WO2024130898A1 - Engineered strain for producing 2'-fucosyllactose, constructing method, and use - Google Patents

Abstract

Provided are an engineered strain for producing 2'-fucosyllactose, a construction method, and use. By means of multi-copying and over-expression of transcription regulatory factor coding genes rcsA and rcsB on plasmids, plus the in-situ over-expression of a coding gene setA of a sugar efflux transporter A and/or a point mutation of a coding gene map of methionine aminopeptidase, the provided engineered strain is beneficial to improving the fermentation yield of 2'-fucosyllactose. Further, wcaG, gmd, lacY, manA, and manB of the genetically engineered strain are subjected to genome overexpression, lacZ, wcaj, and nudd are knocked out, and futC and manC genes are multi-copied and over-expressed on plasmids, which further promote the fermentation yield of 2'-fucosyllactose.

Description

An engineered strain producing 2′-fucosyllactose and its construction method and application Technical Field

The invention belongs to the technical field of genetic engineering, and specifically relates to an engineering strain producing 2'-fucosyllactose, a construction method and an application thereof.

Background technique

Human milk oligosaccharides (HMOs) are one of the important components of breast milk. Such oligosaccharides have many beneficial effects on the health of newborns, and therefore have received sustained and extensive attention. Compared with chemical synthesis and enzymatic methods, host strains produced by fermentation methods are easy to obtain, highly safe, and low in cost. Therefore, the industry has used engineered microorganisms to study the large-scale production methods of various human milk oligosaccharides. In addition, the development of molecular biology technology and metabolic engineering has also promoted the progress of human milk oligosaccharide production technology. 2'-fucosyllactose (2'-FL), 3-fucosyllactose, lacto-N-tetraose, lacto-N-neotetraose, 3'-sialyllactose, 6'-sialyllactose and some complex fucosylated human milk oligosaccharides have been fermented by engineered bacteria. Among them, the fermentation of 2'-fucosyllactose has been the most extensively studied.

Lu et al. (Lu M, et al. Engineered Microbial Routes for Human Milk Oligosaccharides Synthesis [J]. ACS Synthetic Biology, 2021.) reviewed in detail the latest progress in the research on human milk oligosaccharides, especially 2'-fucosyllactose fermentation technology and strain construction in recent years, and summarized the key enzymes and regulatory factors such as the de novo synthesis pathway and salvage pathway involved in the biosynthesis of 2'-fucosyllactose. In the biosynthesis of 2'-fucosyllactose, the GDP-fucosyllactase encoding gene wcaG, GDP-mannose-4,6-dehydratase encoding gene gmd, β-galactosidase encoding gene lacY, phosphomannose isomerase encoding gene manA, phosphomannose mutase encoding gene manB, UDP-glucose lipid carrier transferase encoding gene wcaj, 2'-fucosyllactose synthase encoding gene futC, mannose-1-phosphate guanine transferase encoding gene manC, etc. play a critical role in the enzymatic step. Sugar efflux transporters are beneficial to reduce the intracellular 2'-fucosyllactose concentration and promote product efflux. Transcriptional regulatory factor genes rcsA and rcsB can positively regulate manA, manB, manC, wcaG, gmd, etc.

GDP-L-fucose is a key precursor for the synthesis of fucosylated human milk oligosaccharides and can be synthesized through the de novo synthesis pathway and the salvage pathway. The de novo pathway is generally used as the preferred pathway for the synthesis of GDP-L-fucose. Inactivation of the lon and/or wcaj genes involved in the biosynthesis of colanic acid, and/or overexpression of the transcriptional regulatory factor gene rcsA, can increase the supply of GDP-L-fucose in cells (Drouillard S, et al. Large-scale synthesis of H-antigen oligosaccharides by expressing Helicobacter pylorialpha1,2-fucosyltransferase in metabolically engineered Escherichia coli cells [J]. Angewandte Chemie, 2010, 118 (11): 1778-1780.). Ni et al. (Ni ZJ, et al. Multi-Path Optimization for Efficient Production of 2′-Fucosyllactose in an Engineered Escherichia coli C41 (DE3) Derivative [J]. Frontiers in Bioengineering and Biotechnology, 2020, 8.) A strain for producing 2'-fucosyllactose was constructed using the lacZ mutant Escherichia coli C41 (DE3). The chromosomal genes wcaJ, nudD and nudK involved in the degradation of precursors GDP-L-fucose and GDP-mannose were deleted. It was found that rcsA and rcsB were more conducive to the formation of GDP-L-fucose, thereby promoting the production of 2'-fucosyllactose.

However, due to the complexity and uncertainty of metabolic patterns and regulatory pathways, the editing of genes encoding different enzymes or transporters, especially the combined editing of multiple enzyme or transporter encoding genes, may have an unpredictable effect on the yield of 2'-fucosyllactose. Therefore, creative work is still needed to continuously improve the engineered bacteria to increase the fermentation yield of 2'-fucosyllactose.

Summary of the invention

In order to solve the above technical problems, the present invention adopts gene editing technology to edit the gene of Escherichia coli transcriptional regulatory factor, etc., and obtains an engineered Escherichia coli bacteria that can increase 2'-fucosyllactose.

One of the technical solutions of the present invention provides an engineered strain for producing 2'-fucosyllactose, wherein the starting strain of the engineered strain is Escherichia coli. The engineered strain overexpresses the transcriptional regulatory factor genes rcsA and rcsB on the plasmid to increase the fermentation yield of 2'-fucosyllactose. In order to further increase the fermentation yield of 2'-fucosyllactose, the sugar efflux transporter A encoding gene setA and/or the methionine aminopeptidase encoding gene map of the engineered strain can also be edited so that the engineered strain overexpresses the sugar efflux transporter A encoding gene setA and/or expresses a methionine aminopeptidase mutant. Wherein, the amino acid sequence of the methionine aminopeptidase mutant corresponds to the 44th amino acid position of the wild-type methionine aminopeptidase (Map) amino acid sequence shown in SEQ ID NO: 24, and has a mutation: I>S, and the homology of the methionine aminopeptidase mutant to the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24 is >90%.

Furthermore, the engineered strain overexpresses the sugar efflux transporter A encoding gene setA, and expresses the aforementioned methionine aminopeptidase mutant; the methionine aminopeptidase mutant amino acid sequence corresponds to the 44th amino acid position of the wild-type methionine aminopeptidase (Map) amino acid sequence shown in SEQ ID NO: 24, and has a mutation: I>S, and the methionine aminopeptidase mutant has a homology of >90% with the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24.

Furthermore, the engineered strain in situ overexpresses the sugar efflux transporter A encoding gene setA, and expresses the aforementioned methionine aminopeptidase mutant; the methionine aminopeptidase mutant amino acid sequence corresponds to the 44th amino acid position of the wild-type methionine aminopeptidase (Map) amino acid sequence shown in SEQ ID NO: 24, and has a mutation: I>S, and the methionine aminopeptidase mutant has a homology of >90% with the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24.

When using prokaryotic cells or other cell systems to ferment and produce specific substances, in order to increase the yield of the target substance, In the past, it was necessary to use genetic engineering technology to increase the expression level of related genes. The technology that significantly improves the expression amount of the target gene is called gene overexpression, including in situ overexpression, plasmid overexpression, etc. Among them, plasmid overexpression is gene overexpression on plasmids, that is, using expression control elements with different transcription or translation strengths, constructing a plasmid library ex situ, and transforming the plasmid into microbial cells. Accompanying the self-replication of the plasmid in the cytoplasm, the expression of the target gene can be quickly achieved. In situ overexpression or chromosome in situ overexpression is a commonly used term in the art, which refers to overexpression in situ, that is, by molecular biological means, such as promoters, ribosome binding sites and transcriptional regulatory factors, or codon optimization, etc., the target gene located in the chromosome in situ is regulated to improve the level of gene transcription and translation.

The additionally inserted promoter for gene overexpression (including in situ overexpression and plasmid overexpression) can be a constitutive promoter and/or an inducible promoter. Undoubtedly, the constitutive promoter and inducible promoter described herein refer to promoters suitable for prokaryotic expression systems, especially promoters suitable for Escherichia coli expression systems, including natural promoters and artificially constructed promoters. Constitutive promoters, such as P _J23102 , P _J23104 , P _J23105 , P _J23108 , P _J23100 , P _J23110 , P J23111, P _J23113 , P _J23116 , P _J23119 , P ₆₃₇ , P ₆₉₉ , etc., have been used in the field of Escherichia coli gene editing. These constitutive promoters and inducible promoters can be used for overexpression of rcsA, rcsB, and _setA .

For in situ overexpression of setA, the in situ expression level of the chromosome of setA can be increased by inserting an additional promoter, and the in situ expression level can be increased by other methods that are easy for a person skilled in the art to think of, such as modifying the promoter activity of the small molecule regulatory RNA gene sgrS in front of the setA gene, or inserting an additional promoter in front of the sgrS gene. Preferably, a constitutive promoter is inserted in front of setA for in situ overexpression and/or a promoter of a chloramphenicol resistance gene is inserted for in situ overexpression. Further preferably, the nucleotide sequence of the promoter of the chloramphenicol resistance gene is as shown in SEQ ID NO: 23.

More preferably, the constitutive promoter used is selected from any one of _PJ23108 , _PJ23110 , _PJ23116 , and _PJ23119 . _PJ23108 , _PJ23110 , _PJ23116 , and _PJ23119 can also be used for overexpression of rcsA and rcsB.

Further preferably, the amino acid sequence of the methionine aminopeptidase mutant is shown in SEQ ID NO: 15. The methionine aminopeptidase mutant shown in SEQ ID NO: 15 has only the 44th amino acid position mutated from isoleucine to serine relative to the aforementioned wild-type methionine aminopeptidase. It has been verified that the methionine aminopeptidase mutant shown in SEQ ID NO: 15 is beneficial to improving the fermentation yield of 2'-fucosyllactose.

Due to the compatibility of codons, an amino acid sequence can be translated and expressed by an infinite number of different nucleic acid sequences. In view of this, the present invention further provides a gene encoding a methionine aminopeptidase mutant shown in SEQ ID NO: 15 that can be expressed in cells, wherein the gene encoding at least comprises a nucleotide fragment shown in SEQ ID NO: 22. Site-directed mutagenesis of a wild-type methionine aminopeptidase encoding gene, and introducing the mutated encoding gene into a genetically engineered bacterium, so that the genetically engineered bacterium can express the methionine aminopeptidase mutant shown in SEQ ID NO: 15. The target gene can be introduced into the genetically engineered bacterium by a plasmid transformation method or the like. Therefore, the genome of the aforementioned engineered strain can contain a nucleotide fragment shown in SEQ ID NO: 22 or a nucleotide sequence fragment encoding the same amino acid sequence, so as to express the methionine aminopeptidase mutant shown in SEQ ID NO: 15.

For rcsA and rcsB, multiple copies of both can be overexpressed.

Furthermore, the nucleotide sequence of the aforementioned rcsA is shown as SEQ ID NO: 20; the nucleotide sequence of the aforementioned rcsB is shown as SEQ ID NO: 21; and the nucleotide sequence of the aforementioned setA is shown as SEQ ID NO: 14.

Furthermore, the starting strain is selected from any one of Escherichia coli K12 MG1655, Escherichia coli BL21 (DE3), Escherichia coli JM109, Escherichia coli W3110, and Escherichia coli BW25113. The above strains have been widely used, and Escherichia coli K12 MG1655 (Escherichia colistrain K12 MG1655) is one of the most famous and well-studied organisms in biology. Among them, E. coli K12 MG1655 has been deposited in the American Type Culture Collection (deposit number ATCC53103, ATCC 47076, ATCC 700926); E. coli BL21 (DE3) has been deposited in BCCM genecorner (deposit number LMBP 1455); E. coli JM109 has been deposited in the American Type Culture Collection (deposit number ATCC68635, ATCC68868); E. coli W3110 has been deposited in the Coli Genetics Stock Center (deposit number CGSC#:4474) and E. coli BW25113 has been deposited in the Coli Genetics Stock Center (deposit number CGSC#7636). As the starting strains commonly used by technicians in the field, those skilled in the art are capable of knowing the sources and purchase channels of the above strains.

In order to further improve the fermentation yield of 2'-fucosyllactose, gene editing can also be performed on the de novo synthesis pathway of 2'-fucosyllactose in the engineered strain, the coding genes of enzymes and transporters related to the salvage synthesis pathway, the lactose lac operon sequence, etc. Preferably, in order to further improve the fermentation yield of 2'-fucosyllactose, at least one of the following genes on the Escherichia coli genome can be knocked out: knock out at least one of the following genes on the Escherichia coli genome: β-galactosidase encoding gene lacZ, UDP-glucose lipid carrier transferase encoding gene wcaj, GDP-mannose hydrolase encoding gene nudd, regulatory gene lacI in the lactose lac operon sequence, L-fucose isomerase encoding gene fucI, L-fucokinase encoding gene fuc K, L-fucose-1-phosphate aldolase encoding gene fucA; and/or overexpression or insertion of at least one of the following genes: GDP-fucose synthase encoding gene wcaG, GDP-mannose-4,6-dehydratase encoding gene gmd, β-galactosidase encoding gene lacY, phosphomannose isomerase encoding gene manA, phosphomannose mutase encoding gene manB, mannose-1-phosphate guanyl transferase encoding gene manC, D-arabinose isomerase encoding gene ara A, L-rhamnose isomerase encoding gene rhaA, 2'-fucosyllactose synthase encoding gene futC, L-fucokinase/GDP-L-fucose pyrophosphorylation gene Enzyme encoding gene fkp.

Specifically, in a preferred embodiment, the engineered strain and the genetically engineered bacteria include the following gene editing: knocking out the β-galactosidase encoding gene lacZ on the Escherichia coli genome;

Insert the GDP-fucose synthase encoding gene wcaG into the E. coli genome;

Insert the GDP-mannose-4,6-dehydratase encoding gene gmd into the Escherichia coli genome;

In situ overexpression of β-galactoside permease encoding gene lacY;

Insert the phosphomannose isomerase encoding gene manA into the Escherichia coli genome;

Inserting the phosphomannose mutase encoding gene manB into the Escherichia coli genome;

Knock out the UDP-glucose lipid carrier transferase encoding gene wcaj in the Escherichia coli genome;

Knock out the GDP-mannose hydrolase encoding gene nudd in the Escherichia coli genome;

The 2'-fucosyllactose synthase encoding gene futC was overexpressed on a plasmid;

The mannose-1-phosphate guanylyltransferase encoding gene manC was overexpressed on the plasmid.

Further, the nucleotide sequence of the aforementioned lacZ is shown in SEQ ID NO: 3; the nucleotide sequence of the aforementioned wcaG is shown in SEQ ID NO: 5; the nucleotide sequence of the aforementioned gmd is shown in SEQ ID NO: 6; the nucleotide sequence of the aforementioned lacY is shown in SEQ ID NO: 7; the nucleotide sequence of the aforementioned manA is shown in SEQ ID NO: 9; the nucleotide sequence of the aforementioned manB is shown in SEQ ID NO: 10; the nucleotide sequence of the aforementioned wcaj is shown in SEQ ID NO: 11; the nucleotide sequence of the aforementioned nudd is shown in SEQ ID NO: 13; the nucleotide sequence of the aforementioned futC is shown in SEQ ID NO: 16; and the nucleotide sequence of the aforementioned manC is shown in SEQ ID NO: 17.

Furthermore, the aforementioned wcaG, gmd, manA, manB, lacY, futC and manC are overexpressed using the Ptrc promoter (an inducible promoter); the plasmid is selected from any one of pTrc99a, pSB4K5, pET28a or pET22b; the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO: 4.

The second technical solution of the present invention provides a construction method of the aforementioned engineering strain, using Escherichia coli K12MG1655 as the starting strain, and the construction method comprises the following steps (in no particular order):

The P _lac promoter sequence and the regulatory gene lacI and the β-galactosidase encoding gene lac Z in the lactose lac operon sequence of the starting strain were knocked out, and the GDP-fucose synthase encoding gene wcaG, the GDP-mannose-4,6-dehydratase encoding gene gmd and the β-galactosidase permease encoding gene lac Y were overexpressed with the P _trc promoter behind the original β-galactosidase encoding gene lac Z site;

The phosphomannose isomerase encoding gene manA and the phosphomannose mutase encoding gene manB were overexpressed by using the P _trc promoter at the alcohol dehydrogenase encoding gene adhe site of the starting strain;

Knock out the UDP-glucose lipid carrier transferase encoding gene wcaj and the GDP-mannose hydrolase encoding gene nudd of the starting strain;

Insert a constitutive promoter in front of setA of the starting strain, and insert the promoter of the chloramphenicol resistance gene;

The methionine aminopeptidase encoding gene mab of the starting strain is point mutated into the encoding gene as shown in SEQ ID NO: 22; a plasmid overexpressing the mannose-1-phosphate guanine transferase encoding gene manC and the 2'-fucosyllactose synthase encoding gene futC is introduced into the starting strain; preferably, a recombinant strain is constructed by constructing a plasmid containing the two genes in series and then introducing it into the starting strain.

The aforementioned engineering strains, mutants, coding genes and gene editing technologies involved in their construction, as well as additionally inserted promoters commonly used to achieve in situ overexpression or plasmid overexpression of the aforementioned genes (such as constitutive promoters P406, P479, P535, etc.; inducible expression promoters Ptac, etc.) are well known in the art, and can be found in "Gene Engineering Experimental Technology" edited by Peng Xiuling et al. (Changsha: Hunan Science and Technology Press, 2nd edition, 1998), "Gene Engineering" edited by Yuan Wuzhou (Beijing: Chemical Industry Press, 2nd edition, 2019), "Principles and Techniques of Genetic Engineering" edited by Wei Yutuo (Beijing: Peking University Press, 1st edition, 2017), "Microbial Engineering" edited by Cao Weijun (Science Press, 2nd edition, 2007), etc. In the previously disclosed technical literature, there are also sufficient disclosures and reports, such as but not limited to the following documents:

(1) Chen D, et al. Development of a DNA double-strand break-free base editing tool in Corynebacterium glutamicum for genome editing and metabolic engineering - Science Direct. Metabolic Engineering Communications, 2020, 11, e00135.

(2) Liu Yang, et al. Metabolic regulation of microbial cell factories. Chinese Journal of Biotechnology, 2021, 37(5): 1541-1563.

(3) Liang ST, et al. Activities of constitutive promoters in Escherichia coli. Journal of Molecular Biology, 1999, 292(1): 19-37.

(4) Zhou L, et al. Chromosome engineering of Escherichia coli for constitutive production of salvianic acid A. Microbial Cell Factories, 2017, 16(1): 84.

(5) Zhao, D, et al. CRISPR/Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Scientific Reports, 2017, 7(1): 16624.

(6) Guo, M, et al. Using the promoters of MerR family proteins as "rheostats" to engineer whole-cell heavy metal biosensors with adjustable sensitivity[J]. Journal of Biological Engineering, 2019, 13(1): 1-9 (PMID: 31452678).

The third technical solution of the present invention provides the use of the aforementioned engineered strain in the fermentation production of 2'-fucosyllactose.

Preferably, the carbon source of the fermentation medium of the engineered strain is selected from at least one of glycerol and lactose; The organic nitrogen source of the fermentation medium of the strain is selected from at least one of yeast powder, tryptone and beef extract; the fermentation temperature is 36° C. to 40° C.; and the pH of the fermentation is 6.8 to 7.8.

Beneficial effects of the present invention:

The inventors of the present invention have conducted a series of gene editing and improvement studies on Escherichia coli and found that overexpression of transcriptional regulatory factor genes rcsA and rcsB on the Escherichia coli plasmid is beneficial to improving the fermentation yield of 2'-fucosyllactose. When setA of Escherichia coli is further overexpressed in situ and the methionine aminopeptidase encoding gene map is point mutated, the fermentation yield of 2'-fucosyllactose can be further improved. On this basis, when beneficial gene editing is further performed on the de novo synthesis pathway and salvage pathway of 2'-fucosyllactose, the lactose lac operon sequence, and the encoding genes of the enzymes related to the degradation of 2'-fucosyllactose synthesis precursors, a higher 2'-fucosyllactose yield can be achieved.

Detailed ways

The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

The primer sequences in the following examples are written from 5' to 3' end.

Example 1 Construction of strain TKYW2-2

Based on the Escherichia coli W2 (E. coli K12MG1655△lacIZ::P _trc -wcaG-gmd-lacy,△adhE::P _trc -manB-manA) described in patent document CN112501106A, the UDP-glucose lipid carrier transferase encoding gene wcaj and the GDP-mannose hydrolase encoding gene nudd on the genome were knocked out, and the sugar efflux transporter gene setA was further overexpressed in situ in the genome to construct strain TKYW2-2.

Here, the construction of Escherichia coli W2 is briefly described based on the content of patent document CN112501106A, and its construction method is introduced into this embodiment. In CN112501106A, Escherichia coli W2 is constructed with Escherichia coli K12 MG1655 as the starting strain, the P _lac promoter sequence and the regulatory genes lacI and lacZ in the lactose lac operon sequence of the starting strain are knocked out, and wcaG, gmd and lacY are overexpressed with the P _trc promoter after the original lacZ site to obtain the W1 strain, and then ManA and ManB are overexpressed with the P _trc promoter at the adhe site of the alcohol dehydrogenase encoding gene to obtain the W2 strain. The nucleotide sequence of the Plac promoter involved in the construction of _Escherichia coli W2 is shown in SEQ ID NO: 1; the nucleotide sequence of lacI is shown in SEQ ID NO: 2; the nucleotide sequence of lacZ is shown in SEQ ID NO: 3; the nucleotide sequence of the _Ptrc promoter is shown in SEQ ID NO: 4; the nucleotide sequence of wcaG is shown in SEQ ID NO: 5; the nucleotide sequence of gmd is shown in SEQ ID NO: The nucleotide sequence of lacY is shown in SEQ ID NO: 6; the nucleotide sequence of adhE is shown in SEQ ID NO: 8; the nucleotide sequence of manA is shown in SEQ ID NO: 9; and the nucleotide sequence of manB is shown in SEQ ID NO: 10.

Construction of strain W2Δwcaj

Using strain W2 as the starting strain, CRISPR/Cas9 technology was used to knock out wcaj (nucleotide sequence is shown in SEQ ID NO: 11). The CRISPR/Cas9 technology used in the experiment refers to the previous research report [Zhao D, et al. CRISPR/Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci Rep 7, 16624]. First, construct the first homologous recombination fragment, including the upstream and downstream homologous arms, the chloramphenicol resistance gene cat and the universal N20+NGG sequence (TAGTCCATCGAACCGAAGTAAGG), and introduce the first homologous recombination fragment into the W2 strain containing the pCAGO plasmid by electroporation for the first step of recombination. The pCAGO plasmid contains the recombinase gene, as well as cas9 and gRNA genes [Zhao D, et al. CRISPR/Cas9-assisted gRNA-free one-step genome editing with no sequence limitations and improved targeting efficiency. Sci Rep 7, 16624]. Select the correct clone and perform the second homologous recombination. Pick the correct clone after the second homologous recombination, pass down the pCAGO plasmid to obtain the W2△wcaj strain with the wcaj gene knocked out.

The following describes the specific method in detail:

(1) Construction of the first step homologous recombination fragment. Using the genome of E. coli strain E. coli K12 MG1655 (GeneBank accession NO. NC_000913) as a template, primers up-1 and up-2, and primers down-1 and down-2 in Table 1 were used to PCR amplify the upstream and downstream homologous arms of homologous recombination. Using the genome of a strain carrying the chloramphenicol resistance gene cat (SEQ ID NO: 12, SEQ ID NO: 12 is the cat gene and its promoter sequence) preserved in the laboratory as a template, primers cat-1 and cat20-2 were used for PCR amplification to obtain a fragment with the cat-N20 sequence. Using the upper and downstream homologous arms, the fragment with the cat-N20 sequence, and these three fragments as templates, primers up-1 and down-2 were used for overlapping PCR amplification to obtain the first step homologous recombination fragment.

(2) First step homologous recombination. The pCAGO plasmid was transformed into strain W2 using conventional plasmid transformation methods to obtain strain W2 (pCAGO). W2 (pCAGO) competent cells were prepared using LB medium containing 1% glucose and 0.1 mM IPTG, and the first homologous recombination fragment was introduced using electroporation. The transformed bacterial solution was spread on an LB plate containing 100 mg/L ampicillin and 25 mg/L chloramphenicol, as well as 1% glucose, and cultured at 30°C. Transformants were picked for colony PCR identification to obtain the correct first step homologous recombination strain.

(3) Second step homologous recombination. The first step homologous recombination strain was inoculated into a medium containing 100 mg/L ampicillin, 0.1 mM IPTG and 2g/L arabinose in LB liquid medium, cultured at 30°C for more than 6h, and single colonies were separated by streaking on plates, and clones that could grow on LB plates containing 100mg/L ampicillin but could not grow on LB plates containing 25mg/L chloramphenicol were screened. Sequencing confirmed the correct clone that underwent the second homologous recombination, and further cultured it at 37°C to lose the pCAGO plasmid, thereby obtaining strain W2△wcaj.

Table 1 Primers used to knock out the wcaj gene

2. Construction of strain W2△wcaj△nudd

Based on the E. coli strain W2△wcaj, the nudd gene on the genome was knocked out using the same method as the above CRISPR/Cas9 technology (nucleotide sequence as shown in SEQ ID NO: 13), and the strain W2△wcaj△nudd was constructed and named ZKYW1. The specific method is described in detail below:

(1) Construction of the first step homologous recombination fragment. Using the genome of strain E. coli K12 MG1655 as a template, the primer pairs Nup-1 and Nup-2 and the primer pairs Ndown-1 and Ndown-2 in Table 2 were used to PCR amplify the upstream and downstream homologous arms of homologous recombination. Using the fragment with the cat-N20 sequence obtained when constructing strain W2△wcaj as a template, the primers Ncat-1 and Ncat20-2 in Table 2 were used for PCR amplification to obtain a new fragment with the cat-N20 sequence. Using the upper and downstream homologous arms and the new fragment with the cat-N20 sequence, these three fragments were used as templates, and overlapping PCR amplification was performed using primers Nup-1 and Ndown-2 to obtain the first step homologous recombination fragment.

(2) First step of homologous recombination. The pCAGO plasmid was transformed into strain W2△wcaj using conventional plasmid transformation methods to obtain strain W2△wcaj (pCAGO). W2△wcaj (pCAGO) competent cells were prepared using LB medium containing 1% glucose and 0.1 mM IPTG (isopropyl-β-D-thiogalactoside), and the first homologous recombination fragment was introduced using electroporation. The transformed bacterial solution was spread on an LB plate containing 100 mg/L ampicillin and 25 mg/L chloramphenicol, as well as 1% glucose, and cultured at 30°C. Transformants were picked for colony PCR identification to obtain the correct first step homologous recombination strain.

(3) Second step of homologous recombination. The steps of the second step of homologous recombination were the same as those for knocking out the wcaj gene. The correct clone that underwent the second homologous recombination was obtained by sequencing and further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining the strain W2△wcaj△nudd, which was named TKYW1.

Table 2 Primers used to knock out the nudd gene

3. Construction of strain TKYW2-2

Based on strain TKYW1, the constitutive promoter P _J23110 (http://parts.igem.org/Part:BBa_J23100) was inserted in front of the sugar efflux transporter setA gene (nucleotide sequence as shown in SEQ ID NO: 14) using the same method as the above-mentioned CRISPR/Cas9 technology. The sequence of the promoter P _J23110 is: TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC; at the same time, when CRISPR/Cas9 was used for the second recombination, the promoter of the chloramphenicol resistance gene (nucleotide sequence as shown in SEQ ID NO: 23) was retained to achieve in situ overexpression of setA by dual promoters. The resulting strain was named TKYW2-2.

(1) The first step is to construct the homologous recombination fragment. Using the genome of strain E. coli K12 MG1655 as a template, the primer pairs Sup-1 and Sup-2 and the primer pairs Sdown-1 and Sdown-2 in Table 3 were used as primers to PCR amplify the upstream and downstream homologous arms of homologous recombination. Using the fragment with the cat-N20 sequence obtained when constructing strain W2△wcaj as a template, the primers Scm-1 and Scm-2 in Table 3 were used for PCR amplification to obtain a fragment with the cat gene sequence. Using N20-1 as the upstream primer and 110-2 as the downstream primer, PCR amplification was performed without using a template to obtain a gene fragment with the P _J23110 promoter. Using Sup-1 and Sdown-2 as primers, the upstream homologous arm obtained by the above PCR amplification, the fragment with the cat gene sequence, the gene fragment with the P _J23110 promoter, and the downstream homologous arm, a total of 4 fragments were used as templates for overlapping PCR amplification to obtain the fragments for the first step of homologous recombination.

Table 3 Primers used to construct strains overexpressing the setA gene in the genome

(2) First step of homologous recombination. The pCAGO plasmid was transformed into the strain TKYW1 using a conventional plasmid transformation method to obtain the strain TKYW1 (pCAGO). The TKYW1 (pCAGO) competent state was prepared using LB medium containing 1% glucose and 0.1 mM IPTG, and the above-mentioned fragments for the first homologous recombination were introduced respectively using the electroporation method. The transformed bacterial liquid was spread on LB plates containing 100 mg/L ampicillin and 25 mg/L chloramphenicol, as well as 1% glucose, and cultured at 30°C. The transformants were picked for colony PCR identification to obtain the correct first step homologous recombination strain.

(3) Second step of homologous recombination. The steps of the second step of homologous recombination were the same as those for knocking out the wcaj gene. The correct clone that underwent the second homologous recombination was obtained by sequencing and further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining a strain with the P _J23110 promoter, named TKYW2-2.

Example 2 Construction of strain TKYW3

The amino acid sequence of the wild-type methionine aminopeptidase of Escherichia coli K12 MG1655 is shown in SEQ ID NO: 24. Based on the strain TKYW2-2, the methionine aminopeptidase gene map on the genome was subjected to point mutation using the same method as the above-mentioned CRISPR/Cas9 technology, and the 44th isoleucine of its translated protein was mutated to serine (Map ^Ile44Ser , the amino acid sequence is shown in SEQ ID NO: 15), and the constructed strain was named TKYW3.

1. Construction of the first homologous recombination fragment

A mutant strain of MG1655map ^T131G (map ^T131G nucleotide sequence is shown in SEQ ID NO: 22) with a point mutation in the map gene preserved in the laboratory was used as a template, and the primer pair Mup-1 and Mup-2, and the primer pair Mdown-1 and Mdown-2 in Table 4 were used as primers to PCR amplify the upstream and downstream homologous arms of homologous recombination. The fragment with the cat-N20 sequence obtained by PCR when constructing strain W2△wcaj was used as a template, and PCR amplification was performed using primers Mcat-1 and Mcat20-2 to obtain a new fragment with the cat-N20 sequence. The upper and downstream homologous arms, the new fragment with the cat-N20 sequence, and these three fragments were used as templates, and overlapping PCR was performed using primers Mup-1 and Mdown-2 to obtain the first homologous recombination fragment, which contains a point mutation in the map gene, that is, the 131st base of the wild-type map gene changes from T to For G.

2. First step: homologous recombination

The pCAGO plasmid was transformed into the strain TKYW2-2 using a conventional plasmid transformation method to obtain the strain TKYW2-2 (pCAGO). The TKYW2-2 (pCAGO) competent state was prepared using LB medium containing 1% glucose and 0.1 mM IPTG, and the first homologous recombination fragment was introduced using an electroporation method. The transformed bacterial solution was spread on an LB plate containing 100 mg/L ampicillin and 25 mg/L chloramphenicol, as well as 1% glucose, and cultured at 30°C. The transformants were picked for colony PCR identification to obtain the correct first step homologous recombination strain.

3. Second step homologous recombination

The steps of the second homologous recombination were the same as those for knocking out the wcaj gene. The correct clone that underwent the second homologous recombination was obtained by sequencing and further cultured at 37°C to lose the pCAGO plasmid, thereby obtaining the strain TKYW2-2map ^T131G , which was named TKYW3.

Table 4 Primers used to construct map gene point mutation strains

Example 3 Construction of plasmid pTrc99a-P _trc -futC-manC

The plasmid pTrc99a-futC-manC described in patent document CN112501106A was used as a template (the nucleotide sequence of the P _trc promoter involved in the construction of the plasmid pTrc99a-futC-manC is shown in SEQ ID NO: 4; the nucleotide sequence of the arabinose-inducible promoter P _ara promoter is shown in SEQ ID NO: 18; the nucleotide sequence of the mannose-1-phosphate guanine transferase encoding gene manC is shown in SEQ ID NO: 17; the nucleotide sequence of the 2'-fucosyllactose synthase encoding gene futC is shown in SEQ ID NO: 16), and PCR amplification was performed using Darac-F and Darac-R in Table 5 as primers. After the PCR product was purified and recovered, the seamless cloning enzyme (pEASY-Uni Seamless Cloning and Assembly Kit, Beijing Quanshijin Biotechnology Co., Ltd.), transformed into Escherichia coli JM109 competent cells, cultured on LB plates containing 100 mg/L ampicillin, and the transformants were picked for sequencing verification to obtain the correct recombinant plasmid, named plasmid pTrc99a-P _trc -futC-manC, whose nucleotide sequence is shown in SEQ ID NO: 19.

Table 5 Primers used to construct plasmid pTrc99a-P _trc -futC-manC

Example 4 Construction of plasmid pTrc99a-P _trc -futC -manC -P _J23116 -rcsA-rcsB

The plasmid pTrc99a-P _trc -futC-manC in Example 4 was constructed by overexpressing the transcriptional regulatory factor genes rcsA (nucleotide sequence as shown in SEQ ID NO: 20) and rcsB (nucleotide sequence as shown in SEQ ID NO: 21) of _Escherichia coli MG1655 using the constitutive promoter P _J23116 . The sequence of the promoter P _J23116 is: _{GTTGACAGCTAGCTCAGTCCTAGGGACTATGCTAGCTAC} (http://parts.igem.org/Part:BBa_J23100).

Plasmid construction process: Using plasmid pTrc99a-P _trc -futC-manC as a template, PCR amplification was performed using amp-f and trc-r in Table 6 as primers to obtain linear vector fragments containing futC and manC genes. Using the genome of Escherichia coli MG1655 (GeneBank accession NO. NC_000913) as a template, PCR amplification was performed using csAB-F and csA-R as primers, and csB-F and csAB-R as primers to obtain fragments containing the transcriptional regulatory factor rcsA gene and fragments containing the transcriptional regulatory factor rcsB gene, respectively. The above three PCR products, namely, the vector fragments containing futC and manC, the fragment with rcsA, and the fragment with rcsB, were purified and recovered, connected using seamless cloning enzyme, transformed into E. coli JM109 competent cells, cultured on LB plates containing 100 mg/L ampicillin, and the transformants were picked for sequencing verification to obtain the correct recombinant plasmid pTrc99a-P _trc -futC-manC-P _J23116 -rcsA-rcsB.

Table 6 Primers used to construct plasmid pTrc99a-P _trc -futC -manC -P _J23116 -rcsA-rcsB

Example 5 Construction and fermentation test of 2'-fucosyllactose producing strain

The plasmid pTrc99a-P _trc -futC-manC was introduced into TKYW1 by electroporation to construct 2'-fucosylated lactone The sugar-producing strain TKYW1 (pTrc99a-P _trc -futC-manC); the plasmids pTrc99a-P _trc -futC-manC and pTrc99a-P _trc -futC-manC-P _J23116 -rcsA-rcsB were introduced into TKYW2-2 and TKYW3, respectively, to construct the 2'-fucosyllactose-producing strains TKYW2-2 (pTrc99a-P _trc -futC-manC) and TKYW3 (pTrc99a-P _trc -futC-manC), TKYW2-2 (pTrc99a-P _trc -futC-manC-P _J23116 -rcsA-rcsB), and TKYW3 (pTrc99a-P _trc -futC-manC ₎ -rcsA-rcsB). The fermentation production level of the above strains was tested using the following culture medium: LB culture medium: NaCl 10 g/L, yeast powder 5 g/L, peptone 10 g/L, pH 7.0. Fermentation medium: _{KH2PO4 3g} /L, yeast powder 8g/L, ( _NH4 ) _{2SO4 4g} /L, citric acid 1.7g/L, MgSO4·7H2O 2g/L, thiamine 10mg/L, glycerol 10g/L, lactose 5g/L, 1ml/L trace elements ( _FeCl3 · _6H2O 25g/L, MnCl2·4H2O 9.8g/ _{L ,} CoCl2·6H2O 1.6g/L, CuCl2·H2O _1g /L, H3BO3 1.9g/L, ZnCl2 2.6g/L, Na2MoO4 _· 2H2O 1.1g/ _L , Na2SeO3 _1.5g / _L , _NiSO4 ·6H2O _25g / _L , _MnCl2 ·4H2O 9.8g/L, CoCl2 _· 6H2O 1.6g/L, _{CuCl2 ·} H2O _1g /L, H3BO3 _1.9g /L, ZnCl2 _2.6g /L ₂ O 1.5 g/l), and the pH was adjusted to 7.2 with aqueous ammonia.

The fermentation test process is:

Pick a single colony of the 2'-fucosyllactose production strain, transfer it to LB liquid medium containing 50mg/L ampicillin, and culture it in a shake flask. The shaker temperature is 37°C and the speed is 220 rpm. Culture overnight. Take 10 microliters of culture solution as a seed and transfer it to a 24-deep well plate containing 1mL of fermentation medium in each well. The fermentation medium contains 50mg/L ampicillin and 0.1mM IPTG. Culture it in a well plate shaking incubator at 37°C and 800 rpm. Culture 3 samples in parallel for each strain. After 48 hours of culture, take a sample of 0.5ml, use an ultrasonic disruptor to break the cells, collect the supernatant by centrifugation, boil for ten minutes, add an equal volume of acetonitrile, collect the supernatant by centrifugation again, and then filter it with a 0.22μm filter membrane. The concentration of 2'-fucosyllactose was detected by HPLC. The column used for HPLC analysis was Carbohydrate ES 5u 250mm×4.6mm, the detector was an evaporative light detector, the mobile phase was 70% acetonitrile (acetonitrile: water), the flow rate was 0.8mL/min, the column temperature was set at 30℃, and the injection volume was 5μL. The sample concentration was quantified using 2'-fucosyllactose standards. The yield of 2'-fucosyllactose is shown in Table 7.

Table 7 Fermentation test results of 2'-fucosyllactose producing strains

It can be seen that the strain TKYW2-2 (pTrc99a-P _trc -futC-manC) overexpressing setA can improve the yield compared with TKYW1 (pTrc99a-P _trc -futC-manC). Taking the 2'-fucosyllactose production of strain TKYW2-2 (pTrc99a-P _trc -futC-manC) as the control, the strain TKYW2-2 (pTrc99a-P _trc -futC-manC-P _J23116 -rcsA-rcsB) with overexpression of rcsA and rcsB can further improve the strain's 2'-fucosyllactose production level by 11.47%; TKYW3 (pTrc99a-P _trc -futC-manC) with the introduction of Map ^Ile44Ser point mutation has a better effect on improving the strain level, with an increase of 48.03%; after a large number of experiments, we found that the strain TKYW3 (pTrc99a-P _trc -futC-manC-P _J23116 -rcsA-rcsB) with overexpression of rcsA and rcsB combined with Map ^Ile44Ser mutation -rcsA-rcsB) can have an unexpected effect, and the level of 2'-fucosyllactose produced by the strain is greatly increased, with an increase of 121.51%, which is significantly better than the effect of rcsA and rcsB overexpression, or Map ^Ile44Se mutation alone, and the result of the simple addition of the two effects (59.50%).

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (17)

1. A 2'-fucosyllactose-producing engineered strain, wherein the starting strain of the engineered strain is Escherichia coli, and the gene editing of the engineered strain comprises: overexpressing transcriptional regulatory factor genes rcsA and rcsB on a plasmid, overexpressing the sugar efflux transporter A encoding gene setA and/or expressing a methionine aminopeptidase mutant, the amino acid sequence of the methionine aminopeptidase mutant corresponds to the 44th amino acid position of the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24, and has a mutation: I>S, and the homology between the methionine aminopeptidase mutant and the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24 is >90%; and the starting strain is Escherichia coli capable of synthesizing 2'-fucosyllactose in vivo.
2. The engineered strain according to claim 1 is characterized in that the engineered strain overexpresses the sugar efflux transporter A encoding gene setA and expresses a methionine aminopeptidase mutant; the amino acid sequence of the methionine aminopeptidase mutant corresponds to the 44th amino acid position of the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24, and has a mutation: I>S, and the methionine aminopeptidase mutant has a homology of >90% with the wild-type methionine aminopeptidase amino acid sequence shown in SEQ ID NO: 24.
3. The engineered strain according to claim 2 is characterized in that the engineered strain in situ overexpresses the sugar efflux transporter A encoding gene setA, and a constitutive promoter is inserted in front of the sugar efflux transporter A encoding gene setA for in situ overexpression and/or a promoter of a chloramphenicol resistance gene is inserted in front of the sugar efflux transporter A encoding gene setA for in situ overexpression.
4. The engineered strain according to claim 3 is characterized in that the nucleotide sequence of the promoter of the chloramphenicol resistance gene is as shown in SEQ ID NO: 23.
5. The engineered strain according to claim 1 is characterized in that the amino acid sequence of the methionine aminopeptidase mutant is as shown in SEQ ID NO: 15.
6. The engineered strain according to claim 5 is characterized in that the genome of the engineered strain contains at least the nucleotide fragment shown in SEQ ID NO: 22 or a nucleotide sequence fragment encoding the same amino acid sequence.
7. The engineered strain according to claim 1, characterized in that the rcsA and rcsB are overexpressed in multiple copies.
8. The engineered strain according to claim 1 is characterized in that the rcsA, rcsB, and sugar efflux transporter A coding gene setA are overexpressed using a constitutive promoter.
9. The engineered strain according to claim 8, characterized in that the constitutive promoter is selected from any one of P _J23102 , P _J23104 , P _J23105 , P _J23108 , P _J23100 , P _J23110 , P _J23111 , P _J23113 , P _J23116 , P _J23119 , P ₆₃₇ , and P ₆₉₉ .
10. The engineered strain according to claim 1, characterized in that the nucleotide sequence of rcsA is shown in SEQ ID NO: 20; the nucleotide sequence of rcsB is shown in SEQ ID NO: 21; and the nucleotide sequence of the sugar efflux transporter A encoding gene setA is shown in SEQ ID NO: 14.
11. The engineered strain according to claim 1 is characterized in that the starting strain is selected from any one of Escherichia coli K12 MG1655, Escherichia coli BL21 (DE3), Escherichia coli JM109, Escherichia coli W3110, and Escherichia coli BW25113.
12. The engineered strain according to claim 1, characterized in that the engineered strain further comprises gene editing of genes encoding enzymes or transporters related to the 2'-fucosyllactose synthesis pathway;

    Preferably, it includes knocking out at least one of the following genes on the Escherichia coli genome: knocking out at least one of the following genes on the Escherichia coli genome: β-galactosidase encoding gene lacZ, UDP-glucose lipid carrier transferase encoding gene wcaj, GDP-mannose hydrolase encoding gene nudd, the regulatory gene lacI in the lactose lac operon sequence, L-fucose isomerase encoding gene fucI, L-fucokinase encoding gene fucK, L-fucose-1-phosphate aldolase encoding gene fucA, D-arabinose isomerase encoding gene ara A, L- Rhamnose isomerase encoding gene rhaA; and/or it includes overexpression or insertion of at least one of the following genes: GDP-fucose synthase encoding gene wcaG, GDP-mannose-4,6-dehydratase encoding gene gmd, β-galactosidase encoding gene lacY, phosphomannose isomerase encoding gene manA, phosphomannose mutase encoding gene manB, mannose-1-phosphate guanine transferase encoding gene manC, 2'-fucosyllactose synthase encoding gene futC, L-fucokinase/GDP-L-fucose pyrophosphorylase encoding gene fkp;

    More preferably, the genetically engineered bacteria include the following gene editing:

    Knock out the β-galactosidase encoding gene lacZ in the Escherichia coli genome;

    Insert the GDP-fucose synthase encoding gene wcaG into the E. coli genome;

    Insert the GDP-mannose-4,6-dehydratase encoding gene gmd into the Escherichia coli genome;

    In situ overexpression of β-galactoside permease encoding gene lacY;

    Insert the phosphomannose isomerase encoding gene manA into the Escherichia coli genome;

    Inserting the phosphomannose mutase encoding gene manB into the Escherichia coli genome;

    Knock out the UDP-glucose lipid carrier transferase encoding gene wcaj in the Escherichia coli genome;

    Knock out the GDP-mannose hydrolase encoding gene nudd in the Escherichia coli genome;

    The 2'-fucosyllactose synthase encoding gene futC was overexpressed on a plasmid;

    The mannose-1-phosphate guanylyltransferase encoding gene manC was overexpressed on the plasmid.
13. The engineered strain according to claim 12 is characterized in that the GDP-fucose synthase encoding gene wcaG, the GDP-mannose-4,6-dehydratase encoding gene gmd, the phosphomannose isomerase encoding gene manA, and the phosphomannose mutase encoding gene manB are single-copy inserted into the genome for overexpression; the mannose-1-phosphate guanine transferase encoding gene manC and the 2'-fucosyllactose synthase encoding gene futC are multi-copy overexpression.
14. The engineering strain according to claim 12 is characterized in that the GDP-fucose synthase encoding gene wcaG, GDP-mannose-4,6-dehydratase encoding gene gmd, phosphomannose isomerase encoding gene manA, phosphomannose mutase encoding gene manB, β-galactoside permease encoding gene lacY, 2'-fucosyllactose synthase encoding gene futC and mannose-1-phosphate guanine transferase encoding gene manC are overexpressed using the Ptrc promoter; the plasmid is selected from any one of pTrc99a, pSB4K5, pET28a or pET22b; the nucleotide sequence of the Ptrc promoter is shown in SEQ ID NO: 4.
15. The engineered strain according to claim 12 is characterized in that the nucleotide sequence of the β-galactosidase encoding gene lacZ is as shown in SEQ ID NO: 3; the nucleotide sequence of the GDP-fucose synthase encoding gene wcaG is as shown in SEQ ID NO: 5; the nucleotide sequence of the GDP-mannose-4,6-dehydratase encoding gene gmd is as shown in SEQ ID NO: 6; the nucleotide sequence of the β-galactoside permease encoding gene lacY is as shown in SEQ ID NO: 7; the nucleotide sequence of the phosphomannose isomerase encoding gene manA is as shown in SEQ ID NO: 9 as shown; the nucleotide sequence of the phosphomannose mutase encoding gene manB is as shown in SEQ ID NO: 10; the nucleotide sequence of the UDP-glucose lipid carrier transferase encoding gene wcaj is as shown in SEQ ID NO: 11; the nucleotide sequence of the GDP-mannose hydrolase encoding gene nudd is as shown in SEQ ID NO: 13; the nucleotide sequence of the 2'-fucosyllactose synthase encoding gene futC is as shown in SEQ ID NO: 16; the nucleotide sequence of the mannose-1-phosphate guanine transferase encoding gene manC is as shown in SEQ ID NO: 17.
16. The method for constructing an engineered strain according to any one of claims 12 to 15, characterized in that the starting strain is selected from Escherichia coli K12 MG1655, and the construction method comprises the following steps in no particular order:

    The P _lac promoter sequence and the regulatory gene lacI and the β-galactosidase encoding gene lacZ in the lactose lac operon sequence of the starting strain were knocked out, and the GDP-fucose synthase encoding gene wcaG, the GDP-mannose-4,6-dehydratase encoding gene gmd and the β-galactosidase permease encoding gene lac Y were overexpressed with the P _trc promoter behind the original β-galactosidase encoding gene lac Z site;

    The phosphomannose isomerase encoding gene manA and the phosphomannose mutase encoding gene manB were overexpressed by using the P _trc promoter at the alcohol dehydrogenase encoding gene adhe site of the starting strain;

    Knock out the UDP-glucose lipid carrier transferase encoding gene wcaj and the GDP-mannose hydrolase encoding gene nudd of the starting strain;

    Insert a constitutive promoter in front of setA of the starting strain, and insert the promoter of the chloramphenicol resistance gene;

    The methionine aminopeptidase encoding gene mab of the starting strain was point mutated into the encoding gene as shown in SEQ ID NO: 22; the overexpressed mannose-1-phosphate guanine transferase encoding gene manC and 2'-fucosyllactose were introduced into the starting strain. Preferably, the recombinant strain is constructed by constructing a plasmid containing the two genes in tandem and then introducing the plasmid into the starting strain.
17. Use of the engineered strain according to any one of claims 1 to 15 or the engineered strain constructed according to claim 16 in the fermentation production of 2'-fucosyllactose; preferably, the carbon source of the fermentation medium of the engineered strain is selected from at least one of glycerol and lactose; the organic nitrogen source of the fermentation medium of the engineered strain is selected from at least one of yeast powder, trypsin, and beef extract; the fermentation culture temperature is 36°C to 40°C; the fermentation culture pH is 6.8 to 7.8.