WO2024115545A1

WO2024115545A1 - Chilling stress tolerance in plants induced by flavobacterium

Info

Publication number: WO2024115545A1
Application number: PCT/EP2023/083488
Authority: WO
Inventors: Sofie GOORMACHTIG; Antoine PERSYN; Sonia GARCIA MENDEZ; Anne WILLEMS
Original assignee: Vib Vzw; Universiteit Gent
Priority date: 2022-11-30
Filing date: 2023-11-29
Publication date: 2024-06-06

Abstract

The invention relates to the field of sustainable agriculture, more particularly to means and methods to protect crops against cold and chilling stress. The application provides three novel Flavobacterium strains that upon administration to plants, protect the plants against growth retardation induced by low temperatures.

Description

CHILLING STRESS TOLERANCE IN PLANTS INDUCED BY FLAVOBACTERIUM

FIELD OF THE INVENTION

BACKGROUND

Atmospheric temperature is a key factor in the regulation of plant growth and development. Chilling stress, defined as low, but nonfreezing, and largely plant-specific temperatures, generally results in crop yield loss because of reduced germination rates, hindrance of seedling vigor and delay in overall plant development (Hussain et al 2018 Front Plant Sci 9:393; Liu et al 2018 Front Plant Sci 9:1715). Fresh food crops with a year-round demand, such as lettuce, are often protected from chilling conditions by cultivation under heated greenhouse conditions. Currently, electricity, oil and natural gasses are the main resources used for greenhouse heating, not only generating a big ecological footprint but also high costs for farmers (Anifantis et al 2016 Agric Eng 47:164-170). There is thus a need for technical solutions to grow greenhouse-based cash crops under lower temperature conditions.

Plant Growth-Promoting Rhizobacteria (PGPR), a subset of the bacteria living in close proximity to and inside plant roots, have been used to aid plant growth under abiotic stress conditions, such as drought or high salinity (Jochum et al 2019 Front Microbiol 10:2106; Liu et al 2019 AMB Express 9:169; Batool et al Sci Rep 10:16975; Fan et al Sci Rep 10:12740; Shultana et al PLoS ONE 15:e0238537). Also under low temperature settings, PGPRs have been shown to promote plant development. Burkholderia phytofirmans PsJN reduced the impact of freezing temperatures on the photosynthesis of Arabidopsis thaliana and enhanced the low temperature tolerance of grapevine ( Vitis vinifera L.) by regulating the expression of cold-related genes (Ait Barka et al 2006 Appl Environ Microbiol 72:7246-7252; Fernandez et al 2012 Mol Plant-Microbe Interact 25:496-504; Su et al 2015 Front Plant Sci 6:810). Tolerance to chilling stress in tomato (Solanum lycopersicum) seedlings was conferred by inoculation with a consortium of Bacillus and Serratia species, whereas Bosea and Pseudoduganella species promoted maize (Zea mays) growth under low temperature conditions (Wang et al 2016 J Plant Growth Regul 35:54-64; Beirinckx et al 2020 Microbiome 8:54). SUMMARY

In current application it is disclosed how the inventors studied the low temperature-enriched root microbiome of five lettuce cultivars grown in three different soil types and identified intermutually cold-enriched bacterial strains. Three Flavobacterium strains belonging to 3 different species consistently promoted plant growth under chilling stress.

The invention is further summarized in the following statements:

1. An isolated Flavobacterium strain comprising a 16S RNA sequence as depicted in SEQ. ID No. 1-3.

2. The isolated Flavobacterium strain according to statement 1 having the deposit accession number LMG P-32775, LMG P-32776 or LMG P-32777.

3. The isolated Flavobacterium strain according to any of the statements 1-2 for inducing chilling stress tolerance in plants.

4. An enriched culture of the Flavobacterium strain according to any of statements 1-3.

5. A biologically pure culture of the Flavobacterium strains according to any of statements 1-3.

6. A composition comprising the Flavobacterium strain according to any of statements 1-3 or the culture according to any of statements 4-5.

7. The composition according to statement 6, wherein the Flavobacterium strain is lyophilized, freeze-dried to a powder or present as an aqueous slurry.

8. The composition according to any of statements 6-7 further comprising growth medium appropriate for Flavobacterium species and/or a cryoprotectant.

9. The composition according to any of statements 6-8 further comprising an agriculturally compatible carrier.

10. A plant seed coated with the Flavobacterium strain according to any of statements 1-3 or with the culture according to any of statements 4-5.

11. The plant seed according to statement 10, where the plant seed is a lettuce plant seed.

12. Use of the Flavobacterium strain according to any of statements 1-2, the culture according to any of statements 4-5 or the composition according to any of statements 6-8 to enhance yield and/or plant growth under low temperature conditions, wherein the enhanced yield and/or plant growth is compared to a control situation in the absence of said Flavobacterium strain.

13. The use according to statement 12 wherein the enhanced yield and/or plant growth is increased fresh matter production.

14. The use according to any of statements 12-13, wherein the low temperature conditions are plant growth conditions at a temperature between 0°C and 18°C.

15. A method for enhancing yield and/or plant growth under low temperature conditions, the method comprising the steps of: a. inoculating a plant growth medium with a microbial population, said population comprises the Flavobacterium strain according to any of statements 1-2, the culture according to any of statements 4-5 or the composition according to any of statements 6- 9; and b. growing the plant in said plant growth medium.

16. The method of statement 14, wherein the microbial population is applied to the plant growth medium as a powder, as a pellet, as a granule or as a liquid.

17. A method for enhancing yield and/or plant growth under low temperature conditions, said method comprising growing the coated plant seed according to statement 10, to obtain enhanced yield and/or plant growth of said plant under low temperature conditions.

18. A method for enhancing yield and/or plant growth under low temperature conditions comprising: a. growing said plant in an environment that supports plant growth; and b. administering a sprayable formulation to said environment or to said plant, said formulation comprising the Flavobacterium strain according to any of statements 1-2, the culture according to any of statements 4-5 or the composition according to any of statements 6-9; c. to obtain enhanced yield and/or plant growth of said plant under low temperature conditions.

19. The method according to any of statements 15-18, wherein the plant is grown at low temperature conditions during at least a part of the day and/or for at least a part of the growing season.

20. The method according to any of statements 15-19, wherein the low temperature conditions are growth conditions at a temperature between 0°C and 18°C.

DEPOSIT OF BIOLOGICAL MATERIAL

Purified cultures of the microbial strains described in present application were deposited by Ghent University (K.L. Ledeganckstraat 35, 9000 Gent, Belgium) at the BCCM (Belgian Coordinated Collections of Microorganisms) consortium (BCCM represented by Laboratorium voor Microbiologie - Bacterienverzameling (LMG), Universiteit Gent, K.L. Ledeganckstraat 35, 9000 Gent, Belgium), recognized as an International Depositary Authority by the World Intellectual Property organization since March 1, 1992 and in accordance with the Budapest Treaty as specified in Rule 31(1) EPC for the purpose of patent procedure and the regulations thereunder. The Flavobacterium strain R-76520 of current application has been deposited as Flavobacterium sp. R-76520 with deposit number LMG P- 32776. The Flavobacterium strain R-75912 of current application has been deposited as Flavobacterium sp. R-75912 with deposit number LMG P-32775. The Flavobacterium strain R-76555 of current application has been deposited as Flavobacterium sp. R-76555 with deposit number LMG P-32777. Original deposits have been done on August 22nd, 2022.

SHORT DESCRIPTION OF THE FIGURES

Figure 1 is an overview of the experimental set-up. Five different lettuce cultivars (from left to right: Lozaine, Corentine, Presteria, Platinas and Shentai) were grown under control and low temperature conditions in three different soil types.

Figure 2 shows the effect on lettuce growth (shoot fresh weight in mg) under chilling conditions of 12 different Flavobacterium strains compared to a mock control. Shoot fresh weight of plants inoculated with and without (mock) bacteria (n=15) was measured in three repeats.

Figure 3 shows the difference between lettuce seedlings untreated (lower row) and treated (upper row) with Flavobacterium piscis (A), Flavobacterium fluminis (B) and Flavobacterium hercynium (C) after 20 days of growth under chilling conditions (14°C, day/night)

DETAILED DESCRIPTION

Definitions

In order that the present description can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description. The present invention is described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence", is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably herein. Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B", "A or B", "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated. Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

It is understood that wherever aspects or embodiments are described herein with the language "comprising", otherwise analogous aspects or embodiments described in terms of "consisting of" and/or "consisting essentially of" are also provided. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Press, Plainsview, New York (2012); and Ausubel et al., current Protocols in Molecular Biology (Supplement 100), John Wiley & Sons, New York (2012), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art.

Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance. For example, about 14°C refers to the temperature range between 13.5 and 14.5°C.

In order to reconstruct the evolutionary relationships and sequence identity of one bacterial isolate to another, phylogenetic approaches are used standardly exploiting the 16S rRNA sequence or a portion of the 16S rRNA sequence of the bacteria, although any other sequence or the entire genome of the microorganisms to be analyzed can also be used. In microbiology, "16S rRNA sequence" refers to the sequence derived by characterizing the nucleotides that comprise the 16S ribosomal RNA gene(s). The bacterial 16S rRNA is approximately 1500 nucleotides in length.

As used herein, the terms "nucleic acid", "nucleic acid sequence" or "nucleic acid molecule" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Nucleic acids may have any three- dimensional structure, and may perform any function, known or unknown. Non-limiting examples of nucleic acids include a gene, a gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, control regions, isolated RNA of any sequence, nucleic acid probes, and primers. The nucleic acid molecule may be linear or circular. The nucleic acid may comprise a promoter, an intron, an enhancer region, a polyadenylation site, a translation initiation site, 5' or 3' untranslated regions, a reporter gene, a selectable marker or the like. The nucleic acid may comprise single stranded or double stranded DNA or RNA. The nucleic acid may comprise modified bases or a modified backbone. A nucleic acid that is up to about 100 nucleotides in length, is often also referred to as an oligonucleotide. "Nucleotides" as used herein refer to the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which are absent in nucleosides). A nucleotide without a phosphate group is called a "nucleoside" and is thus a compound comprising a nucleobase moiety and a sugar moiety. As used herein, "nucleobase" means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Naturally occurring nucleobases of RNA or DNA comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Nucleotide sequence", "DNA sequence" or "nucleic acid molecule(s)" as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and singlestranded DNA, the (reverse) complement DNA, and RN A. It also includes known types of modifications, for example, methylation, "caps" substitution of one or more of the naturally occurring nucleotides with an analogue. By "nucleic acid construct" it is meant a nucleic acid sequence that has been constructed to comprise one or more functional units not found together in nature. Examples include circular, linear, double-stranded, extrachromosomal DNA molecules (plasmids), cosmids (plasmids containing COS sequences from lambda phage), viral genomes comprising non-native nucleic acid sequences, and the like. "Coding sequence" is a nucleotide sequence, which is transcribed into mRNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. A coding sequence can include, but is not limited to mRNA, cDNA, recombinant nucleotide sequences or genomic DNA, while introns may be present as well under certain circumstances.

The terms "identical" or percent "identity" in the context of two or more nucleic acid or amino acid sequences refer to two or more sequences that are the same or have a specified percentage of nucleotides or amino acid residues respectively that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of nucleotide or amino acid sequences.

The term "percent sequence identity" or "% sequence identity" or "percent identity" or "% identity" between two polynucleotide or polypeptide sequences refers to the number of identical matched positions shared by the sequences over a comparison window, taking into account additions or deletions (i.e. gaps) that must be introduced for optimal alignment of the two sequences. A matched position is any position where an identical nucleotide or amino acid is presented in both the target and reference sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides or amino acids. Likewise, gaps presented in the reference sequence are not counted since target sequence nucleotides or amino acids are counted, not nucleotides or amino acids from the reference sequence.

One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain aspects, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain aspects, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative aspects, the GAP program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain aspects, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4. One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain aspects, the default parameters of the alignment software are used.

One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. Sequence alignments can be derived from multiple sequence alignments. One suitable program to generate multiple sequence alignments is ClustalW2, available from www.clustal.org. Another suitable program is MUSCLE, available from www.drive5.com/muscle/. ClustalW2 and MUSCLE are alternatively available, e.g., from the EBI (European Bioinformatics Institute).

In certain aspects, the percentage identity "X" of a first nucleotide sequence to a second nucleotide sequence is calculated as 100 x (Y/Z), where Y is the number of nucleotide residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. Different regions within a single polynucleotide target sequence that align with a polynucleotide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer. According to the present application, the degree of identity, between a given reference nucleotide sequence and a nucleotide sequence which is a homologue of said given nucleotide sequence will preferably be at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of identity is given preferably for a nucleic acid region which is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or 100% of the entire length of the reference nucleic acid sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is given preferably for at least 20, at least 40, at least 60, at least 80, at least 100, at least 120, at least 140, at least 160, at least 180, or 200 nucleotides, preferably contiguous nucleotides. In a particular embodiment, the degree/percentage of similarity or identity is given for the entire length of the reference nucleic acid sequence.

The term "defined by SEQ ID No. X" or "as depicted in SEQ ID No. X" as used herein refers to a biological sequence consisting of the sequence of amino acids or nucleotides given in the SEQ. ID No. X. For instance, a protein defined in/by SEQ ID No. X consists of the amino acid sequence given in SEQ ID No. X. A further example is an amino acid sequence comprising SEQ ID No. X, which refers to an amino acid sequence longer than the amino acid sequence given in SEQ ID No. X but entirely comprising the amino acid sequence given in SEQ ID No. X (wherein the amino acid sequence given in SEQ ID No. X can be located N-terminally or C-terminally in the longer amino acid sequence, or can be embedded in the longer amino acid sequence), or to an amino acid sequence consisting of the amino acid sequence given in SEQ ID No. X.

The term "statistically significantly" different is well known by the person skilled in the art. Statistical significance plays a pivotal role in statistical hypothesis testing. It is used to determine whether the null hypothesis should be rejected or retained. The null hypothesis is the default assumption that nothing happened or changed. For the null hypothesis to be rejected, an observed result has to be statistically significant, i.e. the observed p-value is less than the pre-specified significance level a. The p-value of a result, p, is the probability of obtaining a result at least as extreme, given that the null hypothesis were true. In one embodiment, a is 0.05. In a more particular embodiment, a is 0.01. In an even more particular embodiment, a is 0.001.

In all herein described aspects and embodiments - unless specified differently - "stimulate", "enhance", "increase" or "improve" refers to a statistically significant increase and/or an at least 1%, 2%, 3%, 4% or 5% increase or at least 6% increase or at least 7% increase or at least 8% increase or at least 9% increase or at least 10% increase or at least 15% increase or at least 20% increase or at least 25% increase or at least 30% increase or at least 50% increase or at least 75% increase or at least a 100% increase in the property being measured and compared to a control situation. Said control situation is a mock situation wherein the plant, plant seed or other plant part was not treated with the microbial population or Flavobacterium strain herein disclosed. The skilled person is aware how a scientifically sound mock situation should be set up.

"Reduction", "reduced", "decreased", ... as used herein refers to a statistically significant decrease and/or an at least 1%, 2%, 3%, 4% or 5% decrease or at least 6% decrease or at least 7% decrease or at least 8% decrease or at least 9% decrease or at least 10% decrease or at least 15% decrease or at least 20% decrease or at least 25% decrease or at least 30% decrease or at least 50% decrease or at least 75% decrease or at least a 100% decrease in the property being measured and compared to a control situation.

"Treated" as used herein can be direct treatment (e.g. coating seeds or spraying plants) and/or indirect treatment (e.g. providing the substrate wherein the plant is growing with a bacterial population).

"Microbial" as used herein refers to microorganisms, wherein said microorganisms can include bacteria, archaebacteria, fungi, yeasts, mycorrhiza, microscopic eukaryotes (e.g. protozoa and algae), viruses, viroids or a combination thereof. A "microbial population" as used herein can thus refer to a synthetic or artificial collection of different microorganisms with distinct geographical origins. In various more particular embodiments of this application, "microbial" refers to "bacterial".

For the purpose of current application, the term "bacterium" or "bacteria" includes any prokaryotic organism that does not have a distinct nucleus. While being both part of the group of microorganisms, bacteria and fungi are clearly distinct. The term "fungi" or "fungus" includes a wide variety of nucleated spore-bearing organisms that are devoid of chlorophyll.

"CFU" or "cfu" as used herein refers to colony-forming unit. This unit is well-known by the person skilled in the art of microbiology (as well as the methodology how to determine the number of colonyforming units) and is used to estimate the number of viable bacteria or fungal cells in a sample. "Viable" is defined as the ability to multiply via binary fission under controlled conditions. Counting with colony-forming units requires culturing the microbes and counts only viable cells, in contrast with microscopic examination which counts all cells, living or dead.

The term "plant growth promoting" as used herein, refers to a promoting effect on a wide range of growth and development properties of cultured plants or crops, including but not limited to increased root development, increased leaf area, increased plant yield, increased fresh or dry weight, increased seed yield, increased seed germination, increased photosynthesis, increase in accumulated biomass of the plant, increased nitrogen fixation or increased efficiency of nutrients such as nitrogen, phosphorus or potassium.

"Yield", "plant yield" and "crop yield" are used herein interchangeably and generally refer to a measurable product from a plant, and more particularly to the amount or quality of harvestable plant material or plant-derived product. "Yield" is normally defined as the measurable produce of economic value of a crop. For crop plants, "yield" also means the amount and/or quality of harvested material per hectare or unit of production. Yield may be defined in terms of quantity or quality. The harvested material may vary from crop to crop, for example, it may be seeds, above ground biomass, roots, fruits, leaves, flowers, fibres, any other part of the plant, or any plant-derived product which is of economic value. The term "yield" also encompasses yield potential, which is the maximum obtainable yield. Yield may be dependent on a number of yield components, which may be monitored by certain parameters. These parameters are well known to persons skilled in the art and vary from crop to crop. The yield can be determined using any convenient method, for example, kilograms of plant product produced per hectare of planting or bushels or pound of plant product produced per acre of planting. Yield and yield increase (in comparison to a control plant) can be measured in a number of ways, and it is understood that a skilled person will be able to apply the correct meaning in view of the particular embodiments, the particular crop concerned and the specific purpose or application concerned. The terms "enhanced yield" or "improved yield" or "increased yield" can be used interchangeable. As used herein, the term "enhanced yield" means any statistically significant improvement of one or more yield parameters selected from the group consisting of biomass yield, dry biomass yield, aerial dry biomass yield, underground dry biomass yield, fresh-weight biomass yield, aerial fresh-weight biomass yield, underground fresh-weight biomass yield, enhanced yield of harvestable parts, either dry or fresh-weight or both, either aerial or underground or both, enhanced yield of seeds, either dry or fresh-weight or both, either aerial or underground or both, improved nutrient use efficiency, improved seed set and harvest, improved protein content per seed, increased stress tolerance, increased efficiency of nodulation and/or nitrogen fixation, increased efficiency of carbon assimilation, improvement of seedling vigour/early vigour and/or enhanced efficiency of germination (under stressed or non-stressed conditions).

For example, yield refers to biomass yield, e.g. to dry weight biomass yield and/or fresh-weight biomass yield. Biomass yield refers to the aerial or underground parts of a plant, depending on the specific circumstances (test conditions, specific crop of interest, application of interest, and the like). In one embodiment, biomass yield refers to the aerial and underground parts. Biomass yield may be calculated as fresh-weight, dry weight or a moisture adjusted basis. Biomass yield may be calculated on a per plant basis or in relation to a specific area (e.g. biomass yield per acre/square meter/or the like). "Yield" can also refer to seed yield which can be measured by one or more of the following parameters: number of seeds or number of filled seeds (per plant or per area (acre, square meter or the like); seed filling rate (ratio between number of filled seeds and total number of seeds); number of flowers per plant; seed biomass or total seeds weight (per plant or per area (acre, square meter or the like); thousand kernel weight (TKW; extrapolated from the number of filled seeds counted and their total weight; an increase in TKW may be caused by an increased seed size, an increased seed weight, an increased embryo size, and/or an increased endosperm) and protein content of the harvested seeds. Other parameters allowing to measure seed yield are also known in the art. Seed yield may be determined on a dry weight or on a fresh weight basis, or typically on a moisture adjusted basis, e.g. at 15.5 % moisture. For example, the term "increased yield" means that a plant, exhibits an increased growth rate, e.g. in the absence or presence of abiotic environmental stress, compared to the corresponding wild-type plant. An increased growth rate may be reflected inter alia by or confers an increased biomass production of the whole plant, or an increased biomass production of the aerial parts of a plant, or by an increased biomass production of the underground parts of a plant, or by an increased biomass production of parts of a plant, like stems, leaves, blossoms, fruits, and/or seeds. A prolonged growth comprises survival and/or continued growth of the plant, at the moment when the untreated control plant shows visual symptoms of deficiency and/or death.

In accordance with the invention, changes in different phenotypic traits may improve yield. For example, and without limitation, parameters such as floral organ development, seed number, seed weight, protein content of the seed, root initiation, root biomass, harvest index, leaf formation, phototropism, apical dominance, and fruit development, are suitable measurements of improved yield. Increased yield includes higher seed yields, higher protein content of the seed, higher leaf production, higher fresh matter production, and/or higher dry matter production. Any increase in yield is an improved yield in accordance with the invention. For example, the improvement in yield can comprise a 0.1%, 0.2%, 0.5%, 0.8%, 1%, 3%, 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater increase in any measured parameter compared to a mock situation. For example, a statistically significant increase in fresh matter production of lettuce treated with the Flavobacterium strain of the invention, as compared with the fresh matter production of uninoculated lettuce cultivated under the same conditions, is an improved yield in accordance with the invention.

The yield of a plant can depend on the specific plant or crop of interest as well as its intended application (such as food production, feed production, processed food production, biofuel, biogas or alcohol production, or the like) of interest in each particular case. In one embodiment, yield can be calculated as harvest index (i.e. the ratio between the harvested biomass over the total amount of biomass), harvestable parts weight per area (acre, square meter, or the like); and the like. Measurements of plant size in early development, under standardized conditions in a growth chamber or greenhouse, are standard practices to measure potential yield advantages conferred by the presence of plant growth promoting bacteria.

Chilling stress tolerance inducing Flavobacterium strains

In current application three novel Flavobacterium strains are disclosed that when administered to plants increase the tolerance of plants towards low temperatures, more particularly to chilling stress. The Flavobacterium strains have the closest resemblance on a genetic level to F. piscis, F. fluminis or F. hercynium and comprise a 16S rRNA sequence as depicted in SEQ. ID No. 1, 2 or 3 respectively.

SEQ ID No. 1 (16S rRNA F. piscis)

CTGTACTGCAGACTTGATCACAACTCTAGGCTTCCATGGCTTGACGTACGGAGTGTACGAGGCCCGCTAACGT ATTCACCGGATCATGGCTGATATCCGATTACTAGCGATTCCAGCTTCACGGAGTCGAGTTGCAGACTCCGATCC GAACTGTGACCGGTTTTATAGATTCGCTCCTGGTCGCCCAGTGGCTGCTCTCTGTACCGGCCATTGTAGCACGT GTGTAGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCTCACAGTTTGCACTGGCAGTC TTGTTAGAGTTCCCGACATGACTCGCTGGCAACTAACAACAGGGGTTGCGCTCGTTATAGGACTTAACCTGAC ACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTGTAAATTGTCTTGCGAAAGATCTGTTTCCAAAAC GGTCAATCTACATTTAAGCCTTGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGCTCCACCGCTTGTG CGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGTGGGATACTTATCACTTTCGCTT AGCCACTGAAATTGCTTCCAACAGCTAGTATCCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTC GCTACCCACGCTTTCGTCCATCAGCGTCAATCCATTAGTAGTAACCTGCCTTCGCAATTGGTATTCCATGTAATC TCTAAGCATTTCACCGCTACACTACATATTCTAGTTACTTCCTAATAATTCAAGTTTAACAGTATCAATGGCCGT TCCACCGTTGAGCGATGGGCTTTCACCACTGACTTATTAAACCGCCTACGGACCCTTTAAACCCAATGATTCCG GATAACGCTTGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCTTACGATACCGT CAAGCTGCTTCACGAAGCAGTGTTTCTTCTCGTATAAAAGCAGTTTACAATCCATAGGACCGTCATCCTGCACG CGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCTCACTGCTGCCTCCCGTAGGAGTCTGGTCCGT GTCTCAGTACCAGTGTGGGGGATCTCCCTCTCAGGACCCCTACCCATCGTAACCTTGGTAAGCCGTTACCTTAC CAACTAGCTAATGGGACGCATGCTCATCTTTTACCGTTGTGACTTTAATATAATCCTGATGCCAGGGCTATATA CTATGAGGTATTAATCCAAATTTCTCTGGGCTATCCCTCTGTAAAATGTAGATTGCATACGCGTTACGCACCCG TGCGCCGAGTCTCTGGCTACGATAGTACGAT

SEQ ID No. 2 (16S rRNA F. fluminis)

AGTTACCTTGTTACGACTTACTGAGCCATGATCAACTCTAGCTTACCTTGTCTACGACTTACTGAGCGAAGATC GAACGAGCGCGTATTCACCGGATCATGGCTGATATCCGATTACTAGCAATTCCAGCTTCACGGAGTCGAGTTG CAGACTCCGATCCGAACTGTGACCGGCTTTGTAGATTCGCTCCTGGTCACCCAGTGGCTGCTCTCTGTACCGGC CATTGTAGCACGTGTGTAGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCTCACAGTTT GCACTGGCAGTCTCGTTAGAGTTCCCGACATGACTCGCTGGCAACTAACAACAGGGGTTGCGCTCGTTATAGG ACTTAACCTGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTGTAAATTGTCTTGCGAAAGTTCT GTTTCCAAAACGGTCAATCTACATTTAAGCCTTGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGCTC

CACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAAACTTGCGTTCGTACTCCCCAGGTGGGATACTTA

TCACTTTCGCTTAGCCACTGAAGTTGCCCCCAACAGCTAGTATCCATCGTTTACGGCGTGGACTACCAGGGTAT

CTAATCCTGTTCGCTACCCACGCTTTCGTCCATCAGCGTCAATCAATTAGTAGTAACCTGCCTTCGCAATTGGTA

TTCCATGTAATCTCTAAGCATTTCACCGCTACACTACATATTCTAGTTACTTCCTAATAATTCAAGTCTAGCAGTA

TCAATGGCCGTTCCACCGTTGAGCGATGGGCTTTCACCACTGACTTACTAAACCGCCTACGGACCCTTTAAACC

CAATGATTCCGGATAACGCTTGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCT

TACGATACCGTCAAGACATTACACGTAATGTTGTTTCTTCTCGTACAAAAGCAGTTTACAATCCATAGGACCGT

CATCCTGCACGCGGCATGGCTGGTTCAGGCTTGCGCCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGA

ATCTGGTCCGGGTCTCAGTACCAGGGTGGGGGAACTCCCTCTCAGGACCCCTACCCATCGTTGCCTTGGGAAA

CCGTTACCTTACCAACTAGCTAATGGGACGCATGCTCATCTTTCACCGTTGTGACTTTAATTATAAAATGATGCC

ATCCTATAATACTATGAGGTATTAATCCAAATTTCTCTGGGCTATCCCTCTGTGAAATGTAGACCGCATACGCG

CTACGCACCCAGGCATCCAGATCTCTTGGTTACGTTGTATACGATCATTACCTGAGCCATGATCAAACTCTGTA CCTCC

SEQ ID No. 3 (16S rRNA F. hercynium)

AATCTAAGTTACCTTGTTACTACTTACTGCAGACTTGATCAAACTCTAGGATTCCATGGCTTGACGGACGGTGT

GTACAGGCCCGGTAACGTATTCACCGGATCATGGCTGATATCCGATTACTAGCGATTCCAGCTTCACGGAGTC

GAGTTGCAGACTCCGATCCGAACTGTGACCGGTTTTGTAGATTCGCTCCTGGTCGCCCCAGTGGCTGCTCTCTG

TACCGGCCATTGTAGCACGTGTGTAGCCCAAGGCGTAAGGGCCGTGATGATTTGACGTCATCCCCACCTTCCT

CACAGTTTGCACTGGCAGTCTTGTTAGAGTTCCCGACTTGACTCGCTGGCAACTAACAACAGGGGTTGCGCTC

GTTATAGGACTTAACCTGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTGTAAATTGTCTTGC

GAAAGATCTGTTTCCAAATCGGTCAATCTACATTTAAGCCTTGGTAAGGTTCCTCGCGTATCATCGAATTAAAC

CACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGTG

GGATACTTATCACTTTCGCTTAGCCACTGAGATTGCTCCCAACAGCTAGTATCCATCGTTTACGGCGTGGACTA

CCAGGGTATCTAATCCTGTTCGCTACCCACGCTTTCGTCCATCAGCGTCAATCCATTAGTAGTAACCTGCCTTCG

CAATTGGTATTCCATGTAATCTCTAAGCATTTCACCGCTACACTACATATTCTAGTTACTTCCTAATAATTCAAGT

CTGGCAGTATCAATGGCCGTTCCACCGTTGAGCGATGGGCTTTCACCACTGACTTACCAAACCGCCTACGGAC

CCTTTAAACCCAATGATTCCGGATAACGCTTGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCG

ATCCTTATTCTTACGATACCGTCAAGACATTACACGTAATGTTGTTTCTTCTCGTATAAAAGCAGTTTACAATCC

ATAGGACCGTCATCCTGCACGCGGCATGGCTGGATCAGGCTTGCGCCCATTGTCCAATATTCCTCACTGCTGCC

TCCCGTAGGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGATCTCCCTCTCAGGACCCCTACCCATCGTAG

CCTTGGTAAGCCGTTACCTTACCAACTAGCTAAGGGGACGCAGGCTCACCTTTTACCGTTGTGACTTTAATTAT

AAAATGATGCCATTCTATAATACTATGAGGTATTAATCCAAATTTCTCTGGGCTATCCCTCTGTAAAATGTAGAT

TGCATACGCGTTACGCACCCGTGCGCCGAGTCTCTGGCTACCGAAGTACGAT

Therefore a Flavobacterium spp., more particularly an isolated Flavobacterium spp. is provided for inducing chilling stress tolerance in plants or for obtaining low temperature tolerance in plants.

In one aspect of current application, a Flavobacterium strain is provided comprising a 16S rRNA sequence as depicted in SEQ. ID No. 1, 2 or 3. In one embodiment, said Flavobacterium strain is a bacterial strain that protects plants against abiotic stress, more particularly against cold temperatures, even more particularly against chilling stress. In another embodiment, said Flavobacterium strain is a Flavobacterium piscis strain, more particularly the Flavobacterium piscis R-76520 strain, even more particularly the F. piscis strain with deposit accession number LMG P-32776.

In another embodiment, said Flavobacterium strain is a Flavobacterium fluminis strain, more particularly the F. fluminis R-75912 strain, even more particularly the F. fluminis strain with deposit accession number LMG P-32775.

In another embodiment, said Flavobacterium strain is a Flavobacterium hercynium strain, more particularly the F. hercynium R-76555 strain, even more particularly the F. hercynium strain with deposit number LMG P-32777.

From here on, any of the above described Flavobacterium strains will be referred to as "the Flavobacterium strain of current application" or as "any of the Flavobacterium strains of current application".

In another embodiment, said strain is an isolated strain. The term "isolated" means that the bacterial strain has been removed from its natural environment. "Isolated" thus implies a purification step. However, "isolated" does not necessarily reflect the extent to which the microorganism, more particularly the bacterium has been purified. A Flavobacterium strain of current application is purified at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx from the raw material from which it is isolated. As a non-limiting example, if a microorganism is isolated from soil as raw material, the microorganism can be isolated to an extent that its concentration in a given quantity of purified or partially purified material (e.g. soil) is at least 2x, at least 5x, at least lOx, at least 50x or at least lOOx that in the original raw material.

In another aspect of the application a culture of the Flavobacterium strain of current application is provided. The term "culture" as used herein refers to a population of microorganisms that are propagated on or in media of various kinds. In one embodiment, said culture is an enriched culture of the Flavobacterium strain of current application. This is equivalent as saying that a culture of microorganisms, more particularly a bacterial culture, is provided, wherein said culture is enriched with the Flavobacterium strain of current application and wherein "enriched" means that the total microbial (or more particularly the total bacterial) population of said culture contains more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more than 95% of the isolated Flavobacterium strain of current application.

In another embodiment, a biologically pure culture of the Flavobacterium strain of current application is provided. As used herein, "biologically pure" refers to a culture which contains substantially no other microorganisms than the desired strain and thus a culture wherein virtually all of the cells present are of the selected strain. In practice, a culture is defined biologically pure if the culture contains at least more than 96%, at least more than 97%, at least more than 98% or at least more than 99% of the Flavobacterium strain of current application. When a biologically pure culture contains 100% of the desired microorganism a monoculture is reached. A monoculture thus only contains cells of the selected strain and is the most extreme form of a biologically pure culture.

In yet another embodiment, the culture of the Flavobacterium strain of the application comprises at least 1%, at least 5%, at least 10%, at least 25%, at least 50% or at least 75% living Flavobacterium bacteria.

In a particular embodiment, the Flavobacterium strain of current application may be lyophilized, freeze-dried or in a form of a dry powder. In another particular embodiment, an aqueous slurry of the Flavobacterium strain of the current application or of any culture herein described comprising the strain is provided, the slurry being optionally dried to a powder at a temperature which does not adversely affect viability of the Flavobacterium strain.

COMPOSITIONS

In another aspect, a composition is provided comprising the Flavobacterium strain of current application. This is equivalent as saying that the composition comprises an inoculum of the Flavobacterium strain of the application. As used herein, the term "inoculum" is intended to mean any form of bacterial cells, or spores, which is capable of propagating on or in the soil when the conditions of temperature, moisture, etc., are favourable for bacterial growth. A "spore" generally refers to a microorganism in its dormant, protected state.

In a particular embodiment, the composition may be in the form of a liquid, a slurry, a wettable powder or a dry powder. In a particular embodiment, the Flavobacterium strain of current application may be lyophilized, freeze-dried or in the form of a dry powder before it is used in the processing of the composition. In another particular embodiment, an aqueous slurry of the Flavobacterium strain of the current application is provided, which is optionally dried to a powder at a temperature which does not adversely affect viability of the Flavobacterium strain. The powder may then be mixed with an agriculturally compatible carrier. In other embodiments, a liquid suspension or slurry of the Flavobacterium strain of the current application may be applied to an absorbent material, e.g. a granular mass, or may be used to coat plant seeds or other plant tissues. Also a powder comprising the Flavobacterium strain of the application is suitable for coating seeds. When used to coat plant seeds, the composition may be applied to the seeds and allowed to dry. In embodiments wherein the composition is a powder (e.g. a wettable powder), a liquid, such as water, may need to be added to the powder before application to a seed.

In another embodiment, a composition is provided comprising the Flavobacterium strain of current application further comprising a cryoprotectant and/or growth medium appropriate for Flavobacterium genera, more particularly for Flavobacterium piscis, F. fluminis and/or F. hercynium species. A "cryoprotectant" as used herein protects the bacteria by preventing the damaging effects of water crystals when cells are frozen, more particularly at -60°C, or -70°C or -80°C or in liquid nitrogen. Non-limiting examples of a cryoprotectant is glycerol and trehalose. In another embodiment, a composition is provided comprising the Flavobacterium strain herein disclosed wherein the Flavobacterium strain is lyophilized, freeze dried or in the form of a dry powder. In one embodiment, the composition can further comprise a preservative.

In another particular embodiment, any of the compositions described herein further comprises an agriculturally compatible carrier. Said carrier can be inert (e.g. a detectable agent or label or liquid carrier) or active (e.g. a fertilizer), but should allow the Flavobacterium strain of the application to remain efficacious and viable. An "agriculturally compatible carrier" may be a natural or synthetic, organic or inorganic material with which the active compounds (e.g. the Flavobacterium strain of the current application) are combined to facilitate their application on the plant, a plant part, plant seed or to the plant growth medium. Said "agriculturally compatible carrier" which can be regarded as a vehicle, is generally inert and it must be acceptable in agriculture. Thus, the phrase "agriculturally compatible" denotes a substance that can be used routinely under field conditions without interfering with growers' planting equipment, and without adversely influencing crop development or the desired ecological balance in a cultivated area.

The agriculturally compatible carrier can be solid. Solid carriers can include but are not limited to clays, natural or synthetic silicates, silica, resins, waxes, solid fertilizers, a polymer, a granular mass, perlite, a perlite granule, peat, a peat pellet, soil, vermiculite, charcoal, sugar factory carbonation press mud, rice husk, carboxymethyl cellulose, fine sand, calcium carbonate, flour, alum, a starch, talc, polyvinyl pyrrolidone, or a combination thereof. The agriculturally compatible carrier can be a liquid. In one embodiment, the liquid carrier is water, sugar water, diluted or non-dilute growth medium to culture the Flavobacterium strain of the application. Non-limiting examples of suitable growth media for said Flavobacterium strain include yeast extract mannitol (YEM), yeast mannitol agar (YMA), yeast mannitol broth (YMB). Other non-limited example of liquid carriers can include but are not limited to water, sugar wateralcohols, ketones, petroleum fractions, oils, aromatic or paraffinic hydrocarbons, chlorinated hydrocarbons, liquefied gases or a combination thereof. More particularly, the agriculturally compatible carrier can include a dispersant, a surfactant, an additive, a thickener, an anti-caking agent, residue breakdown, a composting formulation, a granular application, diatomaceous earth, a colouring agent, a stabilizer, a preservative, a polymer, a coating or a combination thereof.

The carrier can also be a slurry, optionally comprising a sticking agent capable of sticking the inoculum to the substrate of interest, for example to a plant seed. Non-limiting examples of sticking agents include alginate, mineral oil, syrup, gum arabic, honey, methyl cellulose, milk, wallpaper paste, and combinations thereof. One of the ordinary skills in the art can readily determine the appropriate carrier to be used taking into consideration factors such as a particular bacterial strain, plant to which the inoculum is to be applied, type of soil, climate conditions, whether the inoculum is in liquid, solid or powder form, and the like. The additive can comprise an oil, a gum, a resin, a clay, a polyoxyethylene glycol, a terpene, a viscid organic, a fatty acid ester, a sulfated alcohol, an alkyl sulfonate, a petroleum sulfonate, an alcohol sulfate, a sodium alkyl butane diamate, a polyester of sodium thiobutant dioate, a benzene acetonitrile derivative, a proteinaceous material, or a combination thereof. The proteinaceous material can include a milk product, wheat flour, soybean meal, blood, albumin, gelatin, or a combination thereof. The thickener can comprise a long chain alkylsulfonate of polyethylene glycol, polyoxyethylene oleate or a combination thereof. The surfactant can contain a heavy petroleum oil, a heavy petroleum distillate, a polyol fatty acid ester, a polyethoxylated fatty acid ester, an aryl alkyl polyoxyethylene glycol, an alkyl amine acetate, an alkyl aryl sulfonate, a polyhydric alcohol, an alkyl phosphate, or a combination thereof. The anti-caking agent can include a sodium salt such as a sodium sulfite, a sodium sulfate, a sodium salt of monomethyl naphthalene sulfonate, or a combination thereof, or a calcium salt such as calcium carbonate, diatomaceous earth, or a combination thereof. The agriculturally compatible carrier can also include a fertilizer, a micronutrient fertilizer material, an insecticide, a herbicide, a plant growth amendment, a fungicide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof. Non-limiting examples are provided below. As way of example the Flavobacterium strain of the current application may be mixed with an agriculturally compatible carrier.

Non-limiting examples of the above provided composition in practice are soluble powders, wettable granules, dry flowables, aqueous flowables, wettable dispersible granules, emulsifiable concentrates, aqueous suspensions, a fertilizer granule, a sprayable formulation, an agrochemical formulation. Thus, in another embodiment, an agricultural composition comprising the bacterial strain of current application is provided. "Agricultural composition" as used herein refers to a composition for agricultural purposes. Given that the composition is of use to promote plant growth and development, more particularly to promote the quantitative and/or qualitative yield of a plant under chilling condition or low temperature stress, also a plant growth promoting composition is provided. Plant growth promoting refers to a promoting effect on the growth and development of the cultured plant or crop. Said cultured plant or crop is the plant or crop of interest and does not include unwanted plants. As described above, the composition or "plant growth promoting composition" herein provided can include a herbicide, if said herbicide is used to remove unwanted plants or prevent germination of seeds of unwanted plants. The composition, agricultural composition or plant growth promoting composition can also comprise a fertilizer, a micronutrient fertilizer material, an insecticide, a plant growth amendment, a fungicide, a molluscicide, an algicide, a bacterial inoculant, a fungal inoculant, or a combination thereof. In some cases, the fertilizer is a liquid fertilizer. Liquid fertilizer can include without limitation, ammonium sulfate, ammonium nitrate, ammonium sulfate nitrate, ammonium chloride, ammonium bisulfate, ammonium polysulfide, ammonium thiosulfate, aqueous ammonia, anhydrous ammonia, ammonium polyphosphate, aluminum sulfate, calcium nitrate, calcium ammonium nitrate, calcium sulfate, calcined magnesite, calcitic limestone, calcium oxide, hampene (chelated iron), dolomitic limestone, hydrate lime, calcium carbonate, diammonium phosphate, monoammonium phosphate, potassium nitrate, potassium bicarbonate, monopotassium phosphate, magnesium nitrate, magnesium sulfate, potassium sulfate, potassium chloride, sodium nitrates, magnesian limestone, magnesia, disodium dihydromolybdate, cobalt chlorid hexahydrate, nickel chloride hexahydrate, indole butyric acid, L-tryptophan, urea, urea-formaldehydes, urea ammonium nitrate, sulfur-coated urea, polymer-coated urea, isobutylidene diurea, SC -ZIVIgSC , kainite, sylvinite, kieserite, Epsom salts, elemental sulfur, marl, ground oyster shells, fish meal, oil cakes, fish manure, blood meal, rock phosphate, super phosphates, slag, bone meal, wood ash, manure, bat guano, peat moss, compost, green sand, cottonseed meal, feather meal, crab meal, fish emulsion or a combination thereof. The micronutrient fertilizer material can comprise boric acid, a borate, a boron frit, copper sulfate, a copper frit, a copper chelate, a sodium tetraborate decahydrate, an iron sulfate, an iron oxide, iron ammonium sulfate, an iron frit, an iron chelate, a manganese sulfate, a manganese oxide, a manganese chelate, a manganese chloride, a manganese frit, a sodium molybdate, molybdic acid, a zinc sulfate, a zinc oxide, a zinc carbonate, a zinc frit, zinc phosphate, a zinc chelate or a combination thereof. In a particular embodiment, said fertilizer or fertilizer material does not comprise insoluble selenium, selenium mineral, soluble selenium or salts thereof. The insecticide can include an organophosphate, a carbamate, a pyrethroid, an acaricide, an alkyl phthalate, boric acid, a borate, a fluoride, sulfur, a haloaromatic substituted urea, a hydrocarbon ester, a biologically-based insecticide, or a combination thereof. The herbicide can comprise a chlorophenoxy compound, a nitrophenolic compound, a nitrocresolic compound, a dipyridyl compound, an acetamide, an aliphatic acid, an anilide, a benzamide, a benzoic acid, a benzoic acid derivative, anisic acid, an anisic acid derivative, a benzonitrile, benzothiadiazinone dioxide, a thiocarbamate, a carmabate, carbanilate, chloropyridinyl, a cyclohexenone derivative, a dinitroaminobenzene derivative, a fluorodinitrotoluidine compound, isoxazolidinone, nicotinic acid, isopropylamine, an isopropulamine derivative, oxadiazolinone, a phosphate, a phthalate, a picolinic acid compound, a triazine, a triazole, a uracil, a urea derivative, endothall, sodium chlorate, or a combination thereof. The fungicide can comprise a substituted benzene, a thiocarbamate, an ethylene bis dithiocarbamate, a thiophthalidamide, a copper compound, an organomercury compound, an organotin compound, a cadmium compound, anilazine, benomyl, cyclohexamide, dodine, etridiazole, iprodione, metlaxyl, thiamimefon, triforine, or a combination thereof. The fungal inoculant can comprise a fungal inoculant of the family Glomeraceae, a fungal inoculant of the family Claroidoglomeraceae, a fungal inoculant of the family Acaulosporaceae, a fungal inoculant of the family Sacculospraceae, a fungal inoculant of the family Entrophosporaceae, a fungal inoculant of the family Pacidsproraceae, a fungal inoculant of the family Diversisporaceae, a fungal inoculant of the family Paraglomeraceae, a fungal inoculant of the family Archaeosporaceae, a fungal inoculant of the family Geosiphonaceae, a fungal inoculant of the family Ambisporacea, a fungal inoculant of the family Scutellosproaceae, a fungal inoculant of the family Dentiscultataceae, a fungal inoculant of the family Racocetraceae, a fungal inoculant of the phylum Basidiomycota, a fungal inoculant of the phylum Ascomycota, a fungal inoculant of the phylum Zygomycota, a fungal inoculant of the genus Glomus or a combination thereof. The bacterial inoculant can include a bacterial inoculant of the genus Rhizobium, another bacterial inoculant of the genus Bradyrhizobium, bacterial inoculant of the genus Mesorhizobium, bacterial inoculant of the genus Azorhizobium, bacterial inoculant of the genus Allorhizobium, bacterial inoculant of the genus Burkholderia, bacterial inoculant of the genus Sinorhizobium, bacterial inoculant of the genus Kluyvera, bacterial inoculant of the genus Azotobacter, bacterial inoculant of the genus Pseudomonas, bacterial inoculant of the genus Azosprillium, bacterial inoculant of the genus Bacillus, bacterial inoculant of the genus Streptomyces, bacterial inoculant of the genus Paenibacillus, bacterial inoculant of the genus Paracoccus, bacterial inoculant of the genus Enterobacter, bacterial inoculant of the genus Alcaligenes, bacterial inoculant of the genus Mycobacterium, bacterial inoculant of the genus Trichoderma, bacterial inoculant of the genus Gliocladium, bacterial inoculant of the genus Klebsiella, or a combination thereof. Also, the application provides a combination comprising the Flavobacterium strain of current application and at least one microorganism selected from the list consisting of Bacillus subtilis strain 713, Bacillus amyloliquefaciens MBI 600, Bacillus pumillus Q.ST2808, Pseudomonas fluorescens, Trichoderma vireus, Pseudomonas putida, Trichoderma harzianum Rifai strain T22, Penicillium bilaii, Mesorhizobium, Azospirillum, Azotobacter vinelandii and Clostridium pasteurianum.

In another embodiment, an agricultural or plant growth promoting composition comprising the Flavobacterium strain of current application and an agriculturally compatible carrier is provided.

COATED SEEDS

In a next aspect, a plant seed or plant propagule coated with a microbial population comprising the Flavobacterium strain of current application is provided. This is equivalent as saying that a plant seed or plant propagule is provided, wherein said plant seed or propagule having applied to the surface of said seed or of said propagule, a culture, an enriched culture or a biological pure culture of the Flavobacterium strain of current application. In one embodiment, said Flavobacterium strain of current application is the F. piscis strain with deposit accession number LMG P-32776, the F. fluminis strain with deposit accession number LMG P-32775 and/or the F. hercynium strain with deposit number LMG P-32777.

A "plant propagule" is any plant material for the purpose of plant propagation. Because of the totipotency of plants, any part of the plant may be used (e.g. a stem cutting, a leaf section, a portion of a root), though it is usually a highly meristematic part such as root and stem ends, buds, tubers, bulbs, rhizome, stolon or any plant part for vegetative reproduction. In sexual reproduction, a propagule is a seed or spore.

A "plant seed coated" or alternatively a "coated seed" as used in this application refers to a plant seed covered with a certain composition. This composition (i.e. the coating composition) can be a water composition or an oil composition or a polymer or any of the above described compositions comprising the Flavobacterium strain of the application. "Coating" includes the most simple covering methods of dipping seeds or plant propagules in a microbial suspension or spraying seeds or propagules with a microbial suspension. In the latter case, the coating compositions are found to be film-forming, i.e. upon contacting with seeds or propagules they form a thin liquid film that adheres to the surface. "Coating" also includes rolling seeds/propagules in or dusting seeds/propagules with or brushing seeds/propagules with a powder comprising microorganisms, to more complex procedures as injecting plant seeds/propagules with a composition comprising microorganism or the use of complex coating layers including one or more adhesive, binder solvent and/or filler components. A person skilled in the art is familiar with a variety of conventional and more advanced methods to coat plants seeds (e.g. US5113619, EP0080999, WO1997036471, EP0010630, W02006131213, W02001045489, US4465017, EP2676536 which are here all incorporated as reference). The coating composition can include a number of ingredients, including but not limited to gelatin, a desiccant, water, tallow (e.g. to increase the release rate of any active ingredient in the composition), bulking agents (e.g. clay, vermiculite, perlite and/or bentonite to give more body to the liquid coating composition). Coating compositions which include bulking agents produce more rounded coated seeds. Such coated seeds are generally easier to plant when using mechanical planters. The concentration of the bulking agent can be up to about 50 % of the solids by volume. As way of example of a liquid coating procedure, seeds or propagules are fed into one or more tanks containing the liquid coating composition. The seeds or propagules are transported from the tanks into a drying zone where forced air dries and solidifies the coating applied to the seeds. The seeds or propagules are dipped at least once and preferably at least twice in the liquid coating composition of the present invention. The dried coated seeds or propagules can be sowed or planted using standard sowing or planting machinery or by hand. In the alternative, the coated seeds or propagules can be stored for later application. If the temperature and humidity are relatively high or if prolonged storage is contemplated, it is desirable to place on the surface of the coating an inert material, preferably a powder material, such as, chalk or talcum powder. Such inert material reduces the tendency for the seed to stick together or agglomerate. The coating should cover more than 50%, more than 60%, more than 70%, more than 80%, more than 90, more than 95% of the surface area of the seeds or propagules. In some embodiments, after the coating procedure, the seeds should comprise at least one living cell of the isolated Flavobacterium strain of current application. The coating layer can also consist of one or more components. These components can be additional plant growth promoting microorganisms but can also be fertilizers, biocontrol agents, or pesticides including fungicides, insecticides and herbicides. Non-limiting examples of these components are provided above. The coating composition can also include protective colloids, adhesives, thickening agents, thixotropic agents, penetrating agents, stabilizing agents, sequestering agents, fertilizers, anti-freeze agents, repellents, color additives, corrosion inhibitors, water-repelling agents, siccatives, UV-stabilizers, pigments, dyes or polymers.

In another embodiment, when used as a seed treatment, the Flavobacterium strain of current application is applied at a rate of about lxlO² to about lxlO¹¹ cfu/seed or at a rate of about lxlO³ to about lxlO¹⁰ cfu/seed or at a rate of at least lxlO², at least lxlO³, at least lxlO⁴, at least lxlO⁵, at least 1x10^s, at least lxlO⁷, at least 1x10^s, at least lxlO⁹ , at least lxlO¹⁰ or at least lxlO¹¹ cfu/seed. In yet another embodiment, for coating purposes seeds are treated with a bacterial solution of at least lxlO⁵ cfu of the Flavobacterium strain of current application per ml, at least 1x10^s cfu of the Flavobacterium strain of current application per ml, at least lxlO⁷ cfu of the Flavobacterium strain of current application per ml, at least lxlO⁸ cfu of the Flavobacterium strain of current application per ml, at least lxlO⁹ cfu of the Flavobacterium strain of current application per ml, at least lxlO¹⁰ cfu of the Flavobacterium strain of current application per ml or at least lxlO¹¹ cfu of the Flavobacterium strain of current application per ml. After the coating procedure, the Flavobacterium strain of current application is present on the seeds in a concentration of between lxlO⁴ and lxlO⁷ CFU, between lxlO⁵ and 5x10^s CFU per seed or at least lxlO⁵ CFU, at least 1x10^s CFU or at least lxlO⁷ CFU per seed.

In a particular embodiment, a plant seed refers to a seed of a fresh food crop, a leguminous plant or a plant that is cultivated under protected conditions. Cultivation under protected conditions or protected cropping or greenhouse horticulture refers to the production of horticultural or ornamental crops within, under or sheltered by structures to provide modified growing conditions and/or protection from pests, diseases and adverse weather. In its broadest definition, protected cropping includes the use of greenhouses and glasshouses, shade houses, screen houses and crop top structures. A greenhouse as used herein refers to a permanent structure covered with glass or plastic, generally excluding simple high or low tunnels. A greenhouse is typically a climate-controlled environment. Non-limiting examples of greenhouse crops are lettuce and other leafy vegetables, strawberry, tomato, capsicum (yellow and red bell peppers), cucumber, eggplant, zucchini. Nonlimiting example of greenhouse ornamental plants or ornamental plants grown under protected cultivation are orchids, cut roses, bromeliads, Chrysanthemum, carnation, gerbera, lilium, gladiolus,...

A leguminous plant or alternatively phrased a legume is referred in current application as a plant from the family Fabaceae (or Leguminosae). When used as a dry grain, the seed is also called a pulse. Leguminous plants are grown agriculturally, primarily for human consumption, for livestock forage and silage, and as soil-enhancing green manure. Well-known leguminous plants include beans (Phaseolus), soybeans (Glycine max), broad beans (Vicia faba), peas (Pisum sativum), chickpeas (Cicer arietinum), bitter vetch (Vicia ervilia), peanuts (Arachis hypogaea), lentils (Lens culinaris), lupins (Lupinus), mesquite (Prosopis), carob (Ceratonia siligua), tamarind (Tamarindus indica), alfalfa (Medicago sativa), liquorice (Glycyrrhiza glabra) and clover (Trifolium sp.).

In another aspect, a method is provided of treating plant seeds, the method comprises the step of applying to said seeds an inoculum of the Flavobacterium strain of the application. In one embodiment, said treating is coating. APPLICATIONS

In a next aspect, the use of the Flavobacterium strain of the application or of a microbial population comprising it or of any of the previously described cultures is provided to increase or improve plant yield, more particularly agricultural yield, even more particularly to protect plant or agricultural yield against losses due to low temperature growth conditions.

The herein described increased or improved yield can be achieved in the absence or presence of stress conditions. The Flavobacterium strain of the application is particularly provided to be of use to improve the adaptation of plants, more particular to cool growing conditions. More particularly to be of use to increase or maintain plant growth of the treated plant in cool growing temperatures.

In yet another embodiment, the use of the Flavobacterium strain of the application is provided to increase cold tolerance of a plant, to increase or induce chilling stress tolerance or tolerance against low temperature conditions. This solution is of great agricultural importance as low temperatures often significantly affect plant growth and crop productivity with crop losses as result (Xin and Browse 2001 Plant Cell Environ 23:893-902). Cold tolerance in plants is a very complex trait, involving many different metabolic pathways and cell compartments. Plants respond with changes in their pattern of gene expression and protein products when exposed to low temperatures. Plants differ in their tolerance to cold or chilling (0-17°C) and freezing (< 0°C) temperatures. Plants of tropical and subtropical origins (e.g. soy, maize, tomato) are highly sensitive to cold or chilling stress and are injured or killed by non-freezing low temperatures. They exhibit various symptoms of chilling injury such as chlorosis, necrosis, or growth retardation. Hence, while full field crops such as soy and maize benefit of a long growing season especially for optimal seed ripening, they are sown on the field as late as possible to overcome chilling stress. Developing means and methods overcoming chilling stress support both qualitative and quantitative yield benefits. Chilling stress in protected crops such a tomato, lettuce, paprika, ... is nowadays overcome by heating greenhouses. However, the late huge increases of energy prizes make it economically impossible to grow many of these crops in certain regions. Again, technical solutions such as plant-growth promoting microorganisms that support plant growth under cold temperature conditions can be of great help to greenhouse farmers.

"Cold tolerance" or equivalently "chilling tolerance" or "low temperature tolerance" as used in current application is defined as the ability of a plant to tolerate low temperatures without or with limited injury, damage or yield drop, wherein said low temperatures are non-freezing temperatures. In one embodiment said low temperatures are temperatures between 2 and 20°C or between 8 and 18°C or between 5 and 15°C or between 10 and 14°C or between 8 and 12°C or between 0 and 17°C. In one embodiment, these temperatures are the temperatures of the soil or plant growth medium. Plants or plant roots are exposes to said low temperatures for at least 2h, at least 4h, at least 6h or at least 8h per day or said low temperatures are reached during at least a part of the day, for example during the night.

In particular embodiments, cold tolerance observed in plants that were treated with or were grown from seeds coated with the Flavobacterium strain of current application leads to injury, damage or a drop in yield due to low temperature growing conditions which is at least 10%, least 20%, least 30%, least 40%, least 50%, least 60%, least 70%, least 80%, least 90% or 100% less than the injury, damage or a drop in yield observed in plants that were not treated with or were grown from seeds not coated with the Flavobacterium strain of current application.

In particular embodiments, the use of the Flavobacterium strain of the application is provided to increase tolerance to non-freezing low temperatures in plants, wherein said low temperatures are between 2 and 20°C, between 8 and 18°C, between 5 and 15°C or between 10 and 14°C or between 8 and 12°C or between 0 and 17°C. In other particular embodiments, the use of the Flavobacterium strain of the application is provided to increase tolerance to chilling stress in plants, wherein chilling stress is a statistically significant retardation of plant growth when grown at low temperatures are between 2 and 20°C, between 8 and 18°C, between 5 and 15°C or between 10 and 14°C or between 8 and 12°C or between 0 and 17°C.

In a next aspect, a method is provided for enhancing growth, yield and/or cold tolerance or chilling stress tolerance of a plant comprising inoculating a plant growth medium with a microbial population, wherein said population comprises the Flavobacterium strain of current application; and growing a plant in said plant growth medium; to enhance growth, yield and/or cold or chilling tolerance of said plant. In one embodiment, said yield is seed yield. In another embodiment, said yield is the fresh matter production of the plant.

The term "inoculating" as used herein refers to introducing at least one bacterium into a plant growth medium. By way of example and without the intention to be limiting, said introduction can be performed using a liquid, a powder, a granule, a pellet. "Plant growth medium" is defined as any environment wherein plants can grow. Non-limiting examples of a plant growth medium are soil, sand, gravel, a polysaccharide, mulch, compost, peat moss, straw, logs, clay, or a combination thereof. A plant growth medium can also include a hydroculture system or an in vitro culture system. Hydroculture is the growing of plants in a soilless medium or an aquatic based environment, while an in vitro culture system refers to the growing of plants or explants on or in a recipient with synthetic medium, in sterile conditions, in a controlled environment and in reduced space. Explants refer to parts of a plant, from all the aerial part to isolated cells, as parts of leaves, of roots, seeds, bulbs, tubers, buds. The inoculation of said plant growth medium with a microbial population can be done before, during and/or after sowing or before, during and/or after the start of the plant growth cycle in case of hydroculture or in vitro culture. The inoculation can be performed once or multiple times during the plant growth cycle. In one embodiment, the microbial population is applied to the plant growth medium as a powder, as a pellet, as a granule or as a liquid.

The term "plant" as used herein encompasses whole plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), bulbs, buds, flowers, and tissues and organs. The term "plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores. Thus, in one embodiment, a method is provided for stimulating plant growth or yield and/or cold tolerance or chilling tolerance comprising applying the microbial culture comprising the Flavobacterium strain of current application to a plant, plant part, plant seed or to the plant growth medium. Unless otherwise specified, in the latter and further embodiments and aspects, "stimulating", "enhancing", "increasing" or "improving" refers to a statistically significant increase and/or an at least 5% increase or at least 6% increase or at least 7% increase or at least 8% increase or at least 9% increase or at least 10% increase or at least 12% increase or at least 15% increase or at least 20% increase or at least 25% increase or at least 30% increase or at least 50% increase or at least 75% increase or at least a 100% increase in the property being measured (e.g. plant growth, plant yield, nitrogen fixation) and compared to a mock or control situation.

Plants that are useful in the methods of current application include monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, greenhouse crops or protected crops, trees or shrubs. Non-limiting examples are plants selected from the list comprising Acer spp., Actinidia spp., Abelmoschus spp., Agave sisalana, Agropyron spp., Agrostis stolonifera, Allium spp., Amaranthus spp., Ammophila arenaria, Ananas comosus, Annona spp., Apium graveolens, Arachis spp, Artocarpus spp., Asparagus officinalis, Avena spp. (e.g. Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida), Averrhoa carambola, Bambusa sp., Benincasa hispida, Bertholletia excelsea, Beta vulgaris, Brassica spp. (e.g. Brassica napus, Brassica rapa ssp. [canola, oilseed rape, turnip rape]), Cadaba farinosa, Camellia sinensis, Canna indica, Cannabis sativa, Capsicum spp., Carex elata, Carica papaya, Carissa macrocarpa, Carya spp., Carthamus tinctorius, Castanea spp., Ceiba pentandra, Cichorium endivia, Cinnamomum spp., Citrullus lanatus, Citrus spp., Cocos spp., Coffea spp., Colocasia esculenta, Cola spp., Corchorus sp., Coriandrum sativum, Corylus spp., Crataegus spp., Crocus sativus, Cucurbita spp., Cucumis spp., Cynara spp., Daucus carota, Desmodium spp., Dimocarpus longan, Dioscorea spp., Diospyros spp., Echinochloa spp., Elaeis (e.g. Elaeis guineensis, Elaeis oleifera), Eleusine coracana, Eragrostis tef, Erianthus sp., Eriobotrya japonica, Eucalyptus sp., Eugenia uniflora, Fagopyrum spp., Fagus spp., Festuca arundinacea, Ficus carica, Fortunella spp., Fragaria spp., Ginkgo biloba, Glycine spp. (e.g. Glycine max, Soja hispida or Soja max), Gossypium hirsutum, Helianthus spp. (e.g. Helianthus annuus), Hemerocallis fulva, Hibiscus spp., Hordeum spp. (e.g. Hordeum vulgare), Ipomoea batatas, Juglans spp., Lactuca sativa, Lathyrus spp., Lens culinaris, Linum usitatissimum, Litchi chinensis, Lotus spp., Luffa acutangula, Lupinus spp., Luzula sylvatica, Lycopersicon spp. (e.g. Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Malus spp., Malpighia emarginata, Mammea americana, Mangifera indica, Manihot spp., Manilkara zapota, Medicago sativa, Melilotus spp., Mentha spp., Miscanthus sinensis, Momordica spp., Morus nigra, Musa spp., Nicotiana spp., Olea spp., Opuntia spp., Ornithopus spp., Oryza spp. (e.g. Oryza sativa, Oryza latifolia), Panicum miliaceum, Panicum virgatum, Passiflora edulis, Pastinaca sativa, Pennisetum sp., Persea spp., Petroselinum crispum, Phalaris arundinacea, Phaseolus spp., Phleum pratense, Phoenix spp., Phragmites australis, Physalis spp., Pinus spp., Pistacia vera, Pisum spp., Poa spp., Populus spp., Prosopis spp., Prunus spp., Psidium spp., Punica granatum, Pyrus communis, Quercus spp., Raphanus sativus, Rheum rhabarbarum, Ribes spp., Ricinus communis, Rubus spp., Saccharum spp., Salix sp., Sambucus spp., Secale cereale, Sesamum spp., Sinapis sp., Solanum spp. (e.g. Solanum tuberosum, Solanum integrifolium or Solanum lycopersicum), Sorghum bicolor, Spinacia spp., Syzygium spp., Tagetes spp., Tamarindus indica, Theobroma cacao, Trifolium spp., Tripsacum dactyloides, Triticosecale rimpaui, Triticum spp. (e.g. Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum, Triticum monococcum or Triticum vulgare), Tropaeolum minus, Tropaeolum majus, Vaccinium spp., Vicia spp., Vigna spp., Viola odorata, Vitis spp., Zea mays, Zizania palustris, Ziziphus spp., amongst others. Also envisioned are leguminous plants for example acacia (genus Acacia), alfalfa (Medicago sativa), almendro (Dipteryx oleifera), bean (genus Phaseolus), common bean (P. vulgaris), green bean (P. vulgaris), lima bean (P. lunatus), scarlet runner bean (P. coccineus), bird's-foot trefoil (Lotus corniculatus), bush clover (genus Lespedeza), broom (genus Cytisus), carob (Ceratonia siligua), chickpea (Cicer arietinum), clover (genus Trifolium), cowpea (Vigna unguiculata), crown vetch (Securigera varia), fenugreek (Trigonella foenum-graecum), honey locust (Gleditsia species), hyacinth bean (Lablab purpureus), indigo (genus Indigofera), jicama (Pachyrhizus erosus), kakabeak (genus Clianthus), Kentucky coffee tree (Gymnocladus dioica), kidney vetch (Anthyllis vulneraria), kudzu vine (Pueraria montana), laburnum (genus Laburnum), golden chain (L. anagyroides), genus Lathyrus, beach pea (L. japonicus), sweet pea (L. odoratus), lentil (Lens culinaris), licorice (Glycyrrhiza glabra), locoweed (Astragalus and Oxytropis species), locust (genus Robinia), logwood (Haematoxylum campechianum), lupine (genus Lupinus), Texas bluebonnet (/.. texensis and L. subcarnosus), mesquite (genus Prosopis), mimosa (genus Mimosa), sensitive plant (M. pudica), narra (Pterocarpus species), pagoda tree (Styphnolobium japonicum), palo verde (genus Parkinsonia), pea (Pisum sativum), peanut (Arachis hypogaea), redbud (genus Cercis), rosary pea (Abrus precatorius), royal poinciana (Delonix regia), senna (genus Senna), silk tree (genus Albizia), smoke tree (Dalea spinosa), soybean (Glycine max), suicide tree (Tachigali versicolor), sunn hemp (Crotalaria juncea), tamarind (Tamarindus indica), vetch (genus Vicia), broad bean (V. faba), wisteria (genus Wisteria). In a particular embodiment, said leguminous plant is selected from the list consisting of alfalfa (Medicago sativa), bean (genus Phaseolus), common bean (P. vulgaris), green bean (P. vulgaris), lima bean (P. lunatus), scarlet runner bean (P. coccineus), chickpea (Cicer arietinum), clover (genus Trifolium), cowpea (Vigna unguiculata), fenugreek (Trigonella foenum-graecum), genus Lathyrus, beach pea (L. japonicus), sweet pea (L. odoratus), lentil (Lens culinaris), licorice (Glycyrrhiza glabra), pea (Pisum sativum), peanut (Arachis hypogaea), soybean (Glycine max), tamarind (Tamarindus indica), vetch (genus Vicia) and broad bean (V. faba). In a most particular embodiment, said leguminous plant is soybean (Glycine max), bean (Phaseolus sp.), lentils (Lens culinaris), chickpea (Cicer arietinum), clover (genus Trifolium), cowpea (Vigna unguiculata) or Lathyrus.

Also envisioned are ornamental crops for example Phalaenopsis spp. and other orchids, Alstroemeria, Azalea and other Rhododendron spp., Begonia, Camelia such as C. japonica, Dianthus, Carnation, Chrysanthemum, Dieffenbachia, Ficus spp., Hibiscus, Petunia, Rosa spp.

In another aspect, a method for growing a plant or for enhancing growth, yield and/or cold tolerance or chilling stress tolerance of a plant is provided, wherein said method comprises growing coated seeds of a plant, wherein said seeds are coated with an effective amount of a microbial population comprising the isolated Flavobacterium strain of current application, to obtain enhanced growth, yield and/or cold tolerance cold tolerance or chilling stress tolerance of said plant. In some embodiments, after the coating procedure, the seeds should comprise at least lxlO⁴, lxlO⁵ or 1x10^s living cells or spores of the Flavobacterium strain of current application. In one embodiment, the plant is grown or the coated plant seed are sown at low temperatures during at least a part of the day, for example during the night and for at least a part of the growing season, for example at least 5 days, 7 days, 10 days or 15 days.

An "effective amount" refers to an amount sufficient to effect beneficial or desired results. In a nonlimiting example, an "effective amount" leads to a statistically significant increase of plant growth and/or biomass and/or yield and/or cold tolerance and/or chilling stress tolerance and/or protein content of seed and/or nitrogen fixation as compared to the growth, biomass and/or yield and/or cold tolerance and/or chilling stress tolerance and/or protein content of seed and/or nitrogen fixation of the control plant. An effective amount can be administered in one or more administrations. A "control plant" as used in current application provides a reference point for measuring changes in phenotype of the subject plant and may be any suitable plant cell, seed, plant component, plant tissue, plant organ or whole plant. A control plant may comprise for example a plant or cell which is genetically identical to the subject plant or cell but which is not exposed to the same treatment (e.g. administration of the Flavobacterium strain of current application) as the subject plant or cell.

In yet another aspect, a method for growing a plant or for enhancing growth, yield and/or cold tolerance or chilling stress tolerance of a plant is provided comprising: growing a plant in an environment that supports plant growth; and administering a sprayable formulation to said environment or to said plant, said formulation comprising the Flavobacterium strain of current application; to obtain enhanced growth, yield and/or cold tolerance or chilling stress tolerance of said plant. In one embodiment, said yield is seed yield. In another embodiment, said enhancing yield is enhancing the fresh matter production of said plant.

In one embodiment, the plant is grown at low temperatures during at least a part of the day, for example during the night and for at least a part of the growing season, for example at least 5 days, 7 days, 10 days or 15 days.

A "sprayable formulation" as used herein is an agrochemical or a biological solution that can be sprinkled on a plant or soil. The formulation is composed in such a way that the active ingredients can be absorbed by the above-ground tissue of a plant or is available for the plant roots when administered to the soil. The above disclosed methods thus also includes irrigation with a liquid comprising the Flavobacterium strain of current application. "Irrigating" or "irrigation" as used herein refers to the method in which water or other liquids are supplied to plants at regular intervals. Irrigation includes but is not limited to "localized irrigation" (i.e. a system where water is distributed under pressure through a piped network, in a pre-determined pattern, and applied as a small discharge to each plant or adjacent to it. "Drip (or micro) irrigation", also known as "trickle irrigation" (i.e. a system where water falls drop by drop just at the position of roots or near the root zone of plants) and "sprinkler irrigation" (i.e. a system where water is distributed by overhead sprinklers) belong to this category of irrigation methods. In "sprinkler irrigation", sprinklers can also be mounted on moving platforms connected to the water source by a hose. Automatically moving wheeled systems known as traveling sprinklers may irrigate areas such as small farms, sports fields, parks and pastures unattended. Most of these utilize a length of polyethylene tubing wound on a steel drum. As the tubing is wound on the drum powered by the irrigation water or a small gas engine, the sprinkler is pulled across the field. When the sprinkler arrives back at the reel the system shuts off. This type of system is known to most people as a "waterreel" traveling irrigation sprinkler.

Hence, in various embodiments, a method is provided for growing a plant or for enhancing growth, yield and/or cold tolerance or chilling stress tolerance of a plant, said method comprising: growing said plant in an environment that supports plant growth; irrigating said environment using a liquid solution comprising the Flavobacterium strain of current application; to obtain enhanced growth, yield and/or cold tolerance or chilling stress tolerance of said plant. In one embodiment, said yield is seed yield. In another embodiment, enhancing yield is enhancing the fresh matter production of said plant. In one embodiment, the plant is grown at low temperatures during at least a part of the day, for example during the night and for at least a part of the growing season, for example at least 5 days, 7 days, 10 days or 15 days.

In particular embodiments, when used as a soil treatment, the Flavobacterium strain of current application can be applied as a soil surface drench, injected and/or applied in-furrow or by mixture with irrigation water. The rate of application for drench soil treatments, which may be applied at planting, during or after seeding, or after transplanting and at any stage of plant growth, is about lxlO¹¹ to about 8xl0¹² cfu per acre. In some embodiments, the rate of application is about lxlO¹² to about 8xl0¹² cfu per acre. The rate of application for in-furrow treatments, applied at planting, is about 2.5xlO¹⁰ to about SxlO¹¹ cfu per 1000 row feet. In some embodiments, the rate of application is about 6xlO¹⁰ to about 4xlOⁿ cfu per 1000 row feet. Those of skill in the art will understand how to adjust rates for broadcast treatments (where applications are at a lower rate but made more often) and other less common soil treatments.

In some embodiments, when the Flavobacterium strain of current application is applied as microbial population or bacterial population or solution or culture or agricultural composition or sprayable formulation, the number of colony forming units (cfu) per milliliter (ml) of said Flavobacterium strain of current application in the microbial populations or bacterial populations or solutions or cultures or agricultural compositions or sprayable formulations will be at least 1x10^s cfu/ml or at least lxlO⁷ cfu/ml or at least 1x10^s cfu/ml or at least lxlO⁹ cfu/ml or at least 2xl0⁹ cfu/ml or at least 3xl0⁹ cfu/ml or at least 4xl0⁹ cfu/ml or at least 5xl0⁹ cfu/ml or at least 6xl0⁹ cfu/ml or at least 7xl0⁹ cfu/ml or at least 8xl0⁹ cfu/ml or at least 9xl0⁹ cfu/ml or at least lxlO¹⁰ cfu/ml or at least 2xlO¹⁰ cfu/ml or at least 3xlO¹⁰ cfu/ml or at least 4xlO¹⁰ cfu/ml or at least 5xlO¹⁰ cfu/ml or at least 6xlO¹⁰ cfu/ml or at least

7xlO¹⁰ cfu/ml or at least 8xlO¹⁰ cfu/ml or at least 9xlO¹⁰ cfu/ml or at least lxlO¹¹ cfu/ml or at least

2X10¹¹ cfu/ml or at least 3X10¹¹ cfu/ml or at least 4X10¹¹ cfu/ml or at least SxlO¹¹ cfu/ml or at least

6X10¹¹ cfu/ml or at least 7X10¹¹ cfu/ml or at least SxlO¹¹ cfu/ml or at least 9xlOⁿ cfu/ml or at least lxlO¹² cfu/ml or at least lxlO¹³ cfu/ml or at least lxlO¹⁴ cfu/ml.

EXAMPLES

Example 1. Identification of the lettuce main cold-enriched root microbiome grown in greenhouse soils

To grasp a variety of cold-enriched bacteria as wide as possible, we grew five different lettuce cultivars under control and low temperature conditions in three different soil types. The five commercially available and commonly grown lettuce cultivars PR, PL, COR, LOZ and SH were selected characterized by a wide variety of the genetic diversity available in Western Europe (Figure 1). PR is a butterhead lettuce, PL belongs to the crisphead group and COR, LOZ and SH are red, green and oak leaf lettuce types, respectively. All cultivars were grown in the three major soil types found in Belgium, sand, loam and sand-loam (Figure 1). From all factorial combinations, samples from bulk soil, rhizosphere soil and the root endosphere were taken and subjected to metabarcoding of the 16S rRNA gene V4 region. After low abundant reads had been removed, the obtained libraries yielded 34,283,499 high-quality V4 fragments that were assigned to 24 different bacterial phyla, comprising 261 genera and 1935 ASVs.

Although the cultivar used contributed to some extent to the diversity in the dataset, no perpetual effects were identified in the bacterial relative abundances at the family level. Therefore, we combined the data of all cultivars and treated them as one, to pinpoint perturbations in the relative abundance of bacterial groups orchestrated by the soil type and temperature conditions. The primary focus laid on the root endosphere, because this compartment was found to be most responsive to cold. In addition, the rhizosphere was analyzed to verify whether the root endophytic bacterial groups reoccurred. To define the main cold-specific root microbiome, we selected root endospheric and rhizospheric bacterial groups based on noteworthy abundance (relative abundance >0.5%) and statistically significant enrichment under cold growing conditions (P <0.05).

Over all soil types, these requirements were met by 12 families in the root endosphere (Oxalobacteraceae, Pseudomonadaceae, Flavobacteriaceae, Microscillaceae, Sphingobacteriaceae, Comamonadaceae, Devosiaceae, Methylophilaceae, Cellvibrionaceae, Sandaracinaceae, Thermomonosporaceae, and env.OPS_17 [order Sphingobacteriales]). All of these families (except the Cellvibrionaceae, Sandaracinaceae and Thermomonosporaceae and additionally Rubritaleaceae, Paenibacillaceae, Pedosphaeraceae, Opitutaceae, Nitrosopumilaceae, Micropepsaceae, Haliangiaceae, Blrii41 [order of Polyangiales] and an unknown family [phylum Gammaproteobacteria]) were also found to be enriched in the rhizosphere.

When observing the soil types separately in the rhizosphere, it was striking that 15 of the 18 identified families were associated with sand-loam soil, in contrast to solely 8 and 5 families associated with loam and sandy soil, respectively. Only 4 families, the Flavobacteriaceae, Microscillaceae, Oxalobacteraceae and Pseudomonadaceae, were found to be commonly cold enriched in all soil types. Summarized, despite differences in relative abundances, the recurring enrichment patterns of nine bacterial families under low temperatures conditions in the lettuce rhizosphere and root endosphere led to the identification of the lettuce main cold-specific root-associated microbiome across three different Belgian greenhouse soils.

Example 2. Flavobacterium spp. induce chilling stress resistance in lettuce

A further selection was performed on the level of amplicon sequence variants (ASVs). Among the tested ASVs, ASV15 (Flavobacterium) had relatively high abundances in all soils (3.8%, 7.1% and 4.9% in loam, sand and sand-loam soil, respectively) and was strongly enriched under low temperatures in loamy and sandy (8.9 fold and 4.4 fold, respectively) soils, but soil enrichment in the cold remained minor (1.9-fold) in sand-loam soil. By mapping the lettuce endosphere and rhizosphere cold-enriched root microbiome, we hypothesized that the Flavobacterium genus might accommodate properties that could be beneficial for plant growth under low temperature conditions. Therefore, nine different Flavobacterium strains obtained from bacterial collections were evaluated for their growth-promoting potential on lettuce seedlings under low temperature conditions. Growth promotion was evaluated based on the shoot fresh weight of plants inoculated with and without (mock) bacteria (Figure 2). Three Flavobacterium strains that had been isolated in-house from the root microbiome of the annual meadow grass Poa annua, more particularly the strains belonging to the species Flavobacterium piscis, Flavobacterium fluminis and Flavobacterium hercynium, consistently promoted lettuce growth under low temperature conditions with an average 1.7 ± 0.06-fold increase in shoot fresh weight (Figures 2, 3A-C), but not under control temperatures (data not shown). The two strains, belonging to F. hercynium and F. fluminis, had a 100% match with Flavobacterium ASVs from the lettuce root microbiome and a 99.6% match with the F. piscis strain. In the root endosphere, the ASV most closely matching F. piscis was high abundant (4.8% and 0.8%) and strongly cold-enriched (8.6 and 4.3-fold) in loamy and sandy soil, respectively. In the rhizosphere, it was low abundant (<0.5%) but also strongly cold-enriched in both loamy (8.1-fold) and sandy soil (4.7-fold). The ASV matching F. hercynium was highly abundant (0.6%) and significantly cold enriched (1.3-fold) in the root endosphere in sandy soil. The ASV matching F. flumimis, although absent in the endosphere and very low abundant in the rhizosphere (0.007%), was significantly and strongly cold-enriched (5.8-fold) in the rhizosphere in sand-loam soil.

Claims

2. The isolated Flavobacterium strain according to claim 1 having the deposit accession number LMG P-32775, LMG P-32776 or LMG P-32777.

3. The isolated Flavobacterium strain according to any of the claims 1-2 for inducing chilling stress tolerance in plants.

4. An enriched culture of the Flavobacterium strain according to any of claims 1-3.

5. A biologically pure culture of the Flavobacterium strains according to any of claims 1-3.

6. A composition comprising the Flavobacterium strain according to any of claims 1-3 or the culture according to any of claims 4-5.

7. The composition according to claim 6, wherein the Flavobacterium strain is lyophilized, freeze- dried to a powder or present as an aqueous slurry.

8. The composition according to any of claims 6-7 further comprising growth medium appropriate for Flavobacterium species and/or a cryoprotectant.

9. The composition according to any of claims 6-8 further comprising an agriculturally compatible carrier.

10. A plant seed coated with the Flavobacterium strain according to any of claims 1-3 or with the culture according to any of claims 4-5.

11. The plant seed according to claim 10, where the plant seed is a lettuce plant seed.

12. Use of the Flavobacterium strain according to any of claims 1-2, the culture according to any of claims 4-5 or the composition according to any of claims 6-8 to enhance yield and/or plant growth under low temperature conditions, wherein the enhanced yield and/or plant growth is compared to a control situation in the absence of said Flavobacterium strain.

13. The use according to claim 12 wherein the enhanced yield and/or plant growth is increased fresh matter production.

14. The use according to any of claims 12-13, wherein the low temperature conditions are plant growth conditions at a temperature between 0°C and 18°C for at least a part of the day.

15. A method for enhancing yield and/or plant growth under low temperature conditions, the method comprising the steps of: inoculating a plant growth medium with a microbial population, said population comprises the Flavobacterium strain according to any of claims 1-2, the culture according to any of claims 4-5 or the composition according to any of claims 6-9; and growing the plant in said plant growth medium. The method of claim 15, wherein the microbial population is applied to the plant growth medium as a powder, as a pellet, as a granule or as a liquid. A method for enhancing yield and/or plant growth under low temperature conditions, said method comprising growing the coated plant seed according to claim 10, to obtain enhanced yield and/or plant growth of said plant under low temperature conditions. A method for enhancing yield and/or plant growth under low temperature conditions comprising: growing said plant in an environment that supports plant growth; and administering a sprayable formulation to said environment or to said plant, said formulation comprising the Flavobacterium strain according to any of claims 1-2, the culture according to any of claims 4-5 or the composition according to any of claims 6-9; o obtain enhanced yield and/or plant growth of said plant under low temperature conditions. The method according to any of claims 15-18, wherein the plant is grown at low temperature conditions during at least a part of the day and/or for at least a part of the growing season. The method according to any of claims 15-19, wherein the low temperature conditions are growth conditions at a temperature between 0°C and 18°C.