WO2024119148A1 - Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines - Google Patents

Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines Download PDF

Info

Publication number
WO2024119148A1
WO2024119148A1 PCT/US2023/082186 US2023082186W WO2024119148A1 WO 2024119148 A1 WO2024119148 A1 WO 2024119148A1 US 2023082186 W US2023082186 W US 2023082186W WO 2024119148 A1 WO2024119148 A1 WO 2024119148A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
optionally substituted
independently
aryl
acyl
Prior art date
Application number
PCT/US2023/082186
Other languages
French (fr)
Inventor
Shar-yin Naomi HUANG
Yves Georges POMMIER
Wenjie Wang
Sourav Saha
Original Assignee
The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The United States Of America, As Represented By The Secretary, Department Of Health And Human Services filed Critical The United States Of America, As Represented By The Secretary, Department Of Health And Human Services
Publication of WO2024119148A1 publication Critical patent/WO2024119148A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/473—Quinolines; Isoquinolines ortho- or peri-condensed with carbocyclic ring systems, e.g. acridines, phenanthridines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • TOPOISOMERASE III (TOP3) INHIBITORS AND ANTIVIRAL COMPOUNDS BASED ON BISACRIDINES
  • This disclosure relates to methods and bisacridine compositions for inhibiting topoisomerase III beta (TOP3B), for conferring anticancer activity and/or for conferring antiviral activity.
  • TOP3B topoisomerase III beta
  • TOP3B is one of 6 human topoisomerases, but it is the only one known to act on RNA.
  • TOP3B has been implicated as a host factor for the replication of positive strand viruses including coronaviruses SARS-CoVl and SARS-CoV2.
  • TOP3B can produce RNA-cleavage complexes (RNAccs), which can be trapped by its inhibitors, causing persistent RNA damage that blocks viral maturation or RNA replication, a mechanism that resembles one employed by inhibitors of topoisomerases I and II, which trap DNA cleavage complexes, damage DNA and block DNA replication.
  • RAccs RNA-cleavage complexes
  • TOP3B is a rational anti-cancer target and a target for drug development against RNA viruses for which there is an unmet need.
  • the present disclosure relates to methods and compositions for inhibiting topoisomerase III beta (TOP3B) and for conferring anticancer and/or antiviral activity.
  • TOP3B topoisomerase III beta
  • One aspect of the disclosure provides a method of reducing or inhibiting replication of an RNA virus in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of treating an RNA viral infection in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of damaging viral RNA in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of stimulating anti-RNA viral activity in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • the RNA virus and/or viral RNA is a positive strand RNA virus and/or viral RNA.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota, as well as of specific classes, orders, genera and species under each phylum.
  • the RNA virus is (and/or viral RNA comes from) Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus, which, In various embodiments, is a Middle East respiratory syndrome-related (MERS -related) coronavirus or a Severe acute respiratory syndrome-related (SARS -related) coronavirus. In various embodiments, the Severe acute respiratory syndrome-related (SARS-related) coronavirus is SARS-CoV or SARS-CoV-2.
  • Another aspect of the disclosure provides a method of treating cancer in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of inducing cell death of a TOP3B- expressing cell in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of reducing the number of TOP3B- expressing cells in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of inhibiting TOP3B activity in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier [0017]
  • An aspect of the disclosure provides a method of poisoning TOP3B in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of trapping TOP3B in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • An aspect of the disclosure provides a method of promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • TOP3Bccs TOP3B cleavage complexes
  • the one or more bisacridine compounds are represented by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII:
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C
  • compositions including one or more bisacridine compounds and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition includes NSC690634, which, in various embodiments, is suitable for administration by injection or oral administration.
  • FIG. 1A shows a comparative cellular toxicity screen designed to identify specific class of inhibitors for TOP3B in which a pair of isogenic HCT116 and HCT116 TOP3B-KO (knock out) cells were labeled with different fluorescent proteins (GFP and mCherry, respectively).
  • the two cell lines were mixed in equal ratios and grown together prior to treatment with compounds disclosed herein.
  • On each cell culture plate one column of dimethyl sulfoxide (DMSO)-treated samples served as control.
  • DMSO dimethyl sulfoxide
  • the entire cell culture plate was imaged in multiple fluorescent channels in order to determine the relative viability rates of HCT116 and HCT116 TOP3B-KO cells, normalized to the DMSO-treated control wells on the same plate.
  • FIG. 1B shows representative fluorescent microscopy images of a DMSO control and drug-treated samples.
  • the drug-treated sample were compared to the DMSO control sample in each fluorescent channel, here the GFP channel conveying the effect of the drug on the HCT116 cells and the mCherry channel conveying the effect of the drug on TOP3B-KO cells.
  • the GFP channel conveying the effect of the drug on the HCT116 cells
  • the mCherry channel conveying the effect of the drug on TOP3B-KO cells.
  • Each sample is normalized to the DMSO-treated control samples on the same plate.
  • FIG. 2A and FIG. 2B show data analysis of the comparative cellular cytotoxicity screen.
  • FIG. 2A shows the equation used to compute the “Resistance Factor” for TOP3B-KO cells. Cell count and/or confluency from a set of samples were used to obtain a specific Resistance Factor for a given compound.
  • FIG. 2B shows a graph plotting the RF cell count against the RF confluency for the entire library of compounds tested. The top right corner represents the compounds to which TOP3B-KO cells showed the highest resistance, and the 8% top hits (inside circle) were selected for further testing.
  • FIG. 2C shows a flowchart of the process used to identify compounds with the ability to poison TOP3B.
  • FIG. 3A and FIG. 3B show a modified RADAR assay to demonstrate drug- induced cellular TOP3Bccs.
  • FIG. 3A shows a schematic of the procedure used in the RADAR assay.
  • FIG. 3B shows the chemical structures of five compounds selected from the screen using RADAR assays.
  • FIG. 3C shows a graph of results from experiments in which HEK293 cells were transiently transfected with flag-tagged TOP3B and treated with indicated compounds at 100 ⁇ M for 1 hour prior to analysis by RADAR. The compounds showed a spectrum of potency in inducing TOP3Bcc.
  • FIG. 4A and FIG. 4B show band shift assays demonstrating the induction of DNA- and RNA-TOP3Bccs by bisacridine compounds with recombinant TOP3B.
  • FIG. 4A shows a schematic of the in vitro band shift assay. A DNA or RNA oligo substrate labeled on the 3’- end with a fluorophore is incubated with recombinant TOP3B. A small population of the TOP3B forms the TOP3B cleavage complex (TOP3Bcc) with the DNA or RNA, resulting in a significantly different molecular weight for TOP3Bccs with the attached fluorophore compared to that of free DNA and RNA substrate.
  • TOP3Bcc TOP3B cleavage complex
  • DNA-TOP3Bcc upper panels
  • RNA-TOP3Bcc lower panels
  • DNA-TOP3Bcc lower panels
  • the formation of DNA-TOP3B and RNA-TOP3B cleavage complexes is TOP3B-dependent, and the TOP3Bccs were titrated with each of the lead compounds to reach equilibrium. The effect of each compound is compared to the DMSO-treated control samples.
  • FIG. 5A to FIG. 5H Show that NSC690634 induces endogenous TOP3Bccs in different cell lines.
  • FIG. 5A shows RADAR assay results indicating that treatment with NSC690634 (100 ⁇ M) leads to increase in the levels of endogenous TOP3Bcc in a time- dependent manner in three different human cell lines.
  • FIG. 5B shows a graph of the data shown in FIG. 5A.
  • FIG. 5C shows RADAR results indicating that treatment with NSC690634 for 4 hours leads to increase in the levels of endogenous TOP3Bcc in a dose-dependent manner in three different human cell lines.
  • FIG. 5D shows a graph of the data shown in FIG. 5C.
  • FIG. 5A shows RADAR assay results indicating that treatment with NSC690634 (100 ⁇ M) leads to increase in the levels of endogenous TOP3Bcc in a time- dependent manner in three different human cell lines.
  • FIG. 5B shows a graph of the data
  • FIG. 5E shows results for HEK293 cells that were transiently over-expressing flag-tagged TOP3B and treated with NSC690634 (100 ⁇ M for 1 hour) prior to analysis by RADAR.
  • 1 mg of purified nucleic acid was either mock-treated or treated with RNase A/T1 or with DNase to digest RNA or DNA, respectively, purified through ethanol precipitation, loaded on a slot blot, and probed by immunodetection.
  • FIG. 5F shows a graph of the quantification of band intensities that were normalized to the mock-treated samples.
  • FIG. H shows genomic DNA of HCT116 and HCT116-TOP3B-KO cells, with or without treatment with NSC690634, that was collected and blotted on nitrocellulose membrane before immunoprobing by an antibody specific for R-loop S9.6; RNase H-treated samples serve as negative controls.
  • FIG. H shows HEK293 cells transiently over-expressing TOP3B that were treated with NSC690634 (100 ⁇ M for 1 h) prior to analysis by in vivo complex of enzyme (ICE) bioassays. Ultracentrifugation of cell lysates on a CsCl gradient enabled separation of DNA and RNA species.
  • ICE in vivo complex of enzyme
  • the separated fractions were quantified and 1.5 ⁇ g of DNA or RNA were blotted on a slot blot for independent detection of DNA- and RNA-T0P3Bccs through immunodetection probed with anti-Flag antibodies.
  • the upper row contained 1.5 ⁇ g of nontreated control DNA or RNA samples. Representative blot of 3 independent experiments is shown.
  • FIG. 6A to FIG. 6C show a structure-activity analysis of bisacridine analogs of NSC690634 demonstrates that linker length is critical for inducing TOP3Bccs.
  • FIG. 6A shows chemical structures of a series of bisacridine analogs, as well as the acridine compounds m- AMSA (N-[4-(acridin-9-ylamino)-3-methoxyphenyl]methanesulfon-amide), and ⁇ -AMSA, (N-[4-(acridin-9-ylamino)-2-methoxyphenyl]methanesulfonamide).
  • FIG. 6B shows results for HEK293 cells transiently over- expressing TOP3B (TOP3B OE) that were treated with DMSO (control) or with the indicated bisacridines (100 ⁇ M for 1 hour) prior to analysis by modified RADAR and probed with anti- Flag antibody. The same samples probed with anti-dsDNA antibody served as loading controls. Only NSC690634 showed a strong induction of TOP3Bccs while all the other structurally related compounds with different linker lengths failed to induce cellular TOP3Bccs.
  • 6C shows in vitro biochemical assays that demonstrate that linker length appears to be important for inducing TOP3Bccs by the bisacridines, such as NSC690634.
  • Compounds without linkers e.g., m-AMSA, ⁇ -AMSA
  • NSC690634 with a 3-carbon linker
  • Bisacridine compounds with longer carbon linkers not only fail to induce TOP3Bcc, but they also appear to destabilize the formation of TOP3Bccs with both DNA and RNA.
  • FIG. 7A shows the structure of NSC690634.
  • FIG. 7B and FIG. 7C show results of cell survival assays treated with NSC690634 that confirmed greater resistance of TOP3B- KO cells to NSC690634 as compared to HCT116 parental cells, regardless which fluorescent proteins were used in the labeling (GFP for WT HCT116 cells and mCherry for HCT116- TOP3B-KO cells for FIG. 7B or the labels reversed for FIG. 7C).
  • FIG. 7D shows composite fluorescent microscopy images of DMSO control.
  • FIG. 7E and FIG. 7F show composite fluorescent microscopy images of NSC690634-treated (32 nM) samples of FIG. 7B and FIG. 7C, respectively.
  • FIG. 8A shows the time dependence of NSC690634 to induce TOP3Bcc formation in RADAR assay using HEK293 cells transiently over-expressing TOP3B-flag to enhance TOP3Bcc signals.
  • the sensitivity of anti-flag antibody and the abundance of TOP3B in this system allowed detection of elevated levels of TOP3Bccs after treatments as short as 10 minutes.
  • the level of TOP3Bcc induced by NSC690634 increased in a time-dependent manner and leveled off after about 1 hour.
  • FIG. 8B shows the dose dependence of NSC690634 to induce TOP3Bcc formation in RADAR assay.
  • FIG. 9A shows the results of immunoblotting of HEK293 cells treated with NSC690634 to measure the levels of free TOP3B. Induction of TOP3Bccs by NSC690634 coincided with the reduction of free TOP3B.
  • FIG. 9B shows that the TOP3Bccs induced by NSC690634 were not readily reversible upon removal.
  • FIG. 9C shows RADAR assays of HCT116 cells that indicate NSC690634 selectively induces TOP3Bccs and not cleavage complexes of any other topoisomerases under the same conditions.
  • phrases such as “between X and Y” and “between about X and Y” should be interpreted to include X and Y.
  • phrases such as “between about X and Y” mean “between about X and about Y.”
  • phrases such as “from about X to Y” mean “from about X to about Y.”
  • the term “about,” as used herein when referring to a measurable value such as an amount of a compound or agent of this disclosure, dose, time, temperature, and the like, is meant to encompass variations of ⁇ 10%, ⁇ 5%, ⁇ 1%, ⁇ 0.5%, or even ⁇ 0.1% of the specified amount.
  • each expression e.g., alkyl, m, n, or the like, when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.
  • substitution or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction.
  • substituted is also contemplated to include all permissible substituents of organic compounds.
  • the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds.
  • Illustrative substituents include, for example, those described herein below.
  • the permissible substituents may be one or more and the same or different for appropriate organic compounds.
  • the heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms.
  • bisacridines or “bisacridine drugs”, which are a family of compounds linking two optionally substituted acridine moieties through their 9-position on the tricyclic ring structure (with heterocyclic nitrogen at the 10-position).
  • Linkers are described in detail elsewhere herein.
  • the acridine nitrogen is a carbon, thus making a corresponding family of compounds linking two optionally substituted anthracene moieties, also referred to as “bisanthracenes”.
  • Linkers and optional tricyclic ring substituents for bisanthracene compounds comprise the same structure and scope as described for the bisacridines.
  • Topoisomerases are universal and present in eukaryotes, archaebacteria and eubacteria. Human cells encode six topoisomerases, only one of which operates on RNA, TOP3B.
  • Biological nucleic acid structure e.g., DNA double helix and the flexibility of single stranded RNA leading to secondary structure
  • the opening of duplex DNA and separation of its two strands during transcription and replication generate supercoiling (torsional tension) on both sides of the open DNA segment.
  • Negative supercoiling behind the polymerases tends to extend DNA strand separation and facilitates the formation of abnormal nucleic acid structures such as R-loops, which can stall RNA polymerase when the transcripts remain bound to the unwound DNA template. Negative supercoiling also promotes the formation of non-canonical DNA structures such as z-DNA, intramolecular hairpins and guanosine quartets (G4’s). Topoisomerases prevent the formation of such potentially deleterious structures by removing free supercoiling. Similarly for RNA, topoisomerase 3B likely plays a key role in ensuring proper RNA topology for RNA synthesis or maturation.
  • Trapping TOP3B refers to the reversible inactivation of TOP3B while complexed with (i.e., bound to) RNA or DNA, e.g., by interfacial inhibition, or stacking of a bisacridine drug molecule against RNA base(s) flanking the TOP3B catalytic site, i.e., a form of catalytic inhibition.
  • a “TOP3B poison” or “interfacial inhibitor”, as used herein, is a compound or agent that is capable of binding to a TOPcc at the protein-RNA or protein-DNA interface and trap the TOPcc.
  • “Poisoning” TOP3B refers to reversibly inactivating TOP3B while complexed with RNA or DNA.
  • “poisoning” and “trapping” are used interchangeably, generically referring to an inhibitor causing the enzyme to become “stuck” on DNA/RNA.
  • TOP3B cleavage complexes refer to the complex formed between a topoisomerase and genomic DNA or RNA when working to relieve torsional tension or knots introduced by metabolic processes (e.g., transcription, reverse transcription) by disconnecting the helical backbone of the nucleic acid to relieve the torsional strain within before the backbones are reconnected.
  • metabolic processes e.g., transcription, reverse transcription
  • the enzyme is covalently attached to one end of the disconnected nucleic acid backbone, forming the topoisomerase cleavage complexes (TOPcc).
  • Various compounds of the present disclosure can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present disclosure. Various compounds of the present disclosure may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present disclosure and are intended to be within the scope of the present disclosure. [0049] Various compounds of the present disclosure possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are encompassed within the scope of the present disclosure.
  • the compounds described herein may be prepared as a single isomer (e.g., enantiomer, cis-trans, positional, diastereomer) or as a mixture of isomers.
  • the compounds are prepared as substantially a single isomer.
  • Methods of preparing substantially isomerically pure compounds are known in the art.
  • enantiomerically enriched mixtures and pure enantiomeric compounds can be prepared by using synthetic intermediates that are enantiomerically pure in combination with reactions that either leave the stereochemistry at a chiral center unchanged or result in its complete inversion.
  • the final product or intermediates along the synthetic route can be resolved into a single stereoisomer.
  • the compounds disclosed herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds.
  • the compounds may be radiolabeled with radioactive isotopes, such as for example tritium ( 3 H), iodine-125 ( 125 I) or carbon-14 ( 14 C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are intended to be encompassed within the scope of the present disclosure.
  • resonance stabilization may permit a formal electronic charge to be distributed over the entire molecule. While a particular charge may be depicted as localized on a particular ring system, or a particular heteroatom, it is commonly understood that a comparable resonance structure can be drawn in which the charge may be formally localized on an alternative portion of the compound.
  • Selected compounds having a formal electronic charge may be shown without an appropriate biologically compatible counterion.
  • a counterion serves to balance the positive or negative charge present on the compound.
  • a substance that is biologically compatible is not toxic as used, and it does not have a substantially deleterious effect on biomolecules.
  • negatively charged counterions include, among others, chloride, bromide, iodide, sulfate, alkanesulfonate, aryl sulfonate, phosphate, perchlorate, tetrafluoroborate, tetraarylboride, nitrate and anions of aromatic or aliphatic carboxylic acids.
  • Preferred counterions may include chloride, iodide, perchlorate and various sulfonates.
  • positively charged counterions include, among others, alkali metal, or alkaline earth metal ions, ammonium, or alkylammonium ions.
  • compositions means compositions comprising at least one active agent, such as a compound or salt of Formulae I, II, III, IV, V, VI or VII, and at least one other substance, such as a carrier.
  • active agent such as a compound or salt of Formulae I, II, III, IV, V, VI or VII
  • other substance such as a carrier.
  • Carrier means a diluent, excipient, or vehicle with which an active compound is administered.
  • a “pharmaceutically acceptable carrier” means a substance, e.g., excipient, diluent, or vehicle, that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes a carrier that is acceptable for veterinary use as well as human pharmaceutical use.
  • a “pharmaceutically acceptable carrier” includes both one and more than one such carrier.
  • “Patient”, “subject”, and “individual” mean a human or non-human animal in need of medical treatment.
  • Medical treatment can include treatment of an existing condition, such as a disease or disorder or diagnostic treatment.
  • the patient is a human patient.
  • Providing means giving, administering, selling, distributing, transferring (for profit or not), manufacturing, compounding, or dispensing.
  • Treat”, “Treatment”, or “treating” mean providing therapeutic agent(s) to a patient who has a disease, a symptom of disease or a predisposition to or risk for developing a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, affect, or prevent the disease and/or the symptoms of disease.
  • therapeutic agent(s) are provided in an amount sufficient to measurably reduce any symptoms of infection with a positive strand RNA virus, slow progression or cause regression of an infection by a positive strand RNA virus or prevent infection.
  • treatment of infection with a positive strand RNA virus may be commenced for a subject who does not exhibit signs of such infection.
  • treatment may be administered to a subject who exhibits only early signs of infection with a positive strand RNA virus for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • therapeutic agent(s) are provided in an amount sufficient to provide a therapeutic benefit, such as an amelioration of symptoms of cancer, prevention or slowing of progression of a cancer, promoting regression of a cancer, or promoting eradication of a cancer.
  • a “therapeutically effective amount”, an “effective amount” and an “effective dose” of a pharmaceutical composition refer to an amount effective, at dosages and for periods of time necessary, that when administered to a patient provides a desired therapeutic or prophylactic benefit, such as measurably reducing any biological hallmark or symptom of infection by a positive strand RNA virus, slowing progression of infection by a positive strand RNA virus, causing regression of infection by a positive strand RNA virus, or preventing or delaying onset of symptoms or pathologies resulting from infection by a positive strand RNA virus.
  • a "therapeutically effective amount”, an “effective amount” and an “effective dose” of a pharmaceutical composition refer to an amount effective, when administered to a patient, to provide a therapeutic benefit such as an amelioration of symptoms, e.g., an amount effective to decrease the symptoms of cancer.
  • a patient having cancer may present detectable levels of various tumor markers, including CA 125, CEA, CA19- 9, AFP, PSA, and galactosyltransferase.
  • a therapeutically effect amount is thus an amount sufficient to provide a significant reduction in elevated tumor marker levels or an amount sufficient to provide a return of tumor marker levels to the normal range.
  • a therapeutically effective amount is also an amount sufficient to prevent a significant progression of cancer or cancerous tumor (e.g., increase in tumor size or tumor number) relative that usually seen in untreated patients having the same cancer, or amount sufficient to cause significant regression of cancer or cancerous tumor (e.g., reduce tumor size or tumor number), or cause tumors to disappear from the patient's body altogether or otherwise become undetectable.
  • a significant progression of cancer or cancerous tumor e.g., increase in tumor size or tumor number
  • amount sufficient to cause significant regression of cancer or cancerous tumor e.g., reduce tumor size or tumor number
  • a significant change is any detectable change that is statistically significant in a standard parametric test of statistical significance such as Student’s T-test, where p ⁇ 0.05.
  • references herein to any numerical range expressly includes each numerical value (including fractional numbers and whole numbers) encompassed by that range.
  • reference herein to a range of 0.5 mg to 100 mg explicitly includes all whole numbers of and fractional numbers between the upper and lower limit of the range, inclusive of the upper and lower limit.
  • An individual referred to as “suffering from” infection by a positive strand RNA virus, as described herein, has been diagnosed with and/or displays one or more symptoms of infection by a positive strand RNA virus.
  • An individual “suffering from” a cancer, as described herein, has been diagnosed with and/or displays one or more symptoms of having a cancer.
  • the term “at risk” for infection by a positive strand RNA virus refers to a subject (e.g., a human) that is predisposed to being infected with a positive strand RNA virus (e.g., whose cells are both receptive to virus docking or attachment and permissive to receiving the viral RNA payload) and/or developing symptoms or pathologies related to infection by a positive strand RNA virus.
  • a positive strand RNA virus e.g., whose cells are both receptive to virus docking or attachment and permissive to receiving the viral RNA payload
  • This predisposition may be genetic or due to other factors. It is not intended that the present disclosure be limited to any particular signs or symptoms.
  • the present disclosure encompasses subjects that are experiencing any range or severity of infection by a positive strand RNA virus, from sub- clinical infection to extreme viral titers, wherein the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with infection by a positive strand RNA virus.
  • indicia e.g., signs and symptoms
  • at risk for a cancer refers to a subject (e.g., a human) that is predisposed to developing a cancer. This predisposition may be genetic or due to other factors. It is not intended that the present disclosure be limited to any particular signs or symptoms.
  • the present disclosure encompasses subjects that are experiencing any range or severity of a cancer, from sub-clinical cellular transformation to advanced disease, in which the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with having a cancer.
  • bisacridine compounds, pharmaceutically acceptable salts thereof and pharmaceutical compositions thereof can be utilized in the methods of the disclosure and are described by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI, or Formula VII: ; ; ; ( ormu a );
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ; where R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO 2 R F ; and R E are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl; B is -(CH 2 Y) n -X-(Y’CH 2 ) n - , or - A-(CH 2 -CH 2 -D) n -A’-; where one or more of the CH 2 groups in B is optionally substituted with a C 1 -C 3
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ; where R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO2R F ; R F are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl; R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is 0, 1, 2, or
  • R are each independently H, or C 1-6 alkyl.
  • the one or more bisacridine compounds is represented by Formula I: (Formula I);
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1-3 alkyl; Z and Z’ are NR D ; where R D are independently H, or C 1-3 alkyl; B is -(CH 2 Y) n -X-(Y’CH 2 ) n - , or -A-(CH 2 -CH 2 - D) n -A’-; where one or more of the CH 2 groups in B is optionally substitute
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; Z and Z’ are NR D ; whre R D are independently H, or C 1-3 alkyl; B is -(CH 2 Y) n -X-(Y’CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; where one or more of the CH 2 groups in B is optionally substituted with a C 1 -
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; Z and Z’ are NR D ; where R D are independently H, or C 1-3 alkyl; B is - A-(CH 2 -CH 2 -D) n -A’-; where one or more of the CH 2 groups in B is optionally substituted with a C 1 -C 3 alkyl or C 1 -C 3 alkoxy group; n is 0-1; A is absent or (CH 2 ) W , and A' is absent or (CH 2 ) W , where w
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ; where R D is H; B is -A-(CH 2 -CH 2 -D) n -A’-; n is 0-1; A is absent or (CH 2 ) W ; and A' is absent or (CH 2 ) W , where w is 1, 2 or 3; and D is absent; all with the proviso that the total length of linker -A-(CH 2 -CH 2 -D) n -A’- is between 1 and 4 atoms in length between Z and Z’ or 6
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ; where R D is H; B is -A-(CH 2 -CH 2 -D) n -A’-; n is 0; A is absent; and A' is (CH 2 ) W , where w is 1, 2, 3 or 4; and D is absent.
  • the one or more bisacridine compounds is represented by Formula II:
  • R , R , R , R , R , R , R , R , R , R , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1 .3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alky
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, N0 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1-3 alkyl; Z and Z’ are NR D ; where R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; Z and Z’ are NR D ; where R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; Z and Z’ are NR D ; where R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ; where R D is H; n is 0, 1, 2, or 3; and each R is independently H, or C 1-3 alkyl.
  • the one or more bisacridine compounds is represented by Formula III:
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’COzR”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • the one or more bisacridine compounds is represented by
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, N0 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • the one or more bisacridine compounds is represented by Formula V:
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or S04R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1 .3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • the bisacridine compound is represented by the structure:
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’; where R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; where R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • the one or more bisacridine compounds is represented by
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0 - 4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 ,
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1-
  • NR’CO 2 R NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1- C 7 acyl, or aryl-C 0-4 alkyl; and R” is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl; and each R is independently H, or C 1-6 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 ,
  • R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 ,
  • R’ is H, C 1-3 alkyl; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 ' and R 8 ' are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and each R is independently H, or C 1-3 alkyl.
  • a dash that is not between two letters or symbols is used to indicate a point of att ac ment or a substituent.
  • substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents, which would result from writing the structure from right to left, e.g., — CH 2 O — (or CH 2 O, i.e., without explicit connecting dash(es)) is intended to also recite — OCH 2 — (or OCH 2 ).
  • Alkyl includes both branched and straight chain saturated aliphatic hydrocarbon groups, having the specified number of carbon atoms, generally from 1 to about 8 carbon atoms.
  • Ci-C 6 alkyl indicates an alkyl group having from 1, 2, 3, 4, 5, or 6 carbon atoms.
  • Other embodiments include alkyl groups having from 1 to 8 carbon atoms, 1 to 4 carbon atoms or 1 or 2 carbon atoms, e.g. C 1 -C 8 alkyl, C 1 -C 4 alkyl, and C 1 -C 2 alkyl.
  • C 0 -C n alkyl is used herein in conjunction with another group, for example, -C 0 -C 2 alkyl(phenyl), the indicated group, in this case phenyl, is either directly bound by a single covalent bond ( C 0 alkyl), or attached by an alkyl chain having the specified number of carbon atoms, in this case 1, 2, 3, or 4 carbon atoms.
  • Alkyls can also be attached via other groups such as heteroatoms as in -0-C 0 -C 4 alkyl(C 3 -C 7 cycloalkyl).
  • alkyl examples include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, 3 -methylbutyl, t- butyl, n-pentyl, and sec-pentyl.
  • alkyl unless otherwise noted, is also meant to include those derivatives of alkyl defined in more detail below, such as “heteroalkyl.” Alkyl groups that are limited to hydrocarbon groups are termed “homoalkyl”.
  • Heteroalkyl by itself or in combination with another term, means, unless otherwise stated, a straight or branched chain, or cyclic carbon-containing radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si, P, S, and Se and wherein the nitrogen, phosphorous, sulfur, and selenium atoms are optionally oxidized, and the nitrogen heteroatom is optionally be quaternized.
  • the heteroatom(s) O, N, P, S, Si, and Se may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule.
  • Up to two heteroatoms may be consecutive, such as, for example, — CH 2 — NH — OCH 3 and — CH 2 — O— Si(CH 3 ) 3 .
  • alkenyl is a branched or straight chain aliphatic hydrocarbon group having one or more carbon-carbon double bonds that may occur at any stable point along the chain, having the specified number of carbon atoms.
  • alkenyl include, but are not limited to, ethenyl and propenyl.
  • Alkynyl is a branched or straight chain aliphatic hydrocarbon group having one or more double carbon-carbon triple bonds that may occur at any stable point along the chain, having the specified number of carbon atoms.
  • Alkoxy is an alkyl group as defined above with the indicated number of carbon atoms covalently bound to the group it substitutes by an oxygen bridge (-O-).
  • alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, 2- butoxy, t-butoxy, n-pentoxy, 2-pentoxy, 3- pentoxy, isopentoxy, neopentoxy, n- hexoxy, 2- hexoxy, 3-hexoxy, and 3- methylpentoxy.
  • an “Alkylthio” or a “thioalkyl” group is an alkyl group as defined above with the indicated number of carbon atoms covalently bound to the group it substitutes by a sulfur bridge (-S-).
  • Aryl means, unless otherwise stated, a polyunsaturated, aromatic moiety that can be a single ring or multiple rings (preferably from 1 to 3 rings), which are fused together or linked covalently.
  • heteroaryl refers to aryl groups (or rings) that contain from one to four heteroatoms selected from N, O, S, and Se, wherein the nitrogen, sulfur, and selenium atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized.
  • a heteroaryl group can be attached to the remainder of the molecule through a heteroatom.
  • Non- limiting examples of aryl and heteroaryl groups include phenyl, 1 -naphthyl, 2-naphthyl, 4- biphenyl, 1 -pyrrolyl, 2-pyrrolyl, 3 -pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5- isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2- pyrdinyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2- benzimidazolyl, 5-indoly
  • Aryl when used in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl), includes both aryl and heteroaryl rings as defined above.
  • arylalkyl is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g., benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l-naphthyloxy)propyl, and the like).
  • an alkyl group e.g., benzyl, phenethyl, pyridylmethyl and the like
  • an oxygen atom e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l-naphthyloxy)propyl, and the like.
  • acyl by itself or in combination with another term, means, unless otherwise stated, a substituent comprising a carbonyl moiety and a non-carbonyl moiety (a R — C(O) — group).
  • An acyl group may include, but is not limited to, a formyl group, an acetyl group, a propionyl group, a butylyl group, a benzoyl group, an isobutylyl group, or a valeryl group.
  • Amino or “amine group” refers to the group — NR'R" (or N + RR'R") where R, R' and R" are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl, heteroaryl, and substituted heteroaryl.
  • a substituted amine being an amine group wherein R' or R" is other than hydrogen. In a primary amino group, both R' and R" are hydrogen, whereas in a secondary amino group, either, but not both, R' or R” is hydrogen.
  • the terms “amine” and “amino” can include protonated and quaternized versions of nitrogen, comprising the group — N + RR'R" and its biologically compatible anionic counterions.
  • Alkylamino refers to “amino” as defined above attached to an alkyl moiety having the general formula — (CH 2 ) k NR'R" (or — (CH 2 ) k N + RR'R") wherein k is 1-6 unless stated otherwise in context.
  • Aminoalkyl refers to “amino” as defined above wherein at least one of R, R' or R" is attached to an alkyl moiety having the general formula — NR x (CH 2 ) k , — N((CH 2 ) k ) 2 (“dialkylamino”), — N ((CH 2 ) k ) 3 (“trialkylammonium”), N + R x ((CH 2 ) k ) 2
  • dialkylammonium or N + (R x ) 2 (CH 2 ) k (“alkylammonium”), wherein k is 1-6 unless stated otherwise in context.
  • Carboxyalkyl refers to a group having the general formula — (CH 2 ) k COOH wherein k is 1-6 unless stated otherwise in context.
  • Haldroxyalkyl refers to a group having the general formula — (CH 2 ) k OH wherein k is 1-6 unless stated otherwise in context.
  • Cycloalkyl is a saturated hydrocarbon ring group, having the specified number of carbon atoms, usually from 3 to about 7 carbon atoms.
  • Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl as well as bridged or caged saturated ring groups such as norborane or adamantane.
  • “-(C 0 -C n alkyl)cycloalkyl” is a cycloalkyl group attached to the position it substitutes either by a single covalent bond (C 0 ) or by an alkylene linker having 1 to n carbon atoms.
  • Halo or “halogen” means fluoro, chloro, bromo, or iodo.
  • Heteroaryl is a stable monocyclic aromatic ring having the indicated number of ring atoms which contains from 1 to 3, or in some embodiments from 1 to 2, heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon, or a stable bicyclic or tricyclic system containing at least one 5- to 7-membered aromatic ring which contains from 1 to 3, or in some embodiments from 1 to 2, heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon.
  • Monocyclic heteroaryl groups typically have from 5 to 7 ring atoms.
  • bicyclic heteroaryl groups are 9- to 10-membered heteroaryl groups, that is, groups containing 9 or 10 ring atoms in which one 5- to 7-member aromatic ring is fused to a second aromatic or non-aromatic ring.
  • the total number of S and O atoms in the heteroaryl group exceeds 1, these heteroatoms are not adjacent to one another. It is preferred that the total number of S and O atoms in the heteroaryl group is not more than 2. It is particularly preferred that the total number of S and O atoms in the aromatic heterocycle is not more than 1.
  • Heteroaryl groups include, but are not limited to, oxazolyl, piperazinyl, pyranyl, pyrazinyl, pyrazolopyrimidinyl, pyrazolyl, pyridizinyl, pyridyl, pyrimidinyl, pyrrolyl, quinolinyl, tetrazolyl, thiazolyl, thienylpyrazolyl, thiophenyl, triazolyl, benzol d
  • Heterocycle is a saturated, unsaturated, or aromatic cyclic group having the indicated number of ring atoms containing from 1 to about 3 heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon.
  • heterocycle groups include piperazine and thiazole groups.
  • Heterocycloalkyl is a saturated cyclic group having the indicated number of ring atoms containing from 1 to about 3 heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon.
  • heterocycloalkyl groups include tetrahydrofuranyl and pyrrolidinyl groups.
  • Haloalkyl means both branched and straight-chain alkyl groups having the specified number of carbon atoms, substituted with 1 or more halogen atoms, generally up to the maximum allowable number of halogen atoms.
  • haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2 -fluoroethyl, and penta-fhioroethyl.
  • Haloalkoxy is a haloalkyl group as defined above attached through an oxygen bridge (oxygen of an alcohol radical).
  • “Pharmaceutically acceptable salts” include derivatives of the disclosed compounds in which the parent compound is modified by making inorganic and organic, non toxic, acid or base addition salts thereof.
  • the salts of the present compounds can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting free acid forms of these compounds with a stoichiometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, or the like), or by reacting free base forms of these compounds with a stoichiometric amount of the appropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two.
  • salts of the present compounds further include solvates of the compounds and of the compound salts.
  • Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • the pharmaceutically acceptable salts include the conventional non-toxic salts and the quaternary ammonium salts of the parent compound formed, for example, from non- toxic inorganic or organic acids.
  • conventional non-toxic acid salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxy maleic, phenylacetic, glutamic, benzoic, salicylic, mesylic, esylic, besylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, HOOC-(CH 2 ) n -COOH where n is 0-4, and the like.
  • inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phospho
  • the disclosure provides a method of treating cancer by administering one or more bisacridine compounds of Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII pharmaceutically acceptable salts thereof, or a pharmaceutical compositions comprising one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • the method of treating a cancer including preventing a significant progression of a cancer, causing a significant regression of a cancer or causing a cancer to be eradicated or otherwise become undetectable, comprises providing to a patient an effective amount of a compound or salt of the disclosure.
  • the patient is a mammal, and more specifically a human.
  • An effective amount of a compound pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier described herein will also provide a sufficient concentration of a compound of the disclosure when administered to a patient.
  • a sufficient concentration is a concentration of the compound in the patient's body necessary to combat the disorder. Such an amount may be ascertained experimentally, for example by assaying blood concentration of the compound, or theoretically, by calculating bioavailability.
  • Methods of treatment include providing certain dosage amounts of a compound, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to a patient.
  • Dosage levels of each compound from about 0. 1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per patient per day).
  • the amount of compound that may be combined with the carrier materials to produce a single dosage form will vary depending upon the patient treated and the particular mode of administration.
  • Dosage unit forms will generally contain between from about 1 mg to about 1000 mg of each active compound. In various embodiments 25 mg to 500 mg, or 25 mg to 200 mg of a compound of the disclosure are provided daily to a patient. Frequency of dosage may also vary depending on the compound used and the particular disease treated.
  • the disclosure provides a method of using compounds of Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII, and pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to treat a cancer.
  • the patient is suffering from a cell proliferative disorder or disease.
  • the cell proliferative disorder can be cancer, tumor (cancerous or benign), neoplasm, neovascularization, or melanoma.
  • Cancers for treatment include both solid and disseminated cancers.
  • Exemplary solid cancers (tumors) that may be treated by the methods provided herein include e.g.
  • Cancers that may be treated with a compound of this disclosure, or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier also include bladder cancer, breast cancer, colon cancer, endometrial cancer, lung cancer, bronchial cancer, melanoma, Non-Hodgkin lymphoma, cancer of the blood, pancreatic cancer, prostate cancer, thyroid cancer, brain or spinal cancer, and leukemia.
  • Exemplary disseminated cancers include leukemias or lymphoma including Hodgkin's disease, multiple myeloma and mantle cell lymphoma (MCL), chronic lymphocytic leukemia (CLL), T-cell leukemia, multiple myeloma, and Burkitt's lymphoma.
  • MCL mantle cell lymphoma
  • CLL chronic lymphocytic leukemia
  • T-cell leukemia multiple myeloma
  • Burkitt's lymphoma Burkitt's lymphoma.
  • methods of treating cancer by providing a compound of this disclosure, or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to a patient wherein the cancer is a solid tumor or disseminated cancer.
  • TOP3B inhibitors such as the compounds of the disclosure, are particularly useful for treating TOP3B expressing tumors, including cancers in which the tissue of origin is thyroid, breast, liver, endometrium, and ovary.
  • the disclosure includes methods of treating ovarian, endometrial, liver, breast, thyroid, prostate, pancreatic, stomach, lung, larynx, colon, esophageal, uterine and cervical, gall bladder, kidney, and urinary bladder cancer comprising administering a compound of the disclosure to a patient having such a cancer.
  • the disclosure also includes a method of treating malignant lymphoma comprising administering a compound of the disclosure to a patient with malignant lymphoma.
  • methods are provided to administer a therapeutically effective amount of one or more bisacridine compounds (i.e., those under Formula I through Formula VII, as described elsewhere herein), pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to treat a cancer.
  • one or more bisacridine compounds i.e., those under Formula I through Formula VII, as described elsewhere herein
  • pharmaceutically acceptable salts thereof i.e., those under Formula I through Formula VII, as described elsewhere herein
  • a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to treat a cancer.
  • the method includes one or more of the following: inducing cell death of a TOP3B-expressing cell in a subject; reducing the number of TOP3B-expressing cells in a subject; inhibiting TOP3B activity in a subject; poisoning TOP3B in a subject; trapping TOP3B in a subject; and promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject.
  • the bisacridine compound is present in an amount sufficient to induce cell death of TOP3B-expressing cells in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90% or substantially all of the TOP3B- expressing cells in a subject.
  • the bisacridine compound is present in an amount sufficient to reduce the number of TOP3B-expressing cells in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate the presence of TOP3B-expressing cells in a subject.
  • the bisacridine compound is present in an amount sufficient to inhibit TOP3B activity in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate TOP3B activity in a subject.
  • the bisacridine compound is present in an amount sufficient to poison TOP3B in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or poison substantially all of the TOP3B in a subject.
  • the bisacridine compound is present in an amount sufficient to trap TOP3B in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or trap essentially all of the TOP3B in a subject.
  • the bisacridine compound is present in an amount sufficient to promote the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, 2-fold, 3- fold, 5-fold, or 10-fold as compared to an infected subject not being treated with a method of the disclosure.
  • methods are provided to administer a therapeutically effective amount of one or more bisacridine compounds (again, those under Formula I through Formula VII, as described herein), pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to accomplish one or more of several actions, including reducing or inhibiting replication of an RNA virus in the subject; damaging viral RNA in a subject; stimulating anti -RNA viral activity in a subject, and treating an RNA viral infection in a subject.
  • the RNA virus is a positive strand RNA virus, which is, in various embodiments, from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota and class Alsuviriceles, Flasuviricetes, Magsaviricetes, or Tolucaviricetes.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, and order Hepelivirales, Mar tellivir ales, or Tymovirales.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Hepelivirales, and family Alphatetraviridae , Benyviridae, Hepeviridae or Matonaviridae .
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Martellivirales, and family Bromoviridae, Closteroviridae, Endornaviridae , Kitaviridae, Mayoviridae, Togaviridae, or Virgaviridae .
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Tymovirales, and family Alphaflexiviridae , Betaflexiviridae, Deltaflexiviridae, Gammaflexiviridae, or Tymoviridae .
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus, Hepacivirus, Pegivirus, or Pestivirus. [00173] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, genus Flavivirus, and species Dengue virus, West Nile virus, Yellow Fever virus and Zika virus.
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Magsaviricetes, order Nodamuvirales, and family Nodaviridae or Sinhaliviridae .
  • the positive strand RNA virus is selected from phylum Kitrinoviricota, class Tolucaviricetes, order Tolivirales, and family Carmotetraviridae or Tombusviridae .
  • the positive strand RNA virus is selected from phylum Lenarviricota and class Amabiliviricetes, Howeltoviricetes, Leviviricetes, or Miaviricetes .
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Amabiliviricetes, order Wolframvirales, and family Narnaviridae .
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Howeltoviricetes, order Cryppavirales, and family Mitoviridae.
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, and order Norzivirales or Timlovirales.
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Norzivirales, and family Atkinsviridae, Duinviridae, Fiersviridae, or Solspiviridae .
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Timlovirales, and family Blumeviridae or Steitzviridae .
  • the positive strand RNA virus is selected from phylum Lenarviricota, class Miaviricetes, order Ourlivirales, and family Botourmiaviridae .
  • the positive strand RNA virus is selected from phylum Pisuviricota and class Duplopiviricetes, Pisoniviricetes, or Stelpaviricetes.
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Duplopiviricetes, order Durnavirales, and family Amalgaviridae , Curvulaviridae , Fusariviridae , Hypoviridae, Partitiviridae or Picobirnaviridae .
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, and order Nidovirales, Picornavirales, or Sobelivirales .
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Abnidovirineae and family Abyssoviridae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Arnidovirineae and family Arteriviridae, Cremegaviridae, Gresnaviridae or Olifoviridae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Nidovirales, suborder (Arnidovirineae, family Coronaviridae, and subfamily I.elovirinae. Orthocoronavirinae or Pitovirinae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder (Arnidovirineae, family Coronaviridae, subfamily Orthocoronavirinae and genus Alphacoronavirus, Betacoronavirus, Deltacoronavirus or Gammacoronavirus.
  • the genus is Alphacoronavirus
  • the species is Alphacoronavirus 1 (TGEV, Feline coronavirus, Canine coronavirus), Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, or Scotophilus bat coronavirus 512.
  • the genus is Deltacoronavirus, and in some embodiments, the genus is Gammacoronavirus .
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Mesnidovirineae, and family Medioniviridae or Mesoniviridae .
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Monidovirineae, and family Mononiviridae .
  • the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Nanidovirineae, and family Nanghoshaviridae or Nanhypoviridae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Ronidovirineae, and family Euroniviridae or Roniviridae.
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Tornidovirineae, and family Tobaniviridae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Picornavirales, and family Caliciviridae , Dicistr oviridae. Iflaviridae. Marnaviridae. Picornaviridae. Polycipiviridae, Secoviridae or Solinviviridae .
  • the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Sobelivirales. and family Alvernaviridae , Barnaviridae or Solemoviridae.
  • the positive strand RNA virus is Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus, which, in some embodiments is selected from the group consisting of Middle East respiratory syndrome-related (MERS -related) coronavirus and Severe acute respiratory syndrome-related (SARS-related) coronavirus.
  • MERS -related Middle East respiratory syndrome-related
  • SARS-related coronavirus is SARS-CoV, SARS-CoV-2.
  • the bisacridine compound is present in an amount sufficient to exert a therapeutic effect to reduce one or more symptoms of infection with a positive strand RNA virus by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate one or more symptoms of infection with a positive strand RNA virus.
  • the bisacridine compound is present in an amount sufficient to reduce or inhibit replication of an RNA virus in the subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate replication of an RNA virus in the subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate replication of an RNA virus in the subject.
  • the bisacridine compound is present in an amount sufficient to damage viral RNA in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90% or substantially all of the viral RNA in a subject.
  • the bisacridine compound is present in an amount sufficient to stimulate anti-RNA viral activity in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%.
  • the bisacridine drug is present in an amount sufficient to prevent the onset of a symptom of positive strand RNA virus infection.
  • an effective amount of the bisacridine drug is a daily dose of about grams.
  • the methods of the disclosure include many suitable modes of administration to deliver a bisacridine drug via systemic administration.
  • Suitable formulations and additional carriers are described in, e.g., Remington “The Science and Practice of Pharmacy” (20th Ed., Lippincott Williams & Wilkins, Baltimore Md.), the teachings of which are incorporated by reference in their entirety herein.
  • compositions of the disclosure can be administered to humans and other mammals orally, via injection and topically.
  • Alternative and additional routes such as rectally, parenterally, intraci sternally, intravaginally, intraperitoneally, bucally, or nasally, are envisioned.
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • the sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono- or di glycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial- retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • Injectable depot forms are made by forming microencapsulating matrices of the agent in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of active agent to polymer and the nature of the particular polymer employed, the rate of active agent release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissues.
  • Solid dosage forms for oral administration include capsules, tablets, pills, troches, wafers, powders, and granules.
  • the active agent is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or (a) fillers or extenders such as starches, sucrose, glucose, mannitol, and silicic acid, (b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, (c) humectants such as glycerol, (d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, various silicates, and sodium carbonate, (e) solution retarding agents such as paraffin, (f) absorption accelerators such as quaternary ammonium compounds, (g) wetting agents such as, for example, cetylene glycol, gly
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art.
  • the active agent(s) may be admixed with at least one inert diluent such as sucrose or starch.
  • Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose.
  • additional substances other than inert diluents e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose.
  • the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active agent(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.
  • Liquid dosage forms for ocular administration include buffers and solubilizing agents, preferred diluents such as water, preservatives such as thymosol, and one or more biopolymers or polymers for conditioning the solution, such as polyethylene glycol, hydroxypropylmethylcellulose, sodium hyaluronate, sodium polyacrylate or tamarind gum.
  • Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • the oral compositions can contain inert diluents commonly used in the art such as, for example
  • Dosage forms for topical or transdermal administration of an inventive pharmaceutical composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches.
  • the active agent is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required.
  • ocular or cutaneous infections may be treated with aqueous drops, a mist, an emulsion, or a cream.
  • the ointments, pastes, creams, and gels may contain, in addition to an active agents of the disclosure, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
  • excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
  • Transdermal patches have the added advantage of providing controlled delivery of the active ingredients to the body.
  • dosage forms can be made by dissolving or dispensing the compound in the proper medium.
  • Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
  • Administration of a bisacridine drug or pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier may be therapeutic or may be prophylactic.
  • each agent in this context, one of the “agents” is a composition of this disclosure
  • the disclosure encompasses the delivery of the compositions in combination with agents that may improve their bioavailability, reduce or modify their metabolism, inhibit their excretion, or modify their distribution within the body.
  • the daily dose can range from about 1 x 10 7 g to 5000 mg.
  • Daily dose range may depend on the form of bisacridine drug e.g., the salts used, and/or route of administration, as described herein.
  • typical daily dose ranges are, e.g.
  • the daily dose of bisacridine drug is about 5, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mg. In some embodiments, the daily dose of the bisacridine drug is 10 mg. In some embodiments, the daily dose of the bisacridine drug is 100 mg. In some embodiments, the daily dose of bisacridine drug is 500 mg. In some embodiments, the daily dose of bisacridine drug is 1000 mg.
  • the daily dosages may be around the range described for systemic administration.
  • TOP3B knockout (TOP3B-KO) cells were generated from human colon carcinoma HCT116 cells to discover compounds against which TOP3B-KO cells were more resistant than isogenic parental HCT116 cells, in a “Comparative Cellular Toxicity Screen” (also “CCTS”; Figure 1A). To carry out the screen, HCT116 parental cells and TOP3B-KO cells were labeled with different fluorescent proteins, allowing monitoring of the viability of each cell line in the same well via different fluorescent microscopy channels.
  • the parental GFP-labeled HCT116 and mCherry- labeled TOP3B-KO cells were mixed and seeded in each well at a 1 to 1 ratio. After the cells were allowed to attach for 24-48 hours, the media was changed with media containing various compounds at different concentrations, and the cell plates were incubated for an additional 72 hours. The entire plate was imaged at the end of compound treatment and the sensitivity of each cell line to a particular compound was directly assessed using two distinct channels in fluorescence microscopy (Figure 1A).
  • the CCTS enabled comparison of the parental and TOP3B-KO cells in the same well and reduced the amount of test compounds and reagents by 50%. Further, culturing the parental and TOP3B-KO cells in the same well ensured identical growth conditions and, e.g., eliminated variation in compound concentrations introduced by pipetting errors, variable degrees of liquid evaporation and other potential errors.
  • Mechanistic Set VI Set Library whose compound library was curated to include the different growth inhibition patterns in the NCI-60 cell line screen.
  • Live-cell images of mixed HCT116 parental and TOP3B-KO cells were taken after 72-hour treatment with a given compound in both GFP and mCherry channels, as well as the light microscopy channel. Cell count and confluency were quantified for the parental and TOP3B-KO cells in their respective channel before normalizing to the DMSO-treated wells on the same plate ( Figure 1B). Images were manually inspected for the instances where the drug compounds strongly fluoresce in one of the channels. Cell count and confluency of light microscopy images were quantified for such instances.
  • the light microscopy images represent combined parental and TOP3B-KO cells, so that the levels of cells in the flooded channel can be back-calculated.
  • each compound was screened across a wide range of concentrations (from 32 nM to 20 ⁇ M, in 5-fold serial dilutions). From the combined data, survival curves were constructed for both HCT116 and TOP3B-KO cells to each of the compounds in the library.
  • TOP3B-KO cells are selectively resistant; TOP3B-KO cells are selectively sensitive; TOP3B-KO cells have the same response as the parental cells; and compounds are too toxic even at the lowest concentration tested ( Figure 1 A).
  • Figure 1 A the relative viability of TOP3B-KO vs HCT116 (WT) cells after treatment at every concentration was multiplied together to yield a “Resistance Factor” (RF) value ( Figure 2A).
  • RF Resistance Factor
  • EXAMPLE 2 RADAR assays for the selection compounds inducing cellular TOP3Bccs
  • TOP3B When TOP3B is covalently attached to DNA or RNA, it co-purifies with the nucleic acids and the presence of TOP3Bcc can be detected via specific antibodies (S. Saha et al., Cell Rep 33, 108569 (2020)). Out of 19 compounds selected from the survival assays, 6 gave rise to enhanced TOP3Bcc signals in human epithelial kidney HEK293 cells transiently overexpressing flag-tagged TOP3B after 1-4-hour treatments at 100 ⁇ M (certain structures shown in Figure 3B).
  • NSC690634 induced TOP3Bccs within 1 hour, while it took 4 hours to induce comparable levels of TOP3Bccs for other compounds (Figure 3C).
  • TOPI and TOP2 poisons require short treatments to generate high levels of TOPccs (Y. Sun et al., Sci Adv 6 (2020)), so NSC690634 appears consistent with a direct TOP3B trapping mechanism.
  • TOP3Bccs An in vitro system to detect the formation of TOP3Bccs with either DNA or RNA substrates using recombinant TOP3B enzyme (S. Saha et al., Cell Rep 33, 108569 (2020)) was used to assess the compounds selected according to the process outlined in Figure 2C. Since TOP3B forms covalent linkage with the 5 ’-end of the nucleic acid, a single-strand DNA or RNA construct with a fluorophore molecule attached at the 3 ’-end was used ( Figure 4A).
  • the molecular weight of the free construct increases and the gel migration decreases when a small population of the TOP3B forms TOP3Bcc with the substrates, representing the normally transient intermediate state of the TOP3B catalytic cycle ( Figure 4A).
  • the two species are unambiguously resolved on SDS-PAGE and can detected via the fluorophores on the oligo constructs.
  • This assay also allows for testing different effects of TOP3B on DNA vs RNA.
  • NSC690634 Increasing concentration of NSC690634 stabilized the high molecular weight species (100-180 kDa) of RNA-TOP3Bcc, as well as much higher molecular weight species (>200 kDa).
  • NSC690634 is a bisacridine compound (Figure 3B).
  • Cell survival assays confirmed that TOP3B-KO cells were more resistant to NSC690634 than the HCT116 parental cells ( Figure 7B and Figure 7C), regardless which fluorescent proteins were used in the labeling.
  • TOP3B-KO cells also showed sensitivity to NSC690634 above certain threshold concentrations, indicating these compounds likely have additional cellular targets beyond TOP3B.
  • NSC690634 induced endogenous TOP3Bccs in different human cell lines using RADAR assays. Due to the lower sensitivity of anti-TOP3B antibody and the lower level of endogenous TOP3B, higher concentration of either compound and longer treatments were required to detect endogenous TOP3Bcc induction. NSC690634 induced endogenous TOP3Bcc in time- and dose-dependent manners in all human cell lines tested ( Figures 5A-5F). Immunoblotting of HEK293 cells treated with NSC690634 was performed and the levels of free TOP3B were measured to determine whether as TOP3Bcc levels increase, free TOP3Bcc levels decrease.
  • NSC690634 for trapping TOP3Bcc was tested by probing for the presence of cleavage complexes of other topoisomerases by RADAR assay. It was observed that NSC690634 induced only TOP3Bcc and not cleavage complexes of TOP3 A, TOPI, or TOP2 ( Figure 9C). Thus, NSC690634 is specific for the trapping of TOP3B.
  • TOP3B is the only known RNA topoisomerase in human cells (M. Ahmad et al., Nucleic Acids Res 44, 6335-6349 (2016)), but it also demonstrates DNA topoisomerase activity, and TOP3Bccs form on both DNA and RNA (S. Saha et al., Cell Rep 33, 108569 (2020)). Whether NSC690634 induced TOP3Bccs on DNA or RNA in the cells was tested. Cellular TOP3Bcc on DNA and RNA can be distinguished by selectively digesting away the RNA or DNA in RADAR samples that contain both DNA- and RNA-topoisom erase crosslinks.
  • NSC690634 thus appears to induce primarily RNA-TOP3Bccs in cells, which is consistent with the biochemical assays described above ( Figure 4) showing that NSC690634 traps RNA-TOP3Bccs to a greater extent than DNA-TOP3Bccs.
  • Cellular TOP3Bccs on DNA and RNA can also be distinguished by separating the two nucleic acid species in a CsCl gradient in in vivo complex of enzyme (ICE) bioassays.
  • ICE in vivo complex of enzyme
  • Human embryonic kidney HEK293 cells, human colorectal carcinoma HCT116 cells were cultured in 1 x Dulbecco's modified Eagle's medium (DMEM, Life Technologies), supplemented with 10% (v/v) Fetal Bovine Serum (FBS, Gemini), 100 U/mL penicillin, 100 ⁇ g/mL streptomycin, and 1 x GlutaMax (ThermoFisher). Cells were incubated at 37°C with 5% CO 2 incubator to corresponding confluency.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS Fetal Bovine Serum
  • GlutaMax ThermoFisher
  • Human TOP3B-Myc-Flag cDNA ORF was purchased from OriGene (RC223204) and transfected in HEK293 cells using Lipofectamine 3000 Reagent (ThermoFisher Scientific) according to the manufacturer’s protocol for 48 hours before drug treatments.
  • HCT116-TOP3B-KO cells were as described (S. Saha et al., Resolution of R-loops by topoisomerase Ill-beta (TOP3B) in coordination with the DEAD-box helicase DDX5. Cell Rep 40, 111067 (2022)).
  • HCT116 and HCT116-TOP3B-KO cells stably expressing GFP or mCherry were generated using lentivirus containing pFUGW-FerH-ffLuc2- eGFP (Addgene #71393) or pFUGW-FerH-ffLuc2-mCherry, followed by FACS sorting and subculturing into monoclonal populations.
  • ICE bioassays were carried out as follows: approximately 1 million HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour. The treated and non-treated control cells were pelleted and immediately lysed with 1 mL of 1% sarkosyl. After homogenization with a Dounce, cell lysates were gently layered on step gradients containing four different CsCl (Sigma-Aldrich, CAT#:746487-1KG) solutions (2 mL of each) of the following densities: 1.82, 1.72, 1.50, and 1.45. The gradients were prepared by diluting a stock solution of CsCl of density 1.88.
  • CsCl Sigma-Aldrich, CAT#:746487-1KG
  • Cesium sulfate (Sigma- Aldrich, CAT#:C5205-50G) was included in the bottom solution of density 1.82 to facilitate flotation of the RNA, and sodium thiocyanate (Sigma-Aldrich, CAT#: S7757-1KG) was included in topmost solution of density 1.45 to facilitate the complete removal of noncovalently bound proteins from the nucleic acid species. Samples were centrifuged at 30,700 rpm in a Beckman SW40 rotor for 24 hours at 20 °C. Half-milliliter fractions were collected from the bottom of the tubes.
  • RNA-protein adducts were isolated from cells using protein-crosslinked RNA extraction (XRNAX), as described previously (S. Saha et al., Cell Rep 33, 108569 (2020)).
  • HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour.
  • Cells were lysed in 1 mL TRIzolTM Reagent (Invitrogen, USA, CAT#: 15596026) by pipetting the samples up and down several times followed by incubation at room temperature for 5 min. 200 ⁇ L chloroform was then added to the samples and mixed thoroughly by inverting the tubes. After incubation at room temperature for 3 min and centrifugation for 10 min at 7,000 x g at 4 °C, the aqueous phase was removed, and the interphase was transferred to a new tube.
  • TRIzolTM Reagent Invitrogen, USA, CAT#: 15596026
  • the interphase was gently washed twice with 1 ml low SDS buffer (50 mM Tris-Cl, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% SDS), resuspended in low SDS buffer, centrifuged at 5,000 x g for 2 min at room temperature, and the supernatant was stored. Pellets were washed again with 1 mL of low SDS buffer, then twice more with 1 mL high SDS buffer (50 mM Tris-Cl, 1 mM EDTA, 0.5% SDS), and all the supernatants were stored following centrifugation.
  • 1 ml low SDS buffer 50 mM Tris-Cl, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% SDS
  • EDTA ethylenediaminetetraacetic acid
  • NaCl was added to a final concentration of 300 mM to each of the interphase eluates, along with 10 ⁇ g of RNase-free glycogen and 1 mL isopropanol before mixing by inversion. Samples were spun down for 15 min with 18,000 x g at -10 °C. Supernatant were discarded; pellets were washed with 70% ethanol, with residual ethanol removed; and the pellets were resuspended in nuclease-free water at 4 °C.
  • RNA purity and concentrations were estimated by spectroscopy on a NanoDrop 1000 Spectrophotometer (ThermoFisher Scientific, USA).
  • RNA-TOP3Bccs were detected using mouse monoclonal anti-FLAG M2 antibody (Millipore Sigma, St. Louis, MO, CAT#: Fl 804), and the loading control was carried out by staining with methylene blue stain (Molecular Research Center) following the manufacturer’s protocol.
  • RNA-TOP3Bcc For isolation and detection of RNA-TOP3Bcc the PTex method was performed as described previously (C. Urdaneta et al., Nat. Commun. 10, 990 (2019)). Briefly, 5 x 10 6 HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour, harvested and suspended in 600 ⁇ L of phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • aqueous phase was carefully taken out and transferred to a 2-mL Eppendorf tube containing 300 ⁇ L of solution D (5.85 M guanidine isothiocyanate; 31.1 mM sodium citrate; 25.6 mM N-lauryosyl-sarcosine; 1% 2- mercaptoethanol). Then, 600 ⁇ L phenol and 200 ⁇ L BCP were added to the samples, mixed, and centrifuged (20,000 g, 3 min, 4 °C). After phase separation, the upper aqueous and the lower organic phases were removed using a syringe with a blunt needle.
  • solution D 5.85 M guanidine isothiocyanate; 31.1 mM sodium citrate; 25.6 mM N-lauryosyl-sarcosine; 1% 2- mercaptoethanol.
  • 600 ⁇ L phenol and 200 ⁇ L BCP were added to the samples, mixed, and centrifuged (20,000 g, 3 min, 4 °
  • the resulting interphase was mixed with 400 ⁇ L water, 200 ⁇ L ethanol, 400 ⁇ L phenol, and 200 ⁇ L BCP (1 min, 21 °C, 2,000 rpm) and centrifuged (20,000 g, 3 min, 4 °C). The upper aqueous and the lower organic phases were carefully removed, while interphase was precipitated with 9 volumes of ethanol (-20 °C, overnight). Samples were centrifuged (4 °C, 30 min, 20,000 g), pellets dried, and then solubilized in RNase-free DEPC-treated water. RNA purity and concentrations were estimated by spectroscopy on a NanoDrop 1000 Spectrophotometer (ThermoFisher Scientific, USA).
  • RNA-TOP3Bccs were detected using the mouse monoclonal anti-FLAG M2 antibody (Millipore Sigma, St. Louis, MO, CAT#: Fl 804), and the loading control was carried out by staining with methylene blue stain (Molecular Research Center) following the manufacturer’s protocol.
  • Modified RADAR assays were carried out to purify both DNA and RNA species from the cell lysates, and the entire procedure was carried out under DNase- and RNase-free conditions. Briefly, after treatment with specified compound (e.g., NSC690634) at indicated concentration and time, cells with or without prior transfection with the Flag-tagged TOP3B (TOP3B OE) were directly lysed with 400 ⁇ L of DNAzol (Invitrogen). Instead of the optional centrifugation step at this point, which would remove RNA and other insoluble tissue fragments, the entire sample was collected in order to retain both DNA and RNA species.
  • specified compound e.g., NSC690634
  • TOP3B OE Flag-tagged TOP3B
  • the samples were then precipitated with half-volume of 100% ice-cold ethanol and incubated at -20 °C for 20 min.
  • all nucleic acids were pelleted by centrifugation of the entire sample at 15,000 rpm for 15 min at 4 °C in order to retain both DNA and RNA species.
  • the pellets were then washed with 75% ice-cold ethanol twice, air- dried, and resuspended in 100 ⁇ L RNase-free Tris-ethylenediaminetetraacetic acid (TE) buffer.
  • TE Tris-ethylenediaminetetraacetic acid
  • RNA-TOP3Bcc from TOP3Bccs
  • 10 ⁇ g nucleic acids samples were incubated with 1 ⁇ g/ ⁇ L RNase A and 1 U/ ⁇ L RNase T1 at 37°C for 2 hours, followed by adding 1/10 volume of 3 M sodium acetate, and 3 volume of 100% ice-cold ethanol.
  • 10 ⁇ g nucleic acids samples were incubated with 0. 1 U/ ⁇ L DNase I at 37°C for 2 hours, followed by adding 1/10 volume of 3 M sodium acetate, and 3 volume of 100% ice-cold ethanol.
  • nucleic acid polymers were pelleted by centrifugation at 15,000 rpm for 15 min at 4°C. Nucleic acids pellets were washed with 75% ice-cold ethanol twice, air dried and resuspended in 100 ⁇ L TE buffer.
  • TOP3Bcc signals were probed by anti-Flag antibody (mouse monoclonal, clone M2, Sigma) or anti-TOP3B antibody [rabbit monoclonal, (EP7779), Abeam], Loading controls were probed with anti-ds DNA antibody (ab27156, Abeam).
  • Genomic DNA from HCT116 and HCT116-TOP3B-KO cells treated with DMSO or NSC690634 were extracted using DRIP protocol as described (L. A. Sanz, F. Chedin, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing. Nat Protoc 14, 1734-1755 (2019)). Briefly, cells were lysed in TE buffer containing SDS and proteinase K (at 37°C overnight) before extraction with phenol/chloroform/isoamyl alcohol (25:24: 1) followed by ethanol precipitatation.
  • Genomic DNA was resuspended in TE buffer and digested with a cocktail of restriction enzymes (Hindlll, SspI, EcoRI, BsrGI and Xbal; 30 U each), treated with RNase A (10 ⁇ g/mL) and shortcut RNase III (2 units; New England Biolabs) before purification again with phenol/chloroform/isoamyl alcohol (25:24: 1). Where indicated, 10 ⁇ g of genomic DNA was treated with 20 U of RNase H at 37°C for 3 hours. The resulting genomic DNA samples were spotted on a nitrocellulose membrane, crosslinked and blocked with PBS-Tween (0.1%) buffer containing 5% non-fat milk. The membrane was probed with mouse S9.6 antibody (1 :500 dilution, at 4°C overnight) and developed using standard electrochemiluminescence techniques. The same samples probed with anti-dsDNA antibodies served as loading controls.
  • Hindlll, SspI, EcoRI, BsrGI and Xbal 30 U
  • TOP3B was initially PCR amplified from Human TOP3B-Myc-flag cDNA ORF (CAT#: RC223204) using forward primer: 5 ' -
  • CGGGGTACCATGAAGACTGTGCTCATGG-3 ' SEQ ID NO: 1
  • reverse primer 5 ' -CCGCTCGAGTCATACAAAGTAGGCGGCCAG-3 '
  • TOP3B was then subcloned by Gateway LR recombination (Thermo Fisher) into pDest-635 (22876-X01-635) for insect cell expression which includes anN-terminal His6 tag.
  • Bacmid was prepared in DE77, aDHlOBac- derived strain (Bac-to-Bac system, Thermo Fisher) and after purification, bacmid DNA was verified by PCR amplification across the bacmid junctions. Bacmids were transfected in SF-9 cells using PEI (1 mg/ml with 5% glucose; Polysciences, CAT#: 23966), recombinant baculovirus stock was collected and titrated using ViroCyt (Beckamn).
  • Tni-FNL cells Two liters of Tni-FNL cells were set in a baffled 5-1 Thomson Optimum Growth Flask in GIBCO Express 5 medium with 18 mM glucose at a cell density of 1 x 10 6 cells/ml at 27°C and 24 hour later infected at a MOI (multiplicity of infection) of 3. After 3 days of incubation at 21 °C, cell pellets were collected by centrifugation at 2000 rpm for 11 min and flash frozen on dry ice.
  • MOI multiplicity of infection
  • Cell pellet was thawed by the addition of 200 mL of lysis buffer (20 mM HEPES, 300 mM NaCl, 1 mM TCEP and 1 : 100 v/v of Sigma protease inhibitor P8849) and homogenized by vortexing.
  • lysis buffer (20 mM HEPES, 300 mM NaCl, 1 mM TCEP and 1 : 100 v/v of Sigma protease inhibitor P8849
  • the cells were lysed by performing two passes on an M-110EH-30 microfluidizer (Microfluidics) at 7000 psi, clarified at 100K x g for 30 minutes at 4°C using an optima L-90K ultracentrifuge (Beckman), filtered (0.45 micron) and applied to a f20 mL IMAC HP column (GE Scientific) that was pre-equilibrated with lysis buffer containing 50 mM imidazole on a Bio-Rad NGC. Column was washed with lysis buffer containing 50 mM imidazole and proteins were eluted with lysis buffer containing 500 mM imidazole.
  • the hairpin DNA oligo substrate with long 3 ' -tail GGGATTATTGAACTGTTGTTCAAACTTTAGAACTAGCCATCCGATTTACACTTTG CCCCTATCCACCCC-3’FITC (SEQ ID NO:3) or the corresponding RNA oligo substrate: GGGAUUAUUGAACUGUUGUUCAAACUUUAGAACUAGCCAUCCGAUUUACACU UUGCCCCU-3’-Cy5 (SEQ ID NO:4) was synthesized by IDT (Integrated DNA Technologies, Coralville, Iowa).
  • Embodiment 1 A method of reducing or inhibiting replication of an RNA virus in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 2 A method of damaging viral RNA in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 3 A method of stimulating anti -RNA viral activity in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 4 A method of treating an RNA viral infection in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more cyanine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more cyanine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 5 A method for treating a cancer in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 6 The method of embodiment 5, wherein the cancer is a cancer that expresses TOP3B.
  • Embodiment 7 The method of embodiment 6, wherein the cancer comprises ovarian cancer, endometrial cancer, liver cancer, breast cancer, thyroid cancer, prostate cancer, pancreatic cancer, stomach cancer, lung cancer, larynx cancer, colon cancer, esophageal cancer, uterine cancer, cervical cancer, gall bladder cancer, kidney cancer, urinary bladder cancer or malignant lymphoma.
  • Embodiment 8 A method of inducing cell death of a TOP3B-expressing cell in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 9 A method of reducing the number of TOP3B-expressing cells in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 10 A method of inhibiting TOP3B activity in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 11 A method of poisoning TOP3B in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 12 A method of trapping TOP3B in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • Embodiment 13 A method of promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
  • TOP3Bccs TOP3B cleavage complexes
  • Embodiment 14 The method of any one of embodiments 1-4, wherein the RNA virus is a positive strand RNA virus.
  • Embodiment 15 The method of embodiment 14, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota.
  • Embodiment 16 The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota and class Alsuviriceles, Flasuviricetes, Magsaviricetes, or Tolucaviricetes.
  • Embodiment 17 The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, and order Hepelivirales, Martellivirales, or Tymovirales .
  • Embodiment 18 The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Hepelivirales, and family Alphatetraviridae, Benyviridae, Hepeviridae or Matonaviridae .
  • Embodiment 19 The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles. order Marlellivirales, and family Bromoviridae, Closter oviridae, Endornaviridae, Kitaviridae, Mayoviridae, Togaviridae, or Virgaviridae .
  • Embodiment 20 The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Tymovirales, and family Alphaflexiviridae, Betaflexiviridae, Deltaflexiviridae, Gammaflexiviridae, or Tymoviridae.
  • Embodiment 21 The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kiirinoviricoia, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus, Hepacivirus, Pegivirus, or Pestivirus.
  • Embodiment 22 The method of embodiment 21, wherein the positive strand RNA virus is selected from phylum Kiirinoviricoia, class Flasuviricetes, order Amarillovirales, family Flaviviridae , and genus Flavivirus.
  • Embodiment 23 The method of embodiment 22, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviriceies, order Amarillovirales, family Flaviviridae, genus Flavivirus, and species Dengue virus, West Nile virus, Yellow Fever virus and Zika virus.
  • Embodiment 24 The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Magsaviricetes, order Nodamuvirales, and family Nodaviridae or Sinhaliviridae .
  • Embodiment 25 The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Tolucaviricetes, order Tolivirales, and family Carmotetraviridae or Tombusviridae .
  • Embodiment 26 The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Lenarviricota and class Amabiliviricetes, Howeltoviricetes, Leviviricetes, or Miaviricetes.
  • Embodiment The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Amabiliviricetes, order Wolframvirales, and family Narnaviridae .
  • Embodiment 28 The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Howeltoviricetes, order Cryppavirales, and family Mitoviridae.
  • Embodiment 29 The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, and order Norzivirales or Timlovirales.
  • Embodiment 30 The method of embodiment 29, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Norzivirales, and family Atkinsviridae, Duinviridae, Fiersviridae, or Solspiviridae .
  • Embodiment 31 The method of embodiment 29, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Timlovirales, and family Blumeviridae or Steitzviridae .
  • Embodiment 32 The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Miaviricetes, order Ourlivirales, and family Botourmiaviridae .
  • Embodiment 33 The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Pisuviricota and class Duplopiviricetes, Pisoniviricetes, or Stelpaviricetes.
  • Embodiment 34 The method of embodiment 33, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Duplopiviricetes, order Durnavirales, and family Amalgaviridae , Curvulaviridae, Fusariviridae, Hypoviridae, Partitiviridae or Picobirnaviridae .
  • Embodiment 35 The method of embodiment 33, wherein the positive strand RNA virus is selected from phylum Pisiiviricola, class Pisoniviriceies, and order Nidovirales, Picornavirales, or Sobelivirales .
  • Embodiment 36 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Abnidovirineae and family Abyssoviridae .
  • Embodiment 37 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Nidovirales, suborder Arnidovirineae and family Arteriviridae , Cremegaviridae, Gresnaviridae or Olifoviridae .
  • Embodiment 38 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, and subfamily I.elovirinae, Orthocoronavirinae or Pitovirinae .
  • Embodiment 39 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola, class Pisoniviriceies, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, subfamily Orthocoronavirinae and genus Alphacoronavirus, Betacoronavirus, Deltacoronavirus or Gammacoronavirus.
  • the positive strand RNA virus is selected from phylum Pisiiviricola, class Pisoniviriceies, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, subfamily Orthocoronavirinae and genus Alphacoronavirus, Betacoronavirus, Deltacoronavirus or Gammacoronavirus.
  • Embodiment 40 The method of embodiment 39, wherein the genus is Alphacoronavirus .
  • Embodiment 41 The method of embodiment 40, wherein the genus is Alphacoronavirus and species is Alphacoronavirus 1 (TGEV, Feline coronavirus, Canine coronavirus), Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, or Scotophilus bat coronavirus 512.
  • TGEV Alphacoronavirus 1
  • Feline coronavirus Feline coronavirus, Canine coronavirus
  • Human coronavirus 229E Human coronavirus NL63
  • Miniopterus bat coronavirus 1 1, Miniopterus bat coronavirus HKU8
  • Porcine epidemic diarrhea virus Rhinolophus bat coronavirus HKU2
  • Scotophilus bat coronavirus 512 Scotophilus bat coronavirus 512.
  • Embodiment 42 The method of embodiment 39, wherein the genus is Betacoronavirus .
  • Embodiment 43 The method of embodiment 42, wherein the genus is Betacoronavirus and species is Betacoronavirus 1 (Bovine Coronavirus, Human coronavirus OC 4 3), Human coronavirus HKU1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Rousettus bat coronavirus HKU9, Severe acute respiratory syndrome-related coronavirus (SARS-CoV, SARS-CoV-2), or Tylonycteris bat coronavirus HKU4.
  • Betacoronavirus 1 Bovine Coronavirus, Human coronavirus OC 4 3
  • Human coronavirus HKU1 Middle East respiratory syndrome-related coronavirus
  • Pipistrellus bat coronavirus HKU5 Pipistrellus bat coronavirus HKU5
  • Rousettus bat coronavirus HKU9 Severe acute respiratory syndrome-related coronavirus (SARS-CoV, SARS-CoV-2), or Tylonycter
  • Embodiment 44 The method of embodiment 39, wherein the genus is Deltacoronavirus.
  • Embodiment 45 The method of embodiment 39, wherein the genus is Gammacoronavirus .
  • Embodiment 46 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Mesnidovirineae , and family Medioniviridae or Mesoniviridae .
  • Embodiment 47 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Monidovirineae. and family Mononiviridae .
  • Embodiment 48 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Nanidovirineae , and family Nanghoshaviridae or Nanhypoviridae .
  • Embodiment 49 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Ronidovirineae. and family Euroniviridae or Roniviridae .
  • Embodiment 50 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Tornidovirineae , and family Tobaniviridae .
  • Embodiment 51 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviricetes, order Picornavirales, and family Caliciviridae, Dicistr oviridae, Iflaviridae, Marnaviridae , Picornaviridae, Polycipiviridae, Secoviridae or Solinviviridae .
  • Embodiment 52 The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceles. order Sobelivirales. and family Alvernaviridae. Barnaviridae or Solemoviridae.
  • Embodiment 53 The method of embodiment 14, wherein the positive strand RNA virus is Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus.
  • Embodiment 54 The method of embodiment 53, wherein the coronavirus is selected from the group consisting of Middle East respiratory syndrome-related (MERS -related) coronavirus and Severe acute respiratory syndrome-related (SARS -related) coronavirus.
  • MERS Middle East respiratory syndrome-related
  • SARS Severe acute respiratory syndrome-related
  • Embodiment 55 The method of embodiment 54, wherein the SARS-related coronavirus is SARS-CoV or SARS-CoV-2.
  • Embodiment 56 The method of any one of embodiments 1-55, wherein the one or more bisacridine compounds is represented by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl; and for Formula I:
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, - C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R F are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl;
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent, (CH 2 ) k O, S or N — R F ; where k is 1, 2, or 3;
  • Y is absent, CH 2 , O, CH 2 O or N — R F ;
  • Y’ is absent CH 2 , O, OCH 2 or N — R F , with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where
  • G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH 2 ) W where w is at least 1;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • D is absent, O or N — R z , where R z is H or an optionally substituted C 1 -C 3 alkyl group; all with the proviso that the total length of linker -(CH 2 Y) n -X-(Y’CH 2 ) n - or linker - A-(CH 2 -CH 2 -D) n -A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety; and for Formula II:
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, - C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R E are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where
  • G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is 0, 1, 2, or 3;
  • R are each independently H, or C 1-6 alkyl; and for Formula III to Formula VI:
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 57 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula I
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, - C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R F are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl;
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent, (CH 2 ) k O, S or N — R F ; where k is 1, 2, or 3;
  • Y is absent, CH 2 , O, CH 2 O or N — R F ;
  • Y’ is absent CH 2 , O, OCH 2 or N — R F , with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where
  • G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH 2 ) W where w is at least 1;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • D is absent, O or N — R z , where R z is H or an optionally substituted C 1 -C 3 alkyl group; all with the proviso that the total length of linker -(CH 2 Y) n -X-(Y’CH 2 ) n - or linker - A-(CH 2 -CH 2 -D) n -A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 58 The method of embodiment 57, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted C 1
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO2R F ;
  • R F are independently H, C 1-6 alkyl, or aryl-C 0-4 alkyl;
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent, (CH 2 ) k O, S or N — R F ; where k is 1, 2, or 3;
  • Y is absent, CH 2 , O, CH 2 O or N — R F ;
  • Y’ is absent CH 2 , O, OCH 2 or N — R F , with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH 2 ) W where w is at least 1;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • D is absent, O or N — R z , where R z is H or an optionally substituted C 1 -C 3 alkyl group; all with the proviso that the total length of linker -(CH 2 Y) n -X-(Y’CH 2 ) n - or linker -A- (CH 2 -CH 2 -D) n -A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 59 The method of embodiment 58, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-3 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO2R F ;
  • R F are independently H, C 1-6 alkyl, or aryl-C 0-4 alkyl;
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent, (CH 2 ) k O, S or N — R F ; where k is 1, 2, or 3;
  • Y is absent, CH 2 , O, CH 2 O or N — R F ;
  • Y’ is absent CH 2 , O, OCH 2 or N — R F , with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
  • R F is H, an C 1 -C 3 alkyl group, or (CO)-G, where
  • G is H or an C 1 -C 3 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH 2 ) W where w is at least 1;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • D is absent, O or N — R z , where R z is H or an optionally substituted C 1 -C 3 alkyl group; all with the proviso that the total length of linker -(CH 2 Y) n -X-(Y’CH 2 ) n - or linker -A- (CH 2 -CH 2 -D) n -A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 60 The method of embodiment 59, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent
  • Y is absent or CH 2 ;
  • Y’ is absent or CH 2 ;
  • n is each independently an integer between 0-3, with the proviso that both ns on - (CH 2 Y) n -X-(Y’CH 2 ) n - cannot be 0;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl
  • B is - (CH 2 Y) n - X- (Y’ CH 2 ) n - , or -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group;
  • X is absent
  • Y is absent or CH 2 ;
  • Y’ is absent or CH 2 ;
  • n is each independently an integer between 0-3, with the proviso that both ns on - (CH 2 Y) n -X-(Y’CH 2 ) n - cannot be 0;
  • A is absent or (CH 2 ) W
  • A' is (CH 2 ) W , where w is 1, 2 or 3 the CH 2 groups in A or A' are optionally substituted with a C 1 -C 3 alkyl group or C 1 -C 3 hydroxyalkyl;
  • D is absent; all with the proviso that the total length of linker -(CH 2 Y) n -X-(Y’CH 2 ) n - or linker -A- (CH 2 -CH 2 -D) n -A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 62 The method of embodiment 61, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl
  • B is -A-(CH 2 -CH 2 -D) n -A’-; wherein, one or more of the CH 2 groups in B is optionally substituted with a C 1- C 3 alkyl or C 1 -C 3 alkoxy group; n is 0-1;
  • A is absent or (CH 2 ) W , and A' is absent or (CH 2 ) W , where w is 1, 2 or 3; and D is absent; all with the proviso that the total length of linker -A-(CH 2 -CH 2 -D) n -A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 63 The method of embodiment 62, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ;
  • R D is H
  • B is -A-(CH 2 -CH 2 -D) n -A’-; n is 0-1;
  • A is absent or (CH 2 ) W ;
  • A' is absent or (CH 2 ) W , where w is 1, 2 or 3;
  • D is absent; all with the proviso that the total length of linker -A-(CH 2 -CH 2 -D) n -A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
  • Embodiment 64 The method of embodiment 63, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ;
  • R D is H
  • B is -A-(CH 2 -CH 2 -D) n -A’-; n is 0;
  • A is absent
  • A' is (CH 2 ) W , where w is 1, 2, 3 or 4; and D is absent.
  • Embodiment 65 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula II
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, - C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R F are independently H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl or aryl-C 0-4 alkyl;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where
  • G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 66 The method of embodiment 65, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R ) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted C 1
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R E ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-6 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R F are independently H, C 1-6 alkyl, or aryl-C 0-4 alkyl;
  • R F is H, an optionally substituted C 1 -C 6 alkyl group, or (CO)-G, where
  • G is H or an optionally substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 67 The method of embodiment 66, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • Z and Z’ are each independently C(R F ) 2 , NR D , O, or S(O) 0-2 ;
  • R D are independently H, C 1-3 alkyl, aryl-C 0-4 alkyl, -C(O)CF 3 , -C(O)R F , or -SO 2 R F ;
  • R F are independently H, C 1-6 alkyl, or aryl-C 0-4 alkyl;
  • R F is H, an C 1 -C 3 alkyl group, or (CO)-G, where
  • G is H or an C 1 -C 3 alkyl, C 2 -C 6 alkenyl or C 2 -C 6 alkynyl group; n is 0, 1, 2, or 3; and R are each independently H, or C 1-6 alkyl.
  • Embodiment 68 The method of embodiment 67, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 69 The method of embodiment 68, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 70 The method of embodiment 67, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • Z and Z’ are NR D ;
  • R D are independently H, or C 1-3 alkyl; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 71 The method of embodiment 67, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH;
  • Z and Z’ are NR D ;
  • R D is H; n is 0, 1, 2, or 3; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 72 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula III (Formula III); wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3.7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -
  • R’ is H, C 1-6 alkyl, C 3.7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3.7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 73 The method of embodiment 72, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SCUR 0 , where R s is H or an optionally substituted C 1
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 74 The method of embodiment 73, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 75 The method of embodiment 74, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 76 The method of embodiment 75, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 77 The method of embodiment 76, wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 78 The method of embodiment 77, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula IV (Formula IV); wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 80 The method of embodiment 79, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R ) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted C 1
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 81 The method of embodiment 80, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 82 The method of embodiment 81, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 83 The method of embodiment 82, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH; R’ is H, C 1-3 alkyl; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 84 The method of embodiment 83, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 85 The method of embodiment 84, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 86 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula V
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 - C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R” is C 1-6 alkyl, C 3.7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl; and R are each independently H, or C 1-6 alkyl.
  • Embodiment 87 The method of embodiment 86, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1- C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R ) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted C 1
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 88 The method of embodiment 87, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 89 The method of embodiment 88, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 90 The method of embodiment 89, wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 91 The method of embodiment 90, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 92 The method of embodiment 91, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 93 The method of embodiment 86, wherein the one or more bisacridine compounds of Formula V is .
  • Embodiment 94 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula VI
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3-7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1- C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1
  • R’ is H, C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3-7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 95 The method of embodiment 94, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1 - C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R’) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 96 The method of embodiment 95, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1- C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 97 The method of embodiment 96, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 98 The method of embodiment 97, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 99 The method of embodiment 98, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 100 The method of embodiment 99, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 101 The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula VII
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C 1 -C 6 alkyl, optionally substituted O-C 1 -C 6 alkyl, optionally substituted C 1 -C 7 acyl, C 3.7 cycloalkyl-C 0-4 alkyl, aryl-C 0-4 alkyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 - C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1
  • R’ is H, C 1-6 alkyl, C 3.7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 3.7 cycloalkyl-C 0-4 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 102 The method of embodiment 101, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 6 alkyl, O-C 1 -C 6 alkyl, C 1 - C 7 acyl, C 1 -C 6 alkyl-NR’ 2 , C 1 -C 6 alkyl-OR’, C 1 -C 6 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’ COR’, NR’CONR’R’, NR’CO 2 R”, NR’ SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’, SO 2 N(R ) 2 , SO 3 R s or SO 4 R C , where R s is H or an optionally substituted
  • R’ is H, C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-6 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl; and R are each independently H, or C 1-6 alkyl.
  • Embodiment 103 The method of embodiment 102, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, C 1 - C 3 alkyl-NR’ 2 , C 1 -C 3 alkyl-OR’, C 1 -C 3 alkyl-ONR’ 2 , CF 3 , N(R’) 2 , NR’COR’, NR’CONR’R’, NR’CO 2 R”, NR’SO 2 R”, CN, NO 2 , OH, COOH, C 1 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R is C 1-3 alkyl, C 1 -C 7 acyl, or aryl-C 0-4 alkyl;
  • R are each independently H, or C 1-6 alkyl.
  • Embodiment 104 The method of embodiment 103, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, COOH, C 2 -C 6 OOR’;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 105 The method of embodiment 104, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 106 The method of embodiment 105, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH;
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 107 The method of embodiment 106, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and R are each independently H, or C 1-3 alkyl.
  • Embodiment 108 A compound of Formula III through Formula VII or a pharmaceutically acceptable salt thereof: ;
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 ', R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , N(R’) 2 , CN, NO 2 , OH, or COOH;
  • R’ is H, C 1-3 alkyl
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 109 The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, halogen (F, Cl, Br or I), C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, CF 3 , NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 110 The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein
  • R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , R 8 , R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 and R 8 are each independently H, Cl, C 1 -C 3 alkyl, O-C 1 -C 3 alkyl, NO 2 , OH, or COOH; and
  • R are each independently H, or C 1-3 alkyl.
  • Embodiment 111 The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein the one or more bisacridine compounds is ) Embodiment 112.
  • Embodiment 113 The pharmaceutical composition of embodiment 112, wherein the bisacridine compound is NSC690634.
  • Embodiment 114 The pharmaceutical composition of either embodiment 112 or embodiment 113, wherein the pharmaceutical composition is suitable for administration via injection.
  • Embodiment 115 The pharmaceutical composition of either embodiment 112 or embodiment 113, wherein the pharmaceutical composition is suitable for oral administration, or intranasal administration.
  • Embodiment 116 The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a day.
  • Embodiment 117 The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a week.
  • Embodiment 118 The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a month.
  • Embodiment 119 The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a year.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Methods and bisacridine compositions for inhibiting topoisomerase III beta (TOP3B) and conferring antiviral and/or anti-cancer activity are disclosed.

Description

TOPOISOMERASE III (TOP3) INHIBITORS AND ANTIVIRAL COMPOUNDS BASED ON BISACRIDINES
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of priority of U.S. Provisional Patent Application no. 63/429,923, filed December 2, 2022, which is hereby incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with Government support under contract no. GM139817 awarded by the National Institutes of Health; contract no. BC006161 awarded by National Cancer Institute (part of the National Institutes of Health); and contract no. ZIA AG000686-02 awarded by the National Institute on Aging (part of the National Institutes of Health). The government has certain rights in the invention.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0003] The contents of the electronic sequence listing (22-1285- WO_ST26_Sequence_Listing.xml; Size: 4,482 bytes; and Date of Creation: December 1, 2023) is herein incorporated by reference in its entirety.
FIELD OF THE INVENTION
[0004] This disclosure relates to methods and bisacridine compositions for inhibiting topoisomerase III beta (TOP3B), for conferring anticancer activity and/or for conferring antiviral activity.
BACKGROUND
[0005] TOP3B is one of 6 human topoisomerases, but it is the only one known to act on RNA. TOP3B has been implicated as a host factor for the replication of positive strand viruses including coronaviruses SARS-CoVl and SARS-CoV2. TOP3B can produce RNA-cleavage complexes (RNAccs), which can be trapped by its inhibitors, causing persistent RNA damage that blocks viral maturation or RNA replication, a mechanism that resembles one employed by inhibitors of topoisomerases I and II, which trap DNA cleavage complexes, damage DNA and block DNA replication. TOP3B is a rational anti-cancer target and a target for drug development against RNA viruses for which there is an unmet need. SUMMARY OF THE DISCLOSURE
[0006] The present disclosure relates to methods and compositions for inhibiting topoisomerase III beta (TOP3B) and for conferring anticancer and/or antiviral activity.
[0007] One aspect of the disclosure provides a method of reducing or inhibiting replication of an RNA virus in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0008] An aspect of the disclosure provides a method of treating an RNA viral infection in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier. [0009] An aspect of the disclosure provides a method of damaging viral RNA in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0010] An aspect of the disclosure provides a method of stimulating anti-RNA viral activity in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0011] In various embodiments, the RNA virus and/or viral RNA is a positive strand RNA virus and/or viral RNA. In various embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota, as well as of specific classes, orders, genera and species under each phylum.
[0012] In various embodiments, the RNA virus is (and/or viral RNA comes from) Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus, which, In various embodiments, is a Middle East respiratory syndrome-related (MERS -related) coronavirus or a Severe acute respiratory syndrome-related (SARS -related) coronavirus. In various embodiments, the Severe acute respiratory syndrome-related (SARS-related) coronavirus is SARS-CoV or SARS-CoV-2.
[0013] Another aspect of the disclosure provides a method of treating cancer in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0014] An aspect of the disclosure provides a method of inducing cell death of a TOP3B- expressing cell in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0015] An aspect of the disclosure provides a method of reducing the number of TOP3B- expressing cells in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0016] An aspect of the disclosure provides a method of inhibiting TOP3B activity in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier [0017] An aspect of the disclosure provides a method of poisoning TOP3B in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0018] An aspect of the disclosure provides a method of trapping TOP3B in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier. [0019] An aspect of the disclosure provides a method of promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject, including administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
[0020] In various embodiments of the various aspects, the one or more bisacridine compounds are represented by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII:
Figure imgf000006_0001
Figure imgf000007_0001
wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and, for Formula I, Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; B is -(CH2Y)n-X-(Y’CH2)n- , or -A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; and where X is absent, (CH2)kO, S or N — RF; where k is 1, 2, or 3; Y is absent, CH2, O, CH2O orN — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond; where RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; each n is independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl; D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety; and, for Formula II, Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; n is 0, 1, 2, or 3; and R are each independently H, or C1-6 alkyl; and, for Formula III to Formula VII, each R is independently H, or C1-6 alkyl.
[0021] An aspect of the disclosure provides pharmaceutical compositions including one or more bisacridine compounds and a pharmaceutically acceptable carrier. In various embodiments, the pharmaceutical composition includes NSC690634, which, in various embodiments, is suitable for administration by injection or oral administration.
[0022] These and other aspects of the disclosure are set forth in more detail in the description of the disclosure below. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1A shows a comparative cellular toxicity screen designed to identify specific class of inhibitors for TOP3B in which a pair of isogenic HCT116 and HCT116 TOP3B-KO (knock out) cells were labeled with different fluorescent proteins (GFP and mCherry, respectively). The two cell lines were mixed in equal ratios and grown together prior to treatment with compounds disclosed herein. On each cell culture plate, one column of dimethyl sulfoxide (DMSO)-treated samples served as control. At the end of drug treatment, the entire cell culture plate was imaged in multiple fluorescent channels in order to determine the relative viability rates of HCT116 and HCT116 TOP3B-KO cells, normalized to the DMSO-treated control wells on the same plate. The four potential outcomes are represented from left to right in the middle of the figure: (1) If TOP3B-KO cells showed selective resistance, the compound potentially targeted TOP3B; (2) if a compound was selectively toxic to TOP3B-KO cells, the compound potentially interfered with parallel pathways of TOP3B, so that in KO cells, inhibiting the parallel pathway lead to adverse effects; (3) if a compound showed no effect (same results as DMSO-treated samples), it did not interfere with any pathways related to TOP3B and was discarded; and (4) if a compound showed high toxicity to both HCT116 and TOP3B-KO cells, it was retested at lower concentrations FIG. 1B shows representative fluorescent microscopy images of a DMSO control and drug-treated samples. After deconvoluting into individual fluorescent channels, the drug-treated sample were compared to the DMSO control sample in each fluorescent channel, here the GFP channel conveying the effect of the drug on the HCT116 cells and the mCherry channel conveying the effect of the drug on TOP3B-KO cells. Each sample is normalized to the DMSO-treated control samples on the same plate.
[0024] FIG. 2A and FIG. 2B show data analysis of the comparative cellular cytotoxicity screen. FIG. 2A shows the equation used to compute the “Resistance Factor” for TOP3B-KO cells. Cell count and/or confluency from a set of samples were used to obtain a specific Resistance Factor for a given compound. FIG. 2B shows a graph plotting the RFcell count against the RFconfluency for the entire library of compounds tested. The top right corner represents the compounds to which TOP3B-KO cells showed the highest resistance, and the 8% top hits (inside circle) were selected for further testing. FIG. 2C shows a flowchart of the process used to identify compounds with the ability to poison TOP3B.
[0025] FIG. 3A and FIG. 3B show a modified RADAR assay to demonstrate drug- induced cellular TOP3Bccs. FIG. 3A shows a schematic of the procedure used in the RADAR assay. FIG. 3B shows the chemical structures of five compounds selected from the screen using RADAR assays. FIG. 3C shows a graph of results from experiments in which HEK293 cells were transiently transfected with flag-tagged TOP3B and treated with indicated compounds at 100 μM for 1 hour prior to analysis by RADAR. The compounds showed a spectrum of potency in inducing TOP3Bcc.
[0026] FIG. 4A and FIG. 4B show band shift assays demonstrating the induction of DNA- and RNA-TOP3Bccs by bisacridine compounds with recombinant TOP3B. FIG. 4A shows a schematic of the in vitro band shift assay. A DNA or RNA oligo substrate labeled on the 3’- end with a fluorophore is incubated with recombinant TOP3B. A small population of the TOP3B forms the TOP3B cleavage complex (TOP3Bcc) with the DNA or RNA, resulting in a significantly different molecular weight for TOP3Bccs with the attached fluorophore compared to that of free DNA and RNA substrate. FIG. 4B shows that the DNA-TOP3Bcc (upper panels) and RNA-TOP3Bcc (lower panels) were resolved from the free DNA and RNA on a SDS- PAGE and directly visualized via the fluorophores attached to the oligo constructs. The formation of DNA-TOP3B and RNA-TOP3B cleavage complexes (approximately 100-180 kDa) is TOP3B-dependent, and the TOP3Bccs were titrated with each of the lead compounds to reach equilibrium. The effect of each compound is compared to the DMSO-treated control samples.
[0027] FIG. 5A to FIG. 5H Show that NSC690634 induces endogenous TOP3Bccs in different cell lines. FIG. 5A shows RADAR assay results indicating that treatment with NSC690634 (100 μM) leads to increase in the levels of endogenous TOP3Bcc in a time- dependent manner in three different human cell lines. FIG. 5B shows a graph of the data shown in FIG. 5A. FIG. 5C shows RADAR results indicating that treatment with NSC690634 for 4 hours leads to increase in the levels of endogenous TOP3Bcc in a dose-dependent manner in three different human cell lines. FIG. 5D shows a graph of the data shown in FIG. 5C. FIG. 5E shows results for HEK293 cells that were transiently over-expressing flag-tagged TOP3B and treated with NSC690634 (100 μM for 1 hour) prior to analysis by RADAR. 1 mg of purified nucleic acid was either mock-treated or treated with RNase A/T1 or with DNase to digest RNA or DNA, respectively, purified through ethanol precipitation, loaded on a slot blot, and probed by immunodetection. FIG. 5F shows a graph of the quantification of band intensities that were normalized to the mock-treated samples. FIG. 5G shows genomic DNA of HCT116 and HCT116-TOP3B-KO cells, with or without treatment with NSC690634, that was collected and blotted on nitrocellulose membrane before immunoprobing by an antibody specific for R-loop S9.6; RNase H-treated samples serve as negative controls. FIG. H shows HEK293 cells transiently over-expressing TOP3B that were treated with NSC690634 (100 μM for 1 h) prior to analysis by in vivo complex of enzyme (ICE) bioassays. Ultracentrifugation of cell lysates on a CsCl gradient enabled separation of DNA and RNA species. The separated fractions were quantified and 1.5 μg of DNA or RNA were blotted on a slot blot for independent detection of DNA- and RNA-T0P3Bccs through immunodetection probed with anti-Flag antibodies. The upper row contained 1.5 μg of nontreated control DNA or RNA samples. Representative blot of 3 independent experiments is shown.
[0028] FIG. 6A to FIG. 6C show a structure-activity analysis of bisacridine analogs of NSC690634 demonstrates that linker length is critical for inducing TOP3Bccs. FIG. 6A shows chemical structures of a series of bisacridine analogs, as well as the acridine compounds m- AMSA (N-[4-(acridin-9-ylamino)-3-methoxyphenyl]methanesulfon-amide), and ο-AMSA, (N-[4-(acridin-9-ylamino)-2-methoxyphenyl]methanesulfonamide). The lengths of the carbon linker between the two acridine ring moieties increase from left to right (NSC690634 to NSC260610 to NSC219734). FIG. 6B shows results for HEK293 cells transiently over- expressing TOP3B (TOP3B OE) that were treated with DMSO (control) or with the indicated bisacridines (100 μM for 1 hour) prior to analysis by modified RADAR and probed with anti- Flag antibody. The same samples probed with anti-dsDNA antibody served as loading controls. Only NSC690634 showed a strong induction of TOP3Bccs while all the other structurally related compounds with different linker lengths failed to induce cellular TOP3Bccs. FIG. 6C shows in vitro biochemical assays that demonstrate that linker length appears to be important for inducing TOP3Bccs by the bisacridines, such as NSC690634. Compounds without linkers (e.g., m-AMSA, ο-AMSA) do not trap TOP3B; whereas, NSC690634 (with a 3-carbon linker) induces TOP3Bccs with RNA. Bisacridine compounds with longer carbon linkers not only fail to induce TOP3Bcc, but they also appear to destabilize the formation of TOP3Bccs with both DNA and RNA.
[0029] FIG. 7A shows the structure of NSC690634. FIG. 7B and FIG. 7C show results of cell survival assays treated with NSC690634 that confirmed greater resistance of TOP3B- KO cells to NSC690634 as compared to HCT116 parental cells, regardless which fluorescent proteins were used in the labeling (GFP for WT HCT116 cells and mCherry for HCT116- TOP3B-KO cells for FIG. 7B or the labels reversed for FIG. 7C). FIG. 7D shows composite fluorescent microscopy images of DMSO control. FIG. 7E and FIG. 7F show composite fluorescent microscopy images of NSC690634-treated (32 nM) samples of FIG. 7B and FIG. 7C, respectively.
[0030] FIG. 8A shows the time dependence of NSC690634 to induce TOP3Bcc formation in RADAR assay using HEK293 cells transiently over-expressing TOP3B-flag to enhance TOP3Bcc signals. The sensitivity of anti-flag antibody and the abundance of TOP3B in this system allowed detection of elevated levels of TOP3Bccs after treatments as short as 10 minutes. The level of TOP3Bcc induced by NSC690634 increased in a time-dependent manner and leveled off after about 1 hour. FIG. 8B shows the dose dependence of NSC690634 to induce TOP3Bcc formation in RADAR assay. Similarly, NSC690634 induced TOP3Bcc in a dose-dependent manner, with TOP3Bccs readily detectable at 5 μM of compound for 1 hour. [0031] FIG. 9A shows the results of immunoblotting of HEK293 cells treated with NSC690634 to measure the levels of free TOP3B. Induction of TOP3Bccs by NSC690634 coincided with the reduction of free TOP3B. FIG. 9B shows that the TOP3Bccs induced by NSC690634 were not readily reversible upon removal. FIG. 9C shows RADAR assays of HCT116 cells that indicate NSC690634 selectively induces TOP3Bccs and not cleavage complexes of any other topoisomerases under the same conditions.
DETAILED DESCRIPTION
[0032] The present disclosure is explained in greater detail below. This description is not intended to be a detailed catalog of all the different ways in which the disclosure may be implemented, or all the features that may be added to the instant disclosure. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant disclosure. Hence, the following specification is intended to illustrate some particular embodiments of the disclosure, and not to exhaustively specify all permutations, combinations, and variations thereof.
[0033] Unless the context indicates otherwise, it is specifically intended that the various features of the disclosure described herein can be used in any combination. Moreover, the present disclosure also contemplates that in some embodiments of the disclosure, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The terminology used in the description of the disclosure herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the disclosure.
[0035] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entireties for all purposes.
Definitions
[0036] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “comprises” and/or “comprising,” and/or “including” when used in this specification, specify the presence of stated features, elements, and/or components, but do not preclude the presence or addition of one or more other features, elements, components, and/or groups thereof. As used herein, the term “and/or” includes any and all combinations of one or more of the associated listed items. As used herein, phrases such as “between X and Y” and “between about X and Y” should be interpreted to include X and Y. As used herein, phrases such as “between about X and Y” mean “between about X and about Y.” As used herein, phrases such as “from about X to Y” mean “from about X to about Y.”
[0037] Moreover, the present disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted.
[0038] Furthermore, the term “about,” as used herein when referring to a measurable value such as an amount of a compound or agent of this disclosure, dose, time, temperature, and the like, is meant to encompass variations of ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.
[0039] In the claims, as well as in the specification above, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," or the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of and "consisting essentially of' shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. “Consisting essentially of’ is to be interpreted as encompassing the recited materials or steps and those that do not materially affect the basic and novel characteristic(s) of the disclosure. The open-end phrases such as "comprising" include and encompass the close-ended phrases. Comprising may be amended to the more limiting phrases "consisting essentially of of "consisting of as needed.
[0040] The definition of each expression, e.g., alkyl, m, n, or the like, when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.
[0041] It will be understood that "substitution" or "substituted with" includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction.
[0042] The term "substituted" is also contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described herein below. The permissible substituents may be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. [0043] Compounds of the present disclosure are collectively referred to as “bisacridines” or “bisacridine drugs”, which are a family of compounds linking two optionally substituted acridine moieties through their 9-position on the tricyclic ring structure (with heterocyclic nitrogen at the 10-position). Linkers are described in detail elsewhere herein. In some embodiments, the acridine nitrogen is a carbon, thus making a corresponding family of compounds linking two optionally substituted anthracene moieties, also referred to as “bisanthracenes”. Linkers and optional tricyclic ring substituents for bisanthracene compounds comprise the same structure and scope as described for the bisacridines.
[0044] Topoisomerases are universal and present in eukaryotes, archaebacteria and eubacteria. Human cells encode six topoisomerases, only one of which operates on RNA, TOP3B. Biological nucleic acid structure (e.g., DNA double helix and the flexibility of single stranded RNA leading to secondary structure) promotes entanglement in the compacted nucleus of eukaryotic cells or the nucleoid of bacteria (for DNA and RNA) and the cytoplasm (for RNA). The opening of duplex DNA and separation of its two strands during transcription and replication generate supercoiling (torsional tension) on both sides of the open DNA segment. Excessive positive supercoiling tightens the DNA and prevents further strand separation thereby stalling the polymerases. Negative supercoiling behind the polymerases, on the other hand, tends to extend DNA strand separation and facilitates the formation of abnormal nucleic acid structures such as R-loops, which can stall RNA polymerase when the transcripts remain bound to the unwound DNA template. Negative supercoiling also promotes the formation of non-canonical DNA structures such as z-DNA, intramolecular hairpins and guanosine quartets (G4’s). Topoisomerases prevent the formation of such potentially deleterious structures by removing free supercoiling. Similarly for RNA, topoisomerase 3B likely plays a key role in ensuring proper RNA topology for RNA synthesis or maturation.
[0045] “Trapping” TOP3B, as used herein, refers to the reversible inactivation of TOP3B while complexed with (i.e., bound to) RNA or DNA, e.g., by interfacial inhibition, or stacking of a bisacridine drug molecule against RNA base(s) flanking the TOP3B catalytic site, i.e., a form of catalytic inhibition.
[0046] A “TOP3B poison” or “interfacial inhibitor”, as used herein, is a compound or agent that is capable of binding to a TOPcc at the protein-RNA or protein-DNA interface and trap the TOPcc. “Poisoning” TOP3B refers to reversibly inactivating TOP3B while complexed with RNA or DNA. Herein, “poisoning” and “trapping” are used interchangeably, generically referring to an inhibitor causing the enzyme to become “stuck” on DNA/RNA.
[0047] “TOP3B cleavage complexes” (also “TOP3Bcc” singular and “TOP3Bccs” plural), refer to the complex formed between a topoisomerase and genomic DNA or RNA when working to relieve torsional tension or knots introduced by metabolic processes (e.g., transcription, reverse transcription) by disconnecting the helical backbone of the nucleic acid to relieve the torsional strain within before the backbones are reconnected. During the transient intermediate state of the topoisomerase activity, in this case topoisomerase III beta, the enzyme is covalently attached to one end of the disconnected nucleic acid backbone, forming the topoisomerase cleavage complexes (TOPcc).
[0048] Various compounds of the present disclosure can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms are equivalent to unsolvated forms and are encompassed within the scope of the present disclosure. Various compounds of the present disclosure may exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated by the present disclosure and are intended to be within the scope of the present disclosure. [0049] Various compounds of the present disclosure possess asymmetric carbon atoms (optical centers) or double bonds; the racemates, diastereomers, geometric isomers and individual isomers are encompassed within the scope of the present disclosure.
[0050] The compounds described herein may be prepared as a single isomer (e.g., enantiomer, cis-trans, positional, diastereomer) or as a mixture of isomers. In a preferred embodiment, the compounds are prepared as substantially a single isomer. Methods of preparing substantially isomerically pure compounds are known in the art. For example, enantiomerically enriched mixtures and pure enantiomeric compounds can be prepared by using synthetic intermediates that are enantiomerically pure in combination with reactions that either leave the stereochemistry at a chiral center unchanged or result in its complete inversion. Alternatively, the final product or intermediates along the synthetic route can be resolved into a single stereoisomer. Techniques for inverting or leaving unchanged a particular stereocenter, and those for resolving mixtures of stereoisomers are well known in the art and it is well within the ability of one of skill in the art to choose and appropriate method for a particular situation. See, generally, Furniss et al. (eds.), Vogel's Encyclopedia Of Practical Organic Chemistry 5th Ed., Longman Scientific and Technical Ltd., Essex, 1991, pp. 809-816; and Heller, Acc. Chem. Res. 23: 128 (1990).
[0051] The compounds disclosed herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I) or carbon-14 (14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are intended to be encompassed within the scope of the present disclosure.
[0052] Where a disclosed compound includes a conjugated ring system, resonance stabilization may permit a formal electronic charge to be distributed over the entire molecule. While a particular charge may be depicted as localized on a particular ring system, or a particular heteroatom, it is commonly understood that a comparable resonance structure can be drawn in which the charge may be formally localized on an alternative portion of the compound.
[0053] Selected compounds having a formal electronic charge may be shown without an appropriate biologically compatible counterion. Such a counterion serves to balance the positive or negative charge present on the compound. As used herein, a substance that is biologically compatible is not toxic as used, and it does not have a substantially deleterious effect on biomolecules. Examples of negatively charged counterions include, among others, chloride, bromide, iodide, sulfate, alkanesulfonate, aryl sulfonate, phosphate, perchlorate, tetrafluoroborate, tetraarylboride, nitrate and anions of aromatic or aliphatic carboxylic acids. Preferred counterions may include chloride, iodide, perchlorate and various sulfonates. Examples of positively charged counterions include, among others, alkali metal, or alkaline earth metal ions, ammonium, or alkylammonium ions.
[0054] “Pharmaceutical compositions” means compositions comprising at least one active agent, such as a compound or salt of Formulae I, II, III, IV, V, VI or VII, and at least one other substance, such as a carrier. Pharmaceutical compositions meet the U.S. FDA’s GMP (good manufacturing practice) standards for human or non-human drugs.
[0055] Carrier” means a diluent, excipient, or vehicle with which an active compound is administered. A “pharmaceutically acceptable carrier” means a substance, e.g., excipient, diluent, or vehicle, that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic and neither biologically nor otherwise undesirable, and includes a carrier that is acceptable for veterinary use as well as human pharmaceutical use. A “pharmaceutically acceptable carrier” includes both one and more than one such carrier.
[0056] “Patient”, “subject”, and “individual” mean a human or non-human animal in need of medical treatment. Medical treatment can include treatment of an existing condition, such as a disease or disorder or diagnostic treatment. In some embodiments the patient is a human patient.
[0057] “Providing” means giving, administering, selling, distributing, transferring (for profit or not), manufacturing, compounding, or dispensing.
[0058] Treat”, “Treatment”, or “treating” mean providing therapeutic agent(s) to a patient who has a disease, a symptom of disease or a predisposition to or risk for developing a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, affect, or prevent the disease and/or the symptoms of disease. In some embodiments, therapeutic agent(s) are provided in an amount sufficient to measurably reduce any symptoms of infection with a positive strand RNA virus, slow progression or cause regression of an infection by a positive strand RNA virus or prevent infection. In various embodiments, treatment of infection with a positive strand RNA virus may be commenced for a subject who does not exhibit signs of such infection. In some embodiments, treatment may be administered to a subject who exhibits only early signs of infection with a positive strand RNA virus for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In other embodiments, therapeutic agent(s) are provided in an amount sufficient to provide a therapeutic benefit, such as an amelioration of symptoms of cancer, prevention or slowing of progression of a cancer, promoting regression of a cancer, or promoting eradication of a cancer.
[0059] Regarding RNA viral infections, a “therapeutically effective amount”, an “effective amount” and an “effective dose” of a pharmaceutical composition refer to an amount effective, at dosages and for periods of time necessary, that when administered to a patient provides a desired therapeutic or prophylactic benefit, such as measurably reducing any biological hallmark or symptom of infection by a positive strand RNA virus, slowing progression of infection by a positive strand RNA virus, causing regression of infection by a positive strand RNA virus, or preventing or delaying onset of symptoms or pathologies resulting from infection by a positive strand RNA virus.
[0060] Regarding cancer, a "therapeutically effective amount", an “effective amount” and an “effective dose” of a pharmaceutical composition refer to an amount effective, when administered to a patient, to provide a therapeutic benefit such as an amelioration of symptoms, e.g., an amount effective to decrease the symptoms of cancer. For example, a patient having cancer may present detectable levels of various tumor markers, including CA 125, CEA, CA19- 9, AFP, PSA, and galactosyltransferase. A therapeutically effect amount is thus an amount sufficient to provide a significant reduction in elevated tumor marker levels or an amount sufficient to provide a return of tumor marker levels to the normal range. A therapeutically effective amount is also an amount sufficient to prevent a significant progression of cancer or cancerous tumor (e.g., increase in tumor size or tumor number) relative that usually seen in untreated patients having the same cancer, or amount sufficient to cause significant regression of cancer or cancerous tumor (e.g., reduce tumor size or tumor number), or cause tumors to disappear from the patient's body altogether or otherwise become undetectable.
[0061] A significant change is any detectable change that is statistically significant in a standard parametric test of statistical significance such as Student’s T-test, where p < 0.05.
[0062] Reference herein to any numerical range (for example, a dosage range) expressly includes each numerical value (including fractional numbers and whole numbers) encompassed by that range. For example, but without limitation, reference herein to a range of 0.5 mg to 100 mg explicitly includes all whole numbers of and fractional numbers between the upper and lower limit of the range, inclusive of the upper and lower limit.
[0063] An individual referred to as “suffering from” infection by a positive strand RNA virus, as described herein, has been diagnosed with and/or displays one or more symptoms of infection by a positive strand RNA virus. An individual “suffering from” a cancer, as described herein, has been diagnosed with and/or displays one or more symptoms of having a cancer. [0064] As used herein, the term “at risk” for infection by a positive strand RNA virus, refers to a subject (e.g., a human) that is predisposed to being infected with a positive strand RNA virus (e.g., whose cells are both receptive to virus docking or attachment and permissive to receiving the viral RNA payload) and/or developing symptoms or pathologies related to infection by a positive strand RNA virus. This predisposition may be genetic or due to other factors. It is not intended that the present disclosure be limited to any particular signs or symptoms. Thus, it is intended that the present disclosure encompasses subjects that are experiencing any range or severity of infection by a positive strand RNA virus, from sub- clinical infection to extreme viral titers, wherein the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with infection by a positive strand RNA virus. Similarly, “at risk” for a cancer refers to a subject (e.g., a human) that is predisposed to developing a cancer. This predisposition may be genetic or due to other factors. It is not intended that the present disclosure be limited to any particular signs or symptoms. Thus, it is intended that the present disclosure encompasses subjects that are experiencing any range or severity of a cancer, from sub-clinical cellular transformation to advanced disease, in which the subject exhibits at least one of the indicia (e.g., signs and symptoms) associated with having a cancer.
[0065] COMPOUNDS AND PHARMACEUTICAL COMPOSITIONS
[0066] In various aspects, bisacridine compounds, pharmaceutically acceptable salts thereof and pharmaceutical compositions thereof (including, e.g., one or more bisacridine compounds, or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier), can be utilized in the methods of the disclosure and are described by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI, or Formula VII:
Figure imgf000019_0001
; ;
Figure imgf000020_0001
;
Figure imgf000021_0001
( ormu a );
[0067] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl.
[0068] In some embodiments comprising compounds, pharmaceutically acceptable salts and pharmaceutical compositions thereof according to Formula I, Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RE are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; B is -(CH2Y)n-X-(Y’CH2)n- , or - A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; where X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3; Y is absent, CH2, O, CH2O or N — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond; RF is H, an optionally substituted C1- C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; each n is independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1- C3 hydroxyalkyl; D is absent, O or N — Rz, where Rz is H or an optionally substituted C1- C3 alkyl group; with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0069] In some embodiments comprising compounds, pharmaceutically acceptable salts and pharmaceutical compositions thereof according to Formula II, Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3; and R are each independently H, or C1-6 alkyl.
[0070] In some embodiments comprising compounds, pharmaceutically acceptable salts and pharmaceutical compositions thereof according to Formula III to Formula VII, R are each independently H, or C1-6 alkyl.
[0071] In various aspects, the one or more bisacridine compounds is represented by Formula I:
Figure imgf000022_0001
(Formula I);
[0072] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1- 6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RE are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; B is -(CH2Y)n-X- (Y’CH2)n- , or -A-(CH2-CH2-D)n-A’-, where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3; Y is absent, CH2, O, CH2O or N — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond; RF is H, an optionally substituted C1- C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1- C3 hydroxyalkyl; D is absent, O or N — Rz, where Rz is H or an optionally substituted C1- C3 alkyl group; with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0073] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C( RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or - SO2RF; and RE are independently H, C1-6 alkyl, or aryl-C0-4 alkyl; B is -(CH2Y)n-X- (Y’CH2)n- , or-A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3; Y is absent, CH2, O, CH2O or N — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond; where RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1- C3 hydroxyalkyl; and D is absent, O or N — Rz, where Rz is H or an optionally substituted C1- C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0074] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-3 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RE are independently H, C1-6 alkyl, or aryl-C0-4 alkyl; B is -(CH2Y)n-X-(Y’CH2)n- , or -A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; X is absent, (CH2)kO, S or N — RF; where k is 1, 2, or 3; Y is absent, CH2, O, CH2O or N — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond; where RF is H, an C1-C3 alkyl group, or (CO)-G, where G is H or an C1-C3 alkyl, C2-C6 alkenyl or C2- C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl; and D is absent, O or N — Rz, where Rz is H or an optionally substituted C1- C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0075] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; Z and Z’ are NRD; where RD are independently H, or C1-3 alkyl; B is -(CH2Y)n-X-(Y’CH2)n- , or -A-(CH2-CH2- D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; X is absent; Y is absent or CH2; and Y’ is absent or CH2; n is each independently an integer between 0-3, with the proviso that both ns on -(CH2Y)n-X- (Y’CH2)n- cannot be 0; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1- C3 hydroxyalkyl; and D is absent; all with the proviso that the total length of linker -(CH2Y)n- X-(Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0076] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; Z and Z’ are NRD; whre RD are independently H, or C1-3 alkyl; B is -(CH2Y)n-X-(Y’CH2)n- , or -A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1- C3 alkoxy group; X is absent; Y is absent or CH2; and Y’ is absent or CH2; each n is independently an integer between 0-3, with the proviso that both ns on -(CH2Y)n-X- (Y’CH2)n- cannot be 0; A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1- C3 hydroxyalkyl; D is absent; all with the proviso that the total length of linker -(CH2Y)n-X- (Y’CH2)n- or linker -A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0077] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; Z and Z’ are NRD; where RD are independently H, or C1-3 alkyl; B is - A-(CH2-CH2-D)n-A’-; where one or more of the CH2 groups in B is optionally substituted with a C1-C3 alkyl or C1-C3 alkoxy group; n is 0-1; A is absent or (CH2)W, and A' is absent or (CH2)W, where w is 1, 2 or 3; and D is absent; all with the proviso that the total length of linker -A-(CH2-CH2-D)n-A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0078] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; Z and Z’ are NRD; where RD is H; B is -A-(CH2-CH2-D)n-A’-; n is 0-1; A is absent or (CH2)W ; and A' is absent or (CH2)W, where w is 1, 2 or 3; and D is absent; all with the proviso that the total length of linker -A-(CH2-CH2-D)n-A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
[0079] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; Z and Z’ are NRD; where RDis H; B is -A-(CH2-CH2-D)n-A’-; n is 0; A is absent; and A' is (CH2)W, where w is 1, 2, 3 or 4; and D is absent.
[0080] In various aspects the one or more bisacridine compounds is represented by Formula II:
R3'
(Formula II);
Figure imgf000026_0001
[0081] wherein R , R , R , R , R , R , R , R , R , R , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or S04RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl; RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; and n is 0, 1, 2, or 3; and each R is independently H, or C 1-6 alkyl.
[0082] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C(RF)2, NRD, O, or S(O)0-2; where RD are independently H, C1-6 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or - SO2RF; RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl; RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; and n is 0, 1, 2, or 3; and each R is independently H, or C1-6 alkyl.
[0083] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1.3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; Z and Z’ are each independently C(RF)2, NRD, O, or S(O)0-2; where RD are independently H, C1-3 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF; and RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl; RF is H, an C1-C3 alkyl group, or (CO)-G, where G is H or an C1-C3 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; and n is 0, 1, 2, or 3; and each R is independently H, or C1-6 alkyl.
[0084] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, N02, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; Z and Z’ are NRD; where RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C1-3 alkyl.
[0085] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; Z and Z’ are NRD; where RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C1-3 alkyl.
[0086] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; Z and Z’ are NRD; where RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and each R is independently H, or C1-3 alkyl.
[0087] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; Z and Z’ are NRD; where RDis H; n is 0, 1, 2, or 3; and each R is independently H, or C1-3 alkyl. [0088] In various aspects the one or more bisacridine compounds is represented by Formula III:
Figure imgf000028_0001
[0089] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[0090] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7 acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[0091] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’COzR”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[0092] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[0093] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[0094] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[0095] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[0096] In various aspects the one or more bisacridine compounds is represented by
Formula IV:
Figure imgf000030_0001
(Formula IV);
[0097] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[0098] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7 acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[0099] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00100] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, N02, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00101] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00102] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00103] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00104] In various aspects the one or more bisacridine compounds is represented by Formula V:
Figure imgf000031_0001
[00105] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00106] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or S04RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7 acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00107] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00108] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’; where R’ is H, C1.3 alkyl; and each R is independently H, or C1-3 alkyl.
[00109] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00110] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00111] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00112] In some embodiments, the bisacridine compound is represented by the structure:
[00113] In various a
Figure imgf000032_0001
unds is represented by
Formula VI:
Figure imgf000033_0001
(Formula VI);
[00114] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00115] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7 acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00116] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00117] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00118] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00119] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00120] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00121] In various aspects the one or more bisacridine compounds is represented by
Formula VII:
Figure imgf000034_0001
(Formula VII);
[00122] wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0- 4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00123] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2-C7(CO2)R’; where R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R” is C1-6 alkyl, C1-C7 acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00124] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1-
C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’,
NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; where R’ is H, C1-3 alkyl, C1- C7acyl, or aryl-C0-4 alkyl; and R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and each R is independently H, or C1-6 alkyl.
[00125] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3,
N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00126] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3,
N(R’)2, CN, NO2, OH, or COOH; where R’ is H, C1-3 alkyl; and each R is independently H, or C1-3 alkyl.
[00127] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00128] In some embodiments, R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4, R5 , R6 , R7' and R8' are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and each R is independently H, or C1-3 alkyl.
[00129] A dash that is not between two letters or symbols is used to indicate a point of att
Figure imgf000035_0001
ac ment or a substituent. Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents, which would result from writing the structure from right to left, e.g., — CH2O — (or CH2O, i.e., without explicit connecting dash(es)) is intended to also recite — OCH2 — (or OCH2).
[00130] “Alkyl” includes both branched and straight chain saturated aliphatic hydrocarbon groups, having the specified number of carbon atoms, generally from 1 to about 8 carbon atoms. The term Ci-C6alkyl as used herein indicates an alkyl group having from 1, 2, 3, 4, 5, or 6 carbon atoms. Other embodiments include alkyl groups having from 1 to 8 carbon atoms, 1 to 4 carbon atoms or 1 or 2 carbon atoms, e.g. C1-C8alkyl, C1-C4alkyl, and C1-C2alkyl. When C0-Cn alkyl is used herein in conjunction with another group, for example, -C0-C2alkyl(phenyl), the indicated group, in this case phenyl, is either directly bound by a single covalent bond ( C0alkyl), or attached by an alkyl chain having the specified number of carbon atoms, in this case 1, 2, 3, or 4 carbon atoms. Alkyls can also be attached via other groups such as heteroatoms as in -0-C0-C4alkyl(C3-C7cycloalkyl). Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, 3 -methylbutyl, t- butyl, n-pentyl, and sec-pentyl. The term “alkyl,” unless otherwise noted, is also meant to include those derivatives of alkyl defined in more detail below, such as “heteroalkyl.” Alkyl groups that are limited to hydrocarbon groups are termed “homoalkyl”.
[00131] “Heteroalkyl”, by itself or in combination with another term, means, unless otherwise stated, a straight or branched chain, or cyclic carbon-containing radical, or combinations thereof, consisting of the stated number of carbon atoms and at least one heteroatom selected from the group consisting of O, N, Si, P, S, and Se and wherein the nitrogen, phosphorous, sulfur, and selenium atoms are optionally oxidized, and the nitrogen heteroatom is optionally be quaternized. The heteroatom(s) O, N, P, S, Si, and Se may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to, — CH2 — CH2— O— CH3, — CH2— CH2— NH— CH3, — CH2— CH2— N(CH3)— CH3, — CH2— S— CH2CH3, — CH2— CH2, — S(O)— CH3, — CH2— CH2— S(O)2— CH3, — CH=CH— O— CH3, — Si(CH3)3, — CH2— CH=N— OCH3, and — CH=CH— N(CH3)— CH3. Up to two heteroatoms may be consecutive, such as, for example, — CH2 — NH — OCH3 and — CH2 — O— Si(CH3)3.
[00132] “Alkenyl” is a branched or straight chain aliphatic hydrocarbon group having one or more carbon-carbon double bonds that may occur at any stable point along the chain, having the specified number of carbon atoms. Examples of alkenyl include, but are not limited to, ethenyl and propenyl.
[00133] “Alkynyl” is a branched or straight chain aliphatic hydrocarbon group having one or more double carbon-carbon triple bonds that may occur at any stable point along the chain, having the specified number of carbon atoms.
[00134] “Alkoxy” is an alkyl group as defined above with the indicated number of carbon atoms covalently bound to the group it substitutes by an oxygen bridge (-O-). Examples of alkoxy include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, n-butoxy, 2- butoxy, t-butoxy, n-pentoxy, 2-pentoxy, 3- pentoxy, isopentoxy, neopentoxy, n- hexoxy, 2- hexoxy, 3-hexoxy, and 3- methylpentoxy. Similarly, an “Alkylthio” or a “thioalkyl” group is an alkyl group as defined above with the indicated number of carbon atoms covalently bound to the group it substitutes by a sulfur bridge (-S-).
[00135] “Aryl” means, unless otherwise stated, a polyunsaturated, aromatic moiety that can be a single ring or multiple rings (preferably from 1 to 3 rings), which are fused together or linked covalently. The term “heteroaryl” refers to aryl groups (or rings) that contain from one to four heteroatoms selected from N, O, S, and Se, wherein the nitrogen, sulfur, and selenium atoms are optionally oxidized, and the nitrogen atom(s) are optionally quaternized. A heteroaryl group can be attached to the remainder of the molecule through a heteroatom. Non- limiting examples of aryl and heteroaryl groups include phenyl, 1 -naphthyl, 2-naphthyl, 4- biphenyl, 1 -pyrrolyl, 2-pyrrolyl, 3 -pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5- isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2- pyrdinyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2- benzimidazolyl, 5-indolyl, 1 -isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3- quinolyl, tetrazolyl, benzo[b]furanyl, benzo[b]thienyl, 2,3-dihydrobenzo[l,4]dioxin-6-yl, benzof l, 3]dioxol-5-yl and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. [00136] “Aryl”, when used in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl), includes both aryl and heteroaryl rings as defined above. Thus, the term “arylalkyl” is meant to include those radicals in which an aryl group is attached to an alkyl group (e.g., benzyl, phenethyl, pyridylmethyl and the like) including those alkyl groups in which a carbon atom (e.g., a methylene group) has been replaced by, for example, an oxygen atom (e.g., phenoxymethyl, 2-pyridyloxymethyl, 3-(l-naphthyloxy)propyl, and the like).
[00137] “Acyl” by itself or in combination with another term, means, unless otherwise stated, a substituent comprising a carbonyl moiety and a non-carbonyl moiety (a R — C(O) — group). An acyl group may include, but is not limited to, a formyl group, an acetyl group, a propionyl group, a butylyl group, a benzoyl group, an isobutylyl group, or a valeryl group.
[00138] “Amino” or “amine group” refers to the group — NR'R" (or N+RR'R") where R, R' and R" are independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, aryl, substituted aryl, aryl alkyl, substituted aryl alkyl, heteroaryl, and substituted heteroaryl. A substituted amine being an amine group wherein R' or R" is other than hydrogen. In a primary amino group, both R' and R" are hydrogen, whereas in a secondary amino group, either, but not both, R' or R" is hydrogen. In addition, the terms “amine” and “amino” can include protonated and quaternized versions of nitrogen, comprising the group — N+RR'R" and its biologically compatible anionic counterions.
[00139] “Alkylamino” refers to “amino” as defined above attached to an alkyl moiety having the general formula — (CH2)kNR'R" (or — (CH2)kN+RR'R") wherein k is 1-6 unless stated otherwise in context.
[00140] “Aminoalkyl” refers to “amino” as defined above wherein at least one of R, R' or R" is attached to an alkyl moiety having the general formula — NRx(CH2)k, — N((CH2)k)2 (“dialkylamino”), — N ((CH2)k)3 (“trialkylammonium”), N+Rx((CH2)k)2
(“dialkylammonium”), or N+(Rx)2(CH2)k (“alkylammonium”), wherein k is 1-6 unless stated otherwise in context.
[00141] “Carboxyalkyl” as used herein refers to a group having the general formula — (CH2)kCOOH wherein k is 1-6 unless stated otherwise in context.
[00142] “Hydroxyalkyl” as used herein refers to a group having the general formula — (CH2)kOH wherein k is 1-6 unless stated otherwise in context.
[00143] “Cycloalkyl” is a saturated hydrocarbon ring group, having the specified number of carbon atoms, usually from 3 to about 7 carbon atoms. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl as well as bridged or caged saturated ring groups such as norborane or adamantane. “-(C0-Cnalkyl)cycloalkyl” is a cycloalkyl group attached to the position it substitutes either by a single covalent bond (C0) or by an alkylene linker having 1 to n carbon atoms.
[00144] “Halo” or “halogen” means fluoro, chloro, bromo, or iodo.
[00145] “Heteroaryl” is a stable monocyclic aromatic ring having the indicated number of ring atoms which contains from 1 to 3, or in some embodiments from 1 to 2, heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon, or a stable bicyclic or tricyclic system containing at least one 5- to 7-membered aromatic ring which contains from 1 to 3, or in some embodiments from 1 to 2, heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon. Monocyclic heteroaryl groups typically have from 5 to 7 ring atoms. In some embodiments bicyclic heteroaryl groups are 9- to 10-membered heteroaryl groups, that is, groups containing 9 or 10 ring atoms in which one 5- to 7-member aromatic ring is fused to a second aromatic or non-aromatic ring. When the total number of S and O atoms in the heteroaryl group exceeds 1, these heteroatoms are not adjacent to one another. It is preferred that the total number of S and O atoms in the heteroaryl group is not more than 2. It is particularly preferred that the total number of S and O atoms in the aromatic heterocycle is not more than 1. Heteroaryl groups include, but are not limited to, oxazolyl, piperazinyl, pyranyl, pyrazinyl, pyrazolopyrimidinyl, pyrazolyl, pyridizinyl, pyridyl, pyrimidinyl, pyrrolyl, quinolinyl, tetrazolyl, thiazolyl, thienylpyrazolyl, thiophenyl, triazolyl, benzol d|oxazolyl, benzofuranyl, benzothiazolyl, benzothiophenyl, benzoxadiazolyl, dihydrobenzodioxynyl, furanyl, imidazolyl, indolyl, isothiazolyl, and isoxazolyl.
[00146] “Heterocycle” is a saturated, unsaturated, or aromatic cyclic group having the indicated number of ring atoms containing from 1 to about 3 heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon. Examples of heterocycle groups include piperazine and thiazole groups.
[00147] “Heterocycloalkyl” is a saturated cyclic group having the indicated number of ring atoms containing from 1 to about 3 heteroatoms chosen from N, O, and S, with remaining ring atoms being carbon. Examples of heterocycloalkyl groups include tetrahydrofuranyl and pyrrolidinyl groups.
[00148] “Haloalkyl” means both branched and straight-chain alkyl groups having the specified number of carbon atoms, substituted with 1 or more halogen atoms, generally up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2 -fluoroethyl, and penta-fhioroethyl.
[00149] “Haloalkoxy” is a haloalkyl group as defined above attached through an oxygen bridge (oxygen of an alcohol radical).
[00150] “Pharmaceutically acceptable salts” include derivatives of the disclosed compounds in which the parent compound is modified by making inorganic and organic, non toxic, acid or base addition salts thereof. The salts of the present compounds can be synthesized from a parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting free acid forms of these compounds with a stoichiometric amount of the appropriate base (such as Na, Ca, Mg, or K hydroxide, carbonate, bicarbonate, or the like), or by reacting free base forms of these compounds with a stoichiometric amount of the appropriate acid. Such reactions are typically carried out in water or in an organic solvent, or in a mixture of the two. Generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used, where practicable. Salts of the present compounds further include solvates of the compounds and of the compound salts.
[00151] Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts and the quaternary ammonium salts of the parent compound formed, for example, from non- toxic inorganic or organic acids. For example, conventional non-toxic acid salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxy maleic, phenylacetic, glutamic, benzoic, salicylic, mesylic, esylic, besylic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, HOOC-(CH2)n-COOH where n is 0-4, and the like. Lists of additional suitable salts may be found, e.g., in G. Steffen Paulekuhn, et al, Journal of Medicinal Chemistry 2007, 50, 6665 and Handbook of Pharmaceutically Acceptable Salts: Properties, Selection and Use, P. Heinrich Stahl and Camille G. Wermuth Editors, Wiley- VCH, 2002.
[00152] METHODS OF TREATMENT
[00153] The disclosure provides a method of treating cancer by administering one or more bisacridine compounds of Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII pharmaceutically acceptable salts thereof, or a pharmaceutical compositions comprising one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier. The method of treating a cancer, including preventing a significant progression of a cancer, causing a significant regression of a cancer or causing a cancer to be eradicated or otherwise become undetectable, comprises providing to a patient an effective amount of a compound or salt of the disclosure. In an embodiment the patient is a mammal, and more specifically a human.
[00154] An effective amount of a compound pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier described herein will also provide a sufficient concentration of a compound of the disclosure when administered to a patient. A sufficient concentration is a concentration of the compound in the patient's body necessary to combat the disorder. Such an amount may be ascertained experimentally, for example by assaying blood concentration of the compound, or theoretically, by calculating bioavailability.
[00155] Methods of treatment include providing certain dosage amounts of a compound, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to a patient. Dosage levels of each compound from about 0. 1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per patient per day). The amount of compound that may be combined with the carrier materials to produce a single dosage form will vary depending upon the patient treated and the particular mode of administration. Dosage unit forms will generally contain between from about 1 mg to about 1000 mg of each active compound. In various embodiments 25 mg to 500 mg, or 25 mg to 200 mg of a compound of the disclosure are provided daily to a patient. Frequency of dosage may also vary depending on the compound used and the particular disease treated.
[00156] The disclosure provides a method of using compounds of Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII, and pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to treat a cancer. In various embodiments, the patient is suffering from a cell proliferative disorder or disease. The cell proliferative disorder can be cancer, tumor (cancerous or benign), neoplasm, neovascularization, or melanoma. Cancers for treatment include both solid and disseminated cancers. Exemplary solid cancers (tumors) that may be treated by the methods provided herein include e.g. cancers of the lung, prostate, breast, liver, colon, breast, kidney, pancreas, brain, skin including malignant melanoma and Kaposi's sarcoma, testes or ovaries, carcinoma, kidney cancer (renal cell), and sarcoma. Cancers that may be treated with a compound of this disclosure, or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier also include bladder cancer, breast cancer, colon cancer, endometrial cancer, lung cancer, bronchial cancer, melanoma, Non-Hodgkin lymphoma, cancer of the blood, pancreatic cancer, prostate cancer, thyroid cancer, brain or spinal cancer, and leukemia. Exemplary disseminated cancers include leukemias or lymphoma including Hodgkin's disease, multiple myeloma and mantle cell lymphoma (MCL), chronic lymphocytic leukemia (CLL), T-cell leukemia, multiple myeloma, and Burkitt's lymphoma. Particularly included herein are methods of treating cancer by providing a compound of this disclosure, or pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to a patient wherein the cancer is a solid tumor or disseminated cancer. TOP3B inhibitors, such as the compounds of the disclosure, are particularly useful for treating TOP3B expressing tumors, including cancers in which the tissue of origin is thyroid, breast, liver, endometrium, and ovary. The disclosure includes methods of treating ovarian, endometrial, liver, breast, thyroid, prostate, pancreatic, stomach, lung, larynx, colon, esophageal, uterine and cervical, gall bladder, kidney, and urinary bladder cancer comprising administering a compound of the disclosure to a patient having such a cancer. The disclosure also includes a method of treating malignant lymphoma comprising administering a compound of the disclosure to a patient with malignant lymphoma.
[00157] In one aspect of the disclosure, methods are provided to administer a therapeutically effective amount of one or more bisacridine compounds (i.e., those under Formula I through Formula VII, as described elsewhere herein), pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to treat a cancer.
[00158] In some embodiments, the method includes one or more of the following: inducing cell death of a TOP3B-expressing cell in a subject; reducing the number of TOP3B-expressing cells in a subject; inhibiting TOP3B activity in a subject; poisoning TOP3B in a subject; trapping TOP3B in a subject; and promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject.
[00159] In some embodiments, the bisacridine compound is present in an amount sufficient to induce cell death of TOP3B-expressing cells in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90% or substantially all of the TOP3B- expressing cells in a subject.
[00160] In some embodiments, the bisacridine compound is present in an amount sufficient to reduce the number of TOP3B-expressing cells in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate the presence of TOP3B-expressing cells in a subject.
[00161] In some embodiments, the bisacridine compound is present in an amount sufficient to inhibit TOP3B activity in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate TOP3B activity in a subject.
[00162] In some embodiments, the bisacridine compound is present in an amount sufficient to poison TOP3B in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or poison substantially all of the TOP3B in a subject.
[00163] In some embodiments, the bisacridine compound is present in an amount sufficient to trap TOP3B in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or trap essentially all of the TOP3B in a subject. [00164] In some embodiments, the bisacridine compound is present in an amount sufficient to promote the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, 2-fold, 3- fold, 5-fold, or 10-fold as compared to an infected subject not being treated with a method of the disclosure.
[00165] In other aspects and embodiments of the disclosure, methods are provided to administer a therapeutically effective amount of one or more bisacridine compounds (again, those under Formula I through Formula VII, as described herein), pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier to accomplish one or more of several actions, including reducing or inhibiting replication of an RNA virus in the subject; damaging viral RNA in a subject; stimulating anti -RNA viral activity in a subject, and treating an RNA viral infection in a subject.
[00166] In some embodiments, the RNA virus is a positive strand RNA virus, which is, in various embodiments, from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota.
[00167] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota and class Alsuviriceles, Flasuviricetes, Magsaviricetes, or Tolucaviricetes.
[00168] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, and order Hepelivirales, Mar tellivir ales, or Tymovirales.
[00169] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Hepelivirales, and family Alphatetraviridae , Benyviridae, Hepeviridae or Matonaviridae .
[00170] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Martellivirales, and family Bromoviridae, Closteroviridae, Endornaviridae , Kitaviridae, Mayoviridae, Togaviridae, or Virgaviridae .
[00171] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Tymovirales, and family Alphaflexiviridae , Betaflexiviridae, Deltaflexiviridae, Gammaflexiviridae, or Tymoviridae .
[00172] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus, Hepacivirus, Pegivirus, or Pestivirus. [00173] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus.
[00174] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviricetes, order Amarillovirales, family Flaviviridae, genus Flavivirus, and species Dengue virus, West Nile virus, Yellow Fever virus and Zika virus.
[00175] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Magsaviricetes, order Nodamuvirales, and family Nodaviridae or Sinhaliviridae .
[00176] In some embodiments, the positive strand RNA virus is selected from phylum Kitrinoviricota, class Tolucaviricetes, order Tolivirales, and family Carmotetraviridae or Tombusviridae .
[00177] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota and class Amabiliviricetes, Howeltoviricetes, Leviviricetes, or Miaviricetes .
[00178] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Amabiliviricetes, order Wolframvirales, and family Narnaviridae .
[00179] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Howeltoviricetes, order Cryppavirales, and family Mitoviridae.
[00180] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, and order Norzivirales or Timlovirales.
[00181] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Norzivirales, and family Atkinsviridae, Duinviridae, Fiersviridae, or Solspiviridae .
[00182] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Timlovirales, and family Blumeviridae or Steitzviridae .
[00183] In some embodiments, the positive strand RNA virus is selected from phylum Lenarviricota, class Miaviricetes, order Ourlivirales, and family Botourmiaviridae .
[00184] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota and class Duplopiviricetes, Pisoniviricetes, or Stelpaviricetes.
[00185] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Duplopiviricetes, order Durnavirales, and family Amalgaviridae , Curvulaviridae , Fusariviridae , Hypoviridae, Partitiviridae or Picobirnaviridae . [00186] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, and order Nidovirales, Picornavirales, or Sobelivirales .
[00187] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Abnidovirineae and family Abyssoviridae .
[00188] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Arnidovirineae and family Arteriviridae, Cremegaviridae, Gresnaviridae or Olifoviridae .
[00189] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Nidovirales, suborder (Arnidovirineae, family Coronaviridae, and subfamily I.elovirinae. Orthocoronavirinae or Pitovirinae .
[00190] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder (Arnidovirineae, family Coronaviridae, subfamily Orthocoronavirinae and genus Alphacoronavirus, Betacoronavirus, Deltacoronavirus or Gammacoronavirus.
[00191] In some embodiments, the genus is Alphacoronavirus, and in some embodiments, the species is Alphacoronavirus 1 (TGEV, Feline coronavirus, Canine coronavirus), Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, or Scotophilus bat coronavirus 512.
[00192] In some embodiments, the genus is Betacoronavirus, and in some embodiments, the species is Betacoronavirus 1 (Bovine Coronavirus, Human coronavirus OC43), Human coronavirus HKU1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Rousettus bat coronavirus HKU9, Severe acute respiratory syndrome- related coronavirus (SARS-CoV, SARS-CoV-2), or Tylonycteris bat coronavirus HKU4.
[00193] In some embodiments, the genus is Deltacoronavirus, and in some embodiments, the genus is Gammacoronavirus .
[00194] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Mesnidovirineae, and family Medioniviridae or Mesoniviridae .
[00195] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviriceies, order Nidovirales, suborder Monidovirineae, and family Mononiviridae . [00196] In some embodiments, the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Nanidovirineae, and family Nanghoshaviridae or Nanhypoviridae .
[00197] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Ronidovirineae, and family Euroniviridae or Roniviridae.
[00198] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Tornidovirineae, and family Tobaniviridae .
[00199] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Picornavirales, and family Caliciviridae , Dicistr oviridae. Iflaviridae. Marnaviridae. Picornaviridae. Polycipiviridae, Secoviridae or Solinviviridae .
[00200] In some embodiments, the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Sobelivirales. and family Alvernaviridae , Barnaviridae or Solemoviridae.
[00201] In some embodiments, the positive strand RNA virus is Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus, which, in some embodiments is selected from the group consisting of Middle East respiratory syndrome-related (MERS -related) coronavirus and Severe acute respiratory syndrome-related (SARS-related) coronavirus. In some embodiments, the SARS-related coronavirus is SARS-CoV, SARS-CoV-2.
[00202] In some embodiments, the bisacridine compound is present in an amount sufficient to exert a therapeutic effect to reduce one or more symptoms of infection with a positive strand RNA virus by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate one or more symptoms of infection with a positive strand RNA virus.
[00203] In some embodiments, the bisacridine compound is present in an amount sufficient to reduce or inhibit replication of an RNA virus in the subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate replication of an RNA virus in the subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%, or substantially eliminate replication of an RNA virus in the subject. [00204] In some embodiments, the bisacridine compound is present in an amount sufficient to damage viral RNA in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90% or substantially all of the viral RNA in a subject.
[00205] In some embodiments, the bisacridine compound is present in an amount sufficient to stimulate anti-RNA viral activity in a subject by an average of at least about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, more than 90%.
[00206] In some embodiments, the bisacridine drug is present in an amount sufficient to prevent the onset of a symptom of positive strand RNA virus infection.
[00207] In some embodiments of the various aspects of the disclosure, an effective amount of the bisacridine drug is a daily dose of about grams.
Figure imgf000047_0001
[00208] FORMULATIONS AND ADMINISTRATION OF PHARMACEUTICAL COMPOSITIONS
[00209] The methods of the disclosure include many suitable modes of administration to deliver a bisacridine drug via systemic administration. Suitable formulations and additional carriers are described in, e.g., Remington “The Science and Practice of Pharmacy” (20th Ed., Lippincott Williams & Wilkins, Baltimore Md.), the teachings of which are incorporated by reference in their entirety herein.
[00210] After formulation with an appropriate pharmaceutically acceptable carrier in a desired dosage, the pharmaceutical compositions of the disclosure can be administered to humans and other mammals orally, via injection and topically. Alternative and additional routes such as rectally, parenterally, intraci sternally, intravaginally, intraperitoneally, bucally, or nasally, are envisioned.
[00211] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or di glycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables. The injectable formulations can be sterilized, for example, by filtration through a bacterial- retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
[00212] In order to prolong the effect of an active agent, it is often desirable to slow the absorption of the agent from subcutaneous or intramuscular injection. Delayed absorption of a parenterally administered active agent may be accomplished by dissolving or suspending the agent in an oil vehicle. Injectable depot forms are made by forming microencapsulating matrices of the agent in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of active agent to polymer and the nature of the particular polymer employed, the rate of active agent release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the agent in liposomes or microemulsions which are compatible with body tissues.
[00213] Solid dosage forms for oral administration include capsules, tablets, pills, troches, wafers, powders, and granules. In such solid dosage forms, the active agent is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or (a) fillers or extenders such as starches, sucrose, glucose, mannitol, and silicic acid, (b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, (c) humectants such as glycerol, (d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, various silicates, and sodium carbonate, (e) solution retarding agents such as paraffin, (f) absorption accelerators such as quaternary ammonium compounds, (g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, (h) absorbents such as kaolin and bentonite clay, and (i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof.
[00214] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active agent(s) may be admixed with at least one inert diluent such as sucrose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active agent(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.
[00215] Liquid dosage forms for ocular administration include buffers and solubilizing agents, preferred diluents such as water, preservatives such as thymosol, and one or more biopolymers or polymers for conditioning the solution, such as polyethylene glycol, hydroxypropylmethylcellulose, sodium hyaluronate, sodium polyacrylate or tamarind gum.
[00216] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active agent(s), the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3 -butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
[00217] Dosage forms for topical or transdermal administration of an inventive pharmaceutical composition include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, or patches. The active agent is admixed under sterile conditions with a pharmaceutically acceptable carrier and any needed preservatives or buffers as may be required. For example, ocular or cutaneous infections may be treated with aqueous drops, a mist, an emulsion, or a cream.
[00218] The ointments, pastes, creams, and gels may contain, in addition to an active agents of the disclosure, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, zinc oxide, or mixtures thereof.
[00219] Transdermal patches have the added advantage of providing controlled delivery of the active ingredients to the body. Such dosage forms can be made by dissolving or dispensing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the compound in a polymer matrix or gel.
[00220] Administration of a bisacridine drug or pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier, may be therapeutic or may be prophylactic.
[00221] In general, each agent (in this context, one of the “agents” is a composition of this disclosure) will be administered at a dose and on a time schedule determined for that agent, e.g., one or more times daily, weekly, monthly, yearly and the like. Additionally, the disclosure encompasses the delivery of the compositions in combination with agents that may improve their bioavailability, reduce or modify their metabolism, inhibit their excretion, or modify their distribution within the body.
[00222] Dosing for a bisacridine drug in the methods of the disclosure may be found by routine experimentation. The daily dose can range from about 1 x 10 7 g to 5000 mg. Daily dose range may depend on the form of bisacridine drug e.g., the salts used, and/or route of administration, as described herein. For example, for systemic administration, typical daily dose ranges are, e.g. about 1-5000 mg, or about 1-3000 mg, or about 1-2000 mg, or about 1- 1000 mg, or about 1-500 mg, or about 1-100 mg, or about 10-5000 mg, or about 10-3000 mg, or about 10-2000 mg, or about 10-1000 mg, or about 10-500 mg, or about 10-200 mg, or about 10-100 mg, or about 20-2000 mg or about 20-1500 mg or about 20-1000 mg or about 20-500 mg, or about 20-100 mg, or about 50-5000 mg, or about 50-4000 mg, or about 50-3000 mg, or about 50-2000 mg, or about 50-1000 mg, or about 50-500 mg, or about 50-100 mg, about 100- 5000 mg, or about 100-4000 mg, or about 100-3000 mg, or about 100-2000 mg, or about 100- 1000 mg, or about 100-500 mg. In some embodiments, the daily dose of bisacridine drug is about 5, 10, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 mg. In some embodiments, the daily dose of the bisacridine drug is 10 mg. In some embodiments, the daily dose of the bisacridine drug is 100 mg. In some embodiments, the daily dose of bisacridine drug is 500 mg. In some embodiments, the daily dose of bisacridine drug is 1000 mg.
[00223] It will be understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
[00224] For other forms of administration, the daily dosages may be around the range described for systemic administration.
[00225] Having described the present disclosure, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the disclosure. EXAMPLES
[00226] The Examples that follow are illustrative of specific embodiments of the disclosure, and various uses thereof. They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any way.
EXAMPLE 1: High-throughput Screen to Identify TOP3B Poisons
[00227] To discover TOP3B poisons, the inventors provided the insight that such inhibitors would lead to significant DNA damage only in the presence of TOP3B. TOP3B knockout (TOP3B-KO) cells were generated from human colon carcinoma HCT116 cells to discover compounds against which TOP3B-KO cells were more resistant than isogenic parental HCT116 cells, in a “Comparative Cellular Toxicity Screen” (also “CCTS”; Figure 1A). To carry out the screen, HCT116 parental cells and TOP3B-KO cells were labeled with different fluorescent proteins, allowing monitoring of the viability of each cell line in the same well via different fluorescent microscopy channels. The parental GFP-labeled HCT116 and mCherry- labeled TOP3B-KO cells were mixed and seeded in each well at a 1 to 1 ratio. After the cells were allowed to attach for 24-48 hours, the media was changed with media containing various compounds at different concentrations, and the cell plates were incubated for an additional 72 hours. The entire plate was imaged at the end of compound treatment and the sensitivity of each cell line to a particular compound was directly assessed using two distinct channels in fluorescence microscopy (Figure 1A). The CCTS enabled comparison of the parental and TOP3B-KO cells in the same well and reduced the amount of test compounds and reagents by 50%. Further, culturing the parental and TOP3B-KO cells in the same well ensured identical growth conditions and, e.g., eliminated variation in compound concentrations introduced by pipetting errors, variable degrees of liquid evaporation and other potential errors.
[00228] 811 compounds were screened from the NCI DTP (Developmental Therapeutics
Program) Mechanistic Set VI Set Library, whose compound library was curated to include the different growth inhibition patterns in the NCI-60 cell line screen. Live-cell images of mixed HCT116 parental and TOP3B-KO cells were taken after 72-hour treatment with a given compound in both GFP and mCherry channels, as well as the light microscopy channel. Cell count and confluency were quantified for the parental and TOP3B-KO cells in their respective channel before normalizing to the DMSO-treated wells on the same plate (Figure 1B). Images were manually inspected for the instances where the drug compounds strongly fluoresce in one of the channels. Cell count and confluency of light microscopy images were quantified for such instances. The light microscopy images represent combined parental and TOP3B-KO cells, so that the levels of cells in the flooded channel can be back-calculated. To avoid missing the window of efficacy for a particular compound, each compound was screened across a wide range of concentrations (from 32 nM to 20 μM, in 5-fold serial dilutions). From the combined data, survival curves were constructed for both HCT116 and TOP3B-KO cells to each of the compounds in the library.
[00229] Four responses to the drug treatments are possible: TOP3B-KO cells are selectively resistant; TOP3B-KO cells are selectively sensitive; TOP3B-KO cells have the same response as the parental cells; and compounds are too toxic even at the lowest concentration tested (Figure 1 A). For a particular compound, the relative viability of TOP3B-KO vs HCT116 (WT) cells after treatment at every concentration was multiplied together to yield a “Resistance Factor” (RF) value (Figure 2A). When TOP3B-KO cells were more resistant to a given compound over a wide range of concentrations, the RF value for that compound was large. Conversely, when a compound was consistently more toxic to the TOP3B-KO cells across a wide range of concentrations, its RF value was less than 1. A compound without differential effect for TOP3B-KO versus WT cells generates a RF value close to 1. Compounds that were too toxic in the initial screen were retested at lower concentrations.
[00230] RF can be extracted either from the cell numbers or confluency (RFcell count or RFconfluency), so Log (RFceii Count) was plotted against the Log (RFcontiuency) on a scatter plot (Figure 2B). Nearly all data points are clustered along the X = Y line, indicating the cell count number very closely agrees to the confluency value. Compounds with the highest RF values from this initial screen were selected for further study.
[00231] CCTS assays were repeated with the top 8% hits from the initial screen (circled data in Figure 2B) with independently procured compounds to eliminate any false-positive compounds prior to testing in the next stage. To eliminate the possibility that GFP and mCherry expression might create a bias in the screen, cell lines labeled with the opposite fluorescent proteins were generated for additional comparative cellular toxicity assays. Of the compounds tested in this rigorous manner, 19 of them showed consistent differential effects on the HCT116 vs TOP3B-KO cells (Figure 2C).
EXAMPLE 2: RADAR assays for the selection compounds inducing cellular TOP3Bccs
[00232] To determine whether the 19 compounds selected from the Comparative Cellular Fitness Screen induced cellular TOP3Bccs, a (modified) rapid approach to DNA adduct recovery (RADAR; Y. Sun et al., Sci Adv 6 (2020)) assay was used to specifically detect proteins covalently attached to cellular nucleic acids (Figure 3A). After treatment, the cells were lysed by a combination of chaotropic salts and detergent, ensuring any topoisomerase cleavage complex was instantaneous denatured and thus unable to reverse its covalent bonding to the nucleic acids. When TOP3B is covalently attached to DNA or RNA, it co-purifies with the nucleic acids and the presence of TOP3Bcc can be detected via specific antibodies (S. Saha et al., Cell Rep 33, 108569 (2020)). Out of 19 compounds selected from the survival assays, 6 gave rise to enhanced TOP3Bcc signals in human epithelial kidney HEK293 cells transiently overexpressing flag-tagged TOP3B after 1-4-hour treatments at 100 μM (certain structures shown in Figure 3B).
[00233] Among them, NSC690634 induced TOP3Bccs within 1 hour, while it took 4 hours to induce comparable levels of TOP3Bccs for other compounds (Figure 3C). TOPI and TOP2 poisons require short treatments to generate high levels of TOPccs (Y. Sun et al., Sci Adv 6 (2020)), so NSC690634 appears consistent with a direct TOP3B trapping mechanism.
EXAMPLE 3: Band shift assay screens for TOP3Bcc induction by recombinant human TOP3B
[00234] An in vitro system to detect the formation of TOP3Bccs with either DNA or RNA substrates using recombinant TOP3B enzyme (S. Saha et al., Cell Rep 33, 108569 (2020)) was used to assess the compounds selected according to the process outlined in Figure 2C. Since TOP3B forms covalent linkage with the 5 ’-end of the nucleic acid, a single-strand DNA or RNA construct with a fluorophore molecule attached at the 3 ’-end was used (Figure 4A). In this assay, the molecular weight of the free construct increases and the gel migration decreases when a small population of the TOP3B forms TOP3Bcc with the substrates, representing the normally transient intermediate state of the TOP3B catalytic cycle (Figure 4A). The two species are unambiguously resolved on SDS-PAGE and can detected via the fluorophores on the oligo constructs. This assay also allows for testing different effects of TOP3B on DNA vs RNA.
[00235] The inventors hypothesized that compounds with a direct trapping effect on TOP3B should stabilize the normally transient TOP3Bccs. Testing compounds selected from the RADAR screen showed that NSC690634 stabilized TOP3Bccs in the band shift assay (Figure 4B). In the absence of compound (and presence of DMSO the solvent), TOP3B induced several high molecular weight species (100-180 kDa) (Figure 4B, left lanes). While two compounds (NSC47147 andNSC697726) showed little to no effect on the levels of TOP3Bccs, two compounds showed mild inhibitory effect compared to DMSO-treated samples on both DNA-TOP3Bcc and RNA-TOP3Bcc (NSC267229 and NSC3 16157).
[00236] Increasing concentration of NSC690634 stabilized the high molecular weight species (100-180 kDa) of RNA-TOP3Bcc, as well as much higher molecular weight species (>200 kDa). The in vitro band shift assays suggest that NSC690634 mainly acts to stabilize RNA-TOP3Bccs with relatively mild effects on DNA-TOP3Bccs. NSC690634 was selected for further characterization.
EXAMPLE 4: NSC690634 rapidly induces endogenous TOP3Bccs in human cells
[00237] NSC690634 is a bisacridine compound (Figure 3B). Cell survival assays confirmed that TOP3B-KO cells were more resistant to NSC690634 than the HCT116 parental cells (Figure 7B and Figure 7C), regardless which fluorescent proteins were used in the labeling. TOP3B-KO cells also showed sensitivity to NSC690634 above certain threshold concentrations, indicating these compounds likely have additional cellular targets beyond TOP3B.
[00238] Using HEK293 cells transiently over-expressing TOP3B-flag to enhance TOP3Bcc signals (S. Saha et al., Cell Rep 33, 108569 (2020)), the time- and dose-dependence of NSC690634 to induce TOP3Bcc formation was tested in a RADAR assay. The sensitivity of anti -flag antibody and the abundance of TOP3B in this system allowed detection of elevated levels of TOP3Bccs after treatments as short as 10 minutes for NSC690634 (Figure 8A). The level of TOP3Bcc induced by NSC690634 increased in a time-dependent manner and leveled off after approximately 1 hour. Similarly, NSC690634 induced TOP3Bcc in a dose-dependent manner, with TOP3Bccs readily detectable at 5 μM of NSC690634 for 1 hour (Figure 8B).
[00239] It was also tested whether NSC690634 induced endogenous TOP3Bccs in different human cell lines using RADAR assays. Due to the lower sensitivity of anti-TOP3B antibody and the lower level of endogenous TOP3B, higher concentration of either compound and longer treatments were required to detect endogenous TOP3Bcc induction. NSC690634 induced endogenous TOP3Bcc in time- and dose-dependent manners in all human cell lines tested (Figures 5A-5F). Immunoblotting of HEK293 cells treated with NSC690634 was performed and the levels of free TOP3B were measured to determine whether as TOP3Bcc levels increase, free TOP3Bcc levels decrease. Free cellular TOP3B decreased with increasing concentrations ofNSC690634 (Figure 9A). Together, these results demonstrate that the bisacridine compound NSC690634 traps TOP3B both in biochemical assays with recombinant TOP3B and in cells.
[00240] Whether the TOP3Bccs induced by NSC690634 were reversible upon removal of NSC690634 was also tested. The results showed that removal of NSC690634 after 1 hour treatment did not lead to a steady decrease of TOP3Bcc levels over time (Figure 9B), suggesting TOP3Bccs induced by NSC690634 are not readily reversible.
[00241] The specificity of NSC690634 for trapping TOP3Bcc was tested by probing for the presence of cleavage complexes of other topoisomerases by RADAR assay. It was observed that NSC690634 induced only TOP3Bcc and not cleavage complexes of TOP3 A, TOPI, or TOP2 (Figure 9C). Thus, NSC690634 is specific for the trapping of TOP3B.
EXAMPLE 5: NSC690634 traps primarily RNA-TOP3Bcc in cells
[00242] TOP3B is the only known RNA topoisomerase in human cells (M. Ahmad et al., Nucleic Acids Res 44, 6335-6349 (2016)), but it also demonstrates DNA topoisomerase activity, and TOP3Bccs form on both DNA and RNA (S. Saha et al., Cell Rep 33, 108569 (2020)). Whether NSC690634 induced TOP3Bccs on DNA or RNA in the cells was tested. Cellular TOP3Bcc on DNA and RNA can be distinguished by selectively digesting away the RNA or DNA in RADAR samples that contain both DNA- and RNA-topoisom erase crosslinks. The samples were treated with combined RNase A and T1 or DNase I before a final round of nucleic acid purification, and samples were loaded on slot blots for immunodetection. The TOP3Bcc signals induced by NSC690634 were greatly attenuated after treatment with RNase A and Tl, while treatment with DNase I did not significantly reduce the levels of TOP3Bccs compared to the undigested sample (Figures 5E - 5F). NSC690634 thus appears to induce primarily RNA-TOP3Bccs in cells, which is consistent with the biochemical assays described above (Figure 4) showing that NSC690634 traps RNA-TOP3Bccs to a greater extent than DNA-TOP3Bccs.
[00243] Cellular TOP3Bccs on DNA and RNA can also be distinguished by separating the two nucleic acid species in a CsCl gradient in in vivo complex of enzyme (ICE) bioassays. HEK293 cells transiently over-expressing TOP3B were treated with NSC690634, and the DNA and RNA species in the cell lysate were separated using the ICE bioassay. Equal amounts of nucleic acids (1.5 μg each) from the DNA and RNA fraction were loaded on slot blots for independent immunodetection of TOP3Bcc on DNA vs. RNA. Results from three independent ICE bioassay experiments found that NSC690634 induced TOP3Bcc mainly with RNA and to a lesser extent with DNA (FIG. 5G). Using two additional purification methods for protein complexes cross-linked to cellular RNA, it was verified that treatments with NSC690634 led to strong induction of RNA-TOP3Bccs (data not shown).
[00244] Since TOP3B is important for resolving R-loops in cells, the impact of TOP3B inhibition on cellular R-loops was examined. The R-loop level was higher in the HCT116- TOP3B-KO cells than the parental HCT116 cells (Figure 5G). Treatment with NSC690634 markedly increased the R-loops level in the parental HCT116 cells, but not in the HCT116- TOP3B-KO cells (Figure 5G). As a control, treatment of the genomic DNA samples with RNase H eliminated all signals, demonstrating the specificity of the S9.6 antibody for R-loop detection (S. Saha et al., Resolution of R-loops by topoisomerase Ill-beta (TOP3B) in coordination with the DEAD-box helicase DDX5. Cell Rep 40, 111067 (2022)) in the slot blot assays (Figure 5G). The results indicated that NSC690634 specifically stabilizes RNA- TOP3Bccs and increases R-loops in a TOP3B-depedent manner.
EXAMPLE 6: Structure Activity Studies
[00245] A series of bisacridine compound structurally related to NSC690634 were tested for their effects on TOP3Bcc (structures shown in Figure 6A). It was found that bisacridine compounds with a 3-carbon linker (NSC690634) are more effective than the same family of compounds with longer (e.g., 6- or 8-carbon) linkers in RADAR assays. Only NSC690634 with its 3-carbon linker induced TOP3Bccs (Figure 6B). In vitro band-shift assays also showed that neither the potent TOP2 poison m-AMSA nor o-AMSA, its inactive isomer (Y. Pommier, Drugging topoisomerases: lessons and challenges. ACS Chem Biol 8, 82-95 (2013)) was able to induce TOP3Bccs with either DNA or RNA substrates (Figure 6C). Consistent with earlier results, NSC690634 strongly induced RNA TOP3Bccs, but had relatively mild effect on DNA TOP3Bcc. Surprisingly, lengthening the linkers of the bisacridine compounds to a 6- or 8- carbon linker abolished formation of both DNA- and RNA-TOP3Bcc in vitro (Figure 6C). These biochemical results are consistent with our findings from RADAR assays, indicating that the length of linker between the two acridine moieties is critical for trapping RNA- TOP3Bccs by bisacridines.
METHODS
Mammalian Cell culture
[00246] Human embryonic kidney HEK293 cells, human colorectal carcinoma HCT116 cells were cultured in 1 x Dulbecco's modified Eagle's medium (DMEM, Life Technologies), supplemented with 10% (v/v) Fetal Bovine Serum (FBS, Gemini), 100 U/mL penicillin, 100 μg/mL streptomycin, and 1 x GlutaMax (ThermoFisher). Cells were incubated at 37°C with 5% CO2 incubator to corresponding confluency. Human TOP3B-Myc-Flag cDNA ORF was purchased from OriGene (RC223204) and transfected in HEK293 cells using Lipofectamine 3000 Reagent (ThermoFisher Scientific) according to the manufacturer’s protocol for 48 hours before drug treatments.
[00247] Generation of HCT116-TOP3B-KO cells were as described (S. Saha et al., Resolution of R-loops by topoisomerase Ill-beta (TOP3B) in coordination with the DEAD-box helicase DDX5. Cell Rep 40, 111067 (2022)). HCT116 and HCT116-TOP3B-KO cells stably expressing GFP or mCherry were generated using lentivirus containing pFUGW-FerH-ffLuc2- eGFP (Addgene #71393) or pFUGW-FerH-ffLuc2-mCherry, followed by FACS sorting and subculturing into monoclonal populations.
Fluorescent Microscopy Imaging and Analysis
[00248] All microscopy images were acquired using Cytation 5 (BioTek, Agilent), with 4/ objective on cells seeded in 384-well black cell-culture plates with a clear bottom in GFP and Texas Red channels, as well as a bright-field channel. Automated analysis of all images was done using Gen5 Image Prime Software (BioTek, Agilent).
In vivo Complex of Enzymes (ICE) Bioassays
[00249] ICE bioassays were carried out as follows: approximately 1 million HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour. The treated and non-treated control cells were pelleted and immediately lysed with 1 mL of 1% sarkosyl. After homogenization with a Dounce, cell lysates were gently layered on step gradients containing four different CsCl (Sigma-Aldrich, CAT#:746487-1KG) solutions (2 mL of each) of the following densities: 1.82, 1.72, 1.50, and 1.45. The gradients were prepared by diluting a stock solution of CsCl of density 1.88. Cesium sulfate (Sigma- Aldrich, CAT#:C5205-50G) was included in the bottom solution of density 1.82 to facilitate flotation of the RNA, and sodium thiocyanate (Sigma-Aldrich, CAT#: S7757-1KG) was included in topmost solution of density 1.45 to facilitate the complete removal of noncovalently bound proteins from the nucleic acid species. Samples were centrifuged at 30,700 rpm in a Beckman SW40 rotor for 24 hours at 20 °C. Half-milliliter fractions were collected from the bottom of the tubes. Fractions containing DNA and RNA were pooled separately, quantitated, diluted with 25 mM sodium phosphate buffer (pH 6.5), and applied to nitrocellulose 0.45-pm membranes (Bio-Rad Laboratories, CAT#: 1620115) through a slot-blot vacuum manifold. TOP3Bccs were detected with an anti-Flag antibody (mouse monoclonal, clone M2, Sigma), and the loading control was carried out by staining with methylene blue stain (Molecular Research Center) following the manufacturer’s protocol.
Isolation of Cellular Covalent RNA-Protein Adducts from Cells Using TRIzol® Reagent [00250] RNA-protein adducts were isolated from cells using protein-crosslinked RNA extraction (XRNAX), as described previously (S. Saha et al., Cell Rep 33, 108569 (2020)).
7
Briefly, 10 HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour. Cells were lysed in 1 mL TRIzolTM Reagent (Invitrogen, USA, CAT#: 15596026) by pipetting the samples up and down several times followed by incubation at room temperature for 5 min. 200 μL chloroform was then added to the samples and mixed thoroughly by inverting the tubes. After incubation at room temperature for 3 min and centrifugation for 10 min at 7,000 x g at 4 °C, the aqueous phase was removed, and the interphase was transferred to a new tube. The interphase was gently washed twice with 1 ml low SDS buffer (50 mM Tris-Cl, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% SDS), resuspended in low SDS buffer, centrifuged at 5,000 x g for 2 min at room temperature, and the supernatant was stored. Pellets were washed again with 1 mL of low SDS buffer, then twice more with 1 mL high SDS buffer (50 mM Tris-Cl, 1 mM EDTA, 0.5% SDS), and all the supernatants were stored following centrifugation. NaCl was added to a final concentration of 300 mM to each of the interphase eluates, along with 10 μg of RNase-free glycogen and 1 mL isopropanol before mixing by inversion. Samples were spun down for 15 min with 18,000 x g at -10 °C. Supernatant were discarded; pellets were washed with 70% ethanol, with residual ethanol removed; and the pellets were resuspended in nuclease-free water at 4 °C. 10x TURBO DNase Buffer (ThermoFisher Scientific, USA) was added to the resuspended samples to l x concentration along with 10 μL TURBO DNase (ThermoFisher Scientific, USA) and incubated for 60 min at 37 °C with constant shaking at 700 rpm. After DNase treatment, samples were isopropanol precipitated in the presence of 300 mM NaCl and dissolved in diethyl pyrocarbonate (DEPC)-treated water. RNA purity and concentrations were estimated by spectroscopy on a NanoDrop 1000 Spectrophotometer (ThermoFisher Scientific, USA). Samples were slot-blotted on nitrocellulose membrane, and RNA-TOP3Bccs were detected using mouse monoclonal anti-FLAG M2 antibody (Millipore Sigma, St. Louis, MO, CAT#: Fl 804), and the loading control was carried out by staining with methylene blue stain (Molecular Research Center) following the manufacturer’s protocol.
Phenol-Toloul Extraction (PTex) to Purify Cellular Covalent RNA-Protein Adducts
[00251] For isolation and detection of RNA-TOP3Bcc the PTex method was performed as described previously (C. Urdaneta et al., Nat. Commun. 10, 990 (2019)). Briefly, 5 x 106 HEK293 cells transiently over-expressing TOP3B were treated with the indicated concentration of TOP3B poisons for 1 hour, harvested and suspended in 600 μL of phosphate buffered saline (PBS). Cell suspensions were mixed with 200 μL each of neutral phenol (Phenol solution Equilibrated with 10 mM Tris HC1, pH 8.0, 1 mM EDTA, Millipore Sigma, Catalog#: P4557-400ML), l-Bromo-3 -chloropropane (BCP, Millipore Sigma, Catalog #:B9673-200ML) and Toluene (Millipore Sigma, Catalog #: 32249-1L) for 1 min (21 °C, 2,000 rpm), followed by centrifugation (20,000 g, 3 min, 4 °C). The aqueous phase was carefully taken out and transferred to a 2-mL Eppendorf tube containing 300 μL of solution D (5.85 M guanidine isothiocyanate; 31.1 mM sodium citrate; 25.6 mM N-lauryosyl-sarcosine; 1% 2- mercaptoethanol). Then, 600 μL phenol and 200 μL BCP were added to the samples, mixed, and centrifuged (20,000 g, 3 min, 4 °C). After phase separation, the upper aqueous and the lower organic phases were removed using a syringe with a blunt needle. The resulting interphase was mixed with 400 μL water, 200 μL ethanol, 400 μL phenol, and 200 μL BCP (1 min, 21 °C, 2,000 rpm) and centrifuged (20,000 g, 3 min, 4 °C). The upper aqueous and the lower organic phases were carefully removed, while interphase was precipitated with 9 volumes of ethanol (-20 °C, overnight). Samples were centrifuged (4 °C, 30 min, 20,000 g), pellets dried, and then solubilized in RNase-free DEPC-treated water. RNA purity and concentrations were estimated by spectroscopy on a NanoDrop 1000 Spectrophotometer (ThermoFisher Scientific, USA). Samples were slot-blotted on the nitrocellulose membrane and RNA-TOP3Bccs were detected using the mouse monoclonal anti-FLAG M2 antibody (Millipore Sigma, St. Louis, MO, CAT#: Fl 804), and the loading control was carried out by staining with methylene blue stain (Molecular Research Center) following the manufacturer’s protocol.
RADAR assay for detection of TOP3Bcc
[00252] Modified RADAR assays were carried out to purify both DNA and RNA species from the cell lysates, and the entire procedure was carried out under DNase- and RNase- free conditions. Briefly, after treatment with specified compound (e.g., NSC690634) at indicated concentration and time, cells with or without prior transfection with the Flag-tagged TOP3B (TOP3B OE) were directly lysed with 400 μL of DNAzol (Invitrogen). Instead of the optional centrifugation step at this point, which would remove RNA and other insoluble tissue fragments, the entire sample was collected in order to retain both DNA and RNA species. The samples were then precipitated with half-volume of 100% ice-cold ethanol and incubated at -20 °C for 20 min. Instead of spooling the precipitated DNA as described in the manufacturer’s manual, which would mainly enrich DNA species, all nucleic acids were pelleted by centrifugation of the entire sample at 15,000 rpm for 15 min at 4 °C in order to retain both DNA and RNA species. The pellets were then washed with 75% ice-cold ethanol twice, air- dried, and resuspended in 100 μL RNase-free Tris-ethylenediaminetetraacetic acid (TE) buffer. [00253] To eliminate RNA-TOP3Bcc from TOP3Bccs, 10 μg nucleic acids samples were incubated with 1 μg/μL RNase A and 1 U/μL RNase T1 at 37°C for 2 hours, followed by adding 1/10 volume of 3 M sodium acetate, and 3 volume of 100% ice-cold ethanol. To eliminate DNA-TOP3Bcc from TOP3Bccs, 10 μg nucleic acids samples were incubated with 0. 1 U/μL DNase I at 37°C for 2 hours, followed by adding 1/10 volume of 3 M sodium acetate, and 3 volume of 100% ice-cold ethanol. Samples were incubated at -80°C for 1 hour and the remaining nucleic acid polymers were pelleted by centrifugation at 15,000 rpm for 15 min at 4°C. Nucleic acids pellets were washed with 75% ice-cold ethanol twice, air dried and resuspended in 100 μL TE buffer.
[00254] For the detection of TOP3Bccs, 1 μg to 3 μg of nucleic acids samples per well were applied to nitrocellulose 0.45-pm membranes (Bio-Rad Laboratories, CAT#: 1620115) through a slot-blot vacuum manifold as described (S. Saha et al., Cell Rep 33, 108569 (2020)). TOP3Bcc signals were probed by anti-Flag antibody (mouse monoclonal, clone M2, Sigma) or anti-TOP3B antibody [rabbit monoclonal, (EP7779), Abeam], Loading controls were probed with anti-ds DNA antibody (ab27156, Abeam).
R-loop detection by slot blotting
[00255] Genomic DNA from HCT116 and HCT116-TOP3B-KO cells treated with DMSO or NSC690634 (100 μM, 4 h) were extracted using DRIP protocol as described (L. A. Sanz, F. Chedin, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing. Nat Protoc 14, 1734-1755 (2019)). Briefly, cells were lysed in TE buffer containing SDS and proteinase K (at 37°C overnight) before extraction with phenol/chloroform/isoamyl alcohol (25:24: 1) followed by ethanol precipitatation. Genomic DNA was resuspended in TE buffer and digested with a cocktail of restriction enzymes (Hindlll, SspI, EcoRI, BsrGI and Xbal; 30 U each), treated with RNase A (10 μg/mL) and shortcut RNase III (2 units; New England Biolabs) before purification again with phenol/chloroform/isoamyl alcohol (25:24: 1). Where indicated, 10 μg of genomic DNA was treated with 20 U of RNase H at 37°C for 3 hours. The resulting genomic DNA samples were spotted on a nitrocellulose membrane, crosslinked and blocked with PBS-Tween (0.1%) buffer containing 5% non-fat milk. The membrane was probed with mouse S9.6 antibody (1 :500 dilution, at 4°C overnight) and developed using standard electrochemiluminescence techniques. The same samples probed with anti-dsDNA antibodies served as loading controls.
Recombinant Human TOP3B Production
[00256] TOP3B was initially PCR amplified from Human TOP3B-Myc-flag cDNA ORF (CAT#: RC223204) using forward primer: 5 ' -
CGGGGTACCATGAAGACTGTGCTCATGG-3 ' (SEQ ID NO: 1) and reverse primer: 5 ' -CCGCTCGAGTCATACAAAGTAGGCGGCCAG-3 ' (SEQ ID NO:2) and cloned into Gateway entry vector pENTR3C (Invitrogen, CAT#: A10464). TOP3B was then subcloned by Gateway LR recombination (Thermo Fisher) into pDest-635 (22876-X01-635) for insect cell expression which includes anN-terminal His6 tag. Bacmid was prepared in DE77, aDHlOBac- derived strain (Bac-to-Bac system, Thermo Fisher) and after purification, bacmid DNA was verified by PCR amplification across the bacmid junctions. Bacmids were transfected in SF-9 cells using PEI (1 mg/ml with 5% glucose; Polysciences, CAT#: 23966), recombinant baculovirus stock was collected and titrated using ViroCyt (Beckamn). Two liters of Tni-FNL cells were set in a baffled 5-1 Thomson Optimum Growth Flask in GIBCO Express 5 medium with 18 mM glucose at a cell density of 1 x 106 cells/ml at 27°C and 24 hour later infected at a MOI (multiplicity of infection) of 3. After 3 days of incubation at 21 °C, cell pellets were collected by centrifugation at 2000 rpm for 11 min and flash frozen on dry ice. Cell pellet was thawed by the addition of 200 mL of lysis buffer (20 mM HEPES, 300 mM NaCl, 1 mM TCEP and 1 : 100 v/v of Sigma protease inhibitor P8849) and homogenized by vortexing. The cells were lysed by performing two passes on an M-110EH-30 microfluidizer (Microfluidics) at 7000 psi, clarified at 100K x g for 30 minutes at 4°C using an optima L-90K ultracentrifuge (Beckman), filtered (0.45 micron) and applied to a f20 mL IMAC HP column (GE Scientific) that was pre-equilibrated with lysis buffer containing 50 mM imidazole on a Bio-Rad NGC. Column was washed with lysis buffer containing 50 mM imidazole and proteins were eluted with lysis buffer containing 500 mM imidazole. After SDS-PAGE/Coomassie staining, positive fractions were pooled, dialyzed to 20 mM HEPES, 50 mM NaCl, 1 mM TCEP, 0.5 mM PMSF, 1 : 1000 v/v of PI, 50% glycerol, pH 7.2. Protein concentration was determined (0.88 mg/ml) and stored at -80°C for future use.
In vitro Biochemical Assay
[00257] The hairpin DNA oligo substrate with long 3 ' -tail: GGGATTATTGAACTGTTGTTCAAACTTTAGAACTAGCCATCCGATTTACACTTTG CCCCTATCCACCCC-3’FITC (SEQ ID NO:3) or the corresponding RNA oligo substrate: GGGAUUAUUGAACUGUUGUUCAAACUUUAGAACUAGCCAUCCGAUUUACACU UUGCCCCU-3’-Cy5 (SEQ ID NO:4) was synthesized by IDT (Integrated DNA Technologies, Coralville, Iowa). 75 nM of substrate was combined with 180 nM of purified recombinant TOP3B in buffer containing 100 mM potassium glutamate (pH 7.0), 3 mM MgCh, 0.02% v/v Tween-20, 1 mM DTT, with indicated drug compound or DMSO (10% v/v) and incubated at 30°C for 60 mins before addition of SDS (0.2%) to the samples to stop the reaction. The samples were resolved on 4-20% tris-glycine-SDS-PAGE and directedly visualized via the fluorescence of FITC or Cy5 on a typhoon scanner. [00258] Various aspects of the disclosure are provided by the following enumerated embodiments, which may be combined in any number and in any fashion not technically or logically inconsistent.
Embodiment 1. A method of reducing or inhibiting replication of an RNA virus in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 2. A method of damaging viral RNA in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 3. A method of stimulating anti -RNA viral activity in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 4. A method of treating an RNA viral infection in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more cyanine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more cyanine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 5. A method for treating a cancer in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 6. The method of embodiment 5, wherein the cancer is a cancer that expresses TOP3B.
Embodiment 7. The method of embodiment 6, wherein the cancer comprises ovarian cancer, endometrial cancer, liver cancer, breast cancer, thyroid cancer, prostate cancer, pancreatic cancer, stomach cancer, lung cancer, larynx cancer, colon cancer, esophageal cancer, uterine cancer, cervical cancer, gall bladder cancer, kidney cancer, urinary bladder cancer or malignant lymphoma.
Embodiment 8. A method of inducing cell death of a TOP3B-expressing cell in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 9. A method of reducing the number of TOP3B-expressing cells in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 10. A method of inhibiting TOP3B activity in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier. Embodiment 11. A method of poisoning TOP3B in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 12. A method of trapping TOP3B in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 13. A method of promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of one or more bisacridine compounds, pharmaceutically acceptable salts thereof, or a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier.
Embodiment 14. The method of any one of embodiments 1-4, wherein the RNA virus is a positive strand RNA virus.
Embodiment 15. The method of embodiment 14, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, Lenarviricota, or Pisuviricota.
Embodiment 16. The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota and class Alsuviriceles, Flasuviricetes, Magsaviricetes, or Tolucaviricetes.
Embodiment 17. The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, and order Hepelivirales, Martellivirales, or Tymovirales . Embodiment 18. The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Hepelivirales, and family Alphatetraviridae, Benyviridae, Hepeviridae or Matonaviridae .
Embodiment 19. The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles. order Marlellivirales, and family Bromoviridae, Closter oviridae, Endornaviridae, Kitaviridae, Mayoviridae, Togaviridae, or Virgaviridae .
Embodiment 20. The method of embodiment 17, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Alsuviriceles, order Tymovirales, and family Alphaflexiviridae, Betaflexiviridae, Deltaflexiviridae, Gammaflexiviridae, or Tymoviridae.
Embodiment 21. The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kiirinoviricoia, class Flasuviricetes, order Amarillovirales, family Flaviviridae, and genus Flavivirus, Hepacivirus, Pegivirus, or Pestivirus.
Embodiment 22. The method of embodiment 21, wherein the positive strand RNA virus is selected from phylum Kiirinoviricoia, class Flasuviricetes, order Amarillovirales, family Flaviviridae , and genus Flavivirus.
Embodiment 23. The method of embodiment 22, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Flasuviriceies, order Amarillovirales, family Flaviviridae, genus Flavivirus, and species Dengue virus, West Nile virus, Yellow Fever virus and Zika virus.
Embodiment 24. The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Magsaviricetes, order Nodamuvirales, and family Nodaviridae or Sinhaliviridae .
Embodiment 25. The method of embodiment 16, wherein the positive strand RNA virus is selected from phylum Kitrinoviricota, class Tolucaviricetes, order Tolivirales, and family Carmotetraviridae or Tombusviridae . Embodiment 26. The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Lenarviricota and class Amabiliviricetes, Howeltoviricetes, Leviviricetes, or Miaviricetes.
Embodiment The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Amabiliviricetes, order Wolframvirales, and family Narnaviridae .
Embodiment 28. The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Howeltoviricetes, order Cryppavirales, and family Mitoviridae.
Embodiment 29. The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, and order Norzivirales or Timlovirales.
Embodiment 30. The method of embodiment 29, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Norzivirales, and family Atkinsviridae, Duinviridae, Fiersviridae, or Solspiviridae .
Embodiment 31. The method of embodiment 29, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Leviviricetes, order Timlovirales, and family Blumeviridae or Steitzviridae .
Embodiment 32. The method of embodiment 26, wherein the positive strand RNA virus is selected from phylum Lenarviricota, class Miaviricetes, order Ourlivirales, and family Botourmiaviridae .
Embodiment 33. The method of embodiment 15, wherein the positive strand RNA virus is selected from phylum Pisuviricota and class Duplopiviricetes, Pisoniviricetes, or Stelpaviricetes. Embodiment 34. The method of embodiment 33, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Duplopiviricetes, order Durnavirales, and family Amalgaviridae , Curvulaviridae, Fusariviridae, Hypoviridae, Partitiviridae or Picobirnaviridae .
Embodiment 35. The method of embodiment 33, wherein the positive strand RNA virus is selected from phylum Pisiiviricola, class Pisoniviriceies, and order Nidovirales, Picornavirales, or Sobelivirales .
Embodiment 36. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Abnidovirineae and family Abyssoviridae .
Embodiment 37. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies. order Nidovirales, suborder Arnidovirineae and family Arteriviridae , Cremegaviridae, Gresnaviridae or Olifoviridae .
Embodiment 38. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceies, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, and subfamily I.elovirinae, Orthocoronavirinae or Pitovirinae .
Embodiment 39. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola, class Pisoniviriceies, order Nidovirales, suborder Cornidovirineae, family Coronaviridae, subfamily Orthocoronavirinae and genus Alphacoronavirus, Betacoronavirus, Deltacoronavirus or Gammacoronavirus.
Embodiment 40. The method of embodiment 39, wherein the genus is Alphacoronavirus .
Embodiment 41. The method of embodiment 40, wherein the genus is Alphacoronavirus and species is Alphacoronavirus 1 (TGEV, Feline coronavirus, Canine coronavirus), Human coronavirus 229E, Human coronavirus NL63, Miniopterus bat coronavirus 1, Miniopterus bat coronavirus HKU8, Porcine epidemic diarrhea virus, Rhinolophus bat coronavirus HKU2, or Scotophilus bat coronavirus 512.
Embodiment 42. The method of embodiment 39, wherein the genus is Betacoronavirus .
Embodiment 43. The method of embodiment 42, wherein the genus is Betacoronavirus and species is Betacoronavirus 1 (Bovine Coronavirus, Human coronavirus OC43), Human coronavirus HKU1, Middle East respiratory syndrome-related coronavirus, Pipistrellus bat coronavirus HKU5, Rousettus bat coronavirus HKU9, Severe acute respiratory syndrome-related coronavirus (SARS-CoV, SARS-CoV-2), or Tylonycteris bat coronavirus HKU4.
Embodiment 44. The method of embodiment 39, wherein the genus is Deltacoronavirus.
Embodiment 45. The method of embodiment 39, wherein the genus is Gammacoronavirus .
Embodiment 46. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Mesnidovirineae , and family Medioniviridae or Mesoniviridae .
Embodiment 47. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Monidovirineae. and family Mononiviridae .
Embodiment 48. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Nanidovirineae , and family Nanghoshaviridae or Nanhypoviridae .
Embodiment 49. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricola. class Pisoniviriceles. order Nidovirales, suborder Ronidovirineae. and family Euroniviridae or Roniviridae . Embodiment 50. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisuviricota, class Pisoniviricetes, order Nidovirales, suborder Tornidovirineae , and family Tobaniviridae .
Embodiment 51. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviricetes, order Picornavirales, and family Caliciviridae, Dicistr oviridae, Iflaviridae, Marnaviridae , Picornaviridae, Polycipiviridae, Secoviridae or Solinviviridae .
Embodiment 52. The method of embodiment 35, wherein the positive strand RNA virus is selected from phylum Pisiiviricola. class Pisoniviriceles. order Sobelivirales. and family Alvernaviridae. Barnaviridae or Solemoviridae.
Embodiment 53. The method of embodiment 14, wherein the positive strand RNA virus is Zika virus, West Nile virus, Dengue Fever virus, or a coronavirus.
Embodiment 54. The method of embodiment 53, wherein the coronavirus is selected from the group consisting of Middle East respiratory syndrome-related (MERS -related) coronavirus and Severe acute respiratory syndrome-related (SARS -related) coronavirus.
Embodiment 55. The method of embodiment 54, wherein the SARS-related coronavirus is SARS-CoV or SARS-CoV-2.
Embodiment 56. The method of any one of embodiments 1-55, wherein the one or more bisacridine compounds is represented by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII
(Formula I);
Figure imgf000069_0001
;
Figure imgf000070_0001
;
Figure imgf000071_0001
(Formula VII) wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and for Formula I:
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group; X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker - A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety; and for Formula II:
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RE are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3;
R are each independently H, or C1-6 alkyl; and for Formula III to Formula VI:
R are each independently H, or C1-6 alkyl.
Embodiment 57. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula I
Figure imgf000073_0001
(Formula I); wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker - A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 58. The method of embodiment 57, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A- (CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 59. The method of embodiment 58, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-3 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an C1-C3 alkyl group, or (CO)-G, where
G is H or an C1-C3 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A- (CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 60. The method of embodiment 59, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent;
Y is absent or CH2; and
Y’ is absent or CH2; n is each independently an integer between 0-3, with the proviso that both ns on - (CH2Y)n-X-(Y’CH2)n- cannot be 0;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A- (CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety. Embodiment 61. The method of embodiment 60, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent;
Y is absent or CH2; and
Y’ is absent or CH2; n is each independently an integer between 0-3, with the proviso that both ns on - (CH2Y)n-X-(Y’CH2)n- cannot be 0;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A- (CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 62. The method of embodiment 61, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl;
B is -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group; n is 0-1;
A is absent or (CH2)W, and A' is absent or (CH2)W, where w is 1, 2 or 3; and D is absent; all with the proviso that the total length of linker -A-(CH2-CH2-D)n-A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 63. The method of embodiment 62, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH;
Z and Z’ are NRD;
RDis H;
B is -A-(CH2-CH2-D)n-A’-; n is 0-1;
A is absent or (CH2)W ; and
A' is absent or (CH2)W, where w is 1, 2 or 3; and
D is absent; all with the proviso that the total length of linker -A-(CH2-CH2-D)n-A’- is between 1 and 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety.
Embodiment 64. The method of embodiment 63, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH;
Z and Z’ are NRD;
RDis H;
B is -A-(CH2-CH2-D)n-A’-; n is 0;
A is absent; and
A' is (CH2)W, where w is 1, 2, 3 or 4; and D is absent.
Embodiment 65. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula II
Figure imgf000079_0001
(Formula II); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3; and
R are each independently H, or C1-6 alkyl. Embodiment 66. The method of embodiment 65, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R )2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3; and
R are each independently H, or C1-6 alkyl.
Embodiment 67. The method of embodiment 66, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RF)2, NRD, O, or S(O)0-2;
RD are independently H, C1-3 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl;
RF is H, an C1-C3 alkyl group, or (CO)-G, where
G is H or an C1-C3 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3; and R are each independently H, or C1-6 alkyl.
Embodiment 68. The method of embodiment 67, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and
R are each independently H, or C1-3 alkyl.
Embodiment 69. The method of embodiment 68, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and
R are each independently H, or C1-3 alkyl.
Embodiment 70. The method of embodiment 67, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
Z and Z’ are NRD;
RD are independently H, or C1-3 alkyl; n is 0, 1, 2, or 3; and
R are each independently H, or C1-3 alkyl.
Embodiment 71. The method of embodiment 67, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; Z and Z’ are NRD;
RDis H; n is 0, 1, 2, or 3; and
R are each independently H, or C1-3 alkyl.
Embodiment 72. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula III
Figure imgf000082_0001
(Formula III); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3.7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3.7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3.7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 73. The method of embodiment 72, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SCUR0, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 74. The method of embodiment 73, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 75. The method of embodiment 74, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 76. The method of embodiment 75, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 77. The method of embodiment 76, wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl.
Embodiment 78. The method of embodiment 77, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl.
Embodiment The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula IV
Figure imgf000084_0001
(Formula IV); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. Embodiment 80. The method of embodiment 79, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R )2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 81. The method of embodiment 80, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 82. The method of embodiment 81, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 83. The method of embodiment 82, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH; R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 84. The method of embodiment 83, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl.
Embodiment 85. The method of embodiment 84, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl.
Embodiment 86. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula V
(Formula V);
Figure imgf000086_0001
wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; R” is C1-6 alkyl, C3.7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R are each independently H, or C1-6 alkyl.
Embodiment 87. The method of embodiment 86, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R )2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 88. The method of embodiment 87, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 89. The method of embodiment 88, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 90. The method of embodiment 89, wherein R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 91. The method of embodiment 90, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl.
Embodiment 92. The method of embodiment 91, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl.
Embodiment 93. The method of embodiment 86, wherein the one or more bisacridine compounds of Formula V is .
Figure imgf000088_0001
Embodiment 94. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula VI
Figure imgf000089_0001
(Formula VI); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 95. The method of embodiment 94, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. Embodiment 96. The method of embodiment 95, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 97. The method of embodiment 96, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 98. The method of embodiment 97, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 99. The method of embodiment 98, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl.
Embodiment 100. The method of embodiment 99, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl. Embodiment 101. The method of embodiment 56, wherein the one or more bisacridine compounds is represented by Formula VII
Figure imgf000091_0001
(Formula VII); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3.7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3.7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3.7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 102. The method of embodiment 101, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R )2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R are each independently H, or C1-6 alkyl.
Embodiment 103. The method of embodiment 102, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’;
R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
Embodiment 104. The method of embodiment 103, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 105. The method of embodiment 104, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 106. The method of embodiment 105, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl.
Embodiment 107. The method of embodiment 106, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and R are each independently H, or C1-3 alkyl.
Embodiment 108. A compound of Formula III through Formula VII or a pharmaceutically acceptable salt thereof: ;
Figure imgf000093_0001
Figure imgf000094_0001
(Formula VII); wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl.
Embodiment 109. The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl.
Embodiment 110. The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl.
Embodiment 111. The compound or pharmaceutically acceptable salt thereof of embodiment 108, wherein the one or more bisacridine compounds is )
Figure imgf000094_0002
Embodiment 112. A pharmaceutical composition for use in a method according to any one of embodiments 1 to 111, the pharmaceutical composition comprising a bisacridine compound (e.g., as described in any of embodiments 56 to 111) and a pharmaceutically acceptable carrier.
Embodiment 113. The pharmaceutical composition of embodiment 112, wherein the bisacridine compound is NSC690634.
Embodiment 114. The pharmaceutical composition of either embodiment 112 or embodiment 113, wherein the pharmaceutical composition is suitable for administration via injection.
Embodiment 115. The pharmaceutical composition of either embodiment 112 or embodiment 113, wherein the pharmaceutical composition is suitable for oral administration, or intranasal administration.
Embodiment 116. The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a day.
Embodiment 117. The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a week.
Embodiment 118. The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a month.
Embodiment 119. The method of any one of embodiments 1 to 107, wherein the bisacridine compound is administered at least once a year.
[00259] Having described the invention in detail and by reference to specific embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. More specifically, although some aspects of the present invention are identified herein as particularly advantageous, it is contemplated that the present invention is not necessarily limited to these particular aspects of the invention.

Claims

What is claimed is:
1. A method of reducing or inhibiting replication of an RNA virus, damaging viral RNA, stimulating anti -RNA viral activity, and/or treating an RNA viral infection in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more bisacridine compounds or pharmaceutically acceptable salts thereof.
2. The method of claim 1, wherein the RNA virus is a positive strand RNA virus.
3. The method of claim 2, wherein the positive strand virus comprises one or more of a coronavirus, a SARS coronavirus, a SARS-CoV-2 coronavirus, a MERS coronavirus, a hepatitis C virus, a Zika virus, a West Nile virus, a Dengue virus, a Yellow fever virus, a Japanese encephalitis virus, an enterovirus, or a rhinovirus.
4. A method for treating a cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more bisacridine compounds or pharmaceutically acceptable salts thereof.
5. The method of claim 4, wherein the cancer is a cancer that expresses TOP3B.
6. The method of claim 4, wherein the cancer comprises colon cancer, breast cancer, ovarian cancer, lung cancer, endometrial cancer, liver cancer, thyroid cancer, prostate cancer, pancreatic cancer, stomach cancer, larynx cancer, esophageal cancer, uterine cancer, cervical cancer, gall bladder cancer, kidney cancer, urinary bladder cancer or malignant lymphoma.
7. A method of inducing cell death of a TOP3B-expressing cell, reducing the number of TOP3B-expressing cells, inhibiting TOP3B activity, poisoning TOP3B, trapping TOP3B, and/or promoting the formation of TOP3B cleavage complexes (TOP3Bccs) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of one or more bisacridine compounds or pharmaceutically acceptable salts thereof. The method of any one of claims 1 to 7, wherein the one or more bisacridine compounds or pharmaceutically acceptable salts thereof is administered in the form of a pharmaceutical composition comprising the one or more bisacridine compounds or pharmaceutically acceptable salts thereof together with a pharmaceutically acceptable carrier. The method of any one of claims 1 to 8, wherein the one or more bisacridine compounds is represented by Formula I, Formula II, Formula III, Formula IV, Formula V, Formula VI or Formula VII
Figure imgf000098_0001
; ;
Figure imgf000099_0001
wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and for Formula I:
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker - A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety; and for Formula II:
Z and Z’ are each independently C(RF)2, NRD, O, or S(O)0-2; RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RE are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3;
R are each independently H, or C1-6 alkyl; and for Formula III to Formula VI:
R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula V
Figure imgf000101_0001
(Formula V); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula I
Figure imgf000102_0001
(Formula I); wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker - A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety. method of claim 11, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, aryl-C0-4 alkyl, -C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker -A- (CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula II
(Formula II);
Figure imgf000104_0001
wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3; and
R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula III
(Formula III);
Figure imgf000105_0001
wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula IV
Figure imgf000106_0001
(Formula IV); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula VI
Figure imgf000107_0001
(Formula VI); wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. The method of claim 9, wherein the one or more bisacridine compounds is represented by Formula VII
(Formula VII);
Figure imgf000107_0002
wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl. The bisacridine compound represented by Formula I, Formula II, Formula III, Formula
IV, Formula V, Formula VI or Formula VII
Figure imgf000108_0001
; ;
Figure imgf000109_0001
wherein:
R1, R2, R3, R4, R5, R6, R7, R8, R1', R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), optionally substituted C1-C6 alkyl, optionally substituted O-C1-C6 alkyl, optionally substituted C1-C7acyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1- C6 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R’)2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7 acyl group or an optionally substituted C2-C7(CO2)R’;
R’ is H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and for Formula I:
Z and Z’ are each independently C(RE)2, NRD, O, or S(O)0-2;
RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RF are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
B is - (CH2 Y)n- X- (Y’ CH2)n- , or -A-(CH2-CH2-D)n-A’-; wherein, one or more of the CH2 groups in B is optionally substituted with a C1- C3 alkyl or C1-C3 alkoxy group;
X is absent, (CH2)k O, S or N — RF; where k is 1, 2, or 3;
Y is absent, CH2, O, CH2O or N — RF; and
Y’ is absent CH2, O, OCH2 or N — RF, with the proviso that when one or more of X, Y and Y’ is present, each of X and Y, X and Y’ or Y and Y’, when present, forms a covalent bond;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is each independently an integer between 0-3, wherein when n is 0, X is (CH2)W where w is at least 1;
A is absent or (CH2)W, and A' is (CH2)W, where w is 1, 2 or 3 the CH2 groups in A or A' are optionally substituted with a C1-C3 alkyl group or C1-C3 hydroxyalkyl;
D is absent, O or N — Rz, where Rz is H or an optionally substituted C1-C3 alkyl group; all with the proviso that the total length of linker -(CH2Y)n-X-(Y’CH2)n- or linker - A-(CH2-CH2-D)n-A’- does not exceed 4 atoms in length between Z and Z’ or 6 atoms in length including Z and Z’ as counted by the shortest route between Z and Z’ or from position C9 on a first acridine moiety to position C9 on a second acridine moiety, attached to the first acridine moiety; and for Formula II:
Z and Z’ are each independently C(RF)2, NRD, O, or S(O)0-2; RD are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl, aryl-C0-4 alkyl, - C(O)CF3, -C(O)RF, or -SO2RF;
RE are independently H, C1-6 alkyl, C3-7 cycloalkyl-C0-4 alkyl or aryl-C0-4 alkyl;
RF is H, an optionally substituted C1-C6 alkyl group, or (CO)-G, where
G is H or an optionally substituted C1-C6 alkyl, C2-C6 alkenyl or C2-C6 alkynyl group; n is 0, 1, 2, or 3;
R are each independently H, or C1-6 alkyl; and for Formula III to Formula VI:
R are each independently H, or C1-6 alkyl.
A pharmaceutical composition for use in a method according to any one of claims 1 to 8, the pharmaceutical composition comprising a bisacridine compound according to any one of claims 9-18 and a pharmaceutically acceptable carrier.
The method, compound, or pharmaceutical composition of any of claims 9-19, wherein for the bisacridine compound:
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C6 alkyl, O-C1-C6 alkyl, C1- C7 acyl, C1-C6 alkyl-NR’2, C1-C6 alkyl-OR’, C1-C6 alkyl-ONR’2, CF3, N(R’)2, NR’ COR’, NR’CONR’R’, NR’CO2R”, NR’ SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’, SO2N(R )2, SO3Rs or SO4RC, where Rs is H or an optionally substituted C1-C6 alkyl; and Rc is H, an optionally substituted C1-C6 alkyl, an optionally substituted C1-C7acyl group or an optionally substituted C2- C7(CO2)R’;
R’ is H, C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-6 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and
R are each independently H, or C1-6 alkyl.
The method of claim 20, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, C1- C3 alkyl-NR’2, C1-C3 alkyl-OR’, C1-C3 alkyl-ONR’2, CF3, N(R’)2, NR’COR’, NR’CONR’R’, NR’CO2R”, NR’SO2R”, CN, NO2, OH, COOH, C1-C6 OOR’; R’ is H, C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl;
R” is C1-3 alkyl, C1-C7acyl, or aryl-C0-4 alkyl; and R are each independently H, or C1-6 alkyl. e method of claim 21, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, COOH, C2-C6 OOR’;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl. e method of claim 22, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, N(R’)2, CN, NO2, OH, or COOH;
R’ is H, C1-3 alkyl; and
R are each independently H, or C1-3 alkyl. e method of claim 23, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, halogen (F, Cl, Br or I), C1-C3 alkyl, O-C1-C3 alkyl, CF3, NO2, OH, or COOH;
R are each independently H, or C1-3 alkyl. e method of claim 24, wherein
R1, R2, R3, R4, R5, R6, R7, R8, R1 , R2 , R3 , R4 , R5 , R6 , R7 and R8 are each independently H, Cl, C1-C3 alkyl, O-C1-C3 alkyl, NO2, OH, or COOH; and
R are each independently H, or C1-3 alkyl. The method, compound, or pharmaceutical composition of any of claims 1-25, wherein the bisacridine compound is NSC690634.
PCT/US2023/082186 2022-12-02 2023-12-01 Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines WO2024119148A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263429923P 2022-12-02 2022-12-02
US63/429,923 2022-12-02

Publications (1)

Publication Number Publication Date
WO2024119148A1 true WO2024119148A1 (en) 2024-06-06

Family

ID=91325035

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/082186 WO2024119148A1 (en) 2022-12-02 2023-12-01 Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines

Country Status (1)

Country Link
WO (1) WO2024119148A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010031763A1 (en) * 1997-01-08 2001-10-18 Smithkline Beecham Corporation Substituted bis-acridines and related compounds as CCR5 receptor ligands, anti-inflammatory agents and anti-viral agents
US20190015422A1 (en) * 2016-01-26 2019-01-17 Dana-Farber Cancer Institute, Inc. METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-P13K AND ANTI-mTOR AGENTS

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010031763A1 (en) * 1997-01-08 2001-10-18 Smithkline Beecham Corporation Substituted bis-acridines and related compounds as CCR5 receptor ligands, anti-inflammatory agents and anti-viral agents
US20190015422A1 (en) * 2016-01-26 2019-01-17 Dana-Farber Cancer Institute, Inc. METHODS FOR TREATING BRAIN METASTASES USING COMBINATIONS OF ANTI-P13K AND ANTI-mTOR AGENTS

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBCHEM 19 December 2011 (2011-12-19), ANONYMOUS: "1, N,N'-di-9-acridinyl-", XP009557234, Database accession no. 129915 *
DATABASE PUBCHEM 25 January 2017 (2017-01-25), ANONYMOUS: "SID 129195220", XP009557235, Database accession no. 129195220 *
S A LYAKHOV , Y I SUVEYZDIS, L A LITVINOVA, S A ANDRONATI, S L RYBALKO, S T DYADYUN: "Biological active acridine derivatives. Part 4: Synthesis and antiviral activity of some bis-acridinylated diamides", PHARMAZIE, GOVI VERLAG PHARMAZEUTISCHER VERLAG GMBH, DE, vol. 55, no. 10, 1 October 2000 (2000-10-01), DE , pages 733 - 736, XP009555360, ISSN: 0031-7144 *

Similar Documents

Publication Publication Date Title
JP6106149B2 (en) Novel Stat3 pathway inhibitor and cancer stem cell inhibitor
EP2846794B1 (en) BICYCLIC SULFONE COMPOUNDS FOR INHIBITION OF RORgamma ACTIVITY AND THE TREATMENT OF DISEASE
AU2007238676A1 (en) Use of biarylcarboxamides in the treatment of hedgehog pathway-related disorders
CN102984941A (en) Compositions and methods for treatment of leukemia
US8119640B2 (en) Hedgehog pathway antagonists methods of use
EP2879675B1 (en) Compounds and methods for targeting hsp90
Shaik et al. Design and synthesis of 1, 2, 3-triazolo linked benzo [d] imidazo [2, 1-b] thiazole conjugates as tubulin polymerization inhibitors
EP3703684A1 (en) Small molecule inhibitors of cancer stem cells and mesenchymal cancer types
WO2024008129A1 (en) Compound as kat6 inhibitor
CN117545749A (en) Protein degradation agent
CN104910069B (en) Anthranilic acid analog derivative, its preparation method and its purposes in medicine
WO2020221272A1 (en) Indole macrocyclic derivative, preparation method therefor and use thereof in medicine
EP4074314A1 (en) Isoquinoline derivatives for use as antiviral and antitumour agents
WO2021160012A1 (en) Small molecular compound specifically degrading tau protein and use thereof
WO2024119148A1 (en) Topoisomerase iii (top3) inhibitors and antiviral compounds based on bisacridines
US20240150301A1 (en) Methods of modulating androgen receptor condensates
WO2011146101A1 (en) Chemical agents for the prevention or inhibition of tumor metastasis
WO2016109471A1 (en) Bufalin phosphate prodrugs and methods of use thereof
WO2024118805A1 (en) Topoisomerase iii (top3) inhibitors and antiviral compounds based on cyanines
Andreeva et al. Thiadiazole-, selenadiazole-and triazole-fused anthraquinones as G-quadruplex targeting anticancer compounds
WO2018017589A1 (en) Compounds for targeting cancer stem cells
TWI689503B (en) Ebna1 specific compound based on zinc binder
WO2023232143A1 (en) Phosphorus compound and use thereof
JP4793830B2 (en) Homopiperazine compounds that bind to the RNA pseudoknot structure of SARS coronavirus and suppress ribosome frameshifts
EP3774770B1 (en) Novel hydrazone derivatives for preventing or treating ebv-related cancers

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23899039

Country of ref document: EP

Kind code of ref document: A1