WO2024115767A1

WO2024115767A1 - Nomacopan-pas fusion proteins

Info

Publication number: WO2024115767A1
Application number: PCT/EP2023/083992
Authority: WO
Inventors: Miles Nunn; Uli Binder; Michaela Gebauer
Original assignee: Volution Immuno Pharmaceuticals Sa
Priority date: 2022-12-01
Filing date: 2023-12-01
Publication date: 2024-06-06
Also published as: GB202218084D0

Abstract

The invention is directed to fusion proteins and their use in the treatment of complement-mediated and/or LTB4-mediated diseases; to nucleic acid molecules encoding said fusion proteins; to vectors and host cells comprising said nucleic acid molecules; and to methods of producing said fusion proteins.

Description

NOMACOPAN-PAS FUSION PROTEINS

FIELD OF THE INVENTION

The present invention relates to fusion proteins and their use in the treatment of complement- mediated and/or LTB4-mediated diseases, including paroxysmal nocturnal hemoglobinuria (PNH), atypical haemolytic uremic syndrome (aHUS), neuromyelitis optica spectrum disorder (NMOSD), myasthenia gravis (MG) and retinal diseases, for example for intravitreal or subcutaneous administration.

All documents mentioned in the text and listed at the end of this description are incorporated herein by reference.

BACKGROUND TO THE INVENTION

Complement can be activated inappropriately under certain circumstances leading to undesirable local tissue destruction. Inappropriate complement activation has been shown to play a role in a wide variety of diseases and disorders, such as paroxysmal nocturnal hemoglobinuria (PNH), atypical haemolytic uremic syndrome (aHUS), neuromyelitis optica (NMOSD), myasthenia gravis (MG), and certain conditions of the eye, such as retinal diseases, in particular geographic atrophy (GA). Inappropriate activation of the complement system has thus been a target for therapeutic intervention for many years and numerous complement inhibitors targeting different parts of the complement cascade are under development for therapeutic use.

The invention concerns fusion proteins, which may be used in the treatment of complement-mediated and/or LTB4-mediated diseases or conditions. For example, fusion proteins of the invention are particularly useful for the treatment of PNH, aHUS, NMOSD and MG, or for the treatment of conditions of the eye, such as retinal diseases.

Retinal diseases

Various conditions of the eye involve retinal damage and/or retinal cell death. This damage and/or cell death may be caused by choroidal neovascularisation (CNV) and/or inflammation and may be due in part to the inflammatory Vascular Endothelial Cell Growth Factor A (VEGF-A).

Proliferative retinal conditions are retinal conditions that involve the formation and overgrowth of blood vessels on or beneath the retina (e.g., CNV). For example, blood vessels can be produced in response to reduced blood supply caused by retinal ischaemia. This neovasculation occurs in general in response to VEGF, which stimulates the production of new blood vessels on the optic disc or on the retinal surface. However, these new blood vessels are particularly weak, prone to leaking and can easily rupture resulting in haemorrhage and severe visual loss. Alternatively, or additionally, retinal conditions may be caused by inflammation causing direct retinal cell death. For example, early stages of age-related macular degeneration (AMD) are characterized by the presence and accumulation of drusen, which are extracellular deposits of cellular debris including protein and lipid aggregates. Late-stage AMD can be wet AMD, which is characterised by CNV, or dry AMD, which is characterised by inflammation and retinal cell death. Geographic atrophy (GA) is a late, advanced form of dry AMD. In dry AMD and GA it is thought that drusen components (such cellular debris, complement components, lipids, lipoproteins, amyloid deposits and other products of oxidative stress) trigger inflammation through pathways of the complement cascade [1], This inflammation can ultimately lead to the characteristic retinal cell death [2], Wet and dry AMD can occur simultaneously in the same eye. Retinal diseases of interest include dry AMD (e.g., GA), diabetic retinopathy, retinopathy of prematurity (ROP), uveitis (e.g., autoimmune uveitis, infective uveitis), optic neuritis (e.g. glaucoma associated optic neuritis), wet AMD (e.g., choroidal neovascularisation), diabetic macular oedema, retinal vein occlusion, Stargardt disease, polypoidal choroidal vasculopathy, retinitis pigmentosa, hypertension retinopathy, and sickle cell retinopathy. Of particular interest is dry AMD, especially GA, an advanced form of dry AMD.

Current treatments for certain of these conditions exist. For example, in noninfectious uveitis, treatment is focused on control of eye inflammation with anti-inflammatory medications, e.g. corticosteroids injected intravitreally. For wet AMD, diabetic macular odema, retinal vein occlusion, and diabetic retinopathy current treatments include anti-VEGF treatment. These include anti VEGF-A antibodies or fragments thereof (such as bevacizumab (A vastin), ranibizumab (Lucentis), and brolucizumab (Beovu)), anti-VEGF aptamers (such as pegaptanib (Macugen)), and other VEGF antagonists such as aflibercept (Eylea), a recombinant fusion protein consisting of VEGF-binding portions from the extracellular domains of human VEGF receptors 1 and 2 that are fused to the Fc portion of the human lgG1 immunoglobulin. These treatments have also been proposed and are being tested for ROP.

In 2022, there was no approved treatment for dry AMD nor GA. Treatments being investigated for dry AMD (e.g., GA) include avacincaptad pegol (Zimura), a stabilized aptamer which binds to and inhibits the cleavage of C5 [3], and pegcetacoplan/APL-2 (Empaveli), a symmetrical molecule comprised of two identical pentadecapeptides covalently bound to the ends of a linear 40-kDa PEG molecule which binds to and inhibits cleavage of C3 [4], However, with both these treatments there is an increased risk of CNV in about 10% of the patients, (~2-4 fold increase in the rate of CNV compare to sham) that receive these drugs. When GA patients receiving Zimura or pegcetacoplan develop CNV (wet AMD) they are treated with anti-VEGF inhibitors. CNV is more sight threatening than GA alone.

In 2023, two new treatments were approved - SYFOVRE™ (pegcetacoplan injections) and IZERVAY™ (avacincaptad pegol), both of which are complement inhibitors for the treatment of GA secondary to AMD [5], [6], Many of the aforementioned treatments require intravitreal injection every approximately 1 to 2 months. For example, SYFOVRE™ is approved for intravitreal injection every 25-60 days [5], while IZERVAY™ is approved for intravitreal injection once every month for up to 12 months [6], Since intravitreal injections are associated with side effects such as anxiety, discomfort, inflammation (leading to e.g., redness, pain), retinal detachment, hemorrhage, and bacterial infection (e.g., endophthalmitis), improved treatments for such conditions, and in particular improved intravitreal treatments would be desirable. For example, an improved treatment may provide a longer dosing interval than existing treatments.

Complement

The complement system is an essential part of the body’s natural defence mechanism against foreign invasion and is also involved in the inflammatory process. More than 30 proteins in serum and at the cell surface are involved in the functioning and regulation of the complement system. Recently, it has become apparent that, as well as the approximately 35 known components of the complement system, which may be associated with both beneficial and pathological processes, the complement system itself interacts with at least 85 biological pathways with functions as diverse as angiogenesis, platelet activation and haemostasis, glucose metabolism and spermatogenesis.

The complement system is activated by the presence of materials that are recognised by the immune system as non-self. Three activation pathways exist: (1) the classical pathway which is activated by IgM and IgG complexes or by recognition of certain carbohydrates; (2) the alternative pathway which is activated by non-self surfaces (lacking specific regulatory molecules) and by bacterial endotoxins; and (3) the lectin pathway which is activated by binding of mannan-binding lectin (MBL) to mannose residues on the surface of a pathogen. The three pathways comprise parallel cascades of events that result in the production of complement activation through the formation of similar C3¹ and C5 convertases on cell surfaces, resulting in the release of acute mediators of inflammation (C3a and C5a) and the formation of the membrane attack complex (MAC). The parallel cascades involved in the classical (here defined as classical via C1q and lectin via MBL) and alternative pathways are shown in Figure 1 of [30],

The classical complement pathway, the alternative complement pathway and the lectin complement pathway are herein collectively referred to as the complement pathways. Cleavage of C5 to C5b and C5a initiates the ‘late’ or ‘terminal’ events of complement activation. These comprise release of the

¹ It is conventional to refer to the components of the complement pathway by the letter “C” followed by a number, such as “3”, such that “C3” refers to complement protein C3. Some of these components are cleaved during activation of the complement system and the cleavage products are given lower case letters after the number. Thus, C5 is cleaved into fragments which are conventionally labelled C5a and C5b. The complement proteins do not necessarily act in their number order and so the number does not necessarily give any indication of the order of action. This naming convention is used in this application. proinflammatory anaphylatoxin C5a which activates cells by binding to specific G-protein coupled receptors, and formation of the MAC by interaction of the terminal complement components (C6, C7, C8 and C9) with C5b, which creates a pore in the cell membranes of some pathogens which can lead to cell death or a pore in self cells which can activate them towards a proinflammatory state without causing lysis.

LTB4

Leukotriene B4 (LTB4) is the most powerful chemotactic and chemokinetic eicosanoid described and promotes adhesion of neutrophils and other white blood cells to the vascular endothelium via upregulation of integrins [7], It is also a complete secretagogue for neutrophils, induces their aggregation and increases microvascular permeability. LTB4 recruits and activates natural killer cells, monocytes and eosinophils. It increases superoxide radical formation [8] and modulates gene expression including the production of a number of proinflammatory cytokines and mediators which may augment and prolong tissue inflammation [9,10], LTB4 also has roles in the induction and management of adaptive immune responses. For example, regulation of dendritic cell trafficking to draining lymph nodes [11 ,12], Th2 cytokine IL-13 production from lung T cells [13], recruitment of antigen-specific effector CD8+ T cells [14] and activation and proliferation of human B lymphocytes [15].

LTB4 and the hydroxyeicosanoids mediate their effects though the BLT1 and BLT2 G-protein coupled receptors on cell surfaces [16,17], Human BLT1 is a high affinity receptor (KD 0.39 - 1 ,5nM; [18]) specific for LTB4 with only 20-hydroxy LTB4 and 12-epi LTB4 in high concentrations able to displace LTB4 in competitive binding studies [19], Human BLT2 has a 20-fold lower affinity (KD 23nM) for LTB4 than BLT1 and is activated by a broader range of eicosanoids including 12-epi LTB4, 20-hydroxy LTB4, 12(S)- and 15(S)-HETE and 12(S)- and 15(S)-HPETE [19],

Human BLT1 is mainly expressed on the surface of leukocytes, though it has recently been described in endothelial cells and vascular smooth muscle cells. Human BLT2 is expressed in a broader range of tissue and cell types. A number of specific small molecule antagonists of BLT1 and BLT2 have been described which inhibit activation, extravasation and apoptosis of human neutrophils [20 ] and reduce symptoms caused by neutrophil infiltration in mouse models of inflammatory arthritis [21] and renal ischaemia reperfusion [22], Increasing numbers of studies indicate that both BLT1 and BLT2 can mediate pathological effects through LTB4 and hydroxyeicosanoids [23], although BLT1 certainly has a dominant role in some pathologies such as collagen induced arthritis in mice [24], BLT1-/- deficient mice have also highlighted the importance of BLT1 in directing neutrophil migration in inflammatory responses. In particular, a 5-LOX deficient mouse strain was used to show autocrine activation of BLT1 on neutrophils is needed fortheir recruitment into arthritic joints [25],

A number of marketed drugs target the eicosanoids. These include the glucocorticoids which modulate phospholipase A2 (PLA2) and thereby inhibit release of the eicosanoid precursor arachidonic acid (AA) [26], Non-steroidal anti-inflammatory drugs (NSAID) and other COX2 inhibitors which prevent synthesis of the prostaglandins and thromboxanes [27], There are also a number of leukotriene (LK) modifiers which either inhibit the 5-LOX enzyme required for the synthesis of LTB4 synthesis and other LK including the anti-inflammatory LK lipoxin (Zileuton; [28]) or antagonise the CysLTI receptor that mediates the effects of cysteinyl leukotrienes (Zafirlukast and Montelukast) [29], The LK modifiers are orally available and have been approved by the FDA for use in the treatment of e.g. asthma. No drug that acts specifically on LTB4 or its G-protein coupled receptors has yet reached the market.

Complement inhibitors

W02004/106369 ([30]) relates to complement inhibitors. A particular subset of the disclosed complement inhibitors are directed at C5 and prevent C5 being cleaved into C5a and C5b by any of the complement activation pathways. A particular example of such an inhibitor of C5 cleavage is a protein produced by ticks of the species Ornithodoros moubata, which in mature form is a protein consisting of amino acids 19 to 168 of the amino acid sequence shown in Figure 4 of [30], In [30], this protein is known by the names “rVA576”, “EV576” and “OmCI protein” and has more recently been known as “Coversin” [31], This protein is referred to herein as “nomacopan” which is the INN for the protein.

In the tick, nomacopan is expressed as a pre-protein having a leader sequence comprising amino acids 1 to 18 of the amino acid sequence of SEQ ID NO: 2 at the N-terminal end of the mature nomacopan protein. The leader sequence is cleaved off after translation. The mature protein has the sequence consisting of amino acids 19 to 168 of the amino acid sequence [30] of SEQ ID NO: 2.

Nomacopan also has the ability to inhibit leukotriene B4 (LTB4) activity by sequestering it within the body of the protein. The ability to bind LTB4 may be demonstrated by standard in vitro assays known in the art, for example by means of a competitive ELISA between nomacopan and an anti-LTB4 antibody competing for binding to labelled LTB4, by isothermal titration calorimetry or by fluorescence titration.

There are a number of further patent applications, such as WO 2007/028968, WO 2008/029167, WO 2008/029169, WO 2011/083317, WO 2015/185760, WO 2016/198133, WO 2018/193120, WO 2018/193121 , WO 2018/193122, WO 2020/053206, WO 2020/216513, and WO 2021058117 which relate to the use of nomacopan and functional equivalents thereof in various applications.

WO2020/216513 [32] provides experimental evidence that confirms the efficacy of nomacopan and functional equivalents thereof in the treatment of eye conditions via intravitreal administration.

However, due to its small size (16.8kDa with a hydrodynamic radius of between 2.2 and 2.45nm) the half-life of nomacopan is quite short, for example it is approximately 0.2 hours in the plasma of mice. Frequent intravitreal administration of nomacopan may be required for treatment of certain conditions of the eye, such as retinal diseases. Frequent subcutaneous administration of nomacopan may also be required for treatment of complement-mediated and/or LTB4-mediated diseases or conditions, such as PNH, aHUS, NMOSD or MG.

PASylation®

PASylation® is a technology developed by XL-protein (http://xl-protein.com/) which involves the genetic fusion of a PAS sequence to a polypeptide of interest. WO2008/155134 [58] described PAS sequences consisting of proline, alanine, and serine residues. Subsequently, WO2011/144756 [33] described sequences consisting of proline and alanine (but not serine) residues.

As used herein, the term “PA(S) polypeptides” encompasses polypeptides which comprise, consist essentially of, or consist of proline, alanine, and serine residues (referred to herein as “PAS polypeptides”), and polypeptides which comprise, consist essentially of, or consist of proline and alanine residues (referred to herein as “PA polypeptides”). PA(S) polypeptides are conformationally disordered and composed of repeats of amino acid sequences.

Exemplary PAS polypeptides are described in [58], Exemplary PA polypeptides are described in [33], PA(S) polypeptides adopt a random coil conformation. PA(S) polypeptides typically comprise up to 600 amino acids, for example 200 or 400 or 600 amino acids [34], PA(S) polypeptides reduce clearance rates by kidney filtration in biological systems and increase plasma half-life of the proteins to which they are fused following systemic administration ([35]). Fusion of a 600 amino acid long PAS polypeptide (‘PAS600’) to nomacopan has been described as increasing the plasma half-life in mice by 52-fold from 0.2 hours to 10.4 hours [36], However, further improvements to half-life/increases in hydrodynamic radius are desirable to enable a longer interval between injections, for example between intravitreal injections or between subcutaneous injections. Also, whilst it is desirable to extend the half-life of nomacopan within the plasma, or within the eye (e.g., the vitreous), this must be carefully balanced with several other factors for optimal performance. In particular, it is important to find an optimal balance between half-life and factors such as, but not limited to viscosity, dose volume (particularly for intravitreal administration, especially injection), solubility, potency assessed by measuring affinity and/or avidity for C5 and/or LTB4, drug stability, ease of manufacture (e.g., expression, purification), and drug tolerability.

SUMMARY OF THE INVENTION

The invention provides a fusion protein comprising: a) a first bioactive polypeptide, wherein the first bioactive polypeptide comprises amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and b) a first PA(S) polypeptide, wherein the first bioactive polypeptide and the first PA(S) polypeptide together comprise at least 900 amino acids. In some embodiments, the fusion protein has: i) a calculated hydrodynamic radius of at least 9.2 nm, and/or ii) a hydrodynamic radius determined by dynamic light scattering (DLS) of at least 9.4 nm. In a first aspect, the first PA(S) polypeptide is fused to the N-terminus of the first bioactive polypeptide. In some of such embodiments, the first PA(S) polypeptide comprises at least 800 amino acids. In some of such embodiments, the first PA(S) polypeptide comprises at least 1000 amino acids. In some of such embodiments, the first PA(S) polypeptide comprises at least 1200 amino acids.

In a second aspect, the fusion protein further comprises: c) a second bioactive polypeptide comprising amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, wherein the first bioactive polypeptide is fused to the N-terminus of the PA(S) polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PA(S) polypeptide, optionally via a linker. In some of such embodiments, the first PA(S) polypeptide comprises at least 600 amino acids.

In a third aspect, the fusion protein further comprises: c) a second bioactive polypeptide comprising amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and d) a second PA(S) polypeptide, wherein the first PA(S) polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PA(S) polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide. In some of such embodiments, the first and/or the second PA(S) polypeptide comprises at least 400 amino acids. In some of such embodiments, the first and/or the second PA(S) polypeptide comprises at least 600 amino acids.

In some embodiments, one or more of the fusions is via a linker.

In some embodiments, the first and/or the second bioactive polypeptide comprises the sequence of amino acids 19 to 168 of SEQ ID NO: 2, in which up to 50 amino acid substitutions, insertions or deletions have been made, and the polypeptide binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, wherein each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of the mature Nomacopan molecule as set out in SEQ ID NO: 4 is retained and at least 5, 10, or 15 or each of the LTB4 binding residues and at least 5, 10, 15, or 20 or each of C5 binding residues set is retained or is subject to a conservative modification, wherein the LTB4 binding residues are Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp115 (numbering according to SEQ ID NO:4) and the C5 binding residues are Val26, Val28, Arg29, Ala44, Gly45, Gly61 , Thr62, Ser97, His99, His101 , Met 114, Met 116, Leu117, Asp118, Alai 19, Gly120, Gly121 , Leu122, Glu123, Val124, Glu125, Glu127, His146, Leu147 and Asp 149 (numbering according to SEQ ID NO:4). In some of such embodiments, the first and/or the second bioactive polypeptide, up to 2, 3, 4, 5, 10, 15, or 20 of the LTB4 and C5 binding residues are subject to a conservative modification. In some of such embodiments, in the first and/or the second bioactive polypeptide, at least 5, 10, or 15 or each of the LTB4 binding residues and at least 5, 10, 15, or 20 or each of the C5 binding residues is retained. In some of such embodiments, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained or is subject to a conservative modification. In some of such embodiments, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained or is subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, or 20 of the C5 and/or LTB4 binding residues are subject to a conservative modification. In some preferred embodiments, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained.

In some embodiments, the first and/or the second bioactive polypeptide comprises a sequence having at least 80% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2. In some embodiments, the first and/or the second bioactive polypeptide comprises a sequence having at least 90% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2. In some preferred embodiments, the first and/or the second bioactive polypeptide comprises a sequence having at least 95% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2.

In some preferred embodiments, the first and/or the second bioactive polypeptide: a) binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, or b) binds to LTB4 but has reduced or absent C5-binding activity.

In some preferred embodiments, the first and/or the second bioactive polypeptide comprises or consists of the sequence of amino acids 19 to 168 of SEQ ID NO: 2.

In some embodiments, the first and/or the second bioactive polypeptide comprises or consists of a fragment of the bioactive polypeptide as defined herein, wherein the bioactive polypeptide: a) binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, or b) binds to LTB4 but has reduced or absent C5-binding activity.

In some embodiments, the first and the second bioactive polypeptides are identical. In some preferred embodiments, the first and/or the second PA(S) polypeptide mediates increased in vivo and/or in vitro stability of the first and/or the second bioactive polypeptide. In some preferred embodiments, the first and/or the second PA(S) polypeptide forms a random coil conformation.

In some embodiments, the first and/or the second PA(S) polypeptide is a PAS polypeptide. In some embodiments, the first and/or the second PAS polypeptide consists of proline, alanine, and serine residues. In some embodiments, the first and/or the second PAS polypeptide comprises a plurality of amino acid repeats, wherein each repeat consists of proline, alanine, and serine residues and wherein no more than 6 consecutive amino acid residues are identical. In some embodiments, proline residues constitute more than 4% and less than 40% of the amino acids of the first and/or the second PAS polypeptide. In some embodiments, the first and/or the second PAS polypeptide comprises or consists of repeats of a sequence selected from the group consisting of: ASPAAPAPASPAAPAPSAPA (SEQ ID NO: 15); AAPASPAPAAPSAPAPAAPS (SEQ ID NO: 16); APSSPSPSAPSSPSPASPSS (SEQ ID NO: 17); SAPSSPSPSAPSSPSPASPS (SEQ ID NO: 18); SSPSAPSPSSPASPSPSSPA (SEQ ID NO: 19); AASPAAPSAPPAAASPAAPSAPPA (SEQ ID NO: 20); and ASAAAPAAASAAASAPSAAA (SEQ ID NO: 21). In some embodiments, the first and/or the second PAS polypeptide comprises or consists of repeats of SEQ ID NO: 15.

In some embodiments, the first and/or the second PA(S) polypeptide comprise a maximum of 1200, 1400, or 1600 amino acids. In some embodiments, the first and the second PA(S) polypeptides are identical.

In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 37. In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 39. In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 41. In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 43. In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 45. In some embodiments, the fusion protein comprises or consists of SEQ ID NO: 47.

The invention further provides a pharmaceutical composition comprising a fusion protein described herein. In some preferred embodiments, the pharmaceutical composition is formulated for subcutaneous administration. In some preferred embodiments, the pharmaceutical composition is formulated for intravitreal administration. In some embodiments, the pharmaceutical composition is formulated for administration by injection. In some embodiments, the pharmaceutical composition has a viscosity of up to 30 cP.

The invention further provides a unit dose comprising a fusion protein described herein or a pharmaceutical composition described herein.

The invention further provides a fusion protein described herein, a pharmaceutical composition described herein, or a unit dose described herein, for use in a method of treatment.

The invention further provides a fusion protein described herein, a pharmaceutical composition described herein, or a unit dose described herein, for use in a method of treating a complement- mediated and/or LTB4-mediated disease or condition. In some embodiments, the complement- mediated and/or LTB4-mediated disease or condition is selected from PNH, aHUS, NMOSD and MG. In some embodiments, the complement-mediated and/or LTB4-mediated disease or condition is a retinal disease. In some embodiments, the retinal disease is selected from the group consisting of: dry AMD (e.g., GA), diabetic retinopathy, retinopathy of prematurity, uveitis (e.g., autoimmune uveitis, infective uveitis), optic neuritis (e.g. glaucoma associated optic neuritis), wet AMD (e.g., CNV), diabetic macular oedema, retinal vein occlusion, Stargardt disease, polypoidal choroidal vasculopathy, retinitis pigmentosa, hypertension retinopathy, and sickle cell retinopathy. In some preferred embodiments, the retinal disease is dry AMD or GA.

In some embodiments, the method comprises administering the fusion protein to a subject, wherein the subject is preferably a human. In some preferred embodiments, the fusion protein is administered subcutaneously. In some preferred embodiments, the fusion protein is administered intravitreally. In some embodiments, the fusion protein is administered by injection. In some embodiments, the fusion protein is administered: once every at least 2 months; once every at least 3 months; once every at least 4 months; once every at least 6 months; one every 2 to 6 months; or once every from 3 to 6 months.

The invention further provides a polynucleotide encoding a fusion protein described herein. The invention further provides a vector comprising a polynucleotide described herein. The invention further provides a cell expressing a fusion protein described herein or comprising a polynucleotide or vector described herein. The invention further provides a method of producing a fusion protein described herein, comprising: providing a cell described herein, and purifying the fusion protein from the cell or its culture medium.

DETAILED DESCRIPTION

Fusion proteins

The invention provides fusion proteins comprising or consisting of a) a bioactive polypeptide, wherein the first bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and b) a PA(S) polypeptide. Said bioactive polypeptide and PA(S) polypeptide may be referred to as the ‘first’ bioactive polypeptide and the ‘first’ PA(S) polypeptide, respectively, in embodiments where the fusion protein may further comprise an additional bioactive polypeptide(s) and/or an additional PA(S) polypeptide(s). The bioactive polypeptide may be any bioactive polypeptide described herein. The PA(S) polypeptide may be any PA(S) polypeptide described herein. Preferably, the PA(S) polypeptide is a PAS polypeptide.

Typically, the first bioactive polypeptide and the first PA(S) polypeptide together comprise more than 751 amino acids (i.e. at least 752 amino acids), e.g. when the first bioactive polypeptide consists of 150 amino acids. Preferably, the first bioactive polypeptide and the first PAS polypeptide together comprise more than 871 amino acids (i.e. at least 872 amino acids), e.g. when the first bioactive polypeptide consists of 150 amino acids. Most preferably, the first bioactive polypeptide and the first PAS polypeptide together comprise at least 900 amino acids. In some embodiments, the first bioactive polypeptide and the first PA(S) polypeptide together comprise at least 950 amino acids, at least 1000 amino acids, at least 1050 amino acids, at least 1100 amino acids, at least 1150 amino acids, at least 1200 amino acids, at least 1250 amino acids, at least 1300 amino acids, at least 1350 amino acids, at least 1400 amino acids, at least 1450 amino acids, or at least 1500 amino acids.

Typically, the fusion protein comprises more than 751 amino acids (i.e. at least 752 amino acids), e.g. when the first bioactive polypeptide consists of 150 amino acids. Preferably, the fusion protein comprises more than 871 amino acids (i.e. at least 872 amino acids), e.g. when the first bioactive polypeptide consists of 150 amino acids. Most preferably, the fusion protein comprises at least 900 amino acids. In some embodiments, the fusion protein comprises at least 950 amino acids, at least 1000 amino acids, at least 1050 amino acids, at least 1100 amino acids, at least 1150 amino acids, at least 1200 amino acids, at least 1250 amino acids, at least 1300 amino acids, at least 1350 amino acids, at least 1400 amino acids, at least 1450 amino acids, or at least 1500 amino acids.

As used herein, ‘calculated molecular weight’ (also referred to as ‘calculated Mw’ or simply ‘Mw’) means the sum of the atomic masses of all atoms in a molecule. Typically, the fusion protein has a calculated Mw of at least 80 kDa. In some embodiments, the fusion protein has a calculated Mw of at least 90 kDa, at least 100 kDa, at least 110 kDa, at least 120 kDa, or at least 130 kDa.

As used herein, ‘apparent molecular weight’ (also referred to as ‘apparent Mw’) means the Mw as determined experimentally, for example by size exclusion chromatography (SEC) or dynamic light scattering (DLS). Apparent Mw can be significantly higher than calculated Mw. SEC methods are known in the art [37], DLS methods are known in the art [38], PA(S) polypeptides and fusion proteins comprising PA(S) polypeptides as described herein may have an unexpectedly high apparent Mw compared to their calculated Mw. For example, the apparent Mw, e.g. as determined by SEC, may be at least 8x, 9x, 10x, 11x, 12x, 13x, 14x, or 15x higher than the calculated Mw. The apparent Mw, e.g. as determined by DLS, may be at least 7x, 8x, 9x, or 10x higher than the calculated Mw. Typically, the fusion protein has an apparent Mw as determined by SEC of at least 640 kDa. In some embodiments, the fusion protein has an apparent Mw as determined by SEC of at least 800 kDa, at least 1000 kDa, at least 1200 kDa, at least 1400 kDa, at least 1600 kDa, or at least 1800 kDa. Typically, the fusion protein has an apparent Mw as determined by DLS of at least 630 kDa. In some embodiments, the fusion protein has an apparent Mw as determined by DLS of at least 700 kDa, at least 800 kDa, at least 900 kDa, at least 1000 kDa, at least 1100 kDa, or at least 1200 kDa. In certain embodiments the apparent Mw is determined by SEC performed on a cross-linked agarose polymeric matrix column, at a flow rate of 0.5 mL/min and using PBS as a running buffer (e.g. as described in Example 6). In certain embodiments the apparent Mw is determined by DLS performed in PBS at 25 °C using a DLS instrument equipped with a 3 mm path length quartz cuvette (e.g. as described in Example 7).

In general, Mw correlates positively with hydrodynamic radius, although the relationship is not linear and differs between molecules, depending on their shape. Compact, well-folded proteins diffuse faster than extended, poorly folded proteins, and thus have a smaller hydrodynamic radius.

As used herein, ‘hydrodynamic radius’ (also referred to as ‘Rh’, ‘Stokes radius’, or ‘Stokes-Einstein radius’) of a molecule means the radius of a hard sphere that diffuses at the same rate as the molecule in solution. It factors in not only size but also solvent effects. As used herein, ‘calculated hydrodynamic radius’ means a hydrodynamic radius estimated/predicted based on calculated Mw. As used herein, ‘apparent hydrodynamic radius’ means a hydrodynamic radius as determined experimentally, for example by analytical gel filtration (also known as size exclusion chromatography, SEC) [37, 58, 39] or DLS [38, 40] . In some embodiments, the fusion protein has an apparent hydrodynamic radius, e.g. determined by dynamic light scattering (DLS), of at least 9 nm, at least 10 nm, at least 11 nm, at least 12 nm, at least 13 nm, at least 14 nm, or at least 15 nm. As used herein, the ‘half-life’ (also referred to as ‘elimination half-life’) of a molecule means the time it takes for the concentration of the molecule to halve. When a molecule is delivered systemically (including subcutaneously) half-life is usually measured in blood, plasma or serum. When a molecule is delivered directly to the eye, the half-life can be measured in the vitreous. Methods for determining half-life (including vitreal half-life) are known in the art, e.g., [58, 41], In humans, vitreal half-life is estimated from repeat sampling of aqueous humour.

In some embodiments, the fusion protein has a half-life (preferably a blood, plasma or serum half-life) of at least 5 days. In some embodiments, the half-life is at least 6 days, preferably at least 7 days, more preferably at least 8 days. In some embodiments, the fusion protein has an even longer half-life of at least 9 days, preferably at least 10 days, more preferably at least 11 days, even more preferably at least 12 days.

In some embodiments, the fusion protein has a half-life (preferably an aqueous humour half-life or a vitreal half-life, more preferably a vitreal half-life, e.g. in a human eye) of at least 7 days. In some embodiments, the half-life is preferably at least 8 days, more preferably at least 9 days, even more preferably at least 10 days. In some embodiments, the fusion protein has an even longer half-life of at least 11 days, preferably at least 12 days, more preferably at least 13 days, even more preferably at least 14 days, yet more preferably at least 15 days.

In some embodiments, the vitreal half-life of the fusion protein is at least 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 12 fold, or higher than the vitreal half-life of the bioactive polypeptide alone (i.e., not PASylated). For example, the vitreal half-life of the fusion protein is at least 2 fold, 4 fold, 6 fold, 8 fold, 10 fold, 12 fold, or higher than vitreal half-life of nomacopan (i.e., residues 19 to 168 of SEQ ID NO:2).

It is not in all cases possible to measure half-life, however the apparent hydrodynamic radius generally provides a reasonable estimate of vitreal half-life. In some embodiments the apparent hydrodynamic radius of the fusion protein is at least 4 fold, 5 fold, 6 fold, or 7 fold higher than the apparent hydrodynamic radius of the bioactive polypeptide alone (e.g., nomacopan).

Although a longer half-life is highly desirable, it must be balanced with other factors, such as affinity of the bioactive polypeptide for its target ligands, i.e., C5 and/or LTB4. Preferably, the fusion proteins described herein comprise at least one bioactive polypeptide having an affinity for C5 and/or LTB4 that is at least 50% as strong as nomacopan’s affinity for C5 and/or LTB4 (i.e., residues 19 to 168 of SEQ ID NO:2), preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, yet more preferably at least 90% as strong a nomacopan. In most preferred embodiments, the fusion proteins described herein comprise at least one bioactive polypeptide having an affinity (e.g., KD) for C5 and/or LTB4 that is as strong as nomacopan, or stronger. In embodiments comprising more than one (e.g., two) bioactive polypeptides, one of the bioactive polypeptides may have an affinity for C5 and/or LTB4 which is lower than nomacopan. For example, a bioactive polypeptide fused at its C-terminus to a PA(S) polypeptide may have a lower affinity for C5 than nomacopan, because nomacopan binding to C5 includes an interaction via its C-terminus. However, preferably, the affinity (e.g., KD) of the fusion protein for C5 and/or LTB4 is at least 50% of the affinity of nomacopan (i.e., residues 19 to 168 of SEQ ID NO:2) for C5 and/or LTB4, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, yet more preferably at least 90% of the affinity of nomacopan for C5 and/or LTB4. In most preferred embodiments, the fusion proteins described herein comprise at least one bioactive polypeptide having an affinity for C5 and/or LTB4 that is as strong as nomacopan, or stronger. Even if the affinity of a certain fusion protein for its target ligand(s), e.g., C5 and/or LTB4, is low, e.g., lower than nomacopan, its longer half-life may compensate for the lower affinity such that desirable levels of in vivo activity are achieved. Moreover, fusion proteins comprising multiple bioactive polypeptides may lead to advantageous avidity effects.

Three different formats of fusion protein as described in detail in the following sections, namely 1) PA(S)-nomacopan fusion proteins, 2) nomacopan-PAS-nomacopan fusion proteins, and 3) PAS- nomacopan-PAS-nomacopan fusion proteins.

1) PA(S)-nomacopan fusion proteins

The invention provides fusion proteins comprising or consisting of a) a bioactive polypeptide, wherein the first bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and b) a PA(S) polypeptide, and optionally a linker, for example between the bioactive polypeptide and the PA(S) polypeptide. Such fusion proteins may be referred to herein as, ‘PA(S)-nomacopan’ fusion proteins. Typically, the fusion protein comprises or consists of precisely one bioactive polypeptide and precisely one PA(S) polypeptide.

In PA(S)-nomacopan fusion proteins, the PA(S) polypeptide comprises at least 725 amino acids. Typically, the PA(S) polypeptide comprises at least 750 amino acids. In some embodiments, the PA(S) polypeptide comprises at least 800 amino acids, at least 850 amino acids, at least 900 amino acids, at least 950 amino acids, at least 1000 amino acids, at least 1050 amino acids, at least 1110 amino acids, at least 1150 amino acids, or at least 1200 amino acids.

In some embodiments, the PA(S) polypeptide comprises up to 800 amino acids, up to 850 amino acids, up to 900 amino acids, up to 950 amino acids, up to 1000 amino acids, up to 1050 amino acids, up to 1110 amino acids, up to 1150 amino acids, up to 1200 amino acids, up to 1250 amino acids, up to 1300 amino acids, up to 1350 amino acids, 1400 amino acids, up to 1450 amino acids, up to 1500 amino acids, up to 1550 amino acids, or up to 1600 amino acids.

In preferred embodiments, the PA(S) polypeptide comprises at least 800 amino acids. For example, in some embodiments, the PA(S) polypeptide comprises from 800 amino acids to 1000 amino acids. In some embodiments, the PA(S) polypeptide comprises from 800 amino acids to 1200 amino acids. In some embodiments, the PA(S) polypeptide comprises from 800 amino acids to 1400 amino acids. In some embodiments, the PA(S) polypeptide comprises from 800 amino acids to 1600 amino acids. In some embodiments, the PA(S) polypeptide consists of 800 amino acids.

In preferred embodiments, the PA(S) polypeptide comprises at least 1000 amino acids. For example, in some embodiments, the PA(S) polypeptide comprises from 1000 amino acids to 1200 amino acids. In some embodiments, the PA(S) polypeptide comprises from 1000 amino acids to 1400 amino acids. In some embodiments, the PA(S) polypeptide comprises from 1000 amino acids to 1600 amino acids. In some embodiments, the PA(S) polypeptide consists of 1000 amino acids.

In preferred embodiments, the PA(S) polypeptide comprises at least 1200 amino acids. For example, in some embodiments, the PA(S) polypeptide comprises from 1200 amino acids to 1400 amino acids. In some embodiments, the PA(S) polypeptide comprises from 1200 amino acids to 1600 amino acids. In some embodiments, the PA(S) polypeptide consists of 1200 amino acids.

The bioactive polypeptide typically comprises at least 140 amino acids. The bioactive polypeptide preferably comprises at least 145 amino acids, more preferably at least 146 amino acids, more preferably at least 147 amino acids, even more preferably at least 148 amino acids, yet more preferably at least 149 amino acids, most preferably at least 150 amino acids.

The bioactive polypeptide typically comprises up to 160 amino acids. The bioactive polypeptide preferably comprises up to 155 amino acids, more preferably up to 154 amino acids, more preferably up to 153 amino acids, even more preferably up to 152 amino acids, yet more preferably up to 151 amino acids, most preferably up to 150 amino acids. Preferably the bioactive polypeptide consists of 150 amino acids.

In some embodiments, the fusion protein comprises a minimum number of amino acids which is a) the minimum number of amino acids in the PA(S) polypeptide (as described above) plus b) the minimum number of amino acids in the bioactive polypeptide (as described above). For example, in preferred embodiments, the fusion protein comprises at least 950 amino acids. In other preferred embodiments, the fusion protein comprises at least 1150 amino acids. In other preferred embodiments, the fusion protein comprises at least 1350 amino acids.

The PA(S) polypeptide may be fused to the N-terminus or the C-terminus of the bioactive polypeptide. Preferably, the PA(S) polypeptide is fused to the N-terminus of the bioactive polypeptide. Fusion may be direct (i.e., not via a linker) or indirect (i.e., via a linker).

Preferably, the C-terminus of the bioactive polypeptide is not fused to a PA(S) polypeptide. More preferably the C-terminus of the bioactive polypeptide is not fused to anything (it is free). This may be preferable because the C-terminus of nomacopan binds to C5.

In preferred embodiments, the fusion protein comprises or consists of: a) a bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, or SEQ ID NO: 22, 23, 24, or 25, and b) a PAS polypeptide comprising or consisting of at least 40 repeats of SEQ ID NO: 15, 16, 17, 18, 19, 20, or 21 , wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide.

In certain preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, and b) a PAS polypeptide comprising or consisting of 40 repeats of SEQ ID NO:15 (i.e., SEQ ID NO:32), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 37 (‘PAS800-nomacopan’).

In certain preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, and b) a PAS polypeptide comprising or consisting of 50 repeats of SEQ ID NO:15 (i.e., SEQ ID NO:33), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 39 (‘PASI OOO-nomacopan’).

In certain preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, and b) a PAS polypeptide comprising or consisting of 60 repeats of SEQ ID NO:15 (i.e., SEQ ID NO:34), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 41 (‘PAS1200-nomacopan’).

In other preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), and b) a PAS polypeptide comprising or consisting of 40 repeats of SEQ ID NO:15 (i.e., SEQ ID NO: 32), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 38 (‘PAS800-L-nomacopan’).

In other preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), and b) a PAS polypeptide comprising or consisting of 50 repeats of SEQ ID NO:15 (i.e., SEQ ID NO: 33), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 40 (‘PAS1000-L-nomacopan’).

In other preferred embodiments, the fusion protein comprises or consists of a) a bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), and b) a PAS polypeptide comprising or consisting of 60 repeats of SEQ ID NO:15 (i.e., SEQ ID NO: 34), wherein the PAS polypeptide is fused to the N-terminus of the bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 42 (‘PAS1200-L-nomacopan’).

As discussed previously, it is important to find an optimal balance between half-life and other factors. PA(S)-nomacopan fusion proteins may be beneficial because they may have a long half-life whilst also having a high yield, being easy to purify, having a suitable viscosity, and retaining C5 and/or LTB4 binding affinity.

2) Nomacopan-PA(S)-nomacopan fusion proteins

The invention provides fusion proteins comprising or consisting of a) a first bioactive polypeptide, wherein the first bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, b) a PA(S) polypeptide, and c) a second bioactive polypeptide, wherein the second bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and optionally one or more linkers. Such fusion proteins may be referred to herein as, ‘nomacopan- PA(S)-nomacopan’ fusion proteins. Typically, the fusion protein comprises or consists of precisely two bioactive polypeptides and precisely one PA(S) polypeptide.

In some embodiments, the PA(S) polypeptide comprises at least 400 amino acids, at least 450 amino acids, at least 500 amino acids, at least 550 amino acids, at least 600 amino acids. In some embodiments, the PA(S) polypeptide comprises at least 650 amino acids, at least 700 amino acids, at least 750 amino acids, at least 800 amino acids, at least 850 amino acids, at least 900 amino acids, at least 950 amino acids, at least 1000 amino acids, at least 1050 amino acids, at least 1110 amino acids, at least 1150 amino acids, or at least 1200 amino acids.

In some embodiments, the PA(S) polypeptide comprises up to 600 amino acids, up to 650 amino acids, up to 700 amino acids, up to 750 amino acids, up to 800 amino acids, up to 850 amino acids, up to 900 amino acids, up to 950 amino acids, up to 1000 amino acids, up to 1050 amino acids, up to 1110 amino acids, up to 1150 amino acids, up to 1200 amino acids, up to 1250 amino acids, up to 1300 amino acids, up to 1350 amino acids, 1400 amino acids, up to 1450 amino acids, up to 1500 amino acids, up to 1550 amino acids, or up to 1600 amino acids.

In some embodiments, the PA(S) polypeptide comprises at least 600 amino acids. In some embodiments, the PA(S) polypeptide comprises from 600 amino acids to 800 amino acids. In some embodiments, the PA(S) polypeptide comprises from 600 amino acids to 1000 amino acids. In some embodiments, the PA(S) polypeptide comprises from 600 amino acids to 1200 amino acids. In some embodiments, the PA(S) polypeptide comprises from 600 amino acids to 1400 amino acids. In some embodiments, the PA(S) polypeptide comprises from 600 amino acids to 1600 amino acids. In some embodiments, the PA(S) polypeptide consists of 600 amino acids.

The first and second bioactive polypeptides typically each comprise at least 140 amino acids. The first and second bioactive polypeptides preferably each comprise at least 145 amino acids, more preferably at least 146 amino acids, more preferably at least 147 amino acids, even more preferably at least 148 amino acids, yet more preferably at least 149 amino acids, most preferably 150 amino acids. The first and second bioactive polypeptides typically each comprise up to 160 amino acids. The first and second bioactive polypeptides preferably each comprise up to 155 amino acids, more preferably up to 154 amino acids, more preferably up to 153 amino acids, even more preferably up to 152 amino acids, yet more preferably up to 151 amino acids, most preferably up to 150 amino acids. Preferably the first and second bioactive polypeptide each consist of 150 amino acids.

In some embodiments, the fusion protein comprises a minimum number of amino acids which is a) the minimum number of amino acids in the first bioactive polypeptide plus b) the minimum number of amino acids in the PA(S) polypeptide (as described above) plus c) the minimum number of amino acids in the second bioactive polypeptide. For example, in preferred embodiments, the fusion protein comprises at least 900 amino acids.

In preferred embodiments, the first bioactive polypeptide is fused to the N-terminus of the PA(S) polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PA(S) polypeptide. In other words, preferably, the PA(S) polypeptide separates the first bioactive polypeptide from the second bioactive polypeptide. Fusion of the first bioactive polypeptide to the PA(S) polypeptide may be direct or indirect.

Preferably, the C-terminus of the second bioactive polypeptide is not fused to a PA(S) polypeptide. More preferably the C-terminus of the second bioactive polypeptide is not fused to anything (it is free). This may be preferable because the C-terminus of nomacopan binds to C5.

The first and the second bioactive polypeptides may be identical or different but are preferably identical.

In preferred embodiments, the fusion protein comprises or consists of: a) a first bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, or SEQ ID NO: 22, 23, 24, or 25, b) a PAS polypeptide comprising or consisting of at least 30 repeats of SEQ ID NO: 15, 16, 17, 18, 19, 20, or 21 , and c) a second bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, or SEQ ID NO: 22, 23, 24, or 25 wherein the first bioactive polypeptide is fused to the N-terminus of the PAS polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PAS polypeptide

In certain preferred embodiments, the fusion protein comprises or consists of: a) a first bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, b) a PAS polypeptide comprising or consisting of 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), and c) a second bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, wherein the first bioactive polypeptide is fused to the N-terminus of the PAS polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PAS polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 43 (‘nomacopan-PAS600-nomacopan’). In certain preferred embodiments, the fusion protein comprises or consists of: a) a first bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), b) a PAS polypeptide comprising or consisting of 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), and c) a second bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), wherein the first bioactive polypeptide is fused to the N-terminus of the PAS polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PAS polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 44 (‘L-nomacopan-PAS600-L-nomacopan’).

Nomacopan-PA(S)-nomacopan fusion proteins may be beneficial because they may have a long halflife and may also have a particularly high C5 activation-inhibitory activity due to the avidity effect of multiple bioactive polypeptides, e.g., multiple nomacopan polypeptides.

3) PA(S)-nomacopan-PA(S)-nomacopan fusion proteins

The invention provides fusion proteins comprising or consisting of a) a first bioactive polypeptide, wherein the first bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, b) a first PA(S) polypeptide, c) a second bioactive polypeptide, wherein the second bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and d) a second PA(S) polypeptide, and optionally one or two or three or more linkers. Such fusion proteins may be referred to herein as, ‘PA(S)-nomacopan-PA(S)-nomacopan’ fusion proteins.

Typically, the fusion protein comprises or consists of precisely two PA(S) polypeptides and precisely two bioactive polypeptides.

In some embodiments, the PA(S) polypeptide comprises up to 400 amino acids, up to 450 amino acids, up to 500 amino acids, up to 550 amino acids, up to 600 amino acids, up to 650 amino acids, up to 700 amino acids, up to 750 amino acids, up to 800 amino acids, up to 850 amino acids, up to 900 amino acids, up to 950 amino acids, up to 1000 amino acids, up to 1050 amino acids, up to 1110 amino acids, up to 1150 amino acids, up to 1200 amino acids, up to 1250 amino acids, up to 1300 amino acids, up to 1350 amino acids, 1400 amino acids, up to 1450 amino acids, up to 1500 amino acids, up to 1550 amino acids, or up to 1600 amino acids.

In some embodiments, the first and/or the second PA(S) polypeptide comprises at least 400 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide comprises from 400 amino acids to 600 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide comprises from 400 amino acids to 800 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide comprises from 400 amino acids to 1000 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide consists of 400 amino acids.

In some embodiments, the first and/or the second PA(S) polypeptide comprises at least 600 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide comprises from 600 amino acids to 800 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide comprises from 600 amino acids to 1000 amino acids. In some embodiments, the first and/or the second PA(S) polypeptide consists of 600 amino acids.

The first and second bioactive polypeptides typically each comprise at least 140 amino acids. The first and second bioactive polypeptides preferably each comprise at least 145 amino acids, more preferably at least 146 amino acids, more preferably at least 147 amino acids, even more preferably at least 148 amino acids, yet more preferably at least 149 amino acids, most preferably 150 amino acids.

The first and second bioactive polypeptides typically each comprise up to 160 amino acids. The first and second bioactive polypeptides preferably each comprise up to 155 amino acids, more preferably up to 154 amino acids, more preferably up to 153 amino acids, even more preferably up to 152 amino acids, yet more preferably up to 151 amino acids, most preferably up to 150 amino acids. Preferably the first and second bioactive polypeptide each consist of 150 amino acids.

In some embodiments, the fusion protein comprises a minimum number of amino acids which is a) the minimum number of amino acids in the first PA(S) polypeptide (as described above) b) the minimum number of amino acids in the first bioactive polypeptide plus c) the minimum number of amino acids in the second PA(S) polypeptide (as described above) plus d) the minimum number of amino acids in the second bioactive polypeptide. For example, in preferred embodiments, the fusion protein comprises at least 1100 amino acids. In other preferred embodiments, the fusion protein comprises at least 1500 amino acids.

In preferred embodiments, the first PA(S) polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PA(S) polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide. In other words, the first and the second PA(S) polypeptides are separated by the first bioactive protein and the first and the second bioactive polypeptides are separated by the second PA(S) polypeptide. Fusion of the first PA(S) polypeptide to the first bioactive polypeptide may be direct or indirect.

Preferably, the C-terminus of the second bioactive polypeptide is not fused to a PA(S) polypeptide. More preferably the C-terminus of the second bioactive polypeptide is not fused to anything (it is free). This may be preferable because the C-terminus of nomacopan binds to C5. The first and the second PA(S) polypeptides may be identical or different but are preferably identical. The first and the second bioactive polypeptides may be identical or different but are preferably identical.

In preferred embodiments, the fusion protein comprises or consists of: a) a first PAS polypeptide comprising or consisting of at least 20 repeats of SEQ ID NO: 15, 16, 17, 18, 19, 20, or 21 , b) a first bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, or SEQ ID NO: 22, 23, 24, or 25, c) a second PAS polypeptide comprising or consisting of at least 20 repeats of SEQ ID NO: 15, 16, 17, 18, 19, 20, or 21 , and d) a second bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, or SEQ ID NO: 22, 23, 24, or 25, wherein the first PAS polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PAS polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide.

In preferred embodiments, the fusion protein comprises or consists of: a) a first PAS polypeptide comprising or consisting of 20 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 30), b) a first bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, c) a second PAS polypeptide comprising or consisting of at least 20 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 30), and d) a second bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, wherein the first PAS polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PAS polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N- terminus of the second bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 45 (‘PAS400-nomacopan-PAS400-nomacopan’).

In preferred embodiments, the fusion protein comprises or consists of: a) a first PAS polypeptide comprising or consisting of 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), b) a first bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, c) a second PAS polypeptide comprising or consisting of at least 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), and d) a second bioactive polypeptide comprising or consisting of amino acids 19-168 of SEQ ID NO: 2, wherein the first PAS polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PAS polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N- terminus of the second bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 47 (‘PAS600-nomacopan-PAS600-nomacopan’).

In preferred embodiments, the fusion protein comprises or consists of: a) a first PAS polypeptide comprising or consisting of 20 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 30), b) a first bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), c) a second PAS polypeptide comprising or consisting of at least 20 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 30), and d) a second bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), wherein the first PAS polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PAS polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 46 (‘PAS400-L- nomacopan-PAS400-L-nomacopan’).

In preferred embodiments, the fusion protein comprises or consists of: a) a first PAS polypeptide comprising or consisting of 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), b) a first bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), c) a second PAS polypeptide comprising or consisting of at least 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31), and d) a second bioactive polypeptide comprising or consisting of SEQ ID NO: 22, 23, 24, or 25 (preferably SEQ ID NO: 22), wherein the first PAS polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PAS polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide. In a particularly preferred embodiment, the fusion protein comprises or consists of SEQ ID NO: 48 (‘PAS600-L- nomacopan-PAS600-L-nomacopan’).

PA(S)-nomacopan-PA(S)-nomacopan fusion proteins may be beneficial because they may have a particularly long half-life due to the presence of multiple PA(S) polypeptides, a high C5-neutralising activity due to the avidity effect of multiple bioactive polypeptides, and/or lower viscosity.

Other components of fusion proteins

In addition to bioactive polypeptides and PA(S) polypeptides, fusion proteins may comprise other heterologous sequences. The term “heterologous sequence”, when used herein, is intended to designate any polypeptide other than the bioactive polypeptides and the PA(S) polypeptides described herein.

Heterologous sequences that can be present in the fusion protein are preferably present: a) At the N terminus of the fusion protein (e.g. N-terminal of the most N-terminal bioactive polypeptide or PA(S) polypeptide) b) Between components of the fusion protein, e.g., between a bioactive polypeptide and a PA(S) polypeptide c) At the C terminus of the fusion protein.

If the heterologous sequence is at the C-terminus, e.g. C-terminal to the most C-terminal bioactive polypeptide or PA(S) polypeptide, a cleavage sequence that permits the heterologous sequence to be removed may be present. This leaves the standard C-terminus of the bioactive polypeptide free for interaction with its biological target, e.g. binding to C5.

Examples of heterologous sequences, that can be comprised in the fusion proteins, are the following: multimerization domains, domains of extracellular proteins, signal sequences, export sequences, or sequences allowing purification by affinity chromatography. Many of these heterologous sequences are commercially available in expression plasmids since these sequences are commonly included in the fusion proteins in order to provide additional properties without significantly impairing the specific biological activity of the protein fused to them [42],

Examples of such heterologous sequences include: i) affinity tags such as a polyhistidine tag (e.g. a Hise-tag), a polyarginine-tag, the Strep-tag® II (Trp-Ser- His-Pro-GIn-Phe-Glu-Lys), the Twin-Strep® tag (Trp-Ser-His-Pro-GIn-Phe-Glu-Lys-Gly-Gly-Gly-Ser- Gly-Gly-Gly-Ser-Gly-Gly-Ser-Ser-Ala-Trp-Ser-His-Pro-GIn-Phe-Glu-Lys), a GST tag, a FLAG tag, avidin, or an HA tag; ii) prokaryotic secretory signal peptides such as the signal peptide of OmpA, CspA, MalE, CGTase, pelB, CspB, TorA, DsbA or derivatives thereof; iii) eukaryotic secretory signal peptides such as the signal peptide of mating factor a, IgE, insulin, IgG kappa, albumin, azurocidin preproprotein or derivatives thereof; iv) a protease sensitive cleavage site such as a tobacco etch virus (TEV) or a SUMO protease (Ubl- specific protease 1) cleavage site; v) a targeting moiety directed towards human organs, tissues, or cell types; vi) additional functional/effector domains such as a binding protein, an antibody of fragments thereof, an enzyme for target degradation or prodrug activation; and/or vii) domains to improve protein production yields such as thioredoxin, small ubiquitin-like modifier (SUMO), glutathione-S-Transferase, and CspB-fusion tag.

Fusion proteins of the invention do not require linkers. PA(S) polypeptides are themselves unstructured and flexible and thus effectively serve as a linker. In fact, PA(S) polypeptides are known for use as linkers for example see [43] and [44],

Nevertheless, fusion proteins may additionally comprise linker sequences. For example, the bioactive polypeptide(s) and the PA(S) polypeptide(s) of the fusion proteins of the invention may be fused directly (i.e, without a linker) or indirectly, via a linker.

Any unstructured and/or flexible linker could be included within fusion proteins of the invention. In embodiments, the linker may be a peptide linker or non-peptide linker. A peptide linker may be 1-50, 2- 30, 3-20, 5-10, 2-4, or 3-5 amino acids in length. In embodiments, the linker may be 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 amino acids in length. In embodiments, the linker may be up to 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 amino acids in length. In some embodiments, a linker may comprise or consist of glycine and/or serine, for example a linker may have the formula (Gly4Ser)_n, and n is an integer, e.g. 1-10, 2-9, 3-8, 4-7, 5-6. Preferably a linker comprises one or more alanine residues, or consists of alanine residues. More preferably the linker sequence consists of a single alanine residue. Preferably, linkers do not alter the function of the polypeptide(s) to which they are fused. Linkers may be useful for reducing unwanted interactions between the constituent polypeptides of the fusion protein.

In some of the fusion proteins exemplified herein, there is a single alanine at the N-terminus of the bioactive polypeptide, e.g., nomacopan. In some constructs this alanine separates the bioactive polypeptide from a PA(S) polypeptide and thus may be regarded as a linker. However, this alanine is not intended to function as a linker and these fusion proteins do not require this alanine to function. The alanine is present due to the cloning procedure of PA(S) gene cassettes (see Example 1). In some embodiments, fusion proteins of the invention comprise a single alanine residue at the N-terminus of each bioactive polypeptide. In the sequence listing of this application, X is A (alanine) or is deleted (i.e., absent).

Fusion proteins of the invention may further comprise a single proline residue at the N-terminus of the fusion protein. This may optimize translation initiation when the fusion proteins are intracellularly produced in the cytoplasm of E. coli. Alternatively, fusion proteins of the invention may further comprise a single alanine residue at the N-terminus of the fusion protein. This may facilitate signal peptide cleavage in secretary production systems, if the N-terminal residue is not already an alanine.

Immature fusion proteins may comprise a fusion protein of the invention and, at the N-terminus of the fusion protein, a single methionine residue (the methionine would thus be N-terminal of any N-terminal proline or alanine in the fusion protein). This initial methionine is typically intracellularly cleaved by methionine aminopeptidase leading to a mature fusion protein.

Bioactive polypeptides

The fusion proteins of the invention comprise at least one bioactive polypeptide (a ‘first bioactive polypeptide’). In certain embodiments, the fusion protein comprises a single bioactive polypeptide, i.e., precisely one bioactive polypeptide. In other embodiments, the fusion protein comprises at least two bioactive polypeptides (a ‘first bioactive polypeptide’ and a ‘second bioactive polypeptide). In certain embodiments, the fusion protein comprises precisely two bioactive polypeptides.

In embodiments comprising two bioactive polypeptides, each bioactive polypeptide may be the same (identical) or different. Each of the bioactive polypeptides may be independently selected from the bioactive polypeptides described herein. Thus, references herein to ‘a bioactive polypeptide’, ‘the bioactive polypeptide’, or ‘bioactive polypeptides’ should be interpreted as references to ‘the first bioactive polypeptide and/or the second bioactive polypeptide’ unless explicitly specified otherwise.

In the invention, the bioactive polypeptide comprises or consists of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof. As used herein, ‘nomacopan’ refers to a bioactive polypeptide consisting of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2.

Nomacopan was isolated from the salivary glands of the tick O. moubata. Nomacopan is an outlying member of the lipocalin family and is the first lipocalin family member shown to inhibit complement activation. Nomacopan inhibits the classical, alternative and lectin complement pathways by binding to C5 and preventing its cleavage by C5 convertase into C5a and C5b, thus inhibiting both the production of C5a, which is an active (e.g. proinflammatory) peptide, and the formation of the MAC. Nomacopan has been demonstrated to bind to C5 and prevent its cleavage by C5 convertase in rat, mouse and human serum with an IC50 of approximately 0.02mg/ml.

A bioactive polypeptide of the invention may thus comprise or consist of amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or amino acids 1 to 168 of the amino acid sequence of SEQ ID NO: 2. The first 18 amino acids of the protein sequence given in SEQ ID NO: 2 form a signal sequence which is not required for C5 binding or for LTB4 binding activity and so this may optionally be dispensed with, for example, for efficiency of recombinant protein production.

C5 binding properties of bioactive polypeptides

The nomacopan protein has been demonstrated to bind to C5 with a KD of 1 nM or less, determined using surface plasmon resonance (SPR) [45, 46], In fusion proteins of the invention, the bioactive polypeptides preferably retain the ability to bind C5, conveniently with a KD of less than 20nM, more conveniently less than 10nM, most conveniently less than 5nM, preferably less than 2nM, more preferably less than 1 nM, most preferably less than 0.5nM, even more preferably less than 0.4, 0.3, 0.2, 0.1 nM, and advantageously less than 0.05, 0.02, 0.01 nM, wherein said KD is determined using SPR, preferably in accordance with the method described in [45],

Nomacopan inhibits the classical complement pathway, the alternative complement pathway and the lectin complement pathway. Preferably, a bioactive polypeptide binds to C5 in such a way as to stabilize the global conformation of C5 but not directly block the C5 cleavage site targeted by the C5 convertases of the three activation pathways. Binding of nomacopan to C5 results in stabilization of the global conformation of C5 but does not block the convertase cleavage site. Bioactive polypeptides of the invention also preferably share these properties.

C5 is cleaved by the C5 convertase enzyme (Figure 1 of [30]). The products of this cleavage include an anaphylatoxin C5a and C5b which promotes the formation of a complex of C5b, C6, C7, C8 and C9, also known as membrane attack complex (MAC). C5a is a highly pro-inflammatory peptide implicated in many pathological inflammatory processes including neutrophil and eosinophil chemotaxis, neutrophil activation, increased capillary permeability and inhibition of neutrophil apoptosis [47], Monoclonal antibodies (e.g., eculizumab) and small molecules that bind and inhibit C5 have been developed to treat various diseases [48], for example eculizumab is approved for treatment of PNH, atypical haemolytic uremic syndrome (aHUS), neuromyelitis optica spectrum disorder (NMOSD), including neuromyelitis optica (NMO), and myasthenia gravis (MG). However, some of these monoclonal antibodies (mAb) do not bind to certain C5 proteins from subjects with C5 amino acid polymorphisms, and are thus ineffective in these subjects [49], Preferably, the bioactive polypeptide binds to and inhibits cleavage of not only wild-type C5 but also C5 from subjects with C5 polymorphisms that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab. The term “C5 polymorphism” includes any version of C5 which has been changed by insertion, deletion, amino acid substitution, a frame-shift, truncation, any of which may be single or multiple, or a combination of one or more of these changes compared to the wild-type C5. In a human subject, wild-type C5 is considered the C5 protein with accession number NP_001726.2; version GI:38016947. Examples of C5 polymorphisms include polymorphisms at amino acid position 885, e.g. Arg885Cys (encoded by c.2653C>T), Arg885His (encoded by c.2654G>A), and Arg885Ser, which decrease the effectiveness of the mAb eculizumab [49],

The ability of a bioactive polypeptide to bind C5, including C5 from subjects with C5 polymorphisms, e.g. C5 polymorphisms that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab may be determined by standard in vitro assays known in the art, for example by SPR or western blotting following incubation of the protein on the gel with labelled 05. Preferably, the bioactive polypeptide binds C5, either wild-type and/or C5 from subjects with C5 polymorphisms, e.g. C5 polymorphisms that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab, with a 20nM, more conveniently less than 10nM, most conveniently less than 5nM, preferably less than 2nM, more preferably less than 1 nM, most preferably less than 0.5nM, even more preferably less than 0.4, 0.3, 0.2, 0.1 nM, and advantageously less than 0.05, 0.02, 0.01 nM, wherein said KD is determined using SPR, preferably in accordance with the method described in [45],

The bioactive polypeptide may show higher, lower or the same affinity for wild-type C5 and C5 from subjects with C5 polymorphisms, e.g. C5 polymorphisms that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab.

The ability of a bioactive polypeptide to inhibit complement activation may also be determined by measuring the ability of the bioactive polypeptide to inhibit complement activation in serum. For example, complement activity in the serum can be measured by any means known in the art or described herein.

LTB4 binding properties of bioactive polypeptides

The bioactive polypeptide may also be defined as having the function of inhibiting eicosanoid activity.

Nomacopan has also been demonstrated to bind LTB4. In fusion proteins of the invention, the bioactive polypeptides may also retain the ability to bind LTB4 with a similar affinity as the nomacopan protein.

The ability of a bioactive polypeptide to bind LTB4 may be determined by standard in vitro assays known in the art, for example by means of a competitive ELISA between nomacopan and anti-LTB4 antibody competing for binding to labelled LTB4, by isothermal titration calorimetry or by fluorescence titration. Data obtained using fluorescence titration show that nomacopan binds to LTB4 with a KD of between 200 and 300 pM. For example, binding activity for LTB4 (Caymen Chemicals, Ann Arbor, Ml, USA) in phosphate buffered saline (PBS) can be quantified in a spectrofluorimeter e.g. a LS 50 B spectrofluorimeter (Perkin-Elmer, Norwalk, CT, USA). This may be carried out as follows:

Purified 100 nM solutions of nomacopan (or other bioactive polypeptides), in 2 mL PBS were applied in a quartz cuvette (10 mm path length; Hellma, Muhlheim, Germany) equipped with a magnetic stirrer. Temperature was adjusted to 20 °C and, after equilibrium was reached, protein Tyr/Trp fluorescence was excited at 280 nm (slit width: 15 nm). The fluorescence emission was measured at 340 nm (slit width: 16 nm) corresponding to the emission maximum. A ligand solution of 30 pM LTB4 in PBS was added step-wise, up to a maximal volume of 20 pL (1 % of the whole sample volume), and after 30 s incubation steady state fluorescence was measured at each step. For calculation of the KD value, data was normalized to an initial fluorescence intensity of 100 %, the inner filter effect was corrected using a titration of 3 pM N-acetyl-tryptophanamide solution and data was plotted against the corresponding ligand concentration. Then, non-linear least squares regression based on the law of mass action for bimolecular complex formation was used to fit the data with Origin software version 8.5 (OriginLab, Northampton, MA, USA) using a published formula (Breustedt et al., 2006) [50],

Nomacopan may bind LTB4 with a KD of less than 1 nM, more conveniently less than 0.9nM, most conveniently less than 0.8nM, preferably less than 0.7nM, more preferably less than 0.6nM, most preferably less than 0.5nM, even more preferably less than 0.4 nM, and advantageously less than 0.3nM, wherein said KD is determined using fluorescence titration, preferably in accordance with the method above. Bioactive polypeptides of the invention preferably share these properties.

Bioactive polypeptides that bind both C5 and LTB4

In some embodiments, in fusion proteins of the invention, the bioactive polypeptide may bind to both C5 and to LTB4 (e.g. to both wild-type C5 and C5 from subjects with C5 polymorphisms that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab, and to LTB4).

The bioactive polypeptide may thus act to prevent the cleavage of complement C5 by C5 convertase into complement C5a and complement C5b, and also to inhibit LTB4 activity. Using a bioactive polypeptide which binds to both C5 and LTB4 can be advantageous. C5 and the eicosanoid pathway may both contribute to the observed pathology in complement-mediated and/or LTB4-mediated diseases or conditions, such as PNH, aHUS, NMOSD, MG, or certain conditions of the eye, such as retinal diseases. Thus by using a single bioactive polypeptide which inhibits multiple pathways involved in PNH, aHUS, NMOSD, MG or the retinal diseases an enhanced effect may be achieved, compared to using a bioactive polypeptide which inhibits only a single pathway. There are furthermore practical advantages associated with administering a single molecule. One of the potential benefits of the fusion peptides of the invention which contain bioactive polypeptide(s) that bind to both C5 and LTB4 is that inhibition of both complement and LTB4 signalling may avoid the risk of CNV which is observed as a result of the complement inhibitors Zimura and pegcetacoplan in about 10% of the patients that receive these drugs. Zimura and pegcetacoplan have recently completed phase III clinical testing for the treatment of GA and this side effect is undesirable. When GA patients receiving Zimura or pegcetacoplan develop CNV (wet AMD) they require treatment with anti-VEGF inhibitors. LTB4 inhibition by bioactive polypeptides, e.g. nomacopan, may decrease this risk of choroidal neovascularisation because LTB4 plays a key role in the induction of VEGF, a key driver of CNV in the eye [51],

Bioactive polypeptides that bind to LTB4 but have reduced or absent C5 binding

Bioactive polypeptides which do not bind or which show reduced binding to C5, but which do retain LTB4-binding activity are disclosed, for instance, in WO2018/193121 , the entire contents of which are incorporated herein by reference. Such bioactive polypeptides which have reduced or absent C5- binding activity but which retain LTB4-binding ability may be used in all aspects of the present invention.

Such bioactive polypeptides which have reduced or absent C5-binding activity but which retain LTB4- binding ability may comprise or consist of the following sequences:

SEQ ID NO: 22 (SEQ ID NO: 5 of WO2018/193121) is the amino acid sequence of a modified nomacopan in which SEQ ID NO: 4 has been modified to change Met114 to Gin, Met116 to Gin, Leu117 to Ser, Asp118 to Asn, Alai 19 to Gly, Gly120 to Ser, Gly121 to Ala, Leu122 to Asp, Glu123 to Asp and Val124 to Lys. (nomacopan variant 1)

SEQ ID NO: 23 (SEQ ID NO: 6 of WO2018/193121) is the amino acid sequence of a modified nomacopan in which SEQ ID NO: 4 has been modified to change Ala44 to Asn, Met116 to Gin, Leu117 to Ser, Gly121 to Ala, Leu122 to Asp, Glu123 to Ala and Asp149 to Gly. (nomacopan variant 2, also referred to as ‘L-nomacopan’)

SEQ ID NO: 24 (SEQ ID NO: 7 of WO2018/193121) is the amino acid sequence of a modified nomacopan in which SEQ ID NO: 4 has been modified to change Ala44 to Asn, Met116 to Gin, Leu122 to Asp and Asp149 to Gly. (nomacopan variant 3)

SEQ ID NO: 25 (SEQ ID NO: 8 of WO2018/193121) is the amino acid sequence of a modified nomacopan in which SEQ ID NO: 4 has been modified to change Ala44 to Asn. (nomacopan variant 4).

The modified bioactive polypeptides that exhibit a reduced ability to bind to C5 compared to the unmodified nomacopan polypeptide may in some preferred embodiments exhibit no detectable binding to C5. C5 binding may, for example, be reduced by at least 2, 5, 10, 15, 20, 50, 100 fold, or eliminated relative to the binding exhibited by the unmodified nomacopan polypeptide in SEQ ID NO: 4.

In some embodiments C5 binding is reduced by at least 50%, 60%, 70%, 80%, 90% or 95% relative to the unmodified nomacopan polypeptide in SEQ ID NO: 4.

Such bioactive polypeptides may e.g. bind C5 with a KD greater than 1 micromolar as determined by SPR according to the method described in [52], or as set out in Example 2 of WO2018193121 and/or may inhibit sheep red blood cell lysis by less than 10% when present at a concentration of 0.02mg/mL in whole pooled normal serum with the CH50 lytic assay performed according to or similarly to that performed in [53], The ability of the bioactive polypeptides to bind to C5 may also be determined by measuring the ability of the bioactive polypeptide to inhibit complement activation in serum.

In certain preferred embodiments, the bioactive polypeptide comprises or consists of variant 2.

These bioactive polypeptides are examples of functional equivalents of nomacopan which share the molecule’s ability to bind LTB4, but which do not bind C5 or which have reduced binding to C5.

Homologues and sequence identity

A bioactive polypeptide may be a homologue or fragment of nomacopan which (i) retains its ability to bind to C5 and to prevent the cleavage of C5 by C5 convertase into C5a and C5b and/or (ii) which retains its ability to bind LTB4. In certain embodiments the bioactive polypeptide has property (i) and (ii). In other embodiments the bioactive polypeptide has property (ii), but reduced or no binding to C5 (e.g. one of nomacopan variants 1 to 4).

In some embodiments, the bioactive polypeptide is derived from a haematophagous arthropod. The term “haematophagous arthropod” includes all arthropods that take a blood meal from a suitable host, such as insects, ticks, lice, fleas and mites. Preferably, the bioactive polypeptide is derived from a tick, preferably from the tick O. moubata.

Homologues include paralogues and orthologues of the nomacopan sequence that is explicitly identified in SEQ ID NO: 2, including, for example, the nomacopan protein sequence from other tick species, including Rhipicephalus appendiculatus, R. sanguineus, R. bursa, A. americanum, A. cajennense, A. hebraeum, Boophilus microplus, B. annulatus, B. decoloratus, Dermacentor reticulatus, D. andersoni, D. marginatus, D. variabilis, Haemaphysalis inermis, Ha. Leachii, Ha. Punctata, Hyalomma anatolicum anatolicum, Hy. Dromedarii, Hy. Marginatum marginatum, Ixodes ricinus, I. persulcatus, I. scapularis, I. hexagonus, Argas persicus, A. reflexus, O. erraticus, O. moubata moubata, O. m. porcinus, and O. savignyi.

The term “homologue” is also meant to include the equivalent nomacopan protein sequence from mosquito species, including those of the Culex, Anopheles and Aedes genera, particularly Culex quinquefasciatus, Aedes aegypti and Anopheles gambiae; flea species, such as Ctenocephalides fells (the cat flea); horseflies; sandflies; blackflies; tsetse flies; lice; mites; leeches; and flatworms. The native nomacopan protein is thought to exist in O. moubata also in another three forms of around 18kDa and the term “homologue” is meant to include these alternative forms of nomacopan.

Methods for the identification of homologues of the nomacopan sequence given in SEQ ID NO: 2 will be clear to those of skill in the art. For example, homologues may be identified by homology searching of sequence databases, both public and private. Conveniently, publicly available databases may be used, although private or commercially-available databases will be equally useful, particularly if they contain data not represented in the public databases. Primary databases are the sites of primary nucleotide or amino acid sequence data deposit and may be publicly or commercially available. Examples of publicly-available primary databases include the GenBank database (http://www.ncbi.nlm.nih.gov/), the EMBL database (http://www.ebi.ac.uk/), the DDBJ database (http://www.ddbj.nig.ac.jp/), the SWISS-PROT protein database (http://expasy.hcuge.ch/), PIR (http://pir.georgetown.edu/), TrEMBL (http://www.ebi.ac.uk/), the TIGR databases (see http://www.tigr.org/tdb/index.html), the NRL-3D database (http://www.nbrfa.georgetown.edu), the Protein Data Base (http://www.rcsb.org/pdb), the NRDB database

(ftp://ncbi.nlm.nih.gov/pub/nrdb/README), the OWL database (http://www.biochem.ucl.ac.uk/bsm/dbbrowser/OWL/) and the secondary databases PROSITE (http://expasy.hcuge.ch/sprot/prosite.html), PRINTS (http://iupab.leeds.ac.uk/bmb5dp/prints.html), Profiles (http://ulrec3.unil.ch/software/PFSCAN_form.html),

Pfam (http://www.sanger.ac.uk/software/pfam), Identify (http://dna.stanford.edu/identify/), Blocks (http://www.blocks.fhcrc.org), and UniProt (https://www.uniprot.org) databases. The AlphaFold Protein Structure Database by DeepMind (https://alphafold.ebi.ac.uk/) could also be used to identify homologues that have lower amino acid identity but very closely related folds. Examples of commercially-available databases or private databases include PathoGenome (Genome Therapeutics Inc.) and PathoSeq (previously of Incyte Pharmaceuticals Inc.).

Typically, greater than 30% identity between two polypeptides (preferably, over a specified region such as the active site) is considered to be an indication of functional equivalence and thus an indication that two proteins are homologous. Preferably, proteins that are homologues have a degree of sequence identity with the nomacopan protein sequence identified in SEQ ID NO:2 of greater than 60%. More preferred homologues have degrees of identity of greater than 70%, 80%, 90%, 95%, 98% or 99%, respectively with the nomacopan protein sequence given in SEQ ID NO:2. Percentage identity, as referred to herein, is as determined using BLAST version 2.1.3 using the default parameters specified by the NCBI (the National Center for Biotechnology Information; http://www.ncbi.nlm.nih.gov/) [Blosum 62 matrix; gap open penalty=11 and gap extension penalty=1 ]. The % identity may be over the full length of the relevant reference sequence (e.g. amino acids 1-168 of SEQ ID NO:2 or amino acids 19-168 of SEQ ID NO:2).

Bioactive polypeptides thus can be described by reference to a certain % amino acid sequence identity to a reference sequence e.g. amino acids 19-168 of SEQ ID NO:2 or amino acids 1-168 of SEQ ID NO:2 e.g. as a protein comprising or consisting of a sequence having at least 60%, 70%, 80%, 90%, 95%, 98% or 99% identity to amino acids 19-168 of SEQ ID NO:2 or amino acids 1-168 of SEQ ID NO:2. Preferably, bioactive polypeptides comprise or consist of a sequence having at least 90% identity to amino acids 19-168 of SEQ ID NO:2 or amino acids 1 -168 of SEQ ID NO:2.

In the various aspects and embodiments of this disclosure, the bioactive polypeptides (e.g., modified nomacopan polypeptides) may differ from the unmodified nomacopan polypeptides in SEQ ID NO: 2 and SEQ ID NO: 4 by from 1 to 50, 2-45, 3-40, 4-35, 5-30, 6-25, 7-20, 8-25, 9-20, 10-15 amino acids, up to 1 , 2, 3, 4, 5, 7, 8, 9, 10, 20, 30, 40, 50 amino acids. These may be substitutions, insertions or deletions but are preferably substitutions. Where deletions are made these are preferably deletions of up to 1 , 2, 3, 4, 5, 7 or 10 amino acids, (e.g. deletions from the N or C terminus). Mutants thus include bioactive polypeptides containing amino acid substitutions, e.g. conservative amino acid substitutions that do not affect the function or activity of the protein in an adverse manner. This term is also intended to include natural biological variants (e.g. allelic variants or geographical variations within the species from which the nomacopan proteins are derived). Mutants with improved ability to bind wild-type C5 and/or C5 from subjects with a C5 polymorphism that render treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab and/or LTB4 may also be designed through the systematic or directed mutation of specific residues in the protein sequence.

These modifications may be made to the nomacopan polypeptide as set out in SEQ ID NO: 2 and SEQ ID NO: 4 and the molecule will remain useful and will be considered to be a functional equivalent of nomacopan provided that the resulting bioactive polypeptide retains (i) LTB4 binding activity and/or also (ii) C5 binding comparable with the nomacopan polypeptide as set out in SEQ ID NO: 2 and SEQ ID NO: 4, which can be determined e.g. using the tests referred to elsewhere herein (e.g. the binding to one or both of these is at least 80, 85, 90, 95% of the binding compared to the unmodified nomacopan polypeptide). As discussed elsewhere herein, both nomacopan and L-nomacopan have been shown to be effective in the treatment of a mouse model of autoimmune uveitis. L-nomacopan binds LTB4 but does not bind C5. Bioactive polypeptides may be defined by reference to their ability to bind to C5 and/or their ability to bind to LTB4. Those that bind LTB4 are of particular use in the invention. Those that bind LTB4 and C5 are also of particular use in the invention.

Given the requirement for functional variants to bind LTB4 and optionally also C5, when modifications are made, certain residues should be excluded from modification. These include conserved cysteine residues.

Other residues should be excluded from modification or, if substituted, should only be subject to conservative modification. These are the LTB4 binding residues. In embodiments where the bioactive polypeptide binds LTB4 and C5 then the C5 binding residues as defined below should preferably also be excluded from modification or, if substituted, should preferably only be subject to conservative modification. Given that the binding of LTB4 and C5 is relatively well understood it is possible to design a bioactive polypeptide that may have a percentage identity of around 65% to nomacopan but in which the changes are confined to residues which are not involved in LTB4 binding and optionally also C5 binding.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of the mature nomacopan molecule (e.g. as set out in SEQ ID NO: 4 which corresponds to residues 19 to 168 of the full length protein including the signal sequence) is retained and at least five, ten or fifteen or each of the LTB4 binding residues set out below is retained or is subject to a conservative modification.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and at least five, ten or fifteen or each of the LTB4 binding residues are retained or are subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, 20 of the LTB4 binding residues set out below are subject to a conservative modification.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and at least five, ten or fifteen or each of the LTB4 binding residues set out below is retained.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues set out below is retained or is subject to a conservative modification.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues set out below is retained or is subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, 20 of the LTB4 binding residues are subject to a conservative modification.

For bioactive polypeptides that bind LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues set out below is retained.

For bioactive polypeptides that bind C5 and LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of the mature nomacopan molecule (e.g. as set out in SEQ ID NO: 4 which corresponds to residues 19 to 168 of the full length protein including the signal sequence) is retained and at least five, ten or fifteen or each of the LTB4 binding residues are retained or are subject to a conservative modification and at least five, ten or fifteen or twenty or each of C5 binding residues set out below is retained or is subject to a conservative modification.

For bioactive polypeptides that bind C5 and LTB4, each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and at least five, ten or fifteen or each of the LTB4 binding residues and at least five, ten or fifteen or twenty or each of C5 binding residues set out below is retained or is subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, 20 of the LTB4 and C5 binding residues are subject to a conservative modification. For bioactive polypeptides that bind C5 and LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and at least five, ten or fifteen or each of the LTB4 binding residues and at least five, ten or fifteen or twenty or each of C5 binding residues set out below is retained.

For bioactive polypeptides that bind C5 and LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues and each of C5 binding residues set out below is retained or is subject to a conservative modification.

For bioactive polypeptides that bind C5 and LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues and each of C5 binding residues set out below is retained or is subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, 20 of the C5 and/or LTB4 binding residues are subject to a conservative modification.

For bioactive polypeptides that bind C5 and LTB4, in some embodiments each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 is retained and each of the LTB4 binding residues and each of C5 binding residues set out below is retained.

Modifications made outside of these regions may be conservative or non-conservative.

In each of these embodiments the spacing between these six cysteine amino acid residues is preferably retained to preserve the overall structure of the molecule (e.g. the molecule comprises six cysteine residues that are spaced relative to each other at a distance of 32 amino acids apart, 62 amino acids apart, 28 amino acids apart, 1 amino acid apart and 21 amino acids apart as arranged from the amino terminus to the carboxyl terminus of the sequence according to amino acids 1 to 168 of the amino acid sequence in SEQ ID NO: 2).

LTB4 binding residues

Resides that are thought to be involved in binding to LTB4 and are preferably retained in unmodified form or are subject to conservative changes only in the sequence of any molecule that is modified relative to SEQ ID NO:2 or SEQ ID NO:4 are Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp115 (numbering according to SEQ ID NO:4).

C5 binding residues

Resides that are thought to be involved in binding to C5 may be retained in unmodified form in the sequence of any molecule that is modified relative to SEQ ID NO:2 or SEQ ID NO:4 are Val26, Val28, Arg29, Ala44, Gly45, Gly61 , Thr62, Ser97, His99, His101 , Met 114, Met 1 16, Leu117, Asp118, Alai 19, Gly120, Gly121 , Leu122, Glu123, Val124, Glu125, Glu127, His146, Leu147 and Asp 149 (numbering according to SEQ ID NO:4). These residues are among those that are modified in bioactive polypeptides that bind to LTB4 but which have been modified to reduce binding to C5. LTB4 and/or C5 binding residues

There are two histidine residues involved in both LTB4 and C5 binding, His99 and H is 101 . The list of residues involved in LTB4 and/or C5 binding is therefore Phe18, Tyr25, Val26, Val28, Arg29, Arg36, Leu39, Gly41 , Pro43, Ala44, Gly45, Leu52, Val54, Met56, Phe58, Gly61 , Thr62, Thr67, Trp69, Phe71 , Gln87, Arg89, Ser97, His99, His101 , Asp103, Met 114, Trp115, Met 116, Leu117, Asp118, Alai 19, Gly120, Gly121 , Leu122, Glu123, Val124, Glu125, Glu127, His146, Leu147 and Asp 149 (numbering according to SEQ ID NO:4).

Further examples of bioactive polypeptides that bind LTB4 but have reduced or absent C5 binding

As discussed above, bioactive polypeptides which do not bind or which show reduced binding to C5, but which do retain LTB4-binding activity are disclosed, for instance, in WO2018/193121 , the entire contents of which are incorporated herein by reference. Such bioactive polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability may be used in all aspects of the present invention.

Four exemplary bioactive polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability are disclosed in WO2018/193121 , specfically proteins having the amino acid sequences as set out in SEQ ID NO: 22 (SEQ ID NO: 5 of WO2018/193121 , variant 1), SEQ ID NO: 23 (SEQ ID NO: 6 of WO2018/193121 , variant 2), SEQ ID NO: 24 (SEQ ID NO: 7 of WO2018/193121 , variant 3) and SEQ ID NO: 25 (SEQ ID NO: 8 of WO2018/193121 , variant 4). ‘L-nomacopan’ as referred to in the present examples is variant 2.

Such bioactive polypeptides are considered to be functional equivalents of nomacopan, however they share only the LTB4 binding properties thereof and have reduced or no binding to C5.

Such bioactive polypeptides as defined in WO2018/193121 are described in more detail below and may be used in the present invention.

These bioactive polypeptides which have reduced or absent C5-binding activity but which retain LTB4- binding ability may comprise or consist of the following sequences:

SEQ ID NO: 22 (SEQ ID NO: 5 of WO2018/193121) is the amino acid sequence of a modified nomacopan in which SEQ ID NO: 4 has been modified to change Met114 to Gln, Met116 to Gin, Leu117 to Ser, Asp118 to Asn, Alai 19 to Gly, Gly120 to Ser, Gly121 to Ala, Leu122 to Asp, Glu123 to Asp and Val124 to Lys. (nomacopan variant 1)

SEQ ID NO: 23 (SEQ ID NO: 6 of WO2018/193121) is the amino acid sequence of a modified Coversin in which SEQ ID NO: 4 has been modified to change Ala44 to Asn, Met116 to Gin, Leu117 to Ser, Gly121 to Ala, Leu122 to Asp, Glu123 to Ala and Asp149 to Gly. (nomacopan variant 2) SEQ ID NO: 24 (SEQ ID NO: 7 of WO2018/193121) is the amino acid sequence of a modified Coversin in which SEQ ID NO: 4 has been modified to change Ala44 to Asn, Met116 to Gin, Leu122 to Asp and Asp149 to Gly. (nomacopan variant 3)

SEQ ID NO: 25 (SEQ ID NO: 8 of WO2018/193121) is the amino acid sequence of a modified Coversin in which SEQ ID NO: 4 has been modified to change Ala44 to Asn. (nomacopan variant 4)

SEQ ID NO: 26 (SEQ ID NO: 9 of WO2018/193121) is the amino acid sequence of the loop between beta H and alpha2 at amino acid positions 1 14 to 124 of SEQ ID NO: 4 (amino acid positions 132-142 of SEQ ID NO: 2).

SEQ ID NO: 27 (SEQ ID NO: 10 of WO2018/193121) is the amino acid sequence of the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 in nomacopan variant 1 (SEQ ID NO: 22).

SEQ ID NO: 28 (SEQ ID NO: 11 of WO2018/193121) is the amino acid sequence of the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 in nomacopan variant 2 (SEQ ID NO: 23).

SEQ ID NO: 29 (SEQ ID NO: 12 of WO2018/193121) is the amino acid sequence of the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 in nomacopan variant 3 (SEQ ID NO: 24).

The bioactive polypeptides which have reduced or absent C5-binding activity but which retain LTB4- binding ability may be described as “modified nomacopan polypeptides” (e.g which exhibit leukotriene or hydroxyeicosanoid binding activity and reduced or absent C5 binding). References to a “modified nomacopan polypeptide” are to be understood as a reference to a modified version of either SEQ ID NO: 2 or SEQ ID NO: 4 i.e. the nomacopan polypeptide with or without the 18 amino acid signal sequence seen at the N-terminus of SEQ ID NO: 2.

In embodiments, bioactive polypeptides may exhibit leukotriene or hydroxyeicosanoid (typically LTB4) binding activity and reduced or absent C5 binding and can comprise SEQ ID NO: 4 in which from 1 to 30 amino acid substitutions are made, wherein

(i) in the positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)-(j) is made: a. Met114 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr; b. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr; c. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro; d. Asp118 is replaced with Asn, Gin, Arg, Lys, Gly, Ala, Leu, Ser, He, Phe, Tyr, Met Pro, His, or

Thr; e. Alai 19 is replaced with Gly, Asp, Asn, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His; f. Gly120 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His; g. Gly121 is replaced with Ala, Asp, Asn, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His; h. Leu122 is replaced with Asp, Glu, Asn, Ala, Gin, Arg, Lys, Pro, or His; i. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, He, Phe, Tyr, Pro, His, or

Thr; j. Val124 is replaced with Lys, Gin, Asn, Arg, Lys, Gly, Ala, Pro, His, or Thr; or/and wherein

(ii) Ala44 in SEQ ID NO: 4 is replaced with Asn, Asp, Gin, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met,

Pro, or His; or a fragment thereof in which up to five amino acids are deleted from the N terminus of the modified nomacopan polypeptide.

Leukotriene/eicosanoid (LK/E) binding activity as used herein refers to the ability to bind to leukotrienes and hydroxyeicosanoids including but not limited to LTB4, B4 isoleukotrienes and any hydroxylated derivative thereof, HETEs, HPETEs and EETs. LTB4 binding is of particular interest.

The modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability may consist of SEQ ID NO: 2 or 4, modified in accordance with the description below, or may comprise SEQ ID NO: 2 or 4, modified in accordance with the description below.

The nomacopan polypeptide in SEQ ID NO: 2 and SEQ ID NO: 4 features a loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 (amino acid positions 132-142 of SEQ ID NO: 2). This loop has the sequence shown below:

-Met-Trp-Met-Leu-Asp-Ala-Gly-Gly-Leu-Glu-Val- (SEQ ID NO: 26)

The first Met is at position 114 of SEQ ID NO: 4 and at position 132 of SEQ ID NO: 2.

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability, the nomacopan polypeptide of SEQ ID NO: 2 or SEQ ID NO: 4 is modified such that at positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)-(j) is made: a. Met114 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin or Ala; b. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin or Ala; c. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro, preferably Ser or Ala; d. Asp118 is replaced with Asn, Gin, Arg, Lys, Gly, Ala, Leu, Ser, lie, Phe, Tyr, Met Pro, His, or Thr, preferably Asn; e. Alai 19 is replaced with Gly, Asp, Asn, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His, preferably Gly or Asn; f. Gly120 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His, preferably Ser or Asn; g. Gly121 is replaced with Ala, Asp, Asn, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His, preferably Ala or Asn; h. Leu122 is replaced with Asp, Glu, Asn, Ala, Gin, Arg, Lys, Pro, or His, preferably Asp or Ala; i. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, He, Phe, Tyr, Pro, His, or

Thr, preferably Asp, Ala, Gin or Asn; j. Val124 is replaced with Lys, Gin, Asn, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Lys or Ala.

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability the nomacopan polypeptide in SEQ ID NO: 2 or SEQ ID NO: 4 can be modified such that at positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)-(j) is made: a. Met114 is replaced with Gin; b. Met116 is replaced with Gin; c. Leu117 is replaced with Ser; d. Asp118 is replaced with Asn; e. Alai 19 is replaced with Gly; f. Gly120 is replaced with Ser; g. Gly121 is replaced with Ala; h. Leu 122 is replaced with Asp; i. Glu123 is replaced with Asp, or Ala; j. Val124 is replaced with Lys.

In the modified nomacopan polypeptide two, three, four, five, six, seven, eight, nine, or ten of the substitutions (a)-(j) may be present. Preferably two or more, five or more, or eight or more of the substitutions (a)-(j) may be present.

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability the nomacopan polypeptide in SEQ ID NO: 2 or SEQ ID NO: 4 can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met114 is replaced with Gin; b. Met116 is replaced with Gin; c. Leu117 is replaced with Ser; d. Asp118 is replaced with Asn; e. Alai 19 is replaced with Gly; f. Gly120 is replaced with Ser; g. Gly121 is replaced with Ala; h. Leu 122 is replaced with Asp; i. Glu123 is replaced with Asp; j. Val124 is replaced with Lys. Optionally in the modified nomacopan polypeptide referred to above Trp115 is not substituted. A preferred modified nomacopan polypeptide has a loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 that has the sequence Gln-Trp-Gln-Ser-Asn-Gly-Ser-Ala-Asp- Asp-Lys (SEQ ID NO: 27).

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability, the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin; b. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro, preferably Ser; c. Gly121 is replaced with Ala, Asp, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His, preferably Ala; d. Leu122 is replaced with Asp, Glu, Asn, Gin, Arg, Lys, Pro, or His, preferably Asp; e. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, He, Phe, Tyr, Pro, His, or

Thr, preferably Asp.

In more particular embodiments; a. Met116 is replaced with Gin; b. Leu117 is replaced with Ser; c. Gly121 is replaced with Ala; d. Leu 122 is replaced with Asp; e. Glu123 is replaced with Ala.

Optionally in this modified nomacopan polypeptide referred to above Trp1 15 is not substituted. Optionally in this embodiment Met114, Trp115, Asp118, Alai 19, Gly120 and Val124 are not substituted, or are substituted with conservative substitutions as referred to elsewhere herein. A preferred modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4- binding ability has a loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 that has the sequence Met-Trp-GIn-Ser-Asp-Ala-Gly-Ala-Asp-Ala-Val (SEQ ID NO: 28).

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability, the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin; b. Leu122 is replaced with Asp, Glu, Asn, Gin, Arg, Lys, Pro, or His, preferably Asp;

In more particular embodiments; a. Met116 is replaced with Gin; b. Leu 122 is replaced with Asp.

Optionally in this modified nomacopan polypeptide referred to above Trp1 15 is not substituted.

Optionally in this embodiment Met114, Trp1 15, Leu117, Asp118, Alai 19, Gly120, Gly121 , Glu123 and Val124 are not substituted. A preferred modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability has a loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 that has the sequence Met-Trp-GIn-Leu-Asp-Ala-Gly- Gly-Asp-Glu-Val (SEQ ID NO: 29).

In the modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability the nomacopan polypeptide can be modified such that Ala44 in SEQ ID NO: 4 (Ala62 in SEQ ID NO: 2) is replaced with Asn, Asp, Gin, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His.

In preferred embodiments Ala44 in SEQ ID NO: 4 is replaced with Asn.

This substitution at position 44 of SEQ ID NO: 4 (or position 62 of SEQ ID NO: 2) may be made in combination with any of the other substitutions referred to herein.

In another modified nomacopan polypeptide which has reduced or absent C5-binding activity but which retains LTB4-binding ability the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)-(j) is present: a. Met114 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin or Ala, e.g. Gin; b. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin or Ala e.g. Gin; c. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro, preferably Ser or Ala, e.g. Ser; d. Asp118 is replaced with Asn, Gin, Arg, Lys, Gly, Ala, Leu, Ser, He, Phe, Tyr, Met Pro, His, or Thr, preferably Asn; e. Alai 19 is replaced with Gly, Asp, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His, preferably Gly or Asn, e.g. Gly; f. Gly120 is replaced with Ser, Asp, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His, preferably Ser or Asn, e.g. Ser; g. Gly121 is replaced with Ala, Asp, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His preferably Ala or Asn, e.g. Ala; h. Leu122 is replaced with Asp, Glu, Asn, Gin, Arg, Lys, Pro, or His, preferably Asp or Ala, e.g. Asp; i. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, lie, Phe, Tyr, Pro, His, or Thr, preferably Asp, Ala, Gin or Asn, e.g. Asp or Ala; j. Val124 is replaced with Lys, Gin, Asn, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Lys or Ala, e.g. Lys; and additionally Ala44 in SEQ ID NO: 4 (Ala62 in SEQ ID NO: 2) is replaced with Asn, Asp, Gin, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His, preferably Asn. In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability, the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin; b. Leu117 is replaced with Ser; c. Gly121 is replaced with Ala; d. Leu 122 is replaced with Asp; e. Glu123 is replaced with Ala; and Ala44 in SEQ ID NO: 4 is replaced with Asn.

In preferred aspects of this embodiment the amino acid residues corresponding to positions 114 to 124 of SEQ ID NO: 4 are as set out in SEQ ID NO: 28.

In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability, the nomacopan polypeptide is modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin; b. Leu 122 is replaced with Asp; and Ala44 in SEQ ID NO: 4 is replaced with Asn

In preferred aspects of this embodiment the amino acid residues corresponding to positions 114 to 124 of SEQ ID NO: 4 are as set out in SEQ ID NO: 29.

In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability the nomacopan polypeptide can be modified such that Asp149 in SEQ ID NO: 4 is replaced with Gly, Gin, Asn, Ala, Met, Arg, Lys, Leu, Ser, He, Phe, Tyr, Pro, His, or Thr. In some embodiments the nomacopan polypeptide is modified such that Asp149 of SEQ ID NO: 4 is replaced with Gly. This substitution at position 149 of SEQ ID NO: 4 (position 167 of SEQ ID NO: 2) may be made in combination with any of the other substitutions referred to herein.

In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin; b. Leu117 is replaced with Ser; c. Gly121 is replaced with Ala; d. Leu 122 is replaced with Asp; e. Glu123 is replaced with Ala; and Ala44 in SEQ ID NO: 4 is replaced with Asn and Asp149 of SEQ ID NO: 4 is replaced with Gly149.

In preferred aspects of this embodiment the amino acid residues corresponding to positions 114 to 124 of SEQ ID NO: 4 are as set out in SEQ ID NO: 28. In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability, the nomacopan polypeptide can be modified such that at positions 114 to 124 of SEQ ID NO: 4 the following substitutions are present: a. Met116 is replaced with Gin; b. Leu 122 is replaced with Asp; and Ala44 in SEQ ID NO: 4 is replaced with Asn and Asp149 of SEQ ID NO: 4 is replaced with Gly149.

In the various aspects and embodiments of this disclosure, the modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability differ from the unmodified nomacopan polypeptides in SEQ ID NO: 2 and SEQ ID NO: 4 by from 1 to 30 amino acids. Any modifications may be made to the nomacopan polypeptide in SEQ ID NO: 2 and SEQ ID NO: 4 provided that the resulting modified nomacopan polypeptide exhibits LK/E binding activity and reduced or absent C5 binding, compared to the unmodified nomacopan polypeptide.

In some embodiments the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 are retained in the modified nomacopan polypeptides of the invention.

In some modified nomacopan polypeptides, Asn60 and Asn84 according to the numbering of SEQ ID NO: 4 (Asn78 and Asn102 according to the numbering of SEQ ID NO:2) are each replaced with Gin. This modification can be carried out by site directed mutagenesis to prevent N-linked glycosylation when the polypeptide is expressed in yeast or mammalian cell culture.

In some modified nomacopan polypeptides one or more of the following amino acids in SEQ ID NO: 4 are thought to be involved in binding to LTB4 and may therefore be retained in unmodified form: Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp115. In some modified nomacopan polypeptides, at least five, ten or fifteen, or all of these amino acids are retained in unmodified form in the modified nomacopan polypeptides of the invention. In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability one or more of these amino acids may be conservatively substituted. In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability up to five, ten or fifteen, or all of these amino acids are conservatively substituted in the modified nomacopan polypeptides of the invention.

Amino acids at the following positions in SEQ ID NO: 4 are highly conserved between nomacopan and TSGP2 and TSGP3: 5, 6, 1 1 , 13-15, 20-21 , 24-27, 29-32, 35-41 , 45, 47-48, 50, 52-60, 64, 66, 69-81 , 83, 84, 86, 90-94, 97-104, 112-113, 115, 125-129, 132-139, 145, 148, and 150 [54],

Amino acids at the following positions in SEQ ID NO: 4 are thought to be involved in binding to LTB4 and/or are highly conserved between nomacopan and TSGP2 and TSGP3: 5, 6, 11 , 13-15, 18, 20-21 , 24-27, 29-32, 35-41 , 43, 45, 47-48, 50, 52-60, 64, 66, 67, 69-81 , 83, 84, 86, 87, 89, 90-94, 97-104, 112- 113, 115, 125-129, 132-139, 145, 148, and 150.

Amino acids at the following positions in SEQ ID NO: 4 are thought to be involved in binding to LTB4 and/or are highly conserved between nomacopan and TSGP2 and TSGP3 : 5, 6, 11 , 13-15, 18, 20-21 , 24-25, 27, 30-32, 35-41 , 43, 47-48, 50, 52-60, 64, 66, 67, 69-81 , 83, 84, 86, 87, 89, 90-94, 98, 100, 102-104, 112-113, 115, 126, 128-129, 132-139, 145, 148, and 150.

In some modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability therefore the above amino acids are retained in unmodified form. In some embodiments, at least five, ten, or fifteen, or all of these amino acids are retained in unmodified form in the modified nomacopan polypeptides of the invention. In some embodiments one or more of these amino acids may be conservatively substituted. In some embodiments up to five, ten, fifteen, twenty, twenty-five, 30, 40, 50 or all of these amino acids are conservatively substituted in the modified nomacopan polypeptides of the invention.

The modified nomacopan polypeptides referred to herein typically differ from SEQ ID NO: 2 or SEQ ID NO: 4 by from 1 to 30, preferably from 2 to 25, more preferably from 3 to 20, even more preferably from 4 to 15 amino acids. Typically, the difference will be 5 to 12, or 6 to 10 amino acid changes. For example, from 1 to 30, or 2 to 25, 3 to 30, 4 to 15, 5 to 12, or 6 to 10 amino acid substitutions may be made in SEQ ID NO: 2 or SEQ ID NO: 4.

Modified nomacopan polypeptides which have the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 (amino acid positions 132-142 of SEQ ID NO: 2) as set out in SEQ ID NO: 27 have 10 amino acid substitutions compared to SEQ ID NO: 4 as a result of the presence of this modified loop. In some embodiments, the modified nomacopan polypeptides referred to herein preferably therefore have 1-15, 2-10, 3-5, or up to 2, 3, 4 or 5 additional substitutions compared to SEQ ID NO: 4 beyond those that are set out in SEQ ID NO: 22 (e.g. in the loop of SEQ ID NO: 27).

Modified nomacopan polypeptides which have the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 (amino acid positions 132-142 of SEQ ID NO: 2) as set out in SEQ ID NO: 28 have 5 amino acid substitutions compared to SEQ ID NO: 4 as a result of the presence of this loop. In some embodiments, the modified nomacopan polypeptides referred to herein preferably therefore have 1-20, 2-15, 3-10, or up to 2, 3, 4, 5, 6, 7, 8, 9, 10 additional substitutions compared to SEQ ID NO: 4 beyond those that are set out in SEQ ID NO: 23 (e.g. in the loop of SEQ ID NO: 28). The additional substitutions preferably include substitutions at position 44 and 149, as set out elsewhere herein.

Modified nomacopan polypeptides which have the loop between beta H and alpha2 at amino acid positions 114 to 124 of SEQ ID NO: 4 (amino acid positions 132-142 of SEQ ID NO: 2) as set out in SEQ ID NO: 29 have 2 amino acid substitutions compared to SEQ ID NO: 4 as a result of the presence of this loop. In some embodiments, the modified nomacopan polypeptides preferably therefore have 1- 25, 2-12, 3-15, or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 additional substitutions compared to SEQ ID NO: 4 beyond those that are set out in SEQ ID NO: 24 (e.g. substitutions in the loop of SEQ ID NO: 29). The additional substitutions preferably include substitutions at position 44 and 149, as set out elsewhere herein.

Modified nomacopan polypeptides which have the substitution at position 44 of SEQ ID NO: 4 as set out elsewhere herein preferably have 1-25, 2-12, 3-15, or up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 additional substitutions compared to SEQ ID NO: 4.

Substitutions other than those explicitly referred to above are preferably conservative substitutions as described herein.

Preferred modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability may comprise or consist of the amino acid sequences set out in one of SEQ ID NOs: 22, 23, 24, 25.

Examples of modified nomacopan polypeptides which have reduced or absent C5-binding activity but which retain LTB4-binding ability include

1. A modified nomacopan polypeptide which exhibits leukotriene or hydroxyeicosanoid binding activity and reduced or absent C5 binding, said modified nomacopan polypeptide comprising SEQ ID NO: 4 in which from 1 to 30 amino acid substitutions are made, wherein

(i) in positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)- (j) is made: a. Met114 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr; b. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr; c. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro; d. Asp118 is replaced with Asn, Gin, Arg, Lys, Gly, Ala, Leu, Ser, He, Phe, Tyr, Met Pro, His, or Thr; e. Alai 19 is replaced with Gly, Asp, Asn, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His; f. Gly120 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His; g. Gly121 is replaced with Ala, Asp, Asn, Glu, Arg, Lys, Leu, lie, Phe, Tyr, Met, Pro, or His; h. Leu122 is replaced with Asp, Glu, Asn, Ala, Gin, Arg, Lys, Pro, or His; i. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, lie, Phe, Tyr, Pro, His, or Thr; j. Val124 is replaced with Lys, Gin, Asn, Arg, Lys, Gly, Ala, Pro, His, or Thr; or/and wherein (ii) Ala44 in SEQ ID NO: 3 is replaced with Asn, Asp, Gin, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His; or a fragment thereof in which up to five amino acids are deleted from the N terminus of the modified nomacopan polypeptide. A modified nomacopan polypeptide according to clause 1 wherein

(i) in positions 114 to 124 of SEQ ID NO: 4 one or more of the following substitutions (a)- (j) is made: a. Met114 is replaced with Gin; b. Met116 is replaced with Gin; c. Leu117 is replaced with Ser; d. Asp118 is replaced with Asn; e. Alai 19 is replaced with Gly; f. Gly120 is replaced with Ser; g. Gly121 is replaced with Ala; h. Leu 122 is replaced with Asp; i. Glu123 is replaced with Asp, or Ala; j. Val124 is replaced with Lys; or/and wherein

(ii) Ala44 in SEQ ID NO: 3 is replaced with Asn44; or a fragment thereof in which up to five amino acids are deleted from the N terminus of the modified nomacopan polypeptide. A modified nomacopan polypeptide according to clause 1 or clause 2 or fragment thereof, wherein in positions 114 to 124 of SEQ ID NO: 4 one or more of the substitutions (a)-(j) is present. A modified nomacopan polypeptide according to clause 3 or a fragment thereof, wherein two or more of the substitutions (a) - (j) are present. A modified nomacopan polypeptide according to clause 4 or a fragment thereof, wherein five or more of the substitutions (a) - (j) are present. A modified nomacopan polypeptide according to clause 5 or a fragment thereof, wherein each of the substitutions (a) - (j) is present, optionally wherein Trp 115 is not substituted. A modified nomacopan polypeptide according to clause 5 or a fragment thereof, wherein each of the substitutions (a) - (j) as defined in clause 2 is present, optionally wherein Trp 115 is not substituted. The modified polypeptide according to clause 7 or a fragment thereof, wherein Glu123 is replaced with Asp. A modified nomacopan polypeptide according to any one of clauses 1 to 8, or a fragment thereof which has a loop sequence between amino acid positions 1 14 to 124 of SEQ ID NO:4 as set out in SEQ ID NO:27 and which has 1-15 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:22. The modified nomacopan polypeptide according to clause 9, or a fragment thereof which has 2-10 additional substitutions compared to SEQ ID NO:27 beyond those that are set out in SEQ ID NO:22. The modified nomacopan polypeptide according to clause 9 or 10, or a fragment thereof which has 3-5 additional substitutions compared to SEQ ID NO:27 beyond those that are set out in SEQ ID NO:22. The modified nomacopan polypeptide according to any one of clauses 1 to 8 which consists of or comprises SEQ ID NO:22. A modified nomacopan polypeptide according to any one of clauses 1 to 5, or a fragment thereof wherein: a. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin; b. Leu117 is replaced with Ser, Asp, Asn, Glu, Arg, Lys, Gly, Ala, or Pro, preferably Ser; c. Gly121 is replaced with Ala, Asp, Asn, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His, preferably Ala; d. Leu122 is replaced with Asp, Glu, Asn, Ala, Gin, Arg, Lys, Pro, or His, preferably Asp; and e. Glu123 is replaced with Asp, Ala, Gin, Asn, Arg, Lys, Gly, Leu, Ser, He, Phe, Tyr, Pro, His, or Thr, preferably Ala or Asp. A modified nomacopan polypeptide according to clause 13, or a fragment thereof, wherein in positions 114 to 124 of SEQ ID NO: 4: a. Met116 is replaced with Gin; b. Leu117 is replaced with Ser; c. Gly121 is replaced with Ala; d. Leu 122 is replaced with Asp; and e. Glu123 is replaced with Ala. A modified nomacopan polypeptide according to clause 13 or clause 14, or a fragment thereof, wherein Trp 115 is not substituted. A modified nomacopan polypeptide according to clause 13, 14 or 15, or a fragment thereof, wherein Met114, Trp 115, Asp118, Alai 19, Gly120 and Val124 are not substituted. A modified nomacopan polypeptide according to any one of clauses 1 to 5 or 13 to 16, or a fragment thereof which has a loop sequence between amino acid positions 114 to 124 of SEQ ID NO:4 as set out in SEQ ID NO:28 and which has 1-20 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:23. The modified nomacopan polypeptide according to clause 17, or a fragment thereof which has 2- 15 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:23. The modified nomacopan polypeptide according to clause 17 or 18, or a fragment thereof which has 3-10 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:23. The modified nomacopan polypeptide according to any one of clauses 1 to 5 or 13 to 16 which consists of or comprises SEQ ID NO:23. A modified nomacopan polypeptide according to any one of clauses 1 to 4, or a fragment thereof, wherein: a. Met116 is replaced with Gin, Asp, Asn, Glu, Arg, Lys, Gly, Ala, Pro, His, or Thr, preferably Gin; b. Leu122 is replaced with Asp, Glu, Asn, Ala, Gin, Arg, Lys, Pro, or His, preferably Asp. A modified nomacopan polypeptide according to clause 21 or a fragment thereof, wherein a. Met116 is replaced with Gin; and b. Leu 122 is replaced with Asp. A modified nomacopan polypeptide according to clause 21 or clause 22, or a fragment thereof, wherein Trp 115 is not substituted. A modified nomacopan polypeptide according to clause 21 , 22 or 23, or a fragment thereof, wherein Met114, Trp 115, Leu117, Asp118, Alai 19, Gly120, Gly 121 , Glu123 and Val124 are not substituted. A modified nomacopan polypeptide according to any one of clauses 1 to 4 or 21 to 24, or a fragment thereof which has a loop sequence between amino acid positions 114 to 124 of SEQ ID NO:4 as set out in SEQ ID NO:29 and which has 1-25 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:24. The modified nomacopan polypeptide according to clause 25, or a fragment thereof which has 2- 12 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:24. The modified nomacopan polypeptide according to clause 25 or 26, or a fragment thereof which has 3-15 additional substitutions compared to SEQ ID NO:4 beyond those that are set out in SEQ ID NO:24. The modified nomacopan polypeptide according to any one of clauses 1 to 4 or 21 to 24, which consists of or comprises SEQ ID NO:24. A modified nomacopan polypeptide according to any one of clauses 1 to 11 or 13 to 28, or a fragment thereof, wherein Ala44 in SEQ ID NO: 4 is replaced with Asn, Asp, Gin, Glu, Arg, Lys, Leu, He, Phe, Tyr, Met, Pro, or His. A modified nomacopan polypeptide according to clause 29, or a fragment thereof, wherein Ala44 in SEQ ID NO: 4 is replaced with Asn. A modified nomacopan polypeptide according to any one of clauses 1 to 11 or 13 to 30, or a fragment thereof, wherein Asp149 in SEQ ID NO: 4 is replaced with Gly, Gin, Asn, Ala, Met, Arg, Lys, Leu, Ser, He, Phe, Tyr, Pro, His, or Thr. A modified nomacopan polypeptide according to clause 30 or 31 , wherein Ala44 in SEQ ID NO: 4 is replaced with Asn and Asp149 in SEQ ID NO: 4 is replaced with Gly. A modified nomacopan polypeptide according to any one of the preceding clauses, or a fragment thereof, wherein the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of SEQ ID NO: 4 are retained in unmodified form. A modified nomacopan polypeptide according to any one of clauses 1 to 11 , 13 to 19 or 21 to 27, wherein Asn60 and Asn84 are each replaced with Gin. A modified nomacopan polypeptide according to any one of the preceding clauses, or a fragment thereof, wherein one or more of the following amino acids is not substituted: Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp115.

36. A modified nomacopan polypeptide according to clause 35, or a fragment thereof, wherein all of the following amino acids are not substituted: Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp1 15.

37. A modified nomacopan polypeptide according to any one of clauses 1 to 36, or a fragment thereof wherein: a. none of amino acids 5, 6, 11 , 13-15, 20-21 , 24-27, 29-32, 35-41 , 45, 47-48, 50, 52-60, 64, 66, 69-81 , 83, 84, 86, 90-94, 97-104, 112-113, 1 15, 125-129, 132-139, 145, 148, and 150 in SEQ ID NO:4 are substituted; or b. none of amino acids 5, 6, 11 , 13-15, 18, 20-21 , 24-27, 29-32, 35-41 , 43, 45, 47-48, 50, 52- 60, 64, 66, 67, 69-81 , 83, 84, 86, 87, 89, 90-94, 97-104, 1 12-113, 1 15, 125-129, 132-139, 145, 148, and 150 in SEQ ID NO:4 are substituted; or c. none of amino acids 5, 6, 11 , 13-15, 18, 20-21 , 24-25, 27, 30-32, 35-41 , 43, 47-48, 50, 52- 60, 64, 66, 67, 69-81 , 83, 84, 86, 87, 89, 90-94, 98, 100, 102-104, 112-113, 115, 126, 128- 129, 132-139, 145, 148, and 150 in SEQ ID NO:4 are substituted.

38. A modified nomacopan polypeptide according to clause 1 or clause 2 which comprises or consists of the sequence SEQ ID NO: 25.

39. A modified nomacopan polypeptide according to any one of the preceding clauses or a fragment thereof which binds to LTB4.

Fragments

Bioactive polypeptides of the invention include fragments of nomacopan and fragments of functional equivalents of nomacopan, provided that the fragments retain the ability to (i) bind LTB4 and/or (ii) C5 (e.g. wild-type C5 and/or C5 from subjects with a C5 polymorphism that renders treatment by eculizumab ineffective, or reduce the efficacy of treatment with eculizumab). Preferably the functional fragment has property (i) and (ii). In other preferred embodiments the functional fragment has property (i) but reduced or absent C5 binding.

Fragments may include, for example, polypeptides derived from the nomacopan protein sequence (or homologue) which are less than 150 amino acids, less than 145 amino acids, provided that these fragments retain the ability to bind to LTB4 and optionally also C5.

Fragments may include, for example, polypeptides derived from the nomacopan protein sequence (or homologue) which are at least 140 amino acids, preferably at least 145 amino acids, more preferably at least 146 amino acids, more preferably at least 147 amino acids, even more preferably at least 148 amino acids, yet more preferably at least 149 amino acids, or most preferably at least 150 amino acids, provided that these fragments retain the ability to bind to LTB4 and optionally also C5.

Any functional equivalent or fragment thereof preferably retains the pattern of cysteine residues that is found in nomacopan. For example, said functional equivalent comprises six cysteine residues that are spaced relative to each other at a distance of 32 amino acids apart, 62 amino acids apart, 28 amino acids apart, 1 amino acid apart and 21 amino acids apart as arranged from the amino terminus to the carboxyl terminus of the sequence according to amino acids 1 to 168 of the amino acid sequence in SEQ ID NO:2. Exemplary fragments of nomacopan protein are disclosed in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14. The DNA encoding the corresponding fragments are disclosed in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11 , SEQ ID NO: 13.

Included as such fragments are not only fragments of the O. moubata nomacopan protein that is explicitly identified herein in SEQ ID NO: 2, but also fragments of homologues (e.g. variants) of this protein, as described above. Such fragments of homologues will typically possess greater than 60% identity with fragments of the nomacopan protein sequence in SEQ ID NO: 2, although more preferred fragments of homologues will display degrees of identity of greater than 70%, 80%, 90%, 95%, 98% or 99%, respectively with fragments of the nomacopan protein sequence in SEQ ID NO: 2. Preferably such fragments will retain the cysteine spacing referred to above. Fragments with improved properties may, of course, be rationally designed by the systematic mutation or fragmentation of the wild type sequence followed by appropriate activity assays. Fragments may exhibit similar or greater affinity for LTB4 as nomacopan and optionally also similar or greater affinity for C5 as nomacopan. These fragments may be of a size described above for fragments of the nomacopan protein.

As discussed above, in fusion proteins of the invention, bioactive polypeptides preferably bind to LTB4 and optionally also C5.

Conservative substitutions

Any substitutions are preferably conservative substitutions, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

PA(S) polypeptides

As used herein, the term ‘PA(S) polypeptides’ refers to PAS polypeptides and PA polypeptides. The fusion proteins of the invention comprise at least one PA(S) polypeptide (a ‘first PA(S) polypeptide’). In certain embodiments, the fusion protein comprises a single PA(S) polypeptide, i.e., precisely one PA(S) polypeptide. In other embodiments, the fusion protein comprises at least two PA(S) polypeptides (a ‘first PA(S) polypeptide’ and a ‘second PA(S) polypeptide). In certain embodiments, the fusion protein comprises precisely two PA(S) polypeptides.

In embodiments comprising a single PA(S) polypeptide, the PA(S) polypeptide may be a PAS polypeptide or a PA polypeptide. Preferably, the PA(S) polypeptide is a PAS polypeptide. In embodiments comprising two PA(S) polypeptides, each PA(S) polypeptide may independently be a PAS polypeptide or a PA polypeptide. Preferably, both PA(S) polypeptides are PAS polypeptides. However, a fusion protein may comprise two PA polypeptides, or one PAS polypeptide and one PA polypeptide.

References herein to ‘a PA(S) polypeptide’, ‘the PA(S) polypeptide’, or ‘PA(S) polypeptides’ should be interpreted as references to ‘the first PA(S) polypeptide and/or the second PA(S) polypeptide’ unless explicitly stated otherwise.

Typically, the PA(S) polypeptide forms/adopts a random coil conformation. As used herein, the ‘random coil’ means any conformation of a polymeric molecule, including amino acid polymers (e.g., a PA(S) polypeptide), in which the individual monomeric elements that form said polymeric structure are essentially randomly oriented towards the adjacent monomeric elements while still being chemically bound to said adjacent monomeric elements. In particular, a polypeptide or amino acid polymer forming a ‘random coil conformation’ substantially lacks a defined secondary and tertiary structure. The nature of polypeptide random coils and their methods of experimental identification are known to the person skilled in the art and have been described in the scientific literature [55], [56], [57], Methods for determining whether a PA(S) polypeptide forms/adopts a random coil conformation are described in [58] and [33], for example circular dichroism (CD) spectroscopy, size exclusion chromatography (SEC), and dynamic light scattering (DLS).

Typically, the PA(S) polypeptide forms/adopts a random coil confirmation under physiological conditions. As used herein, ‘physiological conditions’ means conditions (e.g., biochemical and biophysical parameters) in which proteins usually adopt their native conformation, for example as they are normally found in the body (e.g., in particular in body fluids such as the vitreous) of mammals and preferably in humans. With respect to ‘physiological conditions’ at which proteins adopt their native conformation/state, the most important parameters are temperature (37C for the human body), pH (7.35-7.45 for human blood), osmolality (280-320 mOsm), and, if necessary, total protein content (66- 85 g/L serum).

In fusion proteins of the invention, PA(S) polypeptide(s) typically mediate increased in vivo and/or in vitro stability. In other words, in fusion proteins of the present invention, the PA(S) polypeptide(s) mediate increased in vivo and/or in vitro stability of the fusion protein compared to the in vivo and/or in vitro stability of the bioactive polypeptide(s) alone. In preferred embodiments, the PA(S) polypeptide mediates increased in vivo stability, for example in the human body. In more preferred embodiments, the PA(S) polypeptide mediates increased intravitreal stability. As used herein, ‘in vivo stability’ means the capacity of a specific substance that is administered to the living body to remain biologically available and biologically active. In vivo, a substance may be removed and/or inactivated due to excretion, aggregation, degradation and/or other metabolic processes. Accordingly, proteins that have an increased in vivo stability may be less well excreted through the kidneys (urine) or via the feces and/or may be more stable against proteolysis, in particular against in vivo proteolysis in biological fluids, like blood, liquor cerebrospinalis, peritoneal fluid, lymph, or the vitreous. Increased in vivo stability of a fusion protein may beneficially manifest as an increase vitreal half-life of said fusion protein. Methods for measuring the in vivo stability of biologically active proteins are described in [58] and [33], As a result of forming/adopting a random coil conformation, the PA(S) polypeptide typically has a large hydrodynamic radius (Rh). A larger hydrodynamic radius may advantageously confer a longer half-life.

PAS polypeptides

As used herein a ‘PAS polypeptide’ is a polypeptide comprising, consisting essentially of, or consisting of proline, alanine, and serine residues. In some embodiments of the invention, the fusion protein comprises at least one PAS polypeptide (a ‘first PAS polypeptide’). In certain embodiments, the fusion protein comprises a single PAS polypeptide, i.e., precisely one PAS polypeptide. In other embodiments, the fusion protein comprises at least two PAS polypeptides (a ‘first PAS polypeptide’ and a ‘second PAS polypeptide). In certain embodiments, the fusion protein comprises precisely two PAS polypeptides.

In embodiments comprising two PAS polypeptides, each PAS polypeptide may be the same (identical) or different. Each of the PAS polypeptides may be independently selected from the PAS polypeptides described herein. Thus, references herein to ‘a PAS polypeptide’, ‘the PAS polypeptide’, or ‘PAS polypeptides’ should be interpreted as references to ‘the first PAS polypeptide and/or the second PAS polypeptide’ unless explicitly stated otherwise.

In some embodiments, the PAS polypeptide consists essentially of proline, alanine, and serine residues. A PAS polypeptide consisting essentially of proline, alanine, and serine may comprise at least 90%, preferably at least 95%, more preferably 96%, yet more preferably 97%, yet more preferably 98%, even more preferably 99% proline, alanine, and serine (i.e., at least 90%, 95%, 96%, 97%, 98%, or 99% of the residues of the PAS polypeptide are proline, alanine, or serine). A PAS polypeptide consisting essentially of proline, alanine, and serine may comprise a sufficiently high proportion of proline, alanine, and serine to form a random coil conformation. Amino acids different from alanine, serine and proline may be selected from the group consisting of Arg, Asn, Asp, Cys, Gin, Giu, Giy, His, He, Leu, Lys, Met, Phe, Thr, Trp, Tyr, and Vai. Amino acids that do not have hydrophobic side chains, like Vai, He, Leu, Met, Phe, Tyr or Trp, and/or that do not have charged side chains, like Lys, Arg, Asp or Glu, are preferred. In preferred embodiments, the PAS polypeptide consists of proline, alanine, and serine residues. Typically, the PAS polypeptide comprises or consists of a plurality of PAS repeats, wherein typically each repeat consists of proline, alanine, and serine residues and wherein no more than 6 consecutive amino acid residues are identical. Typically, proline residues constitute more than 4% and less than 40% of the amino acids of each PAS repeat and/or each PAS polypeptide (typically alanine and serine residues comprise the remaining at least 60% to 96%). For example, each PAS repeat and/or PAS polypeptide may comprise more than about 4%, preferably more than about 5%, even more preferably more than about 6%, particularly preferably more than about 8%, more particularly preferably more than about 10%, even more particularly preferably more than about 15% and most preferably more than about 20% proline residues (i.e., more than about 4%, 5%, 6%, 8%, 10%, 15%, and 20% of the residues of the PAS repeat and/or PAS polypeptide are proline). PAS repeats preferably comprises less than about 40 % or less than about 35% proline residues. Each PAS repeat may comprise at least or may consist of 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or more amino acid residues, wherein each repeat comprises or consists of (an) alanine, serine, and proline residue(s).

In some embodiments, the PAS polypeptide comprises repeats of the formula: Ser_x[Ala_yProz] wherein x is an integer selected from 0 to 6, y is an integer selected from 1 to 6, and z is an integer selected from 1 to 6.

In some embodiments, each PAS repeat and/or the PAS polypeptide comprises or consists of: a) proline residues, wherein said proline residues constitute more than about 4 %, preferably more than about 5 %, even more preferably more than about 6%, particularly preferably more than about 8%, more particularly preferably more than about 10%, even more particularly preferably more than about 15% and most preferably more than about 20% of the amino acids constituting the random coil forming domain. Such an amino acid polymer of the invention which forms random coil conformation preferably comprises less than about 40%, or less than about 35% of the amino acids constituting the random coil forming domain; b) alanine residues, wherein more than about 4% but less than about 50%, preferably more than about 10% but less than about 50% and most preferably more than about 20% but less than about 50% alanine residues; and/or c) serine residues, wherein more than about 4% and less than about 50%, preferably more than about 10% but less than about 50% and most preferably more than about 20% but less than about 50 % serine residues.

In some embodiments, each PAS repeat and/or PAS polypeptide comprises about 35% proline residues, about 50% alanine residues and about 15% serine residues of the amino acids constituting the random coil forming domain. Alternatively, each PAS repeat and/or PAS polypeptide may comprise about 35% proline residues, about 15% alanine residues and about 50% serine residues of the amino acids constituting the random coil forming domain. As used herein, ‘about’ means +/- 10%, preferably +/- 5%.

In preferred embodiments, the PAS polypeptide comprises or consists of PAS repeats having a sequence selected from the group consisting of: ASPAAPAPASPAAPAPSAPA (SEQ ID NO: 15), AAPASPAPAAPSAPAPAAPS (SEQ ID NO: 16); APSSPSPSAPSSPSPASPSS (SEQ ID NO: 17); SAPSSPSPSAPSSPSPASPS (SEQ ID NO: 18); SSPSAPSPSSPASPSPSSPA (SEQ ID NO: 19); AASPAAPSAPPAAASPAAPSAPPA (SEQ ID NO: 20); and ASAAAPAAASAAASAPSAAA (SEQ ID NO: 21). In even more preferred embodiments, the PAS polypeptide comprises or consists of repeats of SEQ ID NO:15.

In some embodiments, the PAS polypeptide comprises 400, 600, 800, 1000, or 1200 amino acids. In some embodiments, said 400, 600, 800, 1000, or 1200 amino acids consist of repeats of SEQ ID NO:

15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21 , preferably of SEQ ID NO: 15.

In some embodiments, the PAS polypeptide comprises or consists of 20 repeats of SEQ ID NO:15,

16, 17, 19, 20, or 21 , preferably 20 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 30). In some embodiments, the PAS polypeptide comprises or consists of 30 repeats of SEQ ID NO:15, 16, 17, 19, 20, or 21 , preferably 30 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 31). In some embodiments, the PAS polypeptide comprises or consists of 40 repeats of SEQ ID NO:15, 16, 17, 19, 20, or 21 , preferably 40 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 32). In some embodiments, the PAS polypeptide comprises or consists of 50 repeats of SEQ ID NO:15, 16, 17, 19, 20, or 21 , preferably 50 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 33). In some embodiments, the PAS polypeptide comprises or consists of 60 repeats of SEQ ID NO:15, 16, 17, 19, 20, or 21 , preferably 60 repeats of SEQ ID NO: 15 (i.e., SEQ ID NO: 34).

Further exemplary PAS polypeptides are described in [58],

PA polypeptides

As used herein a ‘PA polypeptide’ is a polypeptide comprising, consisting essentially of, or consisting of proline and/or alanine residues. In some embodiments of the invention, the fusion protein comprises at least one PA polypeptide (a ‘first PA polypeptide’). In certain embodiments, the fusion protein comprises a single PA polypeptide, i.e., precisely one PA polypeptide. In other embodiments, the fusion protein comprises at least two PA polypeptides (a ‘first PA polypeptide’ and a ‘second PA polypeptide). In certain embodiments, the fusion protein comprises precisely two PA polypeptides.

In embodiments comprising two PA polypeptides, each PA polypeptide may be the same (identical) or different. Each of the PA polypeptides may be independently selected from the PA polypeptides described herein. Thus, references herein to ‘a PA polypeptide’, ‘the PA polypeptide’, or ‘PA polypeptides’ should be interpreted as references to ‘the first PA polypeptide and/or the second PA polypeptide’ unless explicitly stated otherwise.

In some embodiments, the PA polypeptide consists essentially of proline and alanine residues. A PA polypeptide consisting essentially of proline and alanine may comprise at least 90%, preferably at least 95%, more preferably 96%, yet more preferably 97%, yet more preferably 98%, even more preferably 99% proline and alanine. A PA polypeptide consisting essentially of proline and alanine may comprise a sufficiently high proportion of proline and alanine to form a random coil conformation. Amino acids different from proline and alanine may be selected from the group consisting of Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, He, Leu, Lys, Met, Phe, Thr, Trp, Tyr, and Vai. Amino acids that do not have hydrophobic side chains, like Vai, He, Leu, Met, Phe, Tyr or Trp, and/or that do not have charged side chains, like Lys, Arg, Asp or Glu, are preferred. PA polypeptides may comprise Ser but typically do not comprise Ser. In preferred embodiments, the PA polypeptide consists of proline and alanine residues. Typically, the PA polypeptide comprises or consists of a plurality of PA repeats, wherein typically each repeat consists of proline and alanine residues and wherein no more than 6 consecutive amino acid residues are identical. Typically, proline residues constitute more than 10% and less than 75% of the amino acids of each PA repeat and/or each PA polypeptide (typically alanine residues comprise the remaining at least 25% to 90%). For example, each PA repeat and/or PA polypeptide may comprise more than about 10%, preferably more than about 12%, even more preferably more than about 14%, particularly preferably more than about 18%, more particularly preferably more than about 20%, even more particularly preferably more than about 22%, 23% or 24% and most preferably more than about 25% proline residues. Each PA repeat and/or PA polypeptide preferably comprises less than about 75%, more preferably less than 70%, 65%, 60%, 55% or 50% proline residues, wherein the lower values are preferred. Even more preferably, each PA repeat and/or PA polypeptide comprises less than about 48%, 46%, 44%, 42% proline residues. Particularly preferred are PA repeats and PA polypeptides comprising less than about 41 %, 40%, 39%, 38%, 37% or 36% proline residues, whereby lower values are preferred. Most preferably, each PA repeat and/or PA polypeptide comprises less than about 35% proline residues. Accordingly, each PA repeat and/or PA polypeptide may comprise about 25% proline residues and about 75% alanine residues. Alternatively, each PA repeat and/or PA polypeptide may comprise about 35% proline residues and about 65% alanine residues.

Each PA repeat may comprise at least or may consist of 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or more amino acid residues, wherein each repeat comprises or consists of (an) alanine and proline residue(s).

In some embodiments, the PA polypeptide comprises repeats of the formula: [Pro_xAla_y] wherein x is an integer selected from 1 to 5 and y is an integer selected from 1 to 5.

In preferred embodiments, the PA polypeptide comprises or consists of PA repeats having a sequence selected from the group consisting of: AAPAAPAPAAPAAPAPAAPA (SEQ ID NO: 49), AAPAAAPAPAAPAAPAPAAP (SEQ ID NO: 50), AAAPAAAPAAAPAAAPAAAP (SEQ ID NO: 51), AAPAAPAAPAAPAAPAAPAAPAAP (SEQ ID NO: 52), APAAAPAPAAAPAPAAAPAPAAAP (SEQ ID NO: 53), AAAPAAPAAPPAAAAPAAPAAPPA (SEQ ID NO: 54), and APAPAPAPAPAPAPAPAPAP (SEQ ID NO: 55).

In some embodiments, the PA polypeptide comprises 400, 600, 800, 1000, or 1200 amino acids. In some embodiments, said 400, 600, 800, 1000, or 1200 amino acids consist of repeats of SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 , SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, or SEQ ID NO: 55.

Further exemplary PA polypeptides are described in [33],

Pharmaceutical compositions

The invention provides compositions comprising fusion proteins of the invention. Typically, the compositions are pharmaceutical compositions, for example comprising a pharmaceutically acceptable carrier. The term “pharmaceutically acceptable carrier”, in general will be a liquid but may include other agents provided that the carrier does not itself induce toxicity effects or cause the production of antibodies that are harmful to the individual receiving the pharmaceutical composition. Pharmaceutically acceptable carriers may e.g. contain liquids such as water, saline, glycerol, ethanol or auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like. The pharmaceutical carrier employed will thus vary depending on the route of administration. A thorough discussion of pharmaceutically acceptable carriers is available in [59], In a preferred embodiment the fusion protein is administered in an optically acceptable composition which may be a liquid, e.g. in a solution in water or PBS. In particular embodiments, formulation of pharmaceutically acceptable carrier solutions is well-known to those of skill in the art. It would be understood by the skilled artisan that particular embodiments contemplated herein may comprise other formulations, such as those that are well known in the pharmaceutical art.

The fusion protein of the invention can be used in combination with a second treatment. When a second treatment is used, the second treatment may be comprised in the same composition or comprised in a separate composition as the fusion protein. Compositions comprising fusion proteins of the invention and/or second treatments may be administered together or separately. The composition comprising the fusion protein may be administered first and the composition comprising the second treatment may be administered second, or vice versa. The fusion protein may optionally be delivered using colloidal delivery systems (e.g. liposomes, nanoparticles or microparticles (e.g. as discussed in [60])). Advantages of these carrier systems include protection of sensitive proteins, prolonged release, reduction of administration frequency, patient compliance and controlled plasma levels. Liposomes (e.g. comprising phospholipids of synthetic and/or natural origin) may e.g. be 20 nm to 1 or 2 pm, e.g. small unilamellar vesicles (25-50 nm), large unilamellar vesicles (100-200 nm), giant unilamellar vesicles (1-2 pm) or multilamellar vesicles (MLV; 1-2 pm).

Nanoparticles (colloidal carriers with size ranging from 10 to 1000 nm) can be fabricated from lipids, polymers or metal. Polymeric nanoparticles may be made from natural or synthetic polymers (e.g. chitosan, alginate, PCL, polylactic acid (PLA), poly (glycolide), PLGA and may be generated as nanospheres (molecules are uniformly distributed into polymeric matrix) or nanocapsules (carrying drug molecules confined within a polymeric membrane).

Microparticles e.g. made of starch, alginate, collagen, poly(lactide-co-glycolic acid)) (PLGA), polycaprolactones (PCL) can also be used.

Hydrogels may alternatively or additionally be present.

Pharmaceutical compositions for systemic administration

In some embodiments, the pharmaceutical composition is for systemic delivery, such as by subcutaneous administration. The pharmaceutical composition may be for injection, e.g., via a hypodermic needle or microneedle. Preferably, the pharmaceutical compositions are for subcutaneous administration.

In some embodiments, the pharmaceutical composition has a viscosity suitable for subcutaneous administration, e.g. injection. Solutions with a viscosity of up to 20 cP are well tolerated without pain [61], However, viscosities of up to 50 cP are suitable for subcutaneous injection using a 25- to 27- gauge needle, which is typical for subcutaneous delivery [62], For example, the pharmaceutical composition may have a viscosity of up to 10 cP, up 20 cP, up to 30 cP, up to 40 cP or up to 50 cP. Preferably, however, the pharmaceutical composition has a viscosity of up to 20 cP.

In preferred embodiments, the pharmaceutical composition has a pH suitable for subcutaneous administration, e.g. injection. For example, the pharmaceutical composition may have a pH of from pH 3 to pH 8. In certain embodiments, the pharmaceutical composition has a pH of from pH 3 to pH 8, from pH 4 to pH 8, from pH 5 to pH 8, from pH 6 to pH 8 or from pH 7 to pH 8, e.g. pH 7.2.

Typically, drugs for subcutaneous administration have an osmolarity from 300 mOsm to 600 mOsm [63] (mOsm can also be referred to as mOsm/L). In preferred embodiments, the pharmaceutical composition has an osmolarity suitable for subcutaneous administration, e.g. injection. For example, the pharmaceutical composition may have an osmolarity of up to 400 mOsm, up to 600 mOsm, 800 mOsm or up to 1000 mOsm. Preferably, however, the pharmaceutical composition has an osmolarity of less than 1000 mOsm, e.g., less than 800, less than 600, less than 500, or less than 400 mOsm. In certain embodiments, the pharmaceutical composition has an osmolarity of from 100 to 650 mOsm, 150 to 500 mOsm, 200 to 450 mOsm, 250 to 400 mOsm, or 250 to 350 mOsm. Typically, drugs for subcutaneous administration have an osmolality from 300 mOsm to 600 mOsm [63] (mOsm can also be referred to as mOsm/kg). In preferred embodiments, the pharmaceutical composition has an osmolality suitable for subcutaneous administration, e.g. injection. For example, the pharmaceutical composition may have an osmolality of up to 400 mOsm, up to 600 mOsm, 800 mOsm or up to 1000 mOsm. Preferably, however, the pharmaceutical composition has an osmolality of less than 1000 mOsm, e.g., less than 800, less than 600, less than 500, or less than 400 mOsm. In certain embodiments, the pharmaceutical composition has an osmolality of from 100 to 650 mOsm, 150 to 500 mOsm, 200 to 450 mOsm, 250 to 400 mOsm, or 250 to 350 mOsm.

In some embodiments, the fusion protein is administered in a pharmaceutically acceptable composition which is an isotonic, sterile composition in PBS. In other embodiments, the fusion protein is administered as a pharmaceutical composition comprising suitable excipients.

The invention further provides a unit dose comprising a pharmaceutical composition of the invention.

As used herein a ‘unit dose’ (also referred to as a ‘dosage form’) means a pharmaceutical composition apportioned into a single dose. Preferably, the unit dose has a volume suitable for subcutaneous administration. Typically, a unit dose for subcutaneous delivery comprises up to 1 .5 mL, for example from 0.25 mL to 1 .5 mL, although higher volumes of up to 3 mL or even 5 mL are tolerated [63],

Pharmaceutical compositions for administration directly to the eye

In preferred embodiments, the pharmaceutical composition is for direct administration to an eye. The pharmaceutical composition may be for intravitreal, suprachoroidal, and/or subretinal administration, preferably intravitreal administration. The pharmaceutical composition may be for injection, e.g., via a hypodermic needle or microneedle. Preferably, the pharmaceutical compositions are for administration to the human eye.

In preferred embodiments, the pharmaceutical composition has a viscosity suitable for direct administration, e.g. injection, to the eye. Methods for measuring viscosity are known in the art. For example, viscosity can be measured using an m-VROC microviscometer (Rheosense, San Ramon, CA) equipped with a microfluidic chip containing pressure sensors [64], Viscosities of up to 12 cP are suitable for injection by hand, which is typically used for intravitreal injection [65], However, higher viscosities can be administered by mechanical injection. For example, the pharmaceutical composition may have a viscosity of up to 15 cP, up 20 cP, up to 25 cP, or up to 30 cP. Preferably, however, the pharmaceutical composition has a viscosity of less than 30cP, e.g., less than 25, 20, 15 or 12 cP. In certain embodiments, the pharmaceutical composition has a viscosity of from 2 to 30 cP, 4 to 25 cP, 6 to 20 cP, 8 to 15 cP, e.g., 4 cP to 12 cP, from 6 cP to 12 cP, or from 8 cP to 12 cP. Whilst larger polypeptides and polypeptides with a larger hydrodynamic radius tend to have a longer half-life, they can also have high viscosities. Therefore, when developing compositions for administration directly to the eye, it is important to balance half-life with properties such as viscosity. Although a high viscosity may limit the maximal fusion protein concentration for intravitreal injection, a longer half-life may mean that a lower concentration may be sufficient to achieve desirable in vivo activity. In other words, a longer half-life may compensate for a higher viscosity/lower concentration.

The pH of pharmaceutical compositions may lead to changes in the buffering capacity of the human vitreous [66], A pH in the range of from pH 3 to pH 8 is generally considered safe for intravitreal injection [67], Typically, pharmaceutical compositions for intravitreal administration have a pH between pH 5 and pH 7 [66], In preferred embodiments, the pharmaceutical composition has a pH suitable for direct administration, e.g. injection, to the eye, e.g. the vitreous. For example, the pharmaceutical composition may have a pH of from pH 3 to pH 8. In certain embodiments, the pharmaceutical composition has a pH of from pH 3 to pH 8, from pH 4 to pH 8, from pH 5 to pH 8, from pH 6 to pH 8 or from pH 7 to pH 8, e.g. pH 7.2.

Typically, drugs for intravitreal administration have an osmolarity between 100 mOsm and 1000 mOsm 7 [66] (mOsm can be referred to as mOsm/L). In preferred embodiments, the pharmaceutical composition has an osmolarity suitable for direct administration, e.g. injection, to the eye, e.g. the vitreous. For example, the pharmaceutical composition may have an osmolarity of up to 400 mOsm, up to 600 mOsm, 800 mOsm or up to 1000 mOsm. Preferably, however, the pharmaceutical composition has an osmolarity of less than 1000 mOsm, e.g., less than 800, less than 600, less than 500, or less than 400 mOsm. In certain embodiments, the pharmaceutical composition has an osmolarity of from 150 to 500 mOsm, 200 to 450 mOsm, 250 to 400 mOsm, or 250 to 350 mOsm.

Typically, drugs for intravitreal administration have an osmolality between 100 mOsm and 1000 mOsm 7 [66] (mOsm can be referred to as mOsm/kg). In preferred embodiments, the pharmaceutical composition has an osmolality suitable for direct administration, e.g. injection, to the eye, e.g. the vitreous. For example, the pharmaceutical composition may have an osmolality of up to 400 mOsm, up to 600 mOsm, 800 mOsm or up to 1000 mOsm. Preferably, however, the pharmaceutical composition has an osmolality of less than 1000 mOsm, e.g., less than 800, less than 600, less than 500, or less than 400 mOsm. In certain embodiments, the pharmaceutical composition has an osmolality of from 150 to 500 mOsm, 200 to 450 mOsm, 250 to 400 mOsm, or 250 to 350 mOsm.

Typically, pharmaceutical compositions are isotonic and/or sterile. In some embodiments, the fusion protein is administered in an optically acceptable composition which is an isotonic, sterile composition in PBS. In other embodiments, the fusion protein is administered as a pharmaceutical composition comprising suitable excipients. Common excipients include diluents (e.g. saline), counter ions (e.g. sodium sulfate), organic polymers (e.g polyethylene glycol 400 (PEG400), PEG 3350 (Carbowax™400 or 3350)), surfactants (e.g. macrogol (e.g. Solutol® HS 15 (macrogol (15)- hydroxystearate, polyethylene glycol (15)-hydroxystrearate, polyoxyethylated 12-hydroxystearic acid, Kolliphor® HS15), polysorbate 21 , polysorbate 80, Pluronic® F108 (Poloaxmer 338)), suspending agents (e.g. ethyl cellulose polymers, 48-49.5% ethoxy content), cyclodextrins (e.g. sulfobutyl ether 7 beta-cyclodextrin (SBE-p-CD), ionic strength modifier and stabilizers (e.g. D-mannitol), pH adjustment (e.g. sodium citrate, sodium phosphate), viscosity adjustment (e.g. polyvinyl alcohol) and microsphere technology (e.g. Medisorb® (poly lactic-co-glycolic acid (PLGA)) [68], In some embodiments, pharmaceutical compositions may include any one or more of these excipients. Typically, the buffer strength used is as low as possible while sill achieving a suitable window for long-term storage and maintaining the desired pH [67],

Preferably, the unit dose has a volume suitable for direct administration to the eye. Typically, a unit dose for intravitreal administration comprises up to 0.1 mL, for example from 0.05 mL to 0.1 mL. A unit dose may comprise a therapeutically or prophylactically effective amount as described herein. Alternatively, it may be necessary to administer a therapeutically or prophylactically effective amount as described herein as multiple (e.g., two) separate injections. Therefore, a unit dose may comprise a portion, e.g., half, of a therapeutically or prophylactically effective amount.

Therapeutically or prophylactically effective amount

Typically, the fusion protein is administered in a therapeutically or prophylactically effective amount. Typically, the pharmaceutical compositions described here comprise the fusion protein in a therapeutically or prophylactically effective amount. The term “therapeutically effective amount” refers to the amount of fusion protein needed to treat the relevant condition, e.g. PNH, aHUS, NMOSD, MG or certain conditions of the eye, such as retinal diseases. In this context, “treating” includes reducing the severity of the disorder. The term “prophylactically effective amount” used herein refers to the amount of fusion protein needed to prevent the relevant condition, e.g. PNH, aHUS, NMOSD, MG or certain conditions of the eye, such as retinal diseases. In this context, “preventing” includes reducing the severity of the disorder, e.g. if the presence of the disorder is not detected before the administration of the fusion protein is commenced. Reducing the severity of the disorder could be, for example be reducing growth rate of retinal lesions and/or improving visual acuity. The reduction or improvement is relative to the outcome without administration of the fusion protein as described herein. The outcomes are assessed according to the standard criteria used to assess such patients. To the extent that this can be quantitated, there is a reduction or improvement of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100% in the relative criteria.

The therapeutically or prophylactically effective amount can additionally be defined in terms of the inhibition of terminal complement, for example, an amount that means that terminal complement activity (TCA) is reduced by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%, compared to TCA in the absence of treatment. Dose and frequency may be adjusted in order to maintain TCA at the desired level, which may be, for example 10% or less, for example 9, 8, 7, 6, 5, 4, 3, 2, 1% or less compared to TCA in the absence of treatment. In other embodiments, inhibition of TCA is measured systemically (e.g. in plasma), for example when the fusion protein is administered by subcutaneous injection. In some embodiments, inhibition of TCA is measured within eye, for example, when the fusion protein is administered by intravitreal injection. The therapeutically or prophylactically effective amount can additionally be defined in terms of the reduction of LTB4 levels in plasma or vitreous, for example, an amount that means that the LTB4 level in plasma or vitreous is reduced by at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100%, compared to the LTB4 level in plasma or vitreous in the absence of treatment or which causes LTB4 levels to be within a certain range of the normal levels (e.g. 90-110% of normal, 85-115% of normal). Dose and frequency may be adjusted in order to maintain the LTB4 level in plasma or vitreous at the desired level, which may be, for example 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less, for example 9, 8, 7, 6, 5, 4, 3, 2, 1 % or less compared to the LTB4 level in plasma in the absence of treatment or which is within a certain range of the normal levels (e.g. 90- 110% of normal, 85-115% of normal). LTB4 levels may be determined by routine methods (e.g. immunoassays, such as the commercially available R&D Systems assay based on a sequential competitive binding technique [69]).

Terminal complement activity can be measured by standard assays known in the art, e.g. using the Quidel CHso haemolysis assay and the sheep red blood cell lytic CH50 assay.

The exact dosage and the frequency of doses may also be dependent on the patient’s status at the time of administration. Factors that may be taken into consideration when determining dosage include the need for treatment or prophylaxis, the severity of the disease state in the patient, the general health of the patient, the age, weight, gender, diet, time and frequency of administration, drug combinations, reaction sensitivities and the patient’s tolerance or response to therapy. The precise amount can be determined by routine experimentation but may ultimately lie with the judgement of the clinician.

Exemplary doses for intravitreal administration are doses of up to 8mg per dose (e.g. in a volume as described below), typically up to 6 mg per dose, more preferably 1-6, 2-5, or 3-5mg per dose. Exemplary concentrations of the fusion protein (e.g., in a pharmaceutical composition) for intraviteal administration are concentrations of up to 80 mg/mL, typically up to 60 mg/mL, more preferably 10-60 mg/mL, 20-50 mg/mL, or 30-50 mg/mL.

Exemplary doses for subcutaneous administration are doses of up to 300 mg per dose (e.g. in a volume as described below), typically up to 250 mg per dose, more preferably 100-300 mg, 150-300 mg, or 200-300 mg per dose. Exemplary concentrations of the fusion protein (e.g., in a pharmaceutical composition) for subcutaneous administration are concentrations of up to 150 mg/mL, typically up to 100 mg/mL, more preferably 40-150 mg/mL, 40-100 mg/mL, or 60-100 mg/mL.

Modes of administration

Fusion proteins may be delivered by any known route of administration. Fusion proteins may be delivered locally or systemically. Fusion proteins may be delivered by a parenteral route (e.g., by injection, either subcutaneously, intraperitoneally, intravenously or intramuscularly or delivered to the interstitial space of a tissue). The compositions can also be administered into a lesion. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal or transcutaneous applications, needles, and hyposprays. Local administration includes topical administration, e.g., application to the skin, e.g. in the affected area.

Fusion proteins may be administered directly to the eye (e.g. intravitreally), topically to the surface of the eye, or systemically (e.g. subcutaneously). They are preferably administered directly into the eye (e.g. direct administration within the boundary of the eye as defined by the sclera).

In some embodiments, subcutaneous administration is preferred. In other embodiments, intravitreal administration is preferred.

Systemic delivery by subcutaneous administration

Fusion proteins described herein can be administered systemically, for example by subcutaneous delivery. In preferred embodiments the fusion protein of the invention is introduced subcutaneously. In other embodiments the fusion protein of the invention is introduced intraperitoneally, intravenously, or intramuscularly or delivered to the interstitial space of a tissue.

Subcutaneous administration is well known in the art. Subcutaneous administration is typically performed by injection. Subcutaneous administration can be performed using a hypodermic needle. Needle size varies according to the substance injected, with 25-gauge to 30-gauge needles being typically used [63],

In some embodiments, fusion proteins are delivered via subcutaneous injection. In some embodiments this is via once or twice weekly subcutaneous injection, e.g. with an initial loading dose of between 1 mg/kg (mass of drug compared to mass of patient) to 20 mg/kg, preferably 2 mg/kg to 8 mg/kg, followed by once weekly maintenance doses of between 0.5 mg/kg to 20 mg/kg, preferably 1 mg/kg to 8 mg/kg, or other doses disclosed elsewhere herein. Alternatively, the agent may be delivered via subcutaneous injection every other week.

Preferably the course of treatment is continued for at least 1 , 2, 3, 4, 5 or 6 weeks or longer. In some cases, the course of treatment is continued for at least 1 , 2, 3, 4, 5 or 6 months or at least 1 , 2, 3, 4, 5 or 6 years. The course of treatment is preferably continued at least until the subject’s symptoms have reduced. Lifelong treatment may be required to prevent recurrence of symptoms.

An injection volume (i.e. the volume of a single dose) injected into the patient of 1 mL to 1 .5 mL is typical for subcutaneous administration, although larger volumes of up to 5 mL can be used. Larger subcutaneous injection volumes can be associated with pain. In certain embodiments, fusion proteins of the invention are administered in an injection volume of from 0.25 mL to 5 mL, from 0.5 mL to 4 mL, from 0.75 mL to 3 mL, or from 1 mL to 2 mL, or from 1 mL to 1 .5 mL. Administration directly into the eye

It can be advantageous, particularly when treating retinal diseases, to introduce the fusion protein of the invention directly into the eye, e.g direct administration within the boundary of the eye as defined by the sclera. In preferred embodiments the fusion protein of the invention is introduced intravitreally. In other embodiments the fusion protein of the invention is introduced suprachoroidally or subretinally.

Intravitreal administration is well known in the art, e.g. [70], Intravitreal administration is typically performed by injection. Intravitreal administration can be performed using a hypodermic needle, microneedle, or micro-stent.

In certain embodiments intravitreal administration is performed once every at least 2 months, preferably once every at least 3 months, more preferably once every at least 4 months, most preferably once every at least 6 months. In certain embodiments, intravitreal administration (e.g. injection) is performed once every from 2 to 6 months, preferably every from 3 to 6 months. Existing and proposed treatments for retinal diseases typically require injection every 4-6 weeks, or every 4-8 weeks, or every 4-10 weeks (e.g. for dry AMD pegcetacoplan and Zimura require injection approximately every 4 weeks, SYFOVRE ™ is administered approximately every 4-8 weeks and IZERVAY™ is administered approximately every 4 weeks). It is expected to be advantageous to perform intravitreal administration less frequently because it may reduce side effects such as discomfort, inflammation (leading to e.g., redness, pain), retinal detachment, hemorrhage, and bacterial infection (e.g., endophthalmitis) which, in turn, may improve patient compliance.

Typically, the course of treatment is continued for at least 1 , 2, 3, 4, 5 or 6 months or at least 1 , 2, 3, 4, 5 or 6 years. The course of treatment is preferably continued at least until the subject’s symptoms have reduced. Lifelong treatment may be required to prevent recurrence of symptoms.

In preferred embodiments, fusion proteins are administered by intravitreal injection. Needle size is one of the significant factors in the safety of intravitreal injection procedure [71], Needle size varies according to the substance injected, with 27-gauge to 31 -gauge needles being typical. Needle length ranges between 12.7 to 15.75 mm [72], In certain embodiments, fusion proteins are administered using a needle in the range of 27-gauge to 31 -gauge, 28-gauge to 31 -gauge or 29-gauge to 31- gauge. In preferred embodiments, fusion proteins are administered using a 30-gauge needle. However, a wider-bore needle (e.g., 27-gauge or 28-gauge) may be required for more viscous compositions. In certain embodiments, fusion proteins are administered with a needle having a length of from 10 mm to 18 mm, from 12 mm to 18 mm, from 13 mm to 18 mm, from 13 mm to 16 mm, from 13 mm to 15 mm, or from 13 to 14 mm. Typical needles lengths are from 13 mm to 18 mm [73], In preferred embodiments, fusion proteins are delivered using a needle length of about 13 mm. These needle lengths allow deep placement of compositions towards the central vitreous cavity, thereby reducing vitreous reflux and incarceration. An injection volume (i.e. the volume of a single dose injected into the eye of 0.05 mL to 0.1 mL is typical for intravitreal administration. Volumes of more than 0.1 mL cause a large increase in the intraocular pressure (IOP), whereas, below 0.1 mL the effect on IOP is relatively small [74], In certain embodiments, fusion proteins of the invention are administered in an injection volume of from 0.025 mL to 0.1 mL, from 0.03 mL to 0.1 mL, from 0.04 mL to 0.1 mL, or from 0.05 mL to 0.1 mL. In other embodiments, fusion proteins of the invention are administered in an injection volume of at least 0.02 mL to 0.08 mL, 0.03 mL to 0.07 mL or 0.04 mL to 0.06 mL. In preferred embodiments, fusion proteins of the invention are delivered in an injection volume of 0.05 mL. If larger volumes are required, they are typically administered as multiple separate injections/doses. For example, two, three, four, or more injections may be carried out. Each injection may have a volume of from 0.05 mL to 0.1 mL.

Treatments

The invention provides a method of treatment (e.g., a method of treating or preventing) comprising administering a fusion protein or pharmaceutical composition as described herein to a subject in need thereof. Typically, the subject has a complement-mediated and/or LTB4-mediated disease or condition. The disease or condition may be PNH, aHUS, NMOSD or MG. The disease or condition may be a retinal disease or condition and, in particular, may be a retinal disease or condition which is complement-mediated and/or LTB4-mediated.

The invention also provides a fusion protein or pharmaceutical composition as described herein for use in a method of treatment, e.g. for use in treating or preventing a disease or condition. The method may comprise administering the fusion protein or pharmaceutical composition to a subject in need thereof. The invention further provides a fusion protein or pharmaceutical composition as described herein for use in a method of treating or preventing a complement-mediated and/or LTB4 mediated disease or condition. The method may comprise administering the fusion protein or pharmaceutical composition to a subject having a disease or condition. The disease or condition may be PNH, aHUS, NMOSD or MG. The disease or condition may be a retinal disease or condition and, in particular, may be a retinal disease or condition which is complement-mediated and/or LTB4-mediated.

The invention further provides a use of a fusion protein or pharmaceutical composition as described herein in the manufacture of a medicament. Typically, the medicament is for treating or preventing a complement-mediated and/or LTB4-mediated disease or condition. The disease or condition may be PNH, aHUS, NMOSD or MG. The disease or condition may be a retinal disease or condition and, in particular, may be a retinal disease or condition which is complement-mediated and/or LTB4- mediated.

Preferably, the fusion protein or pharmaceutical composition is administered to the subject in a therapeutically or prophylactically effective amount.

Any references herein to treatments using a fusion protein should be interpreted as also referring to treatment using a nucleic acid molecule encoding said fusion protein. Paroxysmal nocturnal gemoglobuinuria (PNH)

PNH is an acquired, life-threatening blood disorder characterised by destruction of red blood cells by the complement system. PNH may develop on its own ("primary PNH") or in the context of other bone marrow disorders such as aplastic anemia ("secondary PNH"). Symptoms include red discolouration of the urine due to the presence of haemoglobin and hemosiderin from the breakdown of red blood cells, anemia, such as fatigue, shortness of breath, and palpitations. Left untreated, PNH can cause hemolytic anemia, chronic kidney disease or thrombosis, the latter of which is the main cause of severe complications and death in PNH.

In addition to the complement system, LTB4 may contribute to the pathogenesis of PNH [75], [76], [77], [78], [79], [80], [81], In particular, LTB4 may play a role in inducing thrombosis, the most common and life-threatening complication in PNH patients. For example, LTB4 can induce platelet aggregation under shear stress [75], [76] Furthermore, LTB4 is involved in glomerulonephritis (acute inflammation of the kidney), and administration of an antagonist of the LTB4 receptor, BLT1 , can suppress glomerulonephritis [77], As noted above, kidney damage often occurs in PNH patients.

Currently, the only cure for PNH is allogenic bone marrow transplantation. However, this is associated with significant rates of additional medical problems and death. Typically, symptoms are treated with steroids (such as prednisolone), iron therapy, warfarin, red blood cell transfusions, the monoclonal anti-C5 antibodies eculizumab and ravulizumab, and pegcetacoplan a complement C3 inhibitor.

Atypical haemolytic uremic syndrome (aHUS) aHUS is a genetic disease caused by chronic, uncontrolled activation of the complement system. aHUS causes small blood clots to form in blood vessels, blocking blood flow to vital organs. Clinical signs and symptoms can include abdominal pain, confusion, fatigue, edema, nausea/vomiting and diarrhea. Long-term, aHUS can cause kidney damage or failure, hemolytic anemia, thrombocytopenia heart disease or heart attack, or stroke. LTB4 may play a role in inducing thrombosis and/or kidney inflammation [75], [76], [77], [78], [79], [80], [81], [82], [83], Thus, LTB4 may also be involved in the pathogenesis of aHUS.

While there is no known cure for aHUS, it can be treated with plasma exchange/infusion (PE/PI), monoclonal anti-C5 antibody therapy (eculizumab or ravulizumab), dialysis or kidney transplant.

Neuromyelitis optica spectrum disorder (NMOSD)

NMOSD (e.g. neuromyelitis optica, NMO) is a severe demyelinating autoimmune inflammatory disease affecting the central nervous system. Preclinical data support a central pathogenic role of complement activation in NMOSD. In addition, LTB4 levels may be significantly increased in the cerebrospinal fluid of NMOSD patients [84], LTB4 may therefore play a role in NMOSD [84], [85], [86], LTB4 is a key recruiter of eosinophils, which are abundant in inflammatory demyelinating lesions in NMOSD [85], NMOSD mainly affects the spinal cord and the optic nerves. The signs and symptoms of NMOSD depend on the neurologic structures that the disease affects. The most common initial symptom is inflammation of the spinal cord (myelitis), resulting in spinal cord dysfunction. In turn, this results in muscle weakness, lost or reduced sensation, spasms, loss of bladder and bowel control, or erectile dysfunction.

There is no cure for NMOSD, but some treatments are available to reduce the symptoms. For example, treatments include corticosteroids (e.g. methylprednisolone) and monoclonal antibodies targeting C5 (eculizumab), CD19 (inebilizumab) and IL-6 (satralizumab). Although some patients recover, many are left with impairment of vision and limbs, which can be severe in some cases.

Myasthenia gravis (MG)

MG is a chronic autoimmune disease that results in progressive fatigue, loss of muscle tone and increasing paralysis. These symptoms are caused by inappropriate activation of complement resulting in an immune response directed against the nicotinic acetylcholine receptor (AchR) which leads, in turn, to reduced neuromuscular transmission. MG may occur in association with other diseases such as a thymic tumor or thyrotoxicosis, as well as with rheumatoid arthritis and lupus erythematosus. In addition to the complement system, LTB4 has a potential role in the pathogenesis of MG [87], [88], For example, LTB4 induces inflammation, such as eosinophil infiltration. Inhibition of LTB4 has been shown to reduce eosinophil infiltration and disease pathology in a murine model of experimental allergic encephalomyelitis, which is considered a mouse model of MG [87],

There is currently no cure for MG. The disease is typically treated initially using anticholinesterase agents, such as neostigmine bromide (Prostigmin) and pyridostigmine bromide (Mestinon), which help improve neuromuscular transmission and increase muscle strength. In addition, the monoclonal anti- 05 antibody (eculizumab) is approved for treatment of MG. Treatment with anticholinesterase agents is associated with adverse side effects caused from acetylcholine accumulation including gastrointestinal complaints and increased bronchial and oral secretions. In addition, although anticholinesterase agents often provide symptomatic benefit, they do not influence the course of the disease. Patients who do not respond to anticholinerterase agents may also be treated with long-term immunosuppressive drugs such as the cortocosteroid prednisone, or other immunosuppressant drugs such as cyclosporine, azathioprine and cyclophosphamide. These immunosuppressant drugs are, however, associated with serious side effect. Corticosteroids side effects include weight gain, osteoporosis, hypertension and glaucoma. Azathioprine and cyclosporine are associated with liver dysfunction and an increased risk of malignancy. In some cases, thymectomy is recommended as an alternative to drugs but the disease response is unpredictable and symptoms of the disease may continue for months or years after surgery.

There is thus a need for agents that improve upon the currently available treatments for PNH, aHUS, NMOSD and MG, in particular complement inhibitory agents which can be administered at reduced frequency by subcutaneous administration which provides a greater degree of patient control over their own therapy by permitting self-administration by patients at home in contrast to the intravenous route of administration which is used to deliver e.g. eculizumab and ravulizumab.

Retinal diseases

Various conditions of the eye involve retinal damage and/or retinal cell death. This damage may be caused by choroidal neovascularisation (CNV) due in large part to the inflammatory mediator VEGF-A (referred to generally as proliferative retinal disease). Alternatively or additionally inflammation may give rise to direct retinal cell death.

Retinal diseases include dry AMD (e.g., GA), diabetic retinopathy, ROP, uveitis (e.g., autoimmune uveitis, infective uveitis), optic neuritis (e.g., glaucoma associated optic neuritis), wet AMD (e.g., choroidal neovascularisation), diabetic macular oedema, and retinal vein occlusion. Other retinal diseases include Stargardt disease, polypoidal choroidal vasculopathy, retinitis pigmentosa, hypertension retinopathy, and sickle cell retinopathy. Retinal diseases of particular interest include dry AMD, especially GA, an advanced form of dry AMD.

It was previously shown that nomacopan and nomacopan-type proteins (including L-nomacopan, PAS600-nomacopan and PAS600-L-nomacopan) can reduce disease in a mouse model of experimental autoimmune uveitis (EAU), as described in [32] and [89], Without wishing to be bound by any theory, the administration of nomacopan-type proteins - including any of the fusion proteins described herein - is believed to result in a reduction in the levels of VEGF, which reduces and/or prevents the production of new blood vessels and/or reduces and/or prevents inflammation. Further, there is considerable evidence for complement cascade dysfunction and inflammation in retinal diseases including dry AMD and GA, as discussed in [1], [90], [91], On this basis, various drugs targeting the complement pathway are under development (see [2]).

Therefore, fusion proteins described herein may be useful in the treatment or prevention of retinal diseases (including both proliferative retinal diseases and other retinal diseases) particularly dry AMD, including GA. The presence of these diseases may be determined by routine diagnosis that is well understood in the art. The severity of certain conditions can also be scored, which is useful in assessing whether a certain treatment is effective.

Further details on certain retinal diseases are provided below.

Age-related macular degeneration (AMD)

AMD is a degenerative retinal eye disease that causes a progressive, irreversible, severe loss of central vision. The disease impairs the macula, the region of highest visual acuity, and is one of the leading causes of blindness in Americans aged 60 years or older. More than 170 million people worldwide have AMD. There are two types of AMD - wet and dry AMD. Dry AMD (also called atrophic AMD) accounts for about 80-90% of cases and generally develops slowly, often affecting both eyes simultaneously. It usually causes only mild loss of vision. Dry AMD is characterised by fatty deposits behind the retina which cause the macula to thin and dry out.

GA is an advanced form of dry age-AMD which severely affects vision and can lead to complete vision loss. More than 5 million people worldwide have GA. In GA, areas of the retina atrophy, and these areas can grow and result in dim or blind spots in a subject’s vision.

In 2022, there were no approved treatments or interventions to prevent dry AMD or GA. Trials have taken place or are ongoing, for example, testing antibodies and antibody fragments (e.g., ANX009 - C1q inhibitor, lampalizumab - complement factor D inhibitor, anti HtrA1), small molecules (e.g. Danicopan - alternative pathway factor D inhibitor), aptamers (e.g., Zimura (avacincaptad pegol) - C5 inhibitor), antisense oligonucleotides (e.g. IONIS-FB-LRX - complement factor B inhibitor), synthetic cyclic peptides (Pegcetacoplan, Apl-2 - C3 inhibitor), gene therapies (GT005 targeting Fl and AAVCAGsCD CD59 targeting CD59). Additionally, stem cell therapies wherein sheets of cells are surgically placed under the retina, are being tested. In 2023, two new treatments were approved - SYFOVRE™ (pegcetacoplan injections) and IZERVAY™ (avacincaptad pegol), both of which are complement inhibitors for the treatment of GA secondary to AMD [5], [6],

Increased local and systemic complement activation have been observed in AMD. Polymorphisms in a number of complement genes increase the risk of AMD [92], Avacincaptad pegol (Zimura), a stabilized RNA aptamer which binds to and inhibits the cleavage of C5, has completed phase III clinical testing for dry AMD. Nomacopan is known to bind to and inhibit the cleavage of C5. Therefore, nomacopan-type proteins including fusion proteins described herein that bind to C5 may be effective at treating dry AMD by inhibiting the activation of the complement pathway.

Wet AMD (also called neovascular AMD) is associated with rapidly deteriorating vision and severe impairment. Visual function is severely impaired in wet AMD, and eventually inflammation and scarring cause permanent loss of visual function in the affected retina. Wet MD has two subtypes— ‘'classic" and "occult". In the classic subtype new blood vessels can be seen distinctly by an ophthalmologist using angiography, whereas in the occult subtype the leaking blood vessels are obscured. Patients may present with a combination of both occult and classic CNV [93], Wet AMD is particularly characterized by abnormal neovascularization in and under the neuroretina in response to various stimuli. This abnormal vessel growth leads to the formation of leaky vessels which often haemorrhage. Abnormal blood vessel growth is activated by VEGF. The LTB4 receptor has been shown to promote laser-induced choroidal neovascularization (CNV) in a mouse model for wet-type AMD and the expression of VEGF mRNA has been spatially and temporally correlated with neovascularization in several animal models of retinal ischemia [94, 95], Therefore, nomacopan-type proteins including fusion proteins described herein may result in a reduction in the levels of VEGF, which prevents the production of new blood vessels. Therefore, nomacopan-type proteins including fusion proteins described herein may be particularly effective at treating wet AMD.

AMD can be self-assessed using a STARS questionnaire [96], AMD can be classified based on fundus lesions assessed within 2-disc diameters of the fovea in persons older than 55 years. Subjects with no visible drusen or pigmentary abnormalities should be considered to have no signs of AMD. Persons with small drusen (<63pm), also termed drupelets, should be considered to have normal aging changes with no clinically relevant increased risk of late AMD developing. Persons with medium drusen (>63-< 125pm), but without pigmentary abnormalities thought to be related to AMD, should be considered to have early AMD. Persons with large drusen or with pigmentary abnormalities associated with at least medium drusen should be considered to have intermediate AMD. Persons with lesions associated with neovascular AMD or GA should be considered to have late AMD [97],

Therefore, the invention provides a method for preventing or treating dry AMD in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. In other embodiments, the invention provides a fusion protein described herein for use in preventing or treating dry AMD. Preferably, the dry AMD is GA.

Furthermore, the invention provides a method for preventing or treating wet AMD in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein as described herein. In other embodiments, the invention provides a fusion protein as described herein for use in preventing or treating wet AMD. The wet AMD can be occult, classic or a combination thereof.

Typically, the subject to be treated is aged 50 years or older, preferably 60 years or older, more preferably 70 years older, yet more preferably 80 years or older. The incidence of AMD increases with age.

Subjects at risk of developing AMD may benefit from administration of the fusion proteins referred to herein, in order to prevent AMD. Risk factors for AMD include smoking, sunlight, artificial fats (such as partially-hydrogenated vegetable oils), a diet high in processed, packaged foods and low in fresh vegetables, uncontrolled hypertension and high cholesterol, diabetes, old age (patients over the age of 60 are at a greater risk than younger patients), and obesity.

Subjects having one or more of these risk factors are preferred, in terms of treatment or prevention of AMD. In some embodiments a subject may have one or more of these risk factors but may not show clinical symptoms.

Diabetic retinopathy

Diabetes profoundly impacts the microvasculature in nearly every tissue. Diabetic retinopathy is characterized by microaneurysms, hard exudates, hemorrhages and venous abnormalities. Hyperglycemia induces microvascular retinal changes which leads to blurred vision, dark spots or flashing lights, and sudden loss of vision [98],

There are three different types of diabetic retinopathy— background retinopathy, diabetic maculopathy and proliferative retinopathy. Background retinopathy, also known as simple retinopathy, involves tiny swellings in the walls of the blood vessels. Known as blebs, they show up as small dots on the retina and are usually accompanied by yellow patches of exudates (blood proteins). Diabetic maculopathy is when the macula sustains some form of damage. One such cause of macular damage is from diabetic macular oedema whereby blood vessels near to the macula leak fluid or protein onto the macula. Proliferative retinopathy is an advanced stage of diabetic retinopathy in which the retina becomes blocked causing the growth of abnormal blood vessels. These can then bleed into the eyes, cause the retina to detach, and seriously damage vision. If left untreated, this can cause blindness [98],

VEGF is an important factor in the development of diabetic retinopathy. Nomacopan-type proteins including fusion proteins described herein can bind to and inhibit LTB4, which may result in a reduction in the levels of VEGF. Therefore, nomacopan-type proteins including fusion proteins described herein may be useful in the treatment or prevention of diabetic retinopathy.

Therefore, the invention provides a method for preventing or treating diabetic retinopathy in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating diabetic retinopathy. The diabetic retinopathy can be background retinopathy, diabetic maculopathy or proliferative retinopathy.

The subject in need of treatment can have type 1 or type 2 diabetes. The longer a subject suffers from diabetes and if the blood sugar levels are poorly controlled the higher the probability of suffering from diabetic retinopathy. In some embodiments, the subject has suffered from diabetes for at least 5, 10, 20, 30 or 40 years.

Other risk factors include high blood pressure, high cholesterol, pregnancy, tobacco use, and being African-American, Hispanic or Native American.

Subjects at risk of developing diabetic retinopathy may benefit from administration of the fusion proteins referred to herein to prevent diabetic retinopathy. Subjects having one or more of these risk factors are preferred, in terms of treatment or prevention of diabetic retinopathy. In some embodiments a subject may have one or more of these risk factors but may not show clinical symptoms. Retinopathy of prematurity (ROP)

ROP is one of the leading causes of childhood blindness, which is characterized by retinal neovascularization that can eventually lead to fractional retinal detachment. ROP affects around 20 per cent of babies who are born prematurely. It mainly occurs in babies who are born before week 32 of pregnancy or weigh less than 1500g when they are born.

ROP has no outward symptoms, therefore all premature babies born before week 32 of pregnancy or weighing less than 1 ,5kg are screened by an ophthalmologist on a weekly or two-weekly basis. The extent and severity of ROP are traditionally described in terms of location (zones; I to III), severity (stages; 1 to 5), extent (clock hours; 1 to 12), and vascular dilatation and tortuosity (plus disease) according to the International Classification of ROP definition [99],

The blood vessels normally develop between 16-36 weeks of pregnancy and VEGF plays a key role in the angiogenesis of the foetus. During normal development VEGF is released in response to the higher oxygen demand of the retinal tissue, which leads to the development of blood vessels. However, in premature infants the levels of VEGF are elevated which leads to abnormal vascular proliferation [100],

Therefore, the invention provides a method for preventing or treating ROP in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating ROP.

In some embodiments, the subject is a premature baby born before 27 weeks gestational age, born between 27 and 32 weeks gestational age or born >32 weeks gestational age but with birthweight <1501 grams.

Uveitis

Autoimmune uveitis is an inflammatory process of the uveal components (the iris, ciliary body and choroid) due to an autoimmune reaction to self-antigens or caused by an innate inflammatory reaction secondary to an external stimulus. It can be present in different anatomical forms - anterior, intermediate, posterior or diffuse. Anterior uveitis is the most common form of the disease, which manifests as iritis that affects the iris, or iridociclitis which affects the ciliary body. Intermediate uveitis or vitritis involves the vitreous cavity and may involve the pars plana and posterior uveitis is divided in three types: choroiditis, retinochoroiditis, and chorioretinitis. Chorioretinitis is usually associated with infective diseases such as toxoplasmosis. In diffuse involvement or when uveitis affects many areas, it is described as panuveitis.

The type of uveitis can be classified using the International Uveitis Study Group (IUSG) Classification and the Standardization of Uveitis Nomenclature (SUN) group can be used to define the criteria for the onset, duration, and course of uveitis [101], Uveitis predominantly affects people aged 20 to 50 years; although it can occur at any age and even affects children. Uveitis rates are also high in patients aged 65 or older.

Nomacopan-type proteins have been shown to reduce clinical scores and histological scores in a mouse model of autoimmune uveitis (EAU) [32],

Furthermore, Th17 cells, a CD4+ T-cell subset, produce interleukin (IL)-17, a pro-inflammatory cytokine that has been shown to be involved in several forms of infectious and non-infectious uveitis. IL-17 induces the production of other inflammatory cytokines such as IL-6, granulocyte colonystimulating factor (CSF), granulocyte-macrophage-CSF, IL-1 , TGF-p, and tumor necrosis factor (TNF)-a [102], [32] also demonstrates that nomacopan-type proteins can decrease the percentage of CD4+ cells which express IL-17. Without wishing to be bound by any particular theory these molecules may reduce the levels of IL-17 producing Th17 cells, which results in reduced inflammation in the uvea, thereby reducing the progression of uveitis. Nomacopan-type proteins including fusion proteins described herein may therefore be particularly useful in the treatment or prevention of autoimmune uveitis or infective uveitis.

VEGF plays an important role in the inflammatory process by promoting angiogenesis and increases vascular permeability. The expression of VEGF is linked to a number of major cytokines in the inflammatory cascade, activated via the transcription factor NFKB. The importance of VEGF in the development of retinal neovascularisation is well-established [103], Nomacopan-type proteins including fusion proteins described herein can bind to LTB4 and inhibit its action, which is proposed to reduce the level of VEGF expression by M2 macrophages. This is demonstrated in the EAU mouse model in [32], which shows that nomacopan-type proteins decrease VEGF levels in retinal tissue. The resulting decrease in the levels of VEGF prevents the production of new blood vessels. Nomacopan- type proteins including fusion proteins described herein may, therefore, be useful in the treatment or prevention of autoimmune uveitis or infective uveitis.

In preferred embodiments, the invention provides a method for preventing or treating autoimmune uveitis in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. In addition, the invention provides a fusion protein described herein for use in preventing or treating autoimmune uveitis.

In certain embodiments, the invention provides a method for preventing or treating infective uveitis in a subject, which comprises administering a therapeutically or prophylactically effective amount of fusion protein described herein. In addition, the invention provides a fusion protein described herein for use in preventing or treating infective uveitis.

In certain embodiments, the autoimmune uveitis can be anterior, intermediate, posterior or diffuse uveitis. In preferred embodiments, the invention provides a method for preventing or treating anterior uveitis in a subject. Also provided are fusion proteins and compositions of the invention for use in preventing or treating anterior uveitis in a subject. Subjects at risk of developing autoimmune uveitis may benefit from administration of the fusion proteins referred to herein to prevent autoimmune uveitis. Risk factors for uveitis include smoking. Subjects who are smokers or who have been smokers are preferred, in terms of treatment or prevention of autoimmune uveitis. In some embodiments a subject may have one or more of these risk factors but may not show any clinical symptoms.

The subject to be treated can be aged from 20 to 65 years old. In some embodiments, the subject is more than 65 years old. In some embodiments, the subject is 18 years or older. In other embodiments, the subject is under 18 years in age.

Optic neuropathy

Optic neuropathy occurs after damage to the optic nerve. The classic clinical signs of optic neuropathy are visual field defect, dyschromatopsia, and abnormal papillary response. The main symptom is loss of vision, with colours appearing subtly washed out in the affected eye. In many cases, only one eye is affected and patients may not be aware of the loss of colour vision until the doctor asks them to cover the healthy eye.

The rapid onset of optic neuropathy is characteristic of optic neuritis, ischemic optic neuropathy, inflammatory (non-demyelinating) and traumatic optic neuropathy. A gradual progression of symptoms is observed in compressive toxic/nutritional optic neuropathy.

There are several types of optic neuropathies including:

(a) Ischemic optic neuropathies, where there is insufficient blood flow to the optic nerve. These include anterior ischemic optic neuropathies that affect the optic nerve head and cause swelling of the optic disc and posterior ischemic optic neuropathies that do not involve the disc swelling;

(b) Optic neuritis, which is inflammation of the optic nerve and is associated with swelling and destruction of the myelin sheath covering the optic nerve. Optic neuritis can be classified into single isolated optic neuritis, relapsing isolated optic neuritis, chronic relapsing inflammatory optic neuropathy, neuromyelitis optica spectrum disorder, multiple sclerosis associated optic neuritis and classified optic neuritis forms. Optic neuritis can also be associated with glaucoma;

(c) Compressive optic neuropathy, which results from tumours, infections and inflammatory processes that cause lesions within the orbit and, less commonly, the optic canal. The lesions compress the optic nerve resulting optic disc swelling and progressive visual loss. Implicated orbital disorders include optic gliomas, meningiomas, hemangiomas, lymphangiomas, dermoid cysts, carcinoma, lymphoma, multiple myeloma, inflammatory orbital pseudotumor, and thyroid ophthalmopathy; (d) Infiltrative optic neuropathy, where the optic nerve is be infiltrated by a variety of processes, including tumors, inflammation, and infections. The most common inflammatory disorder that infiltrates the optic nerve is sarcoidosis. Opportunistic fungi, viruses, and bacteria may also infiltrate the optic nerve. The optic nerve may be elevated if the infiltration occurs in the proximal portion of the nerve. The appearance of the nerve on examination depends on the portion of the nerve that is damaged;

(e) Traumatic optic neuropathy, where the optic nerve is be damaged when exposed to direct or indirect injury. Falls are also a common cause, and optic neuropathy most commonly occurs when there is a loss of consciousness associated with multi-system trauma and serious brain injury;

(f) Mitochondrial optic neuropathies. Mitochondria play a central role in maintaining the life cycle of retinal ganglion cells because of their high energy dependence. Genetic mutations in mitochondrial DNA, vitamin depletion, alcohol and tobacco abuse, and use of certain drugs can cause derangements in efficient transport of mitochondria, which can cause a primary or secondary optic neuropathy;

(g) Nutritional optic neuropathies, which result from a lack of nutrition in the patient’s diet. Nutritional deficiencies affect the whole body, so pain or loss of sensation in the arms and legs (peripheral neuropathy) is often seen in patients with nutritional optic neuropathies;

(h) Toxic optic neuropathies. The most common cause of which is methanol intoxication;

(i) Hereditary optic neuropathies, which typically manifest as symmetric bilateral central visual loss. Possible hereditary optic neuropathies include: Leber’s hereditary optic neuropathy, dominant optic atrophy, Behr’s syndrome and Berk-Tabatznik syndrome.

Therefore, the invention provides a method for preventing or treating an optic neuropathy condition in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating an optic neuropathy condition.

In some embodiments, the optic neuropathy condition comprises any condition in which the optic nerve is damaged. The optic neuropathy condition may be selected from: optic neuritis, ischemic optic neuropathy, compressive optic neuropathy, infiltrative optic neuropathy, traumatic optic neuropathy, mitochondrial optic neuropathy, nutritional optic neuropathy, toxic optic neuropathy and hereditary optic neuropathy. In preferred embodiments the optic neuropathy condition is glaucoma associated optic neuritis.

Retinal vein occlusion

Retinal vein occlusion is a vascular disorder of the retina. It is the second most common cause of blindness after diabetic retinopathy and occurs mostly in patients over 60 years old. There are three types of retinal vein occlusion. The first is branch retinal vein occlusion caused by a blockage in one of the four retinal veins, the second is central retinal vein occlusion which is caused by an obstruction of the main retinal vein and the third is branch retinal vein occlusion, where the obstruction occurs at a distal branch of the retinal vein. Central retinal vein occlusion usually results in more severe vision loss. Retinal vein occlusion can be further subdivided into non-ischemic and ischemic types, depending on the amount of retinal capillary ischemia [104],

Retinal vein occlusion can be diagnosed using optical coherence tomography. This involves taking a high-definition image of the retina using a scanning ophthalmoscope with a resolution of 5 microns. These images can determine the presence of swelling and edema by measuring the thickness of the retina. An ophthalmoscopy and fluorescein angiography can also be used to diagnose retinal vein occlusion by examining the retina and retinal blood vessels, respectively.

The two main complications of retinal vein occlusion are macular oedema and retinal ischaemia leading to iris and retinal neovascularisation. After a blockage occurs in the renal vein, pressure builds up in the capillaries, leading to hemorrhage and leakage of fluid and blood. Neovascularization, new abnormal blood vessel growth, then occurs, which can result in neovascular glaucoma, vitreous hemorrhage, and, in late or severe cases, retinal detachment [104], VEGF has a leading role in retinal vein occlusion pathogenesis as if ischaemia develops the VEGF is secreted, which results in further vascular leakage and retinal oedema [105],

Nomacopan-type proteins including fusion proteins described herein can bind to and inhibit LTB4, which may result in a reduction in the levels of VEGF. Therefore, the invention provides a method for preventing or treating retinal vein occlusion in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating retinal vein occlusion. The retinal vein occlusion can be branch retinal vein occlusion, central retinal vein occlusion or hemicentral retinal vein occlusion.

In some embodiments, the subject is 60 years or older, 65 years or older, 70 years or older or 80 years or older. In preferred embodiments, the subject is 65 years or older.

Stargardt disease

Stargardt disease is an inherited macular dystrophy caused by mutations in the ABCA4 gene encoding a retinal transporter protein. It is the most prevalent form of macular degeneration in children with an estimated prevalence of approximately 10 to 12.5 per 100,000 individuals in the United States. Patients with Stargardt disease develop severe vision loss within their first or second decades of life, which progresses to irreversible decreased visual acuity in almost all cases [106], Pathology can include choroidal neovascularization, in which case intravitreal anti-VEGF injections are performed [107], [32] has shown that nomacopan-type proteins can reduce VEGF levels in retinal diseases.

Therefore, the invention provides a method for preventing or treating Stargardt disease in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating Stargardt disease.

Polypoidal choroidal vasculopathy

Polypoidal choroidal vasculopathy (PCV) is a disease of the choroidal vasculature. It is present in both men and woman of many ethnicities, characterized by serosanguineous detachments of the pigmented epithelium and exudative changes that can commonly lead to subretinal fibrosis. Evidence indicates symptomatic patients with PCV can have complete regression without severe vision loss with photodynamic therapy and anti-VEGF treatment [108], The present inventors have shown that nomacopan-type proteins can reduce VEGF levels in retinal diseases.

Therefore, the invention provides a method for preventing or treating polypoidal choroidal vasculopathy disease in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating polypoidal choroidal vasculopathy disease. In some embodiments, the fusion protein is administered in combination with photodynamic therapy.

Pre-retinal diseases

The subject may have, be suspected of having, or may be at risk of developing retinal diseases. For example, the subject may have a pre-retinopathy, e.g. pre-AMD. Pre-retinopathies indicate the occurrence of chronic retinal ischaemia due to blocked capillaries. The clinical signs of a pre- retinopathy include multiple cotton wool spots, venous beading and/or looping, multiple deep round and blot haemorrhages and intra-retinal microvascular abnormalities.

The invention provides a method for preventing or treating a pre-retinal disease in a subject, which comprises administering a therapeutically or prophylactically effective amount of a fusion protein described herein. Furthermore, the invention provides a fusion protein described herein for use in preventing or treating a pre-retinal disease.

Other diseases and conditions

Fusion proteins described here are particularly useful for treating retinal diseases because it is particularly desirable to reduce the frequency of intravitreal administrations (due to their numerous side effects), it is generally desirable to reduce the frequency of administration by any route. Therefore, fusion proteins of the invention are advantageous for treatment of any complement- mediated and/or LTB4-mediated disease or condition.

Examples of other complement-mediated and/or LTB4-mediated diseases and conditions which have been shown to be treated using nomacopan and can be treated using fusion proteins of the present invention are set out below: a) myasthenia gravis [109]; b) peripheral nerve disorders such as post-infective demyelinating polyradiculoneuropathy (Guillain Barre syndrome), Miller Fisher syndrome, acute inflammatory demyelinating polyradiculoneuropathy (AIDP), chronic inflammatory demyelinating polyradiculoneuropathy (CIDP), diabetic neuropathy, uraemic pruritus, multifocal motor neuropathy, paraproteinaemic neuropathy, anti-Hu neuropathy, post- diphtheria demyelinating neuropathy, multiple sclerosis, radiation myelopathy, giant cell arteritis (temporal arteritis), transverse myelitis, motor neurone disease, and dermatomyositis, preferably GBS [110]; c) respiratory disorders such as asthma, including severe and steroid resistant asthma, COPD, immune complex alveolitis including those caused by exposure to organic dusts, moulds, airborne allergens, mineral dust, chemicals etc. (such conditions include but are not limited to: farme"s lung, pigeon or bird fancie"s lung, barn fever, mille"s lung, metalworke"s lung, humidifier fever, silicosis, pneumoconiosis, asbestosis, byssinosis, berylliosis, mesothelioma), rhinitis, alveolitis or diffuse fibrotic lung disease caused by exposure to systemic or inhaled drugs and chemical agents (including but not limited to: bleomycin, mitomycin, penicillins, sulphonamides, cephalosporins, aspirin, NSAIDs, tartrazine, ACE inhibitors, iodine containing contrast media, non-selective [beta] blocking drugs, suxamethonium, hexamethonium, thiopentone, amiodarone, nitrofurantoin, paraquat, oxygen, cytotoxic agents, tetracyclines, phenytoin, carbamazepine, chlorpropamide, hydralazine, procainamide, isoniazid, 4- aminosalicylic acid), physical lung damage (including but not limited to: crush injury, smoke and hot gas inhalation, blast injury, radiation injury, aspiration pneumonitis, lipoid pneumonia), lung damage associated with organ transplantation (including but not limited to: cardiac transplantation, lung transplantation, bone marrow transplantation), cryptogenic fibrosing alveolitis, allergic granulomatosis (Churg-Strauss syndrome), Wegene"s granulomatosis, bronchiolitis obliterans, interstitial pulmonary fibrosis, cystic fibrosis, respiratory manifestations of autoimmune and connective tissue diseases (including but not limited to: rheumatoid disease, systemic lupus erythematosus, systemic sclerosis, polyarteritis nodosa, polymyositis, dermatomyositis, Sjogren’s syndrome, ankylosing spondylitis, caplan’s syndrome), Goodpasture’s syndrome, pulmonary alveolar proteinosis, idiopathic pulmonary haemosiderosis, histiocytosis X, pulmonary infiltration with eosinophilia (PIE) (including but not limited to: simple pulmonary eosinophilia, prolonged pulmonary eosinophilia, asthmatic bronchopulmonary eosinophilia), allergic bronchopulmonary aspergillosis, aspergilloma, invasive aspergillosis, tropical pulmonary eosinophilia, hypereosinohilic syndrome, parasitic infestation, and Lymphangioleiomyomatosis (LAM), preferably asthma [111]; d) Inflammatory effects of viral infection of the respiratory tract such as pandemic influenza virus, e.g. influenza A H5N1 (avian influenza) and influenza A H1 N1 (swine‘'flu), and SARS coronaviruses [112]; e) acute graft versus host disease (GvHD) [113]; f) cicatrising eye inflammatory disorders such as atopic keratoconjunctivitis (AKC) (e.g. steroid resistant atopic keratoconjunctivitis), mucous membrane pemphigoid (MMP), Sjogren’s syndrome, graft versus host syndrome dry eye, keratoconjunctivitis sicca, vernal keratoconjunctivitis, blepharo keratoconjunctivitis, perennial keratoconjunctivitis, ocular lupus erythematosus, ocular rosacea, trachoma, bacterial, viral or fungal keratitis, ocular herpes simplex or herpes zoster, keratoconus (including, but not limited to, hereditary and traumatic keratoconus), retinitis pigmentosa, retinitis of prematurity, Down’s syndrome, osteogenesis imperfecta, Addison’s disease, Leber’s congenital amaurosis, Ehlers-Danlos syndrome, map- dot- fingerprint corneal dystrophy, Fuch’s corneal dystrophy, lattice corneal dystrophy, photokeratitis, anterior uveitis and pterygium, preferably AKC and MMP, most preferably AKC [114]; g) autoimmune blistering diseases (AIBD) such as pemphigus (including pemphigus vulgaris and pemphigus foliaceus), pemphigoid (including bullous pemphigoid (BP), mucous membrane pemphigoid, and pemphigoid gestationis), IgA-mediated dermatoses and epidermolysis bullosa acquista (EBA), preferably BP and EBA, most preferably BP [115]; h) rheumatic diseases such as ankylosing spondylitis, relapsing polychondritis, systemic lupus erythematosus, rheumatoid arthritis (RA), gout, inflammatory arthritis, pseudogout, juvenile arthritis, Sjogren syndrome, scleroderma, polymyositis, dermatomyositis, Bechet’s disease and psoriatic arthritis, preferably RA [116]; i) hematopoietic stem cell transplant associated thrombotic microangiopathy (HSCT-TMA) [117].

Fusion proteins comprising bioactive peptides which bind LTB4 may be particularly useful in the treatment of diseases mediated by a leukotriene or hydroxyeicosanoid [118], Examples of such diseases include: a) contact hypersensitivity, ulcerative colitis, esophageal adenocarcinoma, pancreatic adenocarcinoma, breast cancer, acne, aneurysm, periodontal disease, cystic fibrosis, asthma, and bronchiolitis; b) lung and airways conditions such as Alpha-1 antitrypsin disease (AATD), pulmonary arterial hypertension (PAH), chronic obstructive pulmonary disease (COPD), bronchiolitis obliterans syndrome (BOS), idiopathic pulmonary disease (IPD), severe persistent asthma, exercise and aspirin induced asthma, allergic rhinitis, and silicosis; c) skin conditions such as autoimmune blistering diseases, atopic dermatitis, contact dermatitis, psoriasis, and Churg-Strauss Syndrome; d) cancers such as pancreatic cancer, ovarian cancer, colon cancer, prostate cancer, lung cancer, oesophageal cancer, and cancer metastases; e) eye conditions such as uveitis, autoimmune uveitis, allergic conjunctivitis, Sjogren’s dry eye, Graft versus host syndrome dry eye, Keratoconjunctivitis sicca, Atopic keratoconjunctivitis, mucuous membrane pemphigoid, Vernal keratoconjunctivitis, Blepharo keratoconjunctivitis, Perennial keratoconjunctivitis, Ocular lupus erythematosus, Ocular rosacea, Trachoma, Bacterial, viral or fungal keratitis, Ocular herpes simplex or herpes zoster, Keratoconus including but not limited to the following varieties: Hereditary, Traumatic, Retinitis pigmentosa, Retinitis of prematurity, Down’s syndrome, Osteogenesis imperfecta, Addison’s disease, Leber’s congenital amaurosis, and Ehlers-Danlos syndrome, Map-dot-fingerprint corneal dystrophy, Fuch’s corneal dystrophy, Lattice corneal dystrophy, Photokeratitis, Anterior uveitis, Pterygium, preferably autoimmune uveitis and allergic conjunctivitis; f) general systemic conditions such as rheumatoid arthritis, osteoclastic arthritis, postmenopausal osteoporosis, systemic lupus eyrthematosus (SLE), inflammatory bowel disease, vasculitides including Goodpasture"s Syndrome and glomerulonephritis, systemic sclerosis, type 2 diabetes, diabetic nephropathy, sickle cell disease (SOD), malaria, trauma, myocardial infarction, obstructive sleep apnea syndrome, atherosclerosis, restenosis after coronary angioplasty, multiple sclerosis (MS), dementia, graft versus host disease (GVHD), and neuropathy; uveitis, atopic dermatitis, contact hypersensitivity, ulcerative colitis, esophageal adenocarcinoma, pancreatic adenocarcinoma, breast cancer, ovarian cancer, colon cancer, lung cancer, acne, obliterative bronchiolitis, aneurysms, periodontal disease, cystic fibrosis, prostate cancer, post-inflammatory pigmentation, fibromyalgia, systemic lupus erythematosus, tumor metastasis, scleroderma, multiple sclerosis, sarcoidosis, radiation induced gastrointestinal inflammation, and gout; g) asthma, bronchitis, atherosclerosis, psoriasis, psoriatic arthritis, inflammatory bowel disease (including Crohn"s disease), sepsis, arteritis, myocardial infarction, stroke, and coronary heart disease, ischaemia reperfusion injury, nephritis and arthritis, including rheumatoid arthritis, spondyloarthropathies, osteoarthritis, and juvenile arthritis. Conditions known to be mediated by LTB4 that can be treated in accordance with the present invention include obliterative bronchiolitis, scleroderma interstitial lung disease, periodontal disease, chronic B lymphocytic leukaemia, prostate cancer and atherosclerosis; and h) nephritis, arthritis of various sorts, uveitis, cancer, sepsis, ischaemia reperfusion injury, stroke and myocardial infarction. Outcomes of administration

The subject may, as a result of the treatment, have reduced incidence of symptoms, alleviation of symptoms, inhibition or delay of occurrence or re-occurrence of symptoms, or a combination thereof. Preferably the treatment gives rise to a reduction in the typical disease condition symptoms.

In some embodiments, as a result of treatment for PNH, a subject who was previously packed red blood cells (PRBC) transfusion dependent, may become transfusion independent. In other embodiments, a subject may achieve haemoglobin stabilisation. In other embodiments, a subject may have a reduced risk of thrombosis [119],

In some embodiments, as a result of treatment for aHUS, a subject may achieve a normal platelet count (150,000 - 400,000 platelets per pL of blood. In other embodiments a subject may achieve improved renal function, for example at least 25% reduction in serum creatinine. In other embodiments, the subject may require a reduction in the number of plasma exchange or plasma infusion interventions, or the number of new dialyses, for example per day [119],

In some embodiments, as a result of treatment for MG, the subject may experience a reduction compared to baseline in their MG-specific activities of daily living scale (MG-ADL) total score. In other embodiments, the subject may experience a reduction compared to baseline in their quantitative MG (QMG) total score [119],

In some embodiments, as a result of the treatment NMOSD, the subject may experience an increase in the time to their first adjudicated on-trial relapse [119],

For example, visual acuity is used as an endpoint in a number of clinical studies for retinal disease treatment. Treatment according to the invention may therefore give rise to an improvement in visual acuity.

As a result of the treatment the subject may exhibit an improvement in their clinical score, e.g. using one of the methods referred to above in relation to one of the specific diseases.

Furthermore, as a result of treatment the subject may exhibit reduced vascularisation or reduced vascular proliferation (e.g. within the eye). Other outcomes may include an improvement in visual acuity, a reduction in vision loss, an increase in visual recovery, a reduction in the central retina thickness and/or improvements in diabetic retinopathy severity scores. Furthermore, the treatment may result in a reduction in vitreous hemorrhages, neovascularization of the iris or angle, neovascular glaucoma and/or retinal detachment. The reduction observed after administration of the fusion protein can be measured relative to a healthy individual, an individual with a more severe form of the relevant retinal disease or observed in the patient before treatment with the fusion protein. The treatment may result in the reduction of retinal inflammation, a reduction in the number of Th17 cells, a reduction in the number of CD4+ cells expressing RORgt/Tbet (e.g. in uveitis).

An exemplary endpoint for assessing efficacy of the treatment of GA is the lesion area, as referred to e.g. in [4], The lesion area can be determined by imaging using fundus autofluorescence imaging. Other outcome measurements include untransformed GA lesion area, distance of GA lesion from the fovea (foveal encroachment) measured using fundus autofluorescence imaging, best corrected visual acuity (BCVA), low-luminance BCVA (LLBCVA), and low-luminance visual acuity deficit (LL-VD). The treatment may therefore result in a reduction in rate of lesion growth, a reduction in rate of foveal GA lesion growth, and/or an improvement in BCVA and/or LLBCVA score

The treatment may also result in a reduction in the amount of, or duration of, or frequency of treatment with a second disease treatment that is required.

Thus in a further embodiment of the invention, there is provided a method of improving visual acuity, improving clinical score, reducing vascularisation or vascular proliferation (e.g. within the eye), reducing vision loss, increasing visual recovery, reducing central retina thickness and/or improving diabetic retinopathy severity scores, reducing vitreous hemorrhages, reducing neovascularization of the iris or angle, reducing neovascular glaucoma and/or retinal detachment, reducing inflammation, reducing the number of Th17 cells, and/or reducing the number of CD4+ cells expressing RORgt/Tbet (e.g. in uveitis), reducing the rate of GA lesion growth, reducing the rate of foveal GA lesion growth, and/or improving BCVA and/or LLBCVA score in a subject with a retinal disease, said method comprising administering a therapeutically or prophylactically effective amount of a fusion protein described herein. This may be alone or with a second retinal disease treatment.

The invention also provides a fusion protein described herein, or a nucleic acid molecule encoding said fusion protein, for use in a method of improving visual acuity, improving clinical score, reducing vascularisation or vascular proliferation (e.g. within the eye), reducing vision loss, increasing visual recovery, reducing central retina thickness and/or improving diabetic retinopathy severity scores, reducing vitreous hemorrhages, reducing neovascularization of the iris or angle, reducing neovascular glaucoma and/or retinal detachment, reducing inflammation, a reducing the number of Th17 cells, and/or reducing the number of CD4+ cells expressing RORgt/Tbet (e.g. in uveitis), reducing the rate of GA lesion growth, reducing the rate of foveal GA lesion growth, and/or improving BCVA and/or LLBCVA score in a subject with a retinal disease.

In a further embodiment of the invention, there is provided a method of treating or preventing a retinal disease in a subject, said method comprising administering a therapeutically or prophylactically effective amount of a fusion protein described herein, or a nucleic acid molecule encoding said fusion protein, wherein the fusion protein gives rise to a reduction in VEGF levels, e.g. in retinal tissue, and/or the fusion protein gives rise to a reduction of VEGF signalling, e.g. in retinal tissues. The invention also provides a fusion protein described herein, or a nucleic acid molecule encoding said fusion protein, for use in a method of treating or preventing a retinal disease in a subject, wherein the fusion protein gives rise to a reduction in VEGF levels, e.g. in retinal tissue, and/or the fusion protein gives rise to a reduction of VEGF signalling, e.g. in retinal tissues.

Any reference to any reduction or increase is a reduction or increase in a disease parameter and is compared to said subject in the absence of the treatment. Preferably, the parameter can be quantitated and where this is the case the increase or decrease is preferably statistically significant. For example, the increase or decrease may be at least 3, 5, 10, 15, 20, 30, 40, 50% or more compared to the parameter in the absence of treatment (e.g. before said treatment is started).

Combination treatments

The fusion protein of the invention can be used in combination with other disease treatments, e.g., PNH, aHUS, NMOSD, MG or retinal disease treatments, referred to herein as a “second treatment”, as discussed above. The combination of the fusion protein of the invention with the second treatment may be such that the amount of the second agent is reduced in comparison to the amount that is used in the absence of treatment with the agent of the invention, or the duration of the treatment with the second treatment is reduced in comparison to the duration of treatment in the absence of treatment with the fusion protein of the invention or the frequency with the second treatment that needs to be administered is reduced. This is advantageous in view of the side effects of certain known treatments. Therefore, there is also provided a method of reducing the amount of a second treatment, reducing the frequency of administration of a second treatment, or reducing the duration of the second treatment, said method comprising administering a therapeutically or prophylactically effective amount of a fusion protein described herein and optionally further comprising administering said second treatment.

Where a second treatment is used, preferably it is selected from: a) an anti-inflammatory medication, e.g. steroid such as corticosteroid, b) an immunomodulatory therapy (IMT) drug e.g. methotrexate, azathioprine, and mycophenolate, c) a biologic response modifier (BRM) drug e.g. an anti-TNFalpha agent, for example an antibody or fragment thereof that binds TNFalpha, such as infliximab and adalimumab, d) an anti-VEGF treatment such as:

(i) an anti-VEGF antibody or fragment thereof such as anti-VEGF-A antibodies, e.g. bevacizumab (Avastin), ranibizumab (Lucentis), and brolucizumab (Beovu)

(ii) an anti-VEGF aptamer such as pegaptanib (Macugen),

(iii) another VEGF antagonist such as aflibercept (Eylea), a recombinant fusion protein consisting of VEGF-binding portions from the extracellular domains of human VEGF receptors 1 and 2 that are fused to the Fc portion of the human lgG1 immunoglobulin, e) a complement pathway inhibitor such as a C5 inhibitor, e.g. avacincaptad pegol (Zimura), or a C3 inhibitor, e.g. pegcetacoplan/APL-2 (Empaveli).

When the fusion protein and a second treatment are used, they may be administered together or separately. The fusion protein may be administered first and the second treatment may be administered second, or vice versa.

Thus, where the fusion protein of the invention is used in combination with one or more second treatments, e.g. in methods described as above, this can be described as (i) a fusion protein described herein for use in a method of treating or preventing PNH, aHUS, NMOSD, MG or a retinal disease with a second PNH, aHUS, NMOSD, MG or retinal disease treatment, or (ii) a second PNH, aHUS, NMOSD, MG or retinal disease treatment for use in a method of treating or preventing PNH, aHUS, NMOSD, MG or a retinal disease with a fusion protein described herein, or (iii) a fusion protein described herein and a second PNH, aHUS, NMOSD, MG or retinal disease treatment, for use in a method of treating or preventing PNH, aHUS, NMOSD, MG or a retinal disease. In each of (i) to (iii) said method comprises administering a fusion protein described herein and administering a second PNH, aHUS, NMOSD, MG or retinal disease treatment.

In some embodiments the fusion protein described herein is administered systemically, e.g. subcutaneously and the second PNH, aHUS, NMOSD, or MG treatment is administered systemically or topically.

In some embodiments the second PNH, aHUS, NMOSD or MG treatment is also a fusion protein described herein.

Where the treatment gives rise to a reduction in the amount or duration of the second PNH, aHUS, NMOSD or MG treatment, the reduction may be up to or at least 10, 20, 30, 40, 50, 60, 70, 80 % compared to the amount of the second treatment that is used in the absence of the fusion protein of the invention.

Where the treatment gives rise to a reduction in the frequency of the treatment with the second PNH, aHUS, NMOSD or MG treatment, this may result in an increase in the time between administration of the second PNH, aHUS, NMOSD or MG treatment of up to about 1 , 2, 3, 4, 5, 6, 7 or 8 weeks.

In some embodiments the fusion protein described herein is administered directly into the eye, e.g. intravitreally, intrachoroidally, or suprachoroidally (preferably intravitreally), and the second retinal disease treatment is administered systemically, topically, or directly into the eye, e.g. intravitreally, intrachoroidally, or suprachoroidally.

In some embodiments the second retinal disease treatment is also a fusion protein described herein. Where the treatment gives rise to a reduction in the amount or duration of the second retinal disease treatment, the reduction may be up to or at least 10, 20, 30, 40, 50, 60, 70, 80 % compared to the amount of the second treatment that is used in the absence of the fusion protein of the invention.

Where the treatment gives rise to a reduction in the frequency of the treatment with the second retinal disease treatment, this may result in an increase in the time between administration of the second retinal disease treatment of up to about 1 , 2, 3, 4, 5, 6, 7 or 8 weeks.

Subjects

Preferred subjects, fusion proteins, doses and the like are as disclosed herein.

The subject to which the fusion protein is administered in the practice of the invention is preferably a mammal, preferably a human. The subject to which the fusion protein is administered is at risk of or has a complement-mediated and/or LTB4-mediated disease or condition. In some embodiments, the subject to which the fusion protein is administered is at risk of or has PNH, aHUS, NMOSD or MG. In other embodiments, the subject to which the fusion protein is administered is at risk of a retinal disease or has a retinal disease.

Methods of the invention may also comprise one or more additional steps of (i) determining whether the subject is at risk of or has a complement-mediated and/or LTB4-mediated disease or condition, (ii) determining the severity of the complement-mediated and/or LTB4-mediated disease or condition, which may be carried out before and/or after administration of the fusion protein of the invention.

Methods of the invention may also comprise one or more additional steps of (i) determining whether the subject is at risk of or has PNH, aHUS, NMOSD or MG, (ii) determining the severity of the PNH, aHUS, NMOSD or MG, which may be carried out before and/or after administration of the fusion protein of the invention.

Methods of the invention may also comprise one or more additional steps of (i) determining whether the subject is at risk of or has a retinal disease, (ii) determining the severity of the retinal disease, which may be carried out before and/or after administration of the fusion protein of the invention.

Polynucleotides, vectors, and cells

Polynucleotides

The invention further provides polynucleotides encoding one or more of the bioactive polypeptides, one or more of the PA(S) polynucleotides described herein, and/or one or more other components of the fusion proteins described herein (e.g., linkers, heterologous sequences). In some embodiments, the polynucleotide encodes a fusion protein described herein. Typically, the polynucleotide is DNA, e.g. cDNA. However, the polynucleotide may be an RNA polynucleotide. The polynucleotide may be single or double stranded and may include within it synthetic or modified nucleotides.

The polynucleotide referred to above may alternatively or additionally be modified to include sequences encoding extension at either or both ends or internally at loop regions of the encoded polypeptide.

Polynucleotides for use in the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The polynucleotides are typically provided in isolated and/or purified form.

The polynucleotides described herein may be used as therapeutic agents in their own right. The polynucleotides may be used to treat or prevent a complement mediated disease or condition, such as PNH, aHUS, NMOSD or MG or a retinal disease or condition, according to any of the methods described herein.

Polynucleotides as described herein have utility in production of the polypeptides for use in the present invention, which may take place in vitro, in vivo or ex vivo. The polynucleotides may be involved in recombinant protein synthesis. The polynucleotides for use in the invention are typically incorporated into a recombinant replicable vector. Therefore, polynucleotides for use in the invention may be made by introducing a polynucleotide into a replicable vector, introducing the vector into a compatible host cell and growing the host cell under conditions which bring about replication of the vector. The host cell may, for example, be an Escherichia coli or Corynebacterium glutamicum cell.

Vectors

The invention also includes cloning and expression vectors comprising the nucleic acid molecules of this aspect of the invention. Such expression vectors may incorporate the appropriate transcriptional and translational control sequences, for example enhancer elements, promoter-operator regions, termination stop sequences, mRNA stability sequences, start and stop codons or ribosomal binding sites, linked in frame with the nucleic acid molecules of the invention.

Preferably, the vector is an expression vector comprising a polynucleotide described herein. The coding sequences may also be selected to provide a preferred codon usage suitable for the host organism to be used. Exemplary vectors are described in [58] and [33], Other suitable vectors would be apparent to persons skilled in the art. Preferably, a polynucleotide for use in the invention in a vector is operably linked to a control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence, such as a promoter, "operably linked" to a coding sequence is positioned in such a way that expression of the coding sequence is achieved under conditions compatible with the regulatory sequence.

Vectors according to the invention include plasmids. Other vectors include viruses (including both bacteriophage and eukaryotic viruses) as well as other linear or circular DNA carriers, such as those employing transposable elements or homologous recombination technology. Suitable viral vectors include baculovirus-, adenovirus-and vaccinia virus-based vectors.

Host cells

Suitable hosts for recombinant expression include commonly used prokaryotic species or eukaryotic yeasts that can be made to express high levels of recombinant proteins and that can easily be grown in large quantities. Mammalian cell lines grown in vitro are also suitable, particularly when using virus- driven expression systems. Another suitable expression system is the baculovirus expression system that involves the use of insect cells as hosts. An expression system may also constitute host cells that have the DNA incorporated into their genome. Proteins, or protein fragments may also be expressed in vivo, for example in insect larvae or in mammalian tissues.

Where the host cells are prokaryotic, they are typically E. coli cells, preferably E. coli cells having mutations in the thioredoxin reductase (trxB) and/or glutathione reductase (gor) genes such that cytoplasmic disulfide bond formation is reduced or prevented (e.g., E. coli Origami B cells). A further example of suitable E. coli cells is ESETEC® (a modified E. coli K12 strain produced by WACKER) [120], Other preferred cell types are C. glutamicum cells.

A variety of techniques may be used to introduce the vectors according to the present invention into prokaryotic or eukaryotic cells. Suitable transformation or transfection techniques are well known in the art. In eukaryotic cells, expression systems may either be transient (e. g. episomal) or permanent (chromosomal integration) according to the needs of the system. Thus, the invention provides transformed or transfected host cells comprising a polynucleotide (e.g., a vector) as defined herein.

Methods of production and purification

The invention also provides a method for producing a fusion protein as described herein, the method comprising a) culturing host cells containing a polynucleotide encoding as fusion protein described herein under conditions whereby the fusion protein is expressed, typically in the cytoplasm, and b) recovering the fusion protein. Typically, the host cells are E. coli cells or C. glutamicum cells. The polynucleotide may be a plasmid, which optionally may be introduced into the host cells by transformation. Typically, the fusion protein is expressed in the cytoplasm of the host cells.

Alternatively, the fusion protein is secreted into the culture medium of the host cells. Preferably, the method further comprises c) purifying the fusion protein from the cell or its culture medium. The invention also provides a method of purifying a fusion protein which has been produced according to a method described herein.

Where the fusion protein comprises a single bioactive polypeptide, the purification typically comprises 1) ammonium sulfate precipitation, optionally followed by 2) subtractive cation exchange chromatography, and further optionally 3) anion exchange chromatography. The eluted protein may be concentrated by ammonium sulfate precipitation. The protein may be subjected to a polishing step using preparative size exclusion chromatography (SEC).

Where the fusion protein comprises two bioactive polypeptides, the purification typically comprises 1) subtractive cation exchange chromatography, optionally followed by 2) subtractive anion exchange chromatography, optionally followed by 3) binding anion exchange chromatography. Optionally, a multimodal chromatography step is included. The eluted protein may be concentrated by centrifugal filtration. The protein may be subjected to a polishing step(s) using a preparative size exclusion chromatography (SEC). Furthermore, a hydrophobic interaction chromatography step may be included to deplete pyrogens, for example lipopolysaccharides and fatty acids.

BRIEF DESCRIPTION OF FIGURES

Figure 1A: Exemplary plasmid map for the newly developed fusion protein PAS(400)-nomacopan- PAS(400)-nomacopan. The structural gene for PAS(400)-nomacopan-PAS(400)-nomacopan is under transcriptional control of the tetracycline promoter/operator (tet ⁰) The plasmid backbone, i.e. outside the expression cassette flanked by the Xba\ and Hind 111 restriction sites, is identical with that of the generic cloning and expression vector pASK75 [121], Singular restriction sites are indicated. Similar expression vectors were used for the other newly developed fusion proteins.

Figure 1B: Depiction of the newly generated fusion proteins, indicating the bioactive polypeptide (nomacopan) and the PAS polypeptide domain(s).

Figure 2A: Analysis of the purified PAS(800)-nomacopan fusion protein. Samples from each step of the purification protocol were analysed by 10% SDS-PAGE, followed by staining with Coomassie brilliant blue R-250. After purification, the PAS(800)-nomacopan fusion protein appeared as a single homogeneous band.

Figure 2B: Analytical SEC of the PAS(800)-nomacopan fusion protein. No aggregates were observed.

Figure 3A, C and E: SDS-PAGE analysis of the purified nomacopan-PAS(600)-nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan fusion proteins. Samples from each step of the purification protocol were analysed by 10% SDS- PAGE, followed by staining with Coomassie brilliant blue R-250. After purification, the nomacopan- PAS(600)-nomacopan fusion protein was predominantly detectable, but a second weaker band was also seen (Figure 3A). PAS(400)-nomacopan-PAS(400)-nomacopan, and PAS(600)-nomacopan- PAS(600)-nomacopan fusion proteins both appeared as a single homogeneous bands (Figure 3C and E).

Figure 3B, D and F: Analytical SEC of nomacopan-PAS(600)-nomacopan, PAS(400)-nomacopan- PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan fusion proteins.

Figure 4A and B: Analytical SEC of nomacopan and PAS(600)-nomacopan compared with the new fusion proteins described herein (PAS(800)-nomacopan, nomacopan-PAS(600)-nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan). The new fusion proteins had a larger hydrodynamic volume than nomacopan or PAS(600)-nomacopan. Figure 4B shows an inset of Figure 4A.

Figure 5: DLS analysis of nomacopan and PAS(600)-nomacopan compared with the new fusion proteins described herein (PAS(800)-nomacopan, nomacopan-PAS(600)-nomacopan, PAS(400)- nomacopan-PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan). The new fusion proteins had a larger hydrodynamic volume than nomacopan or PAS(600)-nomacopan.

Figure 6A-D: ESI-MS of the new fusion proteins described herein (PAS(800)-nomacopan, nomacopan-PAS(600)-nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan and PAS(600)- nomacopan-PAS(600)-nomacopan). The deconvoluted spectra of the fusion proteins show a single peak for each fusion protein corresponding to a mass which closely matches the calculated mass of the respective fusion protein devoid of the start methionine (Met) residue.

Figure 7A: Schematic diagram of the SPR setup for measuring C5 binding activity.

Figure 7B-I: SPR measurements of the binding kinetics between the new fusion proteins described herein and human C5. The reference-corrected sensorgrams for the monovalent fusion proteins PAS(600)-nomacopan and PAS(800)-nomacopan showed binding curves typical for a bimolecular reaction (Figure 7B and C). For the bivalent fusion proteins (PAS(600)-nomacopan-PAS(600)- nomacopan, nomacopan-PAS(600)-nomacopan and PAS(400)-nomacopan-PAS(400)-nomacopan) the reference-corrected sensorgrams required fitting by the heterogeneous ligand model, indicating that the first bioactive polypeptide and the second bioactive polypeptide within these fusion proteins differ in terms of their binding behaviour towards human C5 (Figure 7D-I).

Figure 8: Measurement of PAS(600)-nomacopan concentration in the vitreous overtime after a single injection. The vitreous of New Zealand white rabbits injected intravitreally with either 20 mg/mL or 60 mg/mL PAS(600)-nomacopan was collected at 3, 7, 14, 21 and 28 days and the concentration of PAS(600)-nomacopan was measured using RRLC-MS/MS. PAS(600)-nomacopan half-life in the vitreous was determined to be 7.4 days or 8.4 days for 20 mg/mL or 60 mg/mL doses, respectively. Figure 9: Inhibition of complement activity by nomacopan, PAS(600)-nomacopan and the new fusion proteins described herein (PAS(800)-nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan) in normal human serum. Activated normal human serum complement was incubated with dilution series (200 - 0 nM) of nomacopan or various PAS- nomacopan fusion proteins for 1 h at 37 °C. The generated terminal complement complexes (TCC) were quantified by a sandwich ELISA and their relative amount was plotted against the molar protein concentration.

Figure 10A and B: Analysis of the purified PAS(800)-nomacopan fusion protein (A) and PAS(1000)- nomacopan fusion protein (B). Samples from each step of the purification protocol were analysed by 4-12% SDS-PAGE under non-reducing and reducing conditions, followed by staining with Coomassie brilliant blue. After purification, the PAS(800)- and PAS(1000)-nomacopan fusion proteins each appeared as a single homogeneous band.

Figure 10C and D: Analytical SEC of the PAS(800)-nomacopan fusion protein (C) and PAS(1000)- nomacopan fusion protein. No aggregates were observed.

Figure 10E and F: ESI-MS of the PAS(800)-nomacopan fusion protein (E) and PAS(1000)- nomacopan fusion protein (F). The deconvoluted spectra of the fusion proteins show a single peak for each fusion protein corresponding to a mass which closely matches the calculated mass of the respective fusion protein.

Figure 11 : Analytical SEC of PAS(600)-, PAS(800)- and PAS(1000)-nomacopan fusion proteins. The molecular size of the fusion protein was seen to significantly increase with increasing size of the PAS moiety.

Figure 12: DLS analysis of PAS(600)-, PAS(800)- and PAS(1000)-nomacopan fusion proteins. PAS(1000)-nomacopan fusion proteins had a larger hydrodynamic radii than measured for PAS(600)- and PAS(800)-nomacopan fusion proteins.

Figure 13: SPR measurements of the binding kinetics between PAS(800)-nomacopan fusion protein (A) and PAS(1000)-nomacopan fusion protein (B) and human C5, demonstrating that PAS(1000)- nomacopan fusion proteins retain C5 binding function.

EXAMPLES

The following nomenclature is used to describe the fusion proteins exemplified in the below examples. Sequences forthe exemplified fusion proteins are displayed in Table 1.

Monovalent PAS-nomacopan fusion proteins PAS(600)-nomacopan (SEQ ID NO: 56) is a fusion protein comprising a) a bioactive polypeptide (SEQ ID NO: 4) fused (via an alanine) to the C-terminus of b) a PAS polypeptide consisting of 600 amino acids (SEQ ID NO: 32).

PAS(800)-nomacopan (SEQ ID NO: 57) is a fusion protein comprising a) a bioactive polypeptide (SEQ ID NO: 4) fused (via an alanine) to the C-terminus of b) a PAS polypeptide consisting of 800 amino acids (SEQ ID NO: 31)

PAS(1000)-nomacopan (SEQ ID NO: 58) is a fusion protein comprising a) a bioactive polypeptide (SEQ ID NO: 4) fused (via an alanine) to the C-terminus of b) a PAS polypeptide consisting of 1000 amino acids (SEQ ID NO: 33).

PAS(1200)-nomacopan (SEQ ID NO: 59) is a fusion protein comprising a) a bioactive polypeptide (SEQ ID NO: 4) fused (via an alanine) to the C-terminus of b) a PAS polypeptide consisting of 1200 amino acids (SEQ ID NO: 34).

Bivalent PAS-nomacopan fusion proteins (i.e nomacopan-PAS-nomacopan and PAS-nomacopan- PAS-nomacopan fusion proteins)

Nomacopan-PAS(600)-nomacopan (SEQ ID NO: 60) is a fusion protein comprising a) a first bioactive polypeptide (SEQ ID NO: 4) fused to the N-terminus of b) a PAS polypeptide consisting of 600 amino acids (SEQ ID NO: 31) fused (via an alanine) to the N-terminus of c) a second bioactive polypeptide (SEQ ID NO: 4) fused to the C terminus of the PAS polypeptide.

PAS(400)-nomacopan-PAS(400)-nomacopan (SEQ ID NO: 61) is a fusion protein comprising a) a first PAS polypeptide consisting of 400 amino acids (SEQ ID NO: 30) fused (via an alanine) to the N terminus of b) a first bioactive polypeptide (SEQ ID NO: 4) fused to the N-terminus of c) a second PAS polypeptide consisting of 400 amino acids (SEQ ID NO: 30) fused (via an alanine) to the N terminus of d) a second bioactive polypeptide (SEQ ID NO: 4).

PAS(600)-nomacopan-PAS(600)-nomacopan (SEQ ID NO: 62) is a fusion protein comprising a) a first PAS polypeptide consisting of 600 amino acids (SEQ ID NO: 31) fused (via an alanine) to the N terminus of b) a first bioactive polypeptide (SEQ ID NO: 4) fused to the N-terminus of c) a second PAS polypeptide consisting of 600 amino acids (SEQ ID NO: 31) fused (via an alanine) to the N terminus of d) a second bioactive polypeptide (SEQ ID NO: 4). Table 1 : sequences of exemplified fusion proteins. The bioactive polypeptides are bold and PAS polypeptide sequences are underlined.

Example 1 : Construction of an expression plasmid for a monovalent PAS-nomacopan fusion protein.

For the construction of the monovalent PAS(800)-nomacopan fusion protein, a low-repetitive PAS(800) polypeptide gene cassette (SEQ ID NO: 32), which was codon-optimized for expression in E. coli and cloned on the vector pXL2 (W02017109087A1), was excised by restriction digest with Sapl and subsequently ligated with the vector pASK75-T7RBS-MPA-Stop-Saplrev that had been cut in the identical manner and dephosphorylated with shrimp alkaline phosphatase (New England Biolabs, Frankfurt am Main). pASK75-T7RBS-MPA-Stop-Saplrev is a derivative of pASK75 (Skerra (1994) Gene 151 :131-135) which encodes a start methionine (ATG), followed by a proline (CCA), an alanine (GCC) and a stop codon (TAG). This gene stretch is flanked by an Nde\ restriction site at the 3'-end and a reverse Sapl restriction site at the 5'-end. In a second step, the resulting MP-PAS(800)-A gene cassette was excised by digestion with the restriction enzymes Nde\ and Sapl and ligated with the correspondingly cut expression plasmid pASK75-T7RBS-His6-OmCI-PDI [36], leading to pASK75- T7RBS-MP-PAS(800)-nomacopan/PDI. This bicistronic expression plasmid allows the co-expression of the MP-PAS(800)-nomacopan fusion protein with the mature human disulfide-isomerase (PDI; UniProt P07237, amino acids 18-508, with the signal sequence deleted) to facilitate the proper formation of the 3 native disulfide bonds of nomacopan in the cytoplasm of E. coli Origami B.

For the construction of the monovalent PAS(1000)-nomacopan fusion protein and the monovalent PAS(1200)-nomacopan fusion protein, equivalent methods are used.

Example 2: Construction of expression plasmids encoding bivalent PAS-nomacopan fusion proteins.

For the expression of bivalent PAS-nomacopan fusion proteins, intermediary gene cassettes were stepwise assembled on the acceptor plasmid pASK75-T7RBS-MPA-Stop-Saplrev. To this end, the acceptor plasmid was digested with the restriction enzyme Sapl, dephosphorylated with shrimp alkaline phosphatase, and ligated with either a PAS gene cassette isolated from a pXL2 derivative as described in Example 1 or with a Sapl digested PCR fragment of nomacopan amplified from pASK75- T7RBS-His6-OmCI-PDI using the primers D20 [122] and CovREV (AAGCTTGCTCTTCAGGCACAA TCTTTCAGATGCGGATACATC, SEQ ID NO: 65). This procedure was repeated in a step-wise manner - taking advantage of the repeated identical 3-nucleotide overhangs (GGC/GCC) encoding a C-terminal Ala residue - until the intermediate gene cassettes encoding MP-nomacopan-PAS(600)-A, MP-PAS(400)-nomacopan-PAS400-A and MP-PAS(600)-nomacopan-PAS(600)-A were obtained. These intermediary gene cassettes were then excised by digestion with the restriction enzymes Nde\ and Sapl and ligated with the correspondingly cut vector pASK75-T7RBS-His6-OmCI-PDI, resulting in the expression plasmids pASK75-T7RBS-MP-nomacopan-PAS(600)-nomacopan/PDI, pASK75- T7RBS-MP-PAS(400)-nomacopan-PAS(400)-nomacopan/PDI (Fig. 1A) and pASK75-T7RBS-MP- PAS(600)-nomacopan-PAS(600)-nomacopan/PDI.

Example 3: Shake flask production of fusion proteins in E. coli

All fusion proteins containing an N-terminal Met-Pro sequence (leading to an N-terminal Pro residue in the mature fusion protein via intracellular cleavage with methionine aminopeptidase) were produced in the cytoplasm of E. coli Origami B, a BL21 derivative with mutations in the thioredoxin reductase (trxB) and glutathione reductase (gor) genes to enable cytoplasmic disulfide bond formation [123], To this end, chemically competent Origami B cells (Novagen/Merk Millipore, Billerica, MA) were transformed with pASK75-T7RBS-MP-nomacopan-PAS(600)-nomacopan/PDI, pASK75-T7RBS-MP- PAS(400)-nomacopan-PAS(400)-nomacopan/PDI, pASK75-T7RBS-MP-PAS(600)-nomacopan- PAS(600)-nomacopan/PDI or pASK75-T7RBS-MP-PAS(800)-nomacopan/PDI, described in Examples 1 and 2. 2 ml LB medium in a sterile 13 mL polypropylene tube (Sarstedt, Numbrecht, Germany), substituted with 100 mg/L ampicillin (Amp), was inoculated with a colony of the transformed E. coli Origami B cells and grown overnight at 37 °C under shaking at 170 rpm. The next day, 50 ml terrific broth (TB) medium [124], substituted with 100 mg/L ampicillin, was inoculated with 2 ml of the overnight culture and grown at 37°C and 170 rpm until an ODsso of 0.9 was reached. Then, this TB preculture was used to inoculate a 5 L baffle shake flask filled with 2 L TB/100 mg/L Amp medium and incubated at 37°C and 100 rpm. After reaching an ODsso of 0.2, the temperature was reduced to 30°C and after reaching an OD550 of 0.6 the temperature was decreased to 26°C. E. coli cultures were induced at an OD550 of 1 by addition of anhydrotetracycline (aTc) to a final concentration of 0.25 mg/L. Bacteria were harvested 15 h after induction and cell pellets were immediately stored frozen at -21 °C.

Example 4: Purification of monovalent PAS(800)-nomacopan

The frozen cell pellet from the 2 L shake flask expression described in Example 3 was resuspended in 40 ml 20 mM Tris/HCI, 1 mM EDTA, pH 8.5 supplemented with one tablet of the complete™ EDTA- free protease inhibitor cocktail (Roche, Mannheim, Germany). Cells were disrupted using an EmulsiFlex-C3 homogenizer (A vestin, Ottawa, Canada). After centrifugation (18,000 rpm, 20 min, 4 °C), the supernatant containing the soluble PAS(800)-nomacopan fusion protein was subjected to an ammonium sulfate precipitation by stepwise addition of an aqueous 4 M (NH4)2SO4 solution to a final concentration of 850 mM (NH4)2SO4 under continuous stirring at room temperature. The mixture was centrifuged at 18,000 rpm at room temperature for 20 min. The sediment containing the precipitated PAS(800)-nomacopan fusion protein was redissolved in 40 mM MES/NaOH, 1 mM EDTA, pH 6.0 and the solution was centrifuged (18,000 rpm, 30 min, 4°C) again, to remove insoluble contaminants, and finally filter-sterilized using a 0.2 pM PES syringe filter (Sarstedt, Numbrecht, Germany). The clear protein solution was subjected to a subtractive cation exchange chromatography using a XK26/40 column (Cytiva, Freiburg, Germany) connected to an Akta explorer 100 system at a flow rate of 2 ml/min using 40 mM MES/NaOH, 1 mM EDTA, pH 6.0 as running buffer. The flow-through was dialyzed against a 100-fold volume of 20 mM Tris/HCI, 1 mM EDTA pH 7.5 overnight at 4 °C. To remove residual impurities, the dialysed protein was subjected to a binding anion exchange chromatography using a 100 ml Fractogel EMD TMAE (M) column (Merck Millipore, Darmstadt Germany) connected to an Akta Explorer system operated with 5 ml/min 20 mM Tris/HCI, 1 mM EDTA pH 7.5. The PAS(800)-nomacopan fusion protein was eluted using a 0-300 mM NaCI concentration gradient in running buffer. The eluted protein was concentrated by 850 mM ammonium sulfate precipitation as described above, and as a final polishing step, the precipitate was dissolved in PBS and applied to a preparative size exclusion chromatography on a HiLoad™ 16/600 Superose™ 6 column (Cytiva) operated with PBS on an Akta Explorer 100 system. Samples from each purification step were analyzed by 10 % SDS-PAGE using a high molarity Tris buffer system [100], After SDS- PAGE, the gel was stained with Coomassie brilliant blue R250 (Applichem, Darmstadt, Germany) dissolved in 10 % v/v acetic acid (Honeywell Specialty Chemicals, Seelze, Germany), 25 % v/v isopropanol (CLN, Niederhummel, Germany). After destaining in 10 % v/v acetic acid, blue protein bands became visible and demonstrated high purity after this purification procedure (Fig. 2A). Homogenous protein was obtained after the second (NH4)2SO4 precipitation while no aggregates were observed in the size exclusion chromatography step (Fig. 2B). A yield of 18 mg per 2 L culture (1 .4 mg/g cell mass) was obtained.

Example 5: Purification of bivalent PAS-nomacopan fusion proteins

The frozen cell pellet from the 2 L shake flask expression described in Example 3 was homogenized and centrifuged as described in Example 4. The sterile-filtered supernatant was subjected to a subtractive cation exchange chromatography using a XK26/40 column (Cytiva) connected to an Akta explorer system at a flow rate of 2 ml/min using 40 mM MES/NaOH, 1 mM EDTA, pH 6.0 as running buffer. Subsequently, the flow-through was mixed with 400 mM NaPi pH 7.5 at a volume ratio 9:1 . If necessary, the pH was adjusted to pH 7.5 using 700 mM Na3PO4, followed by dilution with water until a conductivity of 9 mS/cm was reached. Immediately after this step, the protein solution was applied to a subtractive anion exchange chromatography on a 20 ml EshmundoQ column (Bio-Rad Laboratories, Feldkirchen, Germany) connected to an Akta explorer 100 system at a flow rate of 5 ml/min using 40 mM NaPi, 1 mM EDTA, pH 7.5 as running buffer. The flow-through was dialyzed twice against a 100-fold volume of 20 mM Tris/HCI, 1 mM EDTA pH 7.5 overnight at 4 °C. To remove residual impurities, the dialysed protein was subjected to a binding anion exchange chromatography using a 100 ml Fractogel EMD TMAE (M) column (Merck Millipore) connected to an Akta Explorer system operated with 5 ml/min 20 mM Tris/HCI, 1 mM EDTA pH 7.5. Bivalent PAS-nomacopan fusion proteins were eluted using a 0-300 mM NaCI concentration gradient in running buffer and the eluted protein was concentrated using a 50 ml Amicon Ultra centrifugal filter unit with 10 kDa MWCO (Merk Millipore). In case of the nomacopan-PAS(600)-nomacopan fusion, the protein was directly applied to a preparative size exclusion chromatography step on a HiLoad™ 16/600 Superose™ 6 column (Cytiva) operated with PBS on an Akta Explorer 100 system. In case of the PAS(400)-nomacopan- PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan fusion proteins, a polishing step using a 5 ml CaptoCore 400 multimodal chromatography column (Cytiva) connected to an Akta Explorer system operated with 2 ml/min 20 mM Tris/HCI, 1 mM EDTA, 100 mM NaCI, pH 7.5 was introduced prior to the final SEC step. Samples from each purification step were analyzed by 10 % SDS-PAGE [125], The bivalent PAS-nomacopan fusion proteins showed high purity and homogenous bands after this purification procedure (Fig. 3A, C and E) and a peak corresponding to the bivalent PAS-nomacopan was observed in the size exclusion chromatography (Fig. 3B, D and F). Yields of 7.6 mg per 2 L culture (0.5 mg/g cell mass) for nomacopan-PAS(600)-nomacopan, 15.2 mg per 2 L culture (1.0 mg/g cell mass) for PAS(400)-nomacopan-PAS(400)-nomacopan and 12.2 mg per 2 L culture (1.1 mg/g cell mass) for PAS(600)-nomacopan-PAS(600)-nomacopan were obtained.

Example 6: Determination of hydrodynamic radii using size exclusion chromatography

Analytical size exclusion chromatography was performed on a Superose®6 HR 10/300 GL column (Cytiva) at a flow rate of 0.5 ml/min using an Akta Explorer 10 system with PBS (115 mM NaCI, 4 mM KH2PO4, 16 mM N32HPO4 pH 7.4) as running buffer. 200 pl PAS(800)-nomacopan, nomacopan- PAS(600)-nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan or PAS(600)-nomacopan- PAS(600)-nomacopan, purified as described in Examples 4 and 5, or purified nomacopan and PAS(600)-nomacopan (Akari) were individually applied at a concentration of 1-2 mg/ml in PBS. The apparent molecular weight and hydrodynamic radius were calculated from a calibration curve which was generated using the following protein size standards (Sigma, Deisenhofen, Germany) with known molecular weights and Stokes radii [126], which were injected under the same conditions as the PAS- nomacopan fusion proteins: carbonic anhydrase (0.2 mg/ml; MW: 29 kDa; R_s: 2.1 nm), bovine serum albumin (0.5 mg/ml; MW: 26 kDa; R_s: 2.8 nm), alcohol dehydrogenase (0.4 mg/ml; MW: 150 kDa; R_s: 4.6 nm), p-Amylase (0.5 mg/ml; MW: 200 kDa; R_s: 5.4 nm), apoferritin (0.2 mg/ml; MW: 443 kDa; R_s: 6.1 nm) and thyroglobulin (0.5 mg/ml; MW: 663 kDa; R_s: 8.6 nm). The elution volumes (shown in Fig. 4), the calculated and apparent molecular weights and stokes radii of nomacopan as well as its fusion proteins are summarized in Table 2. The molecular size of the fusion protein was seen to significantly increase with increasing size of the PAS moiety. PAS(800)-nomacopan, nomacopan-PAS(600)- nomacopan, PAS(400)-nomacopan-PAS(400)-nomacopan, PAS(600)-nomacopan-PAS(600)- nomacopan all showed significantly larger hydrodynamic radii than nomacopan and PAS(600)- nomacopan.

Of note, fusion proteins described herein are a combination of a globular protein and a polymer, which may elute in size exclusion chromatography differently compared to pure globular proteins, especially if the polymer part dominates the fusion protein [127], Dynamic light scattering (DLS, described in Example 7) offers an alternative measurement of the hydrodynamic radii of the fusion proteins. For measuring the hydrodynamic radii of the monovalent PAS(1000)-nomacopan fusion protein and the monovalent PAS(1200)-nomacopan fusion protein, the same method is used.

Table 2: Elution volumes and calculated hydrodynamic radii (Rh) and molecular masses of fusion proteins as determined by analytical size exclusion chromatography (SEC)

Example 7: Determination of hydrodynamic radii using dynamic light scattering

DLS measurements were performed in PBS at 25 °C using a Zetasizer Nano S photometer (Malvern Instruments, Herrenberg, Germany) equipped with a 3 mm path length quartz cuvette (Hellma, Mullheim, Germany) using the standard operating procedure "Protein size at 25 °C". Depicted data represent the averaged mean hydrodynamic radius [nm] from the intensity particle size distribution, which met the internal quality criteria. Conversion of hydrodynamic radii to apparent molecular masses was performed using the “Molecular Weight Estimate [kDa] for Globular Proteins” function provided by the Zetasizer software. The hydrodynamic radius (shown in Fig. 5) and estimated molecular mass of nomacopan as well as of the fusion proteins is listed in Table 3. DLS of newly developed fusion proteins reveals significantly larger hydrodynamic radii than measured for nomacopan and PAS(600)-nomacopan. For measuring the hydrodynamic radii of the monovalent PAS(1000)-nomacopan fusion protein and the monovalent PAS(1200)-nomacopan fusion protein, the same method is used.

Table 3: Calculated hydrodynamic radii (Rh) and molecular mass of fusion proteins as determined by dynamic light scattering (DLS)

Example 8: Electrospray ionization mass spectrometry (ESI-MS) to verify integrity of the fusion proteins

A 500 pl aliquot of each purified fusion protein from Examples 4 and 5, at a concentration of around 1 mg/mL, was mixed with 500 pl 2 % v/v acetonitrile, 1 % v/v formic acid (RPC running buffer) and applied to a 1 mL Resource RPC column (GE Healthcare, Freiburg, Germany) connected to an Akta explorer 10 system operated with RPC running buffer. The protein was eluted using an acetonitrile gradient from 2 % v/v acetonitrile, 1 % v/v formic acid to 80 % v/v acetonitrile, 0.1 % v/v formic acid over 20 column volumes. The eluted proteins were directly analyzed via ESI mass spectrometry on a maXis II quadrupole time-of-flight (Q-TOF) mass spectrometer equipped with an electrospray ionization (ESI) source (Bruker Daltonics, Bremen, Germany) using the positive ion mode. Deconvolution of the raw spectra was performed via the Bruker Compass Data Analysis Software (ver. 4.3) with the MaxEnt algorithm. The deconvoluted spectra of the fusion proteins (Fig. 6A-D) revealed in each case a single peak corresponding to a mass which essentially coincides with the calculated mass of the respective fusion protein devoid of the start Met residue (Table 4). This clearly demonstrates that such long PAS polypeptide chains fused with nomacopan as well as complex bivalent PAS-nomacopan fusion protein constructs can be produced in E. coli in their intact form.

To verify the integrity of the monovalent PAS(1000)-nomacopan fusion protein and the monovalent PAS(1200)-nomacopan fusion protein, the same method is used.

Table 4: Calculated and measured molecular mass of fusion proteins determined by ESI-MS

Example 9: Surface plasmon resonance spectroscopy to monitor binding kinetics of fusion proteins towards human C5

A Biacore X100 instrument (GE Healthcare), operated with HBS/T (10 mM HEPES pH 7.4, 150 mM NaCI, 3 mM EDTA, 0.05 % v/v Tween 20) as running buffer, was charged with a carboxymethyl dextran-coated CM3 sensor chip (Cytvia). The dextran carboxylate groups in both flow channels were converted to reactive N-hydroxysuccinimide ester groups using the commercially available amine coupling kit (Cytvia). Next, anti-PA(S) Mab 1.1 (XL-protein) was covalently immobilized on the chip surface by injection of 100 pg/ml anti-PA(S) Mab 1.1 , dissolved in 10 mM Na-acetate pH 4.5, for 600 s at a flow rate of 5 pl/min. Unreacted NHS ester groups were blocked by injection of 0.1 M ethanolamine for 430 s at a flow rate of 5 pl/min, resulting in an anti-PA(S) Mab 1.1 surface density of approximately 5400 resonance units (ARU). Subsequently, the chip was charged with the respective PAS-nomacopan fusion protein by injecting the fusion protein, diluted in HBS/T to 10 pg/ml, into flow channel 2 at a flow rate of 5 pl/min until a surface density of 30-40 RU PAS-nomacopan was reached. For each fusion protein, a single cycle kinetic experiment was performed using five consecutive injections from a 1 :3 dilution series (50 nM to 0.6 nM) of human C5 (Complement Technologies, Tyler, TX) at a flow rate of 30 pL/min, each with 60 s contact time, and a long 3600 s dissociation time after the fifth injection. The chip was regenerated at a flow rate of 30 pl/min by two subsequent injections of 10 mM glycine/HCI pH 2.3 for 60 s. A schematic diagram of the SPR setup is show in Fig. 7A. In the case of the monovalent PAS(800)-nomacopan fusion protein, the reference-corrected sensorgram (Fig. 7C) showed binding curves typical for a bimolecular reaction. Data were fitted to a global 1 :1 Langmuir binding model using Biacore X100 evaluation software (Cytvia), resulting in an association rate of 5.4 x 10⁵ M^-1 s^-1, a dissociation rate of 0.9 x 10^-5 s^-1 and an equilibrium dissociation constant (KD value) of 16.7 pM. In the case of the bivalent nomacopan fusion proteins the reference-corrected sensorgrams (Fig. 7D-H) required fitting by the heterogeneous ligand model, implemented in the BiaCore X100 evaluation software, indicating that the two nomacopan fusion proteins differ in terms of their binding behavior towards human C5. Resulting kinetic parameters are listed in Table 5.

To measure the binding kinetics of the monovalent PAS(1000)-nomacopan fusion protein and the monovalent PAS(1200)-nomacopan fusion protein, the same method is used.

Table 5: Kinetic parameters of PAS-nomacopan fusion proteins as determined by surface plasmon resonance.

Example 10: Predicting the half-life of fusion proteins based on measuring the half-life of PAS(600)-nomacopan in rabbits

Current treatments for retinal diseases often require monthly administration via intravitreal injection. It would be beneficial to reduce the frequency of administration. However, an increase in half-life must be balanced against other factors, including viscosity and dose volume (particularly for intravitreal administration, especially injection), solubility, potency assessed by measuring affinity and/or avidity for C5 and/or LTB4, drug stability, ease of manufacture (e.g., expression, purification), and drug tolerability. The inventors hypothesised that, based on its hydrodynamic radius, PAS(600)- nomacopan would have a vitreous half-life in rabbits of about 7 days [128],

Vitreous half-life of PAS(600)-nomacopan was determined following intravitreal administration in rabbits using standard intravitreal pharmacokinetic-pharmacodynamic (PKPD) protocols. A single 50 pL intravitreal injection of 20 mg/mL or 60 mg/mL PAS(600)-nomacopan was delivered to the eye of non-pigmented New Zealand white rabbits. The vitreous was collected at 3, 7, 14, 21 and 28 days and the concentration of PAS(600)-nomacopan was measured using the RRLC-MS/MS qualified method.

The RRLC-MS/MS method was developed and qualified for quantification of PAS(600) nomacopan in vitreous, retina, choroid and plasma from rabbits. In brief, ocular matrices containing the test item, PAS(600)-nomacopan, were thawed at room temperature and a known amount of internal reference standard PAS(600)-L-nomacopan was added before enzymatic digestion and analysis. PAS(600)-L- nomacopan is an engineered variant that differs from PAS(600)-nomacopan by 7 amino acids. Solid matrices (retina and choroid) were crushed in precellys tubes before digestion. To obtain the peptide fragments of interest (i.e. EVPDYEMWMLDAGGLEVEVECCRQK (SEQ ID NO: 63) peptide for PAS(600)-nomacopan and EVPDYEMWQSDAGADAVEVECCRQK (SEQ ID NO:64) peptide for PAS(600)-L nomacopan), enzymatic digestion was performed on the biological samples using a digestion mix containing the endoproteinase Lys-C. After digestion, all samples were solid phase extracted (SPE) using Oasis HLB ICC 30mg cartridges (WatersTM). Samples were then analyzed by reversed phase liquid chromatography (HPLC) with tandem mass spectrometric (MS/MS) detection (positive mode) after ionisation using an electrospray interface (ESI) on a G6465A Ultivo Triple Quadrupole LC/MS/MS. The method allowed the quantification of EVPDYEMWMLDAGGLEVEVECCRQK peptide which is considered equivalent to the amount of PAS(600)-nomacopan in the vitreous, retina, choroid and plasma. For qualification, the selectivity, lower limit of quantification, carry over, interferences, linearity, repeatability, and reproducibility criteria were checked. The half-life was calculated as ti/2 = ln(2) I (-a) with a = slope of In (concentration = fn (t) (days). The inventors found that the half-life of PAS(600)-nomacopan was 7.4 days and 8.4 days for 20 mg/mL and 60 mg/mL doses, respectively (Table 6, Fig. 8). As the measured values closely match the predicted half-life of about 7 days in rabbits based on Figure 3A in [128] these data demonstrate that the half-life of PAS(600)-nomacopan fusion proteins can be predicted based on their hydrodynamic radius.

No major changes were observed in intraocular pressure (IOP) or electroretinography (ERG) for any of the treatments.

The half-life estimates for the higher and lower concentrations of PAS(600)-nomacopan in the vitreous were equivalent and the absolute concentrations of PAS(600)-nomacopan in eye tissue were approx. 3x higher for the high concentration than the low concentration. These results provide evidence of a linear dose concentration response and, thus, the potential for higher doses to prolong the therapeutic response.

Table 6: Measurement of PAS(600)-nomacopan half-life in the vitreous of rabbits

The inventors aimed to further improve the vitreous half-life using fusion proteins with larger hydrodynamic radii, as described in Examples 1-5. For example, the inventors produced and purified PAS(600)-nomacopan-PAS(600)-nomacopan fusion proteins as described in Examples 1-5 and predicted based on its hydrodynamic radius that the half-life is about 10 days.

In human diabetic retinopathy, the median concentration of C5 (190kDa) in vitreous was 0.36 pg/mL [129], therefore about 0.25 pg/mL of residual unbound fusion protein is needed to inhibit C5 in vitreous. Therefore, a half-life of 10 days may result in a dosing interval of 4 months.

Example 11 : Inhibition of terminal complement activity in human serum by nomacopan and PAS-nomacopan fusion proteins

Series of five 1 :2 dilutions were each prepared in triplicate starting from 6.46 pM stock solution of nomacopan and various PAS-nomacopan fusion proteins (PAS(600)-nomacopan, PAS(800)- nomacopan, PAS(400)- nomacopan -PAS(400)- nomacopan, PAS(600)- nomacopan-Pas(600)- nomacopan) in PBS using complement sample diluent (CSD; Quidel Corporation, San Diego, CA, USA). For each dilution, 86 pl of complement CH50 activator (Quidel) and 7 pl of the diluted sample were mixed in a 1 .5 ml vial. Three samples containing CSD instead of nomacopan served as a negative control. After placing the tubes on ice, 20 pl of normal human serum complement (Quidel) was added and the samples were mixed by repeated pipetting, resulting in final nomacopan or PAS- nomacopan fusion protein concentrations between 200 nM and 0 nM. The tubes were simultaneously incubated at 37°C for precisely 1 h in a water bath, then immediately shock frozen in liquid nitrogen and stored at -25°C. The terminal complement complexes (TCC) that had formed in the samples were subsequently quantified using the CH50 Equivalent ELISA (Quidel). To this end, the tubes were thawed in a water bath at room temperature and placed on ice. Then, the ELISA was performed according to the manufacturer's instructions, with the exception that the samples were diluted by a factor 1 :200 with CSD and the horseradish peroxidase reaction was stopped after 20 min (instead of 15 min). Finally, the absorbance at 450 nm was measured using a Synergy 2 microplate reader (BioTek Instruments, Friedrichshall, Germany). The relative amount of TCC was calculated after setting the absorbance at 450 nm of the negative control sample to 100 %. These data were plotted against the molar protein concentration of each sample protein (Figure 9). All sample proteins, nomacopan, PAS(600)-nomacopan, PAS(800)-nomacopan, PAS(400)-nomacopan-PAS(400)- nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan showed inhibition of TCC formation in a dose-dependent manner. Monovalent PAS-nomacopan fusion proteins (PAS(600)-nomacopan and PAS(800)-nomacopan) retained full inhibitory activity and exhibited a C5-inhibitory activity comparable to that of the unfused nomacopan. Surprisingly, the bivalent PAS-nomacopan fusion proteins (PAS(400)-nomacopan-PAS(400)-nomacopan and PAS(600)-nomacopan-PAS(600)-nomacopan) showed twice the activity, as evident from the steeper decay of the curves projecting at an approximately 50 nM concentration on the X-axis instead of 100 nM, even though the second nomacopan moiety within these fusion proteins was expected to have a lower activity as indicated by the SPR measurements described in Example 9. Example 12: Expression and characterization of PAS(1000)-nomacopan fusion proteins

PAS(1000)-nomacopan fusions were expressed as secreted proteins by bench top fermentation using a strain of Corynebacterium glutamicum as an expression host (Ajinomoto Co., Inc; Japan). Production at 1 L fermenter scale with 300 mL working capacity was performed as described in [130], Briefly fermentation supernatants were directly subjected to ammonium sulfate precipitation by stepwise addition of an aqueous 4 M (NH^SC solution to a final concentration of 900 mM (NH^SC under continuous stirring at room temperature. The mixture was incubated for 30 min and then centrifuged at 16,000 rpm at room temperature for 45 min. The sediment containing the precipitated PAS(1000)-nomacopan fusion protein was dissolved and dialysed against 20 mM Bis- Tris/HCI, 1 mM EDTA, pH 6 (buffer A) overnight at 4 °C. The protein preparation was then subjected to a strong anion exchange chromatography using a Capto Adhere column (Cytiva, Freiburg, Germany) connected to an Akta Explorer system operated with buffer A. The PAS(1000)-nomacopan fusion protein was eluted using a 0-750 mM NaCI concentration gradient in 40 mM Tris/HCL, pH 8.5 (buffer B). Purified protein fractions were identified by SDS-PAGE, pooled and dialysed against buffer A overnight. Finally, the dialysate was loaded on a CaptoQ ImpRes column (Cytiva, Freiburg, Germany) equilibrated in buffer A. Purified PAS(1000)-nomacopan eluted in a gradient of 0-250 mM NaCI in buffer A. PAS(800)-nomacopan fusion proteins were expressed and purified alongside PAS(1000)-nomacopan fusion proteins as a comparator. PAS(800)- and PAS(1000)-nomacopan fusion proteins each appeared as a single homogeneous band on SDS-PAGE (Fig. 10A and B), demonstrating high purity. Analysis using SEC further confirmed that homogenous protein was obtained after purification of each fusion protein, with no aggregates being observed (Fig. 10C and D). Finally, the fusion proteins were analysed via ESI-MS (Fig. 10E and F). The deconvoluted spectra of the fusion proteins show a single peak for each fusion protein corresponding to a mass which closely matches the calculated mass of the respective fusion protein.

The results therefore demonstrate that PAS(1000)-nomacopan fusion proteins can be expressed and purified to a high quality.

Example 13: Determination of apparent size of PAS(1000)-nomacopan using size exclusion chromatography

Analytical SEC at a protein concentration of 225 pg/ml was performed as described in Example 6 on PAS(1000)-nomacopan fusion proteins. PAS(600)- and PAS(800)-nomacopan fusion proteins (225 pg/ml each) were also analyzed for comparison. The elution volumes (shown in Fig. 11) and the calculated and apparent molecular weights of PAS(600)-, PAS(800)- and PAS(1000)-nomacopan fusion proteins are summarized in Table 7. The molecular size of the fusion protein was seen to significantly increase with increasing size of the PAS moiety. Table 7: Elution volumes and molecular masses of fusion proteins as determined by analytical SEC

*The absolute values for apparent molecular mass by SEC are slightly different from those in Table 2 due to the use of a different chromatography column. However, the relative increase in apparent size compared to PAS(600)-nomacopan is comparable.

Example 14: Determination of hydrodynamic radii of PAS(1000)-nomacopan using dynamic light scatering

DLS measurements of PAS(1000)-nomacopan fusion proteins were performed at a protein concentration of 4 mg/ml in PBS (21-040-CV, Corning) as described in Example 7, except that the mean peak size of the size distribution by mass (instead of the size distribution by intensity) was used to calculate the hydrodynamic radius. PAS(600)- and PAS(800)-nomacopan fusion proteins were also analyzed for comparison. The intensity weighted mean hydrodynamic radii (shown in Fig. 12) and estimated molecular mass of the fusion proteins derived from analysis of four independent experiments in mean ± standard deviation (SD) are listed in Table 8. DLS of PAS(1000)-nomacopan fusion proteins reveals a larger hydrodynamic radii than measured for PAS(600)- and PAS(800)- nomacopan.

Table 8: Calculated hydrodynamic radii (Rh) and molecular mass of PAS(1000)-nomacopan as determined by DLS

*The absolute values for apparent molecular mass by DLS are slightly different from those in Table 3 due to differences in experimental setup such as protein concentration. However, the relative increase in apparent size compared to PAS(600)- nomacopan is comparable.

Example 15: Surface plasmon resonance spectroscopy to monitor binding kinetics of

PAS(1000)-nomacopan towards human C5

The binding kinetics of PAS(1000)-nomacopan were measured using SPR as described in Example 9, except that a 30% lower PAS-nomacopan immobilization level was used. PAS(800)-nomacopan fusion proteins were also analyzed for comparison. Resulting kinetic parameters are listed in Table 9.

The data demonstrate that PAS(1000)-nomacopan proteins retain C5 binding function.

Table 9: Kinetic parameters of PAS(1000)-nomacopan as determined by SPR

* Although SPR is the preferred method to determine C5 binding, this method is restricted by the detection limit of the instrument (typical working range is 10'⁵-1 s'¹). In this experiment, the korr reached the detection limit (a dissociation period of 1 h was sufficient for reliable measurement). These korr values may therefore not be accurate. The formula for calculating KD is KD

REFERENCES

[1] Johnson et al. (2011) PNAS 104(45):18277-18282

[2] Boyer et al 2017, Retina 37:819-835, 2017

[3] Jaffe et al. (2020) Opthalmology, 128(4):576-586

[4] Liao et al. (2019) Opthalmology, 127(2): 186-195

[5] SYFOVRE ™ prescribing information, Apellis Pharmaceuticals, February 2023

[6] IZERVAY™ prescribing information, IVERIC bio, Inc., August 2023

[7] Hoover et al, 1984, Proc. Nat. Acad. Sci. U.S.A. 81 , 2191-2193

[8] Harrison and Murphy, 1995, J. Biol. Chem. 270, 17273-17276

[9] Ford-Hutchinson, 1990, Crit. Rev. Immunol. 10, 1-12

[10] Showell et al., 1995, J. Pharm. Exp. Ther. 273, 176-184

[11] Klaas et al, 2005 J. Exp. Med. 201 , 1281-1292

[12] Del Prete et al, 2007 Blood, 109, 626-631

[13] Miyahara et al, 2006 A llergol Int. 55, 91-7

[14] Taube et al, 2006 J. Immunol. 176, 3157-3164

[15] Yamaoka et al, 1989 J. Immunol. 143, 1996-2000

[16] Yokomizo et al, 1997 Nature 387, 620-624

[17] Yokomizo et al, 2000 J. Exp. Med. 192, 421-432

[18] Tager and Luster, 2003 Prostaglandins Leukot. Essent. Fatty Acids 69, 123-134

[19] Yokomizo et al., 2001 , J. Biol. Chem. 276, 12454-12459

[20] Kim, N. D. and Luster, A.D. (2007) The Scientific World Journal 7, 1307-1328

[21] Kim et al., 2006. J. Exp. Med. 203, 829-835

[22] Noiri et al., 2000 Proc Nat Acad Sci USA 97, 823-828

[23] Lundeen et al., 2006 . J. Immunol. 177, 3439-3447

[24] Shao et al, 2006 . J. Immunol. 176, 6254-6261

[25] Chen et al., 2006 . J. Exp. Med. 203, 837-842

[26] Sebaldt et al., 1990 Proc Natl Acad Sd. U.S.A. 8, 6974-6978

[27] Curry et al., 2005 Journal of the American Animal Hospital Association 41 , 298- 309

[28] Dube et al., 1998. Zileuton: the first leukotriene inhibitor for use in the management of chronic asthma. In: Drazen JM, Dahlen S, Lee TH, eds. Five-lipoxygenase Products in Asthma. New York, NY: Marcel Dekkar, Inc

[29] Sharma and Mohammed, 2006 Immunopharmacology 14, 10-16

[30] W02004/106369

[31] Jore, M. M. et al, Nature Structural & Molecular Biology 2016 volume 23, pages 378-386

[32] WO2020/216513

[33] WO2011/144756 [34] Binder and Skerra, 2017 Current Opinion in Colloid and Interface Science, 31 :10-17

[35] Schlapschy M, et al Protein Eng Des Sei. 2013 Aug;26(8):489-501

[36] Kuhn et al, Bioconjugate Chem., 2016, 27 (10), pp 2359-2371

[37] Hong et al, Journal of Liquid Chromatography & Related Technologies, 35:2923-2950, 2012

[38] Stetefeld et al Biophys Rev (2016) 8:409-427

[39] Irvine (2000) Current Protocols in Cell Biology, 6: 5.5.1-5.5.16.

[40] Falke et al. (2019). Dynamic Light Scattering (DLS). In: Pereira et al. (eds) Radiation in Bioanalysis. Bioanalysis, vol 8. Springer, Cham.

[41] Garcia-Quintanilla Pharmaceutics 2019, 11 , 365

[42] Terpe K, Appl Microbiol Biotechnol, 60: 523-33, 2003

[43] Lerchner et al. (2016) Protein Eng Des Sei. 29, 557-562

[44] Eggenstein et al. (2019) Protein Eng Des Sei. 32, 289-296

[45] Roversi, P et al Journal of Biological Chemistry 2013, 288(26) 18789-18802

[46] Macphaerson et al., J. Biol. Chem. (2018) 293(36) 14112-14121

[47] Guo, R.F. and P.A. Ward, Annu Rev Immunol, 2005, 23: p. 821-52

[48] Ricklin D & Lambris J, Nature Biotechnology, 25: 1265-1275 (2007)

[49] Nishimura, J et al., New Engl J. Med., 30;7: 632-639 (2014)

[50] Breustedt D.A., Schbnfeld D.L., Skerra A. (2006) Comparative ligand-binding analysis of ten human lipocalins. Biochim Biophys Acta 1764(2):161 -173.

[51] Eskandarpour et al. Cells 2021 , 10(2), 396

[52] Roversi et al. (2013) J Biol Chem. 288, 18789-18802

[53] Giclas 1994 (Giclas, P. C. (1994). Classical and alternative pathway evaluation (sections 13.1 and 13.2). In Current Protocols in Immunology, Vol. 3

[54] Roversi et al. (2007) J Mol Biol, 369:784-793

[55] Cantor (1980) Biophysical Chemistry, 2nd ed., W. H. Freeman and Company, New York

[56] Creighton (1993) Proteins - Structures and Molecular Properties, 2nd ed., W. H. Freeman and Company, New York

[57] Smith (1996) Fold Des I :R95-R106

[58] WO2008/155134

[59] Remington's Pharmaceutical Sciences; Mack Pub. Co., N.J. 1991

[60] Patel et al Ther. Deliv. (2014) 5(3), 337-365

[61] Berteau et al. (2015) Med Devices (Auckl) 8:473-84

[62] Miller et al. (2010) Langmuir 26: 1067 - 1074

[63] Usach et al. (2019). Adv Ther 36:2986-2996

[64] https://www.rheosense.com/applications/viscosity/biopharmaceutical

[65] Burckbuchler et al. (2010) Eur J Pharm Biopharm, 76(3):351-6

[66] Sobolewska et al (2017) Int J Retin Vitr 3:22

[67] Marra et al. (2011) AAPS PharmSciTech, Vol. 12, No. 1

[68] Aguire et al. (2018) Pham Res 35:173

[69] https://resources.rndsystems.com/pdfs/datasheets/kge006b.pdf

[70] Fagan and Al-Qureshi (2013) Intravitreal injections: a review of the evidence for best practice, Clin Exp Opthalmol, 41 (5):500-507

[71] Oztas et al. (2016) The short-needle intravitreal injection technique, Int J Ophthalmol, 9(6): 929- 930

[72] Wilson and Scott (2013) How to Give Intravitreal Injections, EyeNet Magazine

[73] Henein et al. (2019) Pharmaceutics, 11 (8): 371

[74] Allmendinger et al (2021) Euro J Pharma Biopharma, 166:87=93 [75] Scheller et al. (2020) Haematologica 105(6):1667-1676

[76] Blanch-Ruiz et al. (2021) International Journal of Molecular Sciences

[77] Shioda et al. (2022) The FASEB Journal 37:e22789

[78] Bhamidipati et. Al (2014) Arterioscler Thromb Vase Biol

[79] Kristo et al. (2010) Atherosclerosis 210(1): 107-113

[80] Pitanga et al. 2021 Inflammation Research 70:823-834

[81] Hoggatt & Pelus (2010) Leukaemia 24

[82] Landgraf et al. (2014) PLOS ONE 9(10)

[83] Nohgawa et al. (1997) Journal of Leukocyte Biology 62

[84] Xu et al. (2019) Multiple Sclerosis and Related Disorders 27, 34-41

[85] Zhang et al. (2013) The Journal of Clinical Investigation 123(5)

[86] Tugizova et al. (2021) Current Treatment Options in Neurology 23:13

[87] Gladue et al. (1996) Journal of Experimental Medicine 183 1893-1898

[88] Wang et al. (2012) Clinical Immunology

[89] Eskandarpour et al/ (2021) Am J Pathol 191 (2):320-334

[90] Toomey et al. (2018) Invest Ophthalmol Vis Sci. 2018;59:662-673

[91] Copland et al. (2010) Clinical and Experimental Immunology, 159: 303-314

[92] Xu and Chen Eur J Pharmacol. 2016 15; 787: 94-104.

[93] Mitchell and Bradley, Health Qual Life Outcomes. 2006; 4: 97.

[94] Ferrara et al. Annu. Rev. Med. 2007. 58:491-504

[95] Sasaki et al. JCI Insight. 2018 Sep 20;3(18). pii: 96902.

[96] Delcourt et al. (2017) Investigative Ophthalmology & Visual Science, Vol.58, 6399-6407

[97] Clinical Classification of Age-related Macular Degeneration, Ophthalmology 2013;120:844 - 851

[98] Cai & McGinnis, J Diabetes Res. 2016;2016:3789217

[99] An international classification of retinopathy of prematurity. The Committee for the Classification of Retinopathy of Prematurity. Arch Ophthalmol. 1984;102(8):1130-4.

[100] Sankar et al. Cochrane Database of Systematic Reviews 2018, Issue 1 . Art. No.: CD009734.

[101] Anaya JM et al. Autoimmunity: From Bench to Bedside, Chapter 37 - Autoimmune uveitis, Bogota (Colombia): El Rosario University Press; 2013 Jul 18.

[102] Guedes et al, Indian J Ophthalmol. 2016; 64(9): 628-634

[103] Gulati et al. Br J Ophthalmol 2011 95: 162-165

[104] Borke et al. Medscape 2017, Retinal Vein Occlusion (RVO)

[105] The Royal College of Ophthalmologists, Clinical Guidelines Retinal Vein Occlusion (RVO) Guidelines 2017

[106] Lu et. al. Graefes Arch Clin Exp Ophthalmol, 2017, 255:1057-1062

[107] Battaglia et. al. Br J Ophthalmol, 2015, 99:1268-1270

[108] https://eyewiki.aao.Org/Polypoidal_Choroidal_Vasculopathy#cite_ref-Yannuzzi_1_1-0

[109] W02007/028968

[110] W02008/029167

[111] W02008/029169

[112] WO2011/083317

[113] WO2016/198133

[114] W02018/193120

[115] WO2018/193122

[116] W02020/053206

[117] W02021/058117

[118] WO2018/193121 [119] SOLIRIS® prescribing information, Alexion Pharmaceuticals, June 2019

[120] Thon and Koebsch Genetic Engineering & Biotechnology News BIOPROCESS Tutorial

[121] Skerra (1994) Gene 151 : 131-135

[122] Binder (2010) J Mol Biol 400:783-802

[123] Ritz D. et al. (2001) Science 294:158-160

[124] Sambrook (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 3rd ed., New York

[125] Fling SP and Gregerson DS (1986) Anal Biochem 5;155(1):83-8

[126] La Verde V. (2017) Bioprotocol 7:e2230

[127] Breibeck, J. & Skerra, A. (2018) The polypeptide biophysics of proline/alanine-rich sequences

(PAS): Recombinant biopolymers with PEG-like properties. Biopolymers 109, e23069

[128] Crowell et al. 2019 Transl Vis Sci Technol. 8(6): 1 .

[129] Mandava et al., IOVS 2020; 61

[130] Friedrich et al. (2022) Microbial Cell Factories 21 :227

Claims

1 . A fusion protein comprising: a) a first bioactive polypeptide, wherein the first bioactive polypeptide comprises amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and b) a first PA(S) polypeptide, wherein the first bioactive polypeptide and the first PA(S) polypeptide together comprise at least 900 amino acids.

2. The fusion protein according to claim 1 , wherein the fusion protein has: i) a calculated hydrodynamic radius of at least 9.2 nm, and/or ii) a hydrodynamic radius determined by dynamic light scattering (DLS) of at least 9.4 nm.

3. The fusion protein according to claim 1 or 2, wherein the first PA(S) polypeptide is fused to the N-terminus of the first bioactive polypeptide.

4. The fusion protein according to any one of claims 1 to 3, wherein the first PA(S) polypeptide comprises at least 800 amino acids.

5. The fusion protein according to any one of claims 1 to 4, wherein the first PA(S) polypeptide comprises at least 1000 amino acids.

6. The fusion protein according to any one of claims 1 to 5, wherein the first PA(S) polypeptide comprises at least 1200 amino acids.

7. The fusion protein according to claim 1 or 2, wherein the fusion protein further comprises: c) a second bioactive polypeptide comprising amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, wherein the first bioactive polypeptide is fused to the N-terminus of the PA(S) polypeptide and the second bioactive polypeptide is fused to the C-terminus of the PA(S) polypeptide, optionally via a linker.

8. The fusion protein according to claim 7, wherein the first PA(S) polypeptide comprises at least 600 amino acids.

9. The fusion protein according to claim 1 or 2, wherein the fusion protein further comprises c) a second bioactive polypeptide comprising amino acids 19 to 168 of the amino acid sequence of SEQ ID NO: 2 or a functional equivalent thereof, and d) a second PA(S) polypeptide, wherein the first PA(S) polypeptide is fused to the N-terminus of the first bioactive polypeptide and the second PA(S) polypeptide is fused to the C-terminus of the first bioactive polypeptide and to the N-terminus of the second bioactive polypeptide.

10. The fusion protein according to claim 9, wherein the first and/or the second PA(S) polypeptide comprises at least 400 amino acids.

11 . The fusion protein according to claim 9 or 10, wherein the first and/or the second PA(S) polypeptide comprises at least 600 amino acids. The fusion protein according to any one of the preceding claims, wherein one or more of the fusions is via a linker. The fusion protein according to any one of the preceding claims, wherein the first and/or the second bioactive polypeptide comprises the sequence of amino acids 19 to 168 of SEQ ID NO: 2, in which up to 50 amino acid substitutions, insertions or deletions have been made, and the polypeptide binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, wherein each of the six cysteine amino acids at positions 6, 38, 100, 128, 129, 150 of the mature Nomacopan molecule as set out in SEQ ID NO: 4 is retained and at least 5, 10, or 15 or each of the LTB4 binding residues and at least 5, 10, 15, or 20 or each of C5 binding residues set is retained or is subject to a conservative modification, wherein the LTB4 binding residues are Phe18, Tyr25, Arg36, Leu39, Gly41 , Pro43, Leu52, Val54, Met56, Phe58, Thr67, Trp69, Phe71 , Gln87, Arg89, His99, His101 , Asp103, and Trp115 (numbering according to SEQ ID NO:4) and the C5 binding residues are Val26, Val28, Arg29, Ala44, Gly45, Gly61 , Thr62, Ser97, His99, His101 , Met 114, Met 116, Leu117, Asp118, Alai 19, Gly120, Gly121 , Leu122, Glu123, Val124, Glu125, Glu127, His146, Leu147 and Asp 149 (numbering according to SEQ ID NO:4). The fusion protein according to claim 13, wherein, in the first and/or the second bioactive polypeptide, up to 2, 3, 4, 5, 10, 15, or 20 of the LTB4 and C5 binding residues are subject to a conservative modification. The fusion protein according to claim 13 or claim 14, wherein, in the first and/or the second bioactive polypeptide, at least 5, 10, or 15 or each of the LTB4 binding residues and at least 5, 10, 15, or 20 or each of the C5 binding residues is retained. The fusion protein according to any one of claims 13 to 15, wherein, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained or is subject to a conservative modification. The fusion protein according to any one of claims 13 to 16, wherein, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained or is subject to a conservative modification, wherein up to 2, 3, 4, 5, 10, 15, or 20 of the C5 and/or LTB4 binding residues are subject to a conservative modification. The fusion protein according to any one of clams 13 to 17, wherein, in the first and/or the second bioactive polypeptide, each of the LTB4 binding residues and each of the C5 binding residues is retained. The fusion protein according to any one of claims 1 to 12, wherein the first and/or the second bioactive polypeptide comprises a sequence having at least 80% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2. The fusion protein according to any one of claims 1 to 12 or 19, wherein the first and/or the second bioactive polypeptide comprises a sequence having at least 90% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2. The fusion protein according to any one of claims 1 to 12, 19, or 20, wherein the first and/or the second bioactive polypeptide comprises a sequence having at least 95% sequence identity to the sequence of amino acids 19 to 168 of SEQ ID NO: 2. The fusion protein according to any one of claims 19 to 21 , wherein the first and/or the second bioactive polypeptide: a) binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, or b) binds to LTB4 but has reduced or absent C5-binding activity. The fusion protein according to any one of claims 1 to 22, wherein the first and/or the second bioactive polypeptide comprises or consists of the sequence of amino acids 19 to 168 of SEQ ID NO: 2. The fusion protein according to any one of the preceding claims, wherein the first and/or the second bioactive polypeptide comprises or consists of a fragment of the bioactive polypeptide as defined in any one of claims 1 or 13 to 23, wherein the bioactive polypeptide: a) binds C5 to prevent the cleavage of complement C5 by convertase into complement C5a and complement C5b and binds to LTB4, or b) binds to LTB4 but has reduced or absent C5-binding activity. The fusion protein according to any one of the preceding claims, wherein the first and the second bioactive polypeptides are identical. The fusion protein of any one of the preceding claims, wherein the first and/or the second PA(S) polypeptide mediates an increased in vivo and/or in vitro stability of the first and/or the second bioactive polypeptide. The fusion protein of any one of the preceding claims, wherein the first and/or the second PA(S) polypeptide forms a random coil conformation. The fusion protein of any one of the preceding claims, wherein the first and/or the second PA(S) polypeptide is a PAS polypeptide. The fusion protein of claim 28, wherein the first and/or the second PAS polypeptide consists of proline, alanine, and serine residues. The fusion protein of any claim 28 or claim 29, wherein the first and/or the second PAS polypeptide comprises a plurality of amino acid repeats, wherein each repeat consists of proline, alanine, and serine residues and wherein no more than 6 consecutive amino acid residues are identical. The fusion protein of any one of claims 28 to 30, wherein proline residues constitute more than 4% and less than 40% of the amino acids of the first and/or the second PAS polypeptide. The fusion protein of any one of claims 28 to 31 , wherein the first and/or the second PAS polypeptide comprises or consists of repeats of a sequence selected from the group consisting of: i) ASPAAPAPASPAAPAPSAPA (SEQ ID NO: 15); ii) AAPASPAPAAPSAPAPAAPS (SEQ ID NO: 16); iii) APSSPSPSAPSSPSPASPSS (SEQ ID NO: 17); iv) SAPSSPSPSAPSSPSPASPS (SEQ ID NO: 18); v) SSPSAPSPSSPASPSPSSPA (SEQ ID NO: 19); vi) AASPAAPSAPPAAASPAAPSAPPA (SEQ ID NO: 20); and vii) ASAAAPAAASAAASAPSAAA (SEQ ID NO: 21). The fusion protein of any one of claims 28 to 54, wherein the first and/or the second PAS polypeptide comprises or consists of repeats of SEQ ID NO: 15. The fusion protein of any one of the preceding claims, wherein the first and/or the second PA(S) polypeptide comprises a maximum of 1200, 1400, or 1600 amino acids. The fusion protein of any one of the preceding claims, wherein the first and the second PA(S) polypeptides are identical. The fusion protein according to any one of claims 1 to 4, 12 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 37. The fusion protein according to any one of claims 1 to 5, 12 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 39. The fusion protein according to any one of claims 1 to 6, 12 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 41. The fusion protein according to any one of claims 1 , 2, 7, 8, 12 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 43. The fusion protein according to any one of claims 1 , 2, 9, 10, 12 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 45. The fusion protein according to any one of claims 1 , 2, 9 to 23, and 25-35, wherein the fusion protein comprises or consists of SEQ ID NO: 47. A pharmaceutical composition comprising the fusion protein according to any one of claims 1 to 41 . The pharmaceutical composition according to claim 42, formulated for subcutaneous administration. The pharmaceutical composition according to claim 42, formulated for intravitreal administration. The pharmaceutical composition according to claim 43 or 44, formulated for administration by injection. The pharmaceutical composition according to any one of claims 43 to 45, having a viscosity of up to 30 cP. A unit dose comprising the fusion protein according to any of claims 1 to 41 or the pharmaceutical composition according to any one of claims 42 to 46. A fusion protein according to any of claims 1 to 41 , the pharmaceutical composition according to any one of claims 42 to 46, or the unit dose according to claim 47, for use in a method of treatment. A fusion protein according to any of claims 1 to 41 , the pharmaceutical composition according to any one of claims 42 to 46, or the unit dose according to claim 47, for use in a method of treating a complement-mediated and/or LTB4-mediated disease or condition. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to claim 49, wherein the complement-mediated and/or LTB4-mediated disease or condition is selected from paroxysmal nocturnal hemoglobinuria (PNH), atypical haemolytic uremic syndrome (aHUS), neuromyelitis optica spectrum disorder (NMOSD) and myasthenia gravis (MG). The fusion protein, the pharmaceutical composition, or the unit dose for the use according to any one of claims 48-50, wherein the fusion protein is administered subcutaneously. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to claim 49, wherein the complement-mediated and/or LTB4-mediated disease or condition is a retinal disease. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to claim 52, wherein the retinal disease is selected from the group consisting of: dry age-related macular degeneration (e.g., geographic atrophy), diabetic retinopathy, retinopathy of prematurity, uveitis (e.g., autoimmune uveitis, infective uveitis), optic neuritis (e.g. glaucoma associated optic neuritis), wet age-related macular degeneration (e.g., choroidal neovascularisation), diabetic macular oedema, retinal vein occlusion, Stargardt disease, polypoidal choroidal vasculopathy, retinitis pigmentosa, hypertension retinopathy, and sickle cell retinopathy. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to claim 53, wherein the retinal disease is dry AMD or geographic atrophy. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to any one of claims 48-54, wherein method comprises administering the fusion protein to a subject, wherein the subject is a human. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to any one of claims 48-49 or 52-55, wherein the fusion protein is administered intravitreally. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to any one of claims 48-56, wherein the fusion protein is administered by injection. The fusion protein, the pharmaceutical composition, or the unit dose for the use according to any one of claims 48-57, wherein the fusion protein is administered: a) once every at least 2 months; b) once every at least 3 months; c) once every at least 4 months; d) once every at least 6 months; e) one every 2 to 6 months; or f) once every from 3 to 6 months. A polynucleotide encoding the fusion protein according to any one of claims 1 to 41. A vector comprising the polynucleotide according to claim 59. A cell expressing the fusion protein according to any one of claims 1 to 41 or comprising the polynucleotide according to claim 59 or the vector according to claim 60. A method of producing the fusion protein of any one of claims 1 to 41 , comprising: a) providing a cell according to claim 61 , and b) purifying the fusion protein from the cell or its culture medium.