WO2024128831A1

WO2024128831A1 - Method for producing novel hydroxy fatty acid

Info

Publication number: WO2024128831A1
Application number: PCT/KR2023/020664
Authority: WO
Inventors: 오덕근; 이태의
Original assignee: 건국대학교 산학협력단
Priority date: 2022-12-15
Filing date: 2023-12-14
Publication date: 2024-06-20
Also published as: KR20240094252A

Abstract

The present invention relates to a method for producing a hydroxy fatty acid that has not been previously identified and, more specifically, to a method for producing a novel hydroxy fatty acid from a fatty acid substrate by combining a coral-derived 8R-lipoxygenase and a micro-organism-derived 15S-lipoxygenase. According to the present invention, it is possible to produce 10-epi-protectin DX (an epimer of protectin DX at C10; 10-epi-PDX), 8R,15S-DiHEPA, and 10R,17S-DiHDPA, with high productivity and high yield, by using an environmentally friendly method. The 10-epi-PDX, 8R,15S-DiHEPA, and 10R,17S-DiHDPA can be effectively used in various industrial fields such as medicines, functional foods, and functional cosmetic products, and are expected to be involved in various physiological functions in animals including humans.

Description

Novel method for producing hydroxylated fatty acids

The present invention relates to a method for producing hydroxylated fatty acids that has not been identified so far, and more specifically, to produce new hydroxylated fatty acids from fatty acid substrates by combining 8 R -lipoxygenase from coral and 15 S -lipoxygenase from microorganisms. It is about manufacturing method.

The present invention is a research project of "Identification of microbial biosynthesis and inflammation/obesity control mechanism of human oxylipin based on metabolite profiling" of the Group Research Support (R&D)-Basic Research Project (Basic Laboratory Development) supported by the Ministry of Science and ICT (MSIT) Project identification number: 1711119421, performing organization: Konkuk University Industry-Academic Cooperation Foundation, research period: 2020.07.01 ~ 2023.08.31) was carried out with support.

Hydroxylated fatty acids generally refer to substances that have a hydroxyl group in fatty acids, and are natural substances that exist in the lipids of various living organisms such as animals, plants, insects, and microorganisms. In particular, hydroxyl fatty acids are highly reactive and are used industrially as raw materials. They reduce surface tension due to the action of hydroxyl groups and have high antibacterial and antifungal activities, so they are used as raw materials for cosmetics. Among various living organisms, hydroxylated fatty acids found in animals are used as precursors for signaling substances in the human body, and as a single substance, they are involved in various physiological activities. Among lipid mediators, a type of human signaling substance, protectin is produced by forming an epoxide intermediate from docosahexaenoic acid by lipoxygenase and then converted back by lipoxygenase, or has other site specificity. It is produced by combining two lipoxygenases. Lipid regulators, including protectins, are important substances involved in various physiological functions such as homeostasis regulation and immune response in mammals, including humans.

Among the protectins, protectin D1 (protectin D1, PD1, 10 R , 17 S -dihydroxy-4 Z , 7 Z , 11 E , 13 E , 15 Z , 19 Z -docosahexaenoic acid) is an endogenous stereoselective lipid mediator. It is a substance derived from docosahexaenoic acid, a low-omega fatty acid, and was mainly found in tissues such as the retina, lungs, and nervous system. This substance acts as an anti-inflammatory, anti-cancer agent, and neuroprotector. Studies on stroke patients and Alzheimer's disease animal models have confirmed that treatment with this substance potentially reduces inflammation caused by oxidative stress and prevents cell degeneration by inhibiting the induction of cell death. did. It is also known to have the ability to inhibit the infectious ability of avian influenza viruses such as H5N1 and relieve inflammation by weakening the ability of influenza virus replication. Considering the effectiveness of protectin treatment, which has been confirmed not to induce harmful effects on the host's RNA that can cause harmful side effects in host cells, this substance with strong anti-inflammatory ability in viral or bacterial inflammation was used as a biomedical agent for viral infections. This suggests that it can serve not only as a marker but also as a new antiviral agent. On the other hand, protectin is protectedin D1 (protectin D1, PD1, 10 R , 17 S -dihydroxy-4 Z , in the case of 10 R , 17 S -dihydroxy docosahexaenoic acid) depending on the chirality of the hydroxyl group. For 7 Z , 11 E , 13 E , 15 Z , 19 Z -docosahexaenoic acid), 10 S , 17 S -dihydroxy docosahexaenoic acid, protectin DX, PDX, 10 S , 17 S -dihydroxy -4 Z , 7 Z , 11 E , 13 Z , 15 E , 19 Z -docosahexaenoic acid). PDX, like PD1, is also a substance with anti-inflammatory properties and inhibits the influx of circulating white blood cells into the peritoneum in an inflammatory mouse model. It also inhibits cyclooxygenase, thereby suppressing the formation of prostaglandins and blocking the aggregation reaction of platelets. Protectin has the potential as a next-generation medical substance to replace chemically synthesized drugs that have side effects, and can be used as a research material in various fields such as medicine, biology, and biotechnology.

Lipoxygenase (LOX) is a dioxygenating enzyme and catalyzes the reaction that synthesizes oxidized fatty acids. Although it is an oxidizing enzyme, it is characterized by not having heme; instead, it is an enzyme containing iron. Characteristically, it catalyzes stereospecificity and reaction specificity through dioxygenation reaction by using polyunsaturated fatty acid having one or multiple cis, cis 1,4-pentadiene as a substrate. Position specificity varies depending on the type of polyunsaturated fatty acid used as a substrate. Among them, arachidonic acid 8 R -lipoxygenase (hereinafter referred to as 8 R) generates an R -type hydroxyl group at position 8 of arichidonic acid of animal polyunsaturated fatty acids. -In the case of lipoxygenase), it specifically forms an R -type hydroxyl group only at the 8th carbon position in unsaturated fatty acids with more than 20 carbon atoms, such as arachidonic acid. Additionally, this enzyme forms an R -type hydroxyl group at the 10th carbon position in unsaturated fatty acids with more than 22 carbon atoms. 8 In the case of R -lipoxygenase, its presence has been reported in corals, marine organisms. As an additional enzyme to be used in protectin biosynthesis, arachidonic acid 15 S -lipoxygenase (hereinafter referred to as 15 S -lipoxygenase) contains S - at the 15th carbon position in unsaturated fatty acids with 20 or more carbon atoms, such as arachidonic acid. Forms a hydroxyl group. Additionally, in unsaturated fatty acids with more than 22 carbon atoms, an S -type hydroxyl group is formed at the 17th carbon position.

Protectin D1 and Protectin DX reported to date are substances with strong anti-inflammatory properties, antiviral properties, and various functional properties. However, the need for new compounds with various functionalities continues.

Accordingly, the present inventors made diligent efforts to produce a new compound that could have similar functionality to Protectin D1 and Protectin DX, and as a result, the two site-specific lipoxygenase-containing whole cells were combined through a reaction to form Doco. To biosynthesize new compounds from sahexaenoic acid, conversion by whole cells containing each lipoxygenase was confirmed, 8 R -lipoxygenase (8 R -LOX) and 15 S -lipoxygenase (15R-LOX). ), it was confirmed that 10 R -hydroxylated docosahexaenoic acid (10 R -HDHA) and 17 S -hydroxylated docosahexaenoic acid (17 S -HDHA) can be biosynthesized from docosahexaenoic acid alone. The resulting 10 R -hydroxylated docosahexaenoic acid was reacted with 15 S -lipoxygenase to produce 10-epi-protectin DX (epimer of protectin DX at C10; 10-epi) in two steps from docosahexaenoic acid. The present invention was completed by confirming that -PDX) can be biosynthesized.

The 10-epi-protectin DX has never been independently analyzed and identified by LC-MS and LC-MS/MS, and was produced alone for the first time in the present invention and identified through NMR. In addition, since the 10-epi-protectin DX has a protectin-like structure, it is expected to have similar functionality to the previously reported protectins D1 and DX.

Furthermore, the present inventors combined the 8 R -lipoxygenase and 15 S -lipoxygenase to produce 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z from eicosapentaenoic acid (EPA). 17 Z -pentaenoic acid (8R-HEPA), 8R,15S-dihydroxyicosa-5,9,11,14,17-pentaenoic acid (8R,15S-DiHEPA) can be biosynthesized, and docosapentaenoic acid , DPA) to 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA), 10R,17S-Dihydroxy-4,7,11,13,15-docosapentaenoic acid (10 R , 17 S -DiHDPA) was confirmed to be capable of biosynthesis. 8R,15S-DiHEPA and 10R , 17S -DiHDPA are novel compounds that have not been identified so far.

The present invention was derived from the above necessity, and the object of the present invention is to provide a hitherto unidentified compound, 10-epi-protectin DX (epimer of protectin DX at C10; 10-epi-PDX), 8R,15S-DiHEPA. and 10 R , 17 S -DiHDPA, and a method of producing the compounds in high yield through a combination reaction of whole cells containing 8 R -lipoxygenase from coral and whole cells containing 15 S -lipoxygenase from microorganisms. We would like to provide.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

In order to achieve the above object, in one aspect the present invention uses 8 R -lipoxygenase derived from Plexaura homomalla coral and 15 S -lipoxygenase derived from Archangium violaceum strain. A composition for producing 10-Epimer protectin DX (10-epi-PDX) containing the active ingredient is provided.

In the present invention, the 10-Epimer protectin DX (10-epi-PDX) is characterized by being represented by the following formula (1).

[Formula 1]

In the present invention, the 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) is 10 R , 17 S -dihydroxy-4 Z , 7 Z , 11 E , 13 Z , 15 E ,19 Z -docosahexaenoic acid.

In the present invention, the 8 R -lipoxygenase may be characterized as consisting of an amino acid sequence represented by SEQ ID NO: 1 and/or a base sequence represented by SEQ ID NO: 2.

In the present invention, the 15 S -lipoxygenase may be characterized as consisting of an amino acid sequence represented by SEQ ID NO: 3 and/or a base sequence represented by SEQ ID NO: 4.

In the present invention, the composition may be characterized as comprising docosahexaenoic acid and/or 10 R -hydroxydocosahexaenoic acid as a substrate.

In another aspect, the present invention is for producing 10-epi-protectin DX (epimer of protectin DX at C10) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. A composition is provided.

In the present invention, the composition may be characterized as comprising 10 R -hydroxydocosahexaenoic acid as a substrate.

In another aspect, the present invention includes 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain as active ingredients. A composition for producing 8 R ,15 S -DiHEPA is provided.

In the present invention, the 88 R ,15 S -DiHEPA is characterized by being represented by the following formula (2).

[Formula 2]

In the present invention, the 88 R ,15 S -DiHEPA is 8R,15S-dihydroxyicosa-5,9,11,14,17-pentaenoic acid.

In the present invention, the composition includes eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA) as a substrate. It may be characterized as including.

In another aspect, the present invention provides a composition for producing 8 R , 15 S -DiHEPA containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.

In the present invention, the composition may be characterized as comprising 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA) as a substrate.

In another aspect, the present invention includes 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain as active ingredients. A composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA) is provided.

In the present invention, the 10-epi-PDXn-3 (10R,17S-DiHDPA) is characterized by being represented by the following formula (3).

[Formula 3]

In the present invention, the 10-epi-PDXn-3 (10R17S-DiHDPA) is 10R,17S-Dihydroxy-4,7,11,13,15-docosapentaenoic acid.

In the present invention, the composition includes docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA) as a substrate. You can do this.

In another aspect, the present invention provides a composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. to provide.

In the present invention, the composition may be characterized in that it contains 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA) as a substrate.

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It provides a recombinant expression vector for producing 10-epi-protectin DX (epimer of protectin DX at C10) containing a sequence.

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It provides a recombinant expression vector for producing 8 R , 15 S -DiHEPA, including a sequence.

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It provides a recombinant expression vector for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing a sequence.

In the present invention, the recombinant expression vector contains a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. The encoding sequence may be characterized as comprising an operably linked promoter.

In another aspect, the present invention provides a 10-epi-protectin DX (epimer of protectin DX at C10) comprising a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain. Recombinant expression vectors for production are provided.

In another aspect, the present invention provides a recombinant expression vector for producing 8 R , 15 S -DiHEPA comprising a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain. .

In another aspect, the present invention provides a recombination for producing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain. Expression vectors are provided.

In another aspect, the present invention provides a transformant into which the recombinant expression vector is introduced.

In the present invention, the transformant may be any microorganism that can be transformed with a recombinant expression vector to overexpress the target gene and produce an active enzyme protein, and the microorganism is Escherichia coli. And it may be characterized by possessing genetic information similar to that of E. coli.

In the present invention, the microorganism that can be used for transformation is Escherichia coli and a microorganism that possesses genetic information similar to Escherichia coli, for example, a microorganism that has more than 70% homology to the amino acid sequence of Escherichia coli. You can.

In the present invention, the microorganisms include Escherichia coli , enteric bacteria (e.g., Salmonella , Shigella , or Klebsiella ), and Gram-negative groups (e.g., Pseudomonas , Zymomo). It may be characterized as being one or more selected from the group consisting of Zymomonas mobilis and Bdellovibrio ).

In the present invention, transformation of microorganisms with the recombinant expression vector can be performed by transformation techniques known to those skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion. mediated fusion, microinjection, liposome-mediated method, in planta transformation, vacuum infiltration method, floral meristem dipping method. ) and Agrobacteria spraying method.

In another aspect, the present invention provides a recombinant cell for producing 10-epi-protectin DX (epimer of protectin DX at C10) containing a transformant and/or a culture medium thereof.

In another aspect, the present invention provides a recombinant cell for producing 8 R , 15 S -DiHEPA comprising a transformant and/or a culture medium thereof.

In another aspect, the present invention provides a recombinant cell for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing a transformant and/or a culture medium thereof.

In another aspect, the present invention provides a method for producing 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) comprising the following steps.

(a) a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and a sequence encoding 15 S -lipoxygenase from Archangium violaceum strain; Preparing a transformant using a recombinant expression vector; and

(b) Recover whole-cells from the microorganism and/or its culture medium and treat the whole-cells with a substrate to produce 10-epi-protectin DX (epimer of protectin DX at) through bioconversion. C10, 10-epi-PDX) manufacturing steps.

In the present invention, the 8 R -lipoxygenase in step (a) is characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 1 and/or the base sequence represented by SEQ ID NO: 2.

In the present invention, the 15 S -lipoxygenase in step (a) may be characterized as consisting of an amino acid sequence represented by SEQ ID NO: 3 and/or a base sequence represented by SEQ ID NO: 4.

In the present invention, the substrate in step (b) may include docosahexaenoic acid and/or 10 R -hydroxydocosahexaenoic acid . .

In the present invention, the whole cells in step (b) contain 8 R -lipoxygenase, and the concentration of the whole cells may be 2 to 8 g/L.

In the present invention, the substrate in step (b) is docosahexaenoic acid, and the substrate may be treated at a concentration of 1.0mM to 3.0mM.

In the present invention, the substrate of step (b) is docosahexaenoic acid, and step (b) may be performed at pH 7.0 to 9.0.

In the present invention, the substrate of step (b) is docosahexaenoic acid, and step (b) may be performed at a temperature of 15°C to 40°C. 8R-lipoxygenase has excellent enzyme activity at 20°C to 40°C, preferably 20°C to 35°C, more preferably 25°C to 35°C, and 15S-lipoxygenase has excellent enzyme activity at 15°C to 35°C, preferably 15°C. This is because enzyme activity is excellent at ℃ to 30℃, more preferably at 15℃ to 25℃.

In the present invention, the whole cells in step (b) contain 15 S -lipoxygenase, and the concentration of the whole cells may be 2 to 8 g/L.

In the present invention, the substrate in step (b) is 10 R -hydroxylated docosahexaenoic acid, and the substrate may be treated at a concentration of 0.5mM to 2.5mM.

In the present invention, the substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) may be performed at pH 7.5 to 9.5.

In the present invention, the substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) may be performed at a temperature of 15°C to 35°C. This is because 15S-lipoxygenase has excellent enzyme activity at 15°C to 35°C, preferably at 15°C to 30°C, more preferably at 15°C to 25°C.

(a) preparing a transformant with a recombinant expression vector containing a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; and

In the present invention, the substrate in step (b) may include 10 R -hydroxydocosahexaenoic acid.

In the present invention, the substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) may be performed at a temperature of 15°C to 35°C.

In another aspect, the present invention provides a method for producing 8 R ,15 S -DiHEPA comprising the following steps.

(b) Recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate to produce 8 R ,15 S -DiHEPA through bioconversion.

In the present invention, the substrate in step (b) is eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R -HEPA).

In the present invention, the substrate in step (b) may include 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA).

In another aspect, the present invention provides a method for producing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising the following steps.

(b) Recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate to produce 10-epi-PDXn-3 (10R17S-DiHDPA) by bioconversion. Steps to do.

In the present invention, the substrate in step (b) includes docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA). It can be characterized as:

In the present invention, the substrate in step (b) may include 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA).

10-Epi-Protectin DX, 88 R , 15 S -DiHEPA and 10-Epi-PDXn-3 (10R17S-DiHDPA) of the present invention are signaling substances and inflammation promoting mediators (specialized pro-resolving mediator, SPM). As such, it is expected to be involved in various physiological activities in animals, including humans, and has the advantage of being useful in various industrial fields such as medicine, functional foods, and functional cosmetics.

In addition, according to the present invention, 8 R -lipoxygenase-containing whole cells derived from the coral Plexaura homomalla and 15 S -lipoxygenase-containing whole cells derived from Archangium violaceum strain By using 10-epi-protectin DX, 88 R , 15 S -DiHEPA and 10-epi-PDXn-3 (10R17S-DiHDPA), which are compounds that have not been identified so far, a high level of protectin can be obtained in an environmentally friendly way. It can be manufactured with high productivity and high yield.

Figure 1 shows the activity of lipoxykenase-containing whole cells that convert docosahexaenoic acid into hydroxylated docosahexaenoic acid.

Figure 2 shows the activity of lipoxykenase-containing whole cells that convert hydroxylated docosahexaenoic acid into 10-epi-protectin DX.

Figure 3 shows the biosynthetic pathway of 10-epi-protectin DX produced using docosahexaenoic acid as a substrate using 8 R -lipoxygenase-containing whole cells and 15 S -lipoxygenase-containing whole cells of the present invention. It is shown.

Figure 4 is an HPLC chromatogram confirming the production of 10-epi-Protectin DX together with the standard Protectin DX.

Figure 5 shows the effect of pH (Figure 5a) and temperature (Figure 5b) of whole cells containing 8 R -lipoxygenase on the production of 10 R -hydroxylated docosahexaenoic acid using docosahexaenoic acid as a substrate. will be.

Figure 6 shows the effect of the concentration of docosahexaenoic acid (Figure 6a) and 8 R -lipoxygenase-containing whole cells (Figure 6b) on the production of 10 R -hydroxylated docosahexaenoic acid.

Figure 7 shows the production of 10 R -hydroxylated docosahexaenoic acid from docosahexaenoic acid by whole cells containing 8 R -lipoxygenase.

Figure 8 shows the effect of pH (Figure 8a) and temperature (Figure 8b) of whole cells containing 15 S -lipoxygenase on the production of 10-epi-protectin DX.

Figure 9 shows the production of 10-epi-protectin DX according to changes in the concentration of whole cells containing 15 S -lipoxygenase.

Figure 10 shows the production of 10-epi-protectin DX from 10 R -hydroxylated docosahexaenoic acid using whole cells containing 15 S -lipoxygenase.

Figure 11 shows recombinant expression vectors expressing 8 R -lipoxygenase from the Plexaura homomalla coral and 15 S -lipoxygenase from the Archangium violaceum strain, respectively, of the present invention. It is shown.

Hereinafter, the present invention will be described in detail.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

The present inventors conducted continuous research to more effectively produce 8 R -hydroxylated fatty acids, 15 S -hydroxylated fatty acids or protectin analogs through a bioconversion process, and as a result, 8 R -lipoxygena derived from Plexaura homomalla coral. By cloning the 15 S -lipoxygenase derived from the enzyme and Archangium violaceum strain, a recombinant expression vector and a microorganism transformed therefrom were created, whole cells were produced using this, and then used as a substrate. It was confirmed that 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) can be produced with high productivity and yield through an eco-friendly bioconversion method, and the present invention was completed. .

Accordingly, the present invention relates to 10-Epimer protectin DX (10-epi-PDX), consistently represented by Formula 1.

[Formula 1]

In the present invention, the 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) is 10 R , 17 S -dihydroxy-4 Z , 7 Z , 11 E , 13 Z , 15 E , 19 Z -docosahexaenoic acid (10 R , 17 S -dihydroxy-4 Z , 7 Z , 11 E , 13 Z , 15 E , 19 Z -docosahexaenoic acid), and 10 R , 17 S -di It is also called hydroxydocosahexaenoic acid (10 R ,17 S -dihydroxydocosahexaenoic acid).

In the present invention, the 10-Epi-Protectin DX may be characterized as a signal transduction substance and/or a specialized pro-resolving mediator (SPM), but is not limited thereto.

From another aspect, the present invention relates to 8 R , 15 S -DiHEPA represented by Formula 2.

[Formula 2]

From another aspect, the present invention relates to 10-epi-PDXn-3 (10R,17S-DiHDPA) represented by Chemical Formula 3.

[Formula 3]

In another aspect, the present invention relates to Plexaura homomalla coral-derived 8 R -lipoxygenase; and 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. It relates to a composition for producing 10-epi-protectin DX (epimer of protectin DX at C10).

In one embodiment of the present invention, the 8 R -lipoxygenase from Plexaura homomalla coral consists of the amino acid sequence represented by SEQ ID NO: 1 and/or the base sequence represented by SEQ ID NO: 2, The 15 S -lipoxygenase derived from the Archangium violaceum strain is preferably composed of the amino acid sequence represented by SEQ ID NO: 3 and/or the base sequence represented by SEQ ID NO: 4, but the sequence contains one or more All mutant enzymes that can achieve the desired effect of the present invention through substitution, deletion, addition, etc. are included in the scope of the present invention. The 8 R -lipoxygenase may be a product expressed from a gene consisting of the amino acid sequence shown in SEQ ID NO: 1 and/or the base sequence shown in SEQ ID NO: 2, and the 15 S -lipoxygenase may have the amino acid sequence shown in SEQ ID NO: 3. It may be a product expressed from a gene consisting of the indicated amino acid sequence and/or the base sequence shown in SEQ ID NO: 4.

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably docosa. It may be for treating a substrate containing hexaenoic acid and/or 10 R -hydroxydocosahexaenoic acid .

In another aspect, the present invention relates to Plexaura homomalla coral-derived 8 R -lipoxygenase; and 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. It relates to a composition for producing 88 R , 15 S -DiHEPA.

In one embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably Eicosa. It may be for treating a substrate containing pentaenoic acid (eicosapentaenoic acid, EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA).

In another aspect, the present invention relates to Plexaura homomalla coral-derived 8 R -lipoxygenase; and 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. It relates to a composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA).

In one embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably docosa. It may be for treatment with a substrate containing docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA).

From another perspective, the present invention provides a 10-epi-protectin DX (epimer of protectin DX at) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. C10) A composition for production is provided.

In one embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, in particular, an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 10 R -It may be for treating a substrate containing hydroxydocosahexaenoic acid (10 R -hydroxydocosahexaenoic acid).

From another aspect, the present invention relates to a composition for producing 88 R , 15 S -DiHEPA containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.

In one embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 8R- It may be for treating a substrate containing hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA).

From another aspect, the present invention relates to a composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient. It's about.

In one embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 10R- It may be for treatment on a substrate containing Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA).

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It relates to a recombinant expression vector for producing 10-epi-protectin DX (epimer of protectin DX at C10) comprising a sequence.

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It relates to a recombinant expression vector for producing 8 R , 15 S -DiHEPA comprising a sequence.

In another aspect, the present invention provides a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. It relates to a recombinant expression vector for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing a sequence.

In one embodiment of the present invention, any plasmid vector that is used in the art for genetic recombination may be used as the recombinant expression vector. Specifically, it is more preferable to use pET-28a(+) plasmid. , but is not limited to this.

In another embodiment of the present invention, the 8 R -lipoxygenase from Plexaura homomalla coral consists of the amino acid sequence represented by SEQ ID NO: 1 and/or the base sequence represented by SEQ ID NO: 2, The 15 S -lipoxygenase derived from the Archangium violaceum strain is preferably composed of the amino acid sequence represented by SEQ ID NO: 3 and/or the base sequence represented by SEQ ID NO: 4, but the sequence contains one or more All mutant enzymes that can achieve the desired effect of the present invention through substitution, deletion, addition, etc. are included in the scope of the present invention. The 8 R -lipoxygenase may be a product expressed from a gene consisting of the amino acid sequence shown in SEQ ID NO: 1 and/or the base sequence shown in SEQ ID NO: 2, and the 15 S -lipoxygenase may have the amino acid sequence shown in SEQ ID NO: 3. It may be a product expressed from a gene consisting of the indicated amino acid sequence and/or the base sequence shown in SEQ ID NO: 4.

In another embodiment of the present invention, the recombinant expression vector contains a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and/or an Archangium violaceum strain. The sequence encoding the derived 15 S -lipoxygenase may be characterized as comprising an operably linked promoter, but is not limited thereto.

From another perspective, the present invention relates to a transformant into which the above recombinant expression vector has been introduced.

In one embodiment of the present invention, any microorganism may be used as the transformed transformant as long as it can be transformed with a recombinant expression vector to overexpress the target gene and produce an active enzyme protein. E. coli ER 2566 strain can be used, but is not limited thereto. Microorganisms that can be used for the transformation may be Escherichia coli and microorganisms that possess genetic information similar to Escherichia coli, for example, microorganisms that have more than 70% homology to the amino acid sequence of Escherichia coli.

According to another embodiment of the present invention, the microorganism is Escherichia coli , enteric bacteria (e.g., Salmonella , Shigella , or Klebsiella ), Gram-negative group (e.g., Pseudomonas ), Zymomonas mobilis ( Zymomonas mobilis ), and Bdellovibrio ( Bdellovibrio )), but is not limited to this.

According to another embodiment of the present invention, transformation of a microorganism with the recombinant expression vector can be performed by transformation techniques known to those skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion ( PEG-mediated fusion, microinjection, liposome-mediated method, in-planta transformation, vacuum infiltration method, floral meristem method dipping method), Agrobacteria spraying method, etc. can be used.

From another aspect, the present invention relates to a recombinant cell for producing 10-epi-protectin DX (epimer of protectin DX at C10) containing a transformant and/or a culture medium thereof.

From another aspect, the present invention relates to recombinant cells for producing 8 R , 15 S -DiHEPA containing transformants and/or culture medium thereof.

From another aspect, the present invention relates to recombinant cells for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing a transformant and/or a culture medium thereof.

From another aspect, the present invention relates to a method for producing 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) comprising the following steps.

(b) Recover whole-cells from the transformant and/or its culture medium and treat the whole-cells with a substrate to produce 10-epi-protectin DX (epim of protectin) by biotransformation. DX at C10, 10-epi-PDX) manufacturing steps.

In another embodiment of the present invention, the whole cell may contain 8 R -lipoxygenase. The whole cell containing the 8 R -lipoxygenase is cultured as a transformant transformed with a recombinant expression vector containing a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral, It is desirable to obtain and use it.

In another embodiment of the present invention, the whole cell may contain 15 S -lipoxygenase. The whole cell containing the 15S-lipoxygenase or a transformant transformed with a recombinant expression vector containing a sequence encoding 15S -lipoxygenase derived from an Archangium violaceum strain. It is desirable to culture, obtain, and use it.

In another embodiment of the present invention, the whole cells containing the 8 R -lipoxygenase and/or 15 S -lipoxygenase include: i) centrifuging the culture medium to recover primary whole cells; ii) washing the recovered whole cells with saline solution; iii) performing secondary centrifugation on the washed whole cells to remove the supernatant and obtain whole cells; and iv) washing the secondarily recovered whole cells again with physiological saline. Specifically, recovery of whole cells in step i) may be performed at a weight of around 13,000 g using equipment known in the art, such as a centrifuge, and washing of whole cells in step ii) may be performed with a 0.9% or less sodium chloride solution. It is appropriate to carry out.

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably doco It may be for treating a substrate containing docosahexaenoic acid and/ or 10 R -hydroxydocosahexaenoic acid.

In a preferred embodiment of the present invention, the whole cells in step (b) contain 8 R -lipoxygenase, and the concentration of the whole cells is 2 to 8 g/L, most preferably 4 g/L. It may be characterized as, but is not limited to this.

In a preferred embodiment of the present invention, the substrate in step (b) is docosahexaenoic acid, and the substrate is treated at a concentration of 0.2mM to 6mM, preferably 1.0mM to 3.0mM, most preferably 2mM. It may be characterized as, but is not limited to this.

In a preferred embodiment of the present invention, the substrate of step (b) is docosahexaenoic acid, and step (b) may be performed at pH 7.0 to 9.0, preferably pH 7.0 to 8.5. , but is not limited to this. To maintain these pH conditions, HEPES buffer solution can be used as a reaction solvent.

In a preferred embodiment of the present invention, 8R-lipoxygenase has excellent enzyme activity at 20°C to 40°C, preferably 20°C to 35°C, more preferably 25°C to 35°C, and 15S-lipoxygenase has Since the enzyme activity is excellent at 15°C to 35°C, preferably 15°C to 30°C, more preferably 15°C to 25°C, the substrate in step (b) is docosahexaenoic acid, and step (b) is It may be characterized as being carried out at a temperature of 15°C to 40°C, but is not limited thereto.

In a preferred embodiment of the present invention, the whole cells in step (b) contain 15 S -lipoxygenase, and the concentration of the whole cells is 0.2 to 1.2 g/L, most preferably 1 g/L. It may be characterized, but is not limited thereto.

In a preferred embodiment of the present invention, the substrate in step (b) is 10 R -hydroxylated docosahexaenoic acid, and the substrate is treated at a concentration of 0.5mM to 2.5mM, most preferably 1.4mM. It can be done, but is not limited to this.

In a preferred embodiment of the present invention, the substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) is performed at pH 7.5 to 9.5, preferably pH 8.0 to 9.0. It may be a feature, but is not limited thereto. To maintain these pH conditions, HEPES buffer solution can be used as a reaction solvent.

In a preferred embodiment of the present invention, 15S-lipoxygenase has excellent enzyme activity at 15°C to 35°C, preferably at 15°C to 30°C, more preferably at 15°C to 25°C, so step (b) The substrate is 10 R -hydroxylated docosahexaenoic acid, and step (b) is performed at a temperature of 15°C to 35°C, preferably 15°C to 30°C, more preferably 15°C to 25°C. It may be a feature, but is not limited thereto.

By maintaining the above conditions, the production activity of 10 R -hydroxylated fatty acid and 10-epi-protectin DX can be improved.

In another embodiment of the present invention, the time for treating the whole-cell to the substrate can be appropriately adjusted.

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 10 It may be for treating a substrate containing R -hydroxydocosahexaenoic acid (10 R -hydroxydocosahexaenoic acid).

The present invention relates from another aspect to a method for producing 8 R ,15 S -DiHEPA comprising the following steps.

(b) recovering whole-cells from the transformant and/or its culture medium and treating the whole-cells with a substrate to produce 8 R , 15 S -DiHEPA through bioconversion.

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably eico It may be for treatment on a substrate containing eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA). .

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 8R. -hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z It may be for treating a substrate containing -pentaenoic acid (8R-HEPA).

The present invention relates from another aspect to a method for producing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising the following steps.

(b) Recover whole-cells from the transformant and/or its culture medium and treat the whole-cells with a substrate to produce 10-epi-PDXn-3 (10R17S-DiHDPA) by biotransformation. ) Manufacturing steps.

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably doco It may be for treatment with a substrate containing docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA).

In another embodiment of the present invention, the composition contains an unsaturated fatty acid having 22 carbon atoms as a substrate, particularly an unsaturated fatty acid having 20 to 22 carbon atoms with at least one cis , cis -1,4 pentadiene, preferably 10R. -It may be for treating a substrate containing Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA).

As described above, according to the present invention, by using 8 R -lipoxygenase from Plexaura homomalla and 15 S -lipoxygenase from Arcahngium violaceum strain, 10 -Epi-Protectin DX, 8 R , 15 S -DiHEPA and 8 R , 15 S -DiHEPA have high productivity and are more environmentally friendly than materials obtained through chemical synthesis using existing heavy metals and organic solvents, and do not produce hazardous by-products. Since it can be manufactured with extremely high yield, it is expected to be useful in various industrial fields such as medicine, functional food, and functional cosmetics.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[Example]

[Example 1]

88 RR -리폭시게나아제 또는 15-lipoxygenase or 15 SS -리폭시게나아제의 발현을 위한 재조합 발현 벡터 및 형질전환체의 제작-Preparation of recombinant expression vectors and transformants for expression of lipoxygenase

To prepare 8 R -lipoxygenase or 15 R -lipoxygenase of the present invention, 8 R - from the genes of Plexaura homomalla coral and Archangium violaceum strains, respectively. Genes encoding lipoxygenase and 15 S -lipoxygenase were first isolated, and a recombinant expression vector was created to overexpress them.

Specifically, Plexaura homomalla coral-derived 8 R -lipoxygenase is a plasmid cloned into the pET-28a(+) vector by requesting gene synthesis from Bioneer corporation (Daejeon, Republic of Korea). purchased. In addition, 15 S -lipoxygenase was selected by purchasing Archangium violaceum DSM 52838 strain, whose gene base sequence and amino acid sequence were already specified, from the German Biological Resources Center (Germany), and from this In order to perform polymerase chain reaction (PCR) based on the DNA sequence of the derived lipoxygenase, genomic DNA of Archangium violaceum was extracted and used as a template for PCR. Each primer was designed based on the DNA sequence of lipoxygenase, and polymerase chain reaction (PCR) was performed. NdeI and SalI were used as restriction enzymes for each gene, the cloning method was Gibson assembly, and the primers are shown in Table 1 below. Primers for the lipoxygenase sequence are listed in Table 1 below. In addition, in order to clone the gene into pET-28a(+), the vector was also prepared using PCR and then ligated to produce recombinant lipoxygenase.

리폭시게나아제 서열의 프라이머Primers for lipoxygenase sequence

서열번호sequence number	프라이머 명칭Primer name		염기서열base sequence
55	Archangium violaceum 15S-lipoxygenase Forward primer Archangium violaceum 15 S -lipoxygenase Forward primer	AGC GGC CTG GTG CCG CGC GGC AGC CAT ATG ATG CGT TCC ATT CCC TCC CTG CCC CAG AATAGC GGC CTG GTG CCG CGC GGC AGC CAT ATG ATG CGT TCC ATT CCC TCC CTG CCC CAG AAT
66	Archangium violaceum 15S-lipoxygenase Reverse primer Archangium violaceum 15 S -lipoxygenase Reverse primer	ATT CTG GGG CAG GGA GGG AAT GGA ACG CAT CAT ATG GCT GCC GCG CGG CAC CAG GCC GCTATT CTG GGG CAG GGA GGG AAT GGA ACG CAT CAT ATG GCT GCC GCG CGG CAC CAG GCC GCT

Thereafter, the recombinant expression vector obtained as above was transformed into E. coli ER 2566 strain purchased from New England Biolabs (Hertfordshire, UK) by a conventional transformation method, and the transformed microorganisms were incubated with 20% glycerine solution. It was added and cultured for the production of 10 R -hydroxylated fatty acid, 17 S -hydroxylated fatty acid, and protectin, and then stored frozen at -70°C before use.

[Example 2]

88 RR -리폭시게나아제 또는 15-lipoxygenase or 15 SS -리폭시게나아제의 제조-Manufacture of lipoxygenase

For protein expression of enzymes, the transformed microorganisms stored frozen in (1) were aerated at 200 rotations per minute in a flask containing 500 ml of LB (Difco, Sparks, MD, USA) medium and 20 μg/ml kanamycin. Cultured at 37°C under conditions. When the absorbance of the bacteria reaches 0.6 to 0.8 at 600 nm, a final concentration of 0.1 mM IPTG is added to induce protein expression of enzymes, and the culture is incubated at 16°C for 16 hours at 150 rotations per minute. Cultured under agitated conditions.

Cultured E. coli cells containing 8 R -lipoxygenase or 15 S -lipoxygenase were collected and used. In addition, 8 R -lipoxygenase or 15 S -lipoxygenase produced by overexpression as described above was centrifuged at 6,000 After washing twice, the cells were used as recombinant cells to produce 10 R -hydroxylated fatty acids, 17 S -hydroxy fatty acids and 10-epi-protectin DX.

[Example 3]

88 RR -리폭시게나아제 또는 15-lipoxygenase or 15 SS -리폭시게나아제를 이용한 도코사헥사엔산으로부터 10-에피-프로텍틴 DX의 생산 -Production of 10-epi-protectin DX from docosahexaenoic acid using lipoxygenase

To establish the production reaction sequence of 10-epi-protectin DX using the 8 R -lipoxygenase or 15 S -lipoxygenase, docosahexaenoic acid and 10 R -hydroxylated docosahexaenoic acid, 17 S - Hydroxydocosahexaenoic acid was used as a substrate. 10 R -hydroxylated docosahexaenoic acid and 17 S -hydroxylated docosahexaenoic acid were prepared using 5 g/L of recombinant 8 R -lipoxygenase and 15 S -lipoxygenase, respectively, from 1 mM docosahexaenoic acid. A whole cell reaction was performed at pH 8.0 and 25°C for 30 minutes. The produced 10 R -hydroxylated docosahexaenoic acid and 17 S -hydroxylated docosahexaenoic acid were extracted and stored for use in the next reaction. 10-Epi-Protectin DX is prepared from 1 mM 10 R -hydroxylated docosahexaenoic acid and 17 S -hydroxylated docosahexaenoic acid at 5 g/L of recombinant 15 S -lipoxygenase and 8 R -lipoxygenase, respectively. Acid was used, and a whole cell reaction was performed at pH 8.0 and 25°C for 30 minutes.

As a result, as shown in Figure 1, it was confirmed that 15 S -lipoxygenase had a higher conversion activity from docosahexaenoic acid to hydroxylated docosahexaenoic acid. In addition, as shown in Figure 2, it was confirmed that 15 S -lipoxygenase also had a high conversion activity from hydroxylated docosahexaenoic acid to 10-epi-protectin DX. However, in the case of 8 R -lipoxygenase, it was confirmed to have no activity against hydroxylated docosahexaenoic acid, so the sequence was determined by the first reaction.

Therefore, a biosynthetic pathway as shown in Figure 3 was constructed using the determined lipoxygenase reaction sequence. In addition, as shown in Figure 4, the production of 10-epi-protectin DX was confirmed using HPLC, and the new material 10 R , 17 S -dihydroxy docosahexa was confirmed through NMR analysis. 10 - epi - protectin DX ( epimer of protectin DX at C10 , 10-epi-PDX) (Table 2).

[Formula 1]

[Example 4]

88 RR -리폭시게나아제를 이용한 도코사헥사엔산으로부터 10-10 from docosahexaenoic acid using lipoxygenase RR -수산화 도코사헥사엔산으로의 생물전환 -Biological conversion to hydroxylated docosahexaenoic acid

(실시예 4-1) 8(Example 4-1) 8 RR -리폭시게나아제 함유 전세포의 pH 및 온도가 10-The pH and temperature of lipoxygenase-containing whole cells are 10. RR -수산화 도코사헥사엔산의 생산에 미치는 영향-Effect on the production of hydroxylated docosahexaenoic acid

To investigate the effect of pH on the production of 10 R -hydroxylated docosahexaenoic acid using the 8 R -lipoxygenase-containing whole cells, HEPES buffer, pH 7.0, was used for 0.5 mM docosahexaenoic acid. -8.0), EPPS buffer (pH 8.0-8.5) buffer solution, and CHES buffer (pH 8.5-9.0) buffer solution, an enzyme-containing whole-cell reaction was performed for 5 minutes. As a result, it was confirmed that the optimal pH was 7.0 to 9.0, preferably 7.0 to 8.5, and more preferably 7.5 to 8.5 (FIG. 5a).

In addition, in order to investigate the effect of temperature on the production of 10 R -hydroxylated docosahexaenoic acid using the 8 R -lipoxygenase-containing whole cells, 50 mM HEPES buffer solution was used for 0.5 mM docosahexaenoic acid. At pH 8.0, the temperature was ranged from 20°C to 40°C in 5°C intervals, and then an enzyme-containing whole-cell reaction was performed for 5 minutes. As a result, it was confirmed that the optimal temperature was 20°C to 40°C, preferably 20°C to 35°C, and more preferably 25°C to 35°C (FIG. 5b).

(실시예 4-2) 도코사헥사엔산의 농도 변화에 따른 생물전환 확인(Example 4-2) Confirmation of bioconversion according to change in concentration of docosahexaenoic acid

When treating whole cells containing the 8 R -lipoxygenase with docosahexaenoic acid, the change in concentration of docosahexaenoic acid was used to determine the effect on the concentration of 10 R -hydroxylated docosahexaenoic acid produced. , Docosahexaenoic acid at a concentration ranging from 0.2 to 6 mM and 200 mM cysteine, a reducing agent that converts hydroperxy fatty acid into hydroxy fatty acid, were added at the beginning of the reaction. And the reaction was performed at pH 8.0 and 30°C for 30 minutes.

As a result, as shown in Figure 6a, it was confirmed that the optimal substrate concentration was 1 to 3 mM, preferably 2 mM.

(실시예 4-3) 8(Example 4-3) 8 RR -리폭시게나아제 함유 전세포의 농도 변화에 따른 생물전환 확인-Confirmation of biotransformation according to change in concentration of whole cells containing lipoxygenase

When whole cells containing the 8 R -lipoxygenase were treated with docosahexaenoic acid, in order to determine the effect of the change in concentration of the whole cells on the concentration of 10 R -hydroxylated docosahexaenoic acid produced, 2 mM For docosahexaenoic acid, whole cells at a concentration of 0.2 to 8 g/L and cysteine at a concentration of 200 mM were added at the beginning of the reaction, and the reaction was performed at pH 8.0 and 30°C for 30 minutes.

As a result, as shown in Figure 6b, it was confirmed that the optimal concentration of whole cells containing 8 R -lipoxygenase was 2 to 8 g/L, preferably 4 g/L.

[Example 5]

88 RR -리폭시게나아제 함유 전세포를 이용한 도코사헥사엔산으로부터 10-10 from docosahexaenoic acid using lipoxygenase-containing whole cells RR -수산화 도코사헥사엔산으로의 생산-Production into hydroxylated docosahexaenoic acid

To confirm the production of 10 R -hydroxylated docosahexaenoic acid using the 8 R -lipoxygenase-containing whole cells, 4 g/L of 10 R -lipoxygenase was contained for 2 mM docosahexaenoic acid. A 50 mM HEPES buffer solution was used at pH 8.0 and a temperature of 30°C to measure the conversion rate of 10 R -hydroxylated docosahexaenoic acid over time.

As a result, the 8 R -lipoxygenase-containing whole cells produced 1.4 mM 10 R -hydroxylated docosahexaenoic acid, and the final conversion yield of 10 R -hydroxylated docosahexaenoic acid was confirmed to be 70% ( Figure 7).

[Example 6]

1515 SS -리폭시게나아제 함유 전세포를 이용한 10-10 using whole cells containing lipoxygenase RR -수산화 도코사헥사엔산으로부터 10-에피-프로텍틴 DX으로의 생물전환-Biological conversion from hydroxylated docosahexaenoic acid to 10-epi-protectin DX

(실시예 6-1) 15(Example 6-1) 15 SS -리폭시게나아제 함유 전세포의 pH 및 온도가 10-에피-프로텍틴 DX의 생산에 미치는 영향-Effect of pH and temperature of lipoxygenase-containing whole cells on production of 10-epi-protectin DX

To investigate the effect of pH on the production of 10-epi-protectin DX using the 15 S -lipoxygenase-containing whole cells, 0.5 mM 10 R -hydroxylated docosahexaenoic acid was used in EPPS buffer, Enzyme-containing whole-cell reactions were performed in CHES buffer (pH 7.5-8.5) buffer solution and CHES buffer (pH 8.5-9.5) buffer solution for 5 minutes. As a result, it was confirmed that the optimal pH was 7.5 to 9.5, preferably 8.0 to 9.0 (Figure 8a).

Additionally, to investigate the effect of temperature on the production of 10-epi-protectin DX using the 15 S -lipoxygenase-containing whole cells, 0.5 mM 10 R -hydroxylated docosahexaenoic acid, 50 mM Chess. In a buffer solution pH 8.5, the temperature was ranged from 15°C to 35°C in 5°C intervals, and then the enzyme-containing whole-cell reaction was performed for 5 minutes. As a result, it was confirmed that the optimal temperature was 15°C to 35°C, preferably 15°C to 30°C, and more preferably 15°C to 25°C (FIG. 8b).

(실시예 6-2) 15(Example 6-2) 15 SS -리폭시게나아제 함유 전세포의 농도 변화에 따른 생물전환-Biological conversion according to change in concentration of whole cells containing lipoxygenase

When whole cells containing the 15 S -lipoxygenase are treated with 10 R -hydroxylated docosahexaenoic acid, in order to determine the effect of changes in concentration of whole cells on the production concentration of 10-epi-protectin DX, For 1.4 mM 10 R -hydroxylated docosahexaenoic acid, whole cells at a concentration of 0.2 to 1.2 g/L and cysteine at a concentration of 200 mM were added at the beginning of the reaction, and the reaction was carried out at pH 8.5 and 25°C for 30 minutes. did.

As a result, as shown in Figure 9, it was confirmed that the optimal concentration of whole cells containing 15 S -lipoxygenase was 0.2 to 1.2 g/L, preferably 1 g/L.

[Example 7]

1515 SS -리폭시게나아제 함유 전세포를 이용한 10-10 using whole cells containing lipoxygenase RR -수산화 도코사헥사엔산으로부터 10-에피-프로텍틴 DX 생산-Production of 10-epi-protectin DX from hydroxylated docosahexaenoic acid

In order to confirm the production of 10-epi-protectin DX using the 15 S -lipoxygenase-containing whole cells, for 1.4 mM 10 R -hydroxylated docosahexaenoic acid, 15 S -lipoxygenase-containing whole cells 1 The conversion rate of 10-epi-protectin DX over time was measured in 50 mM Chess buffer containing g/L at pH 8.5 and temperature 25°C.

As a result, the 15 S -lipoxygenase produced 1.2 mM 10-epi-protectin DX, and the final conversion yield of 10-epi-protectin DX was confirmed to be 86% (FIG. 10).

As described above, the present invention uses 8 R -lipoxygenase from the Plexaura homomalla coral and 15 S -lipoxygenase from the Archangium violaceum strain to treat diseases, including humans. This relates to a method of producing hydroxylated fatty acids and 10-epi-protectin DX, which can act as lipid mediators in animals, using bioconversion. Specifically, the substrate used was docosahexaenoic acid and included 8 R -lipoxygenase from Plexaura homomalla coral and 15 S -lipoxygenase from Archangium violaceum strain. Using transformed cells, 10 R -hydroxylated fatty acid, 17 S -hydroxylated fatty acid and 10-epi-protectin DX can be specifically produced using biotransformation, making it more environmentally friendly compared to conventional chemical methods. It is of great significance as it not only overcomes the condition but also develops a specific production method through bioconversion of a lipid regulator for which no production method has been developed previously.

As a result of the detailed description of specific parts of the present invention, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. It will be obvious. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

서열번호 1SEQ ID NO: 1

Plexaura homomalla Plexaura homomalla 88 RR -lipoxygenase-lipoxygenase

eTyrLeuLeuProGluArgIleProAsnGlyThrAlaIle

서열번호 2SEQ ID NO: 2

CTATCTTCTTCCAGAACGTATTCCTAACGGAACAGCGATCTAA

서열번호 3SEQ ID NO: 3

Archangium violaceum Archangium violaceum 1515 SS -lipoxygenase-lipoxygenase

alAlaAspPheAsnHisGluLeuValSerHisLeuGlyLeuThrHisLeuLeuIleGlyProIleAlaIleAlaThrHisArgCysIleProGluAlaHisProValSerLeuLeuLeuArgProHisPheGluGlyThrLeuSerIleAsnAspMetAlaGlnAlaThrLeuValAlaProGlyHisGluV alAspLysSerLeuGlyGlyThrIleGlyAlaSerArgGluValAlaArgAspGlyLeuAsnSerArgProPheAsnSerLeuPheLeuProGluAs pLeuLysAlaArgGlyValAsnAspProAlaLeuGluTyrProTyrArgAspAlaLeuGluLeuTrpHisAlaIleGluAlaTrpValThr TyrValLysLeuTyrTyrArgSerAspGluGluValArgAlaAspArgAlaLeuGlnGluTrpAlaAlaGluIleValSerGlnAspGlyAlaArgIleProGlyPheGlyAspAlaGlyAspGlyArgIleGlnSerLeuAlaTyrLeuCysArgAlaLeuThrLeuLeuValPheThrAla SerAlaGlnHisAlaAlaValAsnAlaProGlnAlaGlyLeuMetAsnTyrAlaProAlaThrProProAlaAlaTyrArgAlaAlaProLeuSerLeuSerAspSerAspAsnAsnAspTyrLeuAspTyrPheProProLeuGluMetAlaSerLeuGlnMetGluPheLeuHisLeuLeuGlyGlyVal ValHisThrArgLeuGlyArgTyrGluArgAspTrpPheLysAspAlaLysValArgGluProLeuAlaArgPheGlnSerLysLeuGluGluLeuGluAlaLeuIleThrGluArgAsnArgThrArgPheGlyProTyrProPheLeuLeuProSerArgValProGlnSerIleAsnIle

서열번호 4SEQ ID NO: 4

TGGCCGACTTCAACCACCACGAACTCGTCTCCCACCTGGGGCTCACGCACCTGCTGATCGGCCCGATCGCGATTGCCACGCACCGGTGCATTCCGGAGGCGCACCCGGTGAGCCTGCTGCTGCGGCCGCACTTCGAGGGCACGCTCAGCATCAACGACATGGCGCAGGCCACGCTGGTGGCGCCCGGGCACGAGGTGGACAAGTCGCTCGGCGGCACCATCGGGGCCAGCCGCGAGGTCGCCAGGGGACGGACTGA ACTCCCGGCCGTTCAACTCGCTCTTCCTGCCCGAGGACCTCAAGGCCCGCGGCGTGAACGACCCCGCGCTCGAGTACCCCTACCGGGATGACGCGCTGGAGCTCTGGCACGCCATCGAGGCGTGGG TGACCACCTACGTCAAGCTGTACTACCGCTCGGACGAGGAGGTGCGGGCGGACAGGGCCCTCCAGGAGTGGGCGGCGGAGATCGTCTCGCAGGACGGTGCGCGCATCCCCGGCTTCGGCGACGCGG GGGACGGGCGCATCCAGAGCCTCGCGTACCTGTGCCGGGCGCTCACGTTGCTCGTCTTCACCGCGAGCGCGCAGCACGCGGCCGTCAACGCGCCGCAAGCGGGGCTGATGAACTACGCGCCCGCCA CGCCGCCCGCGGCGTACCGCGCGGCCCCGCTCTCCCTGAGCGACTCCGACAACAACGACTATCTCGACTACTTCCCGCCGCTCGAGATGGCCTCGCTGCAGATGGAGTTCCTGCACCTGCTGGGCGG TGTGGTCCACACGCGGCTCGGCCGCTACGAGCGGGACTGGTTCAAGGACGCGAAGGTGCGCGAGCCGCTCGCGCGCTTCCAGTCGAAGCTCGAGGAGCTCGAGGCGTTGATCACCGAGCGCAACCGGACCCGCTTCGGGCCCTATCCCTTCCTGCTGCCGAGCCGGGTGCCCCAGAGCATCAACATCTGA

서열번호 5SEQ ID NO: 5

Archangium violaceum Archangium violaceum 1515 SS -lipoxygenase Forward primer-lipoxygenase Forward primer

AGC GGC CTG GTG CCG CGC GGC AGC CAT ATG ATG CGT TCC ATT CCC TCC CTG CCC CAG AAT

서열번호 6SEQ ID NO: 6

Archangium violaceum Archangium violaceum 1515 SS -lipoxygenase Reverse primer-lipoxygenase Reverse primer

ATT CTG GGG CAG GGA GGG AAT GGA ACG CAT CAT ATG GCT GCC GCG CGG CAC CAG GCC GCT

Claims

8 R -lipoxygenase from Plexaura homomalla coral; A composition for producing 10-epi-protectin DX (epimer of protectin DX at C10) comprising 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.
According to paragraph 1,

The 10-Epi-Protectin DX is a composition characterized in that it is represented by the following formula (1):

[Formula 1]

.
8 R -lipoxygenase from Plexaura homomalla coral; And 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient, a composition for producing 8 R , 15 S -DiHEPA.
According to paragraph 3,

The 8 R ,15 S -DiHEPA is a composition characterized in that it is represented by the following formula (2):

[Formula 2]

.
8 R -lipoxygenase from Plexaura homomalla coral; A composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.
According to clause 5,

The 8 R ,15 S -DiHEPA is a composition characterized in that it is represented by the following formula (2):

[Formula 3]

.
According to any one of paragraphs 1, 3, and 5,

A composition characterized in that the 8 R -lipoxygenase consists of an amino acid sequence represented by SEQ ID NO: 1 and/or a base sequence represented by SEQ ID NO: 2.
According to any one of paragraphs 1, 3, and 5,

A composition characterized in that the 15 S -lipoxygenase consists of an amino acid sequence represented by SEQ ID NO: 3 and/or a base sequence represented by SEQ ID NO: 4.
According to claim 1 or 2,

The composition is characterized in that it comprises docosahexaenoic acid and/or 10 R -hydroxydocosahexaenoic acid (10 R -hydroxydocosahexaenoic acid) as a substrate.
According to clause 3 or 4,

The composition is characterized in that it contains eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA) as a substrate. A composition made of.
According to claim 5 or 6,

The composition is characterized in that it contains docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA) as a substrate.
A composition for producing 10-epi-protectin DX (epimer of protectin DX at C10), comprising 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.
A composition for producing 8 R , 15 S -DiHEPA, comprising 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.
A composition for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing 15 S -lipoxygenase derived from Archangium violaceum strain as an active ingredient.
According to any one of claims 12 to 14,

A composition characterized in that the 15 S -lipoxygenase consists of an amino acid sequence represented by SEQ ID NO: 3 and/or a base sequence represented by SEQ ID NO: 4.
According to clause 12,

The composition is characterized in that it comprises 10 R -hydroxydocosahexaenoic acid (10 R -hydroxydocosahexaenoic acid) as a substrate.
According to clause 13,

The composition is characterized in that it contains eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA) as a substrate. A composition made of.
According to clause 14,

The composition is characterized in that it contains 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA) as a substrate.
Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; a recombinant expression vector for producing 10-epi-protectin DX (epimer of protectin DX at C10) comprising a sequence.
Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from Archangium violaceum strain; A recombinant expression vector for producing 8 R , 15 S -DiHEPA comprising a.
Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from Archangium violaceum strain; A recombinant expression vector for producing 10-epi-PDXn-3 (10R17S-DiHDPA) containing.
According to any one of claims 19 to 21,

The 8 R -lipoxygenase is a recombinant expression vector, characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 1 and/or the base sequence represented by SEQ ID NO: 2.
According to any one of claims 19 to 21,

The 15 S -lipoxygenase is a recombinant expression vector, characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 3 and/or the base sequence represented by SEQ ID NO: 4.
According to any one of claims 19 to 21,

The recombinant expression vector contains a sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral and/or 15 S -lipoxygenase from Archangium violaceum strain. A recombinant expression vector comprising a promoter whose sequence is operably linked.
A transformant into which the recombinant expression vector of any one of claims 19 to 21 has been introduced.
According to clause 25,

The transformant is Escherichia coli , enteric bacteria (e.g., Salmonella , Shigella or Klebsiella ), Gram-negative group (e.g., Pseudomonas , Zymomonas mobilis) A transformant, characterized in that it is one or more microorganisms selected from the group consisting of ( Zymomonas mobilis ) and Bdellovibrio .
A recombinant cell for producing 10-epi-protectin DX (epimer of protectin DX at C10) comprising a transformant and/or a culture medium thereof into which the recombinant expression vector of claim 19 has been introduced.
A recombinant cell for producing 8R , 15S -DiHEPA comprising a transformant and/or a culture medium thereof into which the recombinant expression vector of claim 20 has been introduced.
Recombinant cells for producing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising a transformant and/or a culture medium thereof into which the recombinant expression vector of claim 21 has been introduced.
Method for producing 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) comprising the following steps:

(a) Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; preparing a transformant with a recombinant expression vector comprising; and

(b) Recover whole-cells from the microorganism and/or its culture medium and treat the whole-cells with a substrate to produce 10-epi-protectin DX (epimer of protectin DX at) through bioconversion. C10, 10-epi-PDX) manufacturing steps.
Method for preparing 8 R ,15 S -DiHEPA comprising the following steps:

(a) Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; preparing a transformant with a recombinant expression vector comprising; and

(b) Recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate to produce 8 R ,15 S -DiHEPA through bioconversion.
Method for preparing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising the following steps:

(a) Sequence encoding 8 R -lipoxygenase from Plexaura homomalla coral; And a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; preparing a transformant with a recombinant expression vector comprising; and

(b) 10-epi-PDXn-3 (10R17S-DiHDPA) comprising recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate for bioconversion ) Manufacturing steps.
According to any one of claims 30 to 32,

8 R -lipoxygenase in step (a) is characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 1 and/or the base sequence represented by SEQ ID NO: 2.
According to any one of claims 30 to 32,

The 15 S -lipoxygenase in step (a) is characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 3 and/or the base sequence represented by SEQ ID NO: 4.
According to clause 30,

A method characterized in that the substrate in step (b) includes docosahexaenoic acid and/ or 10 R -hydroxydocosahexaenoic acid.
According to clause 30,

The whole cells in step (b) contain 8 R -lipoxygenase, and the concentration of the whole cells is 2 to 8 g/L.
According to clause 30,

The substrate in step (b) is docosahexaenoic acid, and the method is characterized in that the substrate is treated at a concentration of 1.0mM to 3.0mM.
According to clause 30,

The substrate of step (b) is docosahexaenoic acid, and step (b) is performed at pH 7.0 to 9.0.
According to clause 30,

The substrate of step (b) is docosahexaenoic acid, and step (b) is performed at a temperature of 15°C to 40°C.
According to clause 30,

The whole cells in step (b) contain 15 S -lipoxygenase, and the concentration of the whole cells is 2 to 8 g/L.
According to clause 30,

The substrate in step (b) is 10 R -hydroxylated docosahexaenoic acid, and the method is characterized in that the substrate is treated at a concentration of 0.5mM to 2.5mM.
According to clause 30,

The substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) is performed at pH 7.5 to 9.5.
According to clause 30,

The substrate of step (b) is 10 R -hydroxylated docosahexaenoic acid, and step (b) is performed at a temperature of 15°C to 35°C.
According to clause 31,

The substrate in step (b) includes eicosapentaenoic acid (EPA) and/or 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA). A method, characterized in that.
According to clause 32,

The substrate of step (b) is characterized in that it contains docosapentaenoic acid (DPA) and/or 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA). , method.
Method for producing 10-epi-protectin DX (epimer of protectin DX at C10, 10-epi-PDX) comprising the following steps:

(a) preparing a transformant with a recombinant expression vector containing a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; and

(b) Recover whole-cells from the microorganism and/or its culture medium and treat the whole-cells with a substrate to produce 10-epi-protectin DX (epimer of protectin DX at) through bioconversion. C10, 10-epi-PDX) manufacturing steps.
Method for preparing 8 R ,15 S -DiHEPA comprising the following steps:

(a) preparing a transformant with a recombinant expression vector containing a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; and

(b) Recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate to produce 8 R ,15 S -DiHEPA through bioconversion.
Method for preparing 10-epi-PDXn-3 (10R17S-DiHDPA) comprising the following steps:

(a) preparing a transformant with a recombinant expression vector containing a sequence encoding 15 S -lipoxygenase derived from an Archangium violaceum strain; and

(b) 10-epi-PDXn-3 (10R17S-DiHDPA) comprising recovering whole-cells from the microorganism and/or its culture medium and treating the whole-cells with a substrate for bioconversion ) Manufacturing steps.
According to any one of claims 46 to 48,

The 15 S -lipoxygenase in step (a) is characterized in that it consists of the amino acid sequence represented by SEQ ID NO: 3 and/or the base sequence represented by SEQ ID NO: 4.
According to clause 46,

A method characterized in that the substrate in step (b) includes docosahexaenoic acid and/ or 10 R -hydroxydocosahexaenoic acid.
According to clause 47,

The method comprising 8R-hydroxyicosa-5 Z , 9 E , 11 Z , 14 Z , 17 Z -pentaenoic acid (8R-HEPA) as the substrate in step (b).
Paragraph 48:

A method comprising 10R-Hydroxy-7,11,13,16,19-Docosapentaenoic Acid (10R-HDPA) as a substrate in step (b).
8 R , 15 S -DiHEPA, prepared by the method of claim 31 or 47.
10-epi-PDXn-3 (10R17S-DiHDPA), prepared by the method of claim 32 or 48.