WO2024133900A1 - Production de (-)-spartéine améliorée - Google Patents

Production de (-)-spartéine améliorée Download PDF

Info

Publication number
WO2024133900A1
WO2024133900A1 PCT/EP2023/087645 EP2023087645W WO2024133900A1 WO 2024133900 A1 WO2024133900 A1 WO 2024133900A1 EP 2023087645 W EP2023087645 W EP 2023087645W WO 2024133900 A1 WO2024133900 A1 WO 2024133900A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
lupin
cyp71d10
sparteine
seeds
Prior art date
Application number
PCT/EP2023/087645
Other languages
English (en)
Inventor
Davide MANCINOTTI
Ting Yang
Fernando Geu FLORES
Original Assignee
University Of Copenhagen
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Copenhagen filed Critical University Of Copenhagen
Publication of WO2024133900A1 publication Critical patent/WO2024133900A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Definitions

  • the present invention relates to the field of plant alkaloid synthesis, and to plants, preferably non-GMO plants with improved production of desirable alkaloids. More specifically, the invention relates to production of (-)-sparteine through the homozygous knockout of a cytochrome P450 monooxygenase in plants.
  • Asymmetric synthesis is the synthesis of chiral molecules using methods that favour the formation of a specific enantiomer/diastereomer.
  • Asymmetric synthesis is particularly relevant for the pharmaceutical industry, as different enantiomers/diastereomers typically have different biological activities.
  • One of the most versatile auxiliary molecules used in asymmetric synthesis is the chiral diamine sparteine. Specifically, complexes between sparteine and lithium have proven unrivaled for asymmetric deprotonations, substitutions, carbometalations, and directed ortho-metalations. As chemists continue to find new uses for sparteine-lithium complexes, their versatility continues to grow, as exemplified by the development of assembly-line chiral synthesis.
  • Sparteine belongs to the family of quinolizidine alkaloids (QAs), which are produced by leguminous plants of the larger genistoid clade (Ohmiya, et al. 1995). Bicyclic, tricyclic, and tetracyclic QAs exist, with sparteine being the simplest tetracyclic one. By large, the most studied QA-producing species are the lupins (Lupinus spp.), which typically produce complex mixtures of QAs sometimes including sparteine. The enantiomeric purity of lupin-derived QAs is species-dependent. For example, the tetracyclic QA lupanine occurs in white lupin (L.
  • Narrow-leafed lupin (NLL, L. angustifolius) is a cultivated lupin species grown in Europe and Australia for its protein-rich seeds. NLL does not accumulate (-)-sparteine but accumulates at least eight related QAs, three of which are efficiently transported to the seeds, potentially causing toxicity.
  • the present invention shows that (-)-sparteine is a common intermediate in the biosynthesis of most of the QAs found in NLL, and that a 2-step enzymatic oxidation transforms (-)-sparteine into the accumulating (+)-lupanine.
  • the invention further discloses that CYP71 D10 catalyses the first step of this transformation, and shows that lupin plants carrying a loss-of-function mutation in CYP71D10 accumulates high levels of (-)-sparteine.
  • the invention provides quinolizidine alkaloid (QA)-producing plants, preferably lupin plants, or parts thereof, wherein said plants carry a mutation in either the CYP71D10 gene leading to reduced CYP71D10 activity or loss-of-function of CYP71 D10 or the SDR gene leading to a reduced SDR activity or loss of function of SDR.
  • QA quinolizidine alkaloid
  • the invention also provides methods of producing (-)-sparteine, said methods comprising the steps of: a. providing a lupin plant, or part thereof, according to the invention b. isolating (-)-sparteine from said plant or part thereof; c. optionally, purifying said (-)-sparteine.
  • the invention also provides methods of producing a plant product, said method comprising the steps of: a. providing seeds of a lupin plant according to the invention; b. processing said seeds into a plant product.
  • Figure 1 Schematic representation of the biosynthesis of QAs in NLL. A two-step enzymatic oxidation transforms (-)-sparteine into (+)-lupanine.
  • CYP71 D10 of SEQ ID NO:3 is a putative sparteine 2-hydroxylase.
  • CYP71 D10 of SEQ ID NO:3 yielded a new compound with the m/z of a didehydrosparteinium ion (peak a), likely 1,2- didehydrosparteinium.
  • Unfed leaves expressing CYP71 D10 of SEQ ID NO:3 and fed leaves expressing GFP were included as controls.
  • the traces are representative extracted ion chromatograms corresponding to sparteine ([M+H] + , m/z 235.22 ⁇ 0.01, continuous trace) and didehydrosparteinium ([M] + , m/z 233.20 ⁇ 0.01 , dotted trace).
  • the traces are slightly offset to aid visualization of the otherwise overlapping peaks.
  • FIG. 3 Production of sparteine in NLL by genetic inactivation of CYP71 D10.
  • Traces are representative extracted ion chromatograms at the combined m/z values of 235.18 ⁇ 0.01 (angustifoline - peak f), 235.22 ⁇ 0.01 (sparteine - peak i), 247.18 ⁇ 0.01 (multiflorine - peak h), 249.20 ⁇ 0.01 (lupanine - peak d), 265.19 ⁇ 0.01 (13-hydroxylupanine - peak b), and 429.24 ⁇ 0.01 (a 13-oxylupanine ester - peak g) ([M+H] + in all cases).
  • Percentages represent the residual amount of individual QAs in seeds of CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) compared to WT plants (carrying a gene encoding CYP71 D10 of SEQ ID NO:3).
  • C) Distribution and relative abundance of six minor QAs detected in seeds of WT plants (carrying a gene encoding CYP71 D10 of SEQ ID NO:3) versus CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) (n 3).
  • Data points are peak areas normalized by internal standard (caffeine) and dry seed weight. Bar charts represent mean values ⁇ 1.5 SD.
  • Percentages represent the residual amount of individual QAs in seeds of CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) compared to WT plants (carrying a gene encoding CYP71 D10 of SEQ ID NO:3).
  • WT plants carrying a gene encoding CYP71 D10 of SEQ ID NO:3
  • multiflorine was more abundant in seeds of CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4)
  • the difference compared to WT plants is shown as a fold change.
  • FIG. 4 Co-expression of CYP71 D10 of SEQ ID NO:3 and SDR of SEQ ID NO:5 enables production of lupanine and small amounts of a-isolupanine in N. benthamiana.
  • the traces are representative extracted ion chromatograms (EICs) corresponding to sparteine (m/z 235.22 ⁇ 0.01 , [M+H] + , left column), didehydrosparteinium (m/z 233.20 ⁇ 0.01 , [M] + , middle column) and lupanine (m/z 249.20 ⁇ 0.01 , [M+H] + , right column). Respective traces from the analysis of NLL seed extracts are also shown for comparison.
  • Peak labels correspond to sparteine (peak a), a-isosparteine (peak b), 1 ,2-didehydrosparteinium (peak c), a-isolupanine (peak d), and lupanine (peak e).
  • Figure 5 Purity of (-)-sparteine from seeds of CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4).
  • the acid-base extraction removed non-alkaloidal contaminants, leaving mostly sparteine (-96% by LC-MS peak area) and a small amount (-4%) of 13-hydroxylupanine (peak b), multiflorine (peak c), lupanine (peak d) and a-isosparteine (peak e) as main contaminants.
  • the sparteine peak is highlighted by the grey band.
  • the peak around 8 min corresponds to the internal standard (caffeine, peak f).
  • , where Fraction ((-) isomer) + Fraction ((+) isomer) 1.
  • a mixture of 50% (-) isomer and 50% (+) isomer has an enantiomeric excess of 0%.
  • the mole fractions can be determined in a number of ways known in the art, including but not limited to chromatography using a chiral support, polarimetric measurement of the rotation of polarized light, nuclear magnetic resonance spectroscopy using chiral shift reagents which include but are not limited to lanthanide containing chiral complexes or the Pirkle alcohol, or derivatization of a compounds using a chiral compound such as Mosher's acid followed by chromatography or nuclear magnetic resonance spectroscopy.
  • the enantiomeric purity of (-)-sparteine is determined as described in Example 4 or Example 5 herein below.
  • enzyme refers to proteins or polypeptides which are capable of catalyzing biochemical reactions. Further, unless context dictates otherwise, as used herein "enzyme” includes protein fragments that retain the relevant catalytic activity, and may include artificial enzymes synthesized to retain the relevant catalytic activity.
  • a functional homologue of an amino acid sequence, refers to a polypeptide comprising said amino acid sequence with the proviso that one or more amino acids are substituted, deleted, added, and/or inserted, and which polypeptide has (qualitatively) the same enzymatic functionality for substrate conversion.
  • a functional homologue shares at least at least 70% sequence identity, preferably at least 80%, preferably at least 85% sequence identity, preferably at least 90% sequence identity, preferably at least 95% sequence identity, more preferred at least 98% sequence identity to said amino acid sequence.
  • mature seeds refers to seeds being ready for harvest. Typically, lupin seeds are considered to be mature when the seed are dry. Dry seeds contain less than 30% water, typically less than 20% of water, preferably in the range of 8 to 30% water. % provided as w/w of the total seed.
  • mutant gene refers to a gene carrying at least one mutation such that the mutant gene is incapable of directing the efficient expression of a full- length fully functional gene product.
  • An endogenous gene can be mutated in the sense of the present invention when the endogenous gene comprises one or more mutations, such as: (a) a "missense mutation”, which is a change in the nucleic acid sequence that results in the substitution of an amino acid for another amino acid; (b) a "nonsense mutation” or "STOP mutation”, which is a change in the nucleic acid sequence that results in the introduction of a premature STOP codon and, thus, premature termination of translation (resulting in a truncated protein); plant genes contain the translation stop codons "TGA” (UGA in RNA), "TAA” (UAA in RNA) and “TAG” (UAG in RNA); thus any nucleotide substitution, insertion, deletion which results in one of these codons in the mature mRNA in the reading frame will terminate translation, (
  • a frameshift mutation can have various causes, such as the insertion, deletion or duplication of one or more nucleotides.
  • the mutation(s) in the endogenous gene preferably result in a mutant protein comprising significantly reduced or no biological activity in vivo or in the production of no protein.
  • Any mutation which results in a protein comprising at least one amino acid insertion, deletion and/or substitution relative to the wild type protein can in principle lead to significantly reduced or no biological activity. It is, however, understood that mutations in certain parts of the protein are more likely to result in a reduced function of the mutant CYP71D10 protein, such as mutations leading to truncated proteins, whereby significant portions of the functional domains are lacking.
  • mutant protein means a protein with one or more mutations compared to a protein occurring in nature.
  • the mutant protein has a sequence that differs from that of all proteins occurring in nature.
  • the amino acid sequence of the mutant protein is at least about any of 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 95, 97, 98, 99, or 99.5% identical to that of the corresponding region of a protein occurring in nature.
  • the mutant protein is a protein fragment that contains at least about any of 25, 50, 75, 100, 150, 200, 300, or 400 contiguous amino acids from a full-length protein.
  • Sequence identity can be measured, for example, using sequence analysis software with the default parameters specified therein (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wl 53705). This software program matches similar sequences by assigning degrees of homology to various amino acids replacements, deletions, and other modifications.
  • sequence analysis software with the default parameters specified therein (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wl 53705). This software program matches similar sequences by assigning degrees of homology to various amino acids replacements, deletions, and other modifications.
  • polypeptide refers a sequential chain of amino acids linked together via peptide bonds. The term is used to refer to an amino acid chain of any length, but one of ordinary skill in the art will understand that the term is not limited to lengthy chains and can refer to a minimal chain comprising two amino acids linked together via a peptide bond. As is known to those skilled in the art,
  • sequence identity describes the relatedness between two amino acid sequences or between two nucleotide sequences, i.e. a candidate sequence (e.g. a mutant sequence) and a reference sequence (such as a wild type sequence) based on their pairwise alignment.
  • sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mo/. Biol. 48: 443- 453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.
  • the Needleman-Wunsch algorithm is also used to determine whether a given amino acid in a sequence other than the reference sequence corresponds to a given position in a reference sequence.
  • sequence identity between two nucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the DNAFULL (EMBOSS version of NCBI NLIC4.4) substitution matrix.
  • sparteine refers to (+)-sparteine, (-)-sparteine, or a mixture of both, “(-)-sparteine” is also known as (7S,7aR,14S,14aS)-dodecahydro-2H,6H-7,14- methanodipyrido[1,2-a:1',2'-e][1,5]diazocine, 7,14-Methano-2H,6H-dipyrido[1,2-a:1',2'- e][1,5]diazocine, dodecahydro-, [7S-(7a,7aa,14a,14aP)], CAS number 90-39-1 , Lupinidine, 6-p,7-a,9-a,11-a-Pachycarpine, l-Sparteine , (-)-Esparteina, (-)-Spartein, or (-)-Sparteinium.
  • “(+)-sparteine” is also known as (7R,7aR,14R,14aS)-dodecahydro- 2H,6H-7,14-methanodipyrido[1,2-a:1',2'-e][1 ,5]diazocine, 7,14-Methano-2H,6H- dipyrido[1,2-a:1',2'-e][1,5]diazocine, dodecahydro-, [7R-(7a,7aa,14a,14aP)], CAS number 492-08-0, Pachycarpine, d-Sparteine, (+)-Esparteina, (+)-Spartein, or (+)- Sparteinium.
  • the present disclosure concerns a lupin plant, or part thereof, wherein said lupin plant carries a mutation in either the CYP71D10 gene leading to reduced CYP71 D10 activity or loss-of-function of CYP71D10 or in the SDR gene leading to a reduced SDR activity or loss of function of SDR.
  • the invention further relates to plant products thereof as well as to methods using said lupin plant or parts thereof.
  • sequence of CYP71D10 may vary amongst different lupin species.
  • the mutation of the lupin plants of the invention are mutations compared to the wild type sequence of CYP71 D10 in the particular lupin species.
  • the wild type CYP71D10 gene may be any gene encoding CYP71D10 of SEQ ID NO:3 or SEQ I D NO: 15 or a functional homologue of any of these sharing at least 70% sequence identity thereto. It may be preferred that said wild type CYP71D10 comprises the amino acids, which are conserved amongst CYP71D10 of different lupin species. In particular, it may be preferred that said wild type CYP71D10 comprises some or all of the amino acids, which are conserved between CYP71 D10 of NLL of SEQ ID NO:3 and CYP71 D10 of sweet pearl lupin (Andean lupin) of SEQ ID NO:15, e.g. all of the amino acid, which are not marked in black boxes in the alignment shown in figure 6.
  • the wild type CYP71 D10 gene of NLL is a gene encoding CYP71D10 of SEQ ID NO:3 or a functional homologue thereof sharing at least 70%, preferably at least 80%, such as at least 90%, for example at least 95% sequence identity thereto.
  • the wild type CYP71D10 gene of NLL is a gene encoding CYP71 D10 of SEQ ID NO:3.
  • the wild type CYP71D10 gene comprises the coding sequence provided herein as SEQ ID NO:1.
  • the coding sequence is the part of the genomic sequence encoding a polypeptide, and corresponds to the cDNA sequence.
  • the genomic sequence encoding CYP71 D10 of NLL is SEQ ID NO 16 or a functional homologue thereof sharing at least 70%, preferably at least 80%, such as at least 90%, for example at least 95% sequence identity thereto.
  • CYP71D10 as well as functional homologues thereof preferably have sparteine hydroxylase activity.
  • CYP71 D10 as well as functional homologues thereof preferably have sparteine hydroxylase activity comparable to the sparteine hydroxylase activity of CYP71D10 of SEQ ID NO:3.
  • the mutations disclosed herein in this section are mutations compared to the wild type CYP71D10 gene, which may be any of the wild type CYP71 D10 genes disclosed above.
  • the mutation is a mutation afflicting one more or more of the amino acids, which are conserved amongst CYP71D10 of different lupin species.
  • said mutation results in a mutant CYP71 D10 gene encoding a mutant CYP71D10 protein, which lacks one or more of the amino acids, which are conserved between CYP71D10 of NLL of SEQ ID NO:3 and CYP71 D10 of sweet pearl lupin (Andean lupin) of SEQ ID NO:15, e.g. the amino acid, which are not marked in black boxes in the alignment shown in figure 6.
  • the definition of the position of an amino acid in relation to a polypeptide of the invention is in general made to SEQ ID NO:3 as reference sequence, but it is understood that the sequence of wild type CYP71 D10 from other lupin species or varieties may differ to some extent from the polypeptide sequence of SEQ ID NO:3.
  • an amino acid corresponds to position X of SEQ ID NO:3 if it aligns to the same position.
  • an alignment between different CYP71 D10 is shown in fig.
  • the mutation is one of the following mutations in the CYP7D10 gene: a. a mutation leading to a premature stop codon; b. a mutation in a splice site; c. a frame-shift mutation; d. deletion of the entire CYP71D10 gene or a part thereof; e. a mutation in the active site of CYP71D10 leading to reduced or abolished CYP71D10 activity or; f. a mutation in the promoter region of the CYP71D10 leading to reduced or abolished transcription or translation.
  • the mutant CYP71D10 gene encodes a mutant CYP71D10 protein, wherein said mutant CYP71D10 is truncated.
  • truncated CYP71 D10 comprises the N-terminal part of CYP71 D10, but lacks C-terminal parts.
  • Truncated CYP71 D10 may e.g. be caused by a premature stop-codon.
  • mutant CYP71 D10 comprises the N-terminal part of CYP71D10, lacks the C-terminal part, but comprise another C-terminus, which does not derive from CYP71D10. This may e.g. be the case if the mutation is a mutation in a splice site, causing aberrant splicing or if the mutation is a frame shift mutation.
  • mutant CYP71 D10 may comprise the N-terminal part of CYP71D10, but lack some or all of the C-terminal part.
  • said mutant CYP71D10 lacks at least the 30 most C terminal amino acids, preferably at least the 50 most C terminal amino acids, such as at least the 100 most C terminal amino acids, such as at least the 250 most C terminal amino acids, such as at least the 282 most C terminal amino acids of wild type CYP71 D10, such as CYP71D10 of SEQ ID NO:3.
  • mutant SDR may be truncated or otherwise lack the C-terminal part.
  • the mutant SDR gene encodes a mutant SDR protein lacking at least the 30 most C terminal amino acids, preferably at least the 50 most C terminal amino acids, such as at least the 100 most C terminal amino acids, such as at least the 250 most C terminal amino acids of SDR of SEQ ID NO:5.
  • the mutant CYP71D10 gene encodes a mutant CYP71D10 protein comprising at the most 300 amino acids of wild type CYP71 D10, such as CYP71D10 of SEQ ID NO:3, preferably at the most 250 amino acids of wild type CYP71 D10, such as CYP71D10 of SEQ ID NO:3, more preferably at the most 215 amino acids of wild type CYP71 D10, e.g. CYP71D10 SEQ ID NO:3.
  • the mutant CYP71 D10 gene encodes a mutant CYP71D10 protein comprising at the most the 300 most N-terminal amino acids of wild type CYP71 D10, such as CYP71D10 SEQ ID NO:3, preferably at the most the 250 most N-terminal amino acids of wild type CYP71 D10, such as CYP71D10 SEQ ID NO:3, more preferably at the most the 215 most N-terminal amino acids of wild type CYP71D10, such as CYP71 D10 SEQ ID NO:3.
  • the mutant CYP71D10 gene encodes a mutant CYP71 D10 protein comprising the amino acids corresponding to amino acid 1 to 215 of SEQ ID NO:3 or fewer amino acids.
  • the mutation in the CYP71D10 gene is a premature stop codon.
  • the mutation in the SDR gene is a premature stop codon.
  • the mutation is a premature stop codon positioned at any one of codons 1 to 216 of the CYP71 D10 gene, for example of a CYP71 D10 gene encoding SEQ ID NO:3. Codons are herein numbered according to which amino acid they encode, i.e. the codon encoding the first amino acid of CYP71D10 is codon 1 , the codon encoding amino acid 10 is codon 10 and so forth. In some embodiments of the present disclosure, the mutation is a premature stop codon positioned at codon 216 of the CYP71 D10 gene, for example of a CYP71D10 gene encoding SEQ ID NO:3.
  • the plant carries a guanine to adenine mutation at a position corresponding to nucleotide 647 of the coding sequence of the CYP71 D10 gene of SEQ ID NO:1.
  • the plant is a NLL plant carrying a guanine to adenine mutation at position 647 of SEQ ID NO:1.
  • the mutant CYP71D10 gene encodes mutant CYP71 D10 protein carrying a mutation in one or more amino acid residues crucial for activity of the enzyme.
  • Such sites may e.g. be the catalytic site of the enzyme (i.e., where the reaction catalyzed by the enzyme occurs).
  • the structure and chemical properties of the active site allow the recognition and binding of a binding compound or substrate.
  • the active site typically includes residues responsible for the binding specificity (e.g., charge, hydrophobicity, and/or steric hindrance) and catalytic residues of the enzyme.
  • Sites crucial for activity of CYP71D10 include, but are not limited to residues in the EXXR motif located in the K helix; the conserved aromatic residue found between the K’ helix and the meander region; the Cys-pocket; and residues potentially implicated in substrate binding in CYP71 enzymes such as amino acid corresponding to L366 in CYP71 D375.
  • loss-of-function mutation refers to a mutation, which abolishes at least one activity of an enzyme, preferably a "loss-of- function mutation” abolishes all activity of the enzyme. It should be noted that the mutation can be detected at the nucleic acid level and/or at the protein level. Those of ordinary skills in the art can translate the effect of a nucleic acid variation in a polynucleotide-of-interest on the encoded polypeptide using the Genetic Code Table.
  • the “premature stop codon” may be the result of any nonsense mutations occurring within the coding sequence of a gene. These mutations lead to the synthesis of a truncated, incomplete protein. It should be noted that the mutation can be detected at the nucleic acid level and/or at the protein level. At the DNA level stop codons are usually TAG, TAA or TGA. Those of ordinary skills in the art can translate the effect of a nucleic acid variation in a polynucleotide-of-interest on the encoded polypeptide using the Genetic Code Table.
  • splice site refers to the junction between an exon and an intron in a pre-mRNA (unspliced RNA) molecule (also known as a "splice junction").
  • a splice site mutation according to the invention may be any genetic mutation that inserts, deletes or changes a number of nucleotides in the specific site at which splicing takes place during the processing of precursor messenger RNA into mature messenger RNA.
  • the splice site mutation results in aberrant splicing of the gene carrying said splice site mutation.
  • the “frame-shift mutation” may be any insertion or deletion of nucleotide bases in the coding sequence of a gene, wherein the number of inserted or deleted nucleotides are not multiples of three. It should be noted that the mutation can be detected at the DNA level and/or at the protein level. Those of ordinary skill in the art can translate the effect of a nucleic acid variation in a polynucleotide-of-interest on the encoded polypeptide using the Genetic Code Table.
  • deletion has its common meaning as understood by those of skill in the art, and may refer to molecules that lack one or more nucleotides or portions of a sequence from either terminus or from a non-terminal region, relative to a corresponding full length molecule, for example, as in the case of truncated molecules provided herein.
  • Truncated molecules that are linear biological polymers such as nucleic acid molecules or polypeptides may have one or more of a deletion from either terminus of the molecule or a deletion from a non-terminal region of the molecule.
  • the “promoter region” may be any region right upstream or right next to where a gene is about to be transcribed. It is the region where certain regulatory proteins such as transcription factors will bind. The binding of regulatory proteins leads to control of transcription resulting in activation or inhibition of the transcription process leading to RNA.
  • the mutant CYP71D10 gene encodes mutant CYP71 D10 protein carrying a deleterious mutation in one or more amino acid residues crucial for activity, including but not restricted to: a. residues in the EXXR motif located in the K helix; b. the conserved aromatic residue found between the K’ helix and the meander region; c. the Cys-pocket; d. and residues potentially implicated in substrate binding in CYP71 enzymes.
  • the coding sequence of the mutant CYP71D10 gene may for example be as set forth in SEQ ID NO 2 or a functional homologue thereof sharing at least 70% sequence identity thereto, preferably at least 80%, such as at least 90%, for example at least 95%, such as at least 99% sequence identity thereto.
  • the present disclosure concerns lupin plants, or part thereof carrying mutations in either CYP71D10 or SDR, as well as to methods using such plants and plant products thereof.
  • the mutations may be any of the mutations described herein above in the section “Mutations”.
  • the lupin plant may be any lupin plant carrying such mutation, for example any Lupinus spp..
  • the lupin plant may be selected from the group consisting of white lupin (L. albus), garden lupin (L. polyphyllus), L. babiger, L. montanus, yellow lupin (L luteus L.), sweet pearl lupin (L mutabilis) and narrow-leafed lupin (L. angustifolius).
  • the lupin plant may also be L. argenteus, L. nootkatensis, L. sericeus, L. cosentinii, L. pilosus, or any other lupin species.
  • the lupin plant is a lupin plant that naturally produces enantiomerically pure or near enantiomerically pure QAs derived from (-)-sparteine.
  • the lupin plant may be selected from the group consisting of L. babiger, L. montanus, narrow-leafed lupin (L. angustifolius), or garden lupin (L. polyphyllus).
  • the plant is of the species narrow- leafed lupin (L. angustifolius), which herein also is referred to as NLL.
  • the lupin plant carrying said mutation may be produced by any useful means. In one embodiment, it is preferred that the plant is produced by non-GMO methods.
  • the plant is produced by a method comprising a step of random mutagenesis or is progeny of a plant produced by a method comprising a step of random mutagenesis.
  • the “random mutagenesis” or “mutagenesis” may be performed by any useful method, for example by incubating lupin plants or seeds thereof with a mutagen.
  • useful mutagens include ethyl methanesulfonate (EMS), nitrous acid, mitomycin C, N-methyl-N-nitrosourea (MNU), diepoxybutane (DEB), 1 , 2, 7, 8- diepoxyoctane (DEO), methyl methane sulfonate (MMS), N-methyl- N'-nitro-N- nitrosoguanidine (MNNG), 4-nitroquinoline 1-oxide (4-NQO), 2-methyloxy-6-chloro-9(3- [ethyl-2-chloroethyl]-aminopropylamino)-acridinedihydrochloride (ICR-170), 2-amino purine (2AP), or hydroxylamine (HA).
  • EMS ethyl methane
  • the mutagenesis can be carried out in vivo.
  • the mutagenic process involves the use of the host organisms DNA replication and repair mechanisms to incorporate and replicate the mutagenized base or bases.
  • the random mutagenesis is EMS mutagenesis.
  • lupin plants carrying a particular mutation in CYP71 D10 gene may be prepared and identified using the FIND-IT method, which for example is described by Knudsen et al., 2022 and in patent application WO 2018/001884.
  • the FIND-IT method allows identification of any specific single-nucleotide substitution caused by a mutagen from a library generated by random mutagenesis.
  • the identification of a given specific mutation is reproducible as long as a sufficiently large library is created.
  • lupin plants carrying a particular mutation in CYP71 D10 gene are prepared essentially as described in international patent application WO 2018/001884 or as described in Knudsen et al., 2022 using primers and probes designed to identify a particular mutation in the CYP71D10 gene.
  • the primers are preferably designed so that they are capable of amplifying a fragment of the CYP71D10 gene comprising the site of the desirable mutation, and the probes are preferably designed to distinguish between wild type and mutant at the site of the desirable mutation.
  • Suitable primers and probes for identification of a NLL carrying a guanine to adenine mutation at nucleotide 647 of SEQ ID NO:1 are described herein below in Example 2.
  • Lupin plants carrying a mutation in the CYP71 D10 gene may also be prepared using various site directed mutagenesis methods, which for example can be designed based on the sequence of the coding sequence of SEQ ID NO:1.
  • the lupin plant is prepared using any one of CRISPR, a TALEN, a zinc finger, meganuclease, and a DNA-cutting antibiotic as described in WO 2017/138986.
  • the lupin plant is prepared using CRISPR/cas9 technique, e.g. using RNA-guided Cas9 nuclease.
  • the lupin plant is prepared using a combination of both TALEN and CRISPR/cas9 techniques, e.g. using RNA-guided Cas9 nuclease. This may be done as described in Holme et al., 2017 except that the TALEN and single guide RNA sequence are designed based on the genes sequences provided herein.
  • the lupin plant is prepared using homology directed repair, a combination of a DNA cutting nuclease and a donor DNA fragment. This may be done as described in Sun et al., 2016 except that the DNA cutting nuclease is designed based on the genes sequences provided herein and the donor DNA fragment is designed based on the coding sequence of the mutated lupin variant provided herein.
  • the lupin plant may be in any suitable form.
  • the lupin plant according to the invention may be a viable lupin plant, a dried plant, a homogenized plant, lupin seeds or flour of lupin seeds.
  • the plant may be a mature plant, an embryo, a seed, or the like.
  • Parts of lupin plants may be any suitable part of the plant, such as seeds, embryos, leaves, stems, roots, flowers, or fractions thereof.
  • a fraction may, for example, be a section of a seed, embryo, leaf, stem, root, or flower.
  • Parts of lupin plants may also be a fraction of a homogenate or a fraction of lupin flour.
  • parts of lupin plants may be cells of said lupin plant, such as viable cells that may be propagated in vitro in tissue cultures. In other embodiments, however, the parts of lupin plants may be viable cells that are not capable of maturing into an entire lupin plant, i.e. cells that are not a reproductive material. It is preferred that the lupin plant has not exclusively been obtained by means of an essentially biological process or is progeny of such a plant.
  • the lupin plant may comprise a mutation in the CYP71D10 gene, wherein said mutation has been induced by chemical and/or physical agents, such as sodium azide or EMS.
  • the lupin plant may have been prepared by a method involving a step of induced mutagenesis or said lupin plant may be progeny of a plant prepared by a method involving a step of induced mutagenesis.
  • Said induced mutagenesis may for example be treatment with a mutagenizing chemical, such as sodium azide or EMS.
  • the lupin plant may comprise other mutations.
  • the lupin plants carrying a mutation in the CYP71D10 gene have suitable agronomic properties.
  • Suitable agronomic properties include, but are not limited to suitable growth rates, high yield, good viability or resistance against infections and/or pests.
  • the lupin plants have similar agronomic properties compared to a reference wild type lupin plant.
  • Said reference wild type lupin plant may be any wild type lupin plant not carrying the mutation in the CYP71D10 gene, but otherwise similar. For example, it may be a wild type lupin plant of the same variety as the parent plant.
  • the “yield” refers to the production of seeds, and is preferably based upon the weight and/or the amount of the dry seeds produced by a plant. If the plants are grown in the field, the yield may be based upon the weight and/or the amount of the dry seeds produced by the plants in a given cultivated area at a favourable sowing density.
  • the lupin plant of the invention has a comparable yield (or even an improved yield) compared to a reference wild type lupin plant.
  • the invention also comprises lupin plants carrying a mutation in the CYP71 D10 gene prepared from plant breeding methods, including methods of selfing, backcrossing, crossing to populations, and the like. Backcrossing methods can be used with the present invention to introduce into another cultivar the mutation of the CYP71 D10 gene.
  • a way to accelerate the process of plant breeding comprises the initial multiplication of generated mutants by application of tissue culture and regeneration techniques.
  • another aspect of the present invention is to provide cells, which upon growth and differentiation produce lupin plants carrying the mutation of the CYP71D10 gene.
  • Lupin plants of the invention may be propagated through any conventional methods, such as growing lupin plants in the field.
  • the present disclosure concerns lupin plants, or part thereof carrying mutations in either CYP71D10 or SDR, as well as to methods using such plants and plant products thereof.
  • the mutations may be any of the mutations described herein above in the section “Mutations” and the plants may be any of the plants described herein above in the section “Lupin Plant”.
  • the lupin plants of the invention produces a high level of sparteine, and/or (-)-sparteine at high enantiomeric purity.
  • the mature seeds of the lupin plants of the invention comprise at least 0.005% such as as least 0.01%, such as at least 0.1% such as at least 0.2%, such as at least 0.8% (-)-sparteine, wherein the % is indicated as % of the dry seed weight. In some embodiments of the present disclosure, the mature seeds of the lupin plants of the invention comprise between 0.005% and 10% (-)-sparteine, wherein the % is indicated as % of the dry seed weight.
  • (-)-sparteine accounts for at least 50%, such as for at least 70%, such as for at least 80%, such as for at least 96%, such for at least 99.5% of all quinolizidine alkaloids in mature seeds of the lupin plants of the invention.
  • the (-)-sparteine accounts for between 50% and 100% of all quinolizidine alkaloids in mature seeds of the lupin plants of the invention.
  • the enantiomeric purity of (-)- sparteine in mature seeds of the lupin plants of the invention has an enantiomeric excess (ee) of at least 50%, such as at least 75%, such as at least 90%, such as at least 95%, such as at least 97%, for example at least 99%.
  • the enantiomeric purity of (-)- sparteine in mature seeds of the lupin plants of the invention has an ee between 50% and 100%.
  • enantiomeric excess and "diastereomeric excess” are used herein in their conventional sense. Compounds with a single stereocenter are referred to as being present in “enantiomeric excess”, those with at least two stereocenters are referred to as being present in “diastereomeric excess”.
  • the value of ee will be a number from 0 to 100, zero being racemic and 100 being enantiomerically pure. For example, a 90% ee reflects the presence of 95% of one enantiomer and 5% of the other(s) in the material in question.
  • the enantiomeric excess is preferably determined as described herein below in Example 4 and/or Example 5.
  • the seeds of the lupin plant or a part thereof contains less of one or more quinolizidine alkaloid compared to the seeds of a wild type lupin plant.
  • the seeds of said plant contains less than 50%, such as less than 25%, for example less than 10%, such as less than 5% of one of more quinolizidine alkaloids compared to the seeds of a wild type lupin plant.
  • the seeds of the lupin plant or a part thereof contains less of one or more quinolizidine alkaloid compared to the seeds of a wild type lupin plant
  • said quinolizidine alkaloids are one or more of 13-OH-lupanine, lupanine, augustifoline, 13-OH-a-isolupanine, a-isolupanine, a-iso augustifoline and/or one or more 13-oxylupanine esters.
  • the disclosure concerns a plant product prepared from the lupin plant carrying a mutation in CYP71 D10 or a part thereof.
  • Said plant product may comprise the lupin plant carrying a mutation in CYP71 D10 or a part thereof.
  • the plant product is selected from the group consisting of a. seeds of said lupin plant b. an extract prepared from seeds of said lupin plant; c. flour prepared from the seeds of said lupin plant and/or from the extract; d. a protein isolate prepared from the seeds of said lupin plant e. a food product or a feed product f. leaching water, e.g. prepared by boiling dry seeds of said lupin plant. g. isolated (-)-sparteine
  • more than one plant product can be produced from the same lupin plant.
  • (-)-sparteine may be isolated from seeds of the lupin plant, and the remainder of the seed may be used for production of a protein isolate, as a food product or a feed product.
  • the food product may be any product suitable for human consumption comprising seeds of the lupin plants of the invention, flour thereof, extracts thereof or protein isolates thereof.
  • the present invention also provides methods of producing a plant product from the lupin plants of the invention.
  • the invention provides methods for production of (-)-sparteine.
  • the method of producing (-)-sparteine comprises the steps of: a. providing a lupin plant carrying a mutation in CYP71 D10, or part thereof; b. isolating (-)-sparteine from said plant or part thereof; c. optionally, purifying said (-)-sparteine.
  • the (-)-sparteine is isolated from the seeds of the lupin plant.
  • the (-)-sparteine may be isolated through any useful method known to the skilled person.
  • (-)-sparteine may be isolated by a method comprising one or more of the following:
  • the step of isolating (-)-sparteine comprises extraction, e.g. extraction with a solvent, e.g. a solvent comprising an alcohol, such as methanol and/or acid-base extraction.
  • a solvent e.g. a solvent comprising an alcohol, such as methanol and/or acid-base extraction.
  • solvent includes any liquid that can dissolve or substantially disperse another substance.
  • the acid-base extraction may be any procedure using sequential liquid-liquid extractions to purify compounds from mixtures at differential pH.
  • the acid-base extraction may be performed as follows. The mixture is dissolved in a suitable solvent and poured into a separating funnel. An aqueous solution of the acid or base is added, and the pH of the aqueous phase is adjusted to bring the compound of interest into its required form. After shaking and allowing for phase separation, the phase containing the compound of interest is collected. The procedure is then repeated with this phase at the opposite pH range. The order of the steps is not important and the process can be repeated to increase the separation.
  • acid-base extraction may be carried out using sulphuric acid (H2SO4) and/or sodium hydroxide (NaOH).
  • the method of isolating (-)-sparteine comprises a step of supercritical fluid extraction.
  • supercritical fluid e.g. supercritical carbon dioxide
  • high pressure e.g. 25 MPa
  • co-solvent e.g. ethanol
  • the method of isolating (-)-sparteine comprises a step of chromatography, for example cation exchange chromatography or adsorption chromatography.
  • aqueous solvent e.g. pure water
  • the extract may be run through a cation exchange resin (e.g. AG 50W-X2).
  • the cation exchange resin may be eluted using a basic solvent (e.g. 10% NaOH in ethanol/water 70:30).
  • Adsorption chromatography may involve use of a polymeric resin.
  • the flour may be extracted in basic aqueous solvent (e.g. water basified with 1 M NaOH to pH 11), the extract may be run through a polymeric resin (e.g. Amberlite XAD-16), and the column may be eluted in an organic solvent (e.g. ethanol).
  • basic aqueous solvent e.g. water basified with 1 M NaOH to pH 11
  • the extract may be run through a polymeric resin (e.g. Amberlite XAD-16), and the column may be eluted in an organic solvent (e.g. ethanol).
  • an organic solvent e.g. ethanol
  • the method comprises the step of isolating (-)-sparteine through crystallization and recrystallization.
  • (-)-sparteine is isolated as sparteine sulfate.
  • the step of isolating (-)-sparteine comprises the use of HPLC.
  • HPLC high performance liquid chromatography
  • the methods concerns producing an extract, said method comprising the steps of: a. providing seeds of a lupin plant carrying a mutation in CYP71 D10, or part thereof; b. preparing an extract of said seeds.
  • the “extract” may be any purified or substantially purified fraction or molecule of the plant.
  • the extract may be prepared by extraction with a solvent as described above.
  • the methods concerns producing a flour, said method comprising the steps of: a. providing seeds of a lupin plant carrying a mutation in CYP71D10, or part thereof and/or an extract of the lupin plant; b. preparing a flour of said seeds and/or extract.
  • Flour is usually prepared by grinding or milling dry seeds of the lupin plant.
  • the flour can be prepared by either wet or dry milling.
  • the methods concerns producing a protein isolate, said method comprising the steps of: a. providing seeds of a lupin plant carrying a mutation in CYP71D10, or part thereof and/or an extract of the lupin plant and/or flour of seeds of the lupin plant; b. preparing a protein isolate of said seeds and/or extract.
  • Protein isolates may be prepared by any useful method, for example methods comprising one or more of the following:
  • Air classification e.g. essentially as described in Silventoninen et al., 2018 or in
  • more than one plant product are prepared from the same lupin seeds.
  • first (-)-sparteine may be isolated, and the remainder of the seed may be used for production of e.g. a flour or a protein isolate.
  • Example 1 CYP71D10 is a putative sparteine 2-hydroxylase
  • CYP71D10 The full-length coding sequence of CYP71D10 (SEQ ID NO:3) was amplified from young leaf cDNA of NLL cultivar Oskar using the primers CYP71D10_pEAQ_forward primer of SEQ ID NO:13 (GGCTTAAUATGGAGCTTCAAAACCCTTTC) and CYP71 D10_pEAQ_reverse primer of SEQ ID NO: 14 (GGTTTAAUTTAAGGCATACGAGTAACAATTGGA).
  • the amplified sequences of CYP71 D10 of SEQ ID NO:1 and of the two other oxidase candidates CYP450_1 and CYP450_2 were cloned individually into the plant expression vector pEAQ-USER (Luo, D.
  • Agrobacterium tumefaciens strain AGL-1 Positive clones were verified by Sanger sequencing and transformed into Agrobacterium tumefaciens strain AGL-1.
  • LC-MS analyses were carried out on a Thermo Fisher Dionex 3000 RS HPLC/UPLC system interfaced to a Bruker compact QqTOF mass spectrometer through an ESI source.
  • ESI mass spectra (m/z 50-1000) were acquired in positive ionization mode with automatic MS 2 acquisition using the following parameters: capillary voltage 4500 V; end plate offset -500 V; source temperature 250 °C; desolvation gas flow 8.0 L/min; and nebulizer pressure 2.5 bar.
  • N2 was used as desolvation, nebulizer and collision cell gas.
  • Sparteine and lupanine were identified by comparison with known standards. (+)- and (- )-sparteine were purchased from Sigma-Aldrich. (+)- and rac-lupanine were purchased from Innosil (Poznan, Poland). The identity of the other QAs was inferred from their predicted molecular formula and their mass spectral pattern.
  • Analytes were eluted using the following gradient at a constant flow rate of 0.3 mL/min: 0-1 min, 2% B (constant); 1-16 min, 2-25% B (linear); 16-24 min, 25-65% B (linear), 24-26 min, 65-100% B (linear); 26-27 min, 100% B (constant); 27-27.5 min, 100-2 % B (linear); and 27.5-33 min, 2% B (constant).
  • a CYP71 D10 knockout plant (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) from a recently constructed, non-GMO NLL mutant library was isolated.
  • the basis for the library was the bitter cultivar Oskar, whose seeds predominantly accumulate (+)-lupanine, (+)-13-hydroxylupanine, and (-)-angustifoline.
  • the library was generated by random mutagenesis of seeds of NLL with EMS.
  • the NLL mutant library was screened using the FIND-IT method essentially as described in Knudsen et al.
  • a target-specific forward primer of SEQ ID NO:7 (CYP71 D10_TaqMan_FW: ATATCAGCAATTGAGGAAGG)
  • a target-specific reverse primer of SEQ ID NO:8 (CYP71 D10_TaqMan_RV: TCAAGTTTAGCCTTTGTCTT)
  • a WT-specific probe containing a HEX fluorophore and a BHQ1 quencher of SEQ ID NO:9 CYP71D10WT_TaqMan_HEX: CAGGAGAACTATGGGTTAGT
  • a mutant specific probe containing the FAM fluorophore and a BHQ1 quencher of SEQ ID NQ:10 (CYP71 D10KQ_TaqMan_FAM: CAGGAGAACTATGAGTTAGTGA).
  • the FIND-IT screening phases 2 and 3 were also performed essentially as described in Knudsen et al. (2022) except that seeds of NLL were investigated and above- mentioned primers and probes were used. One heterozygous mutant seed was retrieved. The M2 heterozygous plant that grew from the seed was allowed to self-pollinate. The resulting M3 seeds were sown in 16 cm-wide, 20 cm-deep pots filled with commercial peat-based potting soil and grown in a growth cabinet with a light/dark photoperiod of 16/8 h, a day/night temperature of 21/18 °C, and a relative humidity of 60%.
  • Genomic DNA was extracted from the leaves using the E.Z.N.A.® Plant DNA DS Kit (Omega Bio-tek), and genotyping was carried out by sequencing a 1926 bp-long PCR fragment spanning the entire gene between its start and stop codons using primers CYP71 D10_pEAQ_FW of SEQ ID NO: 11 (GCTTCTGTATATTCTGCCCAAATTCG) and CYP71 D10_pEAQ_RV of SEQ ID NO:12 (CCGCTCACCAAACATAGAAATGC).
  • the coding sequence of the mutated CYP71 D10 gene present in these plants is provided herein as SEQ ID NO: 2, and the plants are herein referred to as CYP71 D10 KO .
  • the amino acid sequence of the mutant CYP71 D10 protein encoded by the mutant gene of CYP71 D10 KO is provided as SEQ ID NO:4.
  • the CYP71 D10 KO plants carry the expected G to A nucleotide change at position 647 in the coding region of CYP71 D10, corresponding to W216Stop mutation.
  • All the M3 WT plants (carrying a gene encoding CYP71 D10 of SEQ ID NO:3) and CYP71 D10 KO (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) homozygous plants were allowed to self-pollinate.
  • Three mature, dry seeds from three WT plants (carrying a gene encoding CYP71 D10 of SEQ ID NO:3) and three CYP71 D10 KO (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) homozygous plants were pulverized using a steel ball with the help of a TissueLyzer bead beater (Qiagen).
  • QAs were extracted from ⁇ 20 mg of seed flour in 1 ml of extractant (60% methanol, 0.06% formic acid, and 15 ppm caffeine in water) for 3 hours at 1200 rpm.
  • the extracts were briefly centrifuged to remove solid residues, diluted 15x with ultrapure water, and filtered through a 0.22-pm filter.
  • the filtered extracts were analyzed by LC-MS as described in example 1.
  • the homozygous CYP71D10 KO knockout mutant (carrying a mutant gene encoding mutant CYP71D10 of SEQ ID NO:4) presented much reduced amounts of the major QAs in seed extracts, with only 0.6%, 2.3%, and 1.4% left, respectively.
  • knockout seeds accumulated large amounts of (-)-sparteine, which could not be detected in extracts of WT seeds.
  • the levels of (-)-sparteine in the extracts accounted for 0.8% of the weight of the mature seeds.
  • CYP71D10 (SEQ ID NO:3) is a gateway enzyme controlling the conversion of (-)-sparteine (major branch) and (-)-a- isosparteine (minor branch) into a variety of tetracyclic and tricyclic QAs found in narrow-leafed lupin. Furthermore, the inventors did not observe any visible phenotypes or apparent yield penalties compared to WT plants (carrying a gene encoding CYP71D10 of SEQ ID NO:3) in the CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71D10 of SEQ ID NO:4) derived from EMS mutagenesis.
  • Example 3 Co-expression of CYP71D10 and SDR enables production of lupanine in N. benthamiana.
  • SDR acts on the immediate product of CYP71D10 (SEQ ID NO:3), 2-hydroxysparteine, converting it to lupanine.
  • Example 4 Enantiomeric purity of (-)-sparteine from seeds of CYP71D10KO plants
  • the extracts were cleared by centrifugation and diluted 15x with ultrapure water. After filtration through a 0.22-pm filter, the extracts were analysed by LC-MS as described in example 2. Sparteine was quantified using an external standard curve, with caffeine used as internal standard.
  • Chiral GC-MS was carried out on a Shimadzu Nexis GC-2030 gas chromatograph equipped with a Shimadzu AGC-6000 autosampler and coupled to a Shimadzu GCMS- QP2020 NX single quadrupole mass spectrometer. Analytes were separated on an Agilent J&W CycloSil-B capillary column (30 m x 0.25 mm x 0.25 pm) using He as carrier gas. Ethyl acetate extracts were injected in splitless mode (1 pl) at an inlet temperature of 250 °C.
  • Analytes were separated using the following column temperature program at a constant carrier gas pressure of 51 .0 kPa: initial 80 °C, hold for 3 min; ramp to 125 °C at 30 °C/min; ramp to 240 °C at 2 °C/min.
  • the separated analytes were ionized using an electron impact ion source at 250 °C.
  • MS spectra were acquired in scan mode (m/z 10-300) at an energy of 70 eV. (+)- and (-)-sparteine were identified by comparison with commercial standards (Sigma-Aldrich). The enantiomeric excess of (-)-sparteine was calculated from the extracted ion chromatogram of m/z 137 (base peak of sparteine).
  • the inventors of the present disclosure conclude that the NLL CYP71 D10 KO (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) ) plants are a valuable source of (-)-sparteine, based on its high yield and enantiomeric purity.
  • Non-chiral GC-MS analysis was carried out on a Shimadzu GCMS-QP2010 Plus single quadrupole gas chromatograph-mass spectrometer equipped with a Shimadzu AOC- 5000 autosampler. Analytes were separated on an Agilent J&W HP-5ms Ultra Inert capillary column (30 m x 0.25 mm, 0.25 pm) using He as carrier gas. Ethyl acetate extracts were injected in splitless mode (1 pl) at an inlet temperature of 250 °C.
  • Analytes were separated using the following column temperature program at a constant carrier gas linear velocity of 33.7 cm/s: initial 80 °C, hold for 3 min; ramp to 150 °C at 30 °C/min; ramp to 300 °C at 6 °C/min; hold for 10 min.
  • the separated analytes were ionized using an electron impact ion source at 250 °C.
  • MS spectra were acquired in scan mode (m/z 30-600) at an energy of 70 eV.
  • the purity of the extracted sparteine was estimated using the %area normalization method. All chromatographic peaks visible in the total ion chromatogram of the extract but absent in that of a blank extraction sample were included in the calculation of the total peak area.
  • Chiral GC-MS analysis was carried out on a Shimadzu Nexis GC-2030 gas chromatograph equipped with a Shimadzu AGC-6000 autosampler and coupled to a Shimadzu GCMSQP2020 NX single quadrupole mass spectrometer.
  • Analytes were separated on an Agilent J&W CycloSil-B capillary column (30 m x 0.25 mm x 0.25 pm) using He as carrier gas.
  • Ethyl acetate extracts were injected in splitless mode (1 pl) at an inlet temperature of 250 °C.
  • Analytes were separated using the following column temperature program at a constant carrier gas linear velocity of 33.7 cm/s: initial 80 °C, hold for 3 min; ramp to 125 °C at 30 °C/min; hold for 120 min; ramp to 240 °C at 2 °C/min.
  • the separated analytes were ionized using an electron impact ion source at 250 °C.
  • MS spectra were acquired in scan mode (m/z 30-600) at an energy of 70 eV. (+)- and (-)- sparteine were identified by comparison with commercial standards (Sigma-Aldrich). The enantiomeric excess of (-)-sparteine was calculated from the extracted ion chromatogram of m/z 137 (base peak of sparteine).
  • the yield of (-)-sparteine isolated from the mutant seeds (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) as the sulfate salt (C15H26N2 2H2SO4, m.p. 262-264 °C decomp.) was 0.33% (on a dry seed weight basis, assuming 100% purity of the isolated salt).
  • the purity of (-)-sparteine in the isolated sulfate salt was >98% as measured by non-chiral GC-MS.
  • the enantiomeric excess of (-)-sparteine in the isolated sulfate salt was >99% as measured by chiral GC-MS.
  • the inventors of the present disclosure conclude that the NLL CYP71 D10 KO plants (carrying a mutant gene encoding mutant CYP71 D10 of SEQ ID NO:4) are a valuable source of (-)-sparteine.
  • Short-chain dehydrogenase/reductase (SDR) enzyme from narrow-leafed lupin cultivar
  • Short-chain dehydrogenase/reductase (SDR) enzyme from narrow-leafed lupin cultivar
  • LmCYP71 D10 The sequence of CYP71 D10 from sweet pearl lupin (Andean lupin), referred to as LmCYP71 D10.
  • Source data raw RNAseq reads deposited in NCBI as BioProject PRJNA318864:
  • a quinolizidine alkaloid (QA)-containing plant preferably a lupin plant, or part thereof, wherein said plant carries a mutation in either the CYP71D10 gene leading to reduced CYP71 D10 activity or loss-of-function of CYP71D10 or the SDR gene leading to a reduced SDR activity or loss of function of SDR.
  • wild type CYP71D10 gene is a gene encoding CYP71 D10 of SEQ ID NO:3, CYP71D10 of SEQ ID NO:15 or a functional homologue of any of the aforementioned sharing at least 70% sequence identity thereto.
  • CYP71 D10 activity is sparteine 2-hydroxylase activity.
  • the mutation in CYP71 D10 is one of the following mutations: a. a mutation leading to a premature stop codon; b. a mutation in a splice site; c. a frame-shift mutation; d. deletion of the entire CYP71D10 gene or a part thereof; e. a mutation in the active site of CYP71 D10 leading to reduced or abolished CYP71D10 activity or; f. a mutation in the promoter region of the CYP71D10 leading to reduced or abolished transcription or translation. 8.
  • mutant CYP71D10 gene encodes a mutant CYP71 D10 protein lacking at least the 30 most C terminal amino acids, preferably at least the 50 most C terminal amino acids, such as at least the 100 most C terminal amino acids, such as at least the 250 most C terminal amino acids, such as at least the 282 most C terminal amino acids.
  • mutant SDR gene encodes a mutant SDR protein lacking at least the 30 most C terminal amino acids, preferably at least the 50 most C terminal amino acids, such as at least the 100 most C terminal amino acids, such as at least the 250 most C terminal amino acids.
  • mutant CYP71D10 gene encodes a mutant CYP71D10 protein comprising at the most 300 amino acids of wild type CYP71 D10, preferably at the most 250 amino acids of wild type CYP71 D10, more preferably at the most 215 amino acids of wild type CYP71 D10.
  • mutant CYP71D10 gene encodes a mutant CYP71D10 protein comprising at the most 300 amino acids of SEQ ID NO:3, preferably at the most 250 amino acids of SEQ ID NO:3, more preferably at the most 215 amino acids of SEQ ID NO:3.
  • mutant CYP71D10 gene encodes a mutant CYP71D10 protein comprising or consisting of amino acid 1 to 215 of SEQ ID NO:4 or fewer amino acids.
  • mutant CYP71D10 gene encodes mutant CYP71D10 protein carrying a mutation in one or more amino acid residues crucial for activity.
  • amino acid residues crucial for activity are part of the EXXR motif located in the K helix; are the conserved aromatic residue found between the K’ helix and the meander region or are part of the Cys-pocket.
  • (-)-sparteine accounts for at least 50%, such as for at least 70%, such as for at least 80%, such as for at least 96% of all quinolizidine alkaloids in mature seeds of said plant.
  • the seeds of said plant contains less of one or more quinolizidine alkaloid compared to the seeds of a wild type lupin plant, for example seeds of said plant contains less than 50%, such as less than 25%, for example less than 10%, such as less than 5% of one of more quinolizidine alkaloids compared to the seeds of a wild type lupin plant.
  • quinolizidine alkaloids are one or more of 13-OH-lupanine, lupanine, augustifoline, 13-OH-a- isolupanine, a-isolupanine, a-iso augustifoline and/or one or more 13- oxylupanine esters.
  • a plant product comprising the lupin plant of any one of the preceding items or a part thereof.
  • a method of producing (-)-sparteine comprising the steps of: a. providing a lupin plant, or part thereof, according to any one of items 1 to 31 b. isolating (-)-sparteine from said plant or part thereof; c. optionally, purifying said (-)-sparteine.
  • the method according to any one of items 38 to 40, wherein the method of isolating (-)-sparteine comprises a step of chromatography, for example cation exchange chromatography, adsorption chromatography using polymeric resins or HPLC.
  • a method of producing as plant product comprising the steps of: a. providing seeds of a lupin plant according to any one of items 1 to 34; b. processing said seeds into a plant product.
  • step b. comprises preparing an extract of said seeds.
  • the method according to item 44, wherein the plant product is a flour and step b. comprises milling or grinding dry seeds of said lupin plant.
  • the method according to item 44, wherein the plant product is a protein isolate and step b. comprises isolating proteins from said seeds.
  • the method according to item 44, wherein the plant product is leaching water and step b. comprises boiling the dry seeds of said lupin plant.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

L'invention concerne des plantes contenant des alcaloïdes de quinolizidine (QA), de préférence des plantes de lupin, portant une mutation soit dans le gène CYP71D10 conduisant à une activité CYP71D10 réduite ou à une perte de fonction de CYP71D10 ou du gène SDR conduisant à une activité SDR réduite ou à une perte de fonction de SDR. De telles plantes accumulent la (-)-spartéine.
PCT/EP2023/087645 2022-12-22 2023-12-22 Production de (-)-spartéine améliorée WO2024133900A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22216192 2022-12-22
EP22216192.9 2022-12-22

Publications (1)

Publication Number Publication Date
WO2024133900A1 true WO2024133900A1 (fr) 2024-06-27

Family

ID=84923164

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/087645 WO2024133900A1 (fr) 2022-12-22 2023-12-22 Production de (-)-spartéine améliorée

Country Status (1)

Country Link
WO (1) WO2024133900A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017138986A1 (fr) 2016-02-09 2017-08-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2018001884A1 (fr) 2016-07-01 2018-01-04 Carlsberg A/S Procédé de criblage d'un mutant dans une population d'organismes par application d'une approche de regroupement et de division

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017138986A1 (fr) 2016-02-09 2017-08-17 Cibus Us Llc Procédés et compositions permettant d'améliorer l'efficacité de modifications génétiques ciblées en utilisant la réparation de gène médiée par des oligonucléotides
WO2018001884A1 (fr) 2016-07-01 2018-01-04 Carlsberg A/S Procédé de criblage d'un mutant dans une population d'organismes par application d'une approche de regroupement et de division

Non-Patent Citations (17)

* Cited by examiner, † Cited by third party
Title
"CAS", Database accession no. 492-08-0
DATABASE GenPept [online] 16 December 2016 (2016-12-16), "PREDICTED: cytochrome P450 71D10-like [Lupinus angustifolius].", XP002811308, retrieved from NCBI Database accession no. XP_019460468.1 *
DATABASE UniProt [online] 3 July 2019 (2019-07-03), "RecName: Full=Cytochrome P450 {ECO:0008006|Google:ProtNLM};", XP002811307, retrieved from EBI accession no. UNIPROT:A0A4P1R600 Database accession no. A0A4P1R600 *
FENN D ET AL.: "Physicochemical, anti- nutritional, and functional properties of air-classified protein concentrates from commercially grown Canadian yellow pea (Pisum sativum) varieties with variable protein levels", CEREAL CHEMISTRY, vol. 99, 2022, pages 157 - 168
FRICK KAREN M ET AL: "Quinolizidine Alkaloid Biosynthesis in Lupins and Prospects for Grain Quality Improvement", FRONTIERS IN PLANT SCIENCE, vol. 8, 31 January 2017 (2017-01-31), XP002811309, ISSN: 1664-462X *
HANE JAMES K. ET AL: "A comprehensive draft genome sequence for lupin ( Lupinus angustifolius ), an emerging health food: insights into plant-microbe interactions and legume evolution", PLANT BIOTECHNOLOGY JOURNAL, vol. 15, no. 3, 23 March 2017 (2017-03-23), GB, pages 318 - 330, XP093147428, ISSN: 1467-7644, Retrieved from the Internet <URL:https://api.wiley.com/onlinelibrary/tdm/v1/articles/10.1111%2Fpbi.12615> DOI: 10.1111/pbi.12615 *
HOLME, I.B. ET AL.: "Evaluation of the mature grain phytase candidate HvPAPhy_a gene in barley (Hordeum vulgare L.) using CRISPR/Cas9 and TALENs", PLANT MOL BIOL, vol. 95, 2017, pages 111 - 121
KNUDSEN, S. ET AL.: "FIND-IT: Accelerated trait development for a green evolution", SCI. ADV., vol. 8, no. 34, 2022, pages 2266, XP002810318
LAWRENSON ET AL., GENOME BIOLOGY, vol. 16, 2015, pages 258
LUO, D. ET AL.: "Oxidation and cyclization of casbene in the biosynthesis of Euphorbia factors from mature seeds of Euphorbia lathyris L", PROC. NATL. ACAD. SCI. U. S. A, vol. 113, 2016, pages E5082 - E5089
MAGALHÃES SARA C Q ET AL: "Alkaloids in the valorization of European Lupinus spp. seeds crop", INDUSTRIAL CROPS AND PRODUCTS, ELSEVIER, NL, vol. 95, 28 October 2016 (2016-10-28), pages 286 - 295, XP029833750, ISSN: 0926-6690, DOI: 10.1016/J.INDCROP.2016.10.033 *
MANCINOTTI DAVIDE ET AL: "Biosynthesis of quinolizidine alkaloids in lupins: mechanistic considerations and prospects for pathway elucidation", NATURAL PRODUCT REPORTS, vol. 39, no. 7, 1 January 2022 (2022-01-01), GB, pages 1423 - 1437, XP093145726, ISSN: 0265-0568, DOI: 10.1039/D1NP00069A *
NEEDLEMANWUNSCH, J. MO/. BIOL., vol. 48, 1970, pages 443 - 453
OHMIYA, S.SAITO, K.MURAKOSHI, I.: "The Alkaloids: Chemistry and Pharmacology", vol. 47, 1995, ACADEMIC PRESS, pages: 1 - 114
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET., vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SILVENTONINEN ET AL.: "Use of air classification technology to produce protein-enriched barley ingredients", JOURNAL OF FOOD ENGINEERING, vol. 222, April 2018 (2018-04-01), pages 169 - 177, XP085313251, DOI: 10.1016/j.jfoodeng.2017.11.016
SUN Y, LI J ET AL.: "Precise Genome Modification via Sequence-Specific Nucleases-Mediated Gene Targeting for Crop Improvement", FRONT PLANT SCI., vol. 7, 20 December 2016 (2016-12-20), pages 1928

Similar Documents

Publication Publication Date Title
AU2021203237B2 (en) Genes involved in noscapine production
US11312973B2 (en) Plant cytochrome P450
CA2731760C (fr) Gene de biosynthese de pyripyropene a
KR20110049769A (ko) 생합성과 관련된 신규의 유전자들
US20130104258A1 (en) Methyltransferase nucleic acids and polypeptides
WO2024133900A1 (fr) Production de (-)-spartéine améliorée
CN112094330B (zh) 多硫代二酮哌嗪合成相关蛋白质及其相关生物材料与应用
WO2024133899A2 (fr) Production d&#39;alcaloïdes végétaux
Polturak Pathway discovery and metabolic engineering of betalains
Häkkinen A functional genomics approach to the study of alkaloid biosynthesis and metabolism in Nicotiana tabacum and Hyoscyamus muticus cell cultures
AU2015200581A1 (en) Plant cytochrome p450