WO2024134216A1 - Polynucleotide construct encoding a dna polymerase and a pore - Google Patents

Polynucleotide construct encoding a dna polymerase and a pore Download PDF

Info

Publication number
WO2024134216A1
WO2024134216A1 PCT/GB2023/053362 GB2023053362W WO2024134216A1 WO 2024134216 A1 WO2024134216 A1 WO 2024134216A1 GB 2023053362 W GB2023053362 W GB 2023053362W WO 2024134216 A1 WO2024134216 A1 WO 2024134216A1
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
dna
seq
sequence
gene
Prior art date
Application number
PCT/GB2023/053362
Other languages
French (fr)
Inventor
Rocky Cranenburgh
Mariusz Mucha
Original Assignee
Bitrobius Genetics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bitrobius Genetics Ltd filed Critical Bitrobius Genetics Ltd
Publication of WO2024134216A1 publication Critical patent/WO2024134216A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/36—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/10011—Details dsDNA Bacteriophages
    • C12N2795/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2820/00—Vectors comprising a special origin of replication system
    • C12N2820/60—Vectors comprising a special origin of replication system from viruses

Definitions

  • the present invention relates to a technology for replicating a polynucleotide within a eukaryotic cell and transferring said polynucleotide between eukaryotic cells.
  • the polynucleotide may be used to deliver polynucleotide sequence providing a desirable function, such as a therapeutic effect, or a polynucleotide sequence able to complement or directly replace a mutated gene in eukaryotic cells. Methods of treatment comprising administration of said polynucleotide are also disclosed.
  • nucleic acid molecule there are numerous therapeutic approaches that require the transfer of a nucleic acid molecule to a human or other animal for subsequent expression of the genes encoded by the nucleic acid molecule. These include gene therapy, cancer therapy and DNA vaccination.
  • gene therapy a functional copy of a gene that is mutated in the host chromosome is delivered, to correct the defective phenotype transiently, or permanently by chromosomal integration or gene editing (Anguela & High, 2019). Cancers are frequently caused by mutations in genes responsible for DNA repair or regulation of cell division, and these genes can be introduced to prophylactically correct mutations that represent a predisposition to cancer, or to kill tumours (Anguela & High, 2019).
  • DNA vaccination relies on expressing a gene encoding an immunogenic protein from a pathogen in the antigen-presenting cells of the host (Hobemik & Bros, 2018).
  • the nucleic acid may be formulated in solution, encapsulated in liposomes, adhered to microbeads or other carriers, or packaged into viruses (Ates et al. 2020).
  • the transfected DNA ideally needs to reach most of the cells in a target organ to have a beneficial effect.
  • the proportion of cells transfected using current technologies is very low, and this has greatly restricted the development of gene therapy and genetic cancer therapy.
  • the fundamental problem is that the transfecting DNA is restricted to the cells that it initially transfects. Attempting to transfect more cells requires a high dose of DNA or virus, which is expensive to produce and has tolerability issues in the host.
  • Immunotherapy most commonly involves the ex vivo modification of T-cells from an individual to target a tumour antigen (CAR-T therapy).
  • CAR-T therapy a tumour antigen
  • the T-cells are extracted, genetically modified to express T-cell receptors, then reintroduced into the patient (Miliotou & Papadopoulou, 2018).
  • This patient-specific approach is costly, time- and labour-intensive.
  • T-cells are generated by progenitor cells in the bone marrow and mature in the thymus.
  • the modification of T-cells at source would be simpler and more cost- effective, but existing technologies cannot modify enough progenitor cells.
  • Direct treatment of pathogens involves the delivery of antimicrobials including antibiotic, antifungal and antiviral compounds.
  • Viruses may also be targeted using gene editing technologies such as CRISPR-Cas9 for the elimination of viral genomes from infected individuals (Doudna & Charpentier, 2014).
  • CRISPR-Cas9 CRISPR-Cas9 for the elimination of viral genomes from infected individuals
  • Recombinant protein expression involves inserting DNA containing the gene of interest, regulated by a promoter and a polyadenylation signal sequence, into a cell culture derived from a multicellular eukaryote in vitro.
  • the generation and selection of a highly expressing clone is a lengthy process, so transient transfection can be used to achieve transient gene expression in a much shorter time (Banniesayake & Almo, 2014). Ensuring that as many cells as possible take up the DNA maximises the yield of the recombinant protein, but high concentrations of DNA are currently used to achieve this.
  • the present inventor has developed a technology for the intercellular transfer of polynucleotides, such as DNA.
  • the present inventor has surprisingly found that the combination of a gene that expresses a DNA-secreting pore and a gene that provide replication function enables a polynucleotide to spread between eukaryotic cells, enabling a technology that is capable of propagating polynucleotides such as DNA to most of the target cells of a tissue or organ.
  • the applications of the invention include gene therapy, cancer therapy, DNA vaccination, immunotherapy, antimicrobial treatment, and in vitro recombinant protein production.
  • a polynucleotide comprising: a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • a polynucleotide comprising: a) an origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and d) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • a circular or linear plasmid comprising the polynucleotide as defined herein.
  • a pharmaceutical composition comprising the polynucleotide as defined herein, or the plasmid as defined herein, and a pharmaceutically acceptable excipient.
  • a method of treatment comprising administration of the polynucleotide as defined herein, the plasmid as defined herein, or the pharmaceutical composition as defined herein, to an individual in need thereof.
  • SEQ ID NO: 19 Adenovirus 5 DNA-dependent DNA polymerase cistron
  • SEQ ID NO: 20 Adenovirus 5 precursor terminal protein (pTP) amino acid sequence
  • SEQ ID NO: 21 Adenovirus 5 precursor terminal protein (pTP) cistron
  • SEQ ID NO: 22 Adenovirus 5 DNA-binding protein (DBP) amino acid sequence
  • SEQ ID NO: 23 Adenovirus 5 DNA-binding protein (DBP) cistron
  • SEQ ID NO: 30 - 2 A ‘ribosome-skipping’ peptide consensus sequence
  • Figure 1- A) and B) show the mechanism of intercellular DNA transport of the invention, comprising bacteriophage N15 DNA replication functions and a DNA-secreting pore.
  • Figure 2 - shows A) the processing of the telRL site on circular DNA to generate covalently closed hairpin ends (resulting in linear DNA) by the N15 protelomerase TelN, and B) the mechanism of DNA replication by bacteriophage N15 RepA and TelN (adapted from Ravin, 2014).
  • Figure 3 - shows the mechanism of intercellular DNA transport of the invention, comprising Phi29 or AdV DNA replication functions and a DNA-secreting pore (TP: terminal protein; DBP: DNA-binding protein).
  • TP terminal protein
  • DBP DNA-binding protein
  • Figure 4 - shows the mechanism of linear DNA replication using terminal proteins based on Phi29.
  • Phi29 polymerase uses TP (covalently attached to each 5’ end) to prime synthesis of each strand of linear DNA, the strands separating when the DNA polymerases meet and replication continues to generate two linear DNA molecules (adapted from Choi et al., 2016).
  • Figure 5 - shows plasmids used in experiments to investigate membrane binding and DNA secretion by the TdtA and TraB pores: A) pBITTdtA and B) pBITTraB2. Experiments were conducted to show that the FLAG-tagged pore proteins expressed from plasmids transfected into HEK 293 cells. Cells were stained with Wheat Germ Agglutinin Alexa Fluor 647 Conjugate (membrane), DAPI (DNA), and an anti-FLAG antibody to detect the pore proteins, being C) TdtA expressed from pBITTdtA, and D) TraB expressed from pBITTraB2.
  • Figure 6 - shows the results of an experiment where HEK 293 cells were transfected with two plasmids that express mCherry: the negative control pMCPK and TdtA-expressing pBITTdtA, then subsequently transfected with pdClover2-Nl expressing Clover2 (a green fluorescent protein). The total percentage of A) cells expressing Clover2 that also expressed mCherry, and B) cells expressing Clover2 that were adjacent to cells expressing both fluorescent reporter proteins were recorded.
  • Figure 7 - shows the results of an experiment in which the TraB pore-expressing plasmid pBITTraB2 was used to transfect HEK 293 cells, which were subsequently transfected with pdClover2-Nl and the plasmid pCMV-Clover2-CLT that contains the clt locus.
  • the total percentage of A) cells expressing Clover2 that also expressed mCherry, and B) cells expressing Clover2 that were adjacent to cells expressing both fluorescent reporter proteins were recorded.
  • Figure 8 - shows the plasmids that express components of the Gentrafix system: A) pBITREPA2 expressing telN, rep A and tdtA,' B) pBITREPB2 expressing telN, rep A and traB.
  • Figure 9 - shows a western blot demonstrating expression of Gentrafix component proteins TelN, RepA, TdtA and TraB in human cell line HEK 293.
  • Figure 10- shows additional plasmids used in experiments to provide evidence for intercellular DNA secretion: A) pBITREP and B) pMCPK.
  • Figure 11- shows plasmids used in experiments to investigate membrane binding and DNA secretion by the TdtA and TraB pores: A) pdClover2-Nl and B) pCMV-Clover2- CLT.
  • Figure 12- shows the results of an experiment in which HEK 293 cells were transfected with plasmids pMCPK, pBITREP or pBITREP A2.
  • Positive (plasmid-containing) cells were red (as both plasmids also express mCherry), clusters are defined as groups of three or more adjacent red cells: A) number of mCherry-expressing cells per image, B) number of mCherry-expressing cell clusters per image, C) number of mCherry-expressing cells in clusters per image, D) number of mCherry-expressing cells forming clusters and E) representative image with red cells indicated by arrows.
  • Figure 13 - shows the results of an experiment in which HEK 293 cells were transfected with pBITREP, pBITREPA2 and pBITREPB2, and then cells of a second cell line: HEK293 GFP, were added to the culture. Red cells are indicated by white arrows, and cells that are both red and green are indicated by hashed arrows.
  • Figure 14 - shows the results of an experiment in which MDCK-GFP cells were transfected with pMCPK and pBITREPB2, and then cells of a second cell line: MDCK, were added to the culture.
  • Figure 15 - shows plasmids containing the firefly luciferase gene.
  • Figure 16 - shows the results of an experiment in which HEK293 cells were transfected with the plasmids containing the firefly luciferase gene.
  • the term “comprising” is intended to mean including but not limited to.
  • the phrase “A polynucleotide comprising a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells” should be interpreted to mean that the polynucleotide comprises at least one pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA- dependent DNA polymerase and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells
  • the word “comprising” is replaced with the phrase “consisting of.
  • the term “consisting of” is intended to be limiting.
  • the phrase “A polynucleotide consisting of a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells” should be interpreted to mean that the polynucleotide comprises at least one pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase and a polynucleotide sequence encoding a protelomerase or a terminal protein
  • the word “comprising” is replaced with the phrase “consisting essentially of”.
  • the term “consisting essentially of” means that specific further components can be present, namely those not materially affecting the essential characteristics of the subject matter.
  • nucleic acid molecule “nucleic acid sequence ”, “polynucleotide ” and “nucleotide sequence ” are used interchangeably herein, and are intended to refer to a polymeric chain of nucleotides of any length e.g. deoxyribonucleotides, ribonucleotides, or analogs thereof.
  • the polynucleotide may comprise DNA (deoxyribonucleotides) or RNA (ribonucleotides).
  • the polynucleotide may consist of DNA.
  • the polynucleotide may be mRNA. Since the polynucleotide may comprise RNA or DNA, all references to T (thymine) nucleotides may be replaced with U (uracil).
  • nucleotide sequences are written 5’ to 3’, i.e. the first nucleotide in any given sequence can be considered to be at the 5’ end and the last nucleotide can be considered to be at the 3’ end of any given nucleotide. Therefore, a sequence element that is 5 ’ of a second sequence element comes before the second sequence element in a nucleotide sequence.
  • a first sequence element that is 5’ of a second sequence element may come immediately before the second sequence element in the nucleotide sequence.
  • a first sequence element that is 5’ of a second sequence element may not come immediately before the second sequence element in the nucleotide sequence, i.e.
  • the nucleotide sequence may comprise an intervening sequence between the first and second sequence elements.
  • a first sequence element is less than 10 nucleotides 5’ of a second sequence element if the intervening sequence is less than 10 nucleotides in length.
  • a first sequence element that is 3 ’ of a second sequence element comes after the second sequence element in the nucleotide sequence.
  • a first sequence element that is 3’ of a second sequence element may come immediately after the second sequence element in the nucleotide sequence, i.e. there are no intervening nucleotides between the two sequence elements.
  • a first sequence element that is 3’ of a second sequence element may not come immediately after the second sequence element in the nucleotide sequence, i.e.
  • the nucleotide sequence may comprise an intervening sequence between the first and second sequence elements.
  • a first sequence element is less than 10 nucleotides 3’ of a second sequence element if the intervening sequence is less than 10 nucleotides in length.
  • the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in a first sequence for optimal alignment with a second sequence).
  • the nucleotides at each position are then compared. When a position in the first sequence is occupied by the same nucleotide at the corresponding position in the second sequence, then the nucleotides are identical at that position.
  • sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence is 95% identical to SEQ ID NO: 1, SEQ ID NO: 1 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 1 (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: 1 , and identify how many positions in the test sequence were identical to those of SEQ ID NO: 1. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO: 1. If the test sequence is shorter than SEQ ID NO: 1, the gaps or missing positions should be considered to be non-identical positions.
  • an alignment between two sequences can be accomplished using a mathematical algorithm.
  • the two nucleic acid sequences are aligned using the Needleman and Wunsch (1970) algorithm or the BLAST 2 (Basic Local Alignment Search Tool) algorithm from the National Center for Biotechnology Information.
  • the inventor has developed a technology for the intercellular transfer of polynucleotides such as DNA.
  • the polynucleotide is DNA.
  • the polynucleotide is in the form of a plasmid.
  • the polynucleotide is in the form of a circular plasmid or a linear plasmid.
  • the inventor has surprisingly found that a combination of polynucleotide sequences that express a DNA-secreting pore and polynucleotide sequences that provide the replication functions of a plasmid enable a polynucleotide to spread between the eukaryotic cells, enabling a technology that will allow said polynucleotide to reach most of the target cells of a tissue or organ ( Figure 1).
  • the invention is designed to carry out a prophylactic or therapeutic function in the target cells by expressing proteins and RNA encoded by the polynucleotide.
  • the polynucleotide of the invention comprises several polynucleotide sequences. These polynucleotide sequences can be designated as sequence elements, or components. These components comprise at least: polynucleotide sequence encoding a DNA-dependent DNA polymerase; and a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • these components comprise at least: an origin of replication; polynucleotide sequence encoding a DNA-dependent DNA polymerase; a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in any order in the 5 ’ to 3 ’ direction along the polynucleotide of the invention. Other components may also be present to the 5’ of the components listed above, to the 3 ’ of the components listed above, or positioned 5 ’ to some of the components listed above, but 3’ to other of the components listed above.
  • the components may be positioned in the following 5 ’ to 3 ’ direction: DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5’ to 3’ direction: pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase.
  • the components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5 ’ to 3 ’ direction: DNA-dependent DNA polymerase; protelomerase or a terminal protein and a DNA-binding protein; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase.
  • the components may be positioned in the following 5’ to 3’ direction: DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells; protelomerase or a terminal protein and a DNA-binding protein.
  • the components may be positioned in the following 5 ’ to 3 ’ direction: pore that enables secretion of DNA from eukaryotic cells; protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase.
  • the components may be positioned in the following 5’ to 3’ direction: pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase; protelomerase or a terminal protein and a DNA-binding protein.
  • the components may be positioned in the following 5 ’ to 3 ’ direction: origin of replication; protelomerase or a terminal protein and a DNA-binding protein; DNA- dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5 ’ to 3 ’ direction: protelomerase or a terminal protein and a DNA-binding protein; origin of replication; DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase; origin of replication; pore that enables secretion of DNA from eukaryotic cells.
  • the components may be positioned in the following 5’ to 3’ direction: RepA; TdtA.
  • the components may be positioned in the following 5’ to 3’ direction: RepA; TraB.
  • the components may be positioned in the following 5’ to 3’ direction: TelN; RepA; TdtA.
  • the components may be positioned in the following 5’ to 3’ direction: TelN; RepA; TraB.
  • the polynucleotide of the invention may be referred to herein as the Gentrafix system, Gentrafix cassette, or similar.
  • the first aspect of the invention relates to a mechanism of replicating a polynucleotide within a eukaryotic cell.
  • the polynucleotide of the invention present in the eukaryotic cell can be in the form of a linear plasmid or a circular plasmid.
  • the replication of the polynucleotide of the invention is enabled by a DNA-dependent DNA polymerase, combined where required with one or more additional proteins essential for replication. These components may be of bacteriophage, bacterial, archaeal, viral or eukaryotic origin.
  • the enzyme for plasmid replication is preferably the DNA polymerase RepA from bacteriophages including PY54 of Yersinia enterocolitica, the siphoviruses ⁇ KK2 of Klebsiella oxytoca and the coliphage N15.
  • the rep A gene sequence of coliphage N15 contains the origin of replication (ori) on which it acts to initiate replication.
  • N15 RepA is sufficient on its own for replication of circular DNA in the bi-directional theta mode as it possesses primase, helicase, and origin-binding activities (Ravin, 2014).
  • the plasmid containing RepA alone will therefore replicate as a covalently closed circular double-stranded DNA molecule.
  • the polynucleotide comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase.
  • the DNA-dependent DNA polymerase is encoded by the rep A gene.
  • the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, or at least 1300 amino acids of SEQ ID NO: 1; or
  • the DNA-dependent DNA polymerase polynucleotide sequence comprises:
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 2000, at least 2500, at least 3000, at least 3500, at least 3700, at least 3800, or at least 3900 nucleotides of SEQ ID NO: 2; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 2; or
  • Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed.
  • Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include quantitative PCR assays using primers and probes that bind to the DNA sequence being replicated by the DNA polymerase.
  • the polynucleotide of the invention is a linear doublestranded DNA molecule with covalently closed ends, the ends forming a so-called ‘hairpin loop’ and preventing the exposure of DNA ends to exonucleases, thus increasing its stability.
  • the polynucleotide will additionally comprise a polynucleotide sequence comprising telN from bacteriophages including bacteriophage N15, encoding a protelomerase and a single copy of its target site telRL, a 56 bp inverted repeat.
  • the polynucleotide of the invention comprises a polynucleotide sequence encoding the protelomerase TelN from bacteriophage N15.
  • the protelomerase expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 400, at least 450, at least 500, at least 550, or at least 600 amino acids of SEQ ID NO: 3; or
  • the TelN polynucleotide sequence comprises: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1500, at least 1600, at least 1700, or at least 1800 nucleotides of SEQ ID NO: 4; or
  • Said sequence variants retain the ability to function as a protelomerase when expressed.
  • Suitable assays to determine protelomerase activity are known to the skilled person and include agarose gel electrophoresis of plasmid DNA containing the TelRL sequence, as processing by TelN generates a linear form that migrates at its correct size compared to circular plasmid DNA, which can be determined using 'size markers' comprising DNA fragments of known lengths.
  • a restriction endonuclease digest using an enzyme that cuts once in the plasmid will convert a circular plasmid to a single linear form, whereas a linear plasmid will be cut into two fragments.
  • the polynucleotide of the invention comprises a telRL site.
  • the telRL site polynucleotide sequence comprises SEQ ID NO: 5, or a variant of SEQ ID NO: 5 that differs by 1, 2, 3, 4 or 5 nucleotides.
  • Said sequence variants retain the ability to function as a telRL site.
  • Suitable assays to determine telRL site functionality are known to the skilled person and include agarose gel electrophoresis of plasmid DNA containing the TelRL sequence, as processing by TelN generates a linear form that migrates at its correct size compared to circular plasmid DNA, which can be determined using 'size markers' comprising DNA fragments of known lengths. Additionally, a restriction endonuclease digest using an enzyme that cuts once in the plasmid will convert a circular plasmid to a single linear form, whereas a linear plasmid will be cut into two fragments.
  • the replication mechanism for a linear plasmid is as follows.
  • the protelomerase TelN cuts the single telRL site on the plasmid with a staggered cut, generating 6 bp extensions which are folded back and joined to the complementary DNA strand with a phosphodiester bond, creating terminal hairpin loops on a linear, double-stranded DNA molecule. These loops are termed telL and telR.
  • This linear plasmid is replicated by RepA, and when telL is converted from a single strand to a double strand in the replication bubble the resulting site, telLL, is cleaved and self-annealed by TelN to generate a Y-shaped molecule or circular plasmid dimer replication intermediate.
  • telR When telR is converted from a single strand to a double strand in the replication bubble the resulting site, telRR, is also cleaved and self-annealed by TelN to generate a linear plasmid with opposite telL and telR hairpin ends (Ravin, 2014). The newly generated linear plasmid is then replicated by RepA and processed by TelN to create further copies.
  • the mechanism of plasmid replication by bacteriophage N15 RepA and TelN is shown in Figure 2.
  • therapeutic plasmid DNA can be produced in and purified from prokaryotic cells (e.g. Escherichia coli) prior to introduction into the eukaryotic (e.g. Homo sapiens) target cells.
  • prokaryotic cells e.g. Escherichia coli
  • eukaryotic e.g. Homo sapiens
  • the repA and telN polynucleotide sequences are expressed from a standard, hybrid or dual promoter that enables transcription in both prokaryotic and eukaryotic cells.
  • the repA and telN polynucleotide sequences are expressed from a promoter that functions only in eukaryotic cells, with additional repA and telN polynucleotide sequences expressed in trans from promoters that function in the prokaryotic cells.
  • the genes sopA and sopB from bacteriophage N15 may be present in trans to stabilise the linear form of the polynucleotide of the invention in the prokaryotic cell.
  • polynucleotide sequences including one or more of repA, telN, sopA and sopB are present in trans, they may be either on a second plasmid or integrated into the chromosome, with their expression regulated by a prokaryotic promoter or promoters which may be constitutive or inducible.
  • a host cell comprising the polynucleotide of the invention.
  • the host cell is an Escherichia coli cell.
  • the Escherichia coli cell expresses the genes telN and repA from bacteriophage N15.
  • the Escherichia coli cell expresses the genes sopA and sopB from bacteriophage N15.
  • the Escherichia coli cell comprises a polynucleotide comprising polynucleotide sequences encoding sop A and sopB.
  • the SopA expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO: 6; or
  • sopA polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or
  • Said sequence variants retain the ability to function as a SopA protein when expressed.
  • Suitable assays to determine SopA protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
  • the SopB expressed by the polynucleotide sequence comprises: (i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO: 8; or
  • sopB polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO: 9; or
  • Said sequence variants retain the ability to function as a SopB protein when expressed.
  • Suitable assays to determine SopB protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
  • An alternative method of production of the polynucleotide of the invention encompasses a cell-free system whereby TelN and Phi29 polymerase are used to replicate linear DNA with TelR and TelL hairpin ends in vitro.
  • the polynucleotide of the invention is a linear doublestranded DNA molecule with each end protected by covalent linkage at the 5 ’ phosphate to a terminal protein (TP), with inverted repeat sequences functioning as replication origins at the DNA ends.
  • TP terminal protein
  • These systems additionally require a DNA polymerase with DNA replication primed from the TP, and one or more DNA-binding proteins essential for DNA replication.
  • plasmids are circular, and replication is initiated at a bacterial origin of replication which in E. coli may be N15 repA, pMBl, ColEI, p15A or pSC101.
  • a circular plasmid is linearised using a restriction endonuclease to generate a linear plasmid with terminal inverted repeats for transfection into the target eukaryotic cells.
  • the linear plasmid may also be linked to the TP in vitro prior to transfection.
  • the linear replication system comprised as part of the polynucleotide of the invention is from the Phi29 ( ⁇ 29) group of Bacillus subtilis bacteriophages including ⁇ 29, PZA, ⁇ 15, BS32, Bl 03, Nf, M2Y and GA-1 (Meijer et al., 2001).
  • the replication machinery comprises a DNA-dependent DNA polymerase (gene 2), a TP (gene 3), single-stranded DNA binding protein p5 (gene 5) and double-stranded DNA binding protein p6 (gene 6); the DNA-binding proteins being essential for DNA amplification (Salas et al., 2016).
  • the polynucleotide of the invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase from bacteriophage Phi29.
  • the DNA-dependent DNA polymerase is encoded by gene 2.
  • the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, or at least 550 amino acids of SEQ ID NO: 10; or
  • the DNA-dependent DNA polymerase polynucleotide sequence comprises: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, at least 1600, or at least 1700 nucleotides of SEQ ID NO: 11; or
  • Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed.
  • Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include expressing the DNA-dependent DNA polymerase in an E. coli strain along with a plasmid that contains its corresponding origin of replication. An increase in the total yield of DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
  • the polynucleotide of the invention comprises polynucleotide sequences encoding terminal protein TP and DNA-binding proteins p5 and p6 from bacteriophages of the Phi29 group of Bacillus subtilis.
  • the terminal protein expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, or at least 260 amino acids of SEQ ID NO: 12; or
  • the terminal protein polynucleotide sequence comprises; (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 500, at least 600, at least 700, at least 750, or at least 800 nucleotides of SEQ ID NO: 13; or
  • Said sequence variants retain the ability to function as a terminal protein when expressed.
  • Suitable assays to determine terminal protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional terminal protein is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
  • the DNA-binding protein p5 expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, or at least 120 amino acids of SEQ ID NO: 14; or
  • the DNA-binding protein p5 polynucleotide sequence comprises;
  • Said sequence variants retain the ability to function as a DNA-binding protein p5 when expressed.
  • Suitable assays to determine DNA-binding protein p5 activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional p5 is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
  • the DNA-binding protein p6 expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, or at least 100 amino acids of SEQ ID NO: 16; or
  • the DNA-binding protein p6 polynucleotide sequence comprises;
  • Said sequence variants retain the ability to function as a DNA-binding protein p6 when expressed.
  • Suitable assays to determine DNA-binding protein p6 activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional p6 is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
  • the first stage of DNA replication involves the formation of a heterodimer between TP and the DNA polymerase that recognises and binds to replication origin sequences located at either end of the linear plasmid.
  • DNA polymerase forming a phosphodiester bond between the hydroxyl group of a TP Ser232 and dAMP. Initiation is at nucleotide 2 of the template that starts with a T repeat (TTT), so when the first dAMP is added to the new DNA strand, the TP-A complex slides back to the start to ensure no loss of information.
  • TTT T repeat
  • DNA polymerase dissociates from TP after inserting the tenth nucleotide and continues DNA elongation with the single-stranded regions of the replication bubble bound by p5.
  • the linear plasmid When replication forks from each end meet, the linear plasmid is separated into two and replication of each terminates when the DNA polymerase reaches the template end and dissociates (Salas et al., 2016). This creates two linear plasmids, each with a TP linked to each end which can prime subsequent rounds of replication.
  • the linear replication system comprised as part of the polynucleotide of the invention is from an adenovirus (AdV) which infects the cells of vertebrates.
  • Adenovirus uses a precursor terminal protein (pTP) to prime DNA replication by its DNA polymerase AdV Pol (both expressed from the same gene: E2B); a plasmid will additionally require the AdV DNA-binding protein (DBP) encoded by E2A.
  • the polynucleotide of the invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase from adenovirus.
  • the DNA-dependent DNA polymerase is encoded by gene E2B.
  • the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
  • the DNA-dependent DNA polymerase polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 2600, at least 2700, at least 2800, at least 2900, at least 3000, at least 3100, at least 3200, at least 3300, at least 3400 or at least 3500 nucleotides of SEQ ID NO: 19; or
  • Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed.
  • Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include expressing the DNA-dependent DNA polymerase in an E. coli strain along with a plasmid that contains its corresponding origin of replication. An increase in the total yield of DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
  • the polynucleotide of the invention comprises polynucleotide sequences encoding the terminal protein pTP and DNA-binding protein E2A from adenovirus.
  • the terminal protein expressed by the polynucleotide sequence comprises:
  • the terminal protein polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1500, at least 1600, at least 1700, at least 1800, at least 1900, or at least 2000 nucleotides of SEQ ID NO: 21; or
  • Said sequence variants retain the ability to function as a terminal protein when expressed.
  • Suitable assays to determine terminal protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional terminal protein is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
  • the DNA-binding protein expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, or at least 520 amino acids of SEQ ID NO: 22; or
  • the DNA-binding protein polynucleotide sequence comprises; (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, or at least 1500 nucleotides of SEQ ID NO: 23; or
  • Said sequence variants retain the ability to function as a DNA-binding protein when expressed.
  • Suitable assays to determine DNA-binding protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional E2A is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
  • NFI and Oct-1 Two host transcription factors (NFI and Oct-1) are involved in enhancing initiation of DNA replication (Hoeben & Uil, 2013) but are not required on the plasmid. Inverted terminal repeats are included which contain origins of replication.
  • the mechanism of DNA replication is analogous to that of the Phi29 group of bacteriophages.
  • DBP binds the dsDNA and unwinds it by multimerization.
  • the pTP is covalently linked to the 5 ’ phosphate and AdV Pol adds a dCMP to the hydroxyl group of pTP Ser580 (except fowl adenovirus-A which incorporates dGMP) to initiate DNA replication.
  • Initiation is most frequently at nucleotide 4 of the template that starts with a 3 nt repeat (GTAGTA), so once the third nucleotide is added to the new DNA strand, the pTP-CAT complex jumps back to the start to ensure no loss of information.
  • AdV Pol and DBP then act to replicate the sequence, creating two linear plasmids each with a pTP linked to each end which can prime subsequent rounds of replication (Hoeben & Uil, 2013).
  • the linear replication system comprised as part of the polynucleotide of the invention is from other organisms with linear plasmids, genomes or other replicons, including the coliphage PRD1, Streptococcus pneumoniae bacteriophage Cp-1, Streptomyces spp., viruses, archaea, linear plasmids of bacteria, fungi and plants, transposable elements, and mitochondrial DNA (Salas et al., 2016).
  • the mechanism of plasmid replication using linear DNA replication systems featuring terminal proteins is shown in Figure 3.
  • the second aspect of the invention relates to a pore that can secrete DNA from one eukaryotic cell to an adjacent eukaryotic cell.
  • DNA-secreting pore refers to a structure composed of one or more types of protein subunits that spans a membrane between two regions of a cell, or between two cells, and can transfer a DNA molecule across the membrane junction.
  • DNA-secreting pore polynucleotide sequence comprised as part of the polynucleotide of the invention is TraB from Streptomyces spp. including S. lividans, and S. venezuelae plasmid pSVHl.
  • the pore expressed by the polynucleotide sequence comprises;
  • an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, or at least 750 amino acids of SEQ ID NO: 24; or
  • the pore polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1700, at least 1800, at least 1900, at least 2000, at least 2100, at least 2200, or at least 2300 nucleotides of SEQ ID NO: 25; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 25; or
  • Said sequence variants retain the ability to function as a DNA- secreting pore when expressed.
  • Suitable assays to determine DNA- secreting pore activity are known to the skilled person and include transfer of a plasmid encoding a fluorescent marker gene from a donor to a recipient cell line.
  • TraB comprises a single subunit that assembles as a hexameric pore-forming ATPase that resembles the chromosome segregator protein FtsK and translocates DNA by recognising specific 8-bp clt repeats (GACCCGGA- SEQ ID NO: 27) present in the plasmid clt locus (Thoma & Muth, 2012).
  • the polynucleotide of the invention comprises a clt locus polynucleotide sequence.
  • the clt locus polynucleotide sequence comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides. Said sequence variants retain the ability to function as a clt locus.
  • Suitable assays to determine clt locus functionality are known to the skilled person and include an electrophoretic mobility shift assay (EMSA) using DNA sequences with and without the clt locus - only the former are retarded by TraB (Amado et al. 2019)
  • TraB transfers plasmid DNA by conjugation between the mycelial tips of Streptomyces hyphae - proteins encoded by genes of the spd family are involved in subsequent spreading via septal cross walls, but the primary transfer from donor to recipient requires only TraB (Thoma & Muth, 2015).
  • the DNA-secreting pore is the single-protein DNA translocase TdtA from Thermus spp. including Thermus thermophilus, which actively pushes out DNA without a specific sequence from the donor cell (Blesa et al. 2017). TdtA does not require a specific DNA sequence for secretion, such as the clt repeat.
  • the DNA-secreting pore is the single-protein DNA translocase of bacterial or archaeal origin belonging to the FtsK-HerA superfamily, including FtsK and SpoIIIE which recognise 8 bp motifs KOPS and SRS respectively (Amado et al. 2019).
  • the pore expressed by the polynucleotide sequence comprises;
  • an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, or at least 560 amino acids of SEQ ID NO: 28; or
  • the pore polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1300, at least 1400, at least 1450, at least 1500, at least 1550, at least 1600, at least 1650, or at least 1700 nucleotides of SEQ ID NO: 29; or
  • the DNA-secreting pore is a Type VI Secretion System (T4SS) from bacterial genera including Agrobacterium, Bartonella, Brucella, Escherichia, Legionella, Helicobacter, Rickettsia, Salmonella and Shigella, the DNA release system of Neisseria spp., the Helicobacter pylori ComB system or the Bordetella pertussis pertussis toxin export (Ptl) system (Christie et al., 2014).
  • T4SS Type VI Secretion System
  • the third aspect of the invention relates to promoters and other sequences involved in the expression of the polynucleotide sequences comprised in the polynucleotide of the invention in eukaryotic cells.
  • Promoters are the binding sites of RNA polymerases and transcription factors, and are required for the initiation of mRNA synthesis. It is understood in the art that promoters may be used with their complete wild-type sequence or may be truncated derivatives.
  • the polynucleotide of the invention comprises a promoter sequence that works in most cells of a target organism: for mammals these include promoters from human cytomegalovirus (the major immediate early promoter hCMV-MIE), Rous Sarcoma Virus (RSV), Simian Virus 40 (SV40), Moloney Murine Leukaemia Virus long terminal repeat, elongation factor la (EF-la), cytokeratin 18 and 19 (KI 8 and KI 9), amylase (AMY) and rat aquaporin-5 (rAQP5) (Zheng & Baum, 2005).
  • human cytomegalovirus the major immediate early promoter hCMV-MIE
  • RSV Rous Sarcoma Virus
  • SV40 Simian Virus 40
  • Moloney Murine Leukaemia Virus long terminal repeat elongation factor la
  • EF-la elongation factor la
  • cytokeratin 18 and 19 KI 8 and KI 9
  • AMY amylase
  • the promoter sequence comprised in the polynucleotide of the invention will restrict gene expression to specific organs or tissues to limit the spread of the polynucleotide of the invention to regions where its activity will have a therapeutic benefit.
  • tissue-specific promoters regulate genes including the human muscle creatine kinase (MCK) (Wang et al., 2008), the mammary gland-specific murine whey acidic protein (WAP) (Ozturk- Winder et al., 2002) or small breast epithelial mucin gene promoter (SBEM) (Hube et al., 2006), the ciliated cell-specific gene FOXJ1 (hepatocyte nuclear factor-3/forkhead homologue 4) for lungs (Ostrowski et al., 2003), and the WASp (Wiskott-Aldrich syndrome) proximal promoter for haematopoietic cells (Martin et al., 2005).
  • MCK human muscle creatine kina
  • IRES sequences enable two or more cistrons to be regulated by the same promoter by enabling translation initiation within the single mRNA transcript, allowing shorter expression cassettes to be generated.
  • IRES sequences including those of the encephalomyocarditis virus (EMCV) (ALAllaf et al., 2019) and poliovirus (PV) (Malnou et al., 2002) may be incorporated into the polynucleotide of the invention.
  • EMCV encephalomyocarditis virus
  • PV poliovirus
  • 2A ‘ribosome-skipping’ peptides including F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2 A) and T2A (thosea asigna virus 2A) (Liu et al., 2017).
  • F2A foot-and-mouth disease virus
  • E2A equine rhinitis A virus
  • P2A porcine teschovirus-1 2 A
  • T2A thosea asigna virus 2A
  • the 2A peptide may be separated from the upstream protein by a short linker sequence such as GSG to increase skipping frequency (Szymczak-Workman et al., 2012).
  • the polynucleotide of the invention comprises one or more polynucleotides that encode 2A ‘ribosome-skipping’ peptides.
  • poly(A) sequence which contains a central sequence motif AAUAAA, increases the steady-state level of mRNA from a gene expressed in eukaryotic cells (Proudfoot, 2011) and therefore increases recombinant protein expression levels.
  • a poly(A) sequence is placed downstream of a cistron and may include those from the late simian virus 40 (SV40), the human or bovine growth hormone genes (hGH or bGH), and human or rabbit b-globin genes.
  • the polynucleotide of the invention comprises one or more polyadenylation signal (poly(A)) sequences.
  • the fourth aspect of the invention relates to the presence of a selectable marker gene in the polynucleotide of the invention and mechanisms for later removal of the selectable marker gene should this be required.
  • plasmids need a selectable marker gene for initial selection in a bacterial (typically E. coll) host cell, and to ensure that cells that have lost the plasmid do not proliferate in a culture to the detriment of plasmid-containing cells.
  • antibiotic resistance genes including those conferring resistance to b-lactam antibiotics (b-lactamase: bld); aminoglycoside antibiotics such as kanamycin or neomycin (kanamycin phosphotransferase: kan, neomycin phosphotransferase: neo); chloramphenicol (chloramphenicol acetyltransferase: cat); and tetracycline (tetracycline efflux pump: tetA).
  • the antibiotic resistance gene on the plasmid is kan.
  • Alternatives to antibiotic resistance genes are antibiotic-free plasmid selection systems.
  • the polynucleotide of the invention comprises one or more selectable marker genes as discussed above.
  • an antibiotic resistance gene is used during plasmid construction and is removed following transformation into the final E. coli production strain.
  • This can be achieved using the native XerCD multimer resolution system by flanking the antibiotic resistance gene with the recognition sequences of XerC and XerD (cer,psi or dif); enabling the XerCD recombinases to excise the intervening gene by site-specific recombination.
  • the ‘X-mark’ technology is used, whereby the antibiotic resistance gene is flanked by cer or psi sites and adjacent binding sites of accessory proteins PepA and ArgR/ArcA - when cultured in a pepA mutant E.
  • the antibiotic resistance gene is retained, but it is excised when transformed into any E. coli strain with functional pepA (Cranenburgh & Leckenby, 2010).
  • the ‘Xer-cise’ technology is used, whereby the antibiotic resistance gene is flanked by dif sites and the Xer recombination event that excises the antibiotic resistance gene only occurs when the plasmid attains a linear conformation (Bloor & Cranenburgh, 2006).
  • the polynucleotide of the invention comprises one or more antibiotic resistance genes as discussed above. Controlling the duration of protein function and intercellular DNA transfer
  • the fifth aspect of the invention relates to mechanisms for limiting the duration of replication and gene expression to enhance the biosafety of the polynucleotide of the invention, and to potentially remove TPs if these block DNA secretion via intermembrane pores.
  • the half-life of the components such as RepA, TelN, TdtA or TraB can be reduced such that a limited number of replication cycles are permitted to achieve the therapeutic effect and transfer of the polynucleotide of the invention to adjacent cells.
  • a component protein it can be fused with a peptide sequence that targets it for degradation. These include degrons and destabilizing domains (DD). Degrons bind ubiquitin ligases or the proteasome directly, targeting the fusion protein to the ubiquitin-proteasome system (UPS) (Wu et al., 2020).
  • UPS ubiquitin-proteasome system
  • DDs can be N- or C-terminal fusions, and rapidly degrade the fusion protein when expressed in mammalian cells, via an unidentified quality control pathway, unless a ligand is supplied which prevents degradation.
  • An example of a DD sequence is from the rapamycin-binding protein (FKBP12) with ligands including Shldl (Wu et al., 2020).
  • the polynucleotide of the invention comprises one or more polynucleotide sequences that, when expressed, act to restrict the half-life of a protein such as RepA, TelN, TdtA or TraB.
  • the polynucleotide of the invention is self-limiting as the Cas9 RNA-guided nuclease cuts and hence inactivates the polynucleotide of the invention in the nucleus; for applications that do not feature gene editing, a polynucleotide sequence encoding a plasmid-targeted Cas9 can be included as an additional safety feature in the polynucleotide of the invention.
  • the polynucleotide of the invention may comprise a transgene sequence, otherwise known as a payload sequence.
  • a payload sequence can be a therapeutic gene, polynucleotide sequence that has a therapeutic effect on a eukaryotic cell, or a sequence that encodes a protein that has a therapeutic effect on a eukaryotic cell.
  • Example of payload sequences are set out in the below aspects of the invention.
  • the payload sequence may be a therapeutic gene, a CRISPR RNA-guided nuclease, optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor.
  • CRISPR RNA-guided nuclease optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor.
  • the sixth aspect of the invention relates to gene editing to replace the mutated copy of a chromosomal gene that causes a genetic disease, represents an increased risk of cancer or is responsible for a cancer, with a correctly functioning copy of that gene; alternatively, a chromosomal gene is mutated or excised where its inactivation results in a desired effect.
  • Gene editing involves the cutting of specific gene sequences in a genome to inactivate a gene, or to allow the insertion of an exogenous gene, with the break restored by homology- directed repair (HDR) or non-homologous end-joining (NHEJ).
  • Synthetic nucleases comprising restriction enzymes such as FokI fused to modular DNA recognition protein subunits such as zinc fingers (to create zinc finger nucleases: ZFN), or transcription activator-like effector proteins (TALE) from Xanthomonas spp.
  • TALENS to create TAL nucleases: TALENS
  • OMVA Obligate Mobile Element Guided Activity
  • RNA-guided nuclease family such as TnpB (Nety et al., 2023), or the eukaryotic transposon-encoded Fanzor (Fz) proteins (Saito et al., 2023), or an Artificial Peptidic Genome Editing Tool (ApGet) (GB2114453.0) can be used for gene editing in the polynucleotide of the invention.
  • gene editing is performed using components of the CRISPR (clustered regularly interspaced short palindromic repeats) bacterial immune system whereby an RNA-guided nuclease such as Cas9 from Streptococcus pyogenes (SpCas9) is used to introduce specific double stranded breaks in the target host genome.
  • the polynucleotide of the invention comprises a polynucleotide sequence encoding a gene-editing protein or proteins, for example a RNA-guided nuclease such as Cas9.
  • the CRISPR-associated RNA-guided nuclease that is Cas9, or a Cas9 functional equivalent such as Casl3 or CPfl, or variants thereof, may be from prokaryotes including bacteria Acidaminococcus spp., Campylobacter spp., Francisella spp., Lachnospiraceae spp., Neisseria spp., Staphylococcus spp., Streptococcus spp. (Adli, 2018).
  • the nuclease used is the MAD7 nuclease, a type V CRISPR nuclease isolated from Eubacterium rectale.
  • wild-type CRISPR nucleases such as Cas9 can cause unwanted mutations at off-target sites that have homology to the desired target sequence.
  • a Cas9 will be used in the invention with an altered amino acid sequence to reduce or eliminate off-target effects, such as SpCas9-HFl (Kleinstiver et al., 2016) or eSpCas9 (Slaymaker et al., 2016).
  • an N- or C-terminal nuclear localisation signal such as the SV40 large T antigen NLS may increase the efficiency of gene editing (Hu et al. ,2018).
  • Cas9 requires a CRISPR RNA (crRNA) that recognises the complementary DNA target sequence adjacent to a protospacer adjacent motif (PAM, consensus sequence: NGG) and a trans-activating CRISPR RNA (tracrRNA) that binds to Cas9 - these are combined as a single guide RNA (sgRNA) for gene editing applications (Jinek et al., 2013).
  • the sgRNA sequences may be expressed from mammalian promoters that initiate transcription from RNA polymerase III, including the U6, Hl and 7SK promoters (Yin et al., 2020).
  • the polynucleotide comprises a polynucleotide sequence encoding a RNA-guided nuclease such as SpCas9-HFl or eSpCas9.
  • the polynucleotide of the invention comprises one or more polynucleotide sequences encoding a sgRNA.
  • the polynucleotide of the invention can be used to replace mutated genes in gene therapy and cancer therapy applications in humans and other animals, including in embryos, by gene editing.
  • a wild-type or cDNA cistron of the defective gene is included on the polynucleotide of the invention, flanked by target site homology of approximately 1 kb each side, which is in turn flanked by the complementary sites of a pair of sgRNAs that also flank the chromosomal target site.
  • the target site may be the defective gene, particularly where its removal may be beneficial, or may be an intergenic region.
  • the polynucleotide of the invention When the polynucleotide of the invention enters the cell, the first one to be transported across the nuclear membrane into the nucleus undergoes transcription of its genes, with the resulting mRNA exported back across the nuclear membrane into the cytoplasm for translation.
  • the Cas9 protein then enters the nucleus, binds to the sgRNAs and cuts the polynucleotide and chromosome to release the donor DNA and defective gene respectively.
  • the donor DNA is incorporated at the chromosomal break by HDR or potentially by NHEJ.
  • the seventh aspect of the invention relates to the expression of the therapeutic gene without the requirement for chromosomal gene editing.
  • the therapeutic gene is expressed within the target cell to continually produce the therapeutic protein. This may be achieved using a single polynucleotide or plasmid of the invention, or by having the functional genes (encoding the DNA replication proteins and pore) on a first polynucleotide of the invention, which is degraded after a limited duration, for example by Cas9 or another endonuclease, leaving the second polynucleotide to express the therapeutic gene but being unable to transfer to other cells without the first plasmid.
  • the polynucleotide of the invention may be used to treat genetic diseases and cancers.
  • the polynucleotide of the invention may be used to treat genetic diseases and cancers caused by an inactivating coding mutation, or as DNA vaccines.
  • achromatopsia genes encoding components of the cone phototransduction cascade: CNGA3, CNGB3, GNAT2, PDE6C, PDE6H,' activating transcription factor 6: ATF6)'.
  • alpha- 1 -antitrypsin deficiency serine protein inhibitor Al: SERPINA 7
  • Angelman syndrome ubiquitin ligase: UBE3A
  • AADC aromatic L-amino acid decarboxylase
  • DDC dicyclopa decarboxylase
  • Batten disease neuroal ceroid lipofuscinoses
  • hyaluronidase myotonia congenator (chloride channel 1: CLCN1); myotonic dystrophy type 1 (dystrophia myotonica protein kinase: DMPK); neurofibromatosis type 1 (Neurofibromin 1 : NFI); phenylketonuria (phenylalanine hydroxylase: PAH); ornithine transcarbamylase (OCT) deficiency; polycystic kidney disease 1 and 2 (polycystin 1, transient receptor potential channel interacting: PKD1; polycystin 2, transient receptor potential cation channel: PKD2); Pompe disease (alphaglucosidase: GAA); retinitis pigmentosa (cellular retinaldehyde-binding protein: RLBP1); Ret's syndrome (methyl-CpG-binding protein 2: MECP2); sickle cell disease (beta-globin: HBB); spinal muscular atrophy (sur
  • Genetic diseases which can be treated by the polynucleotide of the invention may include those caused by a duplication or amplification of a gene, wherein the therapy represents the deletion of the extraneous copy or copies, or replacement of the duplicate or multiple copies with a single copy.
  • An example is the most common form of Charcot-Marie-Tooth disease type 1 A (peripheral myelin protein 22: PMP22).
  • the CCR5 receptor is the co-receptor of CD4 to which the human immunodeficiency virus (HIV 1 and 2) binds to enter T-helper cells, leading to acquired immune deficiency syndrome (AIDS).
  • HIV 1 and 2 human immunodeficiency virus
  • AIDS acquired immune deficiency syndrome
  • Mutation of the CCR5 gene of humans has no known detrimental effects, thus it may be mutated or deleted using gene editing of haematopoietic stem cells within the bone marrow where they originate, within the thymus where they mature, or modified ex vivo and re-implanted; this will prevent infection by HIV and could lead to the clearance of HIV from an infected individual (Epah & Schafer, 2021).
  • the polynucleotide of the invention is used to treat HIV infection.
  • Loss-of-function diseases where exogenous gene expression is therapeutic
  • Some diseases are not caused by mutated genes, but by the loss of function of a gene or genes through cell death, due to aging or an aberrant immune response. These diseases can be treated by the introduction of functioning genes, either present episomally or chromosomally inserted, by the polynucleotide of the invention.
  • Such diseases include: Parkinson disease (artemin: ARTN; dopa decarboxylase: DDC; glial cell-line derived neurotrophic factor: GDNF; neurturin: NRTN; persephin: PSPN); wet age-related macular degeneration (anti-vascular endothelial growth factor proteins and antibodies).
  • ACRV2A activin a receptor type 2 A
  • APC adenomatous polyposis coli
  • ATRX alpha thalassemia/mental retardation syndrome X- linked
  • CDKN2A cyclin-dependent kinase inhibitor 2A
  • CTNNB1 beta-catenin 1
  • DAXX death domain-associated protein
  • EGFR epidermal growth factor receptor
  • FBXW7 F-box with 7 tandem WD40
  • MEN1 multiple endocrine neoplasia type 1
  • PCBP1 poly C binding protein 1
  • PIK3CA phosphoinositide 3-kinase
  • PTEN phosphatase and tens
  • B2M ⁇ 2-microglobulin
  • the polynucleotide of the invention comprises a gene as set out above. In one embodiment of the invention, the polynucleotide of the invention is used to treat cancer.
  • An eighth aspect of the invention applies to immunotherapy via the genetic modification of the progenitor cells of T-cells and B-cells, such that the resulting T-cells express receptors that enable them to target antigens on pathogens or cancer cells, and B-cells produce antibodies that target antigens on pathogens or cancer cells.
  • the invention enables this approach by its ability to modify most of the cells within a target tissue.
  • Progenitor cells may be modified within the bone marrow where they originate, or in the case of T-cells additionally within the thymus where they mature; or modified ex vivo and re-implanted.
  • haematopoietic stem and progenitor cell can be achieved by gene editing or gene expression (Epah & Schafer, 2021).
  • all the tumour-associated and pathogen-specific antigens listed below could be targeted using modified T- and B-cells arising from modification of HSPCs by the polynucleotide of the invention.
  • a ninth aspect of the invention expresses an immunological protein or proteins from a pathogen or cancer cell within antigen-presenting cells of the host to prime the immune system to target the pathogen or cancer cell, as a DNA vaccine.
  • the invention will allow significantly more antigen-presenting cells to express the antigen than current methods of DNA vaccine delivery, and will use less DNA which will improve tolerability at the injection site.
  • Tumour-associated antigen sequences to be included in the polynucleotide of the invention may be chosen from cancer cells with any of the mutations as described above, and include: AFP: Alpha (a)-fetoprotein; AIM-2: Interferon-inducible protein absent in melanoma 2; ALL: Acute lymphoblastic leukaemia; AML: Acute myeloid leukaemia; 707-AP: 707 alanine proline; APL: Acute promyelocytic leukaemia; ART -4: Adenocarcinoma antigen recognized by T cells 4; BAGE: B antigen; bcr-abl: Breakpoint cluster region- Abelson; CAMEL: CTL-recognized antigen on melanoma; CAP-1: Carcinoembryonic antigen peptide-1; CASP-8: Caspase 8; CDC27: Cell division cycle 27; CDK4: Cyclin-dep endent kinase 4; CEA:
  • DAM-6 is also called MAGE-B2 and DAM- 10 is also called MAGE-B1);
  • ELF2 Elongation factor 2;
  • Ep-CAM Epithelial cell adhesion molecule;
  • EphA2, 3 Ephrin type-A receptor 2, 3;
  • Ets E-26 transforming specific (family of transcription factors);
  • ETV6-AML1 Ets variant gene 6 / acute myeloid leukaemia 1 gene ETS;
  • FGF-5 Fibroblast growth factor 5;
  • FN Fibronectin;
  • G250 Glycoprotein 250;
  • GAGE G antigen
  • GnT-V N-Acetylglucosaminyltransferase V
  • Gp10O Glycoprotein 100 kDa
  • HAGE Helicase antigen
  • HER-2/neu Human epidermal receptor 2/neurological
  • HLA-A*0201-R170I Arginine (R) to isoleucine (I) exchange at residue 170 of the a-helix of the a2-domain in the HLA-A2 gene; H/N: Head and neck; HSP70-2 M: Heat shock protein 70-2 mutated; HST-2: Human signet-ring tumour 2; hTERT: Human telomerase reverse transcriptase; iCE: Intestinal carboxyl esterase; IL-13Ra2: Interleukin 13 receptor a2 chain; KIAA0205; LAGE: L antigen; LDLR/FUT: Low density lipid receptor / GDP-L- fucose:0-D-galactosidase 2-a-L-fucosyltransferase; MAGE: Melanoma antigen; MART- 1/Melan-A: Melanoma antigen recognized by T cells-1 / melanoma antigen A; MART-2: Melanoma Ag recognized by T
  • Antigens may be derived from viruses, bacteria, fungi or eukaryotic parasites including Acinetobacter baumannii; Actinomyces israelii, Actinomyces gerencseriae and Propionibacterium propionicus; Trypanosoma brucei; HIV (Human immunodeficiency virus); Entamoeba histolytica,' Anaplasma spp.; Angiostrongylus,' Anisakis,' Bacillus anthracis,' Arcanobacterium haemolyticum,' Junin virus; Ascaris lumbricoides; Aspergillus spp.; Astroviridae spp.; Babesia spp.; Bacillus cereus; Bacteroides spp.; Balantidium coli; Bartonella,' Baylisascaris spp.; BK virus; Piedr aia hortae,' Blastocystis spp.; Bla
  • Streptococcus pyogenes Streptococcus pyogenes; Streptococcus agalactiae; Haemophilus influenzae; Enteroviruses Coxsackie A virus and enterovirus 71 (EV71); Sin Nombre virus; Heartland virus; Helicobacter pylori,' Escherichia coli ETEC, O157:H7, 0111 and O104:H4; Bunyaviridae spp.; Hendra virus; Hepatitis A virus; Hepatitis B virus; Hepatitis C virus; Hepatitis D Virus; Hepatitis E virus; Herpes simplex virus 1 and 2 (HSV-1 and HSV-2); Histoplasma capsulation,' Ancylostoma duodenale and Necator americanus,' Human bocavirus (HBoV); Ehrlichia ewingii,' Anaplasma phagocytophilum,' Human metapneumovirus (hMPV
  • Orthomyxoviridae spp. Isospora belli,' Kingella kingae,' Lassa virus; Legionella pneumophila,' Legionella pneumophila,' Leishmania spp.; Mycobacterium leprae and Mycobacterium lepromatosis,' Leptospira spp.; Listeria monocytogenes,' Borrelia burgdorferi, Borrelia garinii, and Borrelia afzelii,' Wuchereria bancrofti and Brugia malayi,' Lymphocytic choriomeningitis virus (LCMV); Plasmodium spp.; Marburg virus; Measles virus; Middle East respiratory syndrome (MERS) coronavirus; Burkholderia pseudomallei,' Neisseria meningitidis,' Metagonimus yokagawai; Microsporidia phylum; Molluscum contagiosum virus (MCV); Monkeypox virus; Mumps virus
  • Taenia spp. Clostridium tetani,' Trichophyton spp.; Trichophyton tonsurans,' Trichophyton spp.; Epidermophyton floccosum, Trichophyton rubrum, and Trichophyton mentagrophytes,' Trichophyton rubrum,' Hortaea wasneckii,' Malassezia spp.; Streptococcus pyogenes,' Toxocara canis, Toxocara cati; Toxoplasma gondii,' Trichinella spiralis,' Trichomonas vaginalis,' Trichuris trichiura,' Mycobacterium tuberculosis,' Francisella tularensis,' Salmonella enterica serovar Typhi, Paratyphi, and Typhimurium; Ureaplasma urealyticum,' Coccidioides immitis, Coccidioides posadasii,' Venezuelan equine encephalitis virus;
  • the antigen or antigens genes on the DNA vaccine polynucleotide of the invention may be co-expressed or fused with an immunogenic protein that acts as an adjuvant to increase the level of the immune response.
  • immunogenic proteins include the lethal toxin subunit B (LT-B) from pathogenic strains of E. coli, the Vibrio cholerae toxin subunit B (CT-B) and the Clostridium tetani tetanus toxin (spasmogenic toxin); these may contain mutations to reduce toxicity.
  • the DNA vaccine plasmid may be co-administered with one of these adjuvants or with an adjuvant including aluminium-based mineral salts (aluminium phosphate, aluminium hydroxide); Calcium phosphate; MF59 (submicron oil- in-water emulsion); Monophosphoryl lipid A (MPL: AS03, AS04).
  • aluminium-based mineral salts aluminium phosphate, aluminium hydroxide
  • Calcium phosphate MF59 (submicron oil- in-water emulsion)
  • MPL Monophosphoryl lipid A
  • the invention is designed to express RNAs to achieve a therapeutic effect following the translation of those RNAs into proteins and as CRISPR guide RNAs.
  • the expressed RNA itself is the therapeutic product.
  • the encoded RNA(s) may be single-stranded antisense RNAs including antisense oligonucleotides (ASOs) or double-stranded small interfering RNAs (siRNAs), designed to alter the expression of a host chromosomal gene to achieve a desired therapeutic effect (Zhu et al., 2022).
  • Antisense RNAs bind to the target mRNA by Watson-Crick basepairing and either downregulate expression by steric blocking to reduce or prevent translation, or induce exon skipping: changing an out-of-frame mutation into an in-frame mutation for therapeutic applications such as a small minority of cases of Duchenne muscular dystrophy (Aartsma-Rus et al. 2007).
  • Host mRNAs can be degraded to achieve a therapeutic effect by RNA interference (RNAi) using siRNA or hairpin microRNA (miRNA). miRNA is first processed sequentially by the RNase III enzymes DICER1 and DROSHA to generate a double-stranded RNA analogous to siRNA.
  • AG02 Argonaute 2 protein
  • RISC RNA-induced silencing complex RISC
  • ASOs and siRNAs are usually chemically modified, often by the introduction of phosphorothioate (PS) linkages in place of the phosphodiester bond to reduce their degradation by ribonucleases (Roberts et al., 2020), but the nuclear location of a Gentrafix plasmid and its ability to continually express RNA would enable unmodified RNA to produce a therapeutic effect.
  • PS phosphorothioate
  • Classes of recombinant proteins include antibodies, antibody fragments, antigens, enzymes, and hormones.
  • Mammalian cell lines commonly used for recombinant protein production include those from rodents: CHO (Chinese Hamster Ovary) and NSO (mouse myeloma), and from humans: HEK (human embryonic kidney), PER.C6 (human retinoblast), and CAP-T (primary human amniocytes) (Banmuddyayake and Almo, 2014).
  • the transfection of adherent cell lines with DNA typically requires a high ratio of DNA to cells and frequently does not result in transgene expression in most of the cells in the culture.
  • the invention will modify most of the cells, leading to a higher yield of recombinant protein within a pool of transfected cells (transient gene expression), and a greater number of cells expressing at a high level for subsequent clone selection. Germ line modification and gene drives
  • a polynucleotide of the invention is designed to modify cells of the germ line of an animal by modification of the sperm-producing cells (spermatogonia) or oocytes, using a constitutive or tissue-specific promoter to express the components of the polynucleotide of the invention.
  • This may be used for co-expression of a gene or genes encoding a therapeutic compound.
  • gene editing functions e.g. CRISPR
  • CRISPR gene editing functions
  • Another aspect of germ line modification is the introduction of a ‘gene drive’ genetic cassette that will subsequently be spread to the majority, and potentially all, of the progeny (Wedell et al., 2019).
  • the gene drive may be based on a natural selfish genetic element such as transmission distorters that become over-represented in eggs or sperm by targeting gametogenesis.
  • synthetic meiotic drivers may be used which are based on CRISPR-mediated gene editing to copy the gene drive onto the homologous chromosome, such that it is rapidly transmitted through the resultant population.
  • These may be used to control disease vectors such as mosquitoes, or invasive mammals that are adversely affecting native populations, for example by skewing the sex ratio to produce only males. This may be achieved in rodent populations by relocating the Sry sex determination gene from the X-chromosome to an autosome.
  • a pharmaceutical composition comprising the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, and a pharmaceutically acceptable excipient.
  • the pharmaceutically acceptable excipients may comprise carriers, diluents and/or other medicinal agents, pharmaceutical agents or adjuvants, etc.
  • the pharmaceutically acceptable excipients comprise saline solution.
  • the pharmaceutically acceptable excipients comprise human serum albumin.
  • Typical "pharmaceutically acceptable excipients ’ include any carrier that does not itself induce a reaction harmful to the individual receiving the composition.
  • Pharmaceutically acceptable excipients may also contain diluents, such as water, saline, glycerol, etc.
  • auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like, may be present.
  • Typical pharmaceutical excipients may include one of more of tris buffer, histidine, sodium chloride and sodium phosphate.
  • the invention further provides the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, for use in a method of treatment/method of treating a disease.
  • the method of treatment comprises administering an effective amount of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, to a patient.
  • the invention further provides a method of treatment comprising administering an effective amount of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, to a patient.
  • the invention further provides use of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, in the manufacture of a medicament for use in a method of treatment/method of treating a disease.
  • the terms “method of treating” and “method of treating a disease are used interchangeably herein.
  • the method of treatment/method of treating a disease comprises administering an effective amount of the composition or the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention to a patient.
  • the term “treating” includes both therapeutic treatment and prophylactic or preventative treatment, wherein the object is to prevent or lessen infection.
  • treating may include directly affecting or curing, suppressing, inhibiting, preventing, reducing the severity of, delaying the onset of, reducing symptoms associated with, for example, infection, or a combination thereof.
  • Preventing may refer, inter alia, to delaying the onset of symptoms, preventing relapse of a disease, and the like.
  • Treating may also include “suppressing” or “inhibiting” an infection or illness, for example reducing severity, number, incidence or latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, or combinations thereof.
  • a “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as raising the level of a transgene in a subject (so as to lead to functional trans gene production at a level sufficient to ameliorate the symptoms of a disease or disorder).
  • the diseases and disorders to be treated are those discussed herein.
  • the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention are administered by injection, micro injection, inhalation, jet injection, ingestion, liposome, lipid nanoparticle, virus, virus-like particle or microcarrier mediated delivery to a patient in need thereof.
  • host cells comprising the polynucleotide of the invention or the or the plasmid embodiment of the polynucleotide of the invention.
  • Suitable host cells such as Escherichia coli, are described herein.
  • the Escherichia coli cell expresses the genes repA, telN, sopA and sopB from bacteriophage N15.
  • the SopA expressed by the polynucleotide sequence comprises:
  • an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO: 6; or
  • sopA polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or
  • Said sequence variants retain the ability to function as a SopA protein when expressed.
  • Suitable assays to determine SopA protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
  • the SopB expressed by the polynucleotide sequence comprises: (i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO: 8; or
  • sopB polynucleotide sequence comprises;
  • a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO: 9; or
  • Said sequence variants retain the ability to function as a SopB protein when expressed.
  • Suitable assays to determine SopB protein activity are known to the skilled person and include culturing the in vitro strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
  • a method of producing the plasmid embodiment of the invention comprising culturing a host cell as defined herein, lysing the cell and purifying the plasmid or plasmids from the cell lysate.
  • a eukaryotic cell comprising the polynucleotide of the invention, or the plasmid embodiment of the invention.
  • Plasmids pBITTdtA ( Figure 5A) and pBITTraB2 ( Figure 5B) were constructed to express the pores TdtA and TraB respectively to determine if they are membrane-associated in human cells.
  • the pBITREPB plasmid (see Example 4) was cleaved with Spel and Xbal and ligated with tdtA cistron flanked with Spel and Xbal restriction sites.
  • To generate pBITTraB the traB cistron was inserted into Spel and Xbal sites of pBITREPB plasmid.
  • pBITTraB2 was created by adding a FLAG-tag generated by PCR to the 3’ end of the traB cistron by ligating BamHI-Xbal into pBITTraB.
  • Human embryonic kidney cells (HEK 293) were grown on glass cover slips in standard six-well plates and to a confluency reached 70-80%, and were transfected with 1 pg of pBITTraB2 or pBITTdtA using TurboFect reagent (Life Technologies, UK) accordingly to manufacturer’s protocol.
  • pMCPK plasmid expressing mCherry but lacking the pore cistron.
  • WGA wheat germ agglutinin conjugated with Alexa Fluor 647 (Invitrogen) dissolved in DMEM with 10% FBS medium for 30 minutes at 37°C, 5% CO2, followed by three washes with PBS.
  • cells were fixed with 4% paraformaldehyde (PFA; Merck, UK) in phosphate-buffered saline (PBS) for 10 minutes at room-temperature and washed thrice with PBS.
  • PFA paraformaldehyde
  • PBS phosphate-buffered saline
  • Cells were permeabilised by incubating for 15 minutes in PBS containing 0.05% Triton X-100 (PBST), then blocked for 1 hour in PBST with 10% FBS.
  • the primary antibody mouse anti-FLAG (Merck, UK), was applied in PBST- 10% FBS at 1:1000 dilution and incubated for 1 hour at ambient temperature.
  • the unbound antibody was removed using three washes with PBST and the secondary (goat anti-mouse Alexa Fluor 488; Abeam, UK) antibody was applied at 1:1000 dilution for 1 hour at ambient temperature.
  • the unbound antibody was removed with three washes with PBST, the first wash containing 0.1 ⁇ g/ml DAPI (Life Technologies, UK) and the coverslips were mounted with FluorSave reagent (EMD Millipore, USA), left in the dark to dry and photographed at 63x magnification.
  • the microphotographs in Figure 5 demonstrate the colocalisation of FLAG-tagged pore membrane protein (green, Figure 5C - TdtA, and Figure 5D- TraB) with cell-membrane stain for WGA (red).
  • HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM- GlutaMAX; Life Technologies, UK) and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six-well plates until they reach the density of 70-80%.
  • Cells were transfected with 1 pg of each mCherry-expressing plasmid DNA: pMCPK (negative control) or pBITTdtA (expressing the TdtA pore). After 24 hours the cells were transfected with 0.5 pg of pdClover2-Nl ( Figure 11 A) (Addgene, USA) expressing the green fluorescent protein Clover2.
  • the plasmid pCMV-Clover2-CLT ( Figure 11B) was constructed by synthesising the clt locus (SED ID NO: 26; ThermoFisher, Germany) and cloning it into the single Asel site of pdClover2-Nl.
  • HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM- GlutaMAX; Life Technologies, UK), and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six-well plates until they reach the density of 70-80%.
  • Cells were first transfected with 1 pg pBITTraB2, expressing mCherry and the TraB pore. After 24 hours the cells were transfected with 0.5 pg of plasmids expressing the green fluorescent protein Clover2: either the negative control pdClover2-Nl, or pCMV-Clover2-CLT which additionally contains the clt locus.
  • Two synthetised gene cassettes were generated, one in plasmid pET5R containing EF-la promoter located upstream of telN and 5 ’end of rep A gene separated by P2A peptide, and the other in p3RTmP containing the 3’ end of repA followed by an IRES (Internal Ribosomal Entry Site) element and traB. These were digested with Hindlll and Ndel (all restriction enzymes from NEB, UK) and ligated to create pBITREPB. pBITREPB was used to generate pBITREPA by replacing the traB cistron with synthesised tdtA with a C- terminal FLAG tag as an Nhel-Xbal fragment.
  • both pBITREPA and pBITREPB were further modified by replacing the IRES with an E2A peptide by synthesising a region encoding the C-terminus of repA, E2A and the N-terminal region of the pore cistrons, as a HindIII-Bsu36I fragment for tdtA and a Hindlll-PpuMI fragment for traB,' these were ligated into pBITREPA and pBITREPB cut with the same to create plasmids pBITREPA2 ( Figure 8A) and pBITREPB2 ( Figure 8B).
  • plasmids were transfected into low passage number HEK 293 cells and the efficiency of transfection was verified visually under the microscope 72 hours posttransfection to detect mCherry fluorescence. Cells were then rinsed with PBS, dissolved on ice in radioimmunoprecipitation assay (RIP A) buffer and then heat denatured (100°C for 5 minutes) and reduced with dithiothreitol (DTT) prior to size-separation in sodium dodecyl sulphate (SDS)-acrylamide gel.
  • RIP A radioimmunoprecipitation assay
  • DTT dithiothreitol
  • the proteins were electro-transferred onto nitrocellulose and blocked with 3% skimmed powder milk dissolved in tris-buffered saline with 0.1% Tween 20 detergent (TBST) for 1 hour and followed by immunoblotting with the following antibodies at dilutions of 1:1000: mouse anti-mCherry (Abeam, UK); anti-2A peptide (Merck, UK), anti-V5 tag (Abeam, UK) and anti-FLAG (Abeam, UK) for 1 hour at ambient temperature.
  • Tween 20 detergent Tween 20 detergent
  • membranes were washed thrice with TBST for 10 minutes and the secondary antibody applied for 1 hour: goat-anti mouse conjugated with alkaline phosphatase (Abeam, UK) diluted 1:1000 in 3% milk in TBST.
  • the signal was developed by applying Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega, UK). Developed membranes were photographed and protein sizes were verified by reference to the Prestained Protein Ladder Broad molecular weight (10-245 kDa) (Abeam, UK).
  • HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM-GlutaMAX; Life Technologies, UK), and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six -well plates until they reach the density of 70-80%.
  • Cells were transfected with 1 pg of the Gentrafix plasmids pBITREPA2 (TelN, RepA and TdtA pore) and pBITREPB2 (TelN, RepA and TraB pore), plus the negative control plasmid pMCPK (no Gentrafix components); all plasmids also express the red fluorescent reporter mCherry.
  • DMEM-GlutaMAX Dulbecco's Modified Eagle Medium
  • FBS Fetal Bovine Serum
  • the cells were rinsed with PBS buffer and fixed for 10 minutes with 4% PF A, then wash thrice for 5 minutes with PBS to remove the PFA.
  • Cells were then permeabilised with PBS containing 0.05% Triton X-100 for 15 minutes and blocked with PBS, 0.05% Triton X-100 and 10% FBS for an hour.
  • Cells were incubated in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 rabbit anti-mCherry antibody (Abeam, UK) for 1 hour at room temperature and then wash thrice with PBS containing 0.05% Triton X-100 for 10 minutes.
  • FIG. 12A-D Micrographs representing 30 different fields of view were taken randomly and analysed for the total number of red (mCherry-expressing) cells and the number of clusters per image ( Figure 12A-D).
  • Figure 12E shows a representative image with clusters indicated by arrows.
  • the greater incidence of clusters where the DNA-secreting pores are present is supporting evidence for intercellular DNA transfer by the Gentrafix platform.
  • the smaller control plasmid would be expected to represent a higher proportion of transfected cells as its copy number per unit mass is higher, and smaller plasmids are taken up more efficiently by cells, yet the Gentrafix plasmids are more abundant.
  • HEK 293 cells were transfected with pBITREP ( Figure 10 A), pBITREPA2 ( Figure 8A) and pBITREPB2 ( Figure 8B). After 24 hours the plasmid-containing medium was removed, cells were washed twice and fresh medium containing DNase I was applied. After a further 24 hours the cell line HEK293 GFP (amsbio, UK), which contains a chromosomally integrated green fluorescent protein (GFP) gene, was added to each culture and incubated for 72 hours.
  • GFP chromosomally integrated green fluorescent protein
  • MDCK-GFP cells which are Madin-Darby canine kidney cells constitutively expressing GFP from a chromosomally integrated gene
  • MDCK-GFP cells were transfected with 1 pg of pMCPK and pBITREPB2 plasmids, and the following day medium was replaced with fresh DMEM/FBS containing 5 units per ml of DNasel for two hours. Transfected MDCK-GFP cells were then overlayed with non-fluorescent MDCK cells (UKHSA, UK). After MDCK cells reattached, 3 ml of fresh DMEM/FBS was added and cells were incubated for a further 48 hours. Cells were then fixed with 4% PFA, permeabilised and treated with anti- mCherry antibodies. The images were taken using a Kern & Sohne OCM 167 fluorescence microscope.
  • the negative control pMCPK plasmid remained in the originally transfected MDCK-GFP cells (all red cells are also green), whereas the Gentrafix plasmid pBITREPB2 disseminated into the adjacent MDCK cells (cells that are seen in the merged but not GFP micrograph) in Figure 14.
  • the firefly luciferase gene was cloned into the negative control plasmids pMCPK and pBITREP, and Gentrafix plasmid pBITREPB2. This was achieved by removing the mCherry-puromycin resistance gene cassette by restriction enzyme digestion with BstBI and Avril, followed by ligation of a de novo synthesised firefly luciferase cistron flanked by BstBI and Avril restriction sites.
  • the new plasmids were pLUCK (no Gentrafix genes), pLUCKREP (telN and rep A) and pLUCKB (telN, repA, traB, clt).
  • pLUCKB was used to generate plasmids lacking Gentrafix components.
  • pLUCKB was cut using Avril and BstBI, blunt-ended using the NEB Quick Blunting Kit (NEB, UK) and self-ligated to produce pLUCKCB (telN, rep A, traB).
  • pLUCKB was cut using Spel and Mrel to remove the 5’ portion of traB plus the repA and telN cistrons, and a plasmid pBITTraBclt containing traB was cut with the same enzymes to release the N-terminus of traB which was ligated to restore traB and produce plasmid pLUCKOB (traB, clt).
  • a plasmid lacking repA was constructed by cutting pLUCKB with Mrel which removed the 3 ’ end of telN, all of repA and the 5 ’ end of traB - into this was ligated a synthesised Mrel-cut fragment ‘NoRepA’ restoring telN and traB cistrons with an intervening P2A peptide sequence to produce plasmid pLUCKTB (telN, traB, clt).
  • a /e/,V-dcficicnt plasmid was created by cutting pLUCKB with Spel and Sbfl which removed telN and the 5' end of rep A. Subsequently, a PCR product was generated using pLUCKB as a template, using primers NoTelNRepA (ATAGGACTAGTGCCGCCACCATGACCTTACAAGAATTCTACGCGG) and NoTelNR (GCGCCCCCTGCAGGTCGCCA). This PCR product, which contained the 5' end of repA, was digested with Spel and Sbfl and ligated into pLUCKB. Luciferase plasmids are illustrated in Figure 15.
  • HEK 293 cells were cultured in white, clear-bottom 96-well plates until 50% confluency at 37°C and 5% of CO2 in the tissue culture incubator in sets of four plates. Subsequently, the cells were transfected with equal copy numbers of each plasmid, equivalent to 200 ng of pLUCKB. Over the following four days, the cell medium in one plate per day was replaced in each well with fresh medium supplemented with 150 ⁇ g/ml of luciferin, and luminescence was measured using a GloMax microplate reader. The signal integration time was empirically set at 10 seconds on Day 0, six hours post- transfection. Data obtained over subsequent days were first normalised to the luminescence of untransfected control cells, and then to the luminescence observed on Day 0 for each plasmid. Each plasmid was analysed in five biological replicates ( Figure 16).
  • the plasmids possessing both repA and traB plus clt namely pLUCKB (telN, repA, traB, clt) and pLUCKRB (repA, traB, clt), exhibited a progressively more pronounced luminescence signal throughout the experiment, correlating with replication and intercellular transmission and demonstrating the importance of the combination of a DNA replication component and a DNA-secreting pore.
  • the four plasmids lacking repA and traB exhibited a minimal increase in fluorescence over the course of the experiment.
  • the relative effect of the clt locus can be seen by comparing pLUCKB (telN, repA, traB, clt) with pLUCKCB (telN, repA, traB)-.
  • the latter plasmid, lacking the clt locus produced a signal that was significantly lower than pLUCKB but higher than the plasmids lacking repA and traB, indicating that the clt locus enhances intercellular transmission but is not essential in achieving this.
  • the reduction in cell viability in all cultures resulted in a decrease in all fluorescence signals by Day 5.
  • a polynucleotide comprising: a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • the polynucleotide of embodiment 1, comprising: a) an origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and d) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
  • DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 1, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 that retains the ability to function as a DNA-dependent DNA polymerase.
  • DNA-dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 2, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 2 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
  • protelomerase expressed by the polynucleotide sequence comprises SEQ ID NO: 3, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 3 that retains the ability to function as a protelomerase.
  • protelomerase polynucleotide sequence comprises SEQ ID NO: 4, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 4 that retains the ability to function as a protelomerase when expressed.
  • the DNA-dependent DNA polymerase is from bacteriophage Phi29.
  • DNA-dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 11, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 11 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
  • terminal protein and DNA-binding protein are terminal protein TP and DNA-binding proteins p5 and p6 from bacteriophages of the Phi29 group of Bacillus subtilis.
  • terminal protein polynucleotide sequence comprises SEQ ID NO: 13, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 13 that retains the ability to function as a terminal protein when expressed.
  • DNA-binding proteins p5 and p6 expressed by the polynucleotide sequence comprise SEQ ID NOs: 14 and 16, respectively, or amino acid sequences that are at least 90% identical to SEQ ID NOs: 14 and 16, respectively, that retain the ability to function as DNA-binding proteins.
  • DNA-binding proteins p5 and p6 polynucleotide sequences comprise SEQ ID NO: 15 and 17, respectively, or polynucleotide sequences that are at least 90% identical to SEQ ID NO: 15 and 17, respectively, that retain the ability to function as DNA-binding proteins when expressed.
  • polynucleotide of embodiment 21 or embodiment 22, wherein the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 18, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 18 that retains the ability to function as a DNA-dependent DNA polymerase.
  • DNA-dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 19, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 19 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
  • terminal protein and DNA-binding protein are terminal protein pTP and DNA-binding protein E2A from adenovirus.
  • polynucleotide of embodiment 30, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 24 that retains the ability to function as a pore.
  • polynucleotide of embodiment 30 or embodiment 31 wherein the pore polynucleotide sequence comprises SEQ ID NO: 25, or a polynucleotide sequence that is at least 90% sequence identity to SEQ ID NO: 25 that retains the ability to function as a pore when expressed.
  • the clt locus comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides, wherein the variant maintains the ability to function as a clt locus.
  • polynucleotide of embodiment 35 wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 28 that retains the ability to function as a pore.
  • the polynucleotide of embodiment 40 wherein the payload sequence is a therapeutic gene, a CRISPR RNA-guided nuclease, optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor.
  • a circular or linear plasmid comprising the polynucleotide as defined in any one of the preceding embodiments.
  • linear plasmid comprising the polynucleotide as defined in any one of the embodiments 1 to 10, further comprising hairpin ends with the sequences telR and telL.
  • a host cell comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43.
  • sopA polynucleotide sequence comprises SEQ ID NO: 7, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 7 that retains the ability to function as a SopA protein when expressed
  • sopB polynucleotide sequence comprises SEQ ID NO: 9, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 9 that retains the ability to function as a SopB protein when expressed.
  • a pharmaceutical composition comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43, and a pharmaceutically acceptable excipient.
  • a method of treatment comprising administration of the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43, or the pharmaceutical composition as defined in embodiment 49, to an individual in need thereof.
  • polynucleotide, plasmid or pharmaceutical composition is administered by injection, micro injection, inhalation, jet injection, ingestion, liposome or microcarrier mediated delivery.
  • a method of producing the plasmid of embodiment 42 or embodiment 43 comprising culturing the host cell as defined in any one of embodiments 44 to 48, lysing the cell and purifying the plasmid or plasmids from the cell lysate.
  • a eukaryotic cell comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43.
  • bacteria such as Agrobacterium spp., Bartonella spp., Bordetella spp., Brucella spp., Escherichia spp., Legionella spp., Helicobacter spp., Neisseria spp., Rickettsia spp., Salmonella spp. and Shigella spp..
  • polynucleotide of embodiment 1 or embodiment 2, wherein the origin of replication is from a bacterial plasmid such as pMB 1 , ColEI, p 15 A or pSC 101.
  • polynucleotide of embodiment 1 or embodiment 2, wherein the terminal protein, DNA polymerase, and DNA-binding proteins are from organisms such as the coliphage PRD1, Streptococcus pneumoniae bacteriophage Cp-1, Streptomyces spp., viruses, and archaea, or are from linear plasmids of bacteria, fungi and plants, or are from transposable elements, or are from mitochondrial DNA.
  • polynucleotide of embodiment 1 or embodiment 2 further comprising: a) the recognition site for a restriction endonuclease, such as a homing endonuclease, that is not present in the target host chromosome; and b) a polynucleotide sequence encoding the cognate restriction endonuclease.
  • a restriction endonuclease such as a homing endonuclease
  • a composition comprising; a) a first plasmid comprising the polynucleotide of embodiment 1 or embodiment 2; and b) a second plasmid comprising a telRL site, or telR and telL sites and an origin of replication, or inverted terminal repeats, and clt sequences, wherein the a telRL site, or telR and telL sites and an origin of replication, or inverted terminal repeats, and clt sequences are equivalent to those of the first plasmid.
  • polynucleotide of embodiment 1 or embodiment 2 further comprising a 2A ‘ribosome-skipping’ peptide sequence.
  • polynucleotide of embodiment 59, wherein the ‘ribosome-skipping’ peptide comprises SEQ ID NOs: 30, 31, 32 or 33.
  • Gerstung M Jolly C, Leshchiner I, Dentro SC, Gonzalez S, Rosebrock D, Mitchell TJ, Rubanova Y, Anur P, Yu K, Tarabichi M, Deshwar A, Wintersinger J, Kleinheinz K, Vazquez-Garcia I, Haase K, Jerman L, Sengupta S, Macintyre G, Malikic S, Donmez N, Livitz DG, Cmero M, Demeulemeester J, Schumacher S, Fan Y, Yao X, Lee J, Schlesner M, Boutros PC, Bowtell DD, Zhu H, Getz G, Imielinski M, Beroukhim R, Sahinalp SC, Ji Y, Peifer M, Markowetz F, Mustonen V, Yuan K, Wang W, Morris QD; PCAWG Evolution &Heterogeneity Working Group, Spellman PT, Wedge DC, Van Loo P; PCAWG Consortium.
  • Poliovirus internal ribosome entry segment structure alterations that specifically affect function in neuronal cells: molecular genetic analysis. J Virol. 2002 Nov;76(21): 10617-26. doi: 10.1128/jvi.76.21.10617-10626.2002.
  • Novellino L, Castelli C, Policy for Microwave Selection A listing of human tumour antigens recognized by T cells: March 2004 update. Cancer Immunol Immunother. 2005 Mar;54(3): 187-207. doi: 10.1007/s00262-004-0560-6. Epub 2004 Aug 7. PMID: 15309328.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a technology for replicating a polynucleotide within a eukaryotic cell and transferring said polynucleotide between eukaryotic cells, said polynucleotide comprising a polynucleotide sequence encoding a DNA-secreting pore, and a gene encoding a protein required for DNA replication. The polynucleotide may also comprise a polynucleotide sequence providing a desirable function, such as a therapeutic effect, or a polynucleotide sequence able to complement or directly replace a mutated gene in the eukaryotic cell. Methods of treatment comprising administration of said polynucleotide are also disclosed.

Description

POLYNUCLEOTIDE CONSTRUCT ENCODING A DNA POLYMERASE AND A PORE
Field of the invention
The present invention relates to a technology for replicating a polynucleotide within a eukaryotic cell and transferring said polynucleotide between eukaryotic cells. The polynucleotide may be used to deliver polynucleotide sequence providing a desirable function, such as a therapeutic effect, or a polynucleotide sequence able to complement or directly replace a mutated gene in eukaryotic cells. Methods of treatment comprising administration of said polynucleotide are also disclosed.
Background of the invention
There are numerous therapeutic approaches that require the transfer of a nucleic acid molecule to a human or other animal for subsequent expression of the genes encoded by the nucleic acid molecule. These include gene therapy, cancer therapy and DNA vaccination. In gene therapy, a functional copy of a gene that is mutated in the host chromosome is delivered, to correct the defective phenotype transiently, or permanently by chromosomal integration or gene editing (Anguela & High, 2019). Cancers are frequently caused by mutations in genes responsible for DNA repair or regulation of cell division, and these genes can be introduced to prophylactically correct mutations that represent a predisposition to cancer, or to kill tumours (Anguela & High, 2019). DNA vaccination relies on expressing a gene encoding an immunogenic protein from a pathogen in the antigen-presenting cells of the host (Hobemik & Bros, 2018).
The nucleic acid may be formulated in solution, encapsulated in liposomes, adhered to microbeads or other carriers, or packaged into viruses (Ates et al. 2020). For gene and cancer therapy, the transfected DNA ideally needs to reach most of the cells in a target organ to have a beneficial effect. However, the proportion of cells transfected using current technologies is very low, and this has greatly restricted the development of gene therapy and genetic cancer therapy. The fundamental problem is that the transfecting DNA is restricted to the cells that it initially transfects. Attempting to transfect more cells requires a high dose of DNA or virus, which is expensive to produce and has tolerability issues in the host.
Immunotherapy most commonly involves the ex vivo modification of T-cells from an individual to target a tumour antigen (CAR-T therapy). The T-cells are extracted, genetically modified to express T-cell receptors, then reintroduced into the patient (Miliotou & Papadopoulou, 2018). This patient-specific approach is costly, time- and labour-intensive. T-cells are generated by progenitor cells in the bone marrow and mature in the thymus. The modification of T-cells at source would be simpler and more cost- effective, but existing technologies cannot modify enough progenitor cells.
Direct treatment of pathogens involves the delivery of antimicrobials including antibiotic, antifungal and antiviral compounds. Viruses may also be targeted using gene editing technologies such as CRISPR-Cas9 for the elimination of viral genomes from infected individuals (Doudna & Charpentier, 2014). However, there is no current technology that enables DNA-encoded antimicrobials to spread through an infected organ and target the invading pathogens.
Recombinant protein expression involves inserting DNA containing the gene of interest, regulated by a promoter and a polyadenylation signal sequence, into a cell culture derived from a multicellular eukaryote in vitro. The generation and selection of a highly expressing clone is a lengthy process, so transient transfection can be used to achieve transient gene expression in a much shorter time (Bandaranayake & Almo, 2014). Ensuring that as many cells as possible take up the DNA maximises the yield of the recombinant protein, but high concentrations of DNA are currently used to achieve this.
All the fields described above are limited by the inability of the recombinant DNA molecule to reach most of the cells in the target tissue, organ, or cell culture. Therefore, there is a need to develop a technology that enables intercellular DNA transfer. Summary of the invention
The present inventor has developed a technology for the intercellular transfer of polynucleotides, such as DNA. The present inventor has surprisingly found that the combination of a gene that expresses a DNA-secreting pore and a gene that provide replication function enables a polynucleotide to spread between eukaryotic cells, enabling a technology that is capable of propagating polynucleotides such as DNA to most of the target cells of a tissue or organ. The applications of the invention include gene therapy, cancer therapy, DNA vaccination, immunotherapy, antimicrobial treatment, and in vitro recombinant protein production.
Accordingly, in a first aspect of the invention, there is provided: a polynucleotide comprising: a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
In a further aspect of the invention, there is provided: a polynucleotide comprising: a) an origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and d) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
In a further aspect of the invention, there is provided: a circular or linear plasmid comprising the polynucleotide as defined herein. In a further aspect of the invention, there is provided: a pharmaceutical composition comprising the polynucleotide as defined herein, or the plasmid as defined herein, and a pharmaceutically acceptable excipient.
In a further aspect of the invention, there is provided: a method of treatment comprising administration of the polynucleotide as defined herein, the plasmid as defined herein, or the pharmaceutical composition as defined herein, to an individual in need thereof.
Brief Description of the Sequence Listing
SEQ ID NO: 1 - N15 rep A amino acid sequence
SEQ ID NO: 2 - N15 repA cistron
SEQ ID NO: 3 - N15 telN amino acid sequence
SEQ ID NO: 4 - N15 telN cistron
SEQ ID NO: 5 - N15 telRL
SEQ ID NO: 6 - N15 sopA amino acid sequence
SEQ ID NO: 7 - N15 sopA cistron
SEQ ID NO: 8 - N15 sopB amino acid sequence
SEQ ID NO: 9 - N15 sopB cistron
SEQ ID NO: 10 - Phi29 DNA-dependent DNA polymerase (gene 2) amino acid sequence
SEQ ID NO: 11 - Phi29 DNA-dependent DNA polymerase cistron (gene 2)
SEQ ID NO: 12 - Phi29 terminal protein (gene 3) amino acid sequence
SEQ ID NO: 13 - Phi29 terminal protein cistron (gene 3)
SEQ ID NO: 14 - Phi29 single-stranded DNA binding protein (gene 5) amino acid sequence
SEQ ID NO: 15 - Phi29 single-stranded DNA binding protein cistron (gene 5)
SEQ ID NO: 16 - Phi29 double-stranded DNA binding protein (gene 6) amino acid sequence
SEQ ID NO: 17 - Phi29 double-stranded DNA binding protein cistron (gene 6)
SEQ ID NO: 18 - Adenovirus 5 DNA-dependent DNA polymerase amino acid sequence
SEQ ID NO: 19 - Adenovirus 5 DNA-dependent DNA polymerase cistron SEQ ID NO: 20 - Adenovirus 5 precursor terminal protein (pTP) amino acid sequence
SEQ ID NO: 21 - Adenovirus 5 precursor terminal protein (pTP) cistron
SEQ ID NO: 22 - Adenovirus 5 DNA-binding protein (DBP) amino acid sequence
SEQ ID NO: 23 - Adenovirus 5 DNA-binding protein (DBP) cistron
SEQ ID NO: 24 - Streptomyces venezuelae pSVHl TraB amino acid sequence
SEQ ID NO: 25 - Streptomyces venezuelae pSVHl traB cistron
SEQ ID NO: 26 - Streptomyces venezuelae pSVHl clt locus
SEQ ID NO: 27 - Streptomyces venezuelae pSVHl clt repeat
SEQ ID NO: 28 - Thermus thermophilus TdtA amino acid sequence
SEQ ID NO: 29 - Thermus thermophilus tdtA cistron
SEQ ID NO: 30 - 2 A ‘ribosome-skipping’ peptide consensus sequence
SEQ ID NO: 31 - E2A ‘ribosome-skipping’ peptide sequence
SEQ ID NO: 32 - P2A ‘ribosome-skipping’ peptide sequence
SEQ ID NO: 33 - T2A ‘ribosome-skipping’ peptide s sequence
SEQ ID NO: 34 - pBITREP nucleotide sequence
SEQ ID NO: 35 - pBITREP A2 nucleotide sequence
SEQ ID NO: 36 - pBITREPB2 nucleotide sequence
SEQ ID NO: 37 - nucleotide sequence
SEQ ID NO: 38 - nucleotide sequence
SEQ ID NO: 39 - nucleotide sequence
SEQ ID NO: 40 - nucleotide sequence
SEQ ID NO: 41 - nucleotide sequence
SEQ ID NO: 42 - nucleotide sequence
SEQ ID NO: 43 - nucleotide sequence
SEQ ID NO: 44 - nucleotide sequence
SEQ ID NO: 45 - pLUCK nucleotide sequence
SEQ ID NO: 46 - pLUCKREP nucleotide sequence
SEQ ID NO: 47 - pLUCKB nucleotide sequence
SEQ ID NO: 48 - pLUCKCB nucleotide sequence
SEQ ID NO: 49 - pLUCKOB nucleotide sequence
SEQ ID NO: 50 - pLUCKTB nucleotide sequence
SEQ ID NO: 51 - pLUCKRB nucleotide sequence SEQ ID NO: 52 - NoTelNRepA primer
SEQ ID NO: 53 - NoTelNR primer
Brief Description of the Figures
Figure 1- A) and B) show the mechanism of intercellular DNA transport of the invention, comprising bacteriophage N15 DNA replication functions and a DNA-secreting pore.
Figure 2 - shows A) the processing of the telRL site on circular DNA to generate covalently closed hairpin ends (resulting in linear DNA) by the N15 protelomerase TelN, and B) the mechanism of DNA replication by bacteriophage N15 RepA and TelN (adapted from Ravin, 2014).
Figure 3 - shows the mechanism of intercellular DNA transport of the invention, comprising Phi29 or AdV DNA replication functions and a DNA-secreting pore (TP: terminal protein; DBP: DNA-binding protein).
Figure 4 - shows the mechanism of linear DNA replication using terminal proteins based on Phi29. Phi29 polymerase uses TP (covalently attached to each 5’ end) to prime synthesis of each strand of linear DNA, the strands separating when the DNA polymerases meet and replication continues to generate two linear DNA molecules (adapted from Choi et al., 2016).
Figure 5 - shows plasmids used in experiments to investigate membrane binding and DNA secretion by the TdtA and TraB pores: A) pBITTdtA and B) pBITTraB2. Experiments were conducted to show that the FLAG-tagged pore proteins expressed from plasmids transfected into HEK 293 cells. Cells were stained with Wheat Germ Agglutinin Alexa Fluor 647 Conjugate (membrane), DAPI (DNA), and an anti-FLAG antibody to detect the pore proteins, being C) TdtA expressed from pBITTdtA, and D) TraB expressed from pBITTraB2. Figure 6 - shows the results of an experiment where HEK 293 cells were transfected with two plasmids that express mCherry: the negative control pMCPK and TdtA-expressing pBITTdtA, then subsequently transfected with pdClover2-Nl expressing Clover2 (a green fluorescent protein). The total percentage of A) cells expressing Clover2 that also expressed mCherry, and B) cells expressing Clover2 that were adjacent to cells expressing both fluorescent reporter proteins were recorded.
Figure 7 - shows the results of an experiment in which the TraB pore-expressing plasmid pBITTraB2 was used to transfect HEK 293 cells, which were subsequently transfected with pdClover2-Nl and the plasmid pCMV-Clover2-CLT that contains the clt locus. The total percentage of A) cells expressing Clover2 that also expressed mCherry, and B) cells expressing Clover2 that were adjacent to cells expressing both fluorescent reporter proteins were recorded.
Figure 8 - shows the plasmids that express components of the Gentrafix system: A) pBITREPA2 expressing telN, rep A and tdtA,' B) pBITREPB2 expressing telN, rep A and traB.
Figure 9 - shows a western blot demonstrating expression of Gentrafix component proteins TelN, RepA, TdtA and TraB in human cell line HEK 293.
Figure 10- shows additional plasmids used in experiments to provide evidence for intercellular DNA secretion: A) pBITREP and B) pMCPK.
Figure 11- shows plasmids used in experiments to investigate membrane binding and DNA secretion by the TdtA and TraB pores: A) pdClover2-Nl and B) pCMV-Clover2- CLT.
Figure 12- shows the results of an experiment in which HEK 293 cells were transfected with plasmids pMCPK, pBITREP or pBITREP A2. Positive (plasmid-containing) cells were red (as both plasmids also express mCherry), clusters are defined as groups of three or more adjacent red cells: A) number of mCherry-expressing cells per image, B) number of mCherry-expressing cell clusters per image, C) number of mCherry-expressing cells in clusters per image, D) number of mCherry-expressing cells forming clusters and E) representative image with red cells indicated by arrows.
Figure 13 - shows the results of an experiment in which HEK 293 cells were transfected with pBITREP, pBITREPA2 and pBITREPB2, and then cells of a second cell line: HEK293 GFP, were added to the culture. Red cells are indicated by white arrows, and cells that are both red and green are indicated by hashed arrows.
Figure 14 - shows the results of an experiment in which MDCK-GFP cells were transfected with pMCPK and pBITREPB2, and then cells of a second cell line: MDCK, were added to the culture.
Figure 15 - shows plasmids containing the firefly luciferase gene.
Figure 16 - shows the results of an experiment in which HEK293 cells were transfected with the plasmids containing the firefly luciferase gene.
Detailed Description of the Invention
General Definitions
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this invention belongs.
It is to be understood that different applications of the disclosed invention may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. The term “about” or “around” when referring to a value refers to that value but within a reasonable degree of scientific error. Optionally, a value is “about x” or “around x” if it is within 10%, within 5%, or within 1% of x.
In addition as used in this specification and the appended claims, the singular forms “a”, “an”, and “the” include plural references unless the content clearly dictates otherwise. Thus, for example, reference to “a pore” includes “pores”, and the like.
In general, the term “comprising” is intended to mean including but not limited to. For example, the phrase “A polynucleotide comprising a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells” should be interpreted to mean that the polynucleotide comprises at least one pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA- dependent DNA polymerase and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells, but the polynucleotide may also comprise further polynucleotide sequences.
In some embodiments of the invention, the word “comprising” is replaced with the phrase “consisting of. The term “consisting of is intended to be limiting. For example, the phrase “A polynucleotide consisting of a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells” should be interpreted to mean that the polynucleotide comprises at least one pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA-dependent DNA polymerase and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells and no further polynucleotide seqeunces. In some embodiments of the invention, the word “comprising” is replaced with the phrase “consisting essentially of”. The term “consisting essentially of” means that specific further components can be present, namely those not materially affecting the essential characteristics of the subject matter. For example, the phrase “A polynucleotide consisting essentially of a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells, an origin of replication, a polynucleotide sequence encoding a DNA- dependent DNA polymerase, and a polynucleotide sequence encoding a protelomerase or a terminal protein and a DNA- binding protein required for plasmid replication in eukaryotic cells ” may also comprise polynucleotide sequences such as linker sequences between the claimed polynucleotide sequences.
The terms “nucleic acid molecule ” “nucleic acid sequence ”, “polynucleotide ” and “nucleotide sequence ” are used interchangeably herein, and are intended to refer to a polymeric chain of nucleotides of any length e.g. deoxyribonucleotides, ribonucleotides, or analogs thereof. For example, the polynucleotide may comprise DNA (deoxyribonucleotides) or RNA (ribonucleotides). The polynucleotide may consist of DNA. The polynucleotide may be mRNA. Since the polynucleotide may comprise RNA or DNA, all references to T (thymine) nucleotides may be replaced with U (uracil).
It is standard in the art that nucleotide sequences are written 5’ to 3’, i.e. the first nucleotide in any given sequence can be considered to be at the 5’ end and the last nucleotide can be considered to be at the 3’ end of any given nucleotide. Therefore, a sequence element that is 5 ’ of a second sequence element comes before the second sequence element in a nucleotide sequence. A first sequence element that is 5’ of a second sequence element may come immediately before the second sequence element in the nucleotide sequence. Alternatively, a first sequence element that is 5’ of a second sequence element may not come immediately before the second sequence element in the nucleotide sequence, i.e. the nucleotide sequence may comprise an intervening sequence between the first and second sequence elements. Similarly, a first sequence element is less than 10 nucleotides 5’ of a second sequence element if the intervening sequence is less than 10 nucleotides in length. A first sequence element that is 3 ’ of a second sequence element comes after the second sequence element in the nucleotide sequence. A first sequence element that is 3’ of a second sequence element may come immediately after the second sequence element in the nucleotide sequence, i.e. there are no intervening nucleotides between the two sequence elements. Alternatively, a first sequence element that is 3’ of a second sequence element may not come immediately after the second sequence element in the nucleotide sequence, i.e. the nucleotide sequence may comprise an intervening sequence between the first and second sequence elements. Similarly, a first sequence element is less than 10 nucleotides 3’ of a second sequence element if the intervening sequence is less than 10 nucleotides in length.
For the purpose of this invention, in order to determine the percent identity of two sequences (such as two polynucleotides or two polynucleotide sequences), the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in a first sequence for optimal alignment with a second sequence). The nucleotides at each position are then compared. When a position in the first sequence is occupied by the same nucleotide at the corresponding position in the second sequence, then the nucleotides are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions /total number of positions in the reference sequence x 100).
Typically the sequence comparison is carried out over the length of the reference sequence. For example, if the user wished to determine whether a given (“test”) sequence is 95% identical to SEQ ID NO: 1, SEQ ID NO: 1 would be the reference sequence. To assess whether a sequence is at least 95% identical to SEQ ID NO: 1 (an example of a reference sequence), the skilled person would carry out an alignment over the length of SEQ ID NO: 1 , and identify how many positions in the test sequence were identical to those of SEQ ID NO: 1. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO: 1. If the test sequence is shorter than SEQ ID NO: 1, the gaps or missing positions should be considered to be non-identical positions. The skilled person is aware of different computer programs that are available to align two sequences. For instance, an alignment between two sequences can be accomplished using a mathematical algorithm. In an embodiment, the two nucleic acid sequences are aligned using the Needleman and Wunsch (1970) algorithm or the BLAST 2 (Basic Local Alignment Search Tool) algorithm from the National Center for Biotechnology Information.
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
Polynucleotide replication by bacteriophage N15 and equivalent components
The inventor has developed a technology for the intercellular transfer of polynucleotides such as DNA. In a preferred embodiment of the invention, the polynucleotide is DNA. In a preferred embodiment of the invention, the polynucleotide is in the form of a plasmid. In a preferred embodiment of the invention, the polynucleotide is in the form of a circular plasmid or a linear plasmid.
The inventor has surprisingly found that a combination of polynucleotide sequences that express a DNA-secreting pore and polynucleotide sequences that provide the replication functions of a plasmid enable a polynucleotide to spread between the eukaryotic cells, enabling a technology that will allow said polynucleotide to reach most of the target cells of a tissue or organ (Figure 1). The invention is designed to carry out a prophylactic or therapeutic function in the target cells by expressing proteins and RNA encoded by the polynucleotide.
The polynucleotide of the invention comprises several polynucleotide sequences. These polynucleotide sequences can be designated as sequence elements, or components. These components comprise at least: polynucleotide sequence encoding a DNA-dependent DNA polymerase; and a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells. In a preferred embodiment, these components comprise at least: an origin of replication; polynucleotide sequence encoding a DNA-dependent DNA polymerase; a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
The components may be positioned in any order in the 5 ’ to 3 ’ direction along the polynucleotide of the invention. Other components may also be present to the 5’ of the components listed above, to the 3 ’ of the components listed above, or positioned 5 ’ to some of the components listed above, but 3’ to other of the components listed above.
The components may be positioned in the following 5 ’ to 3 ’ direction: DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells. The components may be positioned in the following 5’ to 3’ direction: pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase. The components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells. The components may be positioned in the following 5 ’ to 3 ’ direction: DNA-dependent DNA polymerase; protelomerase or a terminal protein and a DNA-binding protein; pore that enables secretion of DNA from eukaryotic cells. The components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase. The components may be positioned in the following 5’ to 3’ direction: DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells; protelomerase or a terminal protein and a DNA-binding protein. The components may be positioned in the following 5 ’ to 3 ’ direction: pore that enables secretion of DNA from eukaryotic cells; protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase. The components may be positioned in the following 5’ to 3’ direction: pore that enables secretion of DNA from eukaryotic cells; DNA-dependent DNA polymerase; protelomerase or a terminal protein and a DNA-binding protein.
The components may be positioned in the following 5 ’ to 3 ’ direction: origin of replication; protelomerase or a terminal protein and a DNA-binding protein; DNA- dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells. The components may be positioned in the following 5 ’ to 3 ’ direction: protelomerase or a terminal protein and a DNA-binding protein; origin of replication; DNA-dependent DNA polymerase; pore that enables secretion of DNA from eukaryotic cells. The components may be positioned in the following 5’ to 3’ direction: protelomerase or a terminal protein and a DNA-binding protein; DNA-dependent DNA polymerase; origin of replication; pore that enables secretion of DNA from eukaryotic cells.
The components may be positioned in the following 5’ to 3’ direction: RepA; TdtA. The components may be positioned in the following 5’ to 3’ direction: RepA; TraB. The components may be positioned in the following 5’ to 3’ direction: TelN; RepA; TdtA. The components may be positioned in the following 5’ to 3’ direction: TelN; RepA; TraB.
The polynucleotide of the invention may be referred to herein as the Gentrafix system, Gentrafix cassette, or similar.
The first aspect of the invention relates to a mechanism of replicating a polynucleotide within a eukaryotic cell.
The polynucleotide of the invention present in the eukaryotic cell can be in the form of a linear plasmid or a circular plasmid. The replication of the polynucleotide of the invention is enabled by a DNA-dependent DNA polymerase, combined where required with one or more additional proteins essential for replication. These components may be of bacteriophage, bacterial, archaeal, viral or eukaryotic origin. The enzyme for plasmid replication is preferably the DNA polymerase RepA from bacteriophages including PY54 of Yersinia enterocolitica, the siphoviruses Φ KK2 of Klebsiella oxytoca and the coliphage N15.
The rep A gene sequence of coliphage N15 contains the origin of replication (ori) on which it acts to initiate replication. N15 RepA is sufficient on its own for replication of circular DNA in the bi-directional theta mode as it possesses primase, helicase, and origin-binding activities (Ravin, 2014). The plasmid containing RepA alone will therefore replicate as a covalently closed circular double-stranded DNA molecule.
Thus, in the polynucleotide of the invention, the polynucleotide comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase. In a preferred embodiment of the invention, the DNA-dependent DNA polymerase is encoded by the rep A gene.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, or at least 1300 amino acids of SEQ ID NO: 1; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1; or
(iii) SEQ ID NO: 1.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase polynucleotide sequence comprises:
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 2000, at least 2500, at least 3000, at least 3500, at least 3700, at least 3800, or at least 3900 nucleotides of SEQ ID NO: 2; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 2; or
(iii) SEQ ID NO: 2.
Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed. Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include quantitative PCR assays using primers and probes that bind to the DNA sequence being replicated by the DNA polymerase.
In one embodiment of the invention the polynucleotide of the invention is a linear doublestranded DNA molecule with covalently closed ends, the ends forming a so-called ‘hairpin loop’ and preventing the exposure of DNA ends to exonucleases, thus increasing its stability. In this embodiment the polynucleotide will additionally comprise a polynucleotide sequence comprising telN from bacteriophages including bacteriophage N15, encoding a protelomerase and a single copy of its target site telRL, a 56 bp inverted repeat.
In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding the protelomerase TelN from bacteriophage N15.
In a preferred embodiment of the invention, the protelomerase expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 400, at least 450, at least 500, at least 550, or at least 600 amino acids of SEQ ID NO: 3; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 3; or
(iii) SEQ ID NO: 3.
In a preferred embodiment of the invention, the TelN polynucleotide sequence comprises: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1500, at least 1600, at least 1700, or at least 1800 nucleotides of SEQ ID NO: 4; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 4; or
(iii) SEQ ID NO: 4.
Said sequence variants retain the ability to function as a protelomerase when expressed. Suitable assays to determine protelomerase activity are known to the skilled person and include agarose gel electrophoresis of plasmid DNA containing the TelRL sequence, as processing by TelN generates a linear form that migrates at its correct size compared to circular plasmid DNA, which can be determined using 'size markers' comprising DNA fragments of known lengths. Additionally, a restriction endonuclease digest using an enzyme that cuts once in the plasmid will convert a circular plasmid to a single linear form, whereas a linear plasmid will be cut into two fragments.
In a preferred embodiment of the invention the polynucleotide of the invention comprises a telRL site. In one embodiment, the telRL site polynucleotide sequence comprises SEQ ID NO: 5, or a variant of SEQ ID NO: 5 that differs by 1, 2, 3, 4 or 5 nucleotides.
Said sequence variants retain the ability to function as a telRL site. Suitable assays to determine telRL site functionality are known to the skilled person and include agarose gel electrophoresis of plasmid DNA containing the TelRL sequence, as processing by TelN generates a linear form that migrates at its correct size compared to circular plasmid DNA, which can be determined using 'size markers' comprising DNA fragments of known lengths. Additionally, a restriction endonuclease digest using an enzyme that cuts once in the plasmid will convert a circular plasmid to a single linear form, whereas a linear plasmid will be cut into two fragments.
The replication mechanism for a linear plasmid is as follows. The protelomerase TelN cuts the single telRL site on the plasmid with a staggered cut, generating 6 bp extensions which are folded back and joined to the complementary DNA strand with a phosphodiester bond, creating terminal hairpin loops on a linear, double-stranded DNA molecule. These loops are termed telL and telR. This linear plasmid is replicated by RepA, and when telL is converted from a single strand to a double strand in the replication bubble the resulting site, telLL, is cleaved and self-annealed by TelN to generate a Y-shaped molecule or circular plasmid dimer replication intermediate. When telR is converted from a single strand to a double strand in the replication bubble the resulting site, telRR, is also cleaved and self-annealed by TelN to generate a linear plasmid with opposite telL and telR hairpin ends (Ravin, 2014). The newly generated linear plasmid is then replicated by RepA and processed by TelN to create further copies. The mechanism of plasmid replication by bacteriophage N15 RepA and TelN is shown in Figure 2.
It is well known in the art that therapeutic plasmid DNA can be produced in and purified from prokaryotic cells (e.g. Escherichia coli) prior to introduction into the eukaryotic (e.g. Homo sapiens) target cells. In one embodiment of the invention the repA and telN polynucleotide sequences are expressed from a standard, hybrid or dual promoter that enables transcription in both prokaryotic and eukaryotic cells.
In another embodiment of the invention the repA and telN polynucleotide sequences are expressed from a promoter that functions only in eukaryotic cells, with additional repA and telN polynucleotide sequences expressed in trans from promoters that function in the prokaryotic cells. Additionally, the genes sopA and sopB from bacteriophage N15 may be present in trans to stabilise the linear form of the polynucleotide of the invention in the prokaryotic cell. Where polynucleotide sequences including one or more of repA, telN, sopA and sopB are present in trans, they may be either on a second plasmid or integrated into the chromosome, with their expression regulated by a prokaryotic promoter or promoters which may be constitutive or inducible.
In a preferred embodiment of the invention, a host cell comprising the polynucleotide of the invention is provided. In a preferred embodiment, the host cell is an Escherichia coli cell. In a preferred embodiment, the Escherichia coli cell expresses the genes telN and repA from bacteriophage N15. In a preferred embodiment, the Escherichia coli cell expresses the genes sopA and sopB from bacteriophage N15. In a preferred embodiment, the Escherichia coli cell comprises a polynucleotide comprising polynucleotide sequences encoding sop A and sopB.
In a preferred embodiment of the invention, the SopA expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO: 6; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 6; or
(iii) SEQ ID NO: 6.
In a preferred embodiment of the invention, the sopA polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7; or
(iii) SEQ ID NO: 7.
Said sequence variants retain the ability to function as a SopA protein when expressed. Suitable assays to determine SopA protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
In a preferred embodiment of the invention, the SopB expressed by the polynucleotide sequence comprises: (i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO: 8; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 8; or
(iii) SEQ ID NO: 8.
In a preferred embodiment of the invention, the sopB polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO: 9; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 9; or
(iii) SEQ ID NO: 9.
Said sequence variants retain the ability to function as a SopB protein when expressed. Suitable assays to determine SopB protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
An alternative method of production of the polynucleotide of the invention encompasses a cell-free system whereby TelN and Phi29 polymerase are used to replicate linear DNA with TelR and TelL hairpin ends in vitro.
Linear DNA replication involving terminal proteins
In one embodiment of the invention the polynucleotide of the invention is a linear doublestranded DNA molecule with each end protected by covalent linkage at the 5 ’ phosphate to a terminal protein (TP), with inverted repeat sequences functioning as replication origins at the DNA ends. These systems additionally require a DNA polymerase with DNA replication primed from the TP, and one or more DNA-binding proteins essential for DNA replication. In bacteria, plasmids are circular, and replication is initiated at a bacterial origin of replication which in E. coli may be N15 repA, pMBl, ColEI, p15A or pSC101. A circular plasmid is linearised using a restriction endonuclease to generate a linear plasmid with terminal inverted repeats for transfection into the target eukaryotic cells. The linear plasmid may also be linked to the TP in vitro prior to transfection.
In a further embodiment of the invention the linear replication system comprised as part of the polynucleotide of the invention is from the Phi29 ( φ 29) group of Bacillus subtilis bacteriophages including φ 29, PZA, φ 15, BS32, Bl 03, Nf, M2Y and GA-1 (Meijer et al., 2001). The replication machinery comprises a DNA-dependent DNA polymerase (gene 2), a TP (gene 3), single-stranded DNA binding protein p5 (gene 5) and double-stranded DNA binding protein p6 (gene 6); the DNA-binding proteins being essential for DNA amplification (Salas et al., 2016).
In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase from bacteriophage Phi29. In a preferred embodiment of the invention, the DNA-dependent DNA polymerase is encoded by gene 2.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, or at least 550 amino acids of SEQ ID NO: 10; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 10; or
(iii) SEQ ID NO: 10.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase polynucleotide sequence comprises: (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, at least 1500, at least 1600, or at least 1700 nucleotides of SEQ ID NO: 11; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 11; or
(iii) SEQ ID NO: 11.
Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed. Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include expressing the DNA-dependent DNA polymerase in an E. coli strain along with a plasmid that contains its corresponding origin of replication. An increase in the total yield of DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
In a preferred embodiment of the invention, the polynucleotide of the invention comprises polynucleotide sequences encoding terminal protein TP and DNA-binding proteins p5 and p6 from bacteriophages of the Phi29 group of Bacillus subtilis.
In a preferred embodiment of the invention, the terminal protein expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 125, at least 150, at least 175, at least 200, at least 225, at least 250, or at least 260 amino acids of SEQ ID NO: 12; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 12; or
(iii) SEQ ID NO: 12.
In a preferred embodiment of the invention, the terminal protein polynucleotide sequence comprises; (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 500, at least 600, at least 700, at least 750, or at least 800 nucleotides of SEQ ID NO: 13; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 13; or
(iii) SEQ ID NO: 13.
Said sequence variants retain the ability to function as a terminal protein when expressed. Suitable assays to determine terminal protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional terminal protein is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
In a preferred embodiment of the invention, the DNA-binding protein p5 expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, or at least 120 amino acids of SEQ ID NO: 14; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 14; or
(iii) SEQ ID NO: 14.
In a preferred embodiment of the invention, the DNA-binding protein p5 polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 300, at least 350, at least 360, or at least 370 nucleotides of SEQ ID NO: 15; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 15; or
(iii) SEQ ID NO: 15. Said sequence variants retain the ability to function as a DNA-binding protein p5 when expressed. Suitable assays to determine DNA-binding protein p5 activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional p5 is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
In a preferred embodiment of the invention, the DNA-binding protein p6 expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, or at least 100 amino acids of SEQ ID NO: 16; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 16; or
(iii) SEQ ID NO: 16.
In a preferred embodiment of the invention, the DNA-binding protein p6 polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 260, at least 270, at least 280, at least 290, at least 300, or at least 310 nucleotides of SEQ ID NO: 17; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 17; or
(iii) SEQ ID NO: 17.
Said sequence variants retain the ability to function as a DNA-binding protein p6 when expressed. Suitable assays to determine DNA-binding protein p6 activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional p6 is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA. The first stage of DNA replication involves the formation of a heterodimer between TP and the DNA polymerase that recognises and binds to replication origin sequences located at either end of the linear plasmid. The DNA is unwound by p6 binding to the whole plasmid and DNA replication is initiated by DNA polymerase forming a phosphodiester bond between the hydroxyl group of a TP Ser232 and dAMP. Initiation is at nucleotide 2 of the template that starts with a T repeat (TTT), so when the first dAMP is added to the new DNA strand, the TP-A complex slides back to the start to ensure no loss of information. DNA polymerase dissociates from TP after inserting the tenth nucleotide and continues DNA elongation with the single-stranded regions of the replication bubble bound by p5. When replication forks from each end meet, the linear plasmid is separated into two and replication of each terminates when the DNA polymerase reaches the template end and dissociates (Salas et al., 2016). This creates two linear plasmids, each with a TP linked to each end which can prime subsequent rounds of replication.
In a further embodiment of the invention the linear replication system comprised as part of the polynucleotide of the invention is from an adenovirus (AdV) which infects the cells of vertebrates. Adenovirus uses a precursor terminal protein (pTP) to prime DNA replication by its DNA polymerase AdV Pol (both expressed from the same gene: E2B); a plasmid will additionally require the AdV DNA-binding protein (DBP) encoded by E2A.
In a preferred embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding a DNA-dependent DNA polymerase from adenovirus. In a preferred embodiment of the invention, the DNA-dependent DNA polymerase is encoded by gene E2B.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 700, at least 800, at least 900, at least 950, at least 1000, at least 1050, at least 1100, or at least 1150 amino acids of SEQ ID NO: 18; or (ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 18; or
(iii) SEQ ID NO: 18.
In a preferred embodiment of the invention, the DNA-dependent DNA polymerase polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 2600, at least 2700, at least 2800, at least 2900, at least 3000, at least 3100, at least 3200, at least 3300, at least 3400 or at least 3500 nucleotides of SEQ ID NO: 19; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 19; or
(iii) SEQ ID NO: 19.
Said sequence variants retain the ability to function as a DNA-dependent DNA polymerase when expressed. Suitable assays to determine DNA-dependent DNA polymerase activity are known to the skilled person and include expressing the DNA-dependent DNA polymerase in an E. coli strain along with a plasmid that contains its corresponding origin of replication. An increase in the total yield of DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional DNA-dependent DNA polymerase is replicating the plasmid.
In a preferred embodiment of the invention, the polynucleotide of the invention comprises polynucleotide sequences encoding the terminal protein pTP and DNA-binding protein E2A from adenovirus.
In a preferred embodiment of the invention, the terminal protein expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, or at least 650 amino acids of SEQ ID NO: 20; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 20; or
(iii) SEQ ID NO: 20.
In a preferred embodiment of the invention, the terminal protein polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1500, at least 1600, at least 1700, at least 1800, at least 1900, or at least 2000 nucleotides of SEQ ID NO: 21; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 21; or
(iii) SEQ ID NO: 21.
Said sequence variants retain the ability to function as a terminal protein when expressed. Suitable assays to determine terminal protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional terminal protein is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
In a preferred embodiment of the invention, the DNA-binding protein expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, or at least 520 amino acids of SEQ ID NO: 22; or
(ii) an amino sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 22; or
(iii) SEQ ID NO: 22.
In a preferred embodiment of the invention, the DNA-binding protein polynucleotide sequence comprises; (i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1000, at least 1100, at least 1200, at least 1300, at least 1400, or at least 1500 nucleotides of SEQ ID NO: 23; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 23; or
(iii) SEQ ID NO: 23.
Said sequence variants retain the ability to function as a DNA-binding protein when expressed. Suitable assays to determine DNA-binding protein activity are known to the skilled person and include an increase in the total yield of linear DNA, measured by UV spectrophotometry, agarose gel electrophoresis or quantitative PCR indicates that a functional E2A is contributing to plasmid replication. Additionally, an electrophoretic mobility shift assay can be used to detect terminal protein bound to the DNA.
Two host transcription factors (NFI and Oct-1) are involved in enhancing initiation of DNA replication (Hoeben & Uil, 2013) but are not required on the plasmid. Inverted terminal repeats are included which contain origins of replication. The mechanism of DNA replication is analogous to that of the Phi29 group of bacteriophages. DBP binds the dsDNA and unwinds it by multimerization. The pTP is covalently linked to the 5 ’ phosphate and AdV Pol adds a dCMP to the hydroxyl group of pTP Ser580 (except fowl adenovirus-A which incorporates dGMP) to initiate DNA replication. Initiation is most frequently at nucleotide 4 of the template that starts with a 3 nt repeat (GTAGTA), so once the third nucleotide is added to the new DNA strand, the pTP-CAT complex jumps back to the start to ensure no loss of information. AdV Pol and DBP then act to replicate the sequence, creating two linear plasmids each with a pTP linked to each end which can prime subsequent rounds of replication (Hoeben & Uil, 2013).
In a further embodiment of the invention the linear replication system comprised as part of the polynucleotide of the invention is from other organisms with linear plasmids, genomes or other replicons, including the coliphage PRD1, Streptococcus pneumoniae bacteriophage Cp-1, Streptomyces spp., viruses, archaea, linear plasmids of bacteria, fungi and plants, transposable elements, and mitochondrial DNA (Salas et al., 2016). The mechanism of plasmid replication using linear DNA replication systems featuring terminal proteins is shown in Figure 3.
DNA-secreting pores
The second aspect of the invention relates to a pore that can secrete DNA from one eukaryotic cell to an adjacent eukaryotic cell.
The term ‘DNA-secreting pore’ refers to a structure composed of one or more types of protein subunits that spans a membrane between two regions of a cell, or between two cells, and can transfer a DNA molecule across the membrane junction.
Preferably the DNA-secreting pore polynucleotide sequence comprised as part of the polynucleotide of the invention is TraB from Streptomyces spp. including S. lividans, and S. venezuelae plasmid pSVHl.
In a preferred embodiment of the invention, the pore expressed by the polynucleotide sequence comprises;
(i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, or at least 750 amino acids of SEQ ID NO: 24; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 24; or
(iii) SEQ ID NO: 24.
In a preferred embodiment of the invention, the pore polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1700, at least 1800, at least 1900, at least 2000, at least 2100, at least 2200, or at least 2300 nucleotides of SEQ ID NO: 25; or (ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 25; or
(iii) SEQ ID NO: 25.
Said sequence variants retain the ability to function as a DNA- secreting pore when expressed. Suitable assays to determine DNA- secreting pore activity are known to the skilled person and include transfer of a plasmid encoding a fluorescent marker gene from a donor to a recipient cell line.
TraB comprises a single subunit that assembles as a hexameric pore-forming ATPase that resembles the chromosome segregator protein FtsK and translocates DNA by recognising specific 8-bp clt repeats (GACCCGGA- SEQ ID NO: 27) present in the plasmid clt locus (Thoma & Muth, 2012).
In a preferred embodiment of the invention the polynucleotide of the invention comprises a clt locus polynucleotide sequence. In a preferred embodiment of the invention the clt locus polynucleotide sequence comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides. Said sequence variants retain the ability to function as a clt locus. Suitable assays to determine clt locus functionality are known to the skilled person and include an electrophoretic mobility shift assay (EMSA) using DNA sequences with and without the clt locus - only the former are retarded by TraB (Amado et al. 2019)
TraB transfers plasmid DNA by conjugation between the mycelial tips of Streptomyces hyphae - proteins encoded by genes of the spd family are involved in subsequent spreading via septal cross walls, but the primary transfer from donor to recipient requires only TraB (Thoma & Muth, 2015).
In one embodiment of the invention the DNA-secreting pore is the single-protein DNA translocase TdtA from Thermus spp. including Thermus thermophilus, which actively pushes out DNA without a specific sequence from the donor cell (Blesa et al. 2017). TdtA does not require a specific DNA sequence for secretion, such as the clt repeat. In one embodiment of the invention the DNA-secreting pore is the single-protein DNA translocase of bacterial or archaeal origin belonging to the FtsK-HerA superfamily, including FtsK and SpoIIIE which recognise 8 bp motifs KOPS and SRS respectively (Amado et al. 2019).
In a preferred embodiment of the invention, the pore expressed by the polynucleotide sequence comprises;
(i) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, or at least 560 amino acids of SEQ ID NO: 28; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 28; or
(iii) SEQ ID NO: 28.
In a preferred embodiment of the invention, the pore polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 1300, at least 1400, at least 1450, at least 1500, at least 1550, at least 1600, at least 1650, or at least 1700 nucleotides of SEQ ID NO: 29; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 29; or
(iii) SEQ ID NO: 29.
In one embodiment the DNA-secreting pore is a Type VI Secretion System (T4SS) from bacterial genera including Agrobacterium, Bartonella, Brucella, Escherichia, Legionella, Helicobacter, Rickettsia, Salmonella and Shigella, the DNA release system of Neisseria spp., the Helicobacter pylori ComB system or the Bordetella pertussis pertussis toxin export (Ptl) system (Christie et al., 2014). These multi-component protein pores do not require a specific DNA sequence for secretion. Regulation of gene expression in vivo
The third aspect of the invention relates to promoters and other sequences involved in the expression of the polynucleotide sequences comprised in the polynucleotide of the invention in eukaryotic cells. Promoters are the binding sites of RNA polymerases and transcription factors, and are required for the initiation of mRNA synthesis. It is understood in the art that promoters may be used with their complete wild-type sequence or may be truncated derivatives.
In a preferred embodiment of the invention, the polynucleotide of the invention comprises a promoter sequence that works in most cells of a target organism: for mammals these include promoters from human cytomegalovirus (the major immediate early promoter hCMV-MIE), Rous Sarcoma Virus (RSV), Simian Virus 40 (SV40), Moloney Murine Leukaemia Virus long terminal repeat, elongation factor la (EF-la), cytokeratin 18 and 19 (KI 8 and KI 9), amylase (AMY) and rat aquaporin-5 (rAQP5) (Zheng & Baum, 2005).
Preferably, the promoter sequence comprised in the polynucleotide of the invention will restrict gene expression to specific organs or tissues to limit the spread of the polynucleotide of the invention to regions where its activity will have a therapeutic benefit. These tissue-specific promoters regulate genes including the human muscle creatine kinase (MCK) (Wang et al., 2008), the mammary gland-specific murine whey acidic protein (WAP) (Ozturk- Winder et al., 2002) or small breast epithelial mucin gene promoter (SBEM) (Hube et al., 2006), the ciliated cell-specific gene FOXJ1 (hepatocyte nuclear factor-3/forkhead homologue 4) for lungs (Ostrowski et al., 2003), and the WASp (Wiskott-Aldrich syndrome) proximal promoter for haematopoietic cells (Martin et al., 2005).
Internal ribosome entry site (IRES) sequences enable two or more cistrons to be regulated by the same promoter by enabling translation initiation within the single mRNA transcript, allowing shorter expression cassettes to be generated. In an embodiment of the invention, IRES sequences including those of the encephalomyocarditis virus (EMCV) (ALAllaf et al., 2019) and poliovirus (PV) (Malnou et al., 2002) may be incorporated into the polynucleotide of the invention.
An alternative approach for expressing two or more cistrons from the same promoter is the use of 2A ‘ribosome-skipping’ peptides including F2A (foot-and-mouth disease virus), E2A (equine rhinitis A virus), P2A (porcine teschovirus-1 2 A) and T2A (thosea asigna virus 2A) (Liu et al., 2017). These require a highly conserved sequence GDVEXNPGP (SEQ ID NO: 30) to be added to the C-terminus of the protein encoded by the upstream gene. Post-translationally this sequence is retained on the C-terminus of the ‘upstream’ protein, minus the final proline which becomes the first amino acid of the ‘downstream’ protein. The 2A peptide may be separated from the upstream protein by a short linker sequence such as GSG to increase skipping frequency (Szymczak-Workman et al., 2012). In an embodiment of the invention the polynucleotide of the invention comprises one or more polynucleotides that encode 2A ‘ribosome-skipping’ peptides.
It is known in the art that incorporating a polyadenylation signal (poly(A)) sequence, which contains a central sequence motif AAUAAA, increases the steady-state level of mRNA from a gene expressed in eukaryotic cells (Proudfoot, 2011) and therefore increases recombinant protein expression levels. A poly(A) sequence is placed downstream of a cistron and may include those from the late simian virus 40 (SV40), the human or bovine growth hormone genes (hGH or bGH), and human or rabbit b-globin genes. In an embodiment of the invention, the polynucleotide of the invention comprises one or more polyadenylation signal (poly(A)) sequences.
Selectable marker genes
The fourth aspect of the invention relates to the presence of a selectable marker gene in the polynucleotide of the invention and mechanisms for later removal of the selectable marker gene should this be required.
It is well established in the art that plasmids need a selectable marker gene for initial selection in a bacterial (typically E. coll) host cell, and to ensure that cells that have lost the plasmid do not proliferate in a culture to the detriment of plasmid-containing cells. Most commonly these genes are antibiotic resistance genes, including those conferring resistance to b-lactam antibiotics (b-lactamase: bld); aminoglycoside antibiotics such as kanamycin or neomycin (kanamycin phosphotransferase: kan, neomycin phosphotransferase: neo); chloramphenicol (chloramphenicol acetyltransferase: cat); and tetracycline (tetracycline efflux pump: tetA). Preferably the antibiotic resistance gene on the plasmid is kan. Alternatives to antibiotic resistance genes are antibiotic-free plasmid selection systems. These include complementation of a bacterial host auxotrophy by the presence of a functional gene (e.g. dapD) or suppressor tRNA, toxin-antitoxin systems (e.g. hok/sok and ccdB/ccdA), operator-repressor titration (ORT) and various RNA-based selection systems (Vandermeulen et al., 2011). In an embodiment of the invention, the polynucleotide of the invention comprises one or more selectable marker genes as discussed above.
Preferably an antibiotic resistance gene is used during plasmid construction and is removed following transformation into the final E. coli production strain. This can be achieved using the native XerCD multimer resolution system by flanking the antibiotic resistance gene with the recognition sequences of XerC and XerD (cer,psi or dif); enabling the XerCD recombinases to excise the intervening gene by site-specific recombination. On a circular plasmid the ‘X-mark’ technology is used, whereby the antibiotic resistance gene is flanked by cer or psi sites and adjacent binding sites of accessory proteins PepA and ArgR/ArcA - when cultured in a pepA mutant E. coli the antibiotic resistance gene is retained, but it is excised when transformed into any E. coli strain with functional pepA (Cranenburgh & Leckenby, 2010). On a circular plasmid containing telRL that will be converted to a linear plasmid by the action of TelN the ‘Xer-cise’ technology is used, whereby the antibiotic resistance gene is flanked by dif sites and the Xer recombination event that excises the antibiotic resistance gene only occurs when the plasmid attains a linear conformation (Bloor & Cranenburgh, 2006). In an embodiment of the invention, the polynucleotide of the invention comprises one or more antibiotic resistance genes as discussed above. Controlling the duration of protein function and intercellular DNA transfer
The fifth aspect of the invention relates to mechanisms for limiting the duration of replication and gene expression to enhance the biosafety of the polynucleotide of the invention, and to potentially remove TPs if these block DNA secretion via intermembrane pores.
To limit the time that the proteins expressed from the polynucleotide of the invention are present in a cell, the half-life of the components such as RepA, TelN, TdtA or TraB can be reduced such that a limited number of replication cycles are permitted to achieve the therapeutic effect and transfer of the polynucleotide of the invention to adjacent cells. To restrict the half-life of a component protein, it can be fused with a peptide sequence that targets it for degradation. These include degrons and destabilizing domains (DD). Degrons bind ubiquitin ligases or the proteasome directly, targeting the fusion protein to the ubiquitin-proteasome system (UPS) (Wu et al., 2020). DDs can be N- or C-terminal fusions, and rapidly degrade the fusion protein when expressed in mammalian cells, via an unidentified quality control pathway, unless a ligand is supplied which prevents degradation. An example of a DD sequence is from the rapamycin-binding protein (FKBP12) with ligands including Shldl (Wu et al., 2020). In an embodiment of the invention, the polynucleotide of the invention comprises one or more polynucleotide sequences that, when expressed, act to restrict the half-life of a protein such as RepA, TelN, TdtA or TraB.
In applications where the CRISPR-Cas9 technology is used for gene editing (see below), the polynucleotide of the invention is self-limiting as the Cas9 RNA-guided nuclease cuts and hence inactivates the polynucleotide of the invention in the nucleus; for applications that do not feature gene editing, a polynucleotide sequence encoding a plasmid-targeted Cas9 can be included as an additional safety feature in the polynucleotide of the invention.
The polynucleotide of the invention may comprise a transgene sequence, otherwise known as a payload sequence. A payload sequence can be a therapeutic gene, polynucleotide sequence that has a therapeutic effect on a eukaryotic cell, or a sequence that encodes a protein that has a therapeutic effect on a eukaryotic cell. Example of payload sequences are set out in the below aspects of the invention. For example, the payload sequence may be a therapeutic gene, a CRISPR RNA-guided nuclease, optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor.
Gene editing
The sixth aspect of the invention relates to gene editing to replace the mutated copy of a chromosomal gene that causes a genetic disease, represents an increased risk of cancer or is responsible for a cancer, with a correctly functioning copy of that gene; alternatively, a chromosomal gene is mutated or excised where its inactivation results in a desired effect.
Gene editing involves the cutting of specific gene sequences in a genome to inactivate a gene, or to allow the insertion of an exogenous gene, with the break restored by homology- directed repair (HDR) or non-homologous end-joining (NHEJ). Synthetic nucleases comprising restriction enzymes such as FokI fused to modular DNA recognition protein subunits such as zinc fingers (to create zinc finger nucleases: ZFN), or transcription activator-like effector proteins (TALE) from Xanthomonas spp. (to create TAL nucleases: TALENS) (Adli, 2018), or a member of the Obligate Mobile Element Guided Activity (OMEGA) RNA-guided nuclease family such as TnpB (Nety et al., 2023), or the eukaryotic transposon-encoded Fanzor (Fz) proteins (Saito et al., 2023), or an Artificial Peptidic Genome Editing Tool (ApGet) (GB2114453.0) can be used for gene editing in the polynucleotide of the invention. Preferably, gene editing is performed using components of the CRISPR (clustered regularly interspaced short palindromic repeats) bacterial immune system whereby an RNA-guided nuclease such as Cas9 from Streptococcus pyogenes (SpCas9) is used to introduce specific double stranded breaks in the target host genome. In an embodiment of the invention, the polynucleotide of the invention comprises a polynucleotide sequence encoding a gene-editing protein or proteins, for example a RNA-guided nuclease such as Cas9. The CRISPR-associated RNA-guided nuclease that is Cas9, or a Cas9 functional equivalent such as Casl3 or CPfl, or variants thereof, may be from prokaryotes including bacteria Acidaminococcus spp., Campylobacter spp., Francisella spp., Lachnospiraceae spp., Neisseria spp., Staphylococcus spp., Streptococcus spp. (Adli, 2018). In an embodiment of the invention, the nuclease used is the MAD7 nuclease, a type V CRISPR nuclease isolated from Eubacterium rectale. For gene editing applications, wild-type CRISPR nucleases such as Cas9 can cause unwanted mutations at off-target sites that have homology to the desired target sequence.
Preferably a Cas9 will be used in the invention with an altered amino acid sequence to reduce or eliminate off-target effects, such as SpCas9-HFl (Kleinstiver et al., 2016) or eSpCas9 (Slaymaker et al., 2016). The inclusion of an N- or C-terminal nuclear localisation signal (NLS) such as the SV40 large T antigen NLS may increase the efficiency of gene editing (Hu et al. ,2018).
Cas9 requires a CRISPR RNA (crRNA) that recognises the complementary DNA target sequence adjacent to a protospacer adjacent motif (PAM, consensus sequence: NGG) and a trans-activating CRISPR RNA (tracrRNA) that binds to Cas9 - these are combined as a single guide RNA (sgRNA) for gene editing applications (Jinek et al., 2013). The sgRNA sequences may be expressed from mammalian promoters that initiate transcription from RNA polymerase III, including the U6, Hl and 7SK promoters (Yin et al., 2020). In an embodiment of the invention, the polynucleotide comprises a polynucleotide sequence encoding a RNA-guided nuclease such as SpCas9-HFl or eSpCas9. In an embodiment of the invention, the polynucleotide of the invention comprises one or more polynucleotide sequences encoding a sgRNA.
The polynucleotide of the invention can be used to replace mutated genes in gene therapy and cancer therapy applications in humans and other animals, including in embryos, by gene editing. A wild-type or cDNA cistron of the defective gene is included on the polynucleotide of the invention, flanked by target site homology of approximately 1 kb each side, which is in turn flanked by the complementary sites of a pair of sgRNAs that also flank the chromosomal target site. The target site may be the defective gene, particularly where its removal may be beneficial, or may be an intergenic region. When the polynucleotide of the invention enters the cell, the first one to be transported across the nuclear membrane into the nucleus undergoes transcription of its genes, with the resulting mRNA exported back across the nuclear membrane into the cytoplasm for translation. The Cas9 protein then enters the nucleus, binds to the sgRNAs and cuts the polynucleotide and chromosome to release the donor DNA and defective gene respectively. The donor DNA is incorporated at the chromosomal break by HDR or potentially by NHEJ.
Gene expression in vivo
The seventh aspect of the invention relates to the expression of the therapeutic gene without the requirement for chromosomal gene editing. In this application, the therapeutic gene is expressed within the target cell to continually produce the therapeutic protein. This may be achieved using a single polynucleotide or plasmid of the invention, or by having the functional genes (encoding the DNA replication proteins and pore) on a first polynucleotide of the invention, which is degraded after a limited duration, for example by Cas9 or another endonuclease, leaving the second polynucleotide to express the therapeutic gene but being unable to transfer to other cells without the first plasmid. Thus, the polynucleotide of the invention may be used to treat genetic diseases and cancers. In an embodiment of the invention, the polynucleotide of the invention may be used to treat genetic diseases and cancers caused by an inactivating coding mutation, or as DNA vaccines.
Genetic mutations causing genetic diseases
Potential genetic disease targets (and mutated genes) include: achromatopsia (genes encoding components of the cone phototransduction cascade: CNGA3, CNGB3, GNAT2, PDE6C, PDE6H,' activating transcription factor 6: ATF6)'. alpha- 1 -antitrypsin deficiency (serine protein inhibitor Al: SERPINA 7); Angelman syndrome (ubiquitin ligase: UBE3A)'. aromatic L-amino acid decarboxylase (AADC) deficiency (dopa decarboxylase: DDC), Batten disease (neuronal ceroid lipofuscinoses) (genes including: PPT1, TPP1, CLN3, DNAJC5, CLN5, CLN6, MFSD8, CLN8, CTSD, GRN, ATP13A2, CTSF, KCTD7): β- thalassemia (P-globin: HBB); Charcot-Marie-Tooth disease type 1A (peripheral myelin protein 22: PMP22); choroideremia (Rab escort protein 1: CHM); Crigler-Najjar syndrome (UDP-glucuronosyltransferase: UGT1A1); cystic fibrosis (cystic fibrosis conductance transmembrane regulator: CFTR); Diabetes mellitus (insulin: INS); Duchenne muscular dystrophy (dystrophin: DMD); giant axonal neuropathy (gigaxonin: GAN); dysferlinopathy (dysferlin: DYSF); glycogen storage disease type la (glucose-6-phosphatase: G6PC); haemophilia A (coagulation factor 8: FVIII); haemophilia B (coagulation factor 9: FIX); Huntington’s disease (Huntingtin: HTT); hypercholesterolemia (low-density lipoprotein receptor: LDLR, or apolipoprotein B: APOB); hypophosphataemic rickets (phosphate- regulating endopeptidase homologue, X-linked: PHEX); Leber's congenital amaurosis (retinoid isomerohydrolase: RPE65); Leber hereditary optic neuropathy (NADH dehydrogenase 4: MT-ND4); long-chain fatty acid oxidation disorders (medium-chain acyl- CoA dehydrogenase: ACADM; very long-chain acyl-CoA dehydrogenase: ACADVL; long- chain 3-hydroxy acyl-CoA dehydrogenase: HADHA; carnitine palmitoyltransferase type 1: CPT1A; camitine-acylcamitine translocase: SLC25A20; carnitine palmitoyltransferase type 2: CPT2; carnitine transporter: SLC22A5; short-chain acyl-CoA dehydrogenase: ACADS; multiple acyl-CoA dehydrogenase deficiency: ETFA, ETFB, ETFDH; 3-hydroxyacylCoA dehydrogenase: HADH); limb-girdle muscular dystrophy 2E (sarcoglycan genes: SGCB, SGCC, SGCD); Marfan syndrome (fibrillin: FBNI); mucopolysaccharidosis (alpha-L- iduronidase: IDUA; iduronate sulphatase: IDS; N-sulphoglucosamine sulphohydrolase: SGSH; alpha-N-acetylglucosaminidase: NAGLU; heparan-alpha-glucosaminide N- acetyltransferase: HGSNAT; N-acetylglucosamine-6-sulphatase: GNS; galactose-6-sulphate sulphatase: GALNS; β-galactosidase: GLB1; N-acetylgalactosamine-4-sulphatase: ARSB; β-glucuronidase: GUSB; HYALP. hyaluronidase); myotonia congenator (chloride channel 1: CLCN1); myotonic dystrophy type 1 (dystrophia myotonica protein kinase: DMPK); neurofibromatosis type 1 (Neurofibromin 1 : NFI); phenylketonuria (phenylalanine hydroxylase: PAH); ornithine transcarbamylase (OCT) deficiency; polycystic kidney disease 1 and 2 (polycystin 1, transient receptor potential channel interacting: PKD1; polycystin 2, transient receptor potential cation channel: PKD2); Pompe disease (alphaglucosidase: GAA); retinitis pigmentosa (cellular retinaldehyde-binding protein: RLBP1); Ret's syndrome (methyl-CpG-binding protein 2: MECP2); sickle cell disease (beta-globin: HBB); spinal muscular atrophy (survival of motor neuron 1: SMN1); Tay-Sachs disease (hexosaminidase A: HEXA); Wiskot-Aldrich-syndrome (WASp); X-linked myotubular myopathy (myotubularin 1 : MTM1); X-linked retinitis pigmentosa (X-linked retinitis pigmentosa GTPase regulator: RPGR); X-linked retinoschisis (retinoschisin: RSI); X- linked severe combined immunodeficiency (common gamma chain-encoding gene: IL2RG).
Gene duplications causing genetic diseases
Genetic diseases which can be treated by the polynucleotide of the invention may include those caused by a duplication or amplification of a gene, wherein the therapy represents the deletion of the extraneous copy or copies, or replacement of the duplicate or multiple copies with a single copy. An example is the most common form of Charcot-Marie-Tooth disease type 1 A (peripheral myelin protein 22: PMP22).
Genetic modifications to remove predispositions to infectious diseases
There are situations where removal of an antigen from host cells may reduce or eliminate susceptibility to an infectious disease. The CCR5 receptor is the co-receptor of CD4 to which the human immunodeficiency virus (HIV 1 and 2) binds to enter T-helper cells, leading to acquired immune deficiency syndrome (AIDS). Mutation of the CCR5 gene of humans has no known detrimental effects, thus it may be mutated or deleted using gene editing of haematopoietic stem cells within the bone marrow where they originate, within the thymus where they mature, or modified ex vivo and re-implanted; this will prevent infection by HIV and could lead to the clearance of HIV from an infected individual (Epah & Schafer, 2021). In an embodiment of the invention, the polynucleotide of the invention is used to treat HIV infection.
Loss-of-function diseases where exogenous gene expression is therapeutic Some diseases are not caused by mutated genes, but by the loss of function of a gene or genes through cell death, due to aging or an aberrant immune response. These diseases can be treated by the introduction of functioning genes, either present episomally or chromosomally inserted, by the polynucleotide of the invention. Such diseases include: Parkinson disease (artemin: ARTN; dopa decarboxylase: DDC; glial cell-line derived neurotrophic factor: GDNF; neurturin: NRTN; persephin: PSPN); wet age-related macular degeneration (anti-vascular endothelial growth factor proteins and antibodies).
Genetic mutations predisposing to and actively causing cancers
Potential gene targets leading to cancer when mutated include those encoding the DNA repair enzymes BRCA1, BRCA2 (breast and ovarian cancer) and TP53 (multiple cancers). Other potential targets include genes that regulate cell growth or division and so become oncogenes when mutated, such as ACRV2A (activin a receptor type 2 A); APC (adenomatous polyposis coli); ATRX (alpha thalassemia/mental retardation syndrome X- linked); CDKN2A (cyclin-dependent kinase inhibitor 2A); CTNNB1 (beta-catenin 1); DAXX (death domain-associated protein); EGFR (epidermal growth factor receptor); FBXW7 (F-box with 7 tandem WD40); MEN1 (multiple endocrine neoplasia type 1); PCBP1 (poly C binding protein 1); PIK3CA (phosphoinositide 3-kinase); PTEN (phosphatase and tensin homologue); RAS gene family (HRAS, NRAS and KRAS),' RBI (RB transcriptional corepressor 1); SMAD2, SMAD3 and SMAD4,' SOX (sex-determining region Y-box) gene family including S0X2 and S0X9; TCF7L2 (transcription factor 7 like 2); ZFP36L2 (ZFP36 ring finger protein like 2) (Gerstung et al., 2020).
Other potential targets include genes that enable tumours to proliferate by immune evasion when mutated, including B2M (β2-microglobulin).
Other potential targets include genes that enable tumours to proliferate when they are present in extra copies, for example by genetic recombination or amplification, such as HER2 (human epidermal growth factor receptor 2) and TERT (telomerase reverse transcriptase). In one embodiment of the invention, the polynucleotide of the invention comprises a gene as set out above. In one embodiment of the invention, the polynucleotide of the invention is used to treat cancer.
Immunotherapy
An eighth aspect of the invention applies to immunotherapy via the genetic modification of the progenitor cells of T-cells and B-cells, such that the resulting T-cells express receptors that enable them to target antigens on pathogens or cancer cells, and B-cells produce antibodies that target antigens on pathogens or cancer cells. The invention enables this approach by its ability to modify most of the cells within a target tissue. Progenitor cells may be modified within the bone marrow where they originate, or in the case of T-cells additionally within the thymus where they mature; or modified ex vivo and re-implanted. This approach of haematopoietic stem and progenitor cell (HSPC) gene therapy can be achieved by gene editing or gene expression (Epah & Schafer, 2021). In principle, all the tumour-associated and pathogen-specific antigens listed below (under ‘DNA vaccines’) could be targeted using modified T- and B-cells arising from modification of HSPCs by the polynucleotide of the invention.
DNA vaccines
A ninth aspect of the invention expresses an immunological protein or proteins from a pathogen or cancer cell within antigen-presenting cells of the host to prime the immune system to target the pathogen or cancer cell, as a DNA vaccine. The invention will allow significantly more antigen-presenting cells to express the antigen than current methods of DNA vaccine delivery, and will use less DNA which will improve tolerability at the injection site. Tumour-associated antigen sequences to be included in the polynucleotide of the invention may be chosen from cancer cells with any of the mutations as described above, and include: AFP: Alpha (a)-fetoprotein; AIM-2: Interferon-inducible protein absent in melanoma 2; ALL: Acute lymphoblastic leukaemia; AML: Acute myeloid leukaemia; 707-AP: 707 alanine proline; APL: Acute promyelocytic leukaemia; ART -4: Adenocarcinoma antigen recognized by T cells 4; BAGE: B antigen; bcr-abl: Breakpoint cluster region- Abelson; CAMEL: CTL-recognized antigen on melanoma; CAP-1: Carcinoembryonic antigen peptide-1; CASP-8: Caspase 8; CDC27: Cell division cycle 27; CDK4: Cyclin-dep endent kinase 4; CEA: Carcinoembryonic antigen; CLCA2: Calcium- activated chloride channel 2; CML: Chronic myelogenous leukaemia; CT: Cancer-testis (antigen); CTL: Cytotoxic T lymphocytes; Cyp-B: Cyclophilin B; DAM: Differentiation antigen melanoma (the epitopes of DAM-6 and DAM- 10 are equivalent, but the gene sequences are different. DAM-6 is also called MAGE-B2 and DAM- 10 is also called MAGE-B1); ELF2: Elongation factor 2; Ep-CAM: Epithelial cell adhesion molecule; EphA2, 3: Ephrin type-A receptor 2, 3; Ets: E-26 transforming specific (family of transcription factors); ETV6-AML1: Ets variant gene 6 / acute myeloid leukaemia 1 gene ETS; FGF-5: Fibroblast growth factor 5; FN: Fibronectin; G250: Glycoprotein 250;
GAGE: G antigen; GnT-V: N-Acetylglucosaminyltransferase V; Gp10O: Glycoprotein 100 kDa; HAGE: Helicase antigen; HER-2/neu: Human epidermal receptor 2/neurological;
HLA-A*0201-R170I: Arginine (R) to isoleucine (I) exchange at residue 170 of the a-helix of the a2-domain in the HLA-A2 gene; H/N: Head and neck; HSP70-2 M: Heat shock protein 70-2 mutated; HST-2: Human signet-ring tumour 2; hTERT: Human telomerase reverse transcriptase; iCE: Intestinal carboxyl esterase; IL-13Ra2: Interleukin 13 receptor a2 chain; KIAA0205; LAGE: L antigen; LDLR/FUT: Low density lipid receptor / GDP-L- fucose:0-D-galactosidase 2-a-L-fucosyltransferase; MAGE: Melanoma antigen; MART- 1/Melan-A: Melanoma antigen recognized by T cells-1 / melanoma antigen A; MART-2: Melanoma Ag recognized by T cells-2; MC1R: Melanocortin 1 receptor; M-CSF: Macrophage colony-stimulating factor gene; MHC: Major histocompatibility complex; MSI: Microsatellite instability; MUC1, 2: Mucin 1, 2; MUM-1, -2, -3: Melanoma ubiquitous mutated 1, 2, 3; NA88-A: NA cDNA clone of patient M88; Neo-PAP: Neo- poly(A) polymerase; NPM/ALK: Nucleophosmin/anaplastic lymphoma kinase fusion protein; NSCLC: Non-small cell lung carcinoma; NY-ESO-1: New York esophageous 1; OA1: Ocular albinism type 1 protein; OGT: O-Linked N-acetylglucosamine transferase gene; OS-9; P15: Protein 15; pl 90 minor bcr-abl: Protein of 190-kDa bcr-abl; Pml/RARa: Promyelocytic leukaemia / retinoic acid receptor a; PRAME: Preferentially expressed antigen of melanoma; PSA: Prostate-specific antigen; PSMA: Prostate-specific membrane antigen; PTPRK: Receptor-type protein-tyrosine phosphatase kappa; RAGE: Renal antigen; RCC: Renal cell carcinoma; RU1, 2: Renal ubiquitous 1, 2; SAGE: Sarcoma antigen; SART-1, -2, -3: Squamous antigen rejecting tumour 1, 2, 3; SCC: Squamous cell carcinoma; SSX-2: Synovial sarcoma, X breakpoint 2; Survivin-2B: Intron 2-retaining survivin; SYT/SSX: Synaptotagmin I / synovial sarcoma, X fusion protein; TAA: Tumour- associated antigen; TEL/AML1: Translocation Ets-family leukaemia/acute myeloid leukaemia 1; TGF0RII: Transforming growth factor 0 receptor 2; TPI: Triosephosphate isomerase; TRAG-3: Taxol resistant associated protein 3; TRG: Testin-related gene; TRP- 1: Tyrosinase-related protein 1, or gp75; TRP-2: Tyrosinase-related protein 2; TRP- 2/INT2: TRP-2/intron 2; TRP-2/6b: TRP-2/novel exon 6b; TSTA: Tumour-specific transplantation antigens; WT1: Wilms’ tumour gene (Novellino et al., 2004). Antigens may be derived from viruses, bacteria, fungi or eukaryotic parasites including Acinetobacter baumannii; Actinomyces israelii, Actinomyces gerencseriae and Propionibacterium propionicus; Trypanosoma brucei; HIV (Human immunodeficiency virus); Entamoeba histolytica,' Anaplasma spp.; Angiostrongylus,' Anisakis,' Bacillus anthracis,' Arcanobacterium haemolyticum,' Junin virus; Ascaris lumbricoides; Aspergillus spp.; Astroviridae spp.; Babesia spp.; Bacillus cereus; Bacteroides spp.; Balantidium coli; Bartonella,' Baylisascaris spp.; BK virus; Piedr aia hortae,' Blastocystis spp.; Blastomyces dermatitidis,' Machupo virus; Clostridium botulinum (botulinum toxin); Sabia virus; Brucella spp.; Yersinia pestis,' Burkholderia cepacia, Burkholderia spp.; Mycobacterium ulcerans,' Caliciviridae spp.; Campylobacter spp.; Candida albicans and other Candida spp.; Intestinal disease by Capillaria philippinensis, hepatic disease by Capillaria hepatica and pulmonary disease by Capillaria aerophila,' Bartonella bacilliformis,' Bartonella henselae,' Group A Streptococcus and Staphylococcus,' Trypanosoma cruzi; Haemophilus ducreyi,' Varicella zoster virus (VZV); Alphavirus; Chlamydia trachomatis,' Chlamydophila pneumoniae,' Vibrio cholerae,' Fonsecaea pedrosoi,' Batrachochytrium dendrabatidis,' Clonorchis sinensis; Clostridium difficile; Coccidioides immitis and Coccidioides posadasii; Colorado tick fever virus (CTFV); rhinoviruses and coronaviruses; Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2); Crimean- Congo haemorrhagic fever virus; Cryptococcus neoformans; Cryptosporidium spp.;
Ancylostoma braziliense; Cyclospora cayetanensis; Taenia solium; Cytomegalovirus; Dengue viruses (DEN-1, DEN-2, DEN-3 and DEN-4) - Flaviviruses; Desmodesmus armatus; Dientamoeba fragilis; Corynebacterium diphtheriae; Diphyllobothrium; Dracunculus medinensis; Ebolavirus (EBOV); Echinococcus spp.; Ehrlichia spp.; Enterobius vermicularis; Enterococcus spp.; Enterovirus spp.; Rickettsia prowazekii; Parvovirus Bl 9; Human herpesvirus 6 (HHV-6) and human herpesvirus 7 (HHV-7); Fasciola hepatica and Fasciola gigantica; Fasciolopsis buski; Filarioidea superfamily; Clostridium perfringens; Fusobacterium spp.; Clostridium perfringens; Clostridium spp.; Geotrichum candidum; Giardia lamblia; Burkholderia mallei; Gnathostoma spinigerum and Gnathostoma hispidum; Neisseria gonorrhoeae; Klebsiella granulomatis;
Streptococcus pyogenes; Streptococcus agalactiae; Haemophilus influenzae; Enteroviruses Coxsackie A virus and enterovirus 71 (EV71); Sin Nombre virus; Heartland virus; Helicobacter pylori,' Escherichia coli ETEC, O157:H7, 0111 and O104:H4; Bunyaviridae spp.; Hendra virus; Hepatitis A virus; Hepatitis B virus; Hepatitis C virus; Hepatitis D Virus; Hepatitis E virus; Herpes simplex virus 1 and 2 (HSV-1 and HSV-2); Histoplasma capsulation,' Ancylostoma duodenale and Necator americanus,' Human bocavirus (HBoV); Ehrlichia ewingii,' Anaplasma phagocytophilum,' Human metapneumovirus (hMPV); Ehrlichia chaffeensis,' Human papillomaviruses; Human parainfluenza viruses (HPIV); Hymenolepis nana and Hymenolepis diminuta:, Epstein-Barr virus (EBV);
Orthomyxoviridae spp.; Isospora belli,' Kingella kingae,' Lassa virus; Legionella pneumophila,' Legionella pneumophila,' Leishmania spp.; Mycobacterium leprae and Mycobacterium lepromatosis,' Leptospira spp.; Listeria monocytogenes,' Borrelia burgdorferi, Borrelia garinii, and Borrelia afzelii,' Wuchereria bancrofti and Brugia malayi,' Lymphocytic choriomeningitis virus (LCMV); Plasmodium spp.; Marburg virus; Measles virus; Middle East respiratory syndrome (MERS) coronavirus; Burkholderia pseudomallei,' Neisseria meningitidis,' Metagonimus yokagawai; Microsporidia phylum; Molluscum contagiosum virus (MCV); Monkeypox virus; Mumps virus; Rickettsia typhi,' Mycoplasma pneumoniae,' Mycoplasma genitalium,' Chlamydia trachomatis,' Neisseria gonorrhoeae,' Nipah virus; Norovirus; Nocardia asteroides and Nocardia spp.;
Onchocerca volvulus,' Opisthorchis viverrini and Opisthorchis felineus,' Paracoccidioides brasiliensis,' Paragonimus westermani and other Paragonimus spp.; Pasteurella spp.; Pediculus humanus capitis,' Pediculus humanus corporis,' Pthirus pubis,' Bordetella pertussis,' Yersinia pestis,' Streptococcus pneumoniae,' Pneumocystis jirovecii,' Poliovirus; Prevotella spp.; Naegleria fowleri,' JC virus; Chlamydophila psittaci,' Coxiella burnetii,' Rabies virus; Borrelia hermsii, Borrelia recurrentis, Borrelia spp.; Respiratory syncytial virus (RSV); Rhinosporidium seeberi,' Rhinovirus; Rickettsia spp.; Rickettsia akari,' Rift Valley fever virus; Rickettsia rickettsii,' Rotavirus; Rubella virus; Salmonella spp.; SARS coronavirus; Sarcoptes scabiei,' Group A Streptococcus spp.; Schistosoma spp.; Shigella spp.; Varicella zoster virus (VZV); Variola major or Variola minor; Sporothrix schenckii,' Staphylococcus spp.; Strongyloides stercoralis,' Measles virus; Treponema pallidum,'
Taenia spp.; Clostridium tetani,' Trichophyton spp.; Trichophyton tonsurans,' Trichophyton spp.; Epidermophyton floccosum, Trichophyton rubrum, and Trichophyton mentagrophytes,' Trichophyton rubrum,' Hortaea werneckii,' Malassezia spp.; Streptococcus pyogenes,' Toxocara canis, Toxocara cati; Toxoplasma gondii,' Trichinella spiralis,' Trichomonas vaginalis,' Trichuris trichiura,' Mycobacterium tuberculosis,' Francisella tularensis,' Salmonella enterica serovar Typhi, Paratyphi, and Typhimurium; Ureaplasma urealyticum,' Coccidioides immitis, Coccidioides posadasii,' Venezuelan equine encephalitis virus; Guanarito virus; Vibrio vulnificus,' Vibrio parahaemolyticus,' West Nile virus; Trichosporon beigelii,' Yersinia pseudotuberculosis,' Yersinia enterocolitica,' Yellow fever virus; Zeaspora fungus; Zika virus.
The antigen or antigens genes on the DNA vaccine polynucleotide of the invention may be co-expressed or fused with an immunogenic protein that acts as an adjuvant to increase the level of the immune response. Examples of such proteins include the lethal toxin subunit B (LT-B) from pathogenic strains of E. coli, the Vibrio cholerae toxin subunit B (CT-B) and the Clostridium tetani tetanus toxin (spasmogenic toxin); these may contain mutations to reduce toxicity. Alternatively, the DNA vaccine plasmid may be co-administered with one of these adjuvants or with an adjuvant including aluminium-based mineral salts (aluminium phosphate, aluminium hydroxide); Calcium phosphate; MF59 (submicron oil- in-water emulsion); Monophosphoryl lipid A (MPL: AS03, AS04).
RNA therapies
In the other aspects, the invention is designed to express RNAs to achieve a therapeutic effect following the translation of those RNAs into proteins and as CRISPR guide RNAs. In a tenth aspect of the invention the expressed RNA itself is the therapeutic product. The encoded RNA(s) may be single-stranded antisense RNAs including antisense oligonucleotides (ASOs) or double-stranded small interfering RNAs (siRNAs), designed to alter the expression of a host chromosomal gene to achieve a desired therapeutic effect (Zhu et al., 2022). Antisense RNAs bind to the target mRNA by Watson-Crick basepairing and either downregulate expression by steric blocking to reduce or prevent translation, or induce exon skipping: changing an out-of-frame mutation into an in-frame mutation for therapeutic applications such as a small minority of cases of Duchenne muscular dystrophy (Aartsma-Rus et al. 2007). Host mRNAs can be degraded to achieve a therapeutic effect by RNA interference (RNAi) using siRNA or hairpin microRNA (miRNA). miRNA is first processed sequentially by the RNase III enzymes DICER1 and DROSHA to generate a double-stranded RNA analogous to siRNA. The mechanism of action is via the Argonaute 2 protein (AG02, part of the RNA-induced silencing complex RISC), whereby the double-stranded siRNA associates with AG02, one strand (the passenger strand) is removed, and the remaining antisense guide strand directs the RISC complex to the corresponding mRNA target which is then cleaved by AG02 (Roberts et al., 2020).
ASOs and siRNAs are usually chemically modified, often by the introduction of phosphorothioate (PS) linkages in place of the phosphodiester bond to reduce their degradation by ribonucleases (Roberts et al., 2020), but the nuclear location of a Gentrafix plasmid and its ability to continually express RNA would enable unmodified RNA to produce a therapeutic effect.
Recombinant protein production
It is known in the art that cell lines derived from multicellular eukaryotes are used to produce recombinant proteins in vitro by transfection using plasmids with the gene or genes encoding the proteins - this represents an eleventh aspect of the invention. Classes of recombinant proteins include antibodies, antibody fragments, antigens, enzymes, and hormones. Mammalian cell lines commonly used for recombinant protein production include those from rodents: CHO (Chinese Hamster Ovary) and NSO (mouse myeloma), and from humans: HEK (human embryonic kidney), PER.C6 (human retinoblast), and CAP-T (primary human amniocytes) (Bandaranayake and Almo, 2014). The transfection of adherent cell lines with DNA typically requires a high ratio of DNA to cells and frequently does not result in transgene expression in most of the cells in the culture. The invention will modify most of the cells, leading to a higher yield of recombinant protein within a pool of transfected cells (transient gene expression), and a greater number of cells expressing at a high level for subsequent clone selection. Germ line modification and gene drives
In a further embodiment of the invention, a polynucleotide of the invention is designed to modify cells of the germ line of an animal by modification of the sperm-producing cells (spermatogonia) or oocytes, using a constitutive or tissue-specific promoter to express the components of the polynucleotide of the invention. This may be used for co-expression of a gene or genes encoding a therapeutic compound. Alternatively, gene editing functions (e.g. CRISPR) may be expressed that will enable the modification to be passed on to the offspring of the gene-edited animal. This may be used to correct a genetic mutation to prevent it being transferred to progeny, or to introduce a beneficial trait.
Another aspect of germ line modification is the introduction of a ‘gene drive’ genetic cassette that will subsequently be spread to the majority, and potentially all, of the progeny (Wedell et al., 2019). The gene drive may be based on a natural selfish genetic element such as transmission distorters that become over-represented in eggs or sperm by targeting gametogenesis. Alternatively, synthetic meiotic drivers may be used which are based on CRISPR-mediated gene editing to copy the gene drive onto the homologous chromosome, such that it is rapidly transmitted through the resultant population. These may be used to control disease vectors such as mosquitoes, or invasive mammals that are adversely affecting native populations, for example by skewing the sex ratio to produce only males. This may be achieved in rodent populations by relocating the Sry sex determination gene from the X-chromosome to an autosome.
Pharmaceutical compositions
In a further aspect of the invention, there is provided a pharmaceutical composition comprising the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, and a pharmaceutically acceptable excipient.
The pharmaceutically acceptable excipients may comprise carriers, diluents and/or other medicinal agents, pharmaceutical agents or adjuvants, etc. Optionally, the pharmaceutically acceptable excipients comprise saline solution. Optionally, the pharmaceutically acceptable excipients comprise human serum albumin.
Typical "pharmaceutically acceptable excipients ’ include any carrier that does not itself induce a reaction harmful to the individual receiving the composition. Pharmaceutically acceptable excipients may also contain diluents, such as water, saline, glycerol, etc.
Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present. Typical pharmaceutical excipients may include one of more of tris buffer, histidine, sodium chloride and sodium phosphate.
Methods of treatment
The invention further provides the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, for use in a method of treatment/method of treating a disease. Optionally, the method of treatment comprises administering an effective amount of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, to a patient.
The invention further provides a method of treatment comprising administering an effective amount of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, to a patient.
The invention further provides use of the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention, in the manufacture of a medicament for use in a method of treatment/method of treating a disease. For the avoidance of doubt, the terms “method of treating” and “method of treating a disease are used interchangeably herein. Optionally, the method of treatment/method of treating a disease comprises administering an effective amount of the composition or the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention to a patient. The term “treating” includes both therapeutic treatment and prophylactic or preventative treatment, wherein the object is to prevent or lessen infection. For example, treating may include directly affecting or curing, suppressing, inhibiting, preventing, reducing the severity of, delaying the onset of, reducing symptoms associated with, for example, infection, or a combination thereof. “Preventing” may refer, inter alia, to delaying the onset of symptoms, preventing relapse of a disease, and the like. “Treating” may also include “suppressing” or “inhibiting” an infection or illness, for example reducing severity, number, incidence or latency of symptoms, ameliorating symptoms, reducing secondary symptoms, reducing secondary infections, prolonging patient survival, or combinations thereof.
A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as raising the level of a transgene in a subject (so as to lead to functional trans gene production at a level sufficient to ameliorate the symptoms of a disease or disorder).
In a preferred embodiment of the invention, the diseases and disorders to be treated are those discussed herein.
Methods of administration
In a preferred embodiment of the invention, the polynucleotide of the invention, or the plasmid embodiment of the polynucleotide of the invention, or the pharmaceutical composition of the invention are administered by injection, micro injection, inhalation, jet injection, ingestion, liposome, lipid nanoparticle, virus, virus-like particle or microcarrier mediated delivery to a patient in need thereof.
Methods of manufacture
In a further aspect of the invention, host cells comprising the polynucleotide of the invention or the or the plasmid embodiment of the polynucleotide of the invention, are provided. Suitable host cells, such as Escherichia coli, are described herein. In a preferred embodiment of the invention the Escherichia coli cell expresses the genes repA, telN, sopA and sopB from bacteriophage N15.
In a preferred embodiment of the invention, the SopA expressed by the polynucleotide sequence comprises:
(i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 200, at least 250, at least 275, at least 300, at least 325, at least 350, or at least 375 amino acids of SEQ ID NO: 6; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 6; or
(iii) SEQ ID NO: 6.
In a preferred embodiment of the invention, the sopA polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, or at least 1100 nucleotides of SEQ ID NO: 7; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7; or
(iii) SEQ ID NO: 7.
Said sequence variants retain the ability to function as a SopA protein when expressed. Suitable assays to determine SopA protein activity are known to the skilled person and include culturing the E. coli strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
In a preferred embodiment of the invention, the SopB expressed by the polynucleotide sequence comprises: (i) an amino acid sequence that is at least at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least at least 200, at least 250, at least 275, at least 300, at least 325, or at least 340 amino acids of SEQ ID NO: 8; or
(ii) an amino acid sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 8; or
(iii) SEQ ID NO: 8.
In a preferred embodiment of the invention, the sopB polynucleotide sequence comprises;
(i) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to a contiguous fragment of at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides of SEQ ID NO: 9; or
(ii) a polynucleotide sequence that is at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 9; or
(iii) SEQ ID NO: 9.
Said sequence variants retain the ability to function as a SopB protein when expressed. Suitable assays to determine SopB protein activity are known to the skilled person and include culturing the in vitro strain replicating the plasmid over multiple generations, by inoculating into a flask of nutrient broth at low density, growing to high density and repeating over several days. Comparing plasmid preparations from strains on each day by agarose gel electrophoresis or quantitative PCR will enable any plasmid loss to be detected.
In a further aspect of the invention a method of producing the plasmid embodiment of the invention is provided, comprising culturing a host cell as defined herein, lysing the cell and purifying the plasmid or plasmids from the cell lysate.
In a further aspect of the invention, a eukaryotic cell comprising the polynucleotide of the invention, or the plasmid embodiment of the invention, is provided. Examples
Example 1
Plasmids pBITTdtA (Figure 5A) and pBITTraB2 (Figure 5B) were constructed to express the pores TdtA and TraB respectively to determine if they are membrane-associated in human cells.
To generate pBITTdtA, the pBITREPB plasmid (see Example 4) was cleaved with Spel and Xbal and ligated with tdtA cistron flanked with Spel and Xbal restriction sites. To generate pBITTraB the traB cistron was inserted into Spel and Xbal sites of pBITREPB plasmid. Then pBITTraB2 was created by adding a FLAG-tag generated by PCR to the 3’ end of the traB cistron by ligating BamHI-Xbal into pBITTraB.
Human embryonic kidney cells (HEK 293) were grown on glass cover slips in standard six-well plates and to a confluency reached 70-80%, and were transfected with 1 pg of pBITTraB2 or pBITTdtA using TurboFect reagent (Life Technologies, UK) accordingly to manufacturer’s protocol. As a negative control we used the pMCPK plasmid expressing mCherry but lacking the pore cistron. After 72 hours the cells were incubated with 200 μg/ml wheat germ agglutinin (WGA) conjugated with Alexa Fluor 647 (Invitrogen) dissolved in DMEM with 10% FBS medium for 30 minutes at 37°C, 5% CO2, followed by three washes with PBS. Next, cells were fixed with 4% paraformaldehyde (PFA; Merck, UK) in phosphate-buffered saline (PBS) for 10 minutes at room-temperature and washed thrice with PBS. Cells were permeabilised by incubating for 15 minutes in PBS containing 0.05% Triton X-100 (PBST), then blocked for 1 hour in PBST with 10% FBS. The primary antibody: mouse anti-FLAG (Merck, UK), was applied in PBST- 10% FBS at 1:1000 dilution and incubated for 1 hour at ambient temperature. The unbound antibody was removed using three washes with PBST and the secondary (goat anti-mouse Alexa Fluor 488; Abeam, UK) antibody was applied at 1:1000 dilution for 1 hour at ambient temperature. The unbound antibody was removed with three washes with PBST, the first wash containing 0.1 μg/ml DAPI (Life Technologies, UK) and the coverslips were mounted with FluorSave reagent (EMD Millipore, USA), left in the dark to dry and photographed at 63x magnification. The microphotographs in Figure 5 demonstrate the colocalisation of FLAG-tagged pore membrane protein (green, Figure 5C - TdtA, and Figure 5D- TraB) with cell-membrane stain for WGA (red).
Example 2
An experiment was performed to determine if a plasmid possessing the membrane pore TdtA was able to transfer plasmid DNA to adjacent cells, compared to a control plasmid pMCPK (Figure 10B) lacking the pore.
HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM- GlutaMAX; Life Technologies, UK) and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six-well plates until they reach the density of 70-80%. Cells were transfected with 1 pg of each mCherry-expressing plasmid DNA: pMCPK (negative control) or pBITTdtA (expressing the TdtA pore). After 24 hours the cells were transfected with 0.5 pg of pdClover2-Nl (Figure 11 A) (Addgene, USA) expressing the green fluorescent protein Clover2. A further 48 hours later the cells were rinsed with PBS buffer and fixed for 10 minutes with 4% PFA, then wash thrice for 5 minutes with PBS to remove the PFA. Cells were then permeabilised with PBS containing 0.05% Triton X-100 for 15 minutes and blocked with PBS, 0.05% Triton X-100 and 10% FBS for an hour.
Cells were incubated in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 rabbit anti-mCherry antibody (Abeam, UK) for 1 hour at room temperature and then wash thrice with PBS containing 0.05% Triton X-100 for 10 minutes. Cells were incubated for 1 hour in in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 goat anti-rabbit antibody Alexa Fluor 594 (Abeam, UK) for 1 hour (protected from light). Coverslips were mounted using FluorSave Reagent (Merck, UK) and left in the dark to dry.
The total number of cells expressing both mCherry and Clover2 were recorded, and these were equivalent for the two mCherry plasmids at approximately 25% of total cells, indicating an equivalent transfection efficiency (Figure 6A). The number of Clover2 cells (green) adjacent to dual-fluorescent cells was then recorded, and there was a statistically significant (T-test p=0.049) excess of these for pBITTdtA compared to pMCPK. This indicates secretion of pdClover2-Nl from cells containing pBITTdtA.
Example 3
An experiment was performed to test the specificity of export via the TraB pore using plasmids with and without the clt locus required for secretion of DNA by TraB.
The plasmid pCMV-Clover2-CLT (Figure 11B) was constructed by synthesising the clt locus (SED ID NO: 26; ThermoFisher, Germany) and cloning it into the single Asel site of pdClover2-Nl.
HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM- GlutaMAX; Life Technologies, UK), and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six-well plates until they reach the density of 70-80%. Cells were first transfected with 1 pg pBITTraB2, expressing mCherry and the TraB pore. After 24 hours the cells were transfected with 0.5 pg of plasmids expressing the green fluorescent protein Clover2: either the negative control pdClover2-Nl, or pCMV-Clover2-CLT which additionally contains the clt locus. A further 48 hours later the cells were rinsed with PBS buffer and fixed for 10 minutes with 4% PFA, then wash thrice for 5 minutes with PBS to remove the PFA. Cells were then permeabilised with PBS containing 0.05% Triton X-100 for 15 minutes and blocked with PBS, 0.05% Triton X-100 and 10% FBS for an hour.
Cells were incubated in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 rabbit anti-mCherry antibody (Abeam, UK) for 1 hour at room temperature and then wash thrice with PBS containing 0.05% Triton X-100 for 10 minutes. Cells were incubated for 1 hour in in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 goat anti-rabbit antibody Alexa Fluor 594 (Abeam, UK) for 1 hour (protected from light). Coverslips were mounted using FluorSave Reagent (Milipore EMD, USA) and left to dry.
The total number of cells containing both pBITTraB2 and the Clover2 plasmids was recorded, and pCMV-Clover2-CLT was found in a greater proportion of dual-fluorescing cells than pdClover2-Nl (T-test p=0.029) - one explanation for this would be import of the clt-containing plasmid from adjacent cells (Figure 7A). The number of Clover2 cells (green) adjacent to dual-fluorescent cells was then recorded, and there was a statistically significant (p=0.0046) excess of these for pCMV-Clover2-CLT compared to pdClover2- N 1 , potentially representing the preferential export of the former from cells containing the TraB pore (Figure 7B).
Example 4
Western blots were performed to detect the expression of the two components of the N15 replication system: RepA and TelN, and the pores TraB and TdtA, in human cell culture.
Two synthetised gene cassettes were generated, one in plasmid pET5R containing EF-la promoter located upstream of telN and 5 ’end of rep A gene separated by P2A peptide, and the other in p3RTmP containing the 3’ end of repA followed by an IRES (Internal Ribosomal Entry Site) element and traB. These were digested with Hindlll and Ndel (all restriction enzymes from NEB, UK) and ligated to create pBITREPB. pBITREPB was used to generate pBITREPA by replacing the traB cistron with synthesised tdtA with a C- terminal FLAG tag as an Nhel-Xbal fragment. As the IRES did not enable expression of either pore cistron, both pBITREPA and pBITREPB were further modified by replacing the IRES with an E2A peptide by synthesising a region encoding the C-terminus of repA, E2A and the N-terminal region of the pore cistrons, as a HindIII-Bsu36I fragment for tdtA and a Hindlll-PpuMI fragment for traB,' these were ligated into pBITREPA and pBITREPB cut with the same to create plasmids pBITREPA2 (Figure 8A) and pBITREPB2 (Figure 8B).
Purified plasmids were transfected into low passage number HEK 293 cells and the efficiency of transfection was verified visually under the microscope 72 hours posttransfection to detect mCherry fluorescence. Cells were then rinsed with PBS, dissolved on ice in radioimmunoprecipitation assay (RIP A) buffer and then heat denatured (100°C for 5 minutes) and reduced with dithiothreitol (DTT) prior to size-separation in sodium dodecyl sulphate (SDS)-acrylamide gel. After the electrophoresis the proteins were electro-transferred onto nitrocellulose and blocked with 3% skimmed powder milk dissolved in tris-buffered saline with 0.1% Tween 20 detergent (TBST) for 1 hour and followed by immunoblotting with the following antibodies at dilutions of 1:1000: mouse anti-mCherry (Abeam, UK); anti-2A peptide (Merck, UK), anti-V5 tag (Abeam, UK) and anti-FLAG (Abeam, UK) for 1 hour at ambient temperature. Next, membranes were washed thrice with TBST for 10 minutes and the secondary antibody applied for 1 hour: goat-anti mouse conjugated with alkaline phosphatase (Abeam, UK) diluted 1:1000 in 3% milk in TBST. The signal was developed by applying Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega, UK). Developed membranes were photographed and protein sizes were verified by reference to the Prestained Protein Ladder Broad molecular weight (10-245 kDa) (Abeam, UK).
The results in Figure 9 demonstrate that RepA, TelN, TraB and TdtA are expressed in human cell lines.
Example 5
An experiment was conducted to determine if a plasmid possessing the components of N15 replication functions and a DNA-secreting pore gene was able to transfer to adjacent cells, compared to a control plasmid lacking the pore.
HEK 293 cells were grown with Dulbecco's Modified Eagle Medium (DMEM-GlutaMAX; Life Technologies, UK), and 10% Fetal Bovine Serum (FBS; Merck, UK) on glass coverslips in six -well plates until they reach the density of 70-80%. Cells were transfected with 1 pg of the Gentrafix plasmids pBITREPA2 (TelN, RepA and TdtA pore) and pBITREPB2 (TelN, RepA and TraB pore), plus the negative control plasmid pMCPK (no Gentrafix components); all plasmids also express the red fluorescent reporter mCherry. After 72 hours the cells were rinsed with PBS buffer and fixed for 10 minutes with 4% PF A, then wash thrice for 5 minutes with PBS to remove the PFA. Cells were then permeabilised with PBS containing 0.05% Triton X-100 for 15 minutes and blocked with PBS, 0.05% Triton X-100 and 10% FBS for an hour. Cells were incubated in PBS containing 0.05% Triton X-100 and 10% FBS with 1:1000 rabbit anti-mCherry antibody (Abeam, UK) for 1 hour at room temperature and then wash thrice with PBS containing 0.05% Triton X-100 for 10 minutes. Cells were incubated for 1 hour in in PBS containing 0.05% Triton X-100 and 10% FBS with 1 : 1000 goat anti-rabbit antibody Alexa Fluor 594 (Abeam, UK) for 1 hour (protected from light). Coverslips were mounted using FluorSave Reagent (Milipore EMD, USA) and left to dry.
Micrographs representing 30 different fields of view were taken randomly and analysed for the total number of red (mCherry-expressing) cells and the number of clusters per image (Figure 12A-D). Figure 12E shows a representative image with clusters indicated by arrows.
Compared to the negative control plasmid, there were a greater total number of red cells seen for the Gentrafix plasmids (Figure 12A; T-test for pBITREPA2 p=3.44x10-8; T-test for pBITREPB2 p=2.64x10-14), which also formed a greater total number of clusters (Figure 12B; T-test for pBITREPA2 p=3.51x10-10; T-test for pBITREPB2 p=3.34x10-19). A significantly higher number (Figure 12C; T-test for pBITREPA2 p=5.06x10-14; T-test for pBITREPB2 p=3.54x10-16) and proportion (Figure 12D; T-test for pBITREPA2 p=1.30x10-13; T-test for pBITREPB2 p=5.21x10-21) of the total Gentrafix mCherry cells were present in clusters than for the negative control. Of the two plasmids, the TraB poreexpressing pBITREPB2 produced more transfected cells and cell clusters than the TdtA pore-expressing pBITREPA2.
The greater incidence of clusters where the DNA-secreting pores are present is supporting evidence for intercellular DNA transfer by the Gentrafix platform. The smaller control plasmid would be expected to represent a higher proportion of transfected cells as its copy number per unit mass is higher, and smaller plasmids are taken up more efficiently by cells, yet the Gentrafix plasmids are more abundant.
Example 6
An experiment was conducted to detect the direct transfer of a plasmid from one cell line to another.
Low density HEK 293 cells were transfected with pBITREP (Figure 10 A), pBITREPA2 (Figure 8A) and pBITREPB2 (Figure 8B). After 24 hours the plasmid-containing medium was removed, cells were washed twice and fresh medium containing DNase I was applied. After a further 24 hours the cell line HEK293 GFP (amsbio, UK), which contains a chromosomally integrated green fluorescent protein (GFP) gene, was added to each culture and incubated for 72 hours.
The mixed cultures were fixed with 4% PFA in PBS, blocked with 10% FBS and primary antibodies (mouse anti-GFP and rabbit anti-mCherry, 1:500) were applied for 24 hours at 4°C followed by secondary antibody application (goat anti-mouse AF488 and goat antirabbit AF594). Images were obtained using a Kern & Sohn OCM 167 fluorescence microscope. White arrows indicate cells expressing mCherry only, while hashed arrows show cells expressing GFP co-expressed with mCherry - the latter being the result of intercellular gene transfer and only seen with pBITREPA2 and pBITREPB2, not with pBITREP which lacks a pore gene (Figure 13).
Example 7
An experiment was conducted to detect the direct transfer of a plasmid from one cell line to another across the junction between the two cell lines.
A highly confluent adherent culture of MDCK-GFP cells (Innoprot, Spain), which are Madin-Darby canine kidney cells constitutively expressing GFP from a chromosomally integrated gene, was trypsinised and cells were washed with fresh DMEM/FBS medium and suspended in 1 ml of fresh DMEM/FBS medium. To each well of a 6-well plate, 20 pl of cell suspension was applied then cells were incubated overnight (37 ■C, 5% CO2) until they reattached. Next, MDCK-GFP cells were transfected with 1 pg of pMCPK and pBITREPB2 plasmids, and the following day medium was replaced with fresh DMEM/FBS containing 5 units per ml of DNasel for two hours. Transfected MDCK-GFP cells were then overlayed with non-fluorescent MDCK cells (UKHSA, UK). After MDCK cells reattached, 3 ml of fresh DMEM/FBS was added and cells were incubated for a further 48 hours. Cells were then fixed with 4% PFA, permeabilised and treated with anti- mCherry antibodies. The images were taken using a Kern & Sohne OCM 167 fluorescence microscope. The negative control pMCPK plasmid remained in the originally transfected MDCK-GFP cells (all red cells are also green), whereas the Gentrafix plasmid pBITREPB2 disseminated into the adjacent MDCK cells (cells that are seen in the merged but not GFP micrograph) in Figure 14.
Example 8
An experiment was performed to determine which components of the TraB-based Gentrafix system are essential (rep A, telN, traB and the clt locus) by constructing a luciferase-expressing plasmid with these components, and further plasmids omitting one or more of each component.
The firefly luciferase gene was cloned into the negative control plasmids pMCPK and pBITREP, and Gentrafix plasmid pBITREPB2. This was achieved by removing the mCherry-puromycin resistance gene cassette by restriction enzyme digestion with BstBI and Avril, followed by ligation of a de novo synthesised firefly luciferase cistron flanked by BstBI and Avril restriction sites. The new plasmids were pLUCK (no Gentrafix genes), pLUCKREP (telN and rep A) and pLUCKB (telN, repA, traB, clt).
Next, pLUCKB was used to generate plasmids lacking Gentrafix components. To generate a plasmid lacking the clt locus, pLUCKB was cut using Avril and BstBI, blunt-ended using the NEB Quick Blunting Kit (NEB, UK) and self-ligated to produce pLUCKCB (telN, rep A, traB).
To create a plasmid without the N15 replication components repA and telN (i.e. containing traB and clt), pLUCKB was cut using Spel and Mrel to remove the 5’ portion of traB plus the repA and telN cistrons, and a plasmid pBITTraBclt containing traB was cut with the same enzymes to release the N-terminus of traB which was ligated to restore traB and produce plasmid pLUCKOB (traB, clt).
A plasmid lacking repA was constructed by cutting pLUCKB with Mrel which removed the 3 ’ end of telN, all of repA and the 5 ’ end of traB - into this was ligated a synthesised Mrel-cut fragment ‘NoRepA’ restoring telN and traB cistrons with an intervening P2A peptide sequence to produce plasmid pLUCKTB (telN, traB, clt).
A /e/,V-dcficicnt plasmid was created by cutting pLUCKB with Spel and Sbfl which removed telN and the 5' end of rep A. Subsequently, a PCR product was generated using pLUCKB as a template, using primers NoTelNRepA (ATAGGACTAGTGCCGCCACCATGACCTTACAAGAATTCTACGCGG) and NoTelNR (GCGCCCCCTGCAGGTCGCCA). This PCR product, which contained the 5' end of repA, was digested with Spel and Sbfl and ligated into pLUCKB. Luciferase plasmids are illustrated in Figure 15.
For the luciferase assay, HEK 293 cells were cultured in white, clear-bottom 96-well plates until 50% confluency at 37°C and 5% of CO2 in the tissue culture incubator in sets of four plates. Subsequently, the cells were transfected with equal copy numbers of each plasmid, equivalent to 200 ng of pLUCKB. Over the following four days, the cell medium in one plate per day was replaced in each well with fresh medium supplemented with 150 μg/ml of luciferin, and luminescence was measured using a GloMax microplate reader. The signal integration time was empirically set at 10 seconds on Day 0, six hours post- transfection. Data obtained over subsequent days were first normalised to the luminescence of untransfected control cells, and then to the luminescence observed on Day 0 for each plasmid. Each plasmid was analysed in five biological replicates (Figure 16).
The plasmids possessing both repA and traB plus clt, namely pLUCKB (telN, repA, traB, clt) and pLUCKRB (repA, traB, clt), exhibited a progressively more pronounced luminescence signal throughout the experiment, correlating with replication and intercellular transmission and demonstrating the importance of the combination of a DNA replication component and a DNA-secreting pore. In contrast, the four plasmids lacking repA and traB exhibited a minimal increase in fluorescence over the course of the experiment. The relative effect of the clt locus can be seen by comparing pLUCKB (telN, repA, traB, clt) with pLUCKCB (telN, repA, traB)-. the latter plasmid, lacking the clt locus, produced a signal that was significantly lower than pLUCKB but higher than the plasmids lacking repA and traB, indicating that the clt locus enhances intercellular transmission but is not essential in achieving this. The reduction in cell viability in all cultures resulted in a decrease in all fluorescence signals by Day 5.
Sequence Listing
Figure imgf000065_0001
Figure imgf000066_0001
Figure imgf000067_0001
Figure imgf000068_0001
Figure imgf000069_0001
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0001
Figure imgf000075_0001
Figure imgf000076_0001
Figure imgf000077_0001
Figure imgf000078_0001
Figure imgf000079_0001
Figure imgf000080_0001
Figure imgf000081_0001
Figure imgf000082_0001
Figure imgf000083_0001
Figure imgf000084_0001
Figure imgf000085_0001
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
Figure imgf000092_0001
Figure imgf000093_0001
Figure imgf000094_0001
Figure imgf000095_0001
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000098_0001
Further embodiments of the invention
1. A polynucleotide comprising: a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
2. The polynucleotide of embodiment 1, comprising: a) an origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and d) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
3. The polynucleotide of embodiment 2, wherein the origin of replication is from bacteriophage N 15.
4. The polynucleotide of any one of the preceding embodiments, wherein the DNA- dependent DNA polymerase is from bacteriophage N15. 5. The polynucleotide of any one of the preceding embodiments, wherein the DNA- dependent DNA polymerase is encoded by the repA gene.
6. The polynucleotide of any one of the preceding embodiments, wherein the DNA- dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 1, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 that retains the ability to function as a DNA-dependent DNA polymerase.
7. The polynucleotide of any one of the preceding embodiments, wherein the DNA- dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 2, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 2 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
8. The polynucleotide of any one of the preceding embodiments, wherein the protelomerase is TelN from bacteriophage N15.
9. The polynucleotide of any one of the preceding embodiments, wherein the protelomerase expressed by the polynucleotide sequence comprises SEQ ID NO: 3, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 3 that retains the ability to function as a protelomerase.
10. The polynucleotide of any one of the preceding embodiments, wherein the protelomerase polynucleotide sequence comprises SEQ ID NO: 4, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 4 that retains the ability to function as a protelomerase when expressed.
11. The polynucleotide of any one of the preceding embodiments, further comprising a telRL site, optionally wherein the telRL site polynucleotide sequence comprises SEQ ID NO: 5. 12. The polynucleotide of embodiment 1 or embodiment 2, wherein the DNA- dependent DNA polymerase is from bacteriophage Phi29.
13. The polynucleotide of embodiment 12, wherein the DNA-dependent DNA polymerase is encoded by gene 2.
14. The polynucleotide of embodiment 12 or embodiment 13, wherein the DNA- dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 10, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 that retains the ability to function as a DNA-dependent DNA polymerase.
15. The polynucleotide of embodiment 14, wherein the DNA-dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 11, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 11 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
16. The polynucleotide of any one of embodiments 12 to 15, wherein the terminal protein and DNA-binding protein are terminal protein TP and DNA-binding proteins p5 and p6 from bacteriophages of the Phi29 group of Bacillus subtilis.
17. The polynucleotide of any one of embodiments 12 to 16, wherein the terminal protein expressed by the polynucleotide sequence comprises SEQ ID NO: 12, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 12 that retains the ability to function as a terminal protein.
18. The polynucleotide of embodiment 17, wherein the terminal protein polynucleotide sequence comprises SEQ ID NO: 13, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 13 that retains the ability to function as a terminal protein when expressed.
19. The polynucleotide of any one of embodiments 16 to 18, wherein the DNA-binding proteins p5 and p6 expressed by the polynucleotide sequence comprise SEQ ID NOs: 14 and 16, respectively, or amino acid sequences that are at least 90% identical to SEQ ID NOs: 14 and 16, respectively, that retain the ability to function as DNA-binding proteins.
20. The polynucleotide of any one of embodiments 16 to 19, wherein the DNA-binding proteins p5 and p6 polynucleotide sequences comprise SEQ ID NO: 15 and 17, respectively, or polynucleotide sequences that are at least 90% identical to SEQ ID NO: 15 and 17, respectively, that retain the ability to function as DNA-binding proteins when expressed.
21. The polynucleotide of embodiment 1 or embodiment 2, wherein the DNA- dependent DNA polymerase is from adenovirus.
22. The polynucleotide of embodiment 21, wherein the DNA-dependent DNA polymerase from adenovirus is encoded by the gene E2B.
23. The polynucleotide of embodiment 21 or embodiment 22, wherein the DNA- dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 18, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 18 that retains the ability to function as a DNA-dependent DNA polymerase.
24. The polynucleotide of any one of embodiments 21 to 23, wherein the DNA- dependent DNA polymerase polynucleotide sequence comprises SEQ ID NO: 19, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 19 that retains the ability to function as a DNA-dependent DNA polymerase when expressed.
25. The polynucleotide of any one of embodiments 21 to 24, wherein the terminal protein and DNA-binding protein are terminal protein pTP and DNA-binding protein E2A from adenovirus.
26. The polynucleotide of any one of embodiments 21 to 25, wherein the terminal protein expressed by the polynucleotide sequence comprises SEQ ID NO: 20, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 20 that retains the ability to function as a terminal protein.
27. The polynucleotide of any one of embodiments 21 to 26, wherein the terminal protein polynucleotide sequence comprises SEQ ID NO: 21, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 21 that retains the ability to function as a terminal protein.
28. The polynucleotide of any one of embodiments 21 to 27, wherein the DNA-binding protein expressed by the polynucleotide sequence comprises SEQ ID NO: 22, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 22, that retains the ability to function as a DNA-binding protein when expressed.
29. The polynucleotide of any one of embodiments 21 to 28, wherein the DNA-binding protein polynucleotide sequence comprises SEQ ID NO: 23, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 23 that retains the ability to function as a DNA-binding protein when expressed.
30. The polynucleotide of any one of the preceding embodiments, wherein the pore is TraB from Streptomyces spp..
31. The polynucleotide of embodiment 30, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 24 that retains the ability to function as a pore.
32. The polynucleotide of embodiment 30 or embodiment 31 , wherein the pore polynucleotide sequence comprises SEQ ID NO: 25, or a polynucleotide sequence that is at least 90% sequence identity to SEQ ID NO: 25 that retains the ability to function as a pore when expressed.
33. The polynucleotide of any one of embodiments 30 to 32, further comprising a clt locus. 34. The polynucleotide of embodiment 33, wherein the clt locus comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides, wherein the variant maintains the ability to function as a clt locus.
35. The polynucleotide of any one of embodiments 1 to 29, wherein the pore is TdtA from Thermus spp..
36. The polynucleotide of embodiment 35, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 28 that retains the ability to function as a pore.
37. The polynucleotide of embodiment 35 or embodiment 36, wherein the pore polynucleotide sequence comprises SEQ ID NO: 29, or a polynucleotide sequence that is at least 90% sequence identity to SEQ ID NO: 29 that retains the ability to function as a pore when expressed.
38. The polynucleotide of any one of the preceding embodiments, further comprising a promoter.
39. The polynucleotide of embodiment 38, wherein the promoter is tissue-specific.
40. The polynucleotide of any one of the preceding embodiments, further comprising a payload sequence.
41. The polynucleotide of embodiment 40, wherein the payload sequence is a therapeutic gene, a CRISPR RNA-guided nuclease, optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor. 42. A circular or linear plasmid comprising the polynucleotide as defined in any one of the preceding embodiments.
43. The linear plasmid comprising the polynucleotide as defined in any one of the embodiments 1 to 10, further comprising hairpin ends with the sequences telR and telL.
44. A host cell comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43.
45. The host cell of embodiment 44, wherein the host cell is an Escherichia coli cell.
46. The host cell of embodiment 45, wherein the Escherichia coli cell expresses the genes telN, repA, sop A and sopB from bacteriophage N15.
47. The host cell of embodiment 46, wherein the SopA expressed by the polynucleotide sequence comprises SEQ ID NO: 6, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 6 that retains the ability to function as a SopA protein, and the SopB expressed by the polynucleotide sequence comprises SEQ ID NO: 8, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 8 that retains the ability to function as a SopB protein.
48. The host cell of embodiment 46 or embodiment 47, wherein the sopA polynucleotide sequence comprises SEQ ID NO: 7, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 7 that retains the ability to function as a SopA protein when expressed, and the sopB polynucleotide sequence comprises SEQ ID NO: 9, or a polynucleotide sequence that is at least 90% identical to SEQ ID NO: 9 that retains the ability to function as a SopB protein when expressed.
49. A pharmaceutical composition comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43, and a pharmaceutically acceptable excipient. 50. A method of treatment comprising administration of the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43, or the pharmaceutical composition as defined in embodiment 49, to an individual in need thereof.
51. The method of embodiment 50, wherein the polynucleotide, plasmid or pharmaceutical composition is administered by injection, micro injection, inhalation, jet injection, ingestion, liposome or microcarrier mediated delivery.
52. A method of producing the plasmid of embodiment 42 or embodiment 43, comprising culturing the host cell as defined in any one of embodiments 44 to 48, lysing the cell and purifying the plasmid or plasmids from the cell lysate.
53. A eukaryotic cell comprising the polynucleotide as defined in any one of embodiments 1 to 41, or the plasmid as defined in embodiment 42 or embodiment 43.
54. The polynucleotide of embodiment 1 or embodiment 2, wherein the pore is a type VI secretion system from bacteria such as Agrobacterium spp., Bartonella spp., Bordetella spp., Brucella spp., Escherichia spp., Legionella spp., Helicobacter spp., Neisseria spp., Rickettsia spp., Salmonella spp. and Shigella spp..
55. The polynucleotide of embodiment 1 or embodiment 2, wherein the origin of replication is from a bacterial plasmid such as pMB 1 , ColEI, p 15 A or pSC 101.
56. The polynucleotide of embodiment 1 or embodiment 2, wherein the terminal protein, DNA polymerase, and DNA-binding proteins are from organisms such as the coliphage PRD1, Streptococcus pneumoniae bacteriophage Cp-1, Streptomyces spp., viruses, and archaea, or are from linear plasmids of bacteria, fungi and plants, or are from transposable elements, or are from mitochondrial DNA.
57. The polynucleotide of embodiment 1 or embodiment 2, further comprising: a) the recognition site for a restriction endonuclease, such as a homing endonuclease, that is not present in the target host chromosome; and b) a polynucleotide sequence encoding the cognate restriction endonuclease.
58. A composition comprising; a) a first plasmid comprising the polynucleotide of embodiment 1 or embodiment 2; and b) a second plasmid comprising a telRL site, or telR and telL sites and an origin of replication, or inverted terminal repeats, and clt sequences, wherein the a telRL site, or telR and telL sites and an origin of replication, or inverted terminal repeats, and clt sequences are equivalent to those of the first plasmid.
59. The polynucleotide of embodiment 1 or embodiment 2, further comprising a 2A ‘ribosome-skipping’ peptide sequence.
60. The polynucleotide of embodiment 59, wherein the ‘ribosome-skipping’ peptide comprises SEQ ID NOs: 30, 31, 32 or 33.
References
Patent documents cited in the description
Cranenburgh RM and Leckenby MW, 2010. Self-deleting plasmid, GB201011046A.
Ibrahim MRM, Kanwar N, Oleg R, 2021. Synthetic genome editing system, GB2114453.0.
Non-patent literature cited in the description
Aartsma-Rus A, Janson AA, van Ommen GJ, van Deutekom JC. Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy. BMC Med Genet. 2007 Jul 5;8:43. doi: 10.1186/1471-2350-8-43. PMID: 17612397; PMCID: PMC1931584.
Adli M. The CRISPR tool kit for genome editing and beyond. Nat Commun. 2018 May 15;9(1):1911. doi: 10.1038/s41467-018-04252-2. PMID: 29765029; PMCID: PMC5953931.
Al-Allaf FA, Abduljaleel Z, Athar M, Taher MM, Khan W, Mehmet H, Colakogullari M, Apostolidou S, Bigger B, Waddington S, Coutelle C, Themis M, Al-Ahdal MN, Al- Mohanna FA, Al-Hassnan ZN, Bouazzaoui A. Modifying inter-cistronic sequence significantly enhances IRES dependent second gene expression in bicistronic vector: Construction of optimised cassette for gene therapy of familial hypercholesterolemia. Noncoding RNA Res. 2018 Nov 22;4(1):1-14. doi: 10.1016/j.ncma.2018.11.005. PMID: 30891532; PMCID: PMC6404380.
Amado E, Muth G, Arechaga I, Cabezon E. The FtsK-like motor TraB is a DNA- dependent ATPase that forms higher-order assemblies. J Biol Chem. 2019 Mar 29;294(13):5050-5059. doi: 10.1074/jbc.RAl 19.007459. Epub 2019 Feb 5. PMID: 30723158; PMCID: PMC6442058.
Anguela XM, High KA. Entering the Modem Era of Gene Therapy. Annu Rev Med. 2019 Jan 27;70:273-288. doi: 10.1146/annurev-med-012017-043332. Epub 2018 Nov 26. PMID: 30477394.
Ates I, Rathbone T, Stuart C, Bridges PH, Cottle RN. Delivery Approaches for Therapeutic Genome Editing and Challenges. Genes (Basel). 2020 Sep 23; 11 (10): 1113. doi: 10.3390/genesl 1101113. PMID: 32977396; PMCID: PMC7597956.
Bandaranayake AD, Almo SC. Recent advances in mammalian protein production. FEBS Lett. 2014 Jan 21;588(2):253-60. doi: 10.1016/j.febslet.2013.11.035. Epub 2013 Dec 6. PMID: 24316512; PMCID: PMC3924552.
Blesa A, Baquedano I, Quintans NG, Mata CP, Caston JR, Berenguer J. The transjugation machinery of Thermus thermophilus: Identification of TdtA, an ATPase involved in DNA donation. PLoS Genet. 2017 Mar 10;13(3):e1006669. doi: 10.1371/joumal.pgen.1006669. PMID: 28282376; PMCID: PMC5365140.
Bloor AE, Cranenburgh RM. An efficient method of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Appl Environ Microbiol. 2006 Apr;72(4):2520-5. doi: 10.1128/AEM.72.4.2520-2525.2006. PMID: 16597952; PMCID: PMC1449051.
Choi KH. Viral polymerases. Adv Exp Med Biol. 2012;726:267-304. doi: 10.1007/978-1- 4614-0980-9 12. PMID: 22297518; PMCID: PMC4711277.
Christie PJ, Whitaker N, Gonzalez -Rivera C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 2014 Aug;1843(8):1578-91. doi:
10.1016/j.bbamcr.2013.12.019. Epub 2014 Jan 2. PMID: 24389247; PMCID: PMC4061277.
Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 2014 Nov 28;346(6213): 1258096. doi: 10.1126/science.1258096. PMID: 25430774. Epah J, Schafer R. Implications of hematopoietic stem cells heterogeneity for gene therapies. Gene Ther. 2021 Feb 15. doi: 10.1038/s41434-021-00229-x. Epub ahead of print. Erratum in: Gene Ther. 2021 Mar 4;: PMID: 33589780.
Gerstung M, Jolly C, Leshchiner I, Dentro SC, Gonzalez S, Rosebrock D, Mitchell TJ, Rubanova Y, Anur P, Yu K, Tarabichi M, Deshwar A, Wintersinger J, Kleinheinz K, Vazquez-Garcia I, Haase K, Jerman L, Sengupta S, Macintyre G, Malikic S, Donmez N, Livitz DG, Cmero M, Demeulemeester J, Schumacher S, Fan Y, Yao X, Lee J, Schlesner M, Boutros PC, Bowtell DD, Zhu H, Getz G, Imielinski M, Beroukhim R, Sahinalp SC, Ji Y, Peifer M, Markowetz F, Mustonen V, Yuan K, Wang W, Morris QD; PCAWG Evolution &Heterogeneity Working Group, Spellman PT, Wedge DC, Van Loo P; PCAWG Consortium. The evolutionary history of 2,658 cancers. Nature. 2020 Feb;578(7793): 122-128. doi: 10.1038/s41586-019-1907-7. Epub 2020 Feb 6. PMID: 32025013; PMCID: PMC7054212.
Hafez M, Hausner G. Homing endonucleases: DNA scissors on a mission. Genome. 2012 Aug;55(8):553-69. doi: 10.1139/g2012-049. Epub 2012 Aug 14. PMID: 22891613.
Hobemik D, Bros M. DNA Vaccines-How Far From Clinical Use? Int J Mol Sci. 2018 Nov 15;19(l l):3605. doi: 10.3390/ijmsl9113605. PMID: 30445702; PMCID: PMC6274812.
Hoeben RC, Uil TG. Adenovirus DNA replication. Cold Spring Harb Perspect Biol. 2013 Mar l;5(3):a013003. doi: 10.1101/cshperspect.a013003. PMID: 23388625; PMCID: PMC3578361.
Hu P, Zhao X, Zhang Q, Li W, Zu Y. Comparison of Various Nuclear Localization Signal- Fused Cas9 Proteins and Cas9 mRNA for Genome Editing in Zebrafish. G3 (Bethesda). 2018 Mar 2;8(3):823-831. doi: 10.1534/g3.117.300359. PMID: 29295818; PMCID: PMC5844304.
Hube F, Chooniedass-Kothari S, Hamedani MK, Miksicek RJ, Leygue E, Myal Y. Identification of an octamer-binding site controlling the activity of the small breast epithelial mucin gene promoter. Front Biosci. 2006 Sep 1;11:2483-95. doi: 10.2741/1984. PMID: 16720387.
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012 Aug 17;337(6096):816-21. doi: 10.1126/science.l225829. Epub 2012 Jun 28. PMID: 22745249; PMCID: PMC6286148.
Kleinstiver BP, Pattanayak V, Prew MS, Tsai SQ, Nguyen NT, Zheng Z, Joung JK. High- fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects.
Nature. 2016 Jan 28;529(7587):490-5. doi: 10.1038/naturel6526. Epub 2016 Jan 6. PMID: 26735016; PMCID: PMC4851738. Liu Z, Chen O, Wall JBJ, Zheng M, Zhou Y, Wang L, Vaseghi HR, Qian L, Liu J. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Sci Rep. 2017 May 19;7(1):2193. doi: 10.1038/s41598-017-02460-2. PMID: 28526819; PMCID: PMC5438344.
Malnou CE, Poyry TA, Jackson RJ, Kean KM. Poliovirus internal ribosome entry segment structure alterations that specifically affect function in neuronal cells: molecular genetic analysis. J Virol. 2002 Nov;76(21): 10617-26. doi: 10.1128/jvi.76.21.10617-10626.2002.
PMID: 12368304; PMCID: PMC136602.
Martin F, Toscano MG, Blundell M, Frecha C, Srivastava GK, Santamaria M, Thrasher AJ, Molina IJ. Lentiviral vectors transcriptionally targeted to hematopoietic cells by WASP gene proximal promoter sequences. Gene Ther. 2005 Apr; 12(8):715-23. doi: 10.1038/sj.gt.3302457. PMID: 15750617.
Meijer WJ, Horcajadas JA, Salas M. Phi29 family of phages. Microbiol Mol Biol Rev. 2001 Jun;65(2):261-87 ; second page, table of contents, doi: 10.1128/MMBR.65.2.261- 287.2001. PMID: 11381102; PMCID: PMC99027.
Miliotou AN, Papadopoulou LC. CAR T-cell Therapy: A New Era in Cancer Immunotherapy. Curr Pharm Biotechnol. 2018; 19(1):5-18. doi: 10.2174/1389201019666180418095526. PMID: 29667553.
Nety SP, Altae-Tran H, Kannan S, Demircioglu FE, Faure G, Hirano S, Mears K, Zhang Y, Macrae RK, Zhang F. The Transposon-Encoded Protein TnpB Processes Its Own mRNA into coRNA for Guided Nuclease Activity. CRISPR J. 2023 Jun;6(3):232-242. doi: 10.1089/crispr.2023.0015. PMID: 37272862; PMCID: PMC 10278001.
Novellino L, Castelli C, Parmiani G. A listing of human tumour antigens recognized by T cells: March 2004 update. Cancer Immunol Immunother. 2005 Mar;54(3): 187-207. doi: 10.1007/s00262-004-0560-6. Epub 2004 Aug 7. PMID: 15309328.
Ozturk-Winder F, Renner M, Klein D, Muller M, Salmons B, Gunzburg WH. The murine whey acidic protein promoter directs expression to human mammary tumours after retroviral transduction. Cancer Gene Ther. 2002 May;9(5):421-31. doi: 10.1038/sj.cgt.7700456. PMID: 11961665.
Ostrowski LE, Hutchins JR, Zakel K, O'Neal WK. Targeting expression of a transgene to the airway surface epithelium using a ciliated cell-specific promoter. Mol Ther. 2003 Oct;8(4):637-45. doi: 10.1016/sl525-0016(03)00221-l . PMID: 14529837.
Proudfoot NJ. Ending the message: poly(A) signals then and now. Genes Dev.
2011 ;25(17): 1770-1782. doi: 10.1101/gad.17268411.
Ravin NV. Replication and Maintenance of Linear Phage-Plasmid N15. Microbiol Spectr. 2015 Feb;3(l):PLAS-0032-2014. doi: 10.1128/microbiolspec.PLAS-0032-2014. PMID: 26104561. Roberts TC, Langer R, Wood MJA. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov. 2020 Oct;19(10):673-694. doi: 10.1038/s41573-020-0075-7. Epub 2020 Aug 11. PMID: 32782413; PMCID: PMC7419031.
Saito M, Xu P, Faure G, Maguire S, Kannan S, Altae-Tran H, Vo S, Desimone A, Macrae RK, Zhang F. Fanzor is a eukaryotic programmable RNA-guided endonuclease. Nature. 2023 Jun 28. doi: 10.1038/s41586-023-06356-2. Epub ahead of print. PMID: 37380027.
Salas M, Holguera I, Redrejo-Rodriguez M, de Vega M. DNA-Binding Proteins Essential for Protein-Primed Bacteriophage 029 DNA Replication. Front Mol Biosci. 2016 Aug 5;3:37. doi: 10.3389/fmolb.2016.00037. PMID: 27547754; PMCID: PMC4974454.
Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F. Rationally engineered Cas9 nucleases with improved specificity. Science. 2016 Jan 1 ;351(6268):84-8. doi: 10.1126/science.aad5227. Epub 2015 Dec 1. PMID: 26628643; PMCID: PMC4714946.
Szymczak- Workman AL, Vignali KM, Vignali DA. Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harb Protoc. 2012 Feb 1 ;2012(2): 199- 204. doi: 10.1101/pdb.ip067876. PMID: 22301656.
Thoma L, Muth G. Conjugative DNA transfer in Streptomyces by TraB: is one protein enough? FEMS Microbiol Lett. 2012 Dec;337(2):81-8. doi: 10.1111/1574-6968.12031. PMID: 23082971.
Thoma L, Muth G. The conjugative DNA-transfer apparatus of Streptomyces. Int J Med Microbiol. 2015 Feb;305(2):224-9. doi: 10.1016/j.ijmm.2014.12.020. Epub 2014 Dec 24. PMID: 25592263.
Vandermeulen G, Marie C, Scherman D, Preat V. New generation of plasmid backbones devoid of antibiotic resistance marker for gene therapy trials. Mol Ther. 2011 Nov;19(l l):1942-9. doi: 10.1038/mt.2011.182. Epub 2011 Aug 30. PMID: 21878901; PMCID: PMC3222533.
Wang B, Li J, Fu FH, Chen C, Zhu X, Zhou L, Jiang X, Xiao X. Construction and analysis of compact muscle-specific promoters for AAV vectors. Gene Ther. 2008 Nov;15(22):1489-99. doi: 10.1038/gt.2008.104. Epub 2008 Jun 19. PMID: 18563184.
Wedell N, Price TAR, Lindholm AK. Gene drive: progress and prospects. Proc Biol Sci. 2019 Dec 18;286(1917):20192709. doi: 10.1098/rspb.2019.2709. Epub 2019 Dec 18. PMID: 31847764; PMCID: PMC6939923.
Wu T, Yoon H, Xiong Y, Dixon-Clarke SE, Nowak RP, Fischer ES. Targeted protein degradation as a powerful research tool in basic biology and drug target discovery. Nat Struct Mol Biol. 2020 Jul;27(7):605-614. doi: 10.1038/s41594-020-0438-0. Epub 2020 Jun 15. PMID: 32541897; PMCID: PMC7923177. Yin HC, Chen XY, Wang W, Meng QW. Identification and comparison of the porcine Hl, U6, and 7SK RNA polymerase III promoters for short hairpin RNA expression. Mamm Genome. 2020 Apr;31(3-4):110-116. doi: 10.1007/s00335-020-09838-0. Epub 2020 Apr 21. PMID: 32318815.
Zheng C, Baum BJ. Evaluation of viral and mammalian promoters for use in gene delivery to salivary glands. Mol Ther. 2005 Sep;12(3):528-36. doi: 10.1016/j.ymthe.2005.03.008. PMID: 16099414. Zhu Y, Zhu L, Wang X, Jin H. RNA-based therapeutics: an overview and prospectus. Cell Death Dis. 2022 Jul 23; 13(7):644. doi: 10.1038/s41419-022-05075-2. PMID: 35871216; PMCID: PMC9308039.

Claims

1. A polynucleotide comprising: a) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; and b) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
2. 2. The polynucleotide of claim 1, comprising: a) an origin of replication; b) a polynucleotide sequence encoding a DNA-dependent DNA polymerase; c) a polynucleotide sequence encoding: i) a protelomerase; or ii) a terminal protein and a DNA-binding protein required for plasmid replication in eukaryotic cells; and d) a polynucleotide sequence encoding a pore that enables secretion of DNA from eukaryotic cells.
3. The polynucleotide of claim 2, wherein the origin of replication is from bacteriophage N 15.
4. The polynucleotide of any one of the preceding claims, wherein the DNA- dependent DNA polymerase is from bacteriophage N15.
5. The polynucleotide of any one of the preceding claims, wherein the DNA- dependent DNA polymerase is encoded by the repA gene.
6. The polynucleotide of any one of the preceding claims, wherein the DNA- dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 1, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 1 that retains the ability to function as a DNA-dependent DNA polymerase.
7. The polynucleotide of any one of the preceding claims, wherein the protelomerase is TelN from bacteriophage N15.
8. The polynucleotide of any one of the preceding claims, wherein the protelomerase expressed by the polynucleotide sequence comprises SEQ ID NO: 3, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 3 that retains the ability to function as a protelomerase.
9. The polynucleotide of any one of the preceding claims, further comprising a telRL site, optionally wherein the telRL site polynucleotide sequence comprises SEQ ID NO: 5.
10. The polynucleotide of claim 1 or claim 2, wherein the DNA-dependent DNA polymerase is from bacteriophage Phi29.
11. The polynucleotide of claim 10, wherein the DNA-dependent DNA polymerase is encoded by gene 2.
12. The polynucleotide of claim 10 or claim 11, wherein the DNA-dependent DNA polymerase expressed by the polynucleotide sequence comprises SEQ ID NO: 10, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 that retains the ability to function as a DNA-dependent DNA polymerase.
13. The polynucleotide of any one of claims 10 to 12, wherein the terminal protein and DNA-binding protein are terminal protein TP and DNA-binding proteins p5 and p6 from bacteriophages of the Phi29 group of Bacillus subtilis.
14. The polynucleotide of any one of claims 10 to 13, wherein the terminal protein expressed by the polynucleotide sequence comprises SEQ ID NO: 12, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 12 that retains the ability to function as a terminal protein.
I l l
15. The polynucleotide of claim 13 or claim 14, wherein the DNA-binding proteins p5 and p6 expressed by the polynucleotide sequence comprise SEQ ID NOs: 14 and 16, respectively, or amino acid sequences that are at least 90% identical to SEQ ID NOs: 14 and 16, respectively, that retain the ability to function as DNA-binding proteins.
16. The polynucleotide of any one of the preceding claims, wherein the pore is TraB from Streptomyces spp..
17. The polynucleotide of claim 16, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 24, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 24 that retains the ability to function as a pore.
18. The polynucleotide of claims 16 or claim 17, further comprising a clt locus.
19. The polynucleotide of claim 18, wherein the clt locus comprises SEQ ID NO: 26, or a variant of SEQ ID NO: 26 that differs by 1, 2, 3, 4 or 5 nucleotides, wherein the variant maintains the ability to function as a clt locus.
20. The polynucleotide of any one of claims 1 to 15, wherein the pore is TdtA from Thermits spp..
21. The polynucleotide of claim 20, wherein the pore expressed by the polynucleotide sequence comprises SEQ ID NO: 28, or an amino acid sequence that is at least 90% identical to SEQ ID NO: 28 that retains the ability to function as a pore.
22. The polynucleotide of any one of the preceding claims, further comprising:
(a) a promoter; and/or
(b) a payload sequence.
23. The polynucleotide of claim 22, wherein the payload sequence is a therapeutic gene, a CRISPR RNA-guided nuclease, optionally including CRISPR donor DNA, a zinc finger nuclease or TALEN, an antigen gene or a gene encoding an immunogenic protein or protein from a pathogen or a tumour, or an antibiotic, antifungal or antiviral compound, or an antibody, or a chimeric antigen or T-cell receptor, or a B-cell receptor.
24. A circular or linear plasmid comprising the polynucleotide as defined in any one of the preceding claims.
25. A pharmaceutical composition comprising the polynucleotide as defined in any one of claims 1 to 23, or the plasmid as defined in claim 24, and a pharmaceutically acceptable excipient.
26. A method of treatment comprising administration of the polynucleotide as defined in any one of claims 1 to 23, the plasmid as defined in claim 24, or the pharmaceutical composition as defined in claim 25, to an individual in need thereof.
PCT/GB2023/053362 2022-12-22 2023-12-22 Polynucleotide construct encoding a dna polymerase and a pore WO2024134216A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB2219539.0 2022-12-22
GBGB2219539.0A GB202219539D0 (en) 2022-12-22 2022-12-22 Construct

Publications (1)

Publication Number Publication Date
WO2024134216A1 true WO2024134216A1 (en) 2024-06-27

Family

ID=85130133

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2023/053362 WO2024134216A1 (en) 2022-12-22 2023-12-22 Polynucleotide construct encoding a dna polymerase and a pore

Country Status (2)

Country Link
GB (1) GB202219539D0 (en)
WO (1) WO2024134216A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031020A1 (en) * 2008-07-07 2015-01-29 Oxford Nanopore Technologies Limited Enzyme-pore constructs
WO2020010452A1 (en) * 2018-07-11 2020-01-16 Société De Commercialisation Des Produits De La Recherche Appliquée Socpra Sciences Santé Et Humaines S.E.C Bacterial conjugative system and therapeutic uses thereof
WO2021072031A1 (en) * 2019-10-11 2021-04-15 Insideoutbio, Inc. Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases
WO2022232796A1 (en) * 2021-04-28 2022-11-03 The General Hospital Corporation Il2 tethered to its receptor il2rbeta and pore-forming proteins as a platform to enhance immune cell activity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031020A1 (en) * 2008-07-07 2015-01-29 Oxford Nanopore Technologies Limited Enzyme-pore constructs
WO2020010452A1 (en) * 2018-07-11 2020-01-16 Société De Commercialisation Des Produits De La Recherche Appliquée Socpra Sciences Santé Et Humaines S.E.C Bacterial conjugative system and therapeutic uses thereof
WO2021072031A1 (en) * 2019-10-11 2021-04-15 Insideoutbio, Inc. Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases
WO2022232796A1 (en) * 2021-04-28 2022-11-03 The General Hospital Corporation Il2 tethered to its receptor il2rbeta and pore-forming proteins as a platform to enhance immune cell activity

Non-Patent Citations (51)

* Cited by examiner, † Cited by third party
Title
AARTSMA-RUS AJANSON AAVAN OMMEN GJVAN DEUTEKOM JC: "Antisense-induced exon skipping for duplications in Duchenne muscular dystrophy", BMC MED GENET, vol. 8, 5 July 2007 (2007-07-05), pages 43, XP021028970, DOI: 10.1186/1471-2350-8-43
ADLI M: "The CRISPR tool kit for genome editing and beyond", NAT COMMUN, vol. 9, no. 1, 15 May 2018 (2018-05-15), pages 1911
AL-ALLAF FAABDULJALEEL ZATHAR MTAHER MMKHAN WMEHMET HCOLAKOGULLARI MAPOSTOLIDOU SBIGGER BWADDINGTON S: "Modifying inter-cistronic sequence significantly enhances IRES dependent second gene expression in bicistronic vector: Construction of optimised cassette for gene therapy of familial hypercholesterolemia", NONCODING RNA RES, vol. 4, no. 1, 22 November 2018 (2018-11-22), pages 1 - 14
AMADO EMUTH GARECHAGA ICABEZON E: "The FtsK-like motor TraB is a DNA-dependent ATPase that forms higher-order assemblies", J BIOL CHEM., vol. 294, no. 13, 29 March 2019 (2019-03-29), pages 5050 - 5059
ANGUELA XMHIGH KA: "Entering the Modern Era of Gene Therapy", ANNU REV MED, vol. 70, 27 January 2019 (2019-01-27), pages 273 - 288
ATES IRATHBONE TSTUART CBRIDGES PHCOTTLE RN: "Delivery Approaches for Therapeutic Genome Editing and Challenges", GENES (BASEL, vol. 11, no. 10, 23 September 2020 (2020-09-23), pages 1113, XP055904526, DOI: 10.3390/genes11101113
BANDARANAYAKE ADALMO SC: "Recent advances in mammalian protein production", FEBS LETT, vol. 588, no. 2, 21 January 2014 (2014-01-21), pages 253 - 60, XP028669988, DOI: 10.1016/j.febslet.2013.11.035
BLESA ABAQUEDANO IQUINTANS NGMATA CPCASTON JRBERENGUER J.: "The transjugation machinery of Thermus thermophilus: Identification of TdtA, an ATPase involved in DNA donation", PLOS GENET, vol. 13, no. 3, 10 March 2017 (2017-03-10), pages e1006669
BLOOR AECRANENBURGH RM: "An efficient method of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes", APPL ENVIRON MICROBIOL, vol. 72, no. 4, April 2006 (2006-04-01), pages 2520 - 5, XP002457431, DOI: 10.1128/AEM.72.4.2520-2525.2006
CHOI KH: "Viral polymerases", ADV EXP MED BIOL, vol. 726, 2012, pages 267 - 304
CHRISTIE PJWHITAKER NGONZALEZ-RIVERA C: "Mechanism and structure of the bacterial type IV secretion systems", BIOCHIM BIOPHYS ACTA, vol. 1843, no. 8, August 2014 (2014-08-01), pages 1578 - 91, XP028854200, DOI: 10.1016/j.bbamcr.2013.12.019
DOUDNA JACHARPENTIER E: "Genome editing. The new frontier of genome engineering with CRISPR-Cas9", SCIENCE, vol. 346, no. 6213, 28 November 2014 (2014-11-28), pages 125 8096, XP055162699, DOI: 10.1126/science.1258096
EPAH JSCHAFER R: "Implications of hematopoietic stem cells heterogeneity for gene therapies", GENE THER, 15 February 2021 (2021-02-15)
GENE THER, 4 March 2021 (2021-03-04)
GERSTUNG MJOLLY CLESHCHINER IDENTRO SCGONZALEZ SROSEBROCK DMITCHELL TJRUBANOVA YANUR PYU K, PCAWG EVOLUTION &HETEROGENEITY WORKING GROUP
HAFEZ MHAUSNER G: "Homing endonucleases: DNA scissors on a mission", GENOME, vol. 55, no. 8, August 2012 (2012-08-01), pages 553 - 69, XP002730920, DOI: 10.1139/g2012-049
HOBERNIK DBROS M: "DNA Vaccines-How Far From Clinical Use?", INT J MOL SCI, vol. 19, no. 11, 15 November 2018 (2018-11-15), pages 3605
HOEBEN RCUIL TG: "Adenovirus DNA replication", vol. 5, 1 March 2013, COLD SPRING HARB PERSPECT BIOL, pages: a013003
HU PZHAO XZHANG QLI WZU Y, COMPARISON OF VARIOUS NUCLEAR LOCALIZATION SIGNAL-FUSED CAS9 PROTEINS AND CAS9 MRNA FOR GENOME EDITING IN ZEBRAFISH, vol. 8, no. 3, 2 March 2018 (2018-03-02), pages 823 - 831
HUBE FCHOONIEDASS-KOTHARI SHAMEDANI MKMIKSICEK RJLEYGUE EMYAL Y: "Identification of an octamer-binding site controlling the activity of the small breast epithelial mucin gene promoter", FRONT BIOSCI, vol. 11, 1 September 2006 (2006-09-01), pages 2483 - 95
JINEK MCHYLINSKI KFONFARA IHAUER MDOUDNA JACHARPENTIER E: "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity", SCIENCE, vol. 337, no. 6096, 17 August 2012 (2012-08-17), pages 816 - 21, XP055229606, DOI: 10.1126/science.1225829
KLEINSTIVER BPPATTANAYAK VPREW MSTSAI SQNGUYEN NTZHENG ZJOUNG JK: "High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects", NATURE, vol. 529, no. 7587, 28 January 2016 (2016-01-28), pages 490 - 5, XP055650074, DOI: 10.1038/nature16526
LAI Y-H ET AL: "Tumor-specific suicide gene therapy for hepatocellular carcinoma by transcriptionally targeted retroviral replicating vectors", GENE THERAPY, NATURE PUBLISHING GROUP, LONDON, GB, vol. 22, no. 2, 30 October 2014 (2014-10-30), pages 155 - 162, XP037770608, ISSN: 0969-7128, [retrieved on 20141030], DOI: 10.1038/GT.2014.98 *
LIU ZCHEN OWALL JBJZHENG MZHOU YWANG LVASEGHI HRQIAN LLIU J.: "Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector", SCI REP, vol. 7, no. 1, 19 May 2017 (2017-05-19), pages 2193
MALNOU CEPOYRY TAJACKSON RJKEAN KM: "Poliovirus internal ribosome entry segment structure alterations that specifically affect function in neuronal cells: molecular genetic analysis", J VIROL, vol. 76, no. 21, November 2002 (2002-11-01), pages 10617 - 26
MARTIN FTOSCANO MGBLUNDELL MFRECHA CSRIVASTAVA GKSANTAMARIA MTHRASHER AJMOLINA IJ: "Lentiviral vectors transcriptionally targeted to hematopoietic cells by WASP gene proximal promoter sequences", GENE THER, vol. 12, no. 8, April 2005 (2005-04-01), pages 715 - 23, XP055826328, DOI: 10.1038/sj.gt.3302457
MEIJER WJHORCAJADAS JASALAS M: "Phi29 family of phages", MICROBIOL MOL BIOL REV, vol. 65, no. 2, June 2001 (2001-06-01), pages 261 - 87
MILIOTOU ANPAPADOPOULOU LC: "CAR T-cell Therapy: A New Era in Cancer Immunotherapy", CURR PHARM BIOTECHNOL, vol. 19, no. 1, 2018, pages 5 - 18, XP055560547, DOI: 10.2174/1389201019666180418095526
NETY SPALTAE-TRAN HKANNAN SDEMIRCIOGLU FEFAURE GHIRANO SMEARS KZHANG YMACRAE RKZHANG F: "The Transposon-Encoded Protein TnpB Processes Its Own mRNA into coRNA for Guided Nuclease Activity", CRISPR J, vol. 6, no. 3, June 2023 (2023-06-01), pages 232 - 242
NOVELLINO LCASTELLI CPARMIANI G: "A listing of human tumour antigens recognized by T cells: March 2004 update", CANCER IMMUNOL IMMUNOTHER, vol. 54, no. 3, March 2005 (2005-03-01), pages 187 - 207, XP019333092, DOI: 10.1007/s00262-004-0560-6
OGLODIN E G ET AL: "Analysis of the nucleotide sequence of a cryptic plasmid from Yersinia pestis strains in the Central-Caucasian high-mountain plague focus", RUSSIAN JOURNAL OF GENETICS, MOSCOW, RU, vol. 51, no. 7, 25 July 2015 (2015-07-25), pages 642 - 646, XP035521470, ISSN: 1022-7954, [retrieved on 20150725], DOI: 10.1134/S1022795415060125 *
OSTROWSKI LEHUTCHINS JRZAKEL KO'NEAL WK: "Targeting expression of a transgene to the airway surface epithelium using a ciliated cell-specific promoter", MOL THER, vol. 8, no. 4, October 2003 (2003-10-01), pages 637 - 45
OZTURK-WINDER FRENNER MKLEIN DMULLER MSALMONS BGUNZBURG WH: "The murine whey acidic protein promoter directs expression to human mammary tumours after retroviral transduction", CANCER GENE THER, vol. 9, no. 5, May 2002 (2002-05-01), pages 421 - 31, XP037757175, DOI: 10.1038/sj.cgt.7700456
PROUDFOOT NJ: "Ending the message: poly(A) signals then and now", GENES DEV, vol. 25, no. 17, 2011, pages 1770 - 1782
RAVIN NV: "Replication and Maintenance of Linear Phage-Plasmid N15", MICROBIOL SPECTR, vol. 3, no. 1, February 2015 (2015-02-01), XP055804335, DOI: 10.1128/microbiolspec.PLAS-0032-2014
ROBERTS TCLANGER RWOOD MJA: "Advances in oligonucleotide drug delivery", NAT REV DRUG DISCOV, vol. 19, no. 10, October 2020 (2020-10-01), pages 673 - 694, XP037256878, DOI: 10.1038/s41573-020-0075-7
SAITO MXU PFAURE GMAGUIRE SKANNAN SALTAE-TRAN HVO SDESIMONE AMACRAE RKZHANG F: "Fanzor is a eukaryotic programmable RNA-guided endonuclease", NATURE., 28 June 2023 (2023-06-28)
SALAS MHOLGUERA IREDREJO-RODRIGUEZ MDE VEGA M: "DNA-Binding Proteins Essential for Protein-Primed Bacteriophage Φ29 DNA Replication", FRONT MOL BIOSCI, vol. 3, 5 August 2016 (2016-08-05), pages 37
SHAFAATI MARYAM ET AL: "A brief review on DNA vaccines in the era of COVID-19", FUTURE VIROLOGY, vol. 17, no. 1, 26 November 2021 (2021-11-26), UK, pages 49 - 66, XP093054025, ISSN: 1746-0794, DOI: 10.2217/fvl-2021-0170 *
SLAYMAKER IMGAO LZETSCHE BSCOTT DAYAN WXZHANG F: "Rationally engineered Cas9 nucleases with improved specificity", SCIENCE, vol. 351, no. 6268, 1 January 2016 (2016-01-01), pages 84 - 8
SPELLMAN PTWEDGE DCVAN LOO P: "PCAWG Consortium. The evolutionary history of 2,658 cancers", NATURE, vol. 578, no. 7793, February 2020 (2020-02-01), pages 122 - 128
SZYMCZAK-WORKMAN ALVIGNALI KMVIGNALI DA: "Design and construction of 2A peptide-linked multicistronic vectors", COLD SPRING HARB PROTOC, no. 2, 1 February 2012 (2012-02-01), pages 199 - 204
THOMA LMUTH G: "Conjugative DNA transfer in Streptomyces by TraB: is one protein enough?", FEMS MICROBIOL LETT, vol. 337, no. 2, December 2012 (2012-12-01), pages 81 - 8
THOMA LMUTH G: "The conjugative DNA-transfer apparatus of Streptomyces", INT J MED MICROBIOL, vol. 305, no. 2, February 2015 (2015-02-01), pages 224 - 9
VANDERMEULEN GMARIE CSCHERMAN DPREAT V: "New generation of plasmid backbones devoid of antibiotic resistance marker for gene therapy trials", MOL THER, vol. 19, no. 11, November 2011 (2011-11-01), pages 1942 - 9, XP002698168, DOI: 10.1038/MT.2011.182
WANG BLI JFU FHCHEN CZHU XZHOU LJIANG XXIAO X: "Construction and analysis of compact muscle-specific promoters for AAV vectors", GENE THER, vol. 15, no. 22, November 2008 (2008-11-01), pages 1489 - 99, XP055078593, DOI: 10.1038/gt.2008.104
WEDELL NPRICE TARLINDHOLM AK: "Gene drive: progress and prospects", PROC BIOL SCI., vol. 286, no. 1917, 18 December 2019 (2019-12-18), pages 20192709
WU TYOON HXIONG YDIXON-CLARKE SENOWAK RPFISCHER ES: "Targeted protein degradation as a powerful research tool in basic biology and drug target discovery", NAT STRUCT MOL BIOL, vol. 27, no. 7, July 2020 (2020-07-01), pages 605 - 614, XP037190020, DOI: 10.1038/s41594-020-0438-0
YIN HCCHEN XYWANG WMENG QW: "Identification and comparison of the porcine Hl, U6, and 7SK RNA polymerase III promoters for short hairpin RNA expression", MAMM GENOME, vol. 31, no. 3-4, April 2020 (2020-04-01), pages 110 - 116, XP037130646, DOI: 10.1007/s00335-020-09838-0
ZHENG CBAUM BJ: "Evaluation of viral and mammalian promoters for use in gene delivery to salivary glands", MOL THER., vol. 12, no. 3, September 2005 (2005-09-01), pages 528 - 36, XP005472388, DOI: 10.1016/j.ymthe.2005.03.008
ZHU YZHU LWANG XJIN H: "RNA-based therapeutics: an overview and prospectus", CELL DEATH DIS, vol. 13, no. 7, 23 July 2022 (2022-07-23), pages 644

Also Published As

Publication number Publication date
GB202219539D0 (en) 2023-02-08

Similar Documents

Publication Publication Date Title
EP3487523B1 (en) Therapeutic applications of cpf1-based genome editing
EP3452498B1 (en) Crispr/cas-related compositions for treating duchenne muscular dystrophy
JP2019530467A (en) Self-limiting Cas9 network (SLiCES) plasmid and its lentiviral system for improved safety
JP2023164823A (en) RNA-guided gene editing and gene regulation
US20180073018A1 (en) Compositions and methods for specific reactivation of hiv latent reservoir
JP2022001051A (en) Compositions and methods for in vivo excision of hiv-1 proviral dna
AU2017268842B2 (en) Peptides and nanoparticles for intracellular delivery of genome-editing molecules
JP2018534114A5 (en)
JP2020537545A (en) Peptides and nanoparticles for intracellular delivery of mRNA
AU2014361834A1 (en) CRISPR-Cas systems and methods for altering expression of gene products, structural information and inducible modular cas enzymes
CN111492056A (en) Non-integrative DNA vector for genetic modification of cells
JP2022546592A (en) Methods and compositions for genomic integration
Schleef Minicircle and miniplasmid dna vectors: the future of non-viral and viral gene transfer
CN113631716A (en) Finger ring body and method of use
WO2024134216A1 (en) Polynucleotide construct encoding a dna polymerase and a pore
Rodríguez Nonviral DNA vectors for immunization and therapy: design and methods for their obtention
US9862954B2 (en) DNA vector production system
EP4337268A1 (en) Methods and compositions for genomic integration
Li et al. Clustered regularly interspaced short palindromic repeats and clustered regularly Interspaced Short Palindromic Repeats–Associated protein 9 system: factors affecting Precision Gene Editing Efficiency and optimization strategies
USRE49294E1 (en) DNA vector production system
WO2023134658A1 (en) Method of modulating vegf and uses thereof
EP2739738B1 (en) Use of integrase for targeted gene expression
Braun History of Gene Therapy
Xia CRISPR-cas9 and TALEN Mediated Gene Editing for Treating Cystic Fibrosis
JP2024521793A (en) Compositions and methods for improving the efficiency of precise edit repair - Patents.com