigen which is homologous to the disease-associated antigen or a fragment thereof. If the vaccine antigen comprises a fragment of the disease- associated antigen or an amino acid sequence which is homologous to a fragment of the disease-associated antigen said fragment or amino acid sequence may comprise an epitope of the disease-associated antigen to which the antigen receptor of the immune effector cells is targeted or a sequence which is homologous to an epitope of the disease-associated antigen. Thus, according to the disclosure, a vaccine antigen may comprise an immunogenic fragment of a disease-associated antigen or an amino acid sequence being homologous to an immunogenic fragment of a disease-associated antigen. An "immunogenic fragment of an antigen" according to the disclosure preferably relates to a fragment of an antigen which is capable of inducing an immune response against, e.g., stimulating, priming and/or expanding immune effector cells carrying an antigen receptor binding to, the antigen or cells expressing the antigen. It is preferred that the vaccine antigen (similar to the disease-associated antigen) provides the relevant epitope for binding by the antigen receptor present on the immune effector cells. In some embodiments, the vaccine antigen or a fragment thereof (similar to the disease-associated antigen) is expressed on the surface of a cell such as an antigen-presenting cell (optionally in the context of MHC) so as to provide the relevant epitope for binding by immune effector cells. The vaccine antigen may be a recombinant antigen. In some embodiments of all aspects of the invention, the RNA encoding the vaccine antigen is expressed in cells of a subject to provide the antigen or a procession product thereof for binding by the antigen receptor expressed by immune effector cells, said binding resulting in stimulation, priming and/or expansion of the immune effector cells. An "antigen" according to the present disclosure covers any substance that will elicit an immune response and/or any substance against which an immune response or an immune mechanism such as a cellular response and/or humoral response is directed. This also includes situations wherein the antigen is processed into antigen peptides and an immune response or an immune mechanism is directed against one or more antigen peptides, in particular if presented in the context of MHC molecules. In particular, an "antigen" relates to any substance, such as a peptide or polypeptide, that reacts specifically with antibodies or T-lymphocytes (T-cells). The term "antigen" may comprise a molecule that comprises at least one epitope, such as a T cell epitope. In some embodiments, an antigen is a molecule which, optionally after processing, induces an immune reaction, which may be specific for the antigen (including cells expressing the antigen). In some embodiments, an antigen is a disease-associated antigen, such as a tumor antigen, a viral antigen, or a bacterial antigen, or an epitope derived from such antigen. In some embodiments, an antigen is presented or present on the surface of cells of the immune system such as antigen presenting cells like dendritic cells or macrophages. An antigen or a procession product thereof such as a T cell epitope is in some embodiments bound by an antigen receptor. Accordingly, an antigen or a procession product thereof may react specifically with immune effector cells such as T-lymphocytes (T cells).
The term "autoantigen" or "self-antigen" refers to an antigen which originates from within the body of a subject (i.e., the autoantigen can also be called "autologous antigen") and which produces an abnormally vigorous immune response against this normal part of the body. Such vigorous immune reactions against autoantigens may be the cause of "autoimmune diseases". According to the present disclosure, any suitable antigen may be used, which is a candidate for an immune response, wherein the immune response may comprise a humoral or cellular immune response, or both. In the context of some embodiments of the present disclosure, the antigen is presented by a cell, such as by an antigen presenting cell, in the context of MHC molecules, which results in an immune response against the antigen. An antigen may be a product which corresponds to or is derived from a naturally occurring antigen. Such naturally occurring antigens may include or may be derived from allergens, viruses, bacteria, fungi, parasites and other infectious agents and pathogens or an antigen may also be a tumor antigen. According to the present disclosure, an antigen may correspond to a naturally occurring product, for example, a viral protein, or a part thereof.
The term "disease-associated antigen" is used in its broadest sense to refer to any antigen associated with a disease. A disease-associated antigen is a molecule which contains epitopes that will stimulate a host's immune system to make a cellular antigen-specific immune response and/or a humoral antibody response against the disease. Disease-associated antigens include pathogen-associated antigens, i.e., antigens which are associated with infection by microbes, typically microbial antigens (such as bacterial or viral antigens), or antigens associated with cancer, typically tumors, such as tumor antigens.
In some embodiments, the antigen is a tumor antigen, i.e., a part of a tumor cell, in particular those which primarily occur intracellularly or as surface antigens of tumor cells. In another embodiment, the antigen is a pathogen-associated antigen, i.e., an antigen derived from a pathogen, e.g., from a virus, bacterium, unicellular organism, or parasite, for example a viral antigen such as viral ribonucleoprotein or coat protein. In some embodiments, the antigen should be presented by MHC molecules which results in modulation, in particular activation of cells of the immune system, such as CD4+ and CD8+ lymphocytes, in particular via the modulation of the activity of a T-cell receptor.
The term "tumor antigen" or "tumor-associated antigen" refers to a constituent of cancer cells which may be derived from the cytoplasm, the cell surface or the cell nucleus. In particular, it refers to those antigens which are produced intracellularly or as surface antigens on tumor cells. For example, tumor antigens include the carcinoembryonal antigen, al-fetoprotein, isoferritin, and fetal sulphoglycoprotein, a2-H-ferroprotein and y-fetoprotein, as well as various virus tumor antigens. According to some embodiments of the present disclosure, a tumor antigen comprises any antigen which is characteristic for tumors or cancers as well as for tumor or cancer cells with respect to type and/or expression level.
The term "viral antigen" refers to any viral component having antigenic properties, i.e., being able to provoke an immune response in an individual. The viral antigen may be a viral ribonucleoprotein or an envelope protein.
The term "bacterial antigen" refers to any bacterial component having antigenic properties, i.e. being able to provoke an immune response in an individual. The bacterial antigen may be derived from the cell wall or cytoplasm membrane of the bacterium. The term "epitope" refers to an antigenic determinant in a molecule such as an antigen, i.e., to a part in or fragment of the molecule that is recognized by the immune system, for example, that is recognized by antibodies, T cells or B cells, in particular when presented in the context of MHC molecules. An epitope of a protein may comprises a continuous or discontinuous portion of said protein and, e.g., may be between about 5 and about 100, between about 5 and about 50, between about 8 and about 30, or about 10 and about 25 amino acids in length, for example, the epitope may be preferably 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, the epitope in the context of the present disclosure is a T cell epitope.
Terms such as "epitope", "fragment of an antigen", "immunogenic peptide" and "antigen peptide" are used interchangeably herein and, e.g., may relate to an incomplete representation of an antigen which is, e.g., capable of eliciting an immune response against the antigen or a cell expressing or comprising and presenting the antigen. In some embodiments, the terms relate to an immunogenic portion of an antigen. In some embodiments, it is a portion of an antigen that is recognized (i.e., specifically bound) by a T cell receptor, in particular if presented in the context of MHC molecules. Certain preferred immunogenic portions bind to an MHC class I or class II molecule. The term "epitope" refers to a part or fragment of a molecule such as an antigen that is recognized by the immune system. For example, the epitope may be recognized by T cells, B cells or antibodies. An epitope of an antigen may include a continuous or discontinuous portion of the antigen and may be between about 5 and about 100, such as between about 5 and about 50, between about 8 and about 30, or between about 8 and about 25 amino acids in length, for example, the epitope may be 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length. In some embodiments, an epitope is between about 10 and about 25 amino acids in length. The term "epitope" includes T cell epitopes.
The term "T cell epitope" refers to a part or fragment of a protein that is recognized by a T cell when presented in the context of MHC molecules. The term "major histocompatibility complex" and the abbreviation "MHC" includes MHC class I and MHC class II molecules and relates to a complex of genes which is present in all vertebrates. MHC proteins or molecules are important for signaling between lymphocytes and antigen presenting cells or diseased cells in immune reactions, wherein the MHC proteins or molecules bind peptide epitopes and present them for recognition by T cell receptors on T cells. The proteins encoded by the MHC are expressed on the surface of cells, and display both self-antigens (peptide fragments from the cell itself) and non-self-antigens (e.g., fragments of invading microorganisms) to a T cell. In the case of class I MHC/peptide complexes, the binding peptides are typically about 8 to about 10 amino acids long although longer or shorter peptides may be effective. In the case of class II MHC/peptide complexes, the binding peptides are typically about 10 to about 25 amino acids long and are in particular about 13 to about 18 amino acids long, whereas longer and shorter peptides may be effective.
The peptide and polypeptide antigen can be 2 to 100 amino acids, including for example, 5 amino acids, 10 amino acids, 15 amino acids, 20 amino acids, 25 amino acids, 30 amino acids, 35 amino acids, 40 amino acids, 45 amino acids, or 50 amino acids in length. In some embodiments, a peptide can be greater than 50 amino acids. In some embodiments, the peptide can be greater than 100 amino acids.
The peptide or polypeptide antigen can be any peptide or polypeptide that can induce or increase the ability of the immune system to develop antibodies and T cell responses to the peptide or polypeptide.
In some embodiments, vaccine antigen, i.e., an antigen whose inoculation into a subject induces an immune response, is recognized by an immune effector cell. In some embodiments, the vaccine antigen if recognized by an immune effector cell is able to induce in the presence of appropriate co-stimulatory signals, stimulation, priming and/or expansion of the immune effector cell carrying an antigen receptor recognizing the vaccine antigen. In the context of the embodiments of the present disclosure, the vaccine antigen may be, e.g., presented or present on the surface of a cell, such as an antigen presenting cell.
In some embodiments, an antigen is expressed in a diseased cell (such as tumor cell or an infected cell).
In some embodiments, an antigen is presented by a diseased cell (such as tumor cell or an infected cell). In some embodiments, an antigen receptor is a TCR which binds to an epitope of an antigen presented in the context of MHC. In some embodiments, binding of a TCR when expressed by T cells and/or present on T cells to an antigen presented by cells such as antigen presenting cells results in stimulation, priming and/or expansion of said T cells. In some embodiments, binding of a TCR when expressed by T cells and/or present on T cells to an antigen presented on diseased cells results in cytolysis and/or apoptosis of the diseased cells, wherein said T cells release cytotoxic factors, e.g., perforins and granzymes. In some embodiments, an antigen is expressed on the surface of a diseased cell (such as tumor cell or an infected cell). In some embodiments, an antigen receptor is a CAR which binds to an extracellular domain or to an epitope in an extracellular domain of an antigen. In some embodiments, a CAR binds to native epitopes of an antigen present on the surface of living cells. In some embodiments, binding of a CAR when expressed by T cells and/or present on T cells to an antigen present on cells such as antigen presenting cells results in stimulation, priming and/or expansion of said T cells. In some embodiments, binding of a CAR when expressed by T cells and/or present on T cells to an antigen present on diseased cells results in cytolysis and/or apoptosis of the diseased cells, wherein said T cells preferably release cytotoxic factors, e.g., perforins and granzymes.
According to some embodiments, an amino acid sequence enhancing antigen processing and/or presentation is fused, either directly or through a linker, to an antigenic peptide or polypeptide (antigenic sequence). Accordingly, in some embodiments, the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and/or presentation.
Such amino acid sequences enhancing antigen processing and/or presentation are preferably located at the C-terminus of the antigenic peptide or polypeptide (and optionally at the C- terminus of an amino acid sequence which breaks immunological tolerance), without being limited thereto. Amino acid sequences enhancing antigen processing and/or presentation as defined herein preferably improve antigen processing and presentation. In some embodiments, the amino acid sequence enhancing antigen processing and/or presentation as defined herein includes, without being limited thereto, sequences derived from the human MHC class I complex (HLA-B51, haplotype A2, B27/B51, Cw2/Cw3), in particular a sequence comprising the amino acid sequence of SEQ ID NO: 13 or a functional variant thereof.
In some embodiments, an amino acid sequence enhancing antigen processing and/or presentation comprises the amino acid sequence of SEQ. ID NO: 13, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 13, or a functional fragment of the amino acid sequence of SEQ ID NO: 13, or the amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 13. In some embodiments, an amino acid sequence enhancing antigen processing and/or presentation comprises the amino acid sequence of SEQ ID NO: 13. Accordingly, in some embodiments, the RNA described herein comprises at least one coding region encoding an antigenic peptide or polypeptide and an amino acid sequence enhancing antigen processing and/or presentation, said amino acid sequence enhancing antigen processing and/or presentation preferably being fused to the antigenic peptide or polypeptide, more preferably to the C-terminus of the antigenic peptide or polypeptide as described herein.
Furthermore, a secretory sequence may be fused to the N-terminus of the antigenic peptide or polypeptide.
Amino acid sequences derived from tetanus toxoid of Clostridium tetani may be employed to overcome self-tolerance mechanisms in order to efficiently mount an immune response to self-antigens by providing T-cell help during priming.
According to some embodiments, an amino acid sequence which breaks immunological tolerance is fused, either directly or through a linker to the antigenic peptide or polypeptide. Such amino acid sequences which break immunological tolerance are preferably located at the C-terminus of the antigenic peptide or polypeptide (and optionally at the N-terminus of the amino acid sequence enhancing antigen processing and/or presentation, wherein the amino acid sequence which breaks immunological tolerance and the amino acid sequence enhancing antigen processing and/or presentation may be fused either directly or through a linker, without being limited thereto. Amino acid sequences which break immunological tolerance as defined herein preferably improve T cell responses. In some embodiments, the amino acid sequence which breaks immunological tolerance as defined herein includes, without being limited thereto, sequences derived from tetanus toxoid-derived helper sequences p2 and pl6 (P2P16), in particular a sequence comprising the amino acid sequence of SEQ ID NO: 14 or a functional variant thereof.
In some embodiments, an amino acid sequence which breaks immunological tolerance comprises the amino acid sequence of SEQ ID NO: 14, an amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 14, or a functional fragment of the amino acid sequence of SEQ ID NO: 14, or the amino acid sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the amino acid sequence of SEQ ID NO: 14. In some embodiments, an amino acid sequence which breaks immunological tolerance comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, an antigen receptor is an antibody or B cell receptor which binds to an epitope in an antigen. In some embodiments, an antibody or B cell receptor binds to native epitopes of an antigen.
The term "expressed on the cell surface" or "associated with the cell surface" means that a molecule such as an antigen is associated with and located at the plasma membrane of a cell, wherein at least a part of the molecule faces the extracellular space of said cell and is accessible from the outside of said cell, e.g., by antibodies located outside the cell. In this context, a part may be, e.g., at least 4, at least 8, at least 12, or at least 20 amino acids. The association may be direct or indirect. For example, the association may be by one or more transmembrane domains, one or more lipid anchors, or by the interaction with any other protein, lipid, saccharide, or other structure that can be found on the outer leaflet of the plasma membrane of a cell. For example, a molecule associated with the surface of a cell may be a transmembrane protein having an extracellular portion or may be a protein associated with the surface of a cell by interacting with another protein that is a transmembrane protein. "Cell surface" or "surface of a cell" is used in accordance with its normal meaning in the art, and thus includes the outside of the cell which is accessible to binding by proteins and other molecules. An antigen is expressed on the surface of cells if it is located at the surface of said cells and is accessible to binding by, e.g., antigen-specific antibodies added to the cells. In some embodiments, an antigen expressed on the surface of cells is an integral membrane protein having an extracellular portion which may be recognized by a CAR.
The term "extracellular portion" or "exodomain" in the context of the present disclosure refers to a part of a molecule such as a protein that is facing the extracellular space of a cell and preferably is accessible from the outside of said cell, e.g., by binding molecules such as antibodies located outside the cell. In some embodiments, the term refers to one or more extracellular loops or domains or a fragment thereof.
The terms "T cell" and "T lymphocyte" are used interchangeably herein and include T helper cells (CD4+ T cells) and cytotoxic T cells (CTLs, CD8+ T cells) which comprise cytolytic T cells. The term "antigen-specific T cell" or similar terms relate to a T cell which recognizes the antigen to which the T cell is targeted, in particular when presented on the surface of antigen presenting cells or diseased cells such as cancer cells in the context of MHC molecules and preferably exerts effector functions of T cells. T cells are considered to be specific for antigen if the cells kill target cells expressing an antigen. T cell specificity may be evaluated using any of a variety of standard techniques, for example, within a chromium release assay or proliferation assay. Alternatively, synthesis of lymphokines (such as interferon-y) can be measured.
In some embodiments, the term "target" shall mean an agent such as a cell or tissue which is a target for an immune response such as a cellular immune response. Targets include cells that present an antigen or an antigen epitope, i.e., a peptide fragment derived from an antigen. In some embodiments, the target cell is a cell expressing an antigen and presenting said antigen with class I MHC.
"Antigen processing" refers to the degradation of an antigen into processing products which are fragments of said antigen (e.g., the degradation of a polypeptide into peptides) and the association of one or more of these fragments (e.g., via binding) with MHC molecules for presentation by cells, such as antigen-presenting cells to specific T-cells. Antigen-presenting cells can be distinguished in professional antigen presenting cells and non-professional antigen presenting cells.
The term "professional antigen presenting cells" relates to antigen presenting cells which constitutively express the Major Histocompatibility Complex class II (MHC class II) molecules required for interaction with naive T cells. If a T cell interacts with the MHC class II molecule complex on the membrane of the antigen presenting cell, the antigen presenting cell produces a co-stimulatory molecule inducing activation of the T cell. Professional antigen presenting cells comprise dendritic cells and macrophages.
The term "non-professional antigen presenting cells" relates to antigen presenting cells which do not constitutively express MHC class II molecules, but upon stimulation by certain cytokines such as interferon-gamma. Exemplary, non-professional antigen presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells or vascular endothelial cells.
The term "dendritic cell" (DC) refers to a subtype of phagocytic cells belonging to the class of antigen presenting cells. In some embodiments, dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells initially transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T cell activation potential. Immature dendritic cells constantly sample the surrounding environment for pathogens such as viruses and bacteria. Once they have come into contact with a presentable antigen, they become activated into mature dendritic cells and begin to migrate to the spleen or to the lymph node. Immature dendritic cells phagocytose pathogens and degrade their proteins into small pieces and upon maturation present those fragments at their cell surface using MHC molecules. Simultaneously, they upregulate cell-surface receptors that act as co-receptors in T cell activation such as CD80, CD86, and CD40 greatly enhancing their ability to activate T cells. They also upregulate CCR7, a chemotactic receptor that induces the dendritic cell to travel through the blood stream to the spleen or through the lymphatic system to a lymph node. Here they act as antigen-presenting cells and activate helper T cells and killer T cells as well as B cells by presenting them antigens, alongside non-antigen specific co-stimulatory signals. Thus, dendritic cells can actively induce a T cell- or B cell-related immune response. In some embodiments, the dendritic cells are splenic dendritic cells.
The term "macrophage" refers to a subgroup of phagocytic cells produced by the differentiation of monocytes. Macrophages which are activated by inflammation, immune cytokines or microbial products nonspecifically engulf and kill foreign pathogens within the macrophage by hydrolytic and oxidative attack resulting in degradation of the pathogen. Peptides from degraded proteins are displayed on the macrophage cell surface where they can be recognized by T cells, and they can directly interact with antibodies on the B cell surface, resulting in T and B cell activation and further stimulation of the immune response. Macrophages belong to the class of antigen presenting cells. In some embodiments, the macrophages are splenic macrophages.
By "antigen-responsive CTL" is meant a CD8+ T-cell that is responsive to an antigen or a peptide derived from said antigen, which is presented with class I MHC on the surface of antigen presenting cells.
According to the disclosure, CTL responsiveness may include sustained calcium flux, cell division, production of cytokines such as I FN -y and TNF-a, up-regulation of activation markers such as CD44 and CD69, and specific cytolytic killing of tumor antigen expressing target cells. CTL responsiveness may also be determined using an artificial reporter that accurately indicates CTL responsiveness.
"Activation" or "stimulation", as used herein, refers to the state of a cell that has been sufficiently stimulated to induce detectable cellular proliferation, such as an immune effector cell such as T cell. Activation can also be associated with initiation of signaling pathways, induced cytokine production, and detectable effector functions. The term "activated immune effector cells" refers to, among other things, immune effector cells that are undergoing cell division.
The term "priming" refers to a process wherein an immune effector cell such as a T cell has its first contact with its specific antigen and causes differentiation into effector cells such as effector T cells.
The term "expansion" refers to a process wherein a specific entity is multiplied. In some embodiments, the term is used in the context of an immunological response in which immune effector cells are stimulated by an antigen, proliferate, and the specific immune effector cell recognizing said antigen is amplified. In some embodiments, expansion leads to differentiation of the immune effector cells.
The terms "immune response" and "immune reaction" are used herein interchangeably in their conventional meaning and refer to an integrated bodily response to an antigen and may refer to a cellular immune response, a humoral immune response, or both. According to the disclosure, the term "immune response to" or "immune response against" with respect to an agent such as an antigen, cell or tissue, relates to an immune response such as a cellular response directed against the agent. An immune response may comprise one or more reactions selected from the group consisting of developing antibodies against one or more antigens and expansion of antigen-specific T-lymphocytes, such as CD4+ and CD8+ T- lymphocytes, e.g. CD8+ T-lymphocytes, which may be detected in various proliferation or cytokine production tests in vitro.
The terms "inducing an immune response" and "eliciting an immune response" and similar terms in the context of the present disclosure refer to the induction of an immune response, such as the induction of a cellular immune response, a humoral immune response, or both. The immune response may be protective/preventive/prophylactic and/or therapeutic. The immune response may be directed against any immunogen or antigen or antigen peptide, such as against a tumor-associated antigen or a pathogen-associated antigen (e.g., an antigen of a virus (such as influenza virus (A, B, or C), CMV or RSV)). "Inducing" in this context may mean that there was no immune response against a particular antigen or pathogen before induction, but it may also mean that there was a certain level of immune response against a particular antigen or pathogen before induction and after induction said immune response is enhanced. Thus, "inducing the immune response" in this context also includes "enhancing the immune response". In some embodiments, after inducing an immune response in an individual, said individual is protected from developing a disease such as an infectious disease or a cancerous disease or the disease condition is ameliorated by inducing an immune response.
The terms "cellular immune response", "cellular response", "cell-mediated immunity" or similar terms are meant to include a cellular response directed to cells characterized by expression of an antigen and/or presentation of an antigen with class I or class II MHC. The cellular response relates to cells called T cells or T lymphocytes which act as either "helpers" or "killers". The helper T cells (also termed CD4+ T cells) play a central role by regulating the immune response and the killer cells (also termed cytotoxic T cells, cytolytic T cells, CD8+ T cells or CTLs) kill cells such as diseased cells.
The term "humoral immune response" refers to a process in living organisms wherein antibodies are produced in response to agents and organisms, which they ultimately neutralize and/or eliminate. The specificity of the antibody response is mediated by T and/or B cells through membrane-associated receptors that bind antigen of a single specificity. Following binding of an appropriate antigen and receipt of various other activating signals, B lymphocytes divide, which produces memory B cells as well as antibody secreting plasma cell clones, each producing antibodies that recognize the identical antigenic epitope as was recognized by its antigen receptor. Memory B lymphocytes remain dormant until they are subsequently activated by their specific antigen. These lymphocytes provide the cellular basis of memory and the resulting escalation in antibody response when re-exposed to a specific antigen.
The term "antibody" as used herein, refers to an immunoglobulin molecule, which is able to specifically bind to an epitope on an antigen. In particular, the term "antibody" refers to a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. The term "antibody" includes monoclonal antibodies, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies and combinations of any of the foregoing. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region (CH). Each light chain is comprised of a light chain variable region (VL) and a light chain constant region (CL). The variable regions and constant regions are also referred to herein as variable domains and constant domains, respectively. The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The CDRs of a VH are termed HCDR1, HCDR2 and HCDR3, the CDRs of a VL are termed LCDR1, LCDR2 and LCDR3. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of an antibody comprise the heavy chain constant region (CH) and the light chain constant region (CL), wherein CH can be further subdivided into constant domain CHI, a hinge region, and constant domains CH2 and CH3 (arranged from amino-terminus to carboxy-terminus in the following order: CHI, CH2, CH3). The constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. Antibodies may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
The term "immunoglobulin" relates to proteins of the immunoglobulin superfamily, such as to antigen receptors such as antibodies or the B cell receptor (BCR). The immunoglobulins are characterized by a structural domain, i.e., the immunoglobulin domain, having a characteristic immunoglobulin (Ig) fold. The term encompasses membrane bound immunoglobulins as well as soluble immunoglobulins. Membrane bound immunoglobulins are also termed surface immunoglobulins or membrane immunoglobulins, which are generally part of the BCR. Soluble immunoglobulins are generally termed antibodies. Immunoglobulins generally comprise several chains, typically two identical heavy chains and two identical light chains which are linked via disulfide bonds. These chains are primarily composed of immunoglobulin domains, such as the VL (variable light chain) domain, CL (constant light chain) domain, VH (variable heavy chain) domain, and the CH (constant heavy chain) domains CHI, CH2, CH3, and CH4. There are five types of mammalian immunoglobulin heavy chains, i.e., a, 8, e, y, and p which account for the different classes of antibodies, i.e., IgA, IgD, IgE, IgG, and IgM. As opposed to the heavy chains of soluble immunoglobulins, the heavy chains of membrane or surface immunoglobulins comprise a transmembrane domain and a short cytoplasmic domain at their carboxy-terminus. In mammals there are two types of light chains, i.e., lambda and kappa. The immunoglobulin chains comprise a variable region and a constant region. The constant region is essentially conserved within the different isotypes of the immunoglobulins, wherein the variable part is highly divers and accounts for antigen recognition.
The terms "vaccination" and "immunization" describe the process of treating an individual for therapeutic or prophylactic reasons and relate to the procedure of administering one or more immunogen(s) or antigen(s) or derivatives thereof, in particular in the form of RNA (especially mRNA) coding therefor, as described herein to an individual and stimulating an immune response against said one or more immunogen(s) or antigen(s) or cells characterized by presentation of said one or more immunogen(s) or antigen(s).
By "cell characterized by presentation of an antigen" or "cell presenting an antigen" or "MHC molecules which present an antigen on the surface of an antigen presenting cell" or similar expressions is meant a cell such as a diseased cell, in particular a tumor cell or an infected cell, or an antigen presenting cell presenting the antigen or an antigen peptide, either directly or following processing, in the context of MHC molecules, such as MHC class I and/or MHC class II molecules. In some embodiments, the MHC molecules are MHC class I molecules.
The term "allergen" refers to a kind of antigen which originates from outside the body of a subject (/.e., the allergen can also be called "heterologous antigen") and which produces an abnormally vigorous immune response in which the immune system of the subject fights off a perceived threat that would otherwise be harmless to the subject. "Allergies" are the diseases caused by such vigorous immune reactions against allergens. An allergen usually is an antigen which is able to stimulate a type-1 hypersensitivity reaction in atopic individuals through immunoglobulin E (IgE) responses. Particular examples of allergens include allergens derived from peanut proteins (e.g., Ara h 2.02), ovalbumin, grass pollen proteins (e.g., Phi p 5), and proteins of dust mites (e.g., Der p 2).
The term "growth factors" refers to molecules which are able to stimulate cellular growth, proliferation, healing, and/or cellular differentiation. Typically, growth factors act as signaling molecules between cells. The term "growth factors" include particular cytokines and hormones which bind to specific receptors on the surface of their target cells. Examples of growth factors include bone morphogenetic proteins (BMPs), fibroblast growth factors (FGFs), vascular endothelial growth factors (VEGFs), such as VEGFA, epidermal growth factor (EGF), insulin-like growth factor, ephrins, macrophage colony-stimulating factor, granulocyte colony- stimulating factor, granulocyte macrophage colony-stimulating factor, neuregulins, neurotrophins (e.g., brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF)), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS) (anti- apoptotic survival factor), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factors (transforming growth factor alpha (TGF-a), transforming growth factor beta (TGF-0)), and tumor necrosis factor-alpha (TNF-a). In some embodiments, a "growth factor" is a peptide or polypeptide growth factor.
The term "protease inhibitors" refers to molecules, in particular peptides or polypeptides, which inhibit the function of proteases. Protease inhibitors can be classified by the protease which is inhibited (e.g., aspartic protease inhibitors) or by their mechanism of action (e.g., suicide inhibitors, such as serpins). Particular examples of protease inhibitors include serpins, such as alpha 1-antitrypsin, aprotinin, and bestatin.
The term "enzymes" refers to macromolecular biological catalysts which accelerate chemical reactions. Like any catalyst, enzymes are not consumed in the reaction they catalyze and do not alter the equilibrium of said reaction. Unlike many other catalysts, enzymes are much more specific. In some embodiments, an enzyme is essential for homeostasis of a subject, e.g., any malfunction (in particular, decreased activity which may be caused by any of mutation, deletion or decreased production) of the enzyme results in a disease. Examples of enzymes include herpes simplex virus type 1 thymidine kinase (HSV1-TK), hexosaminidase, phenylalanine hydroxylase, pseudocholinesterase, and lactase.
The term "receptors" refers to protein molecules which receive signals (in particular chemical signals called ligands) from outside a cell. The binding of a signal (e.g., ligand) to a receptor causes some kind of response of the cell, e.g., the intracellular activation of a kinase. Receptors include transmembrane receptors (such as ion channel-linked (ionotropic) receptors, G protein-linked (metabotropic) receptors, and enzyme-linked receptors) and intracellular receptors (such as cytoplasmic receptors and nuclear receptors). Particular examples of receptors include steroid hormone receptors, growth factor receptors, and peptide receptors (i.e., receptors whose ligands are peptides), such as P-selectin glycoprotein ligand-1 (PSGL-1). The term "growth factor receptors" refers to receptors which bind to growth factors.
The term "apoptosis regulators" refers to molecules, in particular peptides or polypeptides, which modulate apoptosis, i.e., which either activate or inhibit apoptosis. Apoptosis regulators can be grouped into two broad classes: those which modulate mitochondrial function and those which regulate caspases. The first class includes proteins (e.g., BCL-2, BCL-xL) which act to preserve mitochondrial integrity by preventing loss of mitochondrial membrane potential and/or release of pro-apoptotic proteins such as cytochrome C into the cytosol. Also to this first class belong proapoptotic proteins (e.g., BAX, BAK, BIM) which promote release of cytochrome C. The second class includes proteins such as the inhibitors of apoptosis proteins (e.g., XIAP) or FLIP which block the activation of caspases.
The term "transcription factors" relates to proteins which regulate the rate of transcription of genetic information from DNA to messenger RNA, in particular by binding to a specific DNA sequence. Transcription factors may regulate cell division, cell growth, and cell death throughout life; cell migration and organization during embryonic development; and/or in response to signals from outside the cell, such as a hormone. Transcription factors contain at least one DNA-binding domain which binds to a specific DNA sequence, usually adjacent to the genes which are regulated by the transcription factors. Particular examples of transcription factors include MECP2, FOXP2, FOXP3, the STAT protein family, and the HOX protein family.
The term "tumor suppressor proteins" relates to molecules, in particular peptides or polypeptides, which protect a cell from one step on the path to cancer. Tumor-suppressor proteins (usually encoded by corresponding tumor-suppressor genes) exhibit a weakening or repressive effect on the regulation of the cell cycle and/or promote apoptosis. Their functions may be one or more of the following: repression of genes essential for the continuing of the cell cycle; coupling the cell cycle to DNA damage (as long as damaged DNA is present in a cell, no cell division should take place); initiation of apoptosis, if the damaged DNA cannot be repaired; metastasis suppression (e.g., preventing tumor cells from dispersing, blocking loss of contact inhibition, and inhibiting metastasis); and DNA repair. Particular examples of tumor- suppressor proteins include p53, phosphatase and tensin homolog (PTEN), SWI/SNF (SWItch/Sucrose Non-Fermentable), von Hippel-Lindau tumor suppressor (pVHL), adenomatous polyposis coli (APC), CD95, suppression of tumorigenicity 5 (ST5), suppression of tumorigenicity 5 (ST5), suppression of tumorigenicity 14 (ST14), and Yippee-like 3 (YPEL3). The term "structural proteins" refers to proteins which confer stiffness and rigidity to otherwise-fluid biological components. Structural proteins are mostly fibrous (such as collagen and elastin) but may also be globular (such as actin and tubulin). Usually, globular proteins are soluble as monomers, but polymerize to form long, fibers which, for example, may make up the cytoskeleton. Other structural proteins are motor proteins (such as myosin, kinesin, and dynein) which are capable of generating mechanical forces, and surfactant proteins. Particular examples of structural proteins include collagen, surfactant protein A, surfactant protein B, surfactant protein C, surfactant protein D, elastin, tubulin, actin, and myosin.
The term "reprogramming factors" or "reprogramming transcription factors" relates to molecules, in particular peptides or polypeptides, which, when expressed in somatic cells optionally together with further agents such as further reprogramming factors, lead to reprogramming or de-differentiation of said somatic cells to cells having stem cell characteristics, in particular pluripotency. Particular examples of reprogramming factors include OCT4, SOX2, c-MYC, KLF4, LIN28, and NANOG.
The term "genomic engineering proteins" relates to proteins which are able to insert, delete or replace DNA in the genome of a subject. Particular examples of genomic engineering proteins include meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly spaced short palindromic repeat-CRISPR- associated protein 9 (CRISPR-Cas9).
The term "blood proteins" relates to peptides or polypeptides which are present in blood plasma of a subject, in particular blood plasma of a healthy subject. Blood proteins have diverse functions such as transport (e.g., albumin, transferrin), enzymatic activity (e.g., thrombin or ceruloplasmin), blood clotting (e.g., fibrinogen), defense against pathogens (e.g., complement components and immunoglobulins), protease inhibitors (e.g., alpha 1- antitrypsin), etc. Particular examples of blood proteins include thrombin, serum albumin, Factor VII, Factor VIII, insulin, Factor IX, Factor X, tissue plasminogen activator, protein C, von Willebrand factor, antithrombin III, glucocerebrosidase, erythropoietin, granulocyte colony stimulating factor (G-CSF), modified Factor VIII, and anticoagulants.
Thus, in some embodiments, the pharmaceutically active peptide or polypeptide is (i) a cytokine, preferably selected from the group consisting of erythropoietin (EPO), interleukin 4 (IL-2), and interleukin 10 (IL-11), more preferably EPO; (ii) an adhesion molecule, in particular an integrin; (iii) an immunoglobulin, in particular an antibody; (iv) an immunologically active compound, in particular an antigen, such as a viral or bacterial antigen, e.g., an antigen of SARS-CoV-2, e.g., a spike (S) protein of SARS-CoV-2 or a variant thereof; (v) a hormone, in particular vasopressin, insulin or growth hormone; (vi) a growth factor, in particular VEGFA; (vii) a protease inhibitor, in particular alpha 1-antitrypsin; (viii) an enzyme, preferably selected from the group consisting of herpes simplex virus type 1 thymidine kinase (HSV1-TK), hexosaminidase, phenylalanine hydroxylase, pseudocholinesterase, pancreatic enzymes, and lactase; (ix) a receptor, in particular growth factor receptors; (x) an apoptosis regulator, in particular BAX; (xi) a transcription factor, in particular FOXP3; (xii) a tumor suppressor protein, in particular p53; (xiii) a structural protein, in particular surfactant protein B; (xiv) a reprogramming factor, e.g., selected from the group consisting of OCT4, SOX2, c-MYC, KLF4, LIN28 and NANOG; (xv) a genomic engineering protein, in particular clustered regularly spaced short palindromic repeat-CRISPR-associated protein 9 (CRISPR-Cas9); and (xvi) a blood protein, in particular fibrinogen.
In some embodiments, a pharmaceutically active peptide or polypeptide comprises one or more antigens or one or more epitopes, i.e., administration of the peptide or polypeptide to a subject elicits an immune response against the one or more antigens or one or more epitopes in a subject which may be therapeutic or partially or fully protective.
In some embodiments, the RNA encodes at least one epitope, e.g., at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes.
In some embodiments, the target antigen is a tumor antigen and the antigenic sequence (e.g., an epitope) is derived from the tumor antigen. The tumor antigen may be a "standard" antigen, which is generally known to be expressed in various cancers. The tumor antigen may also be a "neo-antigen", which is specific to an individual's tumor and has not been previously recognized by the immune system. A neo-antigen or neo-epitope may result from one or more cancer-specific mutations in the genome of cancer cells resulting in amino acid changes. If the tumor antigen is a neo-antigen, the vaccine antigen preferably comprises an epitope or a fragment of said neo-antigen comprising one or more amino acid changes.
Examples of tumor antigens include, without limitation, p53, ART-4, BAGE, beta-catenin/m, Bcr-abL CAMEL, CAP-1 , CASP-8, CDC27/m, CDK4/m, CEA, the cell surface proteins of the claudin family, such as CLAUDIN-6, CLAUDIN-18.2 and CLAUDIN-12, c-MYC, CT, Cyp-B, DAM, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, Gap 100, HAGE, HER-2/neu, HPV-E7, HPV-E6, HAST- 2, hTERT (or hTRT), LAGE, LDLR/FUT, MAGE-A, preferably MAGE-A1 , MAGE-A2, MAGE- A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE-A9, MAGE-A 10, MAGE-A 1 1, or MAGE- A12, MAGE-B, MAGE-C, MART- 1 /Melan-A, MC1R, Myosin/m, MUC1, MUM-1, MUM- 2, MUM-3, NA88-A, NF1 , NY-ESO-1 , NY-BR-1 , pl90 minor BCR-abL, Pml/RARa, PRAME, proteinase 3, PSA, PSM, RAGE, RU1 or RU2, SAGE, SART-1 or SART-3, SCGB3A2, SCP1 , SCP2, SCP3, SSX, SURVIVIN, TEL/AML1 , TPI/m, TRP-1 , TRP-2, TRP-2/INT2, TPTE, WT, and WT-1.
Cancer mutations vary with each individual. Thus, cancer mutations that encode novel epitopes (neo-epitopes) represent attractive targets in the development of vaccine compositions and immunotherapies. The efficacy of tumor immunotherapy relies on the selection of cancer-specific antigens and epitopes capable of inducing a potent immune response within a host. RNA can be used to deliver patient-specific tumor epitopes to a patient. Dendritic cells (DCs) residing in the spleen represent antigen-presenting cells of particular interest for RNA expression of immunogenic epitopes or antigens such as tumor epitopes. The use of multiple epitopes has been shown to promote therapeutic efficacy in tumor vaccine compositions. Rapid sequencing of the tumor mutanome may provide multiple epitopes for individualized vaccines which can be encoded by RNA (in particular, mRNA) described herein, e.g., as a single polypeptide wherein the epitopes are optionally separated by linkers. In some embodiments of the present disclosure, the RNA (in particular, mRNA) encodes at least one epitope, at least two epitopes, at least three epitopes, at least four epitopes, at least five epitopes, at least six epitopes, at least seven epitopes, at least eight epitopes, at least nine epitopes, or at least ten epitopes. Exemplary embodiments include RNA (in particular, mRNA) that encodes at least five epitopes (termed a "pentatope") and RNA (in particular, mRNA) that encodes at least ten epitopes (termed a "decatope").
In some embodiments, the antigen or epitope is derived from a pathogen-associated antigen, in particular from a viral antigen.
In some embodiments, the antigen or epitope is derived from a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof. Thus, in some embodiments, the RNA, e.g., mRNA, used in the present disclosure encodes an amino acid sequence comprising a coronavirus protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus protein or the immunogenic variant thereof.
In some embodiments, the antigen or epitope is derived from a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof. Thus, in some embodiments, the RNA (in particular, mRNA) described in the present disclosure encodes an amino acid sequence comprising a coronavirus S protein, an immunogenic variant thereof, or an immunogenic fragment of the coronavirus S protein or the immunogenic variant thereof. In some embodiments, the coronavirus is MERS- CoV. In some embodiments, the coronavirus is SARS-CoV. In some embodiments, the coronavirus is SARS-CoV-2.
The term "immunologically equivalent" means that the immunologically equivalent molecule such as the immunologically equivalent amino acid sequence exhibits the same or essentially the same immunological properties and/or exerts the same or essentially the same immunological effects, e.g., with respect to the type of the immunological effect. In the context of the present disclosure, the term "immunologically equivalent" is preferably used with respect to the immunological effects or properties of antigens or antigen variants used for immunization. For example, an amino acid sequence is immunologically equivalent to a reference amino acid sequence if said amino acid sequence when exposed to the immune system of a subject induces an immune reaction having a specificity of reacting with the reference amino acid sequence. Thus, in some embodiments, a molecule which is immunologically equivalent to an antigen exhibits the same or essentially the same properties and/or exerts the same or essentially the same effects regarding the stimulation, priming and/or expansion of T cells as the antigen to which the T cells are targeted. miRNA binding sequences
RNA described herein comprises one or more miRNA binding sequences. In some embodiments, the one or more miRNA binding sequences function to recruit one or more miRNA molecules expressed, e.g., selectively expressed, in one or more cell or tissue types in which expression of the RNA is not desired. In some embodiments, the one or more miRNA molecules target the RNA thereby modulating (e.g., inhibiting) the translation of the target RNA or destabilizing the target RNA. In some embodiments, the one or more miRNA molecules are not present or are present in a lower amount in one or more cell or tissue types in which expression of the RNA is desired. In some embodiments, one or more miRNAs endogenously present in one or more cell or tissue types in which expression of the RNA is not desired can target RNA possessing one or more binding sites for the one or more miRNAs. In some embodiments, the miRNAs are expressed or are selectively expressed in one or more cell or tissue types in which expression of the RNA is not desired. MicroRNAs (miRNAs) are small (~20-25 nt) noncoding RNAs that are abundant in cells and function as crucial regulators of gene expression. The canonical model of miRNA biogenesis is tightly controlled by multiple enzymes that produce three major RNA products: primary (pri- ), precursor (pre-), and mature miRNA. Mature miRNA originates from the 5' arm or the 3' arm of the precursor product and is denoted with a -5p or -3p suffix, respectively. Either one of the arms is incorporated into the RNA induced silencing complex (RISC) and becomes functional, whereas the other arm is a byproduct and is degraded, or both mature miR-5p and miR-3p arms of a pre-miRNA can be associated with the RISC.
Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, endothelial cells (miR-126, miR-17-92), hepatocytes (miR-122, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, miR-4783-3p), muscle (miR-208, miR-133, miR-206), hematopoietic cells (miR-142-3p, miR-142-5p, miR-16, miR-223-3p, miR-150-5p, miR-650, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126). Accordingly, expression of RNA can be repressed in one or more selected tissues by incorporating one or more binding sites for one or more miRNAs known to be present in the selected tissue(s). In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR- 122, miR-142-3p, miR-206, miR-208, miR-216, miR-217, miR-16-5p, miR-223-3p, miR-150-5p, miR-650, miR-621, miR-4695-5p, miR-4695-3p, miR-4783-5p, or miR-4783-3p. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, miR-206, miR-208, miR-216, or miR-217. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p, miR-126-3p, miR-122, miR-142-3p, or miR-206. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR- 126-5p, miR-126-3p, miR-122, or miR-142-3p. In some instances the RNA comprises one or more miRNA binding sequences for an miRNA selected from miR-126-5p or miR-126-3p.
Human miR-126 (also known as miR-126-3p) and its complement, miR-126* (also known as miR-126-5p) originate from the same precursor, and their locus is hosted by intron-7 of the Egfl7 (epidermal grow factor-like domain 7) gene on chromosome 9. MiR-126-3p and miR- 126-5p are expressed in endothelial cells, throughout capillaries as well as larger blood vessels. Human miR-122 is encoded at a single genomic locus in chromosome 18, and miR-122 (more particularly miR-122-5p) is highly expressed in the liver. Human miR-142 (particularly miR-142-3p and miR-142-5p) is encoded in chromosome 17, and is highly expressed in hematopoietic cells.
In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises one or more miRNA binding sequences that are complementary to one or more miRNAs. An RNA can comprise any number of miRNA binding sequences (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or more). 2 or more miRNA binding sequences may be more potent at repressing gene expression of RNA than a single miRNA binding sequence. Limitations on the size of the RNA make it practical for 1, 2 or 3 miRNA binding sequences to be present. Where the RNA contains multiple miRNA binding sequences, each of the miRNA binding sequences can bind to the same or a different miRNA, or a combination thereof. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises one miRNA binding sequence. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises two miRNA binding sequences. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises three miRNA binding sequences. In some embodiments, the RNA described herein comprising one or more miRNA binding sequences comprises four miRNA binding sequences. In some embodiments, the miRNA binding sequences bind to the same miRNA, to different miRNAs, or a combination thereof. In some embodiments, the miRNA binding sequences bind to the same miRNA. In some embodiments, the miRNA binding sequences are linked together in series in the RNA.
A miRNA binding sequence can be of any length sufficient to recruit the desired miRNA. In certain embodiments, the miRNA binding sequence is about 5 to about 25 nucleotides in length (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 nucleotides).
A miRNA binding sequence can have any amount of complementarity with its cognate miRNA (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, and 25 complementary nucleotides). In some embodiments, the miRNA binding sequence is engineered to comprise specific combinations of Watson-Crick base pairs and mismatches with its cognate miRNA binding partner. In some embodiments, the miRNA binding sequence is an exact Watson-Crick complement of the miRNA, i.e., it is fully complementary with its cognate miRNA. An RNA can comprise one or more miRNA binding sequences at any portion of the RNA, as long as the position of the one or more miRNA binding sequences does not interfere with proper expression of a pharmaceutically active peptide or polypeptide. In some embodiments, the one or more miRNA binding sequences are present in the 3' UTR of a target RNA. In some embodiments, the one or more miRNA binding sequences are present between the open reading frame and the 3' UTR of a target RNA.
In some embodiments, the one or more cell or tissue types in which expression of the RNA is not desired comprises endothelial cells or endothelial tissues. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of mir-126, e.g., miR-126-5p and/or miR- 126-3p, miR-216a, miR-217 or a combination thereof.
In some embodiments, the one or more cell or tissue types in which expression of the RNA is not desired comprises myocardial cells or myocardial tissues. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of miR-208b, miR-499a or a combination thereof.
In some embodiments, the one or more cell or tissue types in which expression of the RNA is not desired comprises hematopoietic cells, e.g., immune cells, or hematopoietic tissues, e.g., immune tissues. In some embodiments, the immune cells comprise dendritic cells and/or macrophages, e.g., Kupffer cells. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules selected from the group consisting of miR-142-3p, miR-16, miR-223, miR-451, miR-150 or a combination thereof. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-142- 3p.
In some embodiments, the one or more cell or tissue types in which expression of the RNA is not desired comprises hepatic cells or hepatic tissues. In some embodiments, the hepatic cells comprise hepatocytes. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-122.
In some embodiments, the one or more cell or tissue types in which expression of the RNA is not desired comprises muscle cells or muscle tissues. In these embodiments, the one or more miRNA binding sequences in some embodiments function to recruit one or more miRNA molecules comprising miR-206.
The miRNA species and the corresponding binding sequences that may be used herein include species selected from the group shown in the table below.
Figure imgf000113_0001
In some embodiments, an RNA described here comprises a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR-122, or a multiple thereof, e.g., a sequence wherein a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR-122 is repeated 2 times, 3 times, or even more. In some embodiments, a binding sequence for a miRNA selected from miR-126-5p, miR-126-3p, miR-142-3p or miR- 122, or a multiple thereof, is located between the open reading frame and the 3' UTR.
In some embodiments, an RNA described here comprises a binding sequence for miR-126-5p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-5p is repeated 2 times, 3 times, or even more. In some embodiments, a binding sequence for miR-126-5p or a multiple thereof is located between the open reading frame and the 3' UTR.
In some embodiments, an RNA described here comprises a binding sequence for miR-126-3p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-3p is repeated 2 times, 3 times, or even more. In some embodiments, a binding sequence for miR-126-3p or a multiple thereof is located between the open reading frame and the 3' UTR.
In some embodiments, an RNA described here comprises a binding sequence for miR-126-5p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-5p is repeated 2 times, 3 times, or even more, and a binding sequence for miR-126-3p or a multiple thereof, e.g., a sequence wherein a binding sequence for miR-126-3p is repeated 2 times, 3 times, or even more. In some embodiments, a binding sequence for miR-126-5p or a multiple thereof, and a binding sequence for miR-126-3p or a multiple thereof is located between the open reading frame and the 3' UTR.
RNA delivery
RNA described herein may be delivered for therapeutic applications described herein using any appropriate methods known in the art, including, e.g., delivery as naked RNA, or delivery mediated by delivery vehicles.
In some embodiments, after administration of the RNA (in particular, mRNA) compositions/formulations described herein, at least a portion of the RNA is delivered to a target cell or target organ. In some embodiments, at least a portion of the RNA is delivered to the cytosol of the target cell. In some embodiments, the RNA is RNA (in particular, mRNA) encoding a peptide or polypeptide and the RNA is translated by the target cell to produce the peptide or polypeptide. In some embodiments, the target cell is a cell in the liver. In some embodiments, the target cell is a muscle cell. In some embodiments the target cell is a tumor cell or a cell in the tumor microenvironment. In some embodiments, the target cell is a blood cell. In some embodiments, the target cell is a cell in the lymph nodes. In some embodiments, the target cell is a cell in the lung. In some embodiments, the target cell is a cell in the skin. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen. In some embodiments, the target cell is a T cell. In some embodiments, the target cell is a B cell. In some embodiments, the target cell is a NK cell. In some embodiments, the target cell is a monocyte. Thus, RNA (in particular, mRNA) compositions/formulations described herein may be used for delivering RNA to such target cell.
Some aspects of the disclosure involve the targeted delivery of the mRNA disclosed herein to certain cells or tissues. In some embodiments, the disclosure involves targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen. Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA (in particular, mRNA) administered is RNA (in particular, mRNA) encoding an antigen or epitope for inducing an immune response. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen. The "lymphatic system" is part of the circulatory system and an important part of the immune system, comprising a network of lymphatic vessels that carry lymph. The lymphatic system consists of lymphatic organs, a conducting network of lymphatic vessels, and the circulating lymph. The primary or central lymphoid organs generate lymphocytes from immature progenitor cells. The thymus and the bone marrow constitute the primary lymphoid organs. Secondary or peripheral lymphoid organs, which include lymph nodes and the spleen, maintain mature naive lymphocytes and initiate an adaptive immune response.
Lipid-based RNA delivery systems, depending on the composition of the RNA delivery sytems used, may be useful for obtaining RNA expression in the liver. Liver accumulation is caused by the discontinuous nature of the hepatic vasculature or the lipid metabolism (liposomes and lipid or cholesterol conjugates). In some embodiments, the target organ for RNA expression is liver and the target tissue is liver tissue. The delivery to such target tissue is preferred, in particular, if presence of RNA or of the encoded peptide or polypeptide in this organ or tissue is desired and/or if it is desired to express large amounts of the encoded peptide or polypeptide and/or if systemic presence of the encoded peptide or polypeptide, in particular in significant amounts, is desired or required.
Delivery vehicles
To overcome the barriers to safe and effective RNA delivery, RNA may be administered with one or more delivery vehicles that protect the RNA from degradation, maximize delivery to on-target cells and minimize exposure to off-target cells. Such RNA delivery vehicles may complex or encapsulate RNA and include a range of materials, including polymers and lipids. In some embodiments, such RNA delivery vehicles may form particles with RNA.
RNA, in particular mRNA, described herein may be present in particles comprising (i) the RNA, and (ii) at least one cationic or cationically ionizable compound such as a polymer or lipid complexing the RNA. Electrostatic interactions between positively charged molecules such as polymers and lipids and negatively charged RNA are involved in particle formation. This results in complexation and spontaneous formation of RNA particles. Different types of RNA containing particles have been described previously to be suitable for delivery of RNA in particulate form (cf., e.g., Kaczmarek, J. C. et al., 2017, Genome Medicine 9, 60). For non-viral RNA delivery vehicles, nanoparticle encapsulation of RNA physically protects RNA from degradation and, depending on the specific chemistry, can aid in cellular uptake and endosomal escape.
In the context of the present disclosure, the term "particle" relates to a structured entity formed by molecules or molecule complexes, in particular particle forming compounds. In some embodiments, the particle contains an envelope (e.g., one or more layers or lamellas) made of one or more types of amphiphilic substances (e.g., amphiphilic lipids). In this context, the expression "amphiphilic substance" means that the substance possesses both hydrophilic and lipophilic properties. The envelope may also comprise additional substances (e.g., additional lipids) which do not have to be amphiphilic. Thus, the particle may be a monolameliar or multilamellar structure, wherein the substances constituting the one or more layers or lamellas comprise one or more types of amphiphilic substances (in particular selected from the group consisting of amphiphilic lipids) optionally in combination with additional substances (e.g., additional lipids) which do not have to be amphiphilic. In some embodiments, the term "particle" relates to a micro- or nano-sized structure, such as a micro- or nano-sized compact structure. According to the present disclosure, the term "particle" includes nanoparticles.
An "RNA particle" can be used to deliver RNA to a target site of interest (e.g., cell, tissue, organ, and the like). An RNA particle may be formed from lipids comprising at least one cationic or cationically ionizable lipid. Without intending to be bound by any theory, it is believed that the cationic or cationically ionizable lipid combines together with the RNA to form aggregates, and this aggregation results in colloidally stable particles.
RNA particles described herein include lipid nanoparticle (LNP)-based and lipoplex (LPX)-based formulations.
A lipoplex (LPX) described herein is obtainable from mixing two aqueous phases, namely a phase comprising RNA and a phase comprising a dispersion of lipids. In some embodiments, the lipid phase comprises liposomes.
In some embodiments, liposomes are self-closed unilamellar or multilamellar vesicular particles wherein the lamellae comprise lipid bilayers and the encapsulated lumen comprises an aqueous phase. A prerequisite for using liposomes for nanoparticle formation is that the lipids in the mixture as required are able to form lamellar (bilayer) phases in the applied aqueous environment.
In some embodiments, liposomes comprise unilamellar or multilamellar phospholipid bilayers enclosing an aqueous core (also referred to herein as an aqueous lumen). They may be prepared from materials possessing polar head (hydrophilic) groups and nonpolar tail (hydrophobic) groups. In some embodiments, cationic lipids employed in formulating liposomes designed for the delivery of RNA are amphiphilic in nature and consist of a positively charged (cationic) amine head group linked to a hydrocarbon chain or cholesterol derivative via glycerol.
In some embodiments, lipoplexes are multilamellar liposome-based formulations that form upon electrostatic interaction of cationic liposomes with RNAs. In some embodiments, formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA-lipoplexes.
In some embodiments, an LPX particle comprises an amphiphilic lipid, in particular cationic or cationically ionizable amphiphilic lipid, and RNA (especially mRNA) as described herein. In some embodiments, electrostatic interactions between positively charged liposomes (made from one or more amphiphilic lipids, in particular cationic or cationically ionizable amphiphilic lipids) and negatively charged RNA (especially mRNA) results in complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes may be generally synthesized using a cationic or cationically ionizable amphiphilic lipid, such as DOTMA and/or DODMA, and optionally additional lipids, such as DOPE or DSPC.
In general, a lipid nanoparticle (LNP) is typically obtainable from direct mixing of RNA in an aqueous phase with lipids in a phase comprising an organic solvent, such as ethanol. In that case, lipids or lipid mixtures can be used for particle formation, which do not form lamellar (bilayer) phases in water.
In some embodiments, LNPs comprise or consist of a cationic/cationically ionizable lipid and helper lipids such as phospholipids, cholesterol, and/or polymer-conjugated lipids (e.g., polyethylene glycol (PEG) lipids). In some embodiments, in the RNA LNPs described herein the RNA (in particular, mRNA) is bound by cationically ionizable lipid that occupies the central core of the LNP. In some embodiments, polymer-conjugated lipid forms the surface of the LNP, along with phospholipids. In some embodiments, cholesterol and cationically ionizable lipid in charged and uncharged forms can be distributed throughout the LNP. In some embodiments, RNA (e.g., mRNA) described herein may be noncovalently associated with a particle as described herein. In embodiments, the RNA (especially mRNA) may be adhered to the outer surface of the particle (surface RNA (especially surface mRNA)) and/or may be contained in the particle (encapsulated RNA (especially encapsulated mRNA)).
In some embodiments, the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of about 10 to about 2000 nm, such as at least about 15 nm (e.g., at least about 20 nm, at least about 25 nm, at least about 30 nm, at least about 35 nm, at least about 40 nm, at least about 45 nm, at least about 50 nm, at least about 55 nm, at least about 60 nm, at least about 65 nm, at least about 70 nm, at least about 75 nm, at least about 80 nm, at least about 85 nm, at least about 90 nm, at least about 95 nm, or at least about 100 nm) and/or at most about 1900 nm (e.g., at most about 1800 nm, at most about 1700 nm, at most about 1600 nm, at most about 1500 nm, at most about 1400 nm, at most about 1300 nm, at most about 1200 nm, at most about 1100 nm, at most about 1000 nm, at most about 950 nm, at most about 900 nm, at most about 850 nm, at most about 800 nm, at most about 750 nm, at most about 700 nm, at most about 650 nm, at most about 600 nm, at most about 550 nm, or at most about 500 nm), such as in the range of about 20 to about 1500 nm, such as about 30 to about 1200 nm, about 40 to about 1100 nm, about 50 to about 1000 nm, about 60 to about 900 nm, about 70 to about 800 nm, about 80 to about 700 nm, about 90 to about 600 nm, or about 50 to about 500 nm or about 100 to about 500 nm, such as in the range of 10 to 1000 nm, 15 to 500 nm, 20 to 450 nm, 25 to 400 nm, 30 to 350 nm, 40 to 300 nm, 50 to 250 nm, 60 to 200 nm, 70 to 150 nm, or 80 to 150 nm. In some embodiments, the particles (e.g., LNPs and LPXs) described herein have a size (such as a diameter) in the range of from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm.
In some embodiments, the particles (e.g., LNPs and LPXs) described herein have an average diameter that in some embodiments ranges from about 50 nm to about 1000 nm, from about 50 nm to about 800 nm, from about 50 nm to about 700 nm, from about 50 nm to about 600 nm, from about 50 nm to about 500 nm, from about 50 nm to about 450 nm, from about 50 nm to about 400 nm, from about 50 nm to about 350 nm, from about 50 nm to about 300 nm, from about 50 nm to about 250 nm, from about 50 nm to about 200 nm, from about 100 nm to about 1000 nm, from about 100 nm to about 800 nm, from about 100 nm to about 700 nm, from about 100 nm to about 600 nm, from about 100 nm to about 500 nm, from about 100 nm to about 450 nm, from about 100 nm to about 400 nm, from about 100 nm to about 350 nm, from about 100 nm to about 300 nm, from about 100 nm to about 250 nm, from about 100 nm to about 200 nm, from about 150 nm to about 1000 nm, from about 150 nm to about 800 nm, from about 150 nm to about 700 nm, from about 150 nm to about 600 nm, from about 150 nm to about 500 nm, from about 150 nm to about 450 nm, from about 150 nm to about 400 nm, from about 150 nm to about 350 nm, from about 150 nm to about 300 nm, from about 150 nm to about 250 nm, from about 150 nm to about 200 nm, from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 200 nm to about 700 nm, from about 200 nm to about 600 nm, from about 200 nm to about 500 nm, from about 200 nm to about 450 nm, from about 200 nm to about 400 nm, from about 200 nm to about 350 nm, from about 200 nm to about 300 nm, from about 200 nm to about 250 nm, or from about 80 to about 150 nm. In some embodiments, the particles (e.g., LNPs and LPXs) described herein have an average diameter that in some embodiments ranges from about 40 nm to about 200 nm, such as from about 50 nm to about 180 nm, from about 60 nm to about 160 nm, from about 80 nm to about 150 nm or from about 80 nm to about 120 nm.
RNA particles (especially mRNA particles) described herein may exhibit a polydispersity index (PDI) less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.2, less than about 0.1, or less than about 0.05. By way of example, the RNA particles can exhibit a polydispersity index in a range of about 0.01 to about 0.4 or about 0.1 to about 0.3.
The N/P ratio gives the ratio of the nitrogen groups in the lipid to the number of phosphate groups in the RNA. It is correlated to the charge ratio, as the nitrogen atoms (depending on the pH) are usually positively charged and the phosphate groups are negatively charged. The N/P ratio, where a charge equilibrium exists, depends on the pH. Lipid formulations may be formed at N/P ratios larger than four up to twelve, because positively charged nanoparticles can be favorable for transfection. In that case, RNA is considered to be completely bound to nanoparticles.
The present disclosure describes compositions comprising RNA (especially mRNA) and at least one cationic or cat ionically ionizable lipid which associates with the RNA to form RNA particles and formulations comprising such particles. The RNA particles may comprise RNA which is complexed in different forms by non-covalent interactions to the particle. The particles described herein are not viral particles, in particular infectious viral particles, i.e., they are not able to virally infect cells. Suitable cationic or cationically ionizable lipids are those that form RNA particles and are included by the term "particle forming components" or "particle forming agents". The term "particle forming components" or "particle forming agents" relates to any components which associate with RNA to form RNA particles. Such components include any component which can be part of RNA particles.
In some embodiments, RNA particles (especially mRNA particles) comprise more than one type of RNA molecules, where the molecular parameters of the RNA molecules may be similar or different from each other, like with respect to molar mass or fundamental structural elements such as molecular architecture, capping, coding regions or other features,
In particulate formulation, it is possible that each RNA species is separately formulated as an individual particulate formulation. In that case, each individual particulate formulation will comprise one RNA species. The individual particulate formulations may be present as separate entities, e.g. in separate containers. Such formulations are obtainable by providing each RNA species separately (typically each in the form of an RNA-containing solution) together with a particle-forming agent, thereby allowing the formation of particles. Respective particles will contain exclusively the specific RNA species that is being provided when the particles are formed (individual particulate formulations). In some embodiments, a composition such as a pharmaceutical composition comprises more than one individual particle formulation. Respective pharmaceutical compositions are referred to as mixed particulate formulations. Mixed particulate formulations according to the present disclosure are obtainable by forming, separately, individual particulate formulations, followed by a step of mixing of the individual particulate formulations. By the step of mixing, a formulation comprising a mixed population of RNA-containing particles is obtainable. Individual particulate populations may be together in one container, comprising a mixed population of individual particulate formulations. Alternatively, it is possible that all RNA species of the pharmaceutical composition are formulated together as a combined particulate formulation. Such formulations are obtainable by providing a combined formulation (typically combined solution) of all RNA species together with a particle-forming agent, thereby allowing the formation of particles. As opposed to a mixed particulate formulation, a combined particulate formulation will typically comprise particles which comprise more than one RNA species. In a combined particulate composition different RNA species are typically present together in a single particle. Polymers
Given their high degree of chemical flexibility, polymers are commonly used materials for nanoparticle-based delivery. Typically, cationic polymers are used to electrostatically condense the negatively charged RNA into nanoparticles. These positively charged groups often consist of amines that change their state of protonation in the pH range between 5.5 and 7.5, thought to lead to an ion imbalance that results in endosomal rupture. Polymers such as poly-L-lysine, polyamidoamine, protamine and polyethyleneimine, as well as naturally occurring polymers such as chitosan have all been applied to nucleic acid delivery and are suitable as cationic polymers herein. In addition, some investigators have synthesized polymers specifically for nucleic acid delivery. Poly(|3-amino esters), in particular, have gained widespread use in nucleic acid delivery owing to their ease of synthesis and biodegradability. Such synthetic polymers are also suitable as cationic polymers herein.
A "polymer," as used herein, is given its ordinary meaning, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds. The repeat units can all be identical, or in some cases, there can be more than one type of repeat unit present within the polymer. In some cases, the polymer is biologically derived, i.e., a biopolymer such as a protein. In some cases, additional moieties can also be present in the polymer, for example targeting moieties.
If more than one type of repeat unit is present within the polymer, then the polymer is said to be a "copolymer." It is to be understood that the polymer being employed herein can be a copolymer. The repeat units forming the copolymer can be arranged in any fashion. For example, the repeat units can be arranged in a random order, in an alternating order, or as a "block" copolymer, i.e., comprising one or more regions each comprising a first repeat unit (e.g., a first block), and one or more regions each comprising a second repeat unit (e.g., a second block), etc. Block copolymers can have two (a diblock copolymer), three (a triblock copolymer), or more numbers of distinct blocks.
In certain embodiments, the polymer is biocompatible. Biocompatible polymers are polymers that typically do not result in significant cell death at moderate concentrations. In certain embodiments, the biocompatible polymer is biodegradable, i.e., the polymer is able to degrade, chemically and/or biologically, within a physiological environment, such as within the body.
In certain embodiments, polymer may be protamine or polyalkyleneimine. The term "protamine" refers to any of various strongly basic proteins of relatively low molecular weight that are rich in arginine and are found associated especially with DNA in place of somatic histones in the sperm cells of various animals (as fish). In particular, the term "protamine" refers to proteins found in fish sperm that are strongly basic, are soluble in water, are not coagulated by heat, and yield chiefly arginine upon hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin.
According to the disclosure, the term "protamine" as used herein is meant to comprise any protamine amino acid sequence obtained or derived from natural or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof as well as (synthesized) polypeptides which are artificial and specifically designed for specific purposes and cannot be isolated from native or biological sources.
In one embodiment, the polyalkyleneimine comprises polyethylenimine and/or polypropylenimine, preferably polyethyleneimine. A preferred polyalkyleneimine is polyethyleneimine (PEI). The average molecular weight of PEI is preferably 0.75-102 to 107 Da, preferably 1000 to 105 Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.
Preferred according to the disclosure is linear polyalkyleneimine such as linear polyethyleneimine (PEI).
Cationic polymers (including polycationic polymers) contemplated for use herein include any cationic polymers which are able to electrostatically bind nucleic acid. In one embodiment, cationic polymers contemplated for use herein include any cationic polymers with which nucleic acid can be associated, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.
Particles described herein may also comprise polymers other than cationic polymers, i.e., non- cationic polymers and/or anionic polymers. Collectively, anionic and neutral polymers are referred to herein as non-cationic polymers.
Lipids
The terms "lipid" and "lipid-like material" are broadly defined herein as molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also frequently denoted as amphiphiles. Lipids are usually insoluble or poorly soluble in water, but soluble in many organic solvents. In an aqueous environment, the amphiphilic nature allows the molecules to self-assemble into organized structures and different phases. One of those phases consists of lipid bilayers, as they are present in vesicles, multilamellar/unilamellar liposomes, or membranes in an aqueous environment. Hydrophobicity can be conferred by the inclusion of apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). The hydrophilic groups may comprise polar and/or charged groups and include carbohydrates, phosphate, carboxylic, sulfate, amino, sulfhydryl, nitro, hydroxyl, and other like groups.
As used herein, the term "hydrophobic" refers to any a molecule, moiety or group which is substantially immiscible or insoluble in aqueous solution. The term hydrophobic group includes hydrocarbons having at least 6 carbon atoms. The monovalent radical of a hydrocarbon is referred to as hydrocarbyl herein. The hydrophobic group can have functional groups (e.g., ether, ester, halide, etc.) and atoms other than carbon and hydrogen as long as the group satisfies the condition of being substantially immiscible or insoluble in aqueous solution.
The term "hydrocarbon" includes non-cyclic, e.g., linear (straight) or branched, hydrocarbyl groups, such as alkyl, alkenyl, or alkynyl as defined herein. It should be appreciated that one or more of the hydrogen atoms in alkyl, alkenyl, or alkynyl may be substituted with other atoms, e.g., halogen, oxygen or sulfur. Unless stated otherwise, hydrocarbon groups can also include a cyclic (alkyl, alkenyl or alkynyl) group or an aryl group, provided that the overall polarity of the hydrocarbon remains relatively nonpolar.
The term "alkyl" refers to a saturated linear or branched monovalent hydrocarbon moiety which may have one to thirty, typically one to twenty, often six to eighteen carbon atoms. Exemplary nonpolar alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, hexyl, decyl, dodecyl, tetradecyl, hexadecyl, octadecyl, and the like.
The term "alkenyl" refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon-carbon double bond in which the total carbon atoms may be six to thirty, typically six to twenty often six to eighteen. Generally, the maximal number of carbon-carbon double bonds in the alkenyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenyl group by 2 and, if the number of carbon atoms in the alkenyl group is uneven, rounding the result of the division down to the next integer. For example, for an alkenyl group having 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, the alkenyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.
The term "alkynyl" refers to a linear or branched monovalent hydrocarbon moiety having at least one carbon-carbon triple bond in which the total carbon atoms may be six to thirty, typically six to twenty, often six to eighteen. Alkynyl groups can optionally have one or more carbon-carbon double bonds. Generally, the maximal number of carbon-carbon triple bonds in the alkynyl group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkynyl group by 2 and, if the number of carbon atoms in the alkynyl group is uneven, rounding the result of the division down to the next integer. For example, for an alkynyl group having 9 carbon atoms, the maximum number of carbon-carbon triple bonds is 4. Preferably, the alkynyl group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, more preferably 1 or 2 carbon-carbon triple bonds.
The term "alkylene" refers to a saturated linear or branched divalent hydrocarbon moiety which may have one to thirty, typically two to twenty, often four to twelve carbon atoms. Exemplary nonpolar alkylene groups include, but are not limited to, methylene, ethylene, trimethylene, hexamethylene, decamethylene, dodecamethylene, tetradecamethylene, hexadecamethylene, octadecmethylene, and the like.
The term "alkenylene" refers to a linear or branched divalent hydrocarbon moiety having at least one carbon-carbon double bond in which the total carbon atoms may be two to thirty, typically two to twenty, often four to twelve. Generally, the maximal number of carbon- carbon double bonds in the alkenylene group can be equal to the integer which is calculated by dividing the number of carbon atoms in the alkenylene group by 2 and, if the number of carbon atoms in the alkenylene group is uneven, rounding the result of the division down to the next integer. For example, for an alkenylene group having 9 carbon atoms, the maximum number of carbon-carbon double bonds is 4. Preferably, the alkenylene group has 1 to 6 (such as 1 to 4), i.e., 1, 2, 3, 4, 5, or 6, carbon-carbon double bonds.
The term "cycloalkyl" represents cyclic non-aromatic versions of "alkyl" and "alkenyl" with preferably 3 to 14 carbon atoms, such as 3 to 12 or 3 to 10 carbon atoms, i.e., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 carbon atoms (such as 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms), more preferably 3 to 7 carbon atoms. Exemplary cycloalkyl groups include cyclopropyl, cyclopropenyl, cyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, cyclononyl, cyclononenyl, cylcodecyl, cylcodecenyl, and adamantyl. The cycloalkyl group may consist of one ring (monocyclic), two rings (bicyclic), or more than two rings (polycyclic).
The term "aryl" refers to a monoradical of an aromatic cyclic hydrocarbon. Preferably, the aryl group contains 3 to 14 (e.g., 5, 6, 7, 8, 9, or 10, such as 5, 6, or 10) carbon atoms which can be arranged in one ring (e.g., phenyl) or two or more condensed rings (e.g., naphthyl). Exemplary aryl groups include cyclopropenylium, cyclopentadienyl, phenyl, indenyl, naphthyl, azulenyl, fluorenyl, anthryl, and phenanthryl. Preferably, "aryl" refers to a monocyclic ring containing 6 carbon atoms or an aromatic bicyclic ring system containing 10 carbon atoms. Preferred examples are phenyl and naphthyl. Aryl does not encompass fullerenes.
The term "aromatic" as used in the context of hydrocarbons means that the whole molecule has to be aromatic. For example, if a monocyclic aryl is hydrogenated (either partially or completely) the resulting hydrogenated cyclic structure is classified as cycloalkyl for the purposes of the present disclosure. Likewise, if a bi- or polycyclic aryl (such as naphthyl) is hydrogenated the resulting hydrogenated bi- or polycyclic structure (such as 1,2- dihydronaphthyl) is classified as cycloalkyl for the purposes of the present disclosure (even if one ring, such as in 1,2-dihydronaphthyl, is still aromatic).
As used herein, the term "amphiphilic" refers to a molecule having both a polar portion and a non-polar portion. Often, an amphiphilic compound has a polar head attached to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the non- polar portion is insoluble in water. In addition, the polar portion may have either a formal positive charge, or a formal negative charge. Alternatively, the polar portion may have both a formal positive and a negative charge, and be a zwitterion or inner salt. For purposes of the disclosure, the amphiphilic compound can be, but is not limited to, one or a plurality of natural or non-natural lipids and lipid-like compounds.
The term "lipid-like material", "lipid-like compound" or "lipid-like molecule" relates to substances, in particular amphiphilic substances, that structurally and/or functionally relate to lipids but may not be considered as lipids in a strict sense. For example, the term includes compounds that are able to form amphiphilic layers as they are present in vesicles, multilamellar/unilamellar liposomes, or membranes in an aqueous environment and includes surfactants, or synthesized compounds with both hydrophilic and hydrophobic moieties. Generally speaking, the term includes molecules, which comprise hydrophilic and hydrophobic moieties with different structural organization, which may or may not be similar to that of lipids. Examples of lipid-like compounds capable of spontaneous integration into cell membranes include functional lipid constructs such as synthetic function-spacer-lipid constructs (FSL), synthetic function-spacer-sterol constructs (FSS) as well as artificial amphipathic molecules. Lipids comprising two long alkyl chains and a polar head group are generally cylindrical. The area occupied by the two alkyl chains is similar to the area occupied by the polar head group. Such lipids have low solubility as monomers and tend to aggregate into planar bilayers that are water insoluble. Traditional surfactant monomers comprising only one linear alkyl chain and a hydrophilic head group are generally cone shaped. The hydrophilic head group tends to occupy more molecular space than the linear alkyl chain. In some embodiments, surfactants tend to aggregate into spherical or elliptoid micelles that are water soluble. While lipids also have the same general structure as surfactants - a polar hydrophilic head group and a nonpolar hydrophobic tail - lipids differ from surfactants in the shape of the monomers, in the type of aggregates formed in solution, and in the concentration range required for aggregation. As used herein, the term "lipid" is to be construed to cover both lipids and lipid-like materials unless otherwise indicated herein or clearly contradicted by context.
Generally, lipids may be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides (derived from condensation of ketoacyl subunits), sterol lipids and prenol lipids (derived from condensation of isoprene subunits). Although the term "lipid" is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as steroids, i.e., sterol-containing metabolites such as cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.
Fatty acids, or fatty acid residues are a diverse group of molecules made of a hydrocarbon chain that terminates with a carboxylic acid group; this arrangement confers the molecule with a polar, hydrophilic end, and a nonpolar, hydrophobic end that is insoluble in water. The carbon chain, typically between four and 24 carbons long, may be saturated or unsaturated, and may be attached to functional groups containing oxygen, halogens, nitrogen, and sulfur. If a fatty acid contains a double bond, there is the possibility of either a cis or trans geometric isomerism, which significantly affects the molecule's configuration. Cis-double bonds cause the fatty acid chain to bend, an effect that is compounded with more cis double bonds in the chain. Other major lipid classes in the fatty acid category are the fatty esters and fatty amides. Glycerolipids are composed of mono-, di-, and tri-substituted glycerols, the best-known being the fatty acid triesters of glycerol, called triglycerides. The word "triacylglycerol" is sometimes used synonymously with "triglyceride". In these compounds, the three hydroxyl groups of glycerol are each esterified, typically by different fatty acids. Additional subclasses of glycerolipids are represented by glycosylglycerols, which are characterized by the presence of one or more sugar residues attached to glycerol via a glycosidic linkage.
The glycerophospholipids are amphipathic molecules (containing both hydrophobic and hydrophilic regions) that contain a glycerol core linked to two fatty acid-derived "tails" by ester linkages and to one "head" group by a phosphate ester linkage. Examples of glycerophospholipids, usually referred to as phospholipids (though sphingomyelins are also classified as phospholipids) are phosphatidylcholine (also known as PC, GPCho or lecithin), phosphatidylethanolamine (PE or GPEtn) and phosphatidylserine (PS or GPSer).
Sphingolipids are a complex family of compounds that share a common structural feature, a sphingoid base backbone. The major sphingoid base in mammals is commonly referred to as sphingosine. Ceramides (N-acyl-sphingoid bases) are a major subclass of sphingoid base derivatives with an amide-linked fatty acid. The fatty acids are typically saturated or mono- unsaturated with chain lengths from 16 to 26 carbon atoms. The major phosphosphingolipids of mammals are sphingomyelins (ceramide phosphocholines), whereas insects contain mainly ceramide phosphoethanolamines and fungi have phytoceramide phosphoinositols and mannose-containing headgroups. The glycosphingolipids are a diverse family of molecules composed of one or more sugar residues linked via a glycosidic bond to the sphingoid base. Examples of these are the simple and complex glycosphingolipids such as cerebrosides and gangliosides.
Sterol lipids, such as cholesterol and its derivatives, or tocopherol and its derivatives, are an important component of membrane lipids, along with the glycerophospholipids and sphingomyelins. Saccharolipids describe compounds in which fatty acids are linked directly to a sugar backbone, forming structures that are compatible with membrane bilayers. In the saccharolipids, a monosaccharide substitutes for the glycerol backbone present in glycerolipids and glycerophospholipids. The most familiar saccharolipids are the acylated glucosamine precursors of the Lipid A component of the lipopolysaccharides in Gram-negative bacteria. Typical lipid A molecules are disaccharides of glucosamine, which are derivatized with as many as seven fatty-acyl chains. The minimal lipopolysaccharide required for growth in E. coli is Kdo2-Lipid A, a hexa-acylated disaccharide of glucosamine that is glycosylated with two 3-deoxy-D-manno-octulosonic acid (Kdo) residues.
Polyketides are synthesized by polymerization of acetyl and propionyl subunits by classic enzymes as well as iterative and multimodular enzymes that share mechanistic features with the fatty acid synthases. They comprise a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal and marine sources, and have great structural diversity. Many polyketides are cyclic molecules whose backbones are often further modified by glycosylation, methylation, hydroxylation, oxidation, or other processes.
According to the disclosure, lipids and lipid-like materials may be cationic, anionic or neutral. Neutral lipids or lipid-like materials exist in an uncharged or neutral zwitterionic form at a selected pH.
Cationic/Cationically ionizable lipids
In some embodiments, the RNA compositions and formulations and RNA particles described herein comprise at least one cationic or cationically ionizable lipid as particle forming agent. Cationic or cationically ionizable lipids contemplated for use herein include any cationic or cationically ionizable lipids (including lipid-like materials) which are able to electrostatically bind nucleic acid. In some embodiments, cationic or cationically ionizable lipids contemplated for use herein can be associated with nucleic acid, e.g. by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.
As used herein, a "cationic lipid" refers to a lipid or lipid-like material having a net positive charge. Cationic lipids bind negatively charged nucleic acid by electrostatic interaction. Generally, cationic lipids possess a lipophilic moiety, such as a sterol, an acyl chain, a diacyl or more acyl chains, and the head group of the lipid typically carries the positive charge. In some embodiments, a cationic lipid has a net positive charge only at certain pH, in particular acidic pH, while it has preferably no net positive charge, preferably has no charge, i.e., it is neutral, at a different, preferably higher pH such as physiological pH. This ionizable behavior is thought to enhance efficacy through helping with endosomal escape and reducing toxicity as compared with particles that remain cationic at physiological pH.
As used herein, a "cationically ionizable lipid" refers to a lipid or lipid-like material which has a net positive charge or is neutral, i.e., which is not permanently cationic. Thus, depending on the pH of the composition in which the cationically ionizable lipid is solved, the cationically ionizable lipid is either positively charged or neutral. For purposes of the present disclosure, cationically ionizable lipids are covered by the term "cationic lipid" unless contradicted by the circumstances.
In some embodiments, the cationic or cationically ionizable lipid comprises a head group which includes at least one nitrogen atom (N) which is positive charged or capable of being protonated, e.g., under physiological conditions.
Examples of cationic or cationically ionizable lipids include, but are not limited to N,N- dimethyl-2,3-dioleyloxypropylamine (DODMA), l,2-dioleoyl-3-trimethylammonium propane (DOTAP); l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N— (N',NZ- dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB); l,2-dioleoyl-3-dimethylammonium-propane (DODAP); l,2-diacyloxy-3- dimethylammonium propanes; l,2-dialkyloxy-3-dimethylammonium propanes; dioctadecyldimethyl ammonium chloride (DODAC), l,2-distearyloxy-N,N-dimethyl-3- aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), l,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), l,2-dimyristoyl-3- trimethylammonium propane (DMTAP), l,2-dioleyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DORIE), and 2,3-dioleoyloxy- N-[2(spermine carboxamide)ethyl]-N,N- dimethyl-l-propanamium trifluoroacetate (DOSPA), l,2-dilinoleyloxy-N,N- dimethylaminopropane (DLinDMA), l,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3- beta-oxybutan-4-oxy)-l-(cis,cis-9,12-oc-tadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5- en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-l-(cis,cis-9',12'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), l,2-N,N'-dioleylcarbamyl-3- dimethylaminopropane (DOcarbDAP), 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), l,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-
Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4- dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl- [l,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin- MC3-DMA), N-(2-Hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyloxy)-l- propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(dodecyloxy)-l-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N- dimethyl-2,3-bis(tetradecyloxy)-l-propanaminium bromide (GAP-DMRIE), N-(2-Aminoethyl)- N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propanaminium bromide ((3AE-DMRIE), N-(4- carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-l-aminium (DOBAQ), 2-({8-[(3p)- cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l- yloxy]propan-l-amine (Octyl-CLinDMA), l,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), l,2-dipalmitoyl-3-dimethylammonium-propane (DPDAP), N l-[2-((lS)-l-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5), l,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3- bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropan-l-amonium bromide (DLRIE), N-(2- aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-l-aminium bromide (DMORIE), di((Z)-non-2-en-l-yl) 8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)propan-l-amine (DLDMA), N,N-dimethyl-2,3- bis(tetradecyloxy)propan-l-amine (DMDMA), Di((Z)-non-2-en-l-yl)-9-((4-
(dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-Dodecyl-3-((2-dodecylcarbamoyl- ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2- dodecylcarbamoyl-ethylamino)-ethyl]-amino}-ethylamino)propionamide (lipidoid 98N12-5), 1- [2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2 hydroxydodecyl)amino]ethyl]piperazin- l-yl]ethyl]amino]dodecan-2-ol (lipidoid C12-200).
In some embodiments, the cationic or cationically ionizable lipid is DOTMA. In some embodiments, the cationic or cationically ionizable lipid is DODMA.
DOTMA is a cationic lipid with a quaternary amine headgroup. The structure of DOTMA may be represented as follows:
Figure imgf000131_0001
DODMA is an ionizable cationic lipid with a tertiary amine headgroup. The structure of DODMA may be represented as follows:
Figure imgf000131_0002
In some embodiments, the cationic or cationically ionizable lipid may comprise from about 10 mol % to about 95 mol %, from about 20 mol % to about 95 mol %, from about 20 mol % to about 90 mol %, from about 30 mol % to about 90 mol %, from about 40 mol % to about 90 mol %, or from about 40 mol % to about 80 mol % of the total lipid present in the particle.
Additional lipids
The RNA compositions and formulations and RNA particles described herein may also comprise lipids (including lipid-like materials) other than cationic or cationically ionizable lipids (also collectively referred to herein as cationic lipids), i.e., non-cationic lipids (including non- cationic or non-cationically ionizable lipids or lipid-like materials). Collectively, anionic and neutral lipids or lipid-like materials are referred to herein as non-cationic lipids. Optimizing the formulation of RNA particles by addition of other hydrophobic moieties, such as cholesterol and lipids, in addition to a cationic or cationically ionizable lipid may enhance particle stability and efficacy of RNA delivery.
One or more additional lipids may or may not affect the overall charge of the RNA particles. In some embodiments, the or more additional lipids are a non-cationic lipid or lipid-like material. The non-cationic lipid may comprise, e.g., one or more anionic lipids and/or neutral lipids. As used herein, an "anionic lipid" refers to any lipid that is negatively charged at a selected pH. As used herein, a "neutral lipid" refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH.
In some embodiments, the RNA compositions and formulations and RNA particles described herein comprise a cationic or cationically ionizable lipid and one or more additional lipids.
Without wishing to be bound by theory, the amount of the cationic or cationically ionizable lipid compared to the amount of the one or more additional lipids may affect important RNA particle characteristics, such as charge, particle size, stability, tissue selectivity, and bioactivity of the RNA. Accordingly, in some embodiments, the molar ratio of the cationic or cationically ionizable lipid to the one or more additional lipids is from about 10:0 to about 1:9, about 4:1 to about 1:2, about 4:1 to about 1:1, about 3:1 to about 1:1, or about 3:1 to about 2:1.
In some embodiments, the one or more additional lipids comprised in the RNA compositions and formulations and RNA particles described herein comprise one or more of the following: neutral lipids, steroids, and combinations thereof.
In some embodiments, the one or more additional lipids comprise a neutral lipid which is a phospholipid. In some embodiments, the phospholipid is selected from the group consisting of phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines and sphingomyelins. Specific phospholipids that can be used include, but are not limited to, phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines or sphingomyelin. Such phospholipids include in particular diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DM PC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC) and phosphatidylethanolamines, in particular diacylphosphatidylethanolamines, such as dioleoylphosphatidylethanolamine (DOPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl-phosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), dilauroyl-phosphatidylethanolamine (DLPE), diphytanoyl-phosphatidylethanolamine (DPyPE), l,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPG), 1,2-dipalmitoyl-sn- glycero-3-phospho-(l'-rac-glycerol) (DPPG), l-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine (POPE), N-palmitoyl-D-erythro-sphingosylphosphorylcholine (SM), and further phosphatidylethanolamine lipids with different hydrophobic chains. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DOPC, DMPC, DPPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC. In some embodiments, the neutral lipid is DOPE.
In some embodiments, the additional lipid comprises one of the following: (1) a phospholipid, (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof. Thus, in some embodiments, the RNA compositions and formulations and RNA particles described herein comprise (1) a cationic or cationically ionizable lipid, and a phospholipid such as DSPC or DOPE or (2) a cationic or cationically ionizable lipid and a phospholipid such as DSPC or DOPE and cholesterol.
In some embodiments, the RNA particles (especially the particles comprising mRNA) described herein comprise (1) DOTMA and DOPE, (2) DOTMA, DOPE and cholesterol, (3) DODMA and DOPE or (4) DODMA, DOPE and cholesterol.
DSPC is a neutral phospholipid. The structure of DSPC may be represented as follows:
Figure imgf000133_0001
DOPE is a neutral phospholipid. The structure of DOPE may be represented as follows:
Figure imgf000133_0002
The structure of cholesterol may be represented as follows:
Figure imgf000134_0001
In some embodiments, RNA compositions and formulations and RNA particles described herein do not include a polymer conjugated lipid such as a pegylated lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.
In some embodiments, the additional lipid (e.g., one or more phospholipids and/or cholesterol) may comprise from about 0 mol % to about 90 mol %, from about 0 mol % to about 80 mol %, from about 2 mol % to about 80 mol %, from about 5 mol % to about 80 mol %, from about 5 mol % to about 60 mol %, from about 5 mol % to about 50 mol %, from about 7.5 mol % to about 50 mol %, or from about 10 mol % to about 40 mol % of the total lipid present in the particle. In some embodiments, the additional lipid (e.g., one or more phospholipids and/or cholesterol) comprises about 10 mol %, about 15 mol %, or about 20 mol % of the total lipid present in the particle.
In some embodiments, the additional lipid comprises a mixture of: (i) a phospholipid such as DOPE; and (ii) cholesterol or a derivative thereof. In some embodiments, the molar ratio of the phospholipid such as DOPE to the cholesterol or a derivative thereof is from about 9:0 to about 1:10, about 2:1 to about 1:4, about 1:1 to about 1:4, or about 1:1 to about 1:3.
Polymer-conjugated lipids
In some embodiments, RNA compositions and formulations and RNA particles described herein may comprise at least one polymer-conjugated lipid. A polymer-conjugated lipid is typically a molecule comprising a lipid portion and a polymer portion conjugated thereto. In some embodiments, a polymer-conjugated lipid is a PEG-conjugated lipid, also referred to herein as pegylated lipid or PEG-lipid. The term "pegylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art. In some embodiments, a polymer-conjugated lipid is a polysarcosine-conjugated lipid, also referred to herein as sarcosinylated lipid or pSar-lipid. The term "sarcosinylated lipid" refers to a molecule comprising both a lipid portion and a polysarcosine portion. In some embodiments, a polymer-conjugated lipid is designed to sterically stabilize a lipid particle by forming a protective hydrophilic layer that shields the hydrophobic lipid layer. In some embodiments, a polymer-conjugated lipid can reduce its association with serum proteins and/or the resulting uptake by the reticuloendothelial system when such lipid particles are administered in vivo.
Polyethyleneqlycol (PEG)-coniugated lipids
In some embodiments, RNA compositions/formulations and RNA particles described herein comprise a PEG-conjugated lipid.
In some embodiments, the PEG-conjugated lipid (pegylated lipid) is a lipid havingthe structure of the following general formula:
Figure imgf000135_0001
or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein: each of R12 and R13 is each independently a straight or branched, alkyl or alkenyl chain containing from 10 to 30 carbon atoms, wherein the alkyl/alkenyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.
In some embodiments of this formula, each of R12 and R13 is independently a straight alkyl chain containing from 10 to 18 carbon atoms, preferably from 12 to 16 carbon atoms.
In some embodiments of this formula, R12 and R13 are identical. In some embodiments, each of R12 and R13 is a straight alkyl chain containing 12 carbon atoms. In some embodiments, each of R12 and R13 is a straight alkyl chain containing 14 carbon atoms. In some embodiments, each of R12 and R13 is a straight alkyl chain containing 16 carbon atoms.
In some embodiments of this formula, R12 and R13 are different. In some embodiments, one of R12 and R13 is a straight alkyl chain containing 12 carbon atoms and the other of R12 and R13 is a straight alkyl chain containing 14 carbon atoms.
In some embodiments of this formula, w has a mean value ranging from 40 to 50, such as a mean value of 45.
In some embodiments of this formula, w is within a range such that the PEG portion of the pegylated lipid has an average molecular weight of from about 400 to about 6000 g/mol, such as from about 1000 to about 5000 g/mol, from about 1500 to about 4000 g/mol, or from about 2000 to about 3000 g/mol. In some embodiments, each of R12 and R13 is a straight alkyl chain containing 14 carbon atoms and w has a mean value of 45.
Various PEG-conjugated lipids are known in the art and include, but are not limited to pegylated diacylglycerol (PEG-DAG) such as l-(monomethoxy-polyethyleneglycol)-2,3- dimyristoylglycerol (PEG-DMG), a pegylated phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O-(2' ,3 '-di(tetradecanoyloxy)propyl-l-O-(©- methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as ©-methoxy(polyethoxy)ethyl-N-(2,3- di(tetradecanoxy)propyl)carbamate or 2,3-di(tetradecanoxy)propyl-N-(ro methoxy(polyethoxy)ethyl)carbamate, and the like.
In some embodiments, the PEG-conjugated lipid (pegylated lipid) is or comprises 2- [(polyethylene glycol)-2000]-N,N-ditetradecylacetamide. In some embodiments, the pegylated lipid has the following structure:
Figure imgf000136_0001
In some embodiments, the PEG-conjugated lipid (pegylated lipid) is DMG-PEG 2000, e.g., having the following structure:
Figure imgf000136_0002
In some embodiments, the PEG-conjugated lipid (pegylated lipid) has the following structure:
Figure imgf000136_0003
wherein n has a mean value ranging from 30 to 60, such as about 50. In one embodiment, the PEG-conjugated lipid (pegylated lipid) is PEG2000-C-DMA which preferably refers to 3-N-[(w- methoxy polyethylene glycol)2000)carbamoyl]-l,2-dimyristyloxy-propylamine (MPEG-(2 kDa)-C-DMA) or methoxy-polyethylene glycol-2,3-bis(tetradecyloxy)propylcarbamate (2000). In some embodiments, RNA compositions/formulations described herein may comprise one or more PEG-conjugated lipids or pegylated lipids as described in WO 2017/075531 and WO 2018/081480, the entire contents of each of which are incorporated herein by reference for the purposes described herein.
In some embodiments, the pegylated lipid comprises from about 1 mol % to about 10 mol %, preferably from about 1 mol % to about 5 mol %, more preferably from about 1 mol % to about 2.5 mol % of the total lipid present in the RNA compositions/formulations and RNA particles described herein.
Embodiments of Lipoplex Particles
In some embodiments of the present disclosure, the RNA described herein may be present in RNA lipoplex particles.
Lipoplexes (LPX) are electrostatic complexes which are generally formed by mixing preformed cationic lipid liposomes with anionic RNA. Formed lipoplexes possess distinct internal arrangements of molecules that arise due to the transformation from liposomal structure into compact RNA-lipoplexes.
In certain embodiments, the RNA lipoplex particles include both a cationic lipid and an additional lipid. In an exemplary embodiment, the cationic lipid is DOTMA and the additional lipid is DOPE.
In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In specific embodiments, the molar ratio may be about 3:1, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2:1.
RNA lipoplex particles described herein have an average diameter that in some embodiments ranges from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 to about 700 nm, from about 400 to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm. In specific embodiments, the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 675 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In some embodiments, the RNA lipoplex particles have an average diameter that ranges from about 250 nm to about 700 nm. In some embodiments, the RNA lipoplex particles have an average diameter that ranges from about 300 nm to about 500 nm. In an exemplary embodiment, the RNA lipoplex particles have an average diameter of about 400 nm.
The RNA lipoplex particles and compositions comprising RNA lipoplex particles described herein are useful for delivery of RNA to a target tissue after parenteral administration, in particular after intravenous administration.
Spleen targeting RNA lipoplex particles are described in WO 2013/143683, herein incorporated by reference. It has been found that RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen- presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and/or RNA expression in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in the spleen. In an embodiment, after administration of the RNA lipoplex particles, no or essentially no RNA accumulation and/or RNA expression in the lung and/or liver occurs. In some embodiments, after administration of the RNA lipoplex particles, RNA accumulation and/or RNA expression in antigen presenting cells, such as professional antigen presenting cells in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for targeting RNA, e.g., RNA encoding an antigen or at least one epitope, to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen. Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA administered is RNA encoding vaccine antigen. In some embodiments, the target cell is a spleen cell. In some embodiments, the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen. In some embodiments, the target cell is a dendritic cell in the spleen.
The electric charge of the RNA lipoplex particles of the present disclosure is the sum of the electric charges present in the at least one cationic lipid and the electric charges present in the RNA. The charge ratio is the ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA. The charge ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA is calculated by the following equation: charge ratio=[(cationic lipid concentration (mol)) * (the total number of positive charges in the cationic lipid)] / [(RNA concentration (mol)) * (the total number of negative charges in RNA)]. The concentration of RNA and the at least one cationic lipid amount can be determined using routine methods by one skilled in the art.
In some embodiments, at physiological pH the charge ratio of positive charges to negative charges in the RNA lipoplex particles is from about 1.6:2 to about 1:2, or about 1.6:2 to about 1.1:2. In specific embodiments, the charge ratio of positive charges to negative charges in the RNA lipoplex particles at physiological pH is about 1.6:2.0, about 1.5:2.0, about 1.4:2.0, about 1.3:2.0, about 1.2:2.0, about 1.1:2.0, or about 1:2.0.
Embodiments of Lipid nanoparticles (LNPs)
In some embodiments, RNA described herein is present in the form of lipid nanoparticles (LNPs). LNPs typically comprise four components: cationically ionizable lipid, neutral lipids such as phospholipids, a steroid such as cholesterol, and a polymer-conjugated lipid such as PEG-lipid. LNPs may be prepared by mixing lipids dissolved in ethanol with RNA in an aqueous buffer.
In some embodiments, in the RNA LNPs described herein the RNA is bound by cationically ionizable lipid that occupies the central core of the LNP. Polymer-conjugated lipid forms the surface of the LNP, along with phospholipids. In some embodiments, cholesterol and cationically ionizable lipid can be distributed throughout the LNP.
In some embodiments, the LNP comprises one or more cationically ionizable lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and polymer-conjugated lipids. In some embodiments, the LNP comprises a cationically ionizable lipid, a neutral lipid, a steroid, a polymer-conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.
In some embodiments, the LNP comprises from 35 to 65 mol percent, 40 to 60 mol percent, 40 to 55 mol percent, from 45 to 55 mol percent, or from 45 to 50 mol percent of the cationically ionizable lipid.
In some embodiments, the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent.
In some embodiments, the steroid is present in a concentration ranging from 30 to 50 mol percent, from 30 to 45 mol percent, from 35 to 45 mol percent or from 35 to 43 mol percent. In some embodiments, the LNP comprises from 1 to 10 mol percent, from 1 to 5 mol percent, or from 1 to 2.5 mol percent of the polymer-conjugated lipid.
In some embodiments, the LNP comprises from 45 to 55 mol percent of a cationically ionizable lipid; from 5 to 15 mol percent of a neutral lipid; from 30 to 45 mol percent of a steroid; from 1 to 5 mol percent of a polymer-conjugated lipid; and the RNA, encapsulated within or associated with the lipid nanoparticle.
In some embodiments, the mol percent is determined based on total mol of lipid present in the lipid nanoparticle. In some embodiments, the mol percent is determined based on total mol of cationically ionizable lipid, neutral lipid, steroid and polymer-conjugated lipid present in the lipid nanoparticle.
In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC.
In some embodiments, the steroid is cholesterol.
In some embodiments, the polymer conjugated lipid is a pegylated lipid, e.g., a pegylated lipid as described above.
In some embodiments, the cationically ionizable lipid component of the LNPs has the structure of Formula (III):
Figure imgf000140_0001
(III) or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: one of L1 or L2 is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)X-, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O-, and the other of L1 or L2 is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)x-, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O- or a direct bond;
G1 and G2 are each independently unsubstituted C1-C12 alkylene or C1-C12 alkenylene;
G3 is C1-C24 alkylene, C1-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;
Ra is H or C1-C12 alkyl;
R1 and R2 are each independently C6-C24 alkyl or C6-C24 alkenyl; R3 is H, OR5, CN, -C(=O)OR4, -OC(=O)R4 or -NR5C(=O)R4;
R4 is C1-C12 alkyl;
R5 is H or Ci-C6 alkyl; and x is 0, 1 or 2.
In some of the foregoing embodiments of Formula (III), the lipid has one of the following structures (I I IA) or (IIIB):
Figure imgf000141_0001
(IIIA) (IIIB) wherein:
A is a 3 to 8-membered cycloalkyl or cycloalkylene ring;
R6 is, at each occurrence, independently H, OH or C1-C24 alkyl; n is an integer ranging from 1 to 15.
In some of the foregoing embodiments of Formula (III), the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).
In other embodiments of Formula (III), the lipid has one of the following structures (IIIC) or (HID):
Figure imgf000141_0002
(IIIC) (HID) wherein y and z are each independently integers ranging from 1 to 12.
In any of the foregoing embodiments of Formula (HI), one of L1 or L2 is -O(C=O)-. For example, in some embodiments each of L1 and L2 are -O(C=O)-. In some different embodiments of any of the foregoing, L1 and L2 are each independently -(C=O)O- or -O(C=O)-. For example, in some embodiments each of L1 and L2 is -(C=O)O-.
In some different embodiments of Formula (III), the lipid has one of the following structures (HIE) or (HIF):
Figure imgf000142_0001
(HIE) (IIIF)
In some of the foregoing embodiments of Formula (III), the lipid has one of the following structures (IIIG), (III H), (Illi), or (IIIJ):
Figure imgf000142_0002
In some of the foregoing embodiments of Formula (III), n is an integer ranging from 2 to 12, for example from 2 to 8 or from 2 to 4. For example, in some embodiments, n is 3, 4, 5 or 6. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6.
In some other of the foregoing embodiments of Formula (III), y and z are each independently an integer ranging from 2 to 10. For example, in some embodiments, y and z are each independently an integer ranging from 4 to 9 or from 4 to 6.
In some of the foregoing embodiments of Formula (III), R6 is H. In other of the foregoing embodiments, R6 is C1-C24 alkyl. In other embodiments, R6 is OH.
In some embodiments of Formula (III), G3 is unsubstituted. In other embodiments, G3 is substituted. In various different embodiments, G3 is linear C1-C24 alkylene or linear C1-C24 alkenylene.
In some other foregoing embodiments of Formula (III), R1 or R2, or both, is C6-C24 alkenyl. For example, in some embodiments, R1 and R2 each, independently have the following structure:
Figure imgf000143_0001
wherein:
R7a and R7b are, at each occurrence, independently H or C1-C12 alkyl; and a is an integer from 2 to 12, wherein R7a, R7b and a are each selected such that R1 and R2 each independently comprise from 6 to 20 carbon atoms. For example, in some embodiments a is an integer ranging from 5 to 9 or from 8 to 12.
In some of the foregoing embodiments of Formula (III), at least one occurrence of R7a is H. For example, in some embodiments, R7a is H at each occurrence. In other different embodiments of the foregoing, at least one occurrence of R7b is Ci-Cs alkyl. For example, in some embodiments, Ci-Cg alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.
In different embodiments of Formula (III), R1 or R2, or both, has one of the following structures:
Figure imgf000143_0002
In some of the foregoing embodiments of Formula (III), R3 is OH, CN, -C(=O)OR4, -OC(=O)R4 or -NHC(=O)R4. In some embodiments, R4 is methyl or ethyl.
In various different embodiments, the cationic lipid of Formula (III) has one of the structures set forth in the table below.
Representative Compounds of Formula (III).
Figure imgf000144_0001
Figure imgf000145_0001
Figure imgf000146_0001
Figure imgf000147_0001
Figure imgf000148_0001
Figure imgf000149_0001
Figure imgf000150_0001
Further representative cationically ionizable lipids are as follows:
Figure imgf000150_0002
Figure imgf000151_0001
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0315, a neutral lipid, a steroid, and a polymer conjugated lipid.
In some embodiments, the neutral lipid is DSPC. In some embodiments, the steroid is cholesterol. In some embodiments, the polymer conjugated lipid is a pegylated lipid, e.g., DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, a neutral lipid, a steroid, and a pegylated lipid. In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, a neutral lipid, a steroid, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, a neutral lipid, a steroid, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, a neutral lipid, a steroid, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-O366, a neutral lipid, a steroid, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0315, a neutral lipid, a steroid, and a pegylated lipid.
In some embodiments, the neutral lipid is DSPC. In some embodiments, the steroid is cholesterol. In some embodiments, the pegylated lipid is DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and a pegylated lipid.
In some embodiments, the pegylated lipid is DMG-PEG 2000, PEG2000-C-DMA, or ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and DMG-PEG 2000. In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and DMG-PEG 2000.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and DMG-PEG 2000. In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and DMG-PEG 2000.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and DMG-PEG 2000.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and DMG-PEG 2000.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and PEG2000-C-DMA.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and PEG2000-C-DMA.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and PEG2000-C-DMA. In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and PEG2000-C-DMA.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and PEG2000-C-DMA.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0315, DSPC, cholesterol, and PEG2000-C-DMA.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid, e.g., a cationically ionizable lipid as shown above, DSPC, cholesterol, and ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid of Formula III, DSPC, cholesterol, and ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising a cationically ionizable lipid shown in the above tables, DSPC, cholesterol, and ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising 3D-P-DMA, DSPC, cholesterol, and ALC-0159. In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-0366, DSPC, cholesterol, and ALC-0159.
In some embodiments, RNA described herein is formulated in an LNP composition comprising ALC-O315, DSPC, cholesterol, and ALC-0159.
3D-P-DMA: (6Z,16Z)-12-((Z)-dec-4-en-l-yl)docosa-6,16-dien-ll-yl 5-
(dimethylamino)pentanoate
Figure imgf000154_0001
ALC-0366: ((3-hydroxypropyl)azanediyl)bis(nonane-9,l-diyl) bis(2-butyloctanoate)
Figure imgf000154_0002
ALC-0315: ((4-hydroxybutyl)azanediyl)bis(hexane-6,l-diyl)bis(2-hexyldecanoate) / 6-[N-6-(2- hexyldecanoyloxy)hexyl-N-(4-hydroxybutyl)amino]hexyl 2-hexyldecanoate
Figure imgf000154_0003
PEG2000-C-DMA: 3-N-[(w-Methoxy polyethylene glycol)2000) carbamoyl]-l,2-dimyristyloxy- propylamine (MPEG-(2 kDa)-C-DMA or Methoxy-polyethylene glycol-2,3- bis(tetradecyloxy)propylcarbamate (2000))
Figure imgf000155_0001
wherein n has a mean value ranging from 30 to 60, such as about 50.
ALC-0159: 2-[(polyethylene glycol)-2000]-A/,A/-ditetradecylacetamide / 2-[2-(u)-methoxy
(polyethyleneglycol2000) ethoxy]-N,N-ditetradecylacetamide
Figure imgf000155_0002
DSPC: l,2-Distearoyl-sn-glycero-3-phosphocholine
Figure imgf000155_0003
The N/P value is preferably at least about 4. In some embodiments, the N/P value ranges from 4 to 20, 4 to 12, 4 to 10, 4 to 8, or 5 to 7. In some embodiments, the N/P value is about 6.
Doses
The term "dose" as used herein refers in general to a "dose amount" which relates to the amount of RNA administered per administration, i.e., per dosing. In some embodiments, administration of RNA of the present disclosure may be performed by single administration or boosted by multiple administrations.
In some embodiments, an amount the RNA described herein from 0.1 pg to 300 pg, 0.5 pg to 200 pg, or 1 pg to 100 pg, such as about 1 pg, about 3 pg, about 10 pg, about 30 pg, about 50 pg, or about 100 pg may be administered per dose.
In some embodiments, a regimen described herein includes at least one dose. In some embodiments, a regimen includes a first dose and at least one subsequent dose. In some embodiments, a regimen includes a first dose and two subsequent doses. In some embodiments, the first dose is the same amount as at least one subsequent dose. In some embodiments, the first dose is the same amount as all subsequent doses. In some embodiments, the first dose is a different amount as at least one subsequent dose. In some embodiments, the first dose is a different amount than all subsequent doses. In some embodiments, a regimen comprises two doses. In some embodiments, a regimen consists of two doses. In some embodiments, a regimen comprises three doses. In some embodiments, a regimen consists of three doses.
In one embodiment, the disclosure envisions administration of a single dose. In one embodiment, the disclosure envisions administration of a priming dose followed by one or more booster doses.
Additional treatments
In certain embodiments, additional treatments may be administered to a patient in combination with the treatments described herein. Such additional treatments include classical cancer therapy, e.g., radiation therapy, surgery, hyperthermia therapy and/or chemotherapy. Furthermore, such additional treatments include treatments involving immune checkpoint modulators.
Chemotherapy is a type of cancer treatment that uses one or more anti-cancer drugs (chemotherapeutic agents), usually as part of a standardized chemotherapy regimen. The term chemotherapy has come to connote non-specific usage of intracellular poisons to inhibit mitosis. The connotation excludes more selective agents that block extracellular signals (signal transduction). The development of therapies with specific molecular or genetic targets, which inhibit growth-promoting signals from classic endocrine hormones (primarily estrogens for breast cancer and androgens for prostate cancer) are now called hormonal therapies. By contrast, other inhibitions of growth-signals like those associated with receptor tyrosine kinases are referred to as targeted therapy.
Importantly, the use of drugs (whether chemotherapy, hormonal therapy or targeted therapy) constitutes systemic therapy for cancer in that they are introduced into the blood stream and are therefore in principle able to address cancer at any anatomic location in the body. Systemic therapy is often used in conjunction with other modalities that constitute local therapy (i.e. treatments whose efficacy is confined to the anatomic area where they are applied) for cancer such as radiation therapy, surgery or hyperthermia therapy.
Traditional chemotherapeutic agents are cytotoxic by means of interfering with cell division (mitosis) but cancer cells vary widely in their susceptibility to these agents. To a large extent, chemotherapy can be thought of as a way to damage or stress cells, which may then lead to cell death if apoptosis is initiated.
Chemotherapeutic agents include alkylating agents, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic antibiotics.
Alkylating agents have the ability to alkylate many molecules, including proteins, RNA and DNA. The subtypes of alkylating agents are the nitrogen mustards, nitrosoureas, tetrazines, aziridines, cisplatins and derivatives, and non-classical alkylating agents. Nitrogen mustards include mechlorethamine, cyclophosphamide, melphalan, chlorambucil, ifosfamide and busulfan. Nitrosoureas include N-Nitroso-N-methylurea (MNU), carmustine (BCNU), lomustine (CCNU) and semustine (MeCCNU), fotemustine and streptozotocin. Tetrazines include dacarbazine, mitozolomide and temozolomide. Aziridines include thiotepa, mytomycin and diaziquone (AZQ). Cisplatin and derivatives include cisplatin, carboplatin and oxaliplatin. They impair cell function by forming covalent bonds with the amino, carboxyl, sulfhydryl, and phosphate groups in biologically important molecules. Non-classical alkylating agents include procarbazine and hexamethylmelamine. In one particularly preferred embodiment, the alkylating agent is cyclophosphamide.
Anti-metabolites are a group of molecules that impede DNA and RNA synthesis. Many of them have a similar structure to the building blocks of DNA and RNA. Anti-metabolites resemble either nucleobases or nucleosides, but have altered chemical groups. These drugs exert their effect by either blocking the enzymes required for DNA synthesis or becoming incorporated into DNA or RNA. Subtypes of the anti-metabolites are the anti-folates, fluoropyrimidines, deoxynucleoside analogues and thiopurines. The anti-folates include methotrexate and pemetrexed. The fluoropyrimidines include fluorouracil and capecitabine. The deoxynucleoside analogues include cytarabine, gemcitabine, decitabine, azacitidine, fludarabine, nelarabine, cladribine, clofarabine, and pentostatin. The thiopurines include thioguanine and mercaptopurine.
Anti-microtubule agents block cell division by preventing microtubule function. The vinca alkaloids prevent the formation of the microtubules, whereas the taxanes prevent the microtubule disassembly. Vinca alkaloids include vinorelbine, vindesine, and vinflunine. Taxanes include docetaxel (Taxotere) and paclitaxel (Taxol).
Topoisomerase inhibitors are drugs that affect the activity of two enzymes: topoisomerase I and topoisomerase II and include irinotecan, topotecan, camptothecin, etoposide, doxorubicin, mitoxantrone, teniposide, novobiocin, merbarone, and aclarubicin.
The cytotoxic antibiotics are a varied group of drugs that have various mechanisms of action. The common theme that they share in their chemotherapy indication is that they interrupt cell division. The most important subgroup is the anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, idarubicin pirarubicin, and aclarubicin) and the bleomycins; other prominent examples include mitomycin C, mitoxantrone, and actinomycin.
In some embodiments, e.g., prior to administration of immune effector cells, a lymphodepleting treatment may be applied, e.g., by administering cyclophosphamide and fludarabine. Such treatment may increase cell persistence and the incidence and duration of clinical responses.
"Immune checkpoint" refers to regulators of the immune system, and, in particular, co- stimulatory and inhibitory signals that regulate the amplitude and quality of T cell activity. In certain embodiments, the immune checkpoint is an inhibitory signal. In certain embodiments, the inhibitory signal is the interaction between PD-1 and PD-L1 and/or PD-L2.
The "Programmed Death-1 (PD-1)" receptor refers to an immuno-inhibitory receptor belonging to the CD28 family. PD-1 is expressed predominantly on previously activated T cells in vivo, and binds to two ligands, PD-L1 and PD-L2. The term "PD-1" as used herein includes human PD-1 (hPD-1), variants, isoforms, and species homologs of hPD-1, and analogs having at least one common epitope with hPD-1. "Programmed Death Ligand-1 (PD-L1)" is one of two cell surface glycoprotein ligands for PD-1 (the other being PD-L2) that downregulates T cell activation and cytokine secretion upon binding to PD-1. The term "PD-L1" as used herein includes human PD-L1 (hPD-Ll), variants, isoforms, and species homologs of hPD-Ll, and analogs having at least one common epitope with hPD-Ll. The term "PD-L2" as used herein includes human PD-L2 (hPD-L2), variants, isoforms, and species homologs of hPD-L2, and analogs having at least one common epitope with hPD-L2. The ligands of PD-1 (PD-L1 and PD- L2) are expressed on the surface of antigen-presenting cells, such as dendritic cells or macrophages, and other immune cells. Binding of PD-1 to PD-L1 or PD-L2 results in downregulation of T cell activation. Cancer cells expressing PD-L1 and/or PD-L2 are able to switch off T cells expressing PD-1 which results in suppression of the anticancer immune response. The interaction between PD-1 and its ligands results in a decrease in tumor infiltrating lymphocytes, a decrease in T cell receptor mediated proliferation, and immune evasion by the cancerous cells. Immune suppression can be reversed by inhibiting the local interaction of PD-1 with PD-L1, and the effect is additive when the interaction of PD-1 with PD-L2 is blocked as well.
Many of the immune checkpoints are regulated by interactions between specific receptor and ligand pairs, such as those described above. Thus, immune checkpoint proteins mediate immune checkpoint signaling. For example, checkpoint proteins directly or indirectly regulate T cell activation, T cell proliferation and/or T cell function. Cancer cells often exploit these checkpoint pathways to protect themselves from being attacked by the immune system. Hence, the function of checkpoint proteins, which is modulated according to the present disclosure is typically the regulation of T cell activation, T cell proliferation and/or T cell function. Immune checkpoint proteins thus regulate and maintain self-tolerance and the duration and amplitude of physiological immune responses.
As used herein, the term "immune checkpoint modulator" or "checkpoint modulator" refers to a molecule or to a compound that modulates the function of one or more checkpoint proteins. Immune checkpoint modulators are typically able to modulate self-tolerance and/or the amplitude and/or the duration of the immune response. Preferably, the immune checkpoint modulator modulates the function of one or more human checkpoint proteins and is, thus, a "human checkpoint modulator". Specifically, the human checkpoint modulator is an immune checkpoint inhibitor.
As used herein, "immune checkpoint inhibitor" or "checkpoint inhibitor" refers to a molecule that totally or partially reduces, inhibits, interferes with or negatively modulates one or more checkpoint proteins or that totally or partially reduces, inhibits, interferes with or negatively modulates expression of one or more checkpoint proteins. In certain embodiments, the immune checkpoint inhibitor binds to one or more checkpoint proteins. In certain embodiments, the immune checkpoint inhibitor binds to one or more molecules regulating checkpoint proteins.
In certain embodiments, the immune checkpoint inhibitor prevents inhibitory signals associated with the immune checkpoint. In certain embodiments, the immune checkpoint inhibitor is an antibody, or fragment thereof that disrupts inhibitory signaling associated with the immune checkpoint. In certain embodiments, the immune checkpoint inhibitor is a small molecule inhibitor that disrupts inhibitory signaling. In certain embodiments, the immune checkpoint inhibitor is a peptide-based inhibitor that disrupts inhibitory signaling.
In certain embodiments, the immune checkpoint inhibitor is an antibody, fragment thereof, or antibody mimic, that prevents the interaction between checkpoint blocker proteins.
In some embodiments, inhibiting or blocking of inhibitory immune checkpoint signaling, as described herein, results in preventing or reversing immune-suppression and establishment or enhancement of T cell immunity. In some embodiments, inhibition of immune checkpoint signaling, as described herein, reduces or inhibits dysfunction of the immune system. In some embodiments, inhibition of immune checkpoint signaling, as described herein, renders dysfunctional immune cells less dysfunctional. In some embodiments, inhibition of immune checkpoint signaling, as described herein, renders a dysfunctional T cell less dysfunctional.
In certain embodiments, the inhibitory immunoregulator (immune checkpoint blocker) is a component of the PD-1/PD-L1 or PD-1/PD-L2 signaling pathway.
In certain embodiments, the inhibitory immunoregulator (immune checkpoint blocker) is a PD-1 axis binding antagonist.
The term "PD-1 axis binding antagonist" refers to a molecule that inhibits the interaction of a PD-1 axis binding partner with either one or more of its binding partners, so as to remove T- cell dysfunction resulting from signaling on the PD-1 signaling axis - with a result being to restore or enhance T-cell function (e.g., proliferation, cytokine production, target cell killing). As used herein, a PD-1 axis binding antagonist includes a PD-1 binding antagonist, a PD-L1 binding antagonist and a PD-L2 binding antagonist.
The term "PD-1 binding antagonist" refers to a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-1 with one or more of its binding partners, such as PD-L1, PD-L2. In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to one or more of its binding partners. In a specific aspect, the PD-1 binding antagonist inhibits the binding of PD-1 to PD- L1 and/or PD-L2. For example, PD-1 binding antagonists include anti-PD-1 antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interaction of PD-1 with PD-L1 and/or PD-L2. In some embodiments, a PD- 1 binding antagonist reduces the negative co-stimulatory signal mediated by or through cell surface proteins expressed on T lymphocytes mediated signaling through PD-1 so as render a dysfunctional T-cell less dysfunctional (e.g., enhancing effector responses to antigen recognition). In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody.
The term "PD-L1 binding antagonist" refers to a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-L1 with either one or more of its binding partners, such as PD-1, B7-1. In some embodiments, a PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L1 to one or more of its binding partners. In a specific aspect, the PD-L1 binding antagonist inhibits binding of PD-L1 to PD-1 and/or B7-1. In some embodiments, the PD-L1 binding antagonists include anti-PD-Ll antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interaction of PD-L1 with one or more of its binding partners, such as PD-1, B7-1. In some embodiments, a PD-L1 binding antagonist reduces the negative co-stimulatory signal mediated by or through cell surface proteins expressed on T lymphocytes mediated signaling through PD-L1 so as to render a dysfunctional T-cell less dysfunctional (e.g., enhancing effector responses to antigen recognition). In some embodiments, a PD-L1 binding antagonist is an anti-PD-Ll antibody.
The term "PD-L2 binding antagonist" refers to a molecule that decreases, blocks, inhibits, abrogates or interferes with signal transduction resulting from the interaction of PD-L2 with either one or more of its binding partners, such as PD-1. In some embodiments, a PD-L2 binding antagonist is a molecule that inhibits the binding of PD-L2 to one or more of its binding partners. In a specific aspect, the PD-L2 binding antagonist inhibits binding of PD-L2 to PD-1. In some embodiments, the PD-L2 antagonists include anti-PD-L2 antibodies, antigen binding fragments thereof, immunoadhesins, fusion proteins, oligopeptides and other molecules that decrease, block, inhibit, abrogate or interfere with signal transduction resulting from the interaction of PD-L2 with either one or more of its binding partners, such as PD-1. In some embodiments, a PD-L2 binding antagonist reduces the negative co-stimulatory signal mediated by or through cell surface proteins expressed on T lymphocytes mediated signaling through PD-L2 so as render a dysfunctional T-cell less dysfunctional (e.g., enhancing effector responses to antigen recognition). In some embodiments, a PD-L2 binding antagonist is an immunoadhesin.
In some embodiments, a PD-1 axis binding antagonist includes a PD-1 binding antagonist, a PD-L1 binding antagonist and a PD-L2 binding antagonist. Alternative names for "PD-1" include CD279 and SLEB2. Alternative names for "PD-L1" include B7-H1, B7-4, CD274, and B7-
H. Alternative names for "PD-L2" include B7-DC, Btdc, and CD273. In some embodiments, PD-
I, PD-L1, and PD-L2 are human PD-1, PD-L1 and PD-L2.
In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partner(s). In a specific aspect the PD-1 ligand binding partners are PD-L1 and/or PD-L2.
In some embodiments, the PD-L1 binding antagonist is a molecule that inhibits the binding of PD-L1 to its binding partner(s). In a specific aspect, PD-L1 binding partner(s) are PD-1 and/or B7-1.
In some embodiments, the PD-L2 binding antagonist is a molecule that inhibits the binding of PD-L2 to its binding partner(s). In a specific aspect, a PD-L2 binding partner is PD-1.
The antagonist may be an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide.
In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody).
In some embodiments, the PD-L1 binding antagonist is an anti-PD-Ll antibody.
PD-1 axis binding antagonists such as anti-PD-1 antibodies and anti-PD-Ll antibodies may be administered in any manner and by any route known in the art. The mode and route of administration will depend on the type of PD-1 axis binding antagonist to be used.
PD-1 axis binding antagonists may be administered in the form of any suitable pharmaceutical composition as described herein.
PD-1 axis binding antagonists such as anti-PD-1 antibodies and anti-PD-Ll antibodies may be administered in the form of nucleic acid, such DNA or RNA, encoding a PD-1 axis binding antagonist such as anti-PD-1 antibody or anti-PD-Ll antibody. For example, antibodies can be delivered encoded in expressing nucleic acids, as described herein. Nucleic acid molecules can be delivered as such, e.g., in the form of a plasmid or mRNA molecule, or complexed with a delivery vehicle, e.g., a liposome, lipoplex or any other nucleic-acid particle such as nucleic- acid lipid particle. PD-1 axis binding antagonists such as anti-PD-1 antibodies and anti-PD-Ll antibodies may also be administered via an oncolytic virus comprising an expression cassette encoding the PD-1 axis binding antagonist.
Compositions comprising nucleic acid
A composition comprising one or more RNAs described herein, e.g., in the form of RNA particles, may comprise salts, buffers, or other components as further described below.
In some embodiments, a salt for use in the compositions described herein comprises sodium chloride. Without wishing to be bound by theory, sodium chloride functions as an ionic osmolality agent for preconditioning RNA prior to mixing with lipids. In some embodiments, the compositions described herein may comprise alternative organic or inorganic salts. Alternative salts include, without limitation, potassium chloride, dipotassium phosphate, monopotassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, disodium phosphate, monosodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, lithium chloride, magnesium chloride, magnesium phosphate, calcium chloride, and sodium salts of ethylenediaminetetraacetic acid (EDTA).
Generally, compositions for storing RNA particles such as for freezing RNA particles comprise low sodium chloride concentrations, or comprises a low ionic strength. In some embodiments, the sodium chloride is at a concentration from 0 mM to about 50 mM, from 0 mM to about 40 mM, or from about 10 mM to about 50 mM.
According to the present disclosure, the RNA particle compositions described herein have a pH suitable for the stability of the RNA particles and, in particular, for the stability of the RNA. Without wishing to be bound by theory, the use of a buffer system maintains the pH of the particle compositions described herein during manufacturing, storage and use of the compositions. In some embodiments of the present disclosure, the buffer system may comprise a solvent (in particular, water, such as deionized water, in particular water for injection) and a buffering substance. The buffering substance may be selected from 2-[4-(2- hydroxyethyl)piperazin-l-yl]ethanesulfonic acid (HEPES), 2-amino-2- (hydroxymethyl)propane-l,3-diol (Tris), acetate, and histidine. In some embodiments, the buffering substance is HEPES. In some embodiments, the buffering substance is Tris. Compositions (in particular, RNA compositions/formulations) described herein may also comprise a cryoprotectant and/or a surfactant as stabilizer to avoid substantial loss of the product quality and, in particular, substantial loss of RNA activity during storage, freezing, and/or lyophilization, for example to reduce or prevent aggregation, particle collapse, RNA degradation and/or other types of damage.
In some embodiments, the cryoprotectant is a carbohydrate. The term "carbohydrate", as used herein, refers to and encompasses monosaccharides, disaccharides, trisaccharides, oligosaccharides and polysaccharides.
In some embodiments, the cryoprotectant is a monosaccharide. The term "monosaccharide", as used herein refers to a single carbohydrate unit (e.g., a simple sugar) that cannot be hydrolyzed to simpler carbohydrate units. Exemplary monosaccharide cryoprotectants include glucose, fructose, galactose, xylose, ribose and the like.
In some embodiments, the cryoprotectant is a disaccharide. The term "disaccharide", as used herein refers to a compound or a chemical moiety formed by 2 monosaccharide units that are bonded together through a glycosidic linkage, for example through 1-4 linkages or 1-6 linkages. A disaccharide may be hydrolyzed into two monosaccharides. Exemplary disaccharide cryoprotectants include sucrose, trehalose, lactose, maltose and the like. In some embodiments, the cryoprotectant is sucrose.
The term "trisaccharide" means three sugars linked together to form one molecule. Examples of a trisaccharides include raffinose and melezitose.
In some embodiments, the cryoprotectant is an oligosaccharide. The term "oligosaccharide", as used herein refers to a compound or a chemical moiety formed by 3 to about 15, such as 3 to about 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure. Exemplary oligosaccharide cryoprotectants include cyclodextrins, raffinose, melezitose, maltotriose, stachyose, acarbose, and the like. An oligosaccharide can be oxidized or reduced. In an embodiment, the cryoprotectant is a cyclic oligosaccharide. The term "cyclic oligosaccharide", as used herein refers to a compound or a chemical moiety formed by 3 to about 15, such as 6, 7, 8, 9, or 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a cyclic structure. Exemplary cyclic oligosaccharide cryoprotectants include cyclic oligosaccharides that are discrete compounds, such as a cyclodextrin, 0 cyclodextrin, or y cyclodextrin. Other exemplary cyclic oligosaccharide cryoprotectants include compounds which include a cyclodextrin moiety in a larger molecular structure, such as a polymer that contains a cyclic oligosaccharide moiety. A cyclic oligosaccharide can be oxidized or reduced, for example, oxidized to dicarbonyl forms. The term "cyclodextrin moiety", as used herein refers to cyclodextrin (e.g., an a, 0, or y cyclodextrin) radical that is incorporated into, or a part of, a larger molecular structure, such as a polymer. A cyclodextrin moiety can be bonded to one or more other moieties directly, or through an optional linker. A cyclodextrin moiety can be oxidized or reduced, for example, oxidized to dicarbonyl forms.
Carbohydrate cryoprotectants, e.g., cyclic oligosaccharide cryoprotectants, can be derivatized carbohydrates. For example, in an embodiment, the cryoprotectant is a derivatized cyclic oligosaccharide, e.g., a derivatized cyclodextrin, e.g., 2-hydroxypropyl-0-cyclodextrin, e.g., partially etherified cyclodextrins (e.g., partially etherified 0 cyclodextrins).
An exemplary cryoprotectant is a polysaccharide. The term "polysaccharide", as used herein refers to a compound or a chemical moiety formed by at least 16 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure, and includes polymers that comprise polysaccharides as part of their backbone structure. In backbones, the polysaccharide can be linear or cyclic. Exemplary polysaccharide cryoprotectants include glycogen, amylase, cellulose, dextran, maltodextrin and the like.
In some embodiments, RNA particle compositions may include sucrose. Without wishing to be bound by theory, sucrose functions to promote cryoprotection of the compositions, thereby preventing RNA (especially mRNA) particle aggregation and maintaining chemical and physical stability of the composition. In some embodiments, RNA particle compositions may include alternative cryoprotectants to sucrose. Alternative stabilizers include, without limitation, trehalose and glucose. In a specific embodiment, an alternative stabilizerto sucrose is trehalose or a mixture of sucrose and trehalose.
A preferred cryoprotectant is selected from the group consisting of sucrose, trehalose, glucose, and a combination thereof, such as a combination of sucrose and trehalose. In a preferred embodiment, the cryoprotectant is sucrose.
Some embodiments of the present disclosure contemplate the use of a chelating agent in an RNA composition described herein. Chelating agents refer to chemical compounds that are capable of forming at least two coordinate covalent bonds with a metal ion, thereby generating a stable, water-soluble complex. Without wishing to be bound by theory, chelating agents reduce the concentration of free divalent ions, which may otherwise induce accelerated RNA degradation in the present disclosure. Examples of suitable chelating agents include, without limitation, ethylenediaminetetraacetic acid (EDTA), a salt of EDTA, desferrioxamine B, deferoxamine, dithiocarb sodium, penicillamine, pentetate calcium, a sodium salt of pentetic acid, succimer, trientine, nitrilotriacetic acid, trans- diaminocyclohexanetetraacetic acid (DCTA), diethylenetriaminepentaacetic acid (DTPA), and bis(aminoethyl)glycolether-N,N,N',N'-tetraacetic acid. In some embodiments, the chelating agent is EDTA or a salt of EDTA. In some embodiments, the chelating agent is EDTA disodium dihydrate. In some embodiments, the EDTA is at a concentration from about 0.05 mM to about 5 mM, from about 0.1 mM to about 2.5 mM or from about 0.25 mM to about 1 mM.
In an alternative embodiment, the RNA particle compositions described herein do not comprise a chelating agent.
Pharmaceutical compositions
The agents described herein may be administered in pharmaceutical compositions or medicaments and may be administered in the form of any suitable pharmaceutical composition. In some embodiments, the pharmaceutical composition is for therapeutic or prophylactic treatments, e.g., for use in treating or preventing a disease involving an antigen such as a cancer disease or an infectious disease.
The term "pharmaceutical composition" relates to a composition comprising a therapeutically effective agent, preferably together with pharmaceutically acceptable carriers, diluents and/or excipients. Said pharmaceutical composition is useful for treating, preventing, or reducing the severity of a disease by administration of said pharmaceutical composition to a subject.
The pharmaceutical compositions of the present disclosure may comprise one or more adjuvants or may be administered with one or more adjuvants. The term "adjuvant" relates to a compound which prolongs, enhances or accelerates an immune response. Adjuvants comprise a heterogeneous group of compounds such as oil emulsions (e.g., Freund's adjuvants), mineral compounds (such as alum), bacterial products (such as Bordetella pertussis toxin), or immune-stimulating complexes. Examples of adjuvants include, without limitation, LPS, GP96, CpG oligodeoxynucleotides, growth factors, and cytokines, such as monokines, lymphokines, interleukins, chemokines. The chemokines may be IL-1, IL-2, IL-3, IL- 4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, INFa, INF-y, GM-CSF, LT-a. Further known adjuvants are aluminum hydroxide, Freund's adjuvant or oil such as Montanide® ISA51. Other suitable adjuvants for use in the present disclosure include lipopeptides, such as Pam3Cys, as well as lipophilic components, such as saponins, trehalose-6,6-dibehenate (TDB), monophosphoryl lipid-A (MPL), monomycoloyl glycerol (MMG), or glucopyranosyl lipid adjuvant (GLA).
The pharmaceutical compositions of the present disclosure may be in a storable form (e.g., in a frozen or lyophilized/freeze-dried form) or in a "ready-to-use form" (i.e., in a form which can be immediately administered to a subject, e.g., without any processing such as diluting). Thus, prior to administration of a storable form of a pharmaceutical composition, this storable form has to be processed or transferred into a ready-to-use or administrable form. E.g., a frozen pharmaceutical composition has to be thawed, or a freeze-dried pharmaceutical composition has to be reconstituted, e.g. by using a suitable solvent (e.g., deionized water, such as water for injection) or liquid (e.g., an aqueous solution).
The pharmaceutical compositions according to the present disclosure are generally applied in a "pharmaceutically effective amount" and in "a pharmaceutically acceptable preparation".
The term "pharmaceutically acceptable" refers to the non-toxicity of a material which does not interact with the action of the active component of the pharmaceutical composition.
The term "pharmaceutically effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In some embodiments relating to the treatment of a particular disease, the desired reaction may relate to inhibition of the course of the disease. This comprises slowing down the progress of the disease and, in some embodiments, interrupting or reversing the progress of the disease. The desired reaction in a treatment of a disease may also be delay of the onset or a prevention of the onset of said disease or said condition, or symptoms thereof. An effective amount of the pharmaceutical compositions described herein will depend on the condition to be treated, the severeness of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, the doses administered of the pharmaceutical compositions described herein may depend on various of such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.
The pharmaceutical compositions of the present disclosure may contain buffers, preservatives, and optionally other therapeutic agents. In some embodiments, the pharmaceutical compositions of the present disclosure comprise one or more pharmaceutically acceptable carriers, diluents and/or excipients.
Suitable preservatives for use in the pharmaceutical compositions of the present disclosure include, without limitation, benzalkonium chloride, chlorobutanol, paraben and thimerosal. The term "excipient" as used herein refers to a substance which may be present in a pharmaceutical composition of the present disclosure but is not an active ingredient. Examples of excipients, include without limitation, carriers, binders, diluents, lubricants, thickeners, surface active agents, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or colorants
The term "diluent" relates a diluting and/or thinning agent. Moreover, the term "diluent" includes any one or more of fluid, liquid or solid suspension and/or mixing media. Examples of suitable diluents include ethanol, glycerol and water.
The term "carrier" refers to a component which may be natural, synthetic, organic, inorganic in which the active component is combined in order to facilitate, enhance or enable administration of the pharmaceutical composition. A carrier as used herein may be one or more compatible solid or liquid fillers, diluents or encapsulating substances, which are suitable for administration to subject. Suitable carriers include, without limitation, sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide/glycolide copolymers or polyoxyethylene/polyoxy-propylene copolymers. In some embodiments, the pharmaceutical composition of the present disclosure includes isotonic saline.
Pharmaceutically acceptable carriers, excipients or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edit. 1985).
Pharmaceutical carriers, excipients or diluents can be selected with regard to the intended route of administration and standard pharmaceutical practice. In some embodiments, the composition, in particular the pharmaceutical composition, is a vaccine.
Routes of administration of pharmaceutical compositions
In some embodiments, the pharmaceutical compositions described herein may be administered intravenously, intraarterially, subcutaneously, intradermally, dermally, intranodally, intramuscularly, intratumorally, or peritumorally. In some embodiments, the pharmaceutical compositions described herein may be administered intramuscularly. In some embodiments, the pharmaceutical composition is formulated for local administration or systemic administration. Systemic administration may include enteral administration, which involves absorption through the gastrointestinal tract, or parenteral administration. As used herein, "parenteral administration" refers to the administration in any manner other than through the gastrointestinal tract, such as by intravenous injection. In some embodiments, the pharmaceutical compositions are formulated for systemic administration. In some embodiments, the systemic administration is by intravenous administration. In some embodiments, the pharmaceutical compositions are formulated for intrmuscular administration.
Use of compositions
Compositions described herein may be used in the therapeutic or prophylactic treatment of various diseases, in particular diseases in which provision of a peptide or polypeptide, e.g., vaccine antigen, to a subject results in a therapeutic or prophylactic effect, e.g., a disease characterized by the presence of diseased cells expressing an antigen such as cancer diseases or infectious diseases. For example, provision of an antigen or epitope which is derived from a virus may be useful in the treatment of a viral disease caused by said virus. Provision of a tumor antigen or epitope may be useful in the treatment of a cancer disease wherein cancer cells express said tumor antigen. Provision of a functional protein or enzyme may be useful in the treatment of genetic disorder characterized by a dysfunctional protein, for example in lysosomal storage diseases (e.g., mucopolysaccharidoses) or factor deficiencies. Provision of a cytokine or a cytokine-fusion may be useful to modulate tumor microenvironment.
The term "disease" (also referred to as "disorder" herein) refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. A disease may be caused by factors originally from an external source, such as infectious disease, or it may be caused by internal dysfunctions, such as autoimmune diseases. In humans, "disease" is often used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the individual afflicted, or similar problems for those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and atypical variations of structure and function, while in other contexts and for other purposes these may be considered distinguishable categories. Diseases usually affect individuals not only physically, but also emotionally, as contracting and living with many diseases can alter one's perspective on life, and one's personality.
The term "disease involving an antigen" refers to any disease which implicates an antigen, e.g. a disease which is characterized by the presence of an antigen. The disease involving an antigen can be an infectious disease, or a cancer disease or simply cancer. The antigen may be a disease-associated antigen, such as a tumor-associated antigen, a viral antigen, or a bacterial antigen. In some embodiments, a disease involving an antigen is a disease involving cells expressing an antigen, and preferably presenting the antigen on the cell surface, e.g., in the context of MHC.
The term "infectious disease" refers to any disease which can be transmitted from individual to individual or from organism to organism, and is caused by a microbial agent (e.g. common cold). Infectious diseases are known in the art and include, for example, a viral disease, a bacterial disease, or a parasitic disease, which diseases are caused by a virus, a bacterium, and a parasite, respectively. In this regard, the infectious disease can be, for example, hepatitis, sexually transmitted diseases (e.g. chlamydia or gonorrhea), tuberculosis, HIV/acquired immune deficiency syndrome (AIDS), diphtheria, hepatitis B, hepatitis C, cholera, severe acute respiratory syndrome (SARS), the bird flu, and influenza.
The terms "cancer disease" or "cancer" refer to or describe the physiological condition in an individual that is typically characterized by unregulated cell growth. Examples of cancers include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particularly, examples of such cancers include bone cancer, blood cancer lung cancer, liver cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the bladder, cancer of the kidney, renal cell carcinoma, carcinoma of the renal pelvis, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal axis tumors, glioma, meningioma, and pituitary adenoma. The term "cancer" according to the disclosure also comprises cancer metastases.
In the present context, the term "treatment", "treating" or "therapeutic intervention" relates to the management and care of a subject for the purpose of combating a condition such as a disease. The term is intended to include the full spectrum of treatments for a given condition from which the subject is suffering, such as administration of the therapeutically effective compound to alleviate the symptoms or complications, to delay the progression of the disease, disorder or condition, to alleviate or relief the symptoms and complications, and/or to cure or eliminate the disease, disorder or condition as well as to prevent the condition, wherein prevention is to be understood as the management and care of an individual for the purpose of combating the disease, condition or disorder and includes the administration of the active compounds to prevent the onset of the symptoms or complications.
The term "therapeutic treatment" relates to any treatment which improves the health status and/or prolongs (increases) the lifespan of an individual. Said treatment may eliminate the disease in an individual, arrest or slow the development of a disease in an individual, inhibit or slow the development of a disease in an individual, decrease the frequency or severity of symptoms in an individual, and/or decrease the recurrence in an individual who currently has or who previously has had a disease.
The terms "prophylactic treatment" or "preventive treatment" relate to any treatment that is intended to prevent a disease from occurring in an individual. The terms "prophylactic treatment" or "preventive treatment" are used herein interchangeably.
The terms "individual" and "subject" are used herein interchangeably. They refer to a human or another mammal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate), or any other non-mammal-animal, including birds (chicken), fish or any other animal species that can be afflicted with or is susceptible to a disease (e.g., cancer, infectious diseases) but may or may not have the disease, or may have a need for prophylactic intervention such as vaccination, or may have a need for interventions such as by protein replacement. In many embodiments, the individual is a human being. Unless otherwise stated, the terms "individual" and "subject" do not denote a particular age, and thus encompass adults, elderlies, children, and newborns. In some embodiments of the present disclosure, the "individual" or "subject" is a "patient".
The term "patient" means an individual or subject for treatment, in particular a diseased individual or subject.
RNA may be administered to a subject for delivering the RNA to cells of the subject.
RNA may be administered to a subject for delivering a therapeutic or prophylactic peptide or polypeptide (e.g., a pharmaceutically active peptide or polypeptide) to the subject, wherein the RNA encodes a therapeutic or prophylactic peptide or polypeptide.
RNA may be administered to a subject for treating or preventing a disease in a subject, wherein delivering the RNA to cells of the subject is beneficial in treating or preventing the disease.
RNA may be administered to a subject for treating or preventing a disease in a subject, wherein the RNA encodes a therapeutic or prophylactic peptide or polypeptide and wherein delivering the therapeutic or prophylactic peptide or polypeptide to the subject is beneficial in treating or preventing the disease.
In some embodiments, the RNA is present in a composition as described herein.
In some embodiments, the RNA is administered in a pharmaceutically effective amount.
In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.
In some embodiments of the disclosure, the aim is to induce an immune response by providing a vaccine.
A person skilled in the art will know that one of the principles of immunotherapy and vaccination is based on the fact that an immunoprotective reaction to a disease is produced by immunizing a subject with an antigen or an epitope, which is immunologically relevant with respect to the disease to be treated. Accordingly, RNA described herein is applicable for inducing or enhancing an immune response. RNA described herein is thus useful in a prophylactic and/or therapeutic treatment of a disease involving an antigen or epitope.
In some embodiments of the disclosure, the aim is to provide an immune response against diseased cells expressing an antigen such as cancer cells expressing a tumor antigen, and to treat a disease such as a cancer disease involving cells expressing an antigen such as a tumor antigen.
In some embodiments of the disclosure, the aim is to treat cancer by vaccination.
In some embodiments of the disclosure, the aim is to provide an immune response against cancer cells expressing a tumor antigen and to treat a cancer disease involving cells expressing a tumor antigen.
In some embodiments of the disclosure, the aim is to provide protection against an infectious disease by vaccination.
In some embodiments of the disclosure, the aim is to provide secreted therapeutic proteins, such as antibodies, bispecific antibodies, cytokines, cytokine fusion proteins, enzymes, to a subject, in particular a subject in need thereof.
In some embodiments of the disclosure, the aim is to provide a protein replacement therapy, such as production of erythropoietin, Factor VII, Von Willebrand factor, P-galactosidase, alpha-N-acetylglucosaminidase, to a subject, in particular a subject in need thereof.
In some embodiments of the disclosure, the aim is to modulate/reprogram immune cells in the blood.
In some embodiments of the disclosure, the aim is to provide one or more cytokines or cytokine fusions which modulate tumor microenvironment to a subject, in particular a subject in need thereof.
In some embodiments of the disclosure, the aim is to provide one or more cytokines or cytokine fusions which have antitumoral activity to a subject, in particular a subject in need thereof.
Citation of documents and studies referenced herein is not intended as an admission that any of the foregoing is pertinent prior art. All statements as to the contents of these documents are based on the information available to the applicants and do not constitute any admission as to the correctness of the contents of these documents.
The description (including the following examples) is presented to enable a person of ordinary skill in the art to make and use the various embodiments. Descriptions of specific devices, techniques, and applications are provided only as examples. Various modifications to the examples described herein will be readily apparent to those of ordinary skill in the art, and the general principles defined herein may be applied to other examples and applications without departing from the spirit and scope of the various embodiments. Thus, the various embodiments are not intended to be limited to the examples described herein and shown, but are to be accorded the scope consistent with the claims.
Examples
Example 1: Expression of mRNAs containing miRNA binding sites in vitro in HEK293 and HUVEC cells.
Methods mRNA constructs were transfected in HEK293 or HUVEC cells using RiboJuice™ mRNA transfection reagent according to manufacturer's protocol with minor adaptations. Cells were seeded in a 12-well plate (1E5-2E5 per well) overnight and transfected with 150ng mRNA/30nM miRNA mimic per well. The expression of the protein encoded by the RNA was assayed after 18h with FACS (BD FACSCanto II flow cytometer) using protein-specific antibodies.
Experimental Results mRNAs containing a binding site for a set of human miRNAs (miRNA-BS) were produced in order to test miRNA-guided repression of RNA expression. For the initial study, a single miRNA binding site for miRNAs expressed in human endothelium (hsa-mir-126, hsa-mir-216a and hsa- mir-217) or myocardium (hsa-mir-208b and hsa-mir-499a) was placed immediately upstream of the polyA-tail of the mRNA (CDS - F-Element - 1-Element - miR-BS - PolyA). In order to test the efficiency of the mRNA expression downregulation, mRNAs were transfected in HEK293 cells and human umbilical cord vein cells (HUVEC) alone or together with corresponding miRNA or control miRNA mimics. mRNA without miRNA binding sites was used as control. HEK293 cell have low expression of miRNA used in this experiment, which allowed us to monitor how the expression is affected by the presence of miRNA-BS and assess the efficiency of the expression downregulation in the presence of the corresponding miRNA mimic. The expression of mRNA constructs constaining a single copy of miR-126-5p or miR-126-3p binding site (mRNA-126-5p-BS and mRNA-126-3p-BS, respectively) was downregulated when corresponding miRNA mimic was co-transfected, but not in the presence of a non-specific miRNA mimic (Fig. 1).
HUVEC cells were chosen as model for human endothelial cell where endogenous endothelial cell-specific miRNAs are expressed. In fact, miRNA-126 is one of the most abundantly expressed miRNA in HUVEC. In good correlation with this, we observed that the expression of both mRNA-126-5p-BS and mRNA-126-3p-BS mRNAs was abolished even without addition of corresponding miRNA mimics, likely due to high levels of expression of endogenous hsa-mir- 126-5p and -3p in HUVEC cells (Fig. 2).
We have tested 3 other mRNA-miR-BS constructs: based on other two endothelial cell specific miRNAs (hsa-mir-216a and hsa-mir-217) and a myocardium-specific hsa-mir-208b in HEK293 and HUVEC cells (Fig. 3 and 4). Although we observed the reduction of protein expression in HEK293 cells for these three mRNA-miR-BS constructs, the effect was less pronounced compared to miR-126-based ones, for mRNA-208b-BS especially (Fig. 3).
Significantly, we observed minor difference in expression of mRNA-216a-BS and mRNA-217- BS in HUVEC cells compared to HEK293, which indicates that the amount of endogenously expressed miR-216a and miR-217 in HUVECs is not sufficient for an efficient miRNA mimic- independent downregulation of these constructs (Fig. 4).
We next studied the effects of miRNA-BS copy number and their position within the mRNA. One, two or three copies of hsa-mir-126-5p binding sites were placed at three different positions within the 3' UTR of the mRNA. mRNA without miRNA binding sites and nine different mRNA-126-5p-BS constructs (following table, constructs 1-9) were transfected in HEK293 cells together with miR-126-5p or non-specific mir-216a miRNA mimics (Fig. 5). Constructs containing three mir-126-5p binding sites had lowest expression, with exception of construct 6, where three miR-BS were placed between F and I elements. Importantly, expression of constructs containing three mir-126-5p binding sites was as high or even higher than corresponding mRNA samples, when no or non-targeting miRNA mimic was co- transfected. This strongly suggests that incorporation of at least up to three miRNA binding sites has no negative effect on translatability of the mRNA. Note that transfection efficiency in all our experiment was generally higher when mRNAs were co-transfected with miRNA mimics, as illustrated well here for mRNA with mir-126-5p and mir-216a mimics (Figure 5, black bars). Similar results were observed with other tested miRNA-mimics (data not shown) and could be attributed to more efficient mRNA formulation in the presence of miRNA mimics. Position of miRNA-126-5p in mRNA constructs 1-9. mRNA
CDS - F-l - PolyA mRNA-126-5p-BS constructs miR-126-5p-BS between CDS and F-l elements
CDS - miR-126-5p-BS - F-l - PolyA 1
CDS - miR-126-5p-BS x2 - F-l - PolyA 2
CDS - miR-126-5p-BS x3 - F-l - PolyA 3 miR-126-5p-BS between F and I elements
CDS - F - miR-126-5p-BS - I - PolyA 4
CDS - F - miR-126-5p-BS x2 - I - PolyA 5
CDS - F - miR-126-5p-BS x3 - I - PolyA 6 miR-126-5p-BS between F-l elements and polyA
CDS - F- 1 - miR-126-5p-BS - PolyA 7
CDS - F- 1 — miR-126-5p-BS x2 - PolyA 8
CDS - F- 1 - miR-126-5p-BS x3 - PolyA 9
When transfected in HUVEC cells, all tested constructs expectedly displayed low levels of protein expression compared to mRNA without miRNA binding sites (Figure 6). Similar to HEK293 cells, the increasing number of miRNA binding sites lead to even stronger drop in expression, except when miRNA-BS were placed between F and I elements (construct 6).
In summary, we have investigated the effects of miRNA-directed expression downregulation of mRNA constructs containing corresponding miRNA binding sites for several human miRNAs that are specific to endothelial or heart muscle cells. Based on our results in HEK293 and HUVEC cells, miRNA-126-5p and miRNA-126-3p were chosen for subsequent in vivo studies. To maximize the effect of miRNA-directed expression downregulation, we decided to use the construct containing three miRNA-BS immediately downstream of the coding sequence, as it combined high levels of expression downregulation, when corresponding miRNA was present, with efficient expression in HEK293 cells compared to the original mRNA (construct 3, Fig 5 and 6). Example 2: Expression of mRNAs containing miRNA binding sites.
For some therapeutic applications of mRNA delivery, such as for example in protein replacement therapies, it may be useful to downregulate translation of mRNA in immune cells. Towards this goal, the miRNA miR-142-3p was identified to be exclusively expressed in hematopoietic cells (Aucher et al., J. Immunol. (2013), 191(12):6250-60). Other miRNAs that were also detected at high levels in hematopoietic cells include miR-16, miR-223, miR-451, miR-150. The target sites for miR-142-3p (miRT-142-3p) were incorporated into the 3' UTR of luciferase encoding mRNA or murine erythropoietin (EPO) encoding mRNA, to evaluate its potency. Four (4 x) tandem copies of miRT-142-3p sequence (23 nt) (UCCAUAAAGUAGGAAACACUACA) were inserted into the 3'UTR of luciferase (luc) or murine erythropoietin (EPO) encoding mRNA. The target sequences were inserted downstream from the stop codon of the coding sequence and upstream from the 3'UTR F-l element.
Luciferase-encoding mRNA either with ("luc-miRT-142-3p) or without ("luc") insertion of 4 x miRT-142-3p sequences in the 3'UTR was prepared, and used to transfect CHO cells using two different transfection methods (TransIT or lipofectamine). The luciferase activity in CHO cells at 24 hours after transfection of the mRNA was measured and the results are shown in Figure 7(A). Insertion of the miRT-142-3p sequences in the 3'UTR did not affect expression of the encoded luciferase protein. As shown in Figure 7(B), a reduction in mRNA translation was observed following transfection of human primary cells with LNP-formulated IVT EPO encoding mRNA having 4 x miRT-142-3p inserted in the 3'-UTR, specifically in hematopoietic cells: primary human dendritic cells (hDC) and primary human Kupffer cells (hKupffer). LNP formulations used herein comprise polysarcosine and the cationically ionizable lipid BNT9, as described for example in WO2021/191265 (see e.g., Example 8 therein). No effect of the miRT142-3p was observed in primary human hepatocytes (hHEP). Thus, insertion of the miR- 142-3p target sequences in the 3'UTR of the mRNA specifically down-regulated protein expression in hematopoietic cells expressing high levels of the miR-142. A similar effect was observed for EPO-encoding IVT mRNA (Backbone B) having four tandem repeats of miRT-142- 3p inserted in the 3'-UTR, as compared to a scrambled sequence. As shown in Figure 7(C), a reduction in mRNA translation was observed for EPO-encoding IVT mRNA (Backbone B) having 4 x miRT-142-3p inserted in the 3'-UTR specifically in hematopoietic cell types hDCs and hKupffer cells, as compared to other cells types, in human dendritic cells (hDC) and Kupffer cells (hKupffer), translation of LNP-formulated IVT mRNA (Backbone B) containing miR-142- 3p target sites in the 3'UTRs translated 100 and 25-fold less than the corresponding IVT mRNA without miR-142-3p target sites, respectively.
For some therapeutic applications of mRNA delivery, including for example in vaccination for infectious diseases by the intramuscular route, it may be useful to avoid hepatic translation of mRNA. Considering that hepatocytes express high levels of the micro RNA (miR)-122, it was hypothesized that target sites for this miRNA could be incorporated into the 3' UTR of an IVT- produced mRNA in order to suppress translation in hepatocytes. In a similar manner, incorporating miRT-142-3p into the 3'-UTR of IVT-produced mRNA effectively downregulated expression of the mRNA in hematopoietic cells. Similarly, incorporating miRT-206, which is highly expressed in skeletal muscle cells, into the 3'-UTR of IVT-produced mRNA may be used to downregulate expression of the mRNA in muscle cells.
Unmodified or lm<P-modified luciferase-encoding mRNA was prepared incorporating four tandem copies of the miRT-122 sequence (ACAAACACCAUUGUCACACUCCA) in the 3'-UTR downstream of the stop codon of the luciferase coding sequence and upstream of the 3'-UTR F-l element sequence. The expression of luciferase from IVT-produced unmodified or lmMJ- modified mRNA either with ("+ miRT-122") or without ("- miRT-122") the insertion of 4 x miRT- 122 sequences in the 3'UTR was measured 24 hours after transfection, in three different cell types (primary human hepatocytes (hHEP), HepG2 cells, and human dendritic cells (hDCs)). As shown in Figure 8(A), in human hepatocytes, translation of TransIT-formulated IVT mRNA containing miR-122 target sites in the 3'UTR were likely degraded as translation was about 100-times lower than the corresponding IVT mRNA without miR-122 target sites. No similar marked reduction in translation was observed in HepG2 cells or hDCs. As shown in Figure 8(B), a similar hepatocyte-specific knockdown effect was observed in human primary cells transfected with LNP formulated IVT EPO encoding mRNA having the miR-122 target sequences inserted in the 3'-UTR. Thus, insertion of the miR-122 target sequences in the 3'UTR of the mRNA specifically down-regulated protein expression in hHEP expressing high levels of the miR-122. A similar effect was observed for EPO-encoding IVT mRNA (Backbone B) having four tandem repeats of miRT-122 inserted in the 3'-UTR, as compared to a scrambled sequence. As shown in Figure 8(C), a reduction in mRNA translation was observed for EPO- encoding IVT mRNA (Backbone B) having 4 x miRT-122 inserted in the 3'-UTR specifically in hepatocytes (Huh7 and hHEP cells), as compared to other cell types. In human hepatoma cell line and human primary hepatocytes, translation of LNP-formulated IVT mRNA containing miRT-122 in their 3'UTRs translated 10 and 16-fold less than the corresponding IVT mRNA without miR-122 target sites, respectively.
In a further experiment, luciferase-encoding IVT mRNA containing either uridine (U) or 1- methylpseudouridine (ImUJ), either with or without four tandem repeats of miRT-122 in the 3'-UTR, was formulated in LNPs. The formulations were administered to mice by intramuscular injection to deliver the indicated concentrations of mRNA. Luciferase expression levels (Radiance (p/sec/cm3/sr) in the mice were measured 6 hours (6h) and 24 hours (24h) after administration at two different exposure levels. As shown in Figure 9, the presence of 4 tandem miR-122 target sites (miRT-122) in the 3'-UTR of IVT mRNA eliminated the luciferase activity specifically in the liver, thereby demonstrated effective down-regulation of mRNA expression in vivo, in cells expressing the miRNA miR-122.
Human primary hepatocytes (hHEP) or human primary Kupffer cells (hKupffer) were transfected with LNP-formulated EPO-encoding IVT mRNAs (Backbone B) containing four tandem copies of the miR-122 or miR-142-3p target sites, or corresponding scrambled sequences (mix) in the 3'-UTR. The miRT-122 or miRT-142-3p decreased the translation of the encoded protein in primary human hepatocytes or in primary human liver macrophages (Kupffer cells), to 6% and 5%, respectively. This demonstrates cell type-specific downregulation of mRNA expression by incorporation of target sequences for miRNAs highly expressed in the cells in the 3'-UTR.
Human primary skeletal muscle cells (HSkMC) or human dendritic cells (hDCs) were transfected with TransIT formulated LUC-encoding IVT mRNA or with TransIT formulated LUC- encoding IVT mRNA containing four tandem copies of the miR-206 target site in the 3'-UTR. In HSkMC cells 3,8-fold decrease of LUC activity was observed while in human DCs no change of LUC activity was detected when mRNA containing miR-206 target sites was applied (Figure 16).
Example 3: Improvement of translatability of mRNA by optimization of the cloning vector to ensure the prolonged durability of the encoded protein.
One of the key advantages of in vitro-transcribed (IVT) mRNA-based technology is the in vivo synthesis of therapeutic proteins (Qin, S. et al. (2022) Signal transduction and targeted therapy, 7, 166). Nevertheless, the long-term durability of the protein of interest depends strongly on the stability, immunogenicity and translational capacity of the IVT mRNA. It is well known that these properties can be greatly improved and balanced by optimization of the coding sequence (CDS), by incorporation of nucleoside modifications into the mRNA and by the removal of aberrant products produced during in vitro transcription (Loomis, K.H. et al. (2016) Journal of materials chemistry. B, 4, 1619-1632).
The comparison studies of the performance of mRNAs transcribed from DNA constructs which differed in the transcriptional start sites and the short non-coding intermediate sequences (WO2021/214204) highlighted the importance of untranslated regions that do not belong to the CDS, but had been inserted due to individual cloning strategies. It was previously found that even minor changes in the untranslated regions of the RNA backbones can tremendously influence and boost translational activity in vivo. Specifically, for example, the replacement of the first transcribed nucleotides nt4+5 AGACG (Backbone A) to AGAAT (Backbone C) in addition with the removal of the Lig3 motif directly upstream of the Poly(A)tail (WO2021/214204).
Considering that the change of nucleotide content of intermediate sequences of mRNA can impact on the durability of the encoded protein, we performed a comparative study of mRNAs transcribed from different DNA constructs including Backbone A, Backbone C and Backbone B as well as Backbone D (Figure 11A). The backbones contained the following sequences upstream and downstream from the coding sequence, respectively: Backbone A: SEQ ID NO: 6 / SEQ ID NO: 9; Backbone B: SEQ ID NO: 7 / SEQ ID NO: 11; Backbone C: SEQ ID NO: 7 / SEQ ID NO: 10; and Backbone D: SEQ ID NO: 8 / SEQ ID NO: 11. Backbones B and D comprise the previously optimized transcriptional start sites: AGAAT (Backbone B) or AGCAC (Backbone D), which showed the highest translational capacity. The only differences between Backbone C and the Backbone B / Backbone D vectors, are the intermediate sequences (i) between the stop codon of the coding sequence and the 3'-UTR, and (ii) between the 3'-UTR and the poly- A tail. The results herein demonstrate that not only the transcriptional start sites, but also the nucleotide composition of non-coding regions at the 3'end of mRNA can influence its translational activity. Here, we demonstrate how our mRNA optimization studies led to the selection of the new lead cloning vectors Backbone B and Backbone D.
In vivo studies For templates, four plasmids corresponding to Backbone A, Backbone B, Backbone C and Backbone D encoding codon-optimized murine erythropoietin (mEPO) were used and linearized via either enzymatic restriction with BspQI (New England Biolabs, Cat# RO712L) or via PCR. The mRNAs starting with AGACG (Backbone A), AGAAU (Backbone B and C) or AGCAC (Backbone D) were designed to contain the 5' untranslated region (5'UTR) sequences of human a-globin (hAg) mRNA, an Fl element (SEQ ID NO: 3) as the 3'UTR, and an interrupted 100 nt-long 3' poly(A) tail (SEQ ID NO: 4) flanking the coding sequence. The MEGAscript T7 RNA polymerase kit (Thermo Fisher Scientific, Cat#AMB1334-5) was used for transcription, and UTP was replaced with Nl-methylpseudouridine (mlY) triphosphate (TriLink, Cat#N- 1081). Capping of the mRNAs was performed co-transcriptionally using anti-reverse Capl analog CleanCap413 (TriLink, Cat#N-7413) at a final concentration of 3 mM. To reduce the initial byproducts and to obtain the desired transcripts generated with cap analogs, the initial GTP and ml<#TP concentration in a transcription reaction was reduced (Triana-Alonso, FJ. et al. (1995) The Journal of biological chemistry, 270, 6298-6307) from 7.5 mM to 1.5 mM and was incubated at 37°C for 30 min in a hybridization chamber. The initial concentration of additional nucleotides including ATP and CTP corresponded to the final 7.5 mM concentration. Adding of extra 1.5 mM GTP and ml'+’TP to the mixture was performed after 30, 60, 90 and 120 min of incubation and incubated further at 37°C for 30 min. To remove the template, 1/10 volume of DNA Turbo DNase (Thermo Fisher Scientific, Cat#AM1907) was added to the reaction mix and the mixture was incubated at 37°C for 15 minutes. The synthesized mRNA was isolated from the reaction mix by precipitation with half reaction volume of 8 M LiCI solution (Sigma-Aldrich, Cat#L7026). After chilling at -20°C for at least 1 hour, the RNA pellet was collected by centrifuging at 17.000 x g at 4°C for 5 minutes. After washing the RNA pellet twice with at least 200 pl ice-cold 75% Ethanol solution, it was dissolved in nuclease free water. The concentration and quality of in vitro transcribed mRNA were measured on a NanoDrop2000C spectrophotometer (Thermo Fisher Scientific, Cat#ND-2000c). Aliquots of denatured IVT mRNAs were analyzed by electrophoresis in agarose gels containing 0.005% (v/v) GelRed™ nucleic acid gel stain (Masek, T. et al. (2005) Analytical biochemistry, 336, 46- 50). Small aliquots of mRNA samples were stored in siliconized tubes at -20°C. All mRNAs were cellulose-purified as described (Baiersdorfer, M. et al. (2019) Moleculartherapy. Nucleic acids, 15, 26-35). To measure the translational efficiency of EPO mlU>-mRNA transcribed from different DNA constructs including Backbone A, Backbone C and Backbone B as well as Backbone D, a comparison in vivo study was performed. Female BALB/c mice from Janvier Labs (14 Route des Chenes Secs, 53940 Genest Saint Isle, France) at the age of eight to ten weeks were used for in vivo experiments in accordance with federal policies on animal research (Ethics approval number: G18-12-027). Mice (n=3/group) were injected intravenously (i.v.) with 3 pg TransIT- complexed (Mirus Bio, Cat#MIR2255) EPO mlUJ-mRNAs in a final volume of 200 pL Dulbecco's modified Eagle medium (DMEM). Mice used as controls were injected with TransIT-reagent diluted in DMEM but without RNA. To quantify plasma EPO levels, 20 pl blood from each mouse was collected at 6, 24, 48 and 72 hours after injection and EPO levels were analyzed by mouse Erythropoietin DuoSet ELISA kit (R&D Systems, Minneapolis, MN, USA, Cat#DY959). Flat-bottom 96-well plates were pre-coated with 2 pg/ml rat anti-mouse EPO capture antibody (100 pl/well) and incubated at room temperature (RT) overnight. The plates were washed three times with PBS containing 0.05% Tween-20 and incubated with 1% BSA (bovine serum albumin) (Sigma-Aldrich, Cat#2153) solution at RT for 2 hours to prevent non-specific binding of the antibody and washed again. A seven-point standard curve using 2-fold serial dilutions and a high standard of 4000 pg/ml was applied. At a final volume of 50 pl plasma samples and standard diluted in 1% BSA solution were added to the appropriate wells and incubated at RT for 2 hours. After washing the plates, 100 pl of 1 pg/ml of rat biotinylated anti-mouse EPO detection antibody in 1% BSA solution was distributed to each well and incubated RT for 2 hours. The plates were washed and then incubated with 100 pl Streptavidin conjugated to horseradish peroxidase diluted (1:200) in 1% BSA solution at room temperature for 20 min. After washing, TMB 2-Component Microwell Peroxidase substrate solution (Medac Gmbh, Cat#50-76-ll) was added to each well (100 pl/well). Samples were incubated at room temperature for 5 min, and 2 M sulfuric acid (R&D Systems, Cat#DY994) was added (50 pl/well) to stop the reaction and absorbance was measured at 450 nm and 570 nm using an Infinite 200 Pro plate reader (Tecan).
The presented data show that EPO mRNA transcribed from Backbone C is superior to Backbone A, but inferior to that derived from Backbone B and Backbone D cassettes (Figure 11A, B). EPO mRNA transcribed from Backbone C translated significantly better than the construct containing inferior transcription start site AGACG and Lig3 motif (Backbone A), but translated 2.5-fold and 10-fold less than those made from Backbone B and Backbone D at 48 h and 72 h after injection, respectively (Figure 11A, B). Subsequently, the reason for the difference in long-term translational efficacy of the encoded protein was investigated. Considering that the previously selected Backbone C differed in the 3'-end in the downstream region of CDS and at the -9 position in the upstream region of poly(A) tail compared to Backbone B and Backbone D, it was identified that the nucleotide in the -9 position from poly(A) tail could have an impact on translation (Figure 14A), since changing the sequence downstream of the coding sequence, and upstream of the 3'-UTR had previously been shown not to have an effect on the translational capacity of mRNA (WO2021/214204). Backbone C has G, while Backbone B has C, in the -9 position at the 3'end of mRNA and the adapted Backbone B performs markedly better than the original Backbone C cassette, especially at later time points (Figure 14A) To analyze the effect of the nucleotide located in the -9 position on translation, four different Backbone B constructs were designed that contain either G, T, A or C nucleotide in the -9 position upstream of poly(A) tail. EPO mlUJ-mRNA containing G in this position translated 1.5-fold, 3.3-fold, and 8-fold less at 6-24, 48 and 72 hours than those employing C at the same position, respectively (Figure 14B). When EPO mlMJ-mRNA contained U or A in the given position, the differences in EPO level decreased 1.3-fold and 2-fold at 6-24 and 48-72 hours, respectively, compared to those that employ C at the same position (Figure 14B). These data are in good agreement with results obtained from independent in vitro experiments (Figure 12, 13).
To make sure that the effect of this one nucleotide exchange on translational efficiency of mRNA is regardless of transcriptional start site, EPO-encoding mlUi-mRNAs containing four different SNPs (G, U, A or C) in the same -9 position upstream of coded poly(A) tail that transcribed from Backbone D cassette employing AGCAC start site instead of AGAAT were injected intravenously into mice. According to the result of the EPO-specific ELISA, EPO mUP- mRNA containing G in the -9 position upstream of poly(A) tail translated 2-fold, 3-fold, and 8- fold less at 24, 48 and 72 hours, respectively, compared to those employ A, U or C at the same position regardless of the cassette containing a different start site (Figure 15A). Both new cassettes (Backbone B and Backbone D) with C in the -9 position upstream of the coded poly(A) tail performed the best (Figure 14B and 15A). To test whether this -9 position SNP effect interferes with mRNA functionality, hematocrit levels were determined in the individual mice that were injected with EPO mRNA complexed with TransIT-reagent by collecting 18 pL of total blood at the indicated times (Figure 15B) into a tube containing 2 pl of EDTA solution followed by centrifuging in Drummond microcaps glass capillaries (20 pl volume, Merck, Germany) as described (Mahiny, AJ. et al. (2016) Methods in molecular biology (Clifton, N.J.), 1428, 297- 306). The SNPs located at the 3' end of the mRNA constructs have a significant effect on the functionality of the mRNAs encoding murine EPO. In vitro-transcribed mRNA containing C in the -9 position upstream of poly(A)tail led to the highest hematocrit level (58%) at Day 7 after injection (Figure 15B) which is significantly higher compared to those that carry G in this position, in the case of both Backbones B (51%) and D (53.5%). EPO mlMJ-mRNA bearing A, U or C in the -9 position upstream of poly(A) tail showed at least 4-5% higher elevating in hematocrit at Day 7 after injection than those employing G at the same position regardless which Backbone was used (Figure 15B).
In vitro studies
To compare backbones B, C and D, we produced mRNA encoding h IL-18, Firefly Luciferase and eGFP in the context of these backbones. In vitro transcribed mlY-modified mRNAs capped with CC413 cap analog were either lipofected or electroporated in immature human dendritic cells or primary human hepatocytes. When electroporated in hiDCs (Figure 12A) Firefly Luciferase was stronger expressed when it was encoded by Backbones B and D, compared to Backbone C. Similarly, when hiDCs were electroporated with EGFP containing Backbones C and D mRNAs (Figure 12B), the latter showed stronger EGFP expression. When primary human hepatocytes were lipofected with mRNAs encoding human IL-18 in Backbones B, C and D (Figure 12C), higher titers of hlL-18 were detected in culture medium in the case of Backbones B and D, compared to Backbone C. Thus, the same enhanced performance provided by Backbone B or D, as compared to Backbone C, is observed, regardless of the coding sequence. In order to investigate the role of single nucleotide change between Backbones B and D vs Backbone C at the position -9 upstream of the polyA sequence, Firefly Luciferase mRNAs were produced in Backbones B and C containing either A, G, T or C nucleotides at this position. In vitro transcribed mlY mRNAs capped with CC413 cap analog were electroporated in hiDCs and the expression of Luciferase was assayed (Figure 13A, B). For both Backbones, G at the position -9 of the polyA negatively affected Luciferase expression, suggesting that SNP at the position -9 upstream of the polyA sequence has a major effect on mRNA translation.
For electroporation experiments, in vitro transcribed mlY-modified mRNAs capped with CC413 cap analog were electroporated in hiDCs cells in duplicates with 30mM RNA and a single pulse at 300V/12ms. Cells were plated and cultured in 12- or 96-well plates in RPMI medium supplemented with hlL-4/GM-CSF (Miltenyi). For Firefly Luciferase mRNAs, Luciferase expression was assayed with Bright-Glo assay (Promega) 2-48h post electroporation. For eGFP mRNAs, cells were harvested at 6-96h and assayed with FACS Cantoll (BD).
For lipofection experiments, primary human hepatocytes (BiolVT) were transfected with TransIT (Mirus) according to manufacturer protocol. Supernatants were collected at 16-168h and analyzed for h IL-18 translation by ELISA (R&D Systems).
Conclusion
In conclusion, the presented data confirm that the 3'end region of mRNA is a very sensitive and exceptional area in terms of translational capacity as well as functionality of mRNA. This study evaluated and directly compared the quality, the translational efficiency and functionality of mlU^-modified EPO mRNAs derived from the 4 DNA constructs including Backbone A, Backbone B, Backbone C and Backbone D. MltP-mRNA transcribed from the previously selected Backbone C significantly outperforms Backbone A, which contained the inferior transcription start site AGACG and the Lig3 motif at the 3'end (Figure 11A). Nevertheless, the further adapted Backbone B and Backbone D cassette performs markedly better in vitro and in vivo as compared to the Backbone C cassette, especially at later time points (Figure HA, 11B, 12A, 12B, 12C). Both in vitro and in vivo results suggest that, surprisingly, a single nucleotide substitution (e.g., guanine (G) in Backbone C vs. cytosine (C) in Backbone B and Backbone D) in the -9 position upstream of coded poly(A) tail provides improved expression of Backbone B and Backbone D compared to Backbone C. The use of other nucleotides than C, particularly G, at this position has negative impact on translational capacity and functionality of mRNA (Figure 13A, 13B, 14B, 15A, 15B) regardless of start sites.

Claims

1. A composition or medical preparation comprising RNA, wherein the RNA comprises:
(a) a 5' UTR,
(b) a coding sequence that encodes a polypeptide,
(c) a 3' UTR, and
(d) a poly-A sequence, wherein the 3' UTR comprises:
(i) a 3' UTR sequence comprising a first sequence comprising the nucleotide sequence of SEQ ID NO:
1. or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 1, and a second sequence comprising the nucleotide sequence of SEQ ID NO: 2, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 2, and
(ii) one or more miRNA binding sequences.
2. The composition or medical preparation of claim 1, wherein the RNA comprises at least one of the one or more miRNA binding sequences upstream of the first and second sequences, downstream of the first and second sequences, or downstream of the first sequence and upstream of the second sequence.
3. The composition or medical preparation of claim 1 or 2, wherein the first sequence is located upstream of the second sequence.
4. The composition or medical preparation of any one of claims 1 to 3, wherein the 3' UTR sequence comprises the nucleotide sequence of SEQ ID NO: 3, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 3.
5. The composition or medical preparation of any one of claims 1 to 4, wherein the RNA comprises at least one of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
6. The composition or medical preparation of any one of claims 1 to 5, wherein the RNA comprises each of the one or more miRNA binding sequences downstream of the coding sequence that encodes a polypeptide and upstream of the 3' UTR sequence.
7. The composition or medical preparation of claim 5 or 6, wherein the RNA comprises a nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence.
8. The composition or medical preparation of claim 7, wherein the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence (Xl)nCGAX2, wherein XI is any nucleotide, n is 0 to 10, and X2 is G or U.
9. The composition or medical preparation of claim 8, wherein n is 1 to 6, e.g., 2 or 5.
10. The composition or medical preparation of any one of claims 7 to 9, wherein the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence comprises the sequence CUCGAG or GGAUCCGAU.
11. The composition or medical preparation of any one of claims 1 to 10, wherein at least one of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired.
12. The composition or medical preparation of any one of claims 1 to 11, wherein each of the one or more miRNA binding sequences binds to miRNA that is present in cells in which expression of the polypeptide is not desired.
13. The pharmaceutical composition of any one of claims 1 to 12, wherein the RNA comprises three or more miRNA binding sequences, wherein the three or more miRNA binding sequences bind to the same or different miRNAs.
14. The composition or medical preparation of any one of claims 1 to 12, wherein the RNA comprises two or more miRNA binding sequences, wherein the two or more miRNA binding sequences bind to the same or different miRNAs.
15. The composition or medical preparation of any one of claims 1 to 12, wherein the RNA comprises one miRNA binding sequence.
16. The composition or medical preparation of any one of claims 1 to 15, wherein the one or more miRNA binding sequences comprise a nucleotide sequence that is an exact Watson-Crick complement of the miRNA.
17. The composition or medical preparation of any one of claims 1 to 16, wherein the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence GAGACCUGGUCCAGAGUCGCUAGCCGCGUCGCU or CUXGAGCUAGC, wherein X is G, C, A, or U.
18. The composition or medical preparation of any one of claims 1 to 17, wherein the RNA comprises a nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprising the sequence CUXGAGCUAGC, wherein X is C, A, or U.
19. The composition or medical preparation of claim 17 or 18, wherein the nucleotide sequence linking the 3' UTR sequence and the poly-A sequence comprises the sequence CUCGAGCUAGC.
20. The composition or medical preparation of any one of claims 1 to 19, wherein the RNA comprises in the 5' to 3' direction the 5' UTR, the coding sequence that encodes a polypeptide, the miRNA binding sequence(s), optionally the nucleotide sequence linking the miRNA binding sequence(s) and the 3' UTR sequence, the 3' UTR sequence, optionally the nucleotide sequence linking the 3' UTR sequence and the poly-A sequence, and the poly-A sequence.
21. The composition or medical preparation of any one of claims 1 to 17 and 20, wherein the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9.
22. The composition or medical preparation of any one of claims 1 to 17 and 20, wherein the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10.
23. The composition or medical preparation of any one of claims 1 to 20, wherein the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11.
24. The composition or medical preparation of any one of claims 1 to 20, wherein the RNA comprises a 3' UTR comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12.
25. The composition or medical preparation of any one of claims 1 to 24, wherein the poly-A sequence is an interrupted sequence of A nucleotides.
26. The composition or medical preparation of any one of claims 1 to 25, wherein the poly-A sequence comprises at least 100 nucleotides.
27. The composition or medical preparation of any one of claims 1 to 26, wherein the poly-A sequence comprises or consists of the nucleotide sequence Ax-L-Ay, wherein Ax is a sequence of at least 20 A nucleotides, Ay is a sequence of at least 60 A nucleotides and L is a linker of 1 to 20 nucleotides which may include nucleotides other than A.
28. The composition or medical preparation of any one of claims 1 to 27, wherein the poly-A sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 4, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 4.
29. The composition or medical preparation of any one of claims 1 to 28, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7.
30. The composition or medical preparation of any one of claims 1 to 29, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1X2X3X4AACUAGU, wherein XI is any nucleotide, preferably A or C, X2 is any nucleotide, preferably A or C, X3 is any nucleotide, preferably C, U or G, and X4 is A or is missing.
31. The composition or medical preparation of any one of claims 1 to 30, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGACGAACUAGU.
32. The composition or medical preparation of any one of claims 1 to 31, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6.
33. The composition or medical preparation of any one of claims 1 to 30, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGX1AX3AAACUAGU, wherein XI is any nucleotide, preferably A or C, and X3 is any nucleotide, preferably C or U.
34. The composition or medical preparation of any one of claims 1 to 30 and 33, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGAAUAAACUAGU.
35. The composition or medical preparation of any one of claims 1 to 30 and 33, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 14 to 53 of SEQ ID NO: 7 which is preceded by a sequence comprising the nucleotide sequence AGCACAAACUAGU.
36. The composition or medical preparation of any one of claims 1 to 35, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7.
37. The composition or medical preparation of any one of claims 1 to 30, 33, 34, and 36, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7.
38. The composition or medical preparation of any one of claims 1 to 30, 33, 35, and 36, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8.
39. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
40. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
41. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
42. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
43. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 11.
44. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
45. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
46. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
47. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 298 of SEQ ID NO: 11, and a poly-A sequence.
48. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 8 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 11.
49. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
50. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
51. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 12.
52. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
53. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 12, and a poly-A sequence.
54. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 12.
55. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
56. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10 and a poly-A sequence.
57. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 10.
58. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 7 to 53 of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
59. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 295 of SEQ ID NO: 10, and a poly-A sequence.
60. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 7 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 10.
61. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
62. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
63. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9, or a nucleotide sequence having at least 90% identity to the nucleotide sequence of SEQ ID NO: 9.
64. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of nucleotides 6 to 52 of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
65. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' (JTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of nucleotides 1 to 317 of SEQ ID NO: 9, and a poly-A sequence.
66. The composition or medical preparation of any one of claims 1 to 38, wherein the RNA comprises a 5' UTR comprising the nucleotide sequence of SEQ ID NO: 6 and, downstream of the coding sequence that encodes a polypeptide and one or more miRNA binding sequences, a sequence comprising the nucleotide sequence of SEQ ID NO: 9.
67. The composition or medical preparation of any one of claims 1 to 66, wherein at least 90% is at least 95%, 96%, 97%, 98%, or 99%.
68. The composition or medical preparation of any one of claims 1 to 67, wherein the RNA comprises two or more coding sequences encoding two or more polypeptides.
69. The composition or medical preparation of any one of claims 1 to 68, wherein the polypeptide is a pharmaceutically active polypeptide.
70. The composition or medical preparation of any one of claims 1 to 69, wherein the RNA comprises a modified nucleoside in place of uridine.
71. The composition or medical preparation of any one of claims 1 to 70, wherein the RNA comprises a modified nucleoside in place of each uridine.
72. The composition or medical preparation of claim 70 or 71, wherein the modified nucleoside is pseudouridine (i|>) and/or Nl-methyl-pseudouridine (mlip).
73. The composition or medical preparation of any one of claims 70 to 72, wherein the modified nucleoside is Nl-methyl-pseudouridine (mlip).
74. The composition or medical preparation of any one of claims 1 to 73, wherein the RNA comprises a 5' cap.
75. The composition or medical preparation of any one of claims 1 to 74, wherein the RNA comprises a capl structure.
76. The composition or medical preparation of any one of claims 1 to 75, wherein the RNA comprises the 5' cap m27-3' 0Gppp(mi2''0)ApG.
77. The composition or medical preparation of any one of claims 1 to 76, wherein the RNA is single- stranded RNA.
78. The composition or medical preparation of any one of claims 1 to 77, wherein the RNA is mRNA.
79. The composition or medical preparation of any one of claims 1 to 78, wherein the RNA is formulated in a delivery vehicle.
80. The composition or medical preparation of any one of claims 1 to 79, wherein the RNA is formulated in lipid nanoparticles (LNP).
81. The composition or medical preparation of claim 80, wherein lipids that form the lipid nanoparticles comprise a cationic lipid, a polymer-conjugated lipid, a neutral lipid, and a steroid.
82. The composition or medical preparation of claim 81, wherein the cationic lipid comprises a cationically ionizable lipid.
83. The composition or medical preparation of claim 81 or 82, wherein the polymer-conjugated lipid comprises a PEG-conjugated lipid.
84. The composition or medical preparation of any one of claims 81 to 83, wherein the neutral lipid comprises a phospholipid.
85. The composition or medical preparation of any one of claims 81 to 84, wherein the steroid comprises cholesterol.
86. The composition or medical preparation of any one of claims 81 to 85, wherein: a. the cationic lipid is present in about 35-65 mol% of the total lipids; b. the polymer-conjugated lipid is present in about 1-5 mol% of the total lipids; c. the neutral lipid is present in about 5-15 mol% of the total lipids; and d. the steroid is present in about 30-50 mol% of the total lipids.
87. The composition or medical preparation of any one of claims 80 to 86, wherein the lipid nanoparticles have an average size of about 50-150 nm.
88. The composition of any one of claims 1 to 87, which is a pharmaceutical composition.
89. The composition of claim 88, wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers, diluents and/or excipients.
90. The medical preparation of any one of claims 1 to 87, which is a kit.
91. The medical preparation of claim 90, wherein the RNA and optionally the particle forming components are in separate vials.
92. The composition or medical preparation of any one of claims 1 to 91, which is for parenteral administration.
93. The composition or medical preparation of any one of claims 1 to 92, which is for intramuscular administration.
94. The composition or medical preparation of any one of claims 1 to 92, which is for intravenous administration.
95. The composition or medical preparation of any one of claims 1 to 94, wherein at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in endothelial cells.
96. The composition or medical preparation of any one of claims 1 to 95, wherein the miRNA is miR- 126, optionally miR-126-5p or miR-126-3p.
97. The composition or medical preparation of any one of claims 1 to 96, wherein at least one, optionally each, of the miRNA binding sequences comprises or consists of cgcguaccaaaaguaauaaug (binds miR-126-5p) or cgcauuauuacucacgguacga (binds miR-126-3p).
98. The composition or medical preparation of any one of claims 1 to 97, wherein at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hematopoietic cells, e.g., immune cells.
99. The composition or medical preparation of claim 98, wherein the immune cells comprise dendritic cells and/or macrophages, e.g., Kupffer cells.
100. The composition or medical preparation of any one of claims 1 to 99, wherein the miRNA is miR- 142, optionally miR-142-3p.
101. The composition or medical preparation of any one of claims 1 to 100, wherein at least one, optionally each, of the miRNA binding sequences comprises or consists of UCCAUAAAGUAGGAAACACUACA (binds miR-142-3p).
102. The composition or medical preparation of any one of claims 1 to 101, wherein at least one, optionally each, of the one or more miRNA binding sequences binds to miRNA that is present in hepatic cells.
103. The composition or medical preparation of any one of claims 1 to 102, wherein the miRNA is miR-122.
104. The composition or medical preparation of any one of claims 1 to 103, wherein at least one, optionally each, of the miRNA binding sequences comprises or consists of ACAAACACCAUUGUCACACUCCA (binds miR-122).
105. A method of controlling expression of a polypeptide in a subject in a cell type and/or tissue specific manner, the method comprising administering to the subject the composition of any one of claims 1 to 104, wherein the one or more miRNA binding sequences bind to miRNA that is present in one or more cells or tissues of the subject in which expression of the polypeptide is not desired.
106. The method of claim 105, wherein the miRNA is not present in one or more cells or tissues other than the one or more cells or tissues in which expression of the polypeptide is not desired or is present in one or more cells or tissues other than the one or more cells or tissues in which expression of the polypeptide is not desired in a lower amount compared to the one or more cells or tissues in which expression of the polypeptide is not desired.
107. A method for treating a subject comprising administering to the subject the composition of any one of claims 1 to 104 for expressing the polypeptide in cells of the subject while avoiding expression of the polypeptide in selected cells of the subject, wherein the one or more miRNA binding sequences bind to miRNA that is present in the selected cells.
108. The method of claim 107, wherein the miRNA is not present in cells other than the selected cells or is present in cells other than the selected cells in a lower amount compared to the selected cells.
109. The method of any one of claims 105 to 108, wherein administration is by parenteral administration.
110. The method of any one of claims 105 to 109, wherein administration is by intramuscular administration.
111. The method of any one of claims 105 to 109, wherein administration is by intravenous administration.
PCT/EP2024/050983 2023-01-18 2024-01-17 Rna formulations for pharmaceutical use WO2024153675A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EPPCT/EP2023/051117 2023-01-18
PCT/EP2023/051117 WO2024153324A1 (en) 2023-01-18 2023-01-18 Rna formulations for pharmaceutical use

Publications (1)

Publication Number Publication Date
WO2024153675A1 true WO2024153675A1 (en) 2024-07-25

Family

ID=85037171

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/EP2023/051117 WO2024153324A1 (en) 2023-01-18 2023-01-18 Rna formulations for pharmaceutical use
PCT/EP2024/050983 WO2024153675A1 (en) 2023-01-18 2024-01-17 Rna formulations for pharmaceutical use

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/051117 WO2024153324A1 (en) 2023-01-18 2023-01-18 Rna formulations for pharmaceutical use

Country Status (1)

Country Link
WO (2) WO2024153324A1 (en)

Citations (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5876969A (en) 1992-01-31 1999-03-02 Fleer; Reinhard Fusion polypeptides comprising human serum albumin, nucleic acids encoding same, and recombinant expression thereof
US20050287153A1 (en) 2002-06-28 2005-12-29 Genentech, Inc. Serum albumin binding peptides for tumor targeting
US20070003549A1 (en) 2004-08-24 2007-01-04 Olga Ignatovich Ligands that have binding specificity for VEGF and/or EGFR and methods of use therefor
US7176278B2 (en) 2001-08-30 2007-02-13 Biorexis Technology, Inc. Modified transferrin fusion proteins
US20070048282A1 (en) 2004-02-09 2007-03-01 Human Genome Sciences, Inc. Albumin fusion proteins
WO2007036366A2 (en) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modification of rna, producing an increased transcript stability and translation efficiency
US20070178082A1 (en) 2002-11-08 2007-08-02 Ablynx N.V. Stabilized single domain antibodies
US20070269422A1 (en) 2006-05-17 2007-11-22 Ablynx N.V. Serum albumin binding proteins with long half-lives
WO2009083804A2 (en) 2007-12-27 2009-07-09 Novartis Ag Improved fibronectin-based binding molecules and their use
WO2009133208A1 (en) 2008-05-02 2009-11-05 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
US20100113339A1 (en) 2006-09-08 2010-05-06 Ablynx N. V. Serum albumin binding proteins with long half-lives
WO2011124718A1 (en) 2010-04-09 2011-10-13 Novozymes A/S Albumin derivatives and variants
US8158579B2 (en) 2006-07-24 2012-04-17 Biorexis Pharmaceutical Corporation Fusion protein of an exendin to modified transferrin
US20120094909A1 (en) 2010-04-13 2012-04-19 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to pcsk9
WO2013075066A2 (en) 2011-11-18 2013-05-23 Eleven Biotherapeutics, Inc. Proteins with improved half-life and other properties
WO2013143683A1 (en) 2012-03-26 2013-10-03 Biontech Ag Rna formulation for immunotherapy
US20140220017A1 (en) 2011-09-23 2014-08-07 Universitat Stuttgart Serum half-life extension using igbd
WO2016005324A1 (en) 2014-07-11 2016-01-14 Biontech Rna Pharmaceuticals Gmbh Stabilization of poly(a) sequence encoding dna sequences
WO2017060314A2 (en) 2015-10-07 2017-04-13 Biontech Rna Pharmaceuticals Gmbh 3' utr sequences for stabilization of rna
WO2017075531A1 (en) 2015-10-28 2017-05-04 Acuitas Therapeutics, Inc. Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids
WO2017182524A1 (en) 2016-04-22 2017-10-26 Biontech Rna Pharmaceuticals Gmbh Methods for providing single-stranded rna
WO2018081480A1 (en) 2016-10-26 2018-05-03 Acuitas Therapeutics, Inc. Lipid nanoparticle formulations
US20210040456A1 (en) * 2017-11-22 2021-02-11 Modernatx, Inc. Polynucleotides encoding phenylalanine hydroxylase for the treatment of phenylketonuria
WO2021191265A1 (en) 2020-03-25 2021-09-30 Biontech Rna Pharmaceuticals Gmbh Rna particles comprising polysarcosine
WO2021214204A1 (en) 2020-04-22 2021-10-28 BioNTech SE Rna constructs and uses thereof
US20220110966A1 (en) * 2018-09-02 2022-04-14 Modernatx, Inc. Polynucleotides encoding very long-chain acyl-coa dehydrogenase for the treatment of very long-chain acyl-coa dehydrogenase deficiency
CA3171589A1 (en) * 2021-05-03 2022-11-03 Moritz THRAN Improved nucleic acid sequence for cell type specific expression

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2779073C (en) 2009-10-30 2017-10-24 Domain Therapeutics Novel oxime derivatives and their use as allosteric modulators of metabotropic glutamate receptors

Patent Citations (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5876969A (en) 1992-01-31 1999-03-02 Fleer; Reinhard Fusion polypeptides comprising human serum albumin, nucleic acids encoding same, and recombinant expression thereof
US7176278B2 (en) 2001-08-30 2007-02-13 Biorexis Technology, Inc. Modified transferrin fusion proteins
US20050287153A1 (en) 2002-06-28 2005-12-29 Genentech, Inc. Serum albumin binding peptides for tumor targeting
US20070178082A1 (en) 2002-11-08 2007-08-02 Ablynx N.V. Stabilized single domain antibodies
US20070048282A1 (en) 2004-02-09 2007-03-01 Human Genome Sciences, Inc. Albumin fusion proteins
US20070003549A1 (en) 2004-08-24 2007-01-04 Olga Ignatovich Ligands that have binding specificity for VEGF and/or EGFR and methods of use therefor
WO2007036366A2 (en) 2005-09-28 2007-04-05 Johannes Gutenberg-Universität Mainz, Vertreten Durch Den Präsidenten Modification of rna, producing an increased transcript stability and translation efficiency
US20070269422A1 (en) 2006-05-17 2007-11-22 Ablynx N.V. Serum albumin binding proteins with long half-lives
US8158579B2 (en) 2006-07-24 2012-04-17 Biorexis Pharmaceutical Corporation Fusion protein of an exendin to modified transferrin
US20100113339A1 (en) 2006-09-08 2010-05-06 Ablynx N. V. Serum albumin binding proteins with long half-lives
WO2009083804A2 (en) 2007-12-27 2009-07-09 Novartis Ag Improved fibronectin-based binding molecules and their use
WO2009133208A1 (en) 2008-05-02 2009-11-05 Novartis Ag Improved fibronectin-based binding molecules and uses thereof
WO2011124718A1 (en) 2010-04-09 2011-10-13 Novozymes A/S Albumin derivatives and variants
US20120094909A1 (en) 2010-04-13 2012-04-19 Bristol-Myers Squibb Company Fibronectin based scaffold domain proteins that bind to pcsk9
US20140220017A1 (en) 2011-09-23 2014-08-07 Universitat Stuttgart Serum half-life extension using igbd
US20170145062A1 (en) 2011-09-23 2017-05-25 Universitat Stuttgart Serum half-life extension using igbd
WO2013075066A2 (en) 2011-11-18 2013-05-23 Eleven Biotherapeutics, Inc. Proteins with improved half-life and other properties
WO2013143683A1 (en) 2012-03-26 2013-10-03 Biontech Ag Rna formulation for immunotherapy
WO2016005324A1 (en) 2014-07-11 2016-01-14 Biontech Rna Pharmaceuticals Gmbh Stabilization of poly(a) sequence encoding dna sequences
WO2017060314A2 (en) 2015-10-07 2017-04-13 Biontech Rna Pharmaceuticals Gmbh 3' utr sequences for stabilization of rna
WO2017075531A1 (en) 2015-10-28 2017-05-04 Acuitas Therapeutics, Inc. Novel lipids and lipid nanoparticle formulations for delivery of nucleic acids
WO2017182524A1 (en) 2016-04-22 2017-10-26 Biontech Rna Pharmaceuticals Gmbh Methods for providing single-stranded rna
WO2018081480A1 (en) 2016-10-26 2018-05-03 Acuitas Therapeutics, Inc. Lipid nanoparticle formulations
US20210040456A1 (en) * 2017-11-22 2021-02-11 Modernatx, Inc. Polynucleotides encoding phenylalanine hydroxylase for the treatment of phenylketonuria
US20220110966A1 (en) * 2018-09-02 2022-04-14 Modernatx, Inc. Polynucleotides encoding very long-chain acyl-coa dehydrogenase for the treatment of very long-chain acyl-coa dehydrogenase deficiency
WO2021191265A1 (en) 2020-03-25 2021-09-30 Biontech Rna Pharmaceuticals Gmbh Rna particles comprising polysarcosine
WO2021214204A1 (en) 2020-04-22 2021-10-28 BioNTech SE Rna constructs and uses thereof
CA3171589A1 (en) * 2021-05-03 2022-11-03 Moritz THRAN Improved nucleic acid sequence for cell type specific expression

Non-Patent Citations (25)

* Cited by examiner, † Cited by third party
Title
"Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
"Remington's Pharmaceutical Sciences", 1985, MACK PUBLISHING CO
AUCHER ET AL., J. IMMUNOL., vol. 191, no. 12, 2013, pages 6250 - 60
B.H. ZIMM, J. CHEM. PHYS., vol. 13, 1945, pages 141
BAIERSDORFER, M. ET AL.: "Moleculartherapy.", NUCLEIC ACIDS, vol. 15, 2019, pages 26 - 35
BUCHHOLZ ET AL., ELECTROPHORESIS, vol. 22, 2001, pages 4118 - 4128
GIBALDI, M. ET AL.: "Pharmacokinetics", 1982, MARCEL DEKKER
GOULD ET AL., ANTIVIRAL RES., vol. 87, 2010, pages 111 - 124
HOLTKAMP ET AL., BLOOD, vol. 108, 2006, pages 4009 - 4017
JOSE ET AL., FUTURE MICROBIOL., vol. 4, 2009, pages 837 - 856
KACZMAREK, J. C. ET AL., GENOME MEDICINE, vol. 9, 2017, pages 60
KENNETH, A. ET AL.: "Chemical Stability of Pharmaceuticals", A HANDBOOK FOR PHARMACISTS
KONTERMANN, EXPERT OPIN BIOL THER, vol. 16, no. 7, July 2016 (2016-07-01), pages 903 - 15
KOPPEL, D., J. CHEM. PHYS., vol. 57, 1972, pages 4814 - 4820
LOOMIS, K.H., JOURNAL OF MATERIALS CHEMISTRY, vol. 4, 2016, pages 1619 - 1632
MAHINY, A.J. ET AL., METHODS IN MOLECULAR BIOLOGY (CLIFTON, N.J., vol. 1428, 2016, pages 297 - 306
MASEK, T. ET AL., ANALYTICAL BIOCHEMISTRY, vol. 336, 2005, pages 46 - 50
NEDDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443
ORLANDINI VON NIESSEN, A. G. ET AL., MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 27, no. 4, 2019, pages 824 - 836
P. DEBYE, J. APPL. PHYS., vol. 15, 1944, pages 338
PEARSONLIPMAN, PROC. NATL ACAD. SCI. USA, vol. 88, 1988, pages 2444
PETERS ET AL.: "Pharmacokinetic Analysis", A PRACTICAL APPROACH, 1996
SMITHWATERMAN, ADS APP. MATH., vol. 2, 1981, pages 482
TRIANA-ALONSO, F.J. ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, 1995, pages 6298 - 6307
W. BURCHARD, ANAL. CHEM., vol. 75, 2003, pages 4279 - 4291

Also Published As

Publication number Publication date
WO2024153324A1 (en) 2024-07-25

Similar Documents

Publication Publication Date Title
WO2022101486A1 (en) Pharmaceutical compositions comprising particles and mrna and methods for preparing and storing the same
AU2022336160B2 (en) Potency assay for therapeutic potential of coding nucleic acid
WO2023036960A1 (en) Lipid-based rna formulations suitable for therapy
AU2023248681A1 (en) Nucleic acid compositions comprising a multivalent anion, such as an inorganic polyphosphate, and methods for preparing, storing and using the same
US20240226132A1 (en) Rna compositions comprising a buffer substance and methods for preparing, storing and using the same
WO2024153675A1 (en) Rna formulations for pharmaceutical use
EP4238577A2 (en) Compositions for administration of different doses of rna
WO2023126053A1 (en) Lipid-based formulations for administration of rna
WO2023051926A1 (en) Treatment involving non-immunogenic rna for antigen vaccination and pd-1 axis binding antagonists
WO2024213776A1 (en) Rna for preventing or treating tuberculosis
WO2024027910A1 (en) Rna for preventing or treating tuberculosis
WO2024028445A1 (en) Rna for preventing or treating tuberculosis
WO2024216212A1 (en) Rna for preventing or treating tuberculosis
WO2024180054A1 (en) Linker sequence potency assays for multiple coding nucleic acids
WO2024180363A1 (en) Linker sequence potency assays for multiple coding nucleic acids
WO2024216214A1 (en) Rna for preventing or treating tuberculosis
WO2024028325A1 (en) Nucleic acid compositions comprising amphiphilic oligo ethylene glycol (oeg)-conjugated compounds and methods of using such compounds and compositions
AU2022288749A1 (en) Agents and methods for activation and targeting of immune effector cells
WO2023165681A1 (en) Rna lipid nanoparticles (lnps) comprising a polyoxazoline and/or polyoxazine polymer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24701327

Country of ref document: EP

Kind code of ref document: A1