WO2024118776A1 - Matériaux et procédés de sélection d'aptamères - Google Patents

Matériaux et procédés de sélection d'aptamères Download PDF

Info

Publication number
WO2024118776A1
WO2024118776A1 PCT/US2023/081604 US2023081604W WO2024118776A1 WO 2024118776 A1 WO2024118776 A1 WO 2024118776A1 US 2023081604 W US2023081604 W US 2023081604W WO 2024118776 A1 WO2024118776 A1 WO 2024118776A1
Authority
WO
WIPO (PCT)
Prior art keywords
aptamer
target
hydrogel
peg
aptamers
Prior art date
Application number
PCT/US2023/081604
Other languages
English (en)
Inventor
Yong Wang
Naveen Singh
Original Assignee
The Penn State Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Penn State Research Foundation filed Critical The Penn State Research Foundation
Publication of WO2024118776A1 publication Critical patent/WO2024118776A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2458/00—Labels used in chemical analysis of biological material
    • G01N2458/10—Oligonucleotides as tagging agents for labelling antibodies

Definitions

  • Nucleic acid aptamers are single- stranded oligonucleotides screened from DNA/RNA libraries with high affinities and specificities against target molecules. They are known as “chemical antibodies”. Simply speaking, aptamers can be used in many, if not all, applications where antibodies have been used. These areas include but are not limited to cancer therapy, regenerative medicine, molecular biosensing, cell surface engineering, drug or nanoparticle delivery, detoxification, anti-inflammation, and anti -coagulation. Aptamers possess many desirable characteristics, including high binding affinity, high binding specificity, tolerance of harsh conditions, low immunogenicity or toxicity, low batch-to-batch variation, and/or ease of synthesis.
  • aptamers can possess many advantages over antibodies.
  • aptamer have a high tolerance to harsh thermal, physical, and chemical conditions. By contrast, antibodies can easily lose bioactivity under harsh conditions.
  • aptamers have little immunogenicity or toxicity in comparison to many ligands or biomolecules including antibodies because they are not only composed of nucleotides but also small in size (usually about 20 to 30 nucleotides long).
  • aptamers are synthesized with a standard chemical procedure without batch-to-batch variation. Antibody production has to be accomplished in cells or live animals. Therefore, aptamers have been widely studied as “chemical antibodies” for various applications.
  • aptamer selection was initially developed in 1990. The selection involves incubation, partition, and amplification in each cycle. The theoretical calculation suggests that one cycle of selection can enrich the library by one to two orders of magnitude even if the selection runs smoothly. Because the initial library contains ⁇ 10 14 molecules to ensure rigorous selection, multiple cycles of selection are required to reduce the number of aptamer candidates. It generally takes 12 to 15 cycles for selecting an aptamer. Despite its iterative and time-consuming cycles, the selection often fails. One of the important factors is selection biases caused by PCR bias, non-specific sequence amplification, and the removal of high- affinity sequences. Resultantly, low-affinity or nonspecific candidates may have an overwhelmingly higher number in the final enriched aptamer library compared to high-affinity ones.
  • the first category involves aptamer-target immobilization on the surface of a substrate. Most methods belong to this category, including filter membrane selection, plate surface selection, microbead surface selection, microarray surface selection, etc.
  • Molecular binding is determined by both association and dissociation. As the selection is carried out on the surface, it is inevitable to lose high-affinity candidates once they are dissociated from the surface during the washing and enrichment step.
  • Another major concern is the nonspecific binding of sequences to the substrate regardless of whether aptamer-target complexes are physically or chemically immobilized on the surface. As the nonspecific binding is random, the enrichment of nonspecific sequences is significant despite negative selection.
  • the second category is based on the motion of aptamers, targets, and their complexes. Under electrical fields, their mobility shifts are different due to their different sizes, charges, and molecular weights. However, the use of specific electrolyte buffers and electrical fields can change the functional structures of proteins and aptamer candidates. The nonspecific binding of candidates to substrates is also problematic. Thus, these methods still require multiple cycles of selection and are rarely used for aptamer selection. It is also important to note that many methods require specific expertise or instruments (e.g., flow cytometer and capillary electrophoresis system) for separating candidate sequences.
  • specific expertise or instruments e.g., flow cytometer and capillary electrophoresis system
  • compositions and methods disclosed herein address these and other needs.
  • aptamer-target complexes can include an aptamer; and a target.
  • the target can be conjugated to a porous hydrogel.
  • the aptamer can selectively associate with the target.
  • the aptamer can exhibit an affinity constant (K a ) of greater than about 10 5 M 1 with the target, such as greater than about 10 6 M ' , greater than about 10 7 M -1 , greater than about 10 8 M -1 , greater than about 10 9 M -1 , greater than about IO 10 M -1 , greater than about 10 11 M -1 , or greater than about 10 12 M -1 .
  • the aptamers identified using the methods described herein can be used to develop biomaterials for regenerative medicine or immunotherapy applications.
  • FIG. 1 shows an illustration of hydrogel-based aptamer selection (HAS).
  • Target molecules are immobilized in the macroporous hydrogel.
  • HAS hydrogel-based aptamer selection
  • FIGs. 2A-2C show the process validation. Comparison between modeling analysis and experimental measurement.
  • the arrow indicates the increase of binding affinity (from lOpM to IpM, lOOnM, lOnM, and InM).
  • 2B Fluorescence images of porous hydrogels conjugated with thrombin. FAM-labeled DNA 60-18 aptamer; Cy5 labeled- control aptamer.
  • FIGs. 3A-3H shows hydrogel characterization and aptamer selection.
  • (3E) Examination of hydrogel swelling (n 6).
  • (3G) Examination of conjugation efficiency. The initial amount of protein loaded into the hydrogel for conjugation is defined as 100% (n 3).
  • FIGs. 4A-4B show the retention kinetics of aptamer library in native PEG hydrogels and PEG hydrogels functionalized with protein targets.
  • (4A) shows polyacrylamide gel electrophoresis images of PCR amplified product of diffused aptamer library (ssDNA) from hydrogel-protein (IL10, IL12 and Thrombin) and hydrogel as control at different time intervals (h).
  • (4B) Retention kinetics profile, release of ssDNA of aptamer library from protein-hydrogel (IL10, IL12 and Thrombin) and hydrogel (PEG) as control.
  • FIGs. 5A-5C show the characterization of HAS enriched library.
  • FIGs. 6 show the workflow for next generation sequencing (NGS) data analysis and docking for IL10, IL12 and thrombin aptamer selection.
  • NGS data analysis pipeline data analysis was performed with GALXY online tools (https://usegalaxy.org/). Totally, 178,233 NGS reads were acquired. After processing, 5,905 sequences (6,489 reads) were obtained. The top 50 sequences represented a total of 300 reads (4.63% of the 6,489 reads).
  • FIGs. 7A-7C show the SPR signals of aptamer candidates for IL10.
  • X indicates the number of aptamer candidates.
  • the SPR experiments were performed over three individual SPR chips.
  • FIGs. 8A-8B show the SPR signals of aptamer candidates for mIL12 (8A) and thrombin (T) (8B). The aptamer candidates were selected with one-round HAS selection.
  • FIGs. 9A-9D show binding analysis of T.7 aptamers with SPR.
  • (9C) Comparison of different aptamers including truncated T.7 aptamers, aptamer library, and two previously reported aptamers (29mer and 15mer) using SPR (n 2). The SPR signals were normalized by molecular weight of each aptamer. The numbers in the parenthesis show the length of each aptamer sequence.
  • FIGs. 10A-10B show binding analysis of mIL12 aptamer using SPR.
  • FIGs. 11A-11D show binding analysis of IL-10 aptamers using SPR.
  • FIG. 12 shows the final selected aptamer sequences with respective secondary structure and measured Kd values of selected aptamers.
  • FIG. 13A-13C show biosensing demonstration of selected aptamer and specificity.
  • T.7 Schematic illustration of antisense displacement assay with thrombin (T.7) aptamer.
  • 13B Calibration curve of T (thrombin) in 1 x PBS buffer.
  • 13C Examination of aptamer specificity against various analogous proteins at 100 nM concentration (TGF- ⁇ : tumor necrosis factor; IFN- X: Interferon gamma; Interleukin 7, Interleukin 6, HSA: human serum albumin).
  • FIG. 14A-14E shows selection and characterization of aptamers for GM-CSF, IL-12, IL- 10, and BDNF.
  • 14A Gel electrophoresis images of the aptamer library released at different time points during the process of aptamer selection.
  • 14B Electrophoretic mobility shift assay (EMSA) for comparing the initial aptamer library and enriched aptamer pools in binding to target proteins.
  • HAS enriched aptamer pool acquired after one-step HAS; LIB: initial aptamer library.
  • 14E Secondary structures of the representative selected aptamers.
  • Fig. 15A-15B Numerical simulation of aptamer diffusion.
  • FIG. 16A-16B Rheological characterization of the porous PEG hydrogel.
  • FIG. 17A-17C (17A) Gel electrophoresis mobility shift analysis of the enriched aptamer pool and the initial library in binding to thrombin. LIB+T: thrombin mixed with the library; HAS+T: thrombin mixed with the enriched aptamer pool acquired after one-step HAS. This experiment has been done in triplicate with similar results.
  • HAS enriched pool
  • LIB initial aptamer library
  • FIG. 18 Comparison between the initial aptamer library and the enriched aptamer pools.
  • the enriched aptamer pools were acquired by using three hydrogels conjugated with 0.01 pg (O.Olx), 0.1 pg (O.lx) and 1 pg (lx) thrombin.
  • the pools were eluted from the hydrogels at 60 hours.
  • the samples were analyzed under the same conditions.
  • the profiles show the timedependent association and dissociation. The data suggest that when the protein density is low enough, the conjugated proteins will not be able to retain enough desired aptamer candidates.
  • FIG. 19 Cladogram of aptamer candidates analyzed via Clustal Omega. Each family is represented by a blue column. In the cladogram, the first number represents the sequence ID followed by the output of a Multiple Sequence Alignment (MSA) index. It corresponds to the evolutionary distance between sequences as defined by their "length”. The sequence highlighted in yellow were selected for further analysis based on the maximum MSA score and Gibbs energy.
  • MSA Multiple Sequence Alignment
  • FIG. 20A-20B Examination and comparison of truncated aptamers.
  • FIG. 21 A-21D shows selection and characterization of aptamers for GM-CSF, and BDNF.
  • the terms “comprise” (as well as forms, derivatives, or variations thereof, such as “comprising” and “comprises”) and “include” (as well as forms, derivatives, or variations thereof, such as “including” and “includes”) are inclusive (i.e., open-ended) and do not exclude additional elements or steps.
  • the terms “comprise” and/or “comprising,” when used in this specification specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.
  • Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. By “about” is meant within 5% of the value, e.g., within 4, 3, 2, or 1% of the value. When such a range is expressed, another aspect includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself.
  • a range may be construed to include the start and the end of the range.
  • a range of 10% to 20% i.e., range of 10%-20%) can includes 10% and also includes 20%, and includes percentages in between 10% and 20%, unless explicitly stated otherwise herein.
  • the terms “may,” “optionally,” and “may optionally” are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur.
  • the statement that a formulation "may include an excipient” is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient.
  • ribonucleic acid and “RNA” as used herein mean a polymer composed of ribonucleotides.
  • deoxyribonucleic acid and “DNA” as used herein mean a polymer composed of deoxyribonucleotides.
  • nucleic acid As used herein, “nucleic acid,” “oligonucleotide,” and “polynucleotide” are used interchangeably to refer to a polymer of nucleotides of any length, and such nucleotides may include deoxyribonucleotides, ribonucleotides, and/or analogs or chemically modified deoxyribonucleotides or ribonucleotides.
  • polynucleotide oligonucleotide
  • nucleic acid include double- or single-stranded molecules as well as triple-helical molecules.
  • the polynucleotide sequence may be modified, for example, to enhance efficacy and/or to reduce immune responsivity, by using, for example, base modifications or end-capping.
  • an unmodified polynucleotide sequence is used.
  • the polynucleotide can be an RNA sequence or a DNA sequence.
  • the mRNA can include an optimized codon. By codon optimizing, the formation of secondary structures can be reduced and translational efficiency improved.
  • the codon optimization includes GC enrichment of the coding region.
  • the codon optimization includes codon quality enrichment of the coding region.
  • the mRNA can include one or more regions or parts, which act or function as an untranslated region (UTRs) of a gene.
  • UTRs are transcribed but not translated.
  • the 5' UTR starts at the transcription start site and continues to the start codon but does not include the start codon.
  • the 3’ UTR starts immediately following the stop codon and continues until the transcriptional termination signal.
  • the use of human-derived UTRs may facilitate the expression of the polypeptide in cells.
  • the polynucleotide comprises at least one chemically modified nucleotide.
  • the at least one chemically modified nucleotide comprises a chemically modified nucleobase, a chemically modified ribose, a chemically modified phosphodiester linkage, or a combination thereof.
  • the polynucleotide sequence as used comprise modified nucleosides such as 5-methylcystonsine or psudouridine.
  • modified refers to a changed state or structure of a molecule of the invention. Molecules may be modified in many ways including chemically, structurally, and functionally.
  • the polynucleotides of the present invention are “chemically modified” by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and C. Modifications of the nucleosides and/or nucleotides as used in the present invention may be naturally occurring (i.e.
  • Non- canonical nucleotides such as the cap structures are not considered “modified” although they differ from the chemical structure of A, G, C, and U ribonucleotides.
  • a “structural” modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications.
  • modified nucleotides When the polynucleotides of the present invention are chemically and/or structurally modified, the polynucleotides may be referred to as “modified nucleotides”.
  • the nucleic acids disclosed herein can include at least one chemically modified nucleotide.
  • the at least one chemically modified nucleotide comprises a chemically modified nucleobase, a chemically modified ribose, a chemically modified phosphodiester linkage, or a combination thereof.
  • the at least one chemically modified nucleotide is a chemically modified nucleobase.
  • the chemically modified nucleobase is selected from 5- formylcytidine (5fC), 5-methylcytidine (5meC), 5-methoxycytidine (5moC), 5-hydroxycytidine (5hoC), 5-hydroxymethylcytidine (5hmC), 5-formyluridine (5fU), 5-methyluridine (5-meU), 5- methoxyuridine (5moU), 5-carboxymethylesteruridine (5camU), pseudouridine ('P), N 1 - methylpseudouridine (me 1 'P), N 6 -methyladenosine (me 6 A), or thienoguanosine ( ,h G).
  • the chemically modified nucleobase is 5-methoxyuridine (5moU). In some embodiments, the chemically modified nucleobase is pseudouridine (T). In some embodiments, the chemically modified nucleobase is N 1 -methylpseudouridine (me 1 'P).
  • the at least one chemically modified nucleotide is a chemically modified ribose.
  • the chemically modified ribose is selected from 2'-(9-methyl (2'- ⁇ 9- Me), 2'-Fluoro (2'-F), 2'-deoxy-2'-fluoro-beta-D-arabino-nucleic acid (2'F-ANA), 4'-S, 4'- SFANA, 2'-azido, UNA, 2'-(9-methoxy-ethyl (2'-6>-ME), 2'-O-AUyl, 2'-O-Ethylamine, 2'-O- Cyanoethyl, Locked nucleic acid (LAN), Methylene-cLAN, N-MeO-amino BNA, or N-MeO- aminooxy BNA.
  • the chemically modified ribose is 2'-O-methyl (2'-0-Me).
  • the chemically modified ribose is 2'-Fluoro (2'-F).
  • the at least one chemically modified nucleotide is a chemically modified phosphodiester linkage.
  • the chemically modified phosphodiester linkage is selected from phosphorothioate (PS), boranophosphate, phosphodithioate (PS2), 3',5'-amide, N3'- phosphoramidate (NP), Phosphodiester (PO), or 2', 5 '-phosphodiester (2',5'-PO).
  • the chemically modified phosphodiester linkage is phosphorothioate.
  • the mRNA can include a heterologous 5’ untranslated region (5’UTR). In some embodiments, the mRNA can include a heterologous 3’ untranslated region (3’UTR).
  • chemical modifications of a nucleotide can include, singly or in any combination, 2'-position sugar modifications, 5-position pyrimidine modifications (e.g., 5-(N- benzylcarboxyamide)-2'-deoxyuridine, 5-(N-isobutylcarboxyamide)-2'-deoxyuridine, 5-(N- tryptaminocarboxyamide)-2'-deoxyuridine, 5-(N-[l-(3-trimethylammonium) propyl]carboxyamide)-2'-deoxyuridine chloride, 5-(N-naphthylmethylcarboxamide)-2'- deoxyuridine, or 5-(N-[l -(2,3-dihydroxypropyl)]carboxyamide)-2'-deoxyuridine), modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo- or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as the is
  • C-5 modified pyrimidine refers to a pyrimidine with a modification at the C-5 position.
  • Examples of a C-5 modified pyrimidine include those described in U.S. Pat. Nos. 5,719,273 and 5,945,527.
  • Examples of a C-5 modification include substitution of deoxyuridine at the C-5 position with a substituent selected from: benzylcarboxyamide (alternatively benzylaminocarbonyl) (Bn), naphthylmethylcarboxyamide (alternatively naphthylmethylaminocarbonyl) (Nap), tryptaminocarboxyamide (alternatively tryptaminocarbonyl) (Trp), and isobutylcarboxyamide (alternatively isobutylaminocarbonyl) (iBu) as illustrated immediately below.
  • benzylcarboxyamide alternatively benzylaminocarbonyl
  • naphthylmethylcarboxyamide alternatively naphthylmethylaminocarbonyl
  • Trp tryptaminocarboxyamide
  • isobutylcarboxyamide alternatively isobutylaminocarbonyl) (iBu) as illustrated immediately below.
  • representative C-5 modified pyrimidines include: 5-(N- benzylcarboxyamide)-2'-deoxyuridine (BndU), 5-(N-isobutylcarboxyamide)-2'-deoxyuridine (iBudU), 5-(N-tryptaminocarboxyamide)-2'-deoxyuridine (TrpdU) and 5-(N- naphthylmethylcarboxyamide)-2'-deoxyuridine (NapdU).
  • Modifications can also include 3' and 5' modifications, such as capping or pegylation.
  • Other modifications can include substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and those with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, and those with modified linkages (e.g., alpha anomeric nucleic acids, etc.).
  • internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphon
  • any of the hydroxyl groups ordinarily present in a sugar may be replaced by a phosphonate group or a phosphate group; protected by standard protecting groups; or activated to prepare additional linkages to additional nucleotides or to a solid support.
  • the 5' and 3' terminal OH groups can be phosphorylated or substituted with amines, organic capping group moieties of from about 1 to about 20 carbon atoms, or organic capping group moieties of from about 1 to about 20 polyethylene glycol (PEG) polymers or other hydrophilic or hydrophobic biological or synthetic polymers.
  • PEG polyethylene glycol
  • a modification to the nucleotide structure may be imparted before or after assembly of a polymer.
  • a sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including 2'-O-methyl-, 2'-O-allyl, 2'-fluoro- or 2'-azido-ribose, carbocyclic sugar analogs, a-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
  • one or more phosphodiester linkages may be replaced by alternative linking groups.
  • linking groups include embodiments wherein phosphate is replaced by P(O)S (“thioate”), P(S)S (“dithioate”), (0)NR2 (“amidate”), P(O)R, P(O)OR', CO or CH2 (“formacetal”), in which each R or R' is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether ( — O — ) linkage, aryl, alkenyl, cycloalky, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. Substitution of analogous forms of sugars, purines, and pyrimidines can be advantageous in designing a final product, as can alternative backbone structures like a polyamide backbone, for example.
  • the aptamers can include at least additional one chemical modification selected from the group consisting of a 2'-position sugar modification, a 2'-amino (2'-NH2), a 2'-fluoro (2'-F), a 2'-O-methyl (2'-0Me) a modification at a cytosine exocyclic amine, a substitution of 5 -bromouracil, a substitution of 5-bromodeoxyuridine, a substitution of 5-bromodeoxycytidine, a backbone modification, methylation, a 3'cap, and a 5'cap.
  • a DNA encoded chemical library chemically or physically linked with a small molecule, a protein, a peptide, a polysaccharide, or a lipid are used.
  • This linkage allows the identity of the small molecule, protein, peptide, polysaccharide, or lipid to be determined by sequencing the associated DNA. It can be used in high-throughput screening for drug discovery, by attaching unique DNA tags to individual small molecules, proteins, peptides, polysaccharides, or lipids.
  • modified nucleotides have been shown to produce novel aptamers that have very slow off-rates from their respective targets while maintaining high affinity to the target.
  • the C-5 position of the pyrimidine bases may be modified.
  • Aptamers containing nucleotides with modified bases have a number of properties that are different than the properties of standard aptamers that include only naturally occurring nucleotides (i.e., unmodified nucleotides).
  • the method for modification of the nucleotides includes the use of an amide linkage. However, other suitable methods for modification may be used.
  • amplification or “amplifying” means any process or combination of process steps that increases the amount or number of copies of a molecule or class of molecules.
  • partitioning means any process whereby one or more components of a mixture are separated from other components of the mixture.
  • aptamers bound to target molecules can be partitioned from other nucleic acids that are not bound to target molecules and from non-target molecules. More broadly stated, partitioning allows for the separation of all the nucleic acids in a candidate mixture into at least two pools based on their relative affinity and/or dissociation rate to the target molecule. Partitioning can be accomplished by various methods known in the art, including filtration, affinity chromatography, liquid-liquid partitioning, HPLC, etc. For example, nucleic acid-protein pairs can be bound to nitrocellulose filters while unbound nucleic acids are not.
  • oligonucleotides able to associate with a target molecule bound on a column allow the use of column chromatography for separating and isolating the highest affinity aptamers.
  • Beads upon which target molecules are conjugated can also be used to partition aptamers in a mixture. If the beads are paramagnetic, the partitioning can be achieved through application of a magnetic field.
  • Surface plasmon resonance technology can be used to partition nucleic acids in a mixture by immobilizing a target on a sensor chip and flowing the mixture over the chip, wherein those nucleic acids having affinity for the target can be bound to the target, and the remaining nucleic acids can be washed away.
  • Liquid-liquid partitioning can be used as well as filtration gel retardation and density gradient centrifugation.
  • Affinity tags on the target molecules can also be used to separate nucleic acid molecules bound to the tagged target from aptamers that are free in solution. For example, biotinylated target molecules, along with aptamers bound to them, can be sequestered from the solution of unbound nucleic acid sequences using streptavidin paramagnetic beads. Affinity tags can also be incorporated into the aptamer during preparation.
  • binding generally refers to the formation of a non-covalent association between the ligand and the target, although such binding is not necessarily reversible.
  • nucleic acid-target complex or “complex” or “affinity complex” are used to refer to the product of such non-covalent binding association.
  • Polypeptide “peptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length.
  • the polymer may be linear or branched, it may comprise modified amino acids, and/or it may be interrupted by non-amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
  • Polypeptides can be single chains or associated chains.
  • Marker is used to describe a target molecule, frequently a protein, that is a specific indicator or predictor of a specific disease or condition for which a diagnosis is desired.
  • polypeptide refers to a compound made up of a single chain of D- or L-amino acids or a mixture of D- and L-amino acids joined by peptide bonds.
  • a polypeptide is comprised of approximately twenty, standard naturally occurring amino acids, although natural and synthetic amino acids which are not members of the standard twenty amino acids may also be used.
  • the standard twenty amino acids include alanine (Ala, A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine (Cys, C), glutamine (Gin, Q), glutamic acid (Glu, E), glycine (Gly, G), histidine, (His, H), isoleucine (He, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Ser, S), threonine (Thr, T), tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Vai, V).
  • polypeptide sequence or “amino acid sequence” are an alphabetical representation of a polypeptide molecule.
  • Conservative substitutions of amino acids in proteins and polypeptides are known in the art. For example, the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another.
  • the substitutions include combinations such as, for example, Gly, Ala; Vai, He, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included within the polypeptides provided herein.
  • substitutions that are less conservative, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
  • substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
  • an electropositive side chain e.g., lysyl, arginyl, or histidyl
  • an electronegative residue e.g., glutamyl or aspartyl
  • nucleobase refers to the part of a nucleotide that bears the Watson/Crick basepairing functionality.
  • the most common naturally-occurring nucleobases, adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T) bear the hydrogen-bonding functionality that binds one nucleic acid strand to another in a sequence specific manner.
  • modified nucleic acid refers to a nucleic acid sequence containing one or more modified nucleotides. In some embodiments it may be desirable that the modified nucleotides are compatible with the SELEX process.
  • SELEX refers to a process that combines the selection of nucleic acids that interact with a target in a desirable manner (e.g., binding to a protein) with the amplification of those selected nucleic acids. Optional iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids that interact most strongly with the target from a pool that contains a very large number of nucleic acids. Cycling of the selection/amplification procedure is continued until a selected goal is achieved.
  • the SELEX methodology is described in the SELEX Patents. In some embodiments of the SELEX process, aptamers that bind non-covalently to their targets are generated.
  • aptamers that bind covalently to their targets are generated.
  • the targets used in the SELEX process are fixed in the same manner that an analytical sample would be fixed during the use of the slow off-rate aptamer in the histological or cytological characterization of that analytical sample.
  • SELEX target or “target molecule” or “target” refers herein to any compound upon which a nucleic acid can act in a desirable manner.
  • a SELEX target molecule can be a protein, peptide, nucleic acid, carbohydrate, lipid, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, pathogen, toxic substance, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, cell, tissue, any portion or fragment of any of the foregoing, etc., without limitation.
  • the target may be modified in one or more fashion. For example, proteins may be modified by glycosylation, phosphorylation, acetylation, phospholipids, and so forth.
  • the target may be modified to different levels. Slow off-rate aptamers could be produced to differentiate the type or level of modification.
  • a SELEX target does not include molecules that are known to bind nucleic acids, such as, for example, known nucleic acid binding proteins (e.g. transcription factors). Virtually any chemical or biological effector may be a suitable SELEX target. Molecules of any size can serve as SELEX targets.
  • a target can also be modified in certain ways to enhance the likelihood or strength of an interaction between the target and the nucleic acid.
  • a target can also include any minor variation of a particular compound or molecule, such as, in the case of a protein, for example, minor variations in amino acid sequence, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component, which does not substantially alter the identity of the molecule.
  • a “target molecule” or “target” is a set of copies of one type or species of molecule or multimolecular structure that is capable of binding to an aptamer.
  • “Target molecules” or “targets” refer to more than one such set of molecules. Embodiments of the SELEX process in which the target is a peptide are described in U.S. Pat. No.
  • FIG. 7 lists over 500 targets for which aptamers have been produced including a variety of slow off-rate aptamers.
  • the target may also be a “marker” or a molecule that is indicative of a specific disease state or condition and may be used in the diagnosis of that specific disease state or for selection of an appropriate therapeutic regimen or as an indication of potential therapeutic efficacy.
  • markers include prostate specific antigen for prostate cancer, CMBK for heart disease, CEA, C A 125 for cancer, HPV 16 and HP V 18 for cervical cancer, etc.
  • An example of a marker that is predictive of therapeutic efficacy is HER2.
  • aptamer-target complexes comprising an aptamer; and a target.
  • the aptamer can selectively associate with the target.
  • an aptamer refers to a binding reaction which is determinative for the target in a heterogeneous population of other similar compounds. Generally, the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the binding partner.
  • a particular structure e.g., an antigenic determinant or epitope
  • an antibody or antibody fragment selectively associates to its particular target (e.g., an antibody specifically binds to an antigen) but it does not bind in a significant amount to other proteins present in the sample or to other proteins to which the antibody may come in contact in an organism.
  • an aptamer selectively associates to its particular target (e.g., an antibody specifically binds to an antigen) but it does not bind in a significant amount to other proteins present in the sample or to other proteins to which the antibody may come in contact in an organism.
  • its particular target e.g., an antibody specifically binds to an antigen
  • an aptamer that “specifically binds” a target has an affinity constant (K a ) greater than about 10 5 M -1 (e.g., greater than about 10 6 M -1 , greater than about 10 7 M -1 , greater than about 10 8 M -1 , greater than about 10 9 M -1 , greater than about IO 10 M -1 , greater than about 10 11 M -1 , greater than about 10 12 M -1 , or more) with that target.
  • K a affinity constant
  • the target can be conjugated to a porous hydrogel.
  • the target can be covalently bound to the porous hydrogel.
  • the term “hydrogel” means a hydrophilic or amphiphilic three-dimensional polymer network capable of absorbing large amounts of water. Such networks can be composed of homopolymers or copolymers, and such networks are present in the presence of covalent chemical or physical (ionic, hydrophobic interactions, entanglement) crosslinks. Due to insolubility. Such cross-linking provides network structure and physical integrity. Hydrogels exhibit thermodynamic compatibility with water, so that the hydrogel can swell in aqueous media. The chains of the network are connected so that there are pores and a significant portion of such pores have dimensions of 1 nm to 100 nm.
  • porous hydrogel can include a non-fouling polymer.
  • “Non-fouling polymer” refers to any polymer that resists the absorption of proteins and/or adhesion of cells.
  • the non-fouling polymer can include a crosslinked hydrophilic polymer, zwitterionic polymer, mixtures or copolymers thereof.
  • the non-fouling polymer can include a crosslinked hydrophilic polymer.
  • the non-fouling polymer can include a zwitterionic polymer.
  • porous hydrogel can include a zwitterionic polymer.
  • Zwitterionic polymers refers to a family of materials that have the same number of cations and anions along their polymer chains. Typical cations are quatemized ammonium, and zwitterionic groups can be classified into sulfobetaine (SB), carboxybetaine (CB), phosphorylcholine (PC) according to anions.
  • Suitable zwitterionic polymer can include, but are not limited to, examples of zwitterionic polymers: poly(methacryloyloxylethyl phosphorylcholine), polyMPC; poly(sulfobetaine methacrylate), polySBMA; and poly (sulfobetaineacrylamide), polySBAAm.
  • porous hydrogel can include a crosslinked hydrophilic polymer.
  • Suitable crosslinked hydrophilic polymers can include, but are not limited to, poly(ethylene glycol), polyoxazoline, polyaliphatic polyurethanes, polyether polyurethanes, polyester polyurethanes, polyethylene copolymers, polyamides, polyvinyl alcohols, poly(ethylene oxide), polypropylene oxide, polypropylene glycol, polytetramethylene oxide, polyvinyl pyrrolidone, polyacrylamide, poly (hydroxy ethyl acrylate), poly (hydroxy ethyl methacrylate), or mixtures or co-polymers thereof.
  • the hydrophilic polymer can include poly(ethylene glycol) (PEG).
  • PEG poly(ethylene glycol)
  • the PEG can be selected from: PEG- vinyl sulfone (PEG-VS), PEG- acrylate (PEG-Acr), PEG diacrylate, or mixtures or copolymers thereof.
  • the porous hydrogel can have a pore size of from 10 nm to 200 ⁇ m, such as from 10 nm to 50 nm, from 10 nm to 1 ⁇ m, from 10 nm to 50 ⁇ m, from 10 nm to 100 ⁇ m, from 10 nm to 200 ⁇ m, from 50 nm to 1 ⁇ m, from 50 nm to 50 ⁇ m, from 50 nm to 100 ⁇ m, from 50 nm to 200 ⁇ m, from 1 ⁇ m to 20 ⁇ m, from 1 ⁇ m to 50 ⁇ m, from 1 ⁇ m to 100 ⁇ m, from 1 ⁇ m to 200 ⁇ m, from 50 ⁇ m to 100 ⁇ m, from 50 ⁇ m to 200 ⁇ m, or from 100 ⁇ m to 200 pm.
  • the porous hydrogel can be a macroporous hydrogel.
  • the macroporous hydrogel can have a pore size of from 1 ⁇ m to 200 ⁇ m, such as from 1 ⁇ m to 20 ⁇ m, from 1 ⁇ m to 50 ⁇ m, from 1 ⁇ m to 100 ⁇ m, from 1 ⁇ m to 200 ⁇ m, from 10 ⁇ m to 50 ⁇ m, from 10 ⁇ m to 100 ⁇ m, from 10 ⁇ m to 200 ⁇ m, from 50 ⁇ m to 100 ⁇ m, from 50 ⁇ m to 200 ⁇ m, or from 100 ⁇ m to 200 pm.
  • the macroporous hydrogel can have a porosity of from 30% to 90%, such as from 30% to 80%, from 30% to 70%, from 30% to 60%, from 30% to 50%, from 30% to 40%, from 40% to 80%, from 40% to 70%, from 40% to 60%, from 40% to 50%, from 50% to 80%, from 50% to 70%, from 50% to 60%, from 60% to 80%, from 60% to 70%, or from 70% to 80%.
  • Suitable methods for preparing the porous hydrogel are generally known in the art such as including but not limited to cryogelation; gas formation; salt leaching; or particle leaching.
  • Different methods are known in the art for conjugating a target molecule such as proteins to a porous hydrogel network such as EDC/NHS, and click chemistry.
  • the target can include a protein, a peptide, a receptor, an antibody, a growth factor, small molecule, toxins, polysaccharide, cell, bacteria, or virus.
  • the target can include a protein, a peptide, a receptor, an antibody, and a growth factor.
  • the target can be an antibody such as cetuximab, anti-CD24 antibody, panitumumab, bevacizumab, immunoglobulins (e.g., IgG, IgA, IgM, IgD, IgE), and mixtures thereof.
  • an antibody such as cetuximab, anti-CD24 antibody, panitumumab, bevacizumab, immunoglobulins (e.g., IgG, IgA, IgM, IgD, IgE), and mixtures thereof.
  • the target can be growth factor such as transforming growth factor- ⁇ (“TGF- ⁇ ”), transforming growth factors (“TGF- ⁇ ”), platelet-derived growth factors (“PDGF”), fibroblast growth factors (“FGF”), including FGF acidic isoforms 1 and 2, FGF basic form 2 and FGF 4, 8, 9 and 10, nerve growth factors (“NGF”) including NGF 2.5s, NGF 7.0s and beta NGF and neuro trophins, brain derived neurotrophic factor, cartilage derived factor, bone growth factors (BGF), basic fibroblast growth factor, insulin-like growth factor (IGF), vascular endothelial growth factor (VEGF), granulocyte colony stimulating factor (G- CSF), insulin like growth factor (IGF) I and II, hepatocyte growth factor, glial neurotrophic growth factor (GDNF), stem cell factor (SCF), keratinocyte growth factor (KGF), transforming growth factors (TGF), including TGFs alpha, beta, betal, beta2, beta3, skeletal growth factor, bone
  • TGF
  • the target can be a protein such as cytokines, cardiotrophin, stromal cell derived factor, macrophage derived chemokine (MDC), melanoma growth stimulatory activity (MGSA), macrophage inflammatory proteins 1 alpha (MIP-lalpha), 2, 3 alpha, 3 beta, 4 and 5, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL- 13, TGF- ⁇ , TNF-0, VEGF (vascular endothelial growth factor), NGFs (nerve growth factors), PDGF-AA, PDGF-BB, PDGF-AB, FGFb, FGFa, BGF, leptin, leukemia inhibitory factor (LIF), tumor necrosis factor alpha and beta, endostatin, thrombospondin, osteogenic protein- 1, bone morphogenetic proteins 2 and 7, osteonectin, s
  • the aptamer can be any non-naturally occurring nucleic acid that has or may have a desirable action on a target.
  • a desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way that modifies or alters the target or the functional activity of the target, covalently attaching to the target (as in a suicide inhibitor), and facilitating the reaction between the target and another molecule.
  • the action is specific binding affinity for a target molecule, such target molecule being a three-dimensional chemical structure, other than a polynucleotide, that binds to the aptamer through a mechanism which is predominantly independent of Watson/Crick base pairing or triple helix binding, wherein the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule.
  • Aptamers include nucleic acids that are identified from a contacting a candidate mixture of nucleic acids with the target, wherein nucleic acids having affinity to the target bind the target and form nucleic acid-target complexes; partitioning nucleic acid-target complexes from free nucleic acids in the candidate mixture; amplifying the nucleic acids that bind to the target; and identifying nucleic acids that bind to the target, thereby identifying or producing an aptamer to a target; wherein the target is conjugated to a porous hydrogel.
  • an aptamer or “nucleic acid ligand” is a set of copies of one type or species of nucleic acid molecule that has a particular nucleotide sequence.
  • An aptamer can include any suitable number of nucleotides. “Aptamers” refer to more than one such set of molecules. Different aptamers may have either the same number or a different number of nucleotides. Aptamers may be DNA or RNA and may be single stranded, double stranded, or contain double stranded regions.
  • the aptamer can be a single-stranded nucleic acid or a doublestranded nucleic acid. In some embodiments, the aptamer can be a single-stranded nucleic acid. In some embodiments, the aptamer can be a double-stranded nucleic acid. In some embodiments, the aptamer can include DNA, RNA, or both DNA and RNA. In some embodiments, the aptamers can include DNA. In some embodiments, the aptamers can include RNA. In some embodiments, the aptamers can include both DNA and RNA.
  • the aptamer can include a detectable moiety.
  • Suitable detectable moieties can include but are not limited to a dye, a quantum dot, a radiolabel, an electrochemical functional group, an enzyme, an enzyme substrate, a ligand and a receptor.
  • labeling agent refers to one or more reagents that can be used to detect a target molecule/aptamer complex.
  • a detectable moiety or label is capable of being detected directly or indirectly. In general, any reporter molecule that is detectable can be a label.
  • Labels include, for example, (i) reporter molecules that can be detected directly by virtue of generating a signal, (ii) specific binding pair members that may be detected indirectly by subsequent binding to a cognate that contains a reporter molecule, (iii) mass tags detectable by mass spectrometry, (iv) oligonucleotide primers that can provide a template for amplification or ligation, and (v) a specific polynucleotide sequence or recognition sequence that can act as a ligand, such as, for example, a repressor protein, wherein in the latter two instances the oligonucleotide primer or repressor protein will have, or be capable of having, a reporter molecule, and so forth.
  • the reporter molecule can be a catalyst, such as an enzyme, a polynucleotide coding for a catalyst, promoter, dye, fluorescent molecule, quantum dot, chemiluminescent molecule, coenzyme, enzyme substrate, radioactive group, a small organic molecule, amplifiable polynucleotide sequence, a particle such as latex or carbon particle, metal sol, crystallite, liposome, cell, etc., which may or may not be further labeled with a dye, catalyst or other detectable group, a mass tag that alters the weight of the molecule to which it is conjugated for mass spectrometry purposes, and the like.
  • the label can be selected from electromagnetic or electrochemical materials.
  • the detectable label is a fluorescent dye.
  • Other labels and labeling schemes will be evident to one skilled in the art based on the disclosure herein.
  • a detectable moiety can include any of the reporter molecules listed above and any other chemical or component that may be used in any manner to generate a detectable signal.
  • the detectable moiety, or signal generating label may be detected via a fluorescent signal, a chemiluminescent signal, or any other detectable signal that is dependent upon the identity of the moiety.
  • the detectable moiety is an enzyme (for example, alkaline phosphatase)
  • the signal may be generated in the presence of the enzyme substrate and any additional factors necessary for enzyme activity.
  • the detectable moiety is an enzyme substrate, the signal may be generated in the presence of the enzyme and any additional factors necessary for enzyme activity.
  • Suitable reagent configurations for attaching the detectable moiety to a target molecule include covalent attachment of the detectable moiety to the target molecule, non-covalent association of the detectable moiety with another labeling agent component that is covalently attached to the target molecule, and covalent attachment of the detectable moiety to a labeling agent component that is non-covalently associated with the target molecule.
  • Detectable moieties may be incorporated into an aptamer during synthesis by using labeled dNTPs, dyes that have been generated as phosphoramidites, or other chemistries that can be employed during oligonucleotide synthesis, or may be incorporated by modification of the final aptamer product after synthesis.
  • Each aptamer may include multiple detectable moieties to enhance signal generation. When multiple targets from the same sample, for example a histological tissue section, are to be detected then each target specific aptamer may be produced with a unique detectable moiety for simultaneous analysis of multiple targets.
  • the method can include: contacting a candidate mixture of nucleic acids with the target, wherein nucleic acids having affinity to the target bind the target and form nucleic acid-target complexes; partitioning nucleic acid-target complexes from free nucleic acids in the candidate mixture; amplifying the nucleic acids that bind to the target; and identifying nucleic acids that bind to the target, thereby identifying or producing an aptamer to a target; wherein the target is conjugated to a porous hydrogel.
  • the method can further include amplifying the nucleic acids that bind to the target.
  • the methods for identifying or producing an aptamer to a target described herein can include: contacting a candidate mixture of nucleic acids with the target, wherein nucleic acids having affinity to the target bind the target and form nucleic acid-target complexes; partitioning nucleic acid-target complexes from free nucleic acids in the candidate mixture; amplifying the nucleic acids that bind to the target; and identifying nucleic acids that bind to the target, thereby identifying or producing an aptamer to a target; wherein the target is conjugated to a porous hydrogel.
  • the method can include: contacting a candidate mixture of nucleic acids with the target, wherein nucleic acids having affinity to the target bind the target and form nucleic acid-target complexes; partitioning nucleic acid-target complexes from free nucleic acids in the candidate mixture; amplifying the nucleic acids that bind to the target; and identifying nucleic acids that bind to the target, thereby identifying or producing an aptamer to a target; wherein the target is conjugated to a porous hydrogel.
  • the method can include: contacting a candidate mixture of nucleic acids with the target, wherein nucleic acids having affinity to the target bind the target and form nucleic acid-target complexes; partitioning nucleic acid-target complexes from free nucleic acids in the candidate mixture; amplifying the nucleic acids that bind to the target; and identifying nucleic acids that bind to the target, thereby identifying or producing an aptamer to a target; wherein the target is conjugated to a porous hydrogel.
  • a candidate mixture is also sometimes referred to as a “pool” or a “library.”
  • an “RNA pool” refers to a candidate mixture comprised of RNA.
  • candidate mixture is a mixture of nucleic acids of differing sequence from which to select a desired ligand.
  • the source of a candidate mixture can be from naturally occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques. Modified nucleotides, can be incorporated into the candidate mixture.
  • a SELEX process can be used to produce a candidate mixture, that is, a first SELEX process experiment can be used to produce a ligand-enriched mixture of nucleic acids that is used as the candidate mixture in a second SELEX process experiment.
  • a candidate mixture can also comprise nucleic acids with one or more common structural motifs.
  • a candidate mixture of nucleic acids, or a library of nucleic acids may be produced by an enzymatic method using a solid phase.
  • this method comprises the same basic steps described above.
  • the goal is the synthesis of an antisense library and these libraries are produced with a 5' biotin modification. All remaining synthetic processes are as described above.
  • the nucleic acids may be used in a primer extension mix containing one or more modified nucleotides to produce the final candidate mixture in a classic primer extension method.
  • a method for producing a synthetic library of nucleic acids comprises: 1) synthesizing the nucleic acids; 2) deprotecting the nucleic acids; 3) purifying the nucleic acids; and 4) analyzing the nucleic acids.
  • a monomer mixture is prepared where the ratio of the various nucleotides in the mix is optimized to yield equal ratios of each nucleotide in the final product.
  • One or more of the monomers in the mixture may comprise a modified nucleotide.
  • Amidite protection groups are used in this procedure and in one embodiment, the monomer concentration is 0.1 M.
  • the five prime protecting group is retained in the product nucleic acid. Synthesis is conducted on a solid support (controlled pore glass, CPG) and at least about 80 cycles are completed to synthesize the final product.
  • the nucleic acid product is deprotected.
  • a 1.0 M aqueous lysine buffer, pH 9.0 is employed to cleave apurinic sites while the product is retained on the support (controlled pore glass, CPG).
  • CPG controlled pore glass
  • These cleaved truncated sequences are washed away with deionized (di) water two times.
  • 500 LIL of di water are added after the two washes in preparation for the deprotection step.
  • This step involves the treatment with 1.0 mL of t- butylamine:methanol: water, 1: 1:2, for 5 hours at 70° C., followed by freezing, filtration, and evaporation to dryness.
  • the nucleic acid product is purified based on the hydrophobicity of the protecting group on a PRP-3 HPLC column (Hamilton). Appropriate column fractions are collected and pooled, desalted, and evaporated to dryness to remove the volatile elution buffers. The final product is washed with water by a centrifugation process and then re-suspended. Finally, the resuspended material is treated to deprotect the final product.
  • Final product is characterized by base composition, primer extension, and sequencing gel.
  • Aptamers may be synthesized by the same chemistry that is used for the synthesis of a library. However, instead of a mixture of nucleotides, one nucleotide is introduced at each step in the synthesis to control the final sequence generated by routine methods. Modified nucleotides may be introduced into the synthesis process at the desired positions in the sequence. Other functionalities may be introduced as desired using known chemical modifications of nucleotides.
  • each nucleic acid in a candidate mixture may have fixed sequences on either side of a randomized region, to facilitate the amplification process.
  • the nucleic acids in the candidate mixture of nucleic acids can each further comprise fixed regions or “tail” sequences at their 5' and 3' termini to prevent the formation of high molecular weight parasites during the amplification process.
  • variable region of the aptamer includes nucleotides that include modified bases. Certain modified aptamers may be used in any of the described methods, devices, and kits.
  • the aptamers identified using the methods described herein can be use to develop biomaterials for regenerative medicine, immunotherapy applications, among others.
  • compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this disclosure have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the disclosure. More specifically, it will be apparent that certain agents which are both chemically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the disclosure as defined by the appended claims.
  • Aptamers are “chemical antibodies”. Aptamers are synthetic oligonucleotides with the functions of rivaling natural antibodies. Despite this potential, the selection of aptamers is extremely challenging.
  • the hydrogel for aptamer selection (HAS) method makes aptamer selection extremely easy.
  • Target molecules were conjugated into a three-dimensional macroporous hydrogel.
  • the hydrogel is transferred to a selection buffer. After 60 hours, the hydrogel is taken out and the remaining aptamers are eluted from the hydrogel.
  • Negative selection is routinely used for aptamer selection because nucleic acid sequences nonspecifically bind to the surface of substrates or blocking agents (e.g., bovine serum albumin).
  • substrates or blocking agents e.g., bovine serum albumin.
  • the probability of fortuitously developed aptamer against matrix or blocking agent is significant factor for low success rate of standard SELEX procedure, these limitations were considered.
  • the nonspecific absorption was minimized by immobilization of target over PEG hydrogel i.e., well known for its excellent antifouling properties. As a result, selection, and enrichment of nonspecific candidates for target is dramatically minimized.
  • Negative selection is routinely used for aptamer selection because 1) it is inevitable for nonspecific nucleic acid sequences to bind the surface of substrates; and 2) the surface cannot be blocked by using another molecule (e.g., bovine serum albumin. If blocking molecules are used, aptamers will be selected against the blocking molecules.).
  • the entire substrate is a macroporous polyethylene glycol (PEG) hydrogel.
  • PEG is a well-known nonfouling polymer.
  • the nonspecific binding of aptamer candidates to PEG is minimal compared to the substrates used in current state-of-the-art methods. Thus, the enrichment of nonspecific candidates will be dramatically minimized.
  • the proposed method does not involve any complicated instruments like flow cytometers for particle sorting. It does not involve electric fields or specific electrolyte solutions that may dramatically change the functional conformations of proteins and aptamer candidates.
  • Macroporous PEG hydrogels are the substrates to be used for aptamer selection.
  • Two methods of preparing macroporous PEG hydrogels were established, which forms a solid foundation to investigate and establish the proposed method.
  • the first method is free radical polymerization coupled with carbon dioxide formation. Free radical polymerization allows PEG Fig.l. Illustration of the concept, diacrylate to crosslink to form a polymer network. But free radical polymerization itself does not lead to the formation of large pores within the hydrogel matrix.
  • the prepolymer solution is mixed with acetic acid. When the solution is added into a mold containing sodium bicarbonate, carbon dioxide is produced to generate bubbles in the hydrogels.
  • Nonspecific aptamer sequences in a porous hydrogel have apparent diffusion coefficients at the level of ⁇ 10 -7 cm 2 /s. This can be further validated using aptamer release from a macroporous hydrogel. The aptamer release from PEG gel without thrombin and also from thrombin-conjugated PGE gel will be studied.
  • PEG hydrogels with acrylic acid monomers were synthesized. After activation of the carboxyl group with the standard carbodiimide reaction, it was possible to conjugate proteins to the PEG hydrogel network. FAM-labeled BSA was used as a model to illustrate the success of protein conjugation.
  • Thrombin was conjugated to the macroporous PEG hydrogel. After washing the free molecules out of the hydrogel, fluorophore-labeled anti-thrombin aptamers were loaded into the hydrogels and then incubated the hydrogel in a phosphate buffered solution (PBS). The release or retention of the aptamers was evaluated by examining the fluorescence intensity of the PBS supernatant and the PEG hydrogel.
  • PBS phosphate buffered solution
  • the fluorescence intensity of PBS increased with time.
  • the fluorescence intensity of the hydrogels decreased with time.
  • the hydrogel with the high-affinity aptamer had much higher fluorescence intensity than those with the low-affinity or scrambled aptamer.
  • Macro porous PEGMA/PEGDA hydrogel was synthesized through free radical polymerization with a cryo-freezing procedure (Figure 3A). Homogenous macro porous hydrogel (Figure 3B, 3C, 3D) and porosity and pore structure was assessed via the confocal and bright field microscopy was achieved. The interconnected pores with clear boundaries were distributed throughout the hydrogel. The averaged pore diameter was 50+20 ⁇ m and calculated porosity ranged from 40% to 55%. The swealing ratio (Figure 3E) of prepared hydrogel was demonstrated and schematic for conjugation (Figure 3F) of target protein with hydrogel was depicted.
  • Protein (IL10, IL12, and Thrombin) conjugated hydrogel was subjected to the release of aptamer library.
  • Figure 4A, 4B over 95% of the aptamer library's ssDNA was released from the protein-hydrogel after 60 hours, as opposed to the control hydrogel where all the molecules were released after 36 hours.
  • the released samples were collected at different intervals and subjected them to PCR amplification and found similar results.
  • HAS was performed against the IL10, IL12, and thrombin and enriched the aptamer library with high-affinity aptamer candidates.
  • the binding affinity of the enriched aptamer library was evaluated compared to native aptamer library through surface plasmon resonance (SPR) spectroscopy and electrophoretic mobility assay.
  • SPR surface plasmon resonance
  • KD bulk dissociation constant
  • a binding reaction can reduce the apparent diffusion of molecules.
  • those candidates with higher binding affinities will be released more slowly than those with lower binding affinities.
  • higher-affinity aptamer candidates can be automatically separated from those low- affinity sequences through this binding-diffusion process.
  • Successful aptamer selection has the following requirements.
  • the nonspecific binding of candidates to substrates for aptamer selection needs to be minimal.
  • Proteins need to be easily conjugated with the hydrogel under mild conditions.
  • the aptamer library needs to be easily loaded into the hydrogel. Those with low-binding affinities need to diffuse out of the hydrogel quickly.
  • a macroporous PEG structure can satisfy all these requirements. Two methods of synthesizing macroporous PEG hydrogels to mitigate potential technical problems for aptamer selection to a great degree were established, method 1 will be use (i.e., polymerization coupled with gas formation) for aptamer selection and Method 2 (i.e., polymerization coupled with freezing/drying) as an alternative solution.
  • Aptamers were selected against five proteins including human thrombin, human IL-10, murine IL-12, Brain derived neurotropic factor (BDNF) and Granulocyte Macrophage-Colony Stimulating Factor (GMCSF) (see Tables 1 and 3).
  • the reasons for using these three proteins as models are as follows. 1) They have different isoelectric points (pl) that represents negatively, positively, and neutrally charged molecules, respectively. 2) The three model proteins are from different species (human and mouse). 3) The existing thrombin aptamer is probably the most studied aptamer in the literature. When new aptamers against thrombin are select, the new method with traditional ones can be compared. 4) These proteins are important for basic studies or biomedical applications such as biosensing or immunosuppression.
  • Method 1 polymerization coupled with gas formation.
  • the prepolymerization solution will contain PEGDA (15% w/v), acrylic acid (1% w/v), tetramethylethylenediamine (TEMED; 0.2% w/v), ammonium persulfate (APS; 0.4% w/v), and Pluronic F-127 (4% w/v).
  • the prepolymerization solution will be transferred into a mold containing sodium bicarbonate to induce formation of macroporous hydrogels. Fully cured hydrogels will be washed using deionized water to remove unreacted molecules and initiator/catalysts. Macroporous hydrogels will be lyophilized and sterilized using 70% ethanol.
  • Method 2 polymerization coupled with freezing/drying.
  • the prepolymerization solution will be incubated in ice before the addition of APS (0.4% w/v) and TEMED (0.2% v/v).
  • the mixture will be poured into a 35 mm petri dish and the solution will be frozen at -20oC overnight.
  • the hydrogel will be removed from the freezer and allowed to fully thaw at room temperature. Hydrogels will be washed in distilled water to remove all unreacted monomers and initiator/catalysts.
  • the macroporous hydrogels will be lyophilized and sterilized.
  • Covalent immobilization of protein can be achieved using the standard amine coupling method.
  • the macroporous PEG hydrogel were incubated in a mixture of freshly prepared 30 mM l-ethyl-3-(3- dimethylaminopropyl) carbodiimide hydrochloride (EDC) and 20 mM N- hydroxysuccinimide (NHS) in MES buffer for Ih at 4°C. After gentle washing, the activated hydrogel was incubated with Ipg of protein (300 pL) at 4°C for 2h.
  • EDC l-ethyl-3-(3- dimethylaminopropyl) carbodiimide hydrochloride
  • NHS N- hydroxysuccinimide
  • the hydrogel was gently washed with washing buffer (lx PBS, 0.2% Triton X, 300 mM NaCl) for 5 min (3 times) to remove any loosely/physically bound protein.
  • the conjugated hydrogel can be stored at 4°C until used. Unconjugated proteins in the washing solution were analyzed using ELISA to determine the total amount of conjugated proteins in the hydrogel network. Reaction parameters such as protein concentration can be varied. Aptamer selection
  • a DNA aptamer library (5'-CACCTAATACGACTCACTATAGCGGATCCGA-N40- CTGGCTCGAACAAGCTTGC-3’ (SEQ ID NO: 1)) can be ordered from IDT and dissolved in binding buffer (lx PBS, 5mM MgCh, 2.5 mM CaCh and 2.5 mM KC1). The library was denatured at 95°C for 5 min followed by cooling at room temperature for 10 min. The aptamer library in 400 pL binding buffer was incubated with the protein-conjugated PEG hydrogel with one-hour shaking. The hydrogel was then transferred to and incubated in 400 pL binding buffer.
  • the supernatants was collected and replaced with fresh binding buffer solutions at an interval of 12 h for N times, where N can be 5 to 8.
  • N can be 5 to 8.
  • all of the strongly bound aptamer candidates were eluted by incubation in IM NaCl for 6h.
  • the eluted candidates were desalted with Zeba desalting column and concentrated until approximately ⁇ 50 pL solution was be obtained.
  • the concentrated sequences were amplified and purified.
  • the list of primer and aptamer library was incorporated in table 2.
  • the binding affinities (represented by the K/> values) of the enriched aptamer pool were examined by using SPR spectroscopy according to the standard protocol developed in our lab.
  • the sensor chip with carboxyl groups on the surface was activated using the standard amine coupling method.
  • 100 pL of NHS and EDC mixture was injected over the biochip surface at a flow rate of 5 pL/min.
  • Protein solution of 20 pg/mL was prepared in acetate buffer at a pH value close to the protein’s isoelectric point. The protein solution was flowed over the activated surface at 10 pL/min for 5 min. 35 pL of ethanolamine was injected over the surface to deactivate the remaining reactive sites on the biochip.
  • HBSS Hank’s balanced salt solution
  • 20 mM HEPES buffer pH 7.4
  • the aptamers were dissolved in the binding solution (HBSS with 4 mM CaCh, 4 mM MgCh, and 0.005% Tween 20) for the association analysis.
  • the solution ran at a constant rate of 30 pL/min.
  • the binding solution without the aptamers was used as washing buffer to analyze the dissociation.
  • the kinetic parameters, k on and k o ff were determined by the direct curve fitting of the sensorgrams using the Reichert’s Autolink software.
  • the dissociation equilibrium constant, KD was calculated as koff/kon-
  • aptamer selection is to reduce the number of candidates (i.e., the enrichment of high- affinity aptamer candidates). After the selection, one needs to find the exact sequences of aptamer candidates and further validate the binding functions of the identified aptamers. Thus, aptamer candidates will undergo downstream sequencing and functional validation. Experiments were performed for next generation sequencing and bioinformatics analysis. After sequencing, aptamer candidates were be truncated, and their capability of binding their target molecules was examined using SPR. Besides the SPR analysis, individual aptamers can be further analyzed using functional coagulation or cell assays.
  • Truncation of non-essential nucleotides will be performed using a secondary structure generated by mFold/ RNA structure online tool.
  • the secondary structures and Gibbs energy of truncated aptamers will be analyzed and compared with parent aptamers using computer algorithms.
  • Binding affinities of selected and truncated aptamers will be measured using surface plasmon resonance (SPR) spectroscopy as previously described.
  • biological assays will be performed to examine the binding or neutralizing capabilities of the aptamers.
  • thrombin time i.e., thrombin clotting time
  • 50 pL of release medium will be incubated for 2 min at 37 °C in 100 pL of fresh human plasma.
  • 50 pL of thrombin containing 2 NIH U/mL in 25 mM CaCh will be then added into the human plasma solution.
  • Clotting time will be measured using a coagulometer.
  • human & mouse IL- 12 reporter HEK 293 cells (InvivoGen) will be used. In brief, 50,000 cells will be treated with the mixture of IL-12 (10 ng/mL) and aptamers (varied concentration) overnight. 20 pL of induced HEK-Blue IL-12 cell supernatant will be transfered to 180 pL of Quanti-Blue Solution. The SEAP levels will be determined at 630 nm using a spectrophotometer. Doseresponse of HEK 293 cells to IL- 12 will be acquired to determine effective concentration of IL- 12 (i.e., EC50) with or without aptamers. The similar method and procedure will be applied to determine the function of anti-IL-10 aptamers by using IL- 10 reporter HEK 293 cells. See Figures 7A-7C and 8A-8B.
  • top 50 candidates can be identified. After alignment and phylogenetic analysis, 10 to 12 candidates can be choosen for the evaluation of binding strength. The top 3 to 5 candidates are expected to bind target proteins with a KD value at nanomolar or sub-nanomolar levels.
  • the aptamer selected with the proposed method will bind to thrombin with a lower KD value than those aptamers that were selected using the traditional membrane filtration method.
  • the length of the candidates can be shortened to 30 to 50 nucleotide long.
  • the truncated aptamers can bind to target proteins with similar strength as the parent aptamers. Some of the truncated aptamers will not only bind, but also neutralize target proteins; others will bind but not neutralize target proteins.
  • the selected aptamers can be used to develop biomaterials for regenerative medicine or immunotherapy applications.
  • Thrombin protein was immobilized over 10% carboxylic-PEG SPR chip through EDC/NHS covalent chemistry.
  • the prepared SPR chips were than utilized for binding affinity analysis with increasing concentration of selected aptamer.
  • the binding of aptamer over the sensor chip led to increase in SPR angle, reaching the stabilization plateau within 6 min of association phase.
  • buffer solution was passed over the surface to remove loosely bound protein from the surface as dissociation phase (Figure 9A).
  • Calibration curve was plotted against the SPR max signal verses aptamer concentration ( Figure 9B).
  • the formation of aptamer protein complex over the SPR chip is directly related to SPR response unit.
  • the determined KD value for thrombin T.7 aptamer to be 1.41+1.11 nM.
  • Truncation study was performed to shorten the T-7 aptamer.
  • the purpose of this study is to compare the 90-mer thrombin aptamer (T-7) with previously reported (DNA 60-18) 29-mer aptamers ⁇ KD-0.5 nM, (Tasset et al., 1997) ⁇ .
  • T-7 90-mer thrombin aptamer
  • DNA 60-18 29-mer aptamers ⁇ KD-0.5 nM
  • a truncation study was performed to make a fair comparison between similar-length aptamers.
  • the truncation strategy relied on analyses of the secondary structure generated by mfold.
  • the truncated sequences were experimentally verified with SPR (Figure 9C, 9D).
  • Mouse Interleukin- 12 protein was immobilized over 10% carboxylic-PEG SPR chip through EDC/NHS covalent chemistry.
  • the prepared SPR chips were then utilized for binding affinity analysis with increasing concentrations of IL12.35 aptamer.
  • the binding of IL12.35 aptamer over the sensor chip led to an increase in SPR angle (Figure 10A).
  • the calibration curve was plotted against the SPR max signal versus aptamer concentration (Figure 10B), and the sensor surface gets saturated after 25 nM.
  • the binding affinity was discerned 9.72+2.75 nM by using the single ligand binding site equation in 1 : 1 interaction mode.
  • the binding affinity of selected aptamer candidates against human IL 10 was evaluated using repeated HAS-two rounds or extended (2T) HAS time compared to a single round of HAS.
  • the SPR study was performed with the best-selected aptamer from one round (IL10.49), 2 rounds (2m.IL10.03), and extended time (2T. IL.10.13) candidates ( Figure 11A-11C).
  • Figure 12 shows the final selected aptamer sequences with respective secondary structure and measured binding affinity.
  • the applicability of HAS was validated with proteins of different isoelectric point (pl) IL10 - 8.2+0.5, IL12-6.4+1.3 and Thrombin 6.8+1.0 and surface charge.
  • pl isoelectric point
  • IL12-6.4+1.3 isoelectric point
  • Thrombin 6.8+1.0 surface charge
  • surface charge Interestingly no direct relationship observed between the pl of protein and aptamer binding affinity.
  • HAS process could be used for all kinds of proteins in respective of their surface charge and pl. Sequences of respective proteins were identified in the UniProt database and isoelectric points were determined from the Compute pl/Mw tool at ExPASy.
  • the practical application of the selected aptamer was validated through biosensing assay.
  • FIG. 13 A A schematic representation of the aptamer-antisense displacement fluorescent-based assay was shown in Figure 13 A.
  • the conformation- switching property of an aptamer in the presence of targets is the basic principle for this displacement assay.
  • the sensor performance against the respective proteins was analyzed in a binding buffer with optimized parameters. A range of protein concentrations from 1 pM to 100 nM was studied for each selected aptamer. A linear response was observed from IpM to 1 nM for thrombin. The calculated limit of detection (LODs) was 0.2 pM for thrombin (Figure 13B).
  • the aptamer specificity against some analogous proteins was further investigated and no significant affinity was observed between the aptamer and nonspecific protein (Figure 13C). It signifies the good selectivity of the selected aptamers against their specific target.
  • aptamers commonly referred to as "chemical antibodies,” have been studied in various areas. However, the process of aptamer selection poses a significant challenge.
  • Low- affinity aptamer candidates can be rapidly released from the hydrogel, while high-affinity candidates are restricted due to their strong binding to the immobilized protein targets. Consequently, a one-step enriched aptamer pool can be obtained within 60 hours and the enriched pool can strongly bind the protein targets. This enrichment is consistent across all five proteins with isoelectric points in the range from 5 to 9.
  • the anti-thrombin aptamer identified from an enriched aptamer pool has been found to have a binding affinity that is comparable to those identified over ten cycles of selection using traditional methods.
  • this method is simple, fast, low-cost, and instrument-free, with a high probability of obtaining high-quality aptamers in one single step.
  • DNA and RNA oligonucleotides are widely used as molecular tools or building blocks in various applications, ranging from genome editing to molecular computing, due to their ability to recognize and hybridize with complementary sequences.
  • 11-71 Oligonucleotides selected from synthetic DNA or RNA libraries not only recognize complementary sequences, but also non- nucleic acid molecules, and these oligonucleotides are known as aptamers or “chemical antibodies”.
  • 18-101 Aptamers can be applied to most if not all areas where antibodies have been designed. Aptamers are chemically synthesized with little batch-to-batch variation and can be produced at a lower cost compared to antibodies. Additionally, aptamers exhibit high structural or functional stability under various storage and working conditions.
  • aptamers have demonstrated great potential in a wide range of applications such as drug delivery, regenerative medicine, and biosensing. 111-171
  • the rigorous selection of aptamers from libraries containing approximately 10 14 to 1O 1S molecules presents a significant challenge. 118-201
  • aptamer selection uses an iterative process of enrichment involving incubation, partition, and amplification. These methods typically require eight to fifteen cycles of enrichment, with each cycle reducing the number of aptamer candidates by approximately one order of magnitude. 118-201 This process is associated with several challenges, including PCR amplification bias, ineffective partition, and even conformational changes in proteins or aptamer candidates being selected. 118-201 Furthermore, most selection methods rely on two-dimensional selection matrices (e.g., nitrocellulose membrane). Aptamer candidates in the library can nonspecifically bind to these matrices for enrichment even though depletion steps are involved.
  • two-dimensional selection matrices e.g., nitrocellulose membrane
  • a simple enrichment and selection method that is fundamentally different from existing methods in concept is described. Its working principle is a coupled diffusion-binding process in a three-dimensional space that is non- fouling and highly permeable (FIG. 1). This space allows for free and fast diffusion of oligonucleotides without nonspecific binding or entrapment. Conversely, high-affinity aptamer candidates are restricted in their diffusion and release since this space is rationally designed to immobilize target molecules and the candidates strongly bind to the immobilized targets. Even if a high-affinity candidate dissociates from a target molecule, it will re-bind to the next target molecule down the pathway of diffusion in the three-dimensional space, rather than on a two-dimensional surface. This method is essentially equivalent to an instrument-free, automatic, iterative, and sequential incubation-partition process that does not suffer from nonspecific binding, PCR amplification bias, or reduced sequence diversity.
  • a diffusion-binding model was first used to evaluate the three- dimensional transport behavior of aptamers with different binding affinities as indicated by the Kd values ranging from 1 nM to 10 pM.
  • the parameters used in this model are shown in Table 6.
  • the modeling analysis showed that all aptamers were released from a defined porous space immobilized with target molecules (FIGs. 2A, and 14).
  • the concentrations of the aptamers varied, with a higher concentration observed in the central region and a lower concentration on the periphery.
  • different aptamers exhibited different distribution profiles spatially and retention rates temporarily (FIG. 2A, 14 and FIG. 15A-15B.
  • the retention of the low-affinity aptamer with a Kd of 1 pM at 24 hours was 14.1 % whereas that of the high-affinity aptamer with a Kd of 1 nM was 84.9% (FIG. 2A).
  • the retention of the aptamers with the Kd values ranging from 1 nM to 10 pM at 60 hours was 74.4%, 54.4%, 19.4%, 1.6%, and 0.2%, respectively (FIG. 15A-15B).
  • the retention of the aptamer with a Kd of 1 nM was 46 times as much as that with a Kd of 1 pM. Therefore, the modeling analysis demonstrated that aptamers with different binding affinities have a highly different probability of retention in the porous space immobilized with target molecules due to the coupled diffusion-binding process.
  • the porous PEG hydrogel was synthesized through cryogelation, a process that involves free radical polymerization of PEG monomers and crosslinkers at a cold temperature (FIG. 3 A). Concurrently, ice crystals were formed in the hydrogel network, which created large pores in the hydrogel structure upon melting. To examine the pore structure, confocal laser scanning microscopy (CLSM) was used that does not require any specific sample pre-treatment such as lyophilization. A trace amount of fluorescein PEG acrylate was added to the polymerization solution, revealing the three-dimensional porous structure of the PEG hydrogel (FIG. 3B). Scanning electron microscopy images also confirmed the high porosity of the PEG hydrogel (FIG.
  • CSM confocal laser scanning microscopy
  • Protein immobilization in the macroporous hydrogel network To enable protein immobilization in a three-dimensional space, acrylic acid was added to the pre-gelation solution. After polymerization, the PEG hydrogel network would be incorporated with carboxyl groups that can be easily activated for protein conjugation using the standard carbodiimide chemistry (FIG. 3F).
  • fluorescein-labeled albumin was used as a protein model. After conjugation, the PEG hydrogel was washed and examined using the Maestro Imaging System. The PEG hydrogel without carboxyl groups was used as a control for comparison. The fluorescence images show that albumin was immobilized in the hydrogel network (FIG. 3G), which was confirmed by infrared spectrometry (FIG. 3H).
  • thrombin was immobilized in the PEG hydrogel network and loaded a well-studied thrombin aptamer 60-18(29) into the hydrogel to examine whether aptamers can be retained by immobilized proteins in a three-dimensional space that is highly permeable and non-fouling.
  • This aptamer was acquired through eleven cycles of enrichment using the traditional nitrocellulose membrane filtration method and had a reported Kd of 0.5 nM [10] .
  • the release solutions were examined and imaged the entire hydrogel.
  • the results show that the aptamer 60-18(29) was retained in the hydrogel with a much higher percentage than its low-affinity control aptamer (FIG 2C), with retention percentages of 27% and 9% at 24 hours, respectively.
  • the imaging analysis was consistent with the release examination (FIG 2B).
  • the data demonstrate that low-affinity aptamers can be rapidly released from the three-dimensional macroporous PEG hydrogel whereas high-affinity aptamers can be retained with a higher probability in the PEG hydrogel immobilized with target proteins.
  • the experimental data and the modeling analysis show the same trend of aptamer retention in a macroporous space.
  • the target protein-immobilized (Thrombin, IL10, IL12, BDNF and GMCSF) hydrogel consisted of two components: the PEG-based selection matrix and thrombin or (i.e., other target molecule). Binding to the PEG matrix is considered nonspecific and contributes to background noise. Binding to thrombin, on the other hand, is considered specific and generates a positive signal.
  • the library was rapidly released from the blank thrombin-free PEG hydrogel and its retention in this blank PEG hydrogel was close to 0% by 60 hours (FIG. 4A and FIG. 4B; FIG 21A and 21B), suggesting that the background noise due to nonspecific binding to the PEG matrix reached the minimal level.
  • aptamer pools eluted were collected at two earlier time points including 6 and 24 hours, and evaluated their ability to bind to thrombin using SPR analysis.
  • the data show that the eluted aptamer pools at early time points did not exhibit strong binding signals (FIG. 17C), indicating that the aptamer pools collected at later time points had a stronger binding affinity for the immobilized thrombin than those collected at early time points.
  • the HAS method does not require negative selection because PEG, the selection matrix, is non- fouling.
  • the thrombin concentration was also reduced by 10 and 100 times, and examined the capability of the collected aptamer pools in binding to thrombin. With the decrease of thrombin concentration, the collected aptamer pools did not exhibit strong binding to thrombin (FIG. 18). It suggests that it is important for immobilized thrombin to reach a threshold concentration in the macroporous hydrogel for effective aptamer selection.
  • Anti-thrombin aptamer characterization The aptamer pool collected from the hydrogel at 60 hours was analyzed using next-generation sequencing (Fig. 6). 5,905 sequences were acquired after filtering sequences inconsistent with the library in lengths and primer regions, selected the top 50 sequences representing 300 reads (Table 4) based on their abundance, and grouped them into 9 families (FIG. 19). One member from each family was chosen for analysis. One candidate showed a minimal binding signal, and the other eight candidates exhibited strong SPR binding signals (FIG. 8B and FIGs. 9C, 9D). Of these eight candidates, T.7 exhibited the strongest binding signal with a 1.5 nM Kd (FIG. 9A and FIG. 9B). A simple biosensor was used (FIG. 13A and FIG.
  • T.7 The full-length T.7 aptamer, i.e., T.7(90), has a multiple stem-loop secondary structure (FIG. 12). Based on this secondary structure, T.7 was truncated to generate six shorter aptamer sequences (Table 1). These truncated sequences were tested with SPR. T.7(30) and T.7(45) exhibited low binding strength whereas the other four truncated aptamers exhibited high binding affinities similar to the original T.7 aptamer (FIG. 9C and FIG. 9D ).
  • Thrombin was purposely chosen as the representative protein model for aptamer selection since the two well-characterized and widely used anti-thrombin aptamers, 15-mer and 60-18(29) J 10 - 31 ] could be used as gold standards to compare the efficacy of the HAS method to traditional SELEX methods. Both 15-mer and 60-18(29) were selected through over ten cycles of SELEX enrichment. The SPR analysis showed that T.7(40) exhibited a binding affinity comparable to 15-mer and 60-18(29) (FIG. 9C and FIG. 9D and FIG. 20B). Thus, the data show that HAS is effective in selecting high-affinity aptamers in one single step.
  • aptamers were selected against four additional proteins with pl values covering the range from 5 to 9. These proteins were granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin- 12 (IL- 12), IL- 10, and brain derived neurotrophic factor (BDNF), which represent negatively, neutrally, and positively charged molecules.
  • GM-CSF granulocyte-macrophage colony-stimulating factor
  • IL- 12 interleukin- 12
  • BDNF brain derived neurotrophic factor
  • the library was released more slowly from the protein-immobilized PEG hydrogel than the blank protein-free hydrogel.
  • the one-step enriched aptamer pools showed stronger binding to the target proteins than the initial library. Aptamers with low Kd values were identified from the enriched pools.
  • the successful selection of aptamers against a range of proteins with varying charges suggests that the HAS method is effective for discovering aptamers against diverse targets.
  • the sequences and structures of aptamer candidates against these proteins are shown in Table 3.
  • IL10.11 3 GGCGTCTTGTATAATACCATTCGCATTGTGCAAAATGGTC
  • 2xT.IL10.13 13 TGCAAAATAGTGCACGCGGGGGAGTTGACGGGCTGATCTG
  • 2xT.IL10.14 18 CGCCCTGGCTATCGTTAAAGCCGCTACGATGCAGAGTGCA
  • IL12.36 32 TGCAACGGGGCCGACCCGACATTTTGGCAGTGGGAGAACG
  • IL12.35 33 GGCCTAGGGACACGCTCTCCAACAAGAGCATGAGGGGCAA
  • IL12.13 34 AGGTAACAGTTACCAATCTTTTTGAGGATAGCATTTGGAA
  • IL12.20 37 AGTTGGCCTAATGTAACGCCAAGGTGCCAAGTGTTTCTAT
  • IL12.10 38 TCGGACTGGTTTGAGGGTTGCGGAACAGAGCCGTACCCCA IL12.33 39 TGTGATGTATATTAAGCGTGGGCCTCTATCGCACGCTTAC
  • IL12.5 40 ACACGACATATCCACGTTAACCACATAATCCGCTGTGGTA
  • IL12.4 41 CAAATTGGCACCTACTCGTAGAATAAGGTAATTGTGCTCT
  • IL12.3 42 TACACTTGTACACGTAATCGTAGGGGGACGGTAACGGGTC
  • T.2 48 TTAGCACTTTATTTAGGTTTTCGGGCCACGTGTGGTTG
  • BDNF.3 97 CTTATAGCTTGGGAAAAGTCCCTAATCAGATGATGTTTCA
  • BDNF.7 98 ATGCGCCAATTTAGGTATAAAATGTAAAGAGTCATGATAG
  • BDNF11 100 GTAGTTAGATTTCATCTTTGCTTGTATGCTTATGTTATAA
  • BDNF.12 101 GACTGATGTTACGCTGTGCGATCATGCGGACGCGCGGTTG
  • BDNF.48 105 AAGGCGCCGAGACGTAGTAATAAGTCGGGGGAAAGGTGAA BDNF.53 106 ACCATTATATTCGAATGGACTCAACCAGCTCCAACACATA
  • IL10 or IL 12 or T * IL10 or IL 12 or T.
  • XX is nomenclature coding where of IL10, or IL12 or T target protein, XX- selected candidate number), sequence highlighted in bold were selected for further validation study.
  • Aptamer selection systems consist of three main components including a target molecule, an aptamer library, and a selection matrix.
  • the major variable determining optimal aptamer selection is the selection matrix that can take various forms, such as a membrane, particle, or device. As long as a selection matrix is used, one has to consider the binding of the library to the matrix. This library-matrix binding has to be minimized or avoided since it is a nonspecific binding that directly affects the efficiency of aptamer enrichment. Thus, the development of effective selection methods highly relies on choosing or establishing an appropriate selection matrix.
  • capillary electrophoresis-based aptamer selection a promising method, requires a capillary that still acts as a selection matrix or support.
  • the capillary may cause nonspecific binding and electrostatic interactions.
  • electrophoresis needs to be conducted under the influence of ionic current and electric field, which involves buffer solutions with low ionic strength that differ from physiological conditions and potentially affect the conformation and interactions of proteins and aptamers As a selection matrix has to be used, it is necessary to minimize or eliminate its interaction with the library.
  • a macroporous PEG hydrogel is used as the selection matrix since PEG is the most well-studied non-fouling molecule.
  • aptamer selection processes Two types of nonspecific binding need to be considered in aptamer selection processes.
  • One is the nonspecific binding between the library and the selection matrix as discussed above.
  • the other is the random or low-affinity binding of sequences to the immobilized target molecules. Therefore, apart from minimizing the nonspecific binding between the library and the matrix, it is important to eliminate sequences that bind nonspecifically to the target molecules. In the HAS method, this elimination is achieved through a coupled diffusion-binding process.
  • Aptamer candidates exist either in a free state or in a bound state. Their concentrations in these states are determined by their binding affinities or dissociation constants. High-affinity candidates have a lower concentration in the free state, and vice versa.
  • Aptamers were selected against five proteins with the pl values ranging from 5 to 9 to avoid the potential bias of selecting aptamers against positively charged proteins that are typically considered as “aptamer-friendly” or “selection-friendly” molecules in the field.
  • GM-CSF is the most negatively charged molecule with the lowest pl value.
  • specific advantages or disadvantages in the enrichment of the aptamer pool against GM-CSF were not observed in comparison to the other four neutrally or positively charged proteins.
  • HAS can be applied to the selection of aptamers against other molecules or even living cells if they can be chemically immobilized or physically entrapped in the macroporous PEG hydrogel under mild conditions.
  • aptamer selection is accomplished in 60 hours under the current working conditions that may decrease cell viability.
  • HAS can be optimized or integrated with other methods for a shorter duration of aptamer selection, HAS may be applied to select aptamers against targets beyond proteins. Beyond its application in aptamer selection, the HAS method holds promising potential for screening other types of drugs or ligands, such as bacteriophages. Future effort can be made to explore these potentials.
  • HAS is simple, fast, low-cost, and instrument- free for the enrichment of aptamer pools and the selection of aptamers. HAS holds great potential to promote the development of various areas ranging from drug development to clinical diagnosis.
  • ssDNA library and aptamers were obtained from Integrated DNA technologies (Coralville, IA). The aptamer library and primer sequences are reported in Table 2 of Example 1. Recombinant carrier free proteins, human Interleukin- 10 (IL- 10), murine interleukin- 12 (IL- 12), Brain-derived neurotropic factor (BDNF), and granulocyte-macrophage colony-stimulating factor (GM-CSF) expressed in Spodoptera frugiperda (SF 21) insect cells were procured from R&D systems (Minneapolis, MN).
  • IL- 10 human Interleukin- 10
  • IL- 12 murine interleukin- 12
  • BDNF Brain-derived neurotropic factor
  • GM-CSF granulocyte-macrophage colony-stimulating factor expressed in Spodoptera frugiperda
  • Thrombin (T) from human plasma poly (ethylene glycol) monomethyl ether monoacrylate (PEGMA, M n 480), polyethyl glycol diacrylate (PEGDA, M n 750), N-hydroxysuccinimide (NHS), N-(3-Dimethylaminopropyl)-N'-ethylcarbodiimide (EDC), ethanolamine, morpholine ethane sulfonic acid (MES), triton-X, calcium chloride (CaCh), sodium chloride (NaCl), magnesium chloride (MgCh), tetramethylethylenediamine (TEMED), ammonium persulphate (APS), acrylic acid, fluorescein o-acrylate and Amicon Ultra 3-10 kDa cut-off filter were all procured from Sigma Aldrich (St.
  • PEGDA polyethyl glycol diacrylate
  • NHS N-hydroxysuccinimide
  • EDC N-(3-Dimethyla
  • COMSOL Multiphysics v.6.0 was used to simulate DNA diffusion from hydrogel. ‘Transport of Diluted Species in Porous Media’ was applied in the model. A hydrogel disc with a diameter of 6 mm and height of 2 mm was constructed. The initial concentration of DNA in the release medium was assumed to be zero. The aptamers were initially bound to the protein immobilized in the porous hydrogel. Other parameters used for the model are summarized in Table SI. After all the parameters were input into the model, a simulation was executed over 60 h and data were collected at 12 h increments.
  • PEG hydrogels were synthesized using a method previously reported in literature with slight modifications. 1401 Briefly, a petri dish (35mm diameter) was coated with 2 mL of 4% (w/v) Pluronic F-127 surfactant for 2 min and air-dried after the surfactant removal. Meanwhile, a mixture of 2 mL of 10% (v/v) PEGMA and 0.2% (v/v) PEGDA was prepared and supplemented with 0.2% (v/v) TEMED, 4% (w/v) APS and 1% (v/v) acrylic acid in IxPBS of pH 7.3 and kept on ice. The pH of the polymerization solution was adjusted with 1 M NaOH before APS and TEMED were added.
  • Carboxyl groups were incorporated into the PEG hydrogel through the addition of acrylic acid in the polymerization solution. Carboxyl groups were activated using EDC/NHS for covalent immobilization of protein via the formation of amide bonds.
  • the hydrogel was first dehydrated by blotting the gel with Kimwipes. Then the gel was incubated in a mixture of freshly prepared 30 mM EDC and 20 mM NHS in 300 pL 10 mM MES buffer of pH 5.0 for Ih at 4°C. After washing, the activated hydrogel was incubated with l ug of protein in I xPBS (300 pL) at room temperature for 2h.
  • the protein-conjugated PEG hydrogel was washed for three times with washing buffer (IxPBS, 0.2% Triton X, 300 mM NaCl) under shaking to remove loosely/physically bound proteins and stored at 4°C until used.
  • FITC tagged BSA was used for the examination and demonstration of the successful protein conjugation.
  • the conjugation efficiency of the protein was determined by quantification of the fluorescent signal throughout the hydrogel.
  • the PEG hydrogel was examined under the scanning electron microscope (SEM) (Sigma VP-FESEM, Zeiss), and confocal scanning microscope (Fluoview 3000, Olympus).
  • SEM scanning electron microscope
  • the lyophilized hydrogel was coated with iridium prior to imaging.
  • the pore sizes were determined from SEM images using ImageJ.
  • confocal imaging of the hydrogel a fluorescent hydrogel was prepared by adding (0.04 wt % fluorescein o-acrylate) during the hydrogel synthesis using the protocol as mentioned previously. After the hydrogel was washed thoroughly to remove monomers and mounted on the coverslip, images were captured at lOx magnification.
  • the swelling ratio of the hydrogel was calculated by dividing the mass of the fully swollen hydrogel by the mass of the dried hydrogel.
  • FTIR spectra were collected using lyophilized hydrogel on a vertex 70 spectrometer (Brucker optics, Billeric, MA). A spectrum scanning was performed from 2000 to 500 cm' 1 and absorbance was calculated by referencing the clear bare diamond crystal.
  • Rheological characterizations were performed by TA-instrument Discovery HR-2 rheometer. Each experiment was carried with a 20 mm diameter parallel plate and 200 pm gap at room temperature. Typically, frequency sweeps were tested from 0.1 to 100 rad/s at 0.1% strain and amplitude sweeps were tested from 0.1% to 30% strain at 1 rad/s.
  • the gel was incubated in 400 pL BB at 4°C on shaker for diffusion of loosely bound ssDNA from the hydrogel.
  • the binding buffer was collected and replaced with fresh binding buffer at intervals of 12 h and this step was repeated up to 60 hours.
  • the hydrogel was treated with 400 pL of IM NaCl for overnight to elute aptamer candidates from the PEG hydrogel.
  • the eluted ssDNA sequences were desalted with Zeba desalting column and concentrated over the speed vac concentrator until approximately -50-100 pL solution was obtained.
  • the concentrated ssDNA sequences were amplified by PCR using the primers with following conditions: initial denaturation 98°C for 2 mins, followed by 25 cycles of 98°C-10 s, 68°C-12 s, 72°C- 5 s and final extension at 72°C for 5 min (Table 5).
  • the sequence length and purity of PCR products were subsequently checked by running the samples on 2.0% agarose gel for 45 min at 90 V in lx TBE.
  • the target band was cut, and DNA band was extracted with GeneJet extraction kit by following the manufacturer’s protocol and the purified product was used for sequencing.
  • PCR amplified product was PCR amplified with 3 ' biotin tagged reverse primer.
  • the PCR amplified product was incubated with 25 p L streptavidin coated magnetic beads in binding buffer at room temperature for 30 min. The conjugated beads were then washed with binding buffer and ssDNA strands were separated from biotinylated strands using 100 pL of 100 mM NaOH.
  • the pH of separated strand was adjusted to pH 7.3+ 0.5 with 10.5 pL of IM KH2PO4 and quantified with nanodrop after the background substruction with respective buffer.
  • Electrophoretic mobility shift assay (EMSA)
  • Protein at various concentrations and 250 nM of separated ssDNA or aptamer were mixed in the binding buffer (25 pL) and incubated at room temperature for 30 min.
  • the protein- ssDNA complexes were loaded in a 10% PAGE-TBE gel and separated at 90 V for 2hr at 4°C. After electrophoresis, the gel was stained with SYBR gold for 15 min for visualization.
  • SPR Surface plasmon resonance
  • the left channel of the sensor chip was activated by the mixture of 400 mM EDC and 200 mm NHS in 10 mM (pH 5.5) MES buffer at flow rate of 20 pL/min for 15 min. Later, the left channel was immobilized with protein (10 pg/mL in 10 mM MES buffer, pH 5.5) for 20 min at 10 pL/min, followed by blocking with IM ethanol amine. Before the measurement, the system was equilibrated with running buffer until stable sensorgram signal was observed. The running buffer was a binding buffer supplemented with 0.05% of Tween-20.
  • the solution of analytes was passed over the SPR chip at 20 pL/min for association followed by a dissociation phase with binding buffer.
  • the SPR chip was regenerated by washing with 30 mM NaOH at 100 pL/min for 1 min.
  • Data was collected using SPR Autolink Software (Reichert Technologies) and analyzed using Scrubber and Origin software.
  • the Kd value of the aptamer was calculated by plotting a graph of maximum SPR response versus the concentration of proteins and fitted in single ligand binding model of Scrubber 2.0 software.
  • binding and Competition assay was performed using 5 ⁇ m thrombin-coated microparticles (MPs). To prepare the thrombin-coated MPs, 0.1 mg (20 pL 0.5% w/v) streptavidin modified MPs were treated with 1 pg biotinylated thrombin at room temperature. After 1 h incubation, the MPs were washed twice with DPBS to remove the excessive biotinylated thrombin.
  • Fam labeled aptamer T7(59), T7(40) 29mer, 15mer or scrambled aptamer KK was added into the solution (Table 2 of Example 1).
  • the samples were incubated at room temperature for 1 hour followed by gentle washing with binding buffer (same as the aptamer selection buffer) twice.
  • binding buffer as the aptamer selection buffer
  • the microparticles were examined using flow cytometer.
  • the Fam labeled aptamer was fixed at 2.5 pM.
  • the heparin solution with varied concentrations (0, 0.025, 0.25, 2.5, 7.5, 25, 75, 150, 250 pM) was added to compete against the aptamers.
  • the final volume was 400 pL. After 1 h incubation at room temperature, all samples were washed with binding buffer and measured using flow cytometry.
  • the functionalized MB was suspended in buffer and stored at 4 °C.
  • 200 pL of functionalized MB was incubated with the solution of protein at room temperature. After 30 min incubation, the supernatant was collected for fluorescence analysis (excitation at X493 nm and emission at Is 17 nm) using Tecan M200 pro. Binding specificity was evaluated with the same method.
  • a standard aptamer structure consists of conserved forward primer binding region, reverse primer binding region, and in between 40 N random region. These primer regions were sequentially deleted and their effect on binding was evaluated with SPR. Truncation was further performed based on the analysis of the secondary structure derived from M-fold.
  • compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims and any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims.
  • Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims.
  • other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited.
  • a combination of steps, elements, components, or constituents may be explicitly mentioned herein; however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne des procédés d'identification ou de production d'un aptamère sur une cible. La cible peut être conjuguée à un hydrogel microporeux. L'invention concerne également des complexes aptamère-cible comprenant un aptamère et une cible, la cible étant conjuguée à un hydrogel poreux, et l'aptamère s'associant sélectivement à la cible.
PCT/US2023/081604 2022-11-29 2023-11-29 Matériaux et procédés de sélection d'aptamères WO2024118776A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263428466P 2022-11-29 2022-11-29
US63/428,466 2022-11-29
US202363472942P 2023-06-14 2023-06-14
US63/472,942 2023-06-14

Publications (1)

Publication Number Publication Date
WO2024118776A1 true WO2024118776A1 (fr) 2024-06-06

Family

ID=91324926

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/081604 WO2024118776A1 (fr) 2022-11-29 2023-11-29 Matériaux et procédés de sélection d'aptamères

Country Status (1)

Country Link
WO (1) WO2024118776A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009146147A2 (fr) * 2008-04-05 2009-12-03 University Of Florida Research Foundation, Inc. Hydrogels réactifs à une cible
WO2013056090A1 (fr) * 2011-10-12 2013-04-18 University Of Connecticut Substances à base d'affinité pour la séparation et la récupération non-destructives de cellules
US20130196915A1 (en) * 2010-01-23 2013-08-01 Yong Wang Affinity hydrogels for controlled protein release
US20170326058A1 (en) * 2016-03-04 2017-11-16 NEXMOS Co.,Ltd Method for preventing spontaneous oxidation of antioxidant using aptamer, aptamer-based control of the release rate of active ingredient in the hydrogel, material and use thereof
US20220162559A1 (en) * 2018-07-11 2022-05-26 Clemson University Research Foundation Myocardial organoids and methods of making and uses thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009146147A2 (fr) * 2008-04-05 2009-12-03 University Of Florida Research Foundation, Inc. Hydrogels réactifs à une cible
US20130196915A1 (en) * 2010-01-23 2013-08-01 Yong Wang Affinity hydrogels for controlled protein release
WO2013056090A1 (fr) * 2011-10-12 2013-04-18 University Of Connecticut Substances à base d'affinité pour la séparation et la récupération non-destructives de cellules
US20170326058A1 (en) * 2016-03-04 2017-11-16 NEXMOS Co.,Ltd Method for preventing spontaneous oxidation of antioxidant using aptamer, aptamer-based control of the release rate of active ingredient in the hydrogel, material and use thereof
US20220162559A1 (en) * 2018-07-11 2022-05-26 Clemson University Research Foundation Myocardial organoids and methods of making and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SOONTORNWORAJIT BOONCHOY, ZHOU JING, WANG YONG: "A hybrid particle–hydrogel composite for oligonucleotide-mediated pulsatile protein release", SOFT MATTER, ROYAL SOCIETY OF CHEMISTRY, GB, vol. 6, no. 17, 1 January 2010 (2010-01-01), GB , pages 4255, XP093183399, ISSN: 1744-683X, DOI: 10.1039/c0sm00206b *

Similar Documents

Publication Publication Date Title
Kohlberger et al. SELEX: Critical factors and optimization strategies for successful aptamer selection
US12098370B2 (en) Method for generating aptamers with improved off-rates
DK2489743T3 (en) Aptamers with 5- (N-naphthyl) substituted uridines
Pfeiffer et al. Customised nucleic acid libraries for enhanced aptamer selection and performance
Tolle et al. Dressed for success–applying chemistry to modulate aptamer functionality
US8404830B2 (en) Method for generating aptamers with improved off-rates
JP2005517436A5 (fr)
EP2589657A9 (fr) Procédé de détection de molécule cible
Singh et al. High-affinity one-step aptamer selection using a non-fouling porous hydrogel
KR20100120293A (ko) 양이온성 ｓｉＲＮＡ, 합성 및 ＲＮＡ 간섭을 위한 용도
WO2024118776A1 (fr) Matériaux et procédés de sélection d'aptamères
WO2023009898A1 (fr) Xna fonctionnellement amélioré
AU2015249082B2 (en) Method for generating aptamers with improved off-rates
Vlassov et al. Nucleic acids: structures, functions, and applications
WO2003014369A1 (fr) Ligands d'acides nucleiques a duplexes intramoleculaires

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23898800

Country of ref document: EP

Kind code of ref document: A1