WO2024114696A1

WO2024114696A1 - Cpg island methylation enrichment sequencing technology based on restriction enzyme digestion

Info

Publication number: WO2024114696A1
Application number: PCT/CN2023/135179
Authority: WO
Inventors: 姜正文; 方欧; 王果; 林芳斌
Original assignee: 天昊基因科技(苏州)有限公司; 上海天昊生物科技有限公司
Priority date: 2022-11-30
Filing date: 2023-11-29
Publication date: 2024-06-06
Also published as: CN115976161A

Abstract

The present invention provides a simple and efficient methylation sequencing library construction method. Restriction endonuclease combination enzyme digestion is added on the basis of a traditional whole-genome methylation sequencing method, thus realizing enrichment sequencing of CpG islands, especially methylation-modified CpG islands. The method of the present invention reduces the sequencing cost and eliminates complex operations, thus being suitable for research and applications targeting methylation of CpG islands.

Description

CpG island methylation enrichment sequencing technology based on restriction enzyme digestion

Technical Field

The present invention relates to the field of DNA sequencing, and in particular to a CpG island methylation enrichment sequencing technology based on restriction enzyme digestion.

Background technique

DNA methylation modification (5mC) is crucial to normal gene expression and cell function, and is involved in regulating the most basic life activities such as gene expression and chromatin stability. Gene methylation polymorphism is an important cause of individual phenotypic differences, and gene methylation variation can also lead to individual phenotypic abnormalities. A large number of studies have shown that compared with normal cells, the methylation characteristics of tumor cell genes have undergone extensive and significant changes, and cancer-specific methylation variant genes have also been found in different cancer types. Therefore, gene methylation variation can be used as a pan-cancer biomarker.

The discovery and research of methylation tumor markers rely on differential methylation gene analysis of genomic DNA in healthy tissues and cancer tissues. Currently, there are a variety of mature technologies that can be used for whole-genome methylation detection, including Illumina 850K methylation chips based on microarray chips, WGBS (Whole-genome bisulfite sequencing) and RRBS (Reduced representation bisulfite sequencing) based on NGS sequencing platforms, MeDip and MBD-seq technologies based on antibody immunoprecipitation, etc. Methylation detection for specific sites/regions usually uses methods such as MSP (Methylation-specific PCR), BSP (Bisulfite-Sequencing PCR) and MSRE-qPCR.

On the other hand, ctDNA (Plasma Cell-free tumor DNA, ctDNA), which is the focus of liquid biopsy, carries methylation information from tumor tissues. Its detection can realize cancer screening, companion diagnosis and prognosis monitoring. Due to the low copy number and high degree of degradation of ctDNA, its detection is not easy, and the weak methylation marker signal will also be masked by background noise. In early applications, taqman probe qPCR technology is usually relied on to detect designated methylation sites or haplotypes. In recent years, whole genome methylation sequencing (WGBS) based on NGS and target region methylation sequencing technology captured by probe hybridization have also been developed for ctDNA detection at the omics level. This type of method can integrate the methylation information of a large number of sites, train mathematical models, and maximize the detection sensitivity and specificity. At the same time, it has the characteristics of tissue tracing, so it has gradually become the mainstream technology for pan-cancer screening. However, in actual application, both methods have limitations. Although WGBS can obtain whole genome methylation information, it is limited by sequencing costs and has a low sequencing depth. For example, the common 90G sequencing volume can only obtain an average sequencing depth of about 20X, and the detection accuracy and sensitivity are poor. At the same time, the methylation variation regions in the genome that can actually be used to indicate cell carcinogenesis only account for a very small part, and whole genome sequencing is undoubtedly a strategy with low cost performance. Methylation sequencing of target regions based on probe capture certainly makes up for the lack of depth of WGBS sequencing, but due to the complexity of methylation, The haplotype pattern is complex (with the increase of the number of CpG sites in the target region, the number of haplotypes increases exponentially); there are still many technical difficulties in achieving efficient, stable and accurate capture of the target region. The additional steps of probe synthesis and target region hybridization capture also increase the difficulty and cost of the experiment.

Therefore, there is a need in the art to develop a method for simply and efficiently capturing DNA methylation sequences.

Summary of the invention

The purpose of the present invention is to provide a CpG island methylation enrichment sequencing technology based on restriction enzyme cutting.

In a first aspect of the present invention, a method for constructing a DNA methylation sequencing library is provided, comprising the steps of:

S1) providing a DNA sample to be tested;

S2) connecting the adapter sequences to both ends of the DNA to be tested, thereby obtaining DNA with adapters;

S3) performing AT digestion, non-methylation site digestion and CT conversion on the DNA with the adapter, thereby obtaining a digestion sequencing library.

In another preferred embodiment, in step S1), the DNA sample to be tested is selected from the following group: genomic DNA (gDNA), cell-free DNA (cfDNA), or a combination thereof.

In another preferred embodiment, in step S1), the DNA sample to be tested is fragmented, preferably fragmented to 100-600 bp, more preferably 200-400 bp.

In another preferred embodiment, in step S2), the linker is a methylated linker, in which all cytosine Cs are 5-methylated.

In another preferred embodiment, the linker does not contain AATT or TTAA sequence.

In another preferred embodiment, the linker comprises a first chain and a second chain, the 3' end of the first chain is partially base complementary to the 5' end of the second chain, and after the two chains are annealed, a single A base of the first chain protrudes.

In another preferred embodiment, the 5' end of the first chain is modified with a phosphate group.

In another preferred example, the first chain nucleotide sequence is shown as SEQ ID NO.1, and the second chain nucleotide sequence is shown as SEQ ID NO.2.

In another preferred embodiment, in step S2), the steps of end repair and A tailing are also included before connecting the adapter.

In another preferred embodiment, in step S2), after connecting the methylated linker, a sorting and/or purification step is also included.

In another preferred embodiment, the sorting step includes sorting the length of the DNA insert fragments, preferably 200-400 bp, more preferably 250-350 bp.

In another preferred embodiment, the purification step includes purifying and recovering DNA fragments with double-ends connected to methylated adapters.

In another preferred embodiment, the sorting and/or purification includes magnetic bead sorting and/or purification.

In another preferred embodiment, in step S3), the DNA is subjected to one or more rounds of AT enzyme digestion.

In another preferred embodiment, in step S3), the AT enzyme cleavage is performed before CT transformation and/or after CT transformation; or is performed both before CT transformation and after CT transformation.

In another preferred embodiment, the non-methylated site cleavage is performed before CT conversion.

In another preferred embodiment, the non-methylated site digestion is performed before AT digestion, or after AT digestion, or simultaneously with AT digestion in the same reaction system.

In another preferred embodiment, step S3) further includes the step of PCR amplification.

In another preferred embodiment, step S3) comprises a step selected from the following group:

i)a. Perform non-methylated site digestion and AT digestion on DNA, and

b. Perform CT conversion on the digested DNA, followed by a first round of PCR amplification to obtain a digested sequencing library; or

ii)a. Enzyme digestion of DNA at non-methylated sites,

b. CT conversion of the digested DNA followed by the first round of PCR amplification, and

c. performing AT digestion on the transformed DNA, followed by a second round of PCR amplification to obtain a digestion sequencing library; or

iii) a. Perform enzyme digestion of non-methylated sites and the first round of AT digestion on DNA,

c. Perform AT digestion on the transformed DNA, followed by a second round of PCR amplification to obtain a digestion sequencing library.

In another preferred embodiment, in step S3), the AT enzyme cleavage is performed using an enzyme that can recognize and cleave AT-rich sequence DNA.

In another preferred embodiment, the enzyme is selected from the group consisting of restriction endonucleases, CRISPR gene editing enzymes, ZFNs, TALENs, giant nucleases, or combinations thereof.

In another preferred embodiment, the AT digestion is performed using a restriction endonuclease whose digestion recognition site contains only A and T bases.

In another preferred embodiment, the enzyme used for the AT cleavage is selected from the following group: MluCI, MseI, SspI, PsiI, AseI, DraI, PacI, AnaI, AcsI, AgsI, ApoI, AflII, BfrI, BspTI, BstAFI, EcoRI, EcoRV, FaiI, FauNDI, HpaI, KspAI, MfeI, MspCI, MssI, MunI, NdeI, PmeI, PshBI, SaqAI, SmiI, Sse9I, TasI, Tru1I, Tru9I, TspDTI, Tsp509I, VspI, XapI, HindIII, NsiI, NspV, PagI, PciI, SfuI, SnaBI, BfrBI, ClaI, ScaI, SwaI, or a combination thereof.

In another preferred embodiment, the AT digestion is single digestion with MseI, single digestion with MluCI, or double digestion with MseI and MluCI.

In another preferred embodiment, in step S3), the CT conversion is sulfite chemical conversion or APOBEC deaminase conversion, preferably APOBEC deaminase conversion.

In another preferred embodiment, the CT conversion comprises the steps of:

C1) TET2 enzyme oxidatively protects the 5mC base;

C2) Use APOBEC deaminase to convert all unprotected C bases (unmethylated C bases) into U bases.

In another preferred embodiment, the CT conversion comprises the steps of:

Sulfite was used to convert all C bases (unmethylated C bases) into U bases.

In another preferred embodiment, in step S3), the non-methylated site cleavage is performed using a 5mC methylation-sensitive restriction endonuclease or a combination of endonucleases.

In another preferred embodiment, the 5mC methylation-sensitive restriction endonuclease or endonuclease combination is selected from the following group: HpaII endonuclease, BstUI endonuclease, FspI endonuclease, or a combination thereof.

In another preferred embodiment, in step S3), the first round of PCR amplification is performed using a high-fidelity DNA amplification enzyme capable of amplifying templates containing uracil (U base).

In another preferred embodiment, the first round of PCR amplification is performed using adapter sequence-specific primers.

In another preferred example, the first round of PCR amplification uses a forward primer nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer nucleotide sequence as shown in SEQ ID NO.4.

In another preferred example, the second PCR amplification uses a forward primer nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer nucleotide sequence as shown in SEQ ID NO.6.

In another preferred embodiment, each AT digestion and/or non-methylation site digestion step may be followed by a sorting and/or purification step.

In the second aspect of the present invention, a DNA methylation sequencing library is provided. The methylation sequencing library is constructed using the method described in the first aspect of the present invention.

In a third aspect of the present invention, a method for detecting DNA methylation in a sample is provided, comprising the steps of:

1) constructing a methylation library using the method described in the first aspect of the present invention; and

2) Sequencing the methylation library to detect DNA methylation in the sample.

In another preferred embodiment, the sequencing includes using an Illumina sequencing platform or a BGI sequencing platform.

In the fourth aspect of the present invention, a method for diagnosing or predicting diseases related to abnormal DNA methylation is provided, comprising the steps of obtaining a DNA sample from a subject to be tested, and detecting methylation of the DNA sample using the method described in the first aspect of the present invention, thereby diagnosing or predicting the disease.

In another preferred embodiment, the disease is a tumor.

In another preferred embodiment, the subject is a human or non-human mammal.

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form new or preferred technical solutions. Due to limited space, I will not elaborate on them one by one here.

BRIEF DESCRIPTION OF THE DRAWINGS

The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

FIG1 shows the experimental flow chart of the CpG island methylation enrichment sequencing technology based on restriction enzyme digestion.

Figure 2 shows an example of the distribution of sequencing data in CpG islands after the first round of AT digestion in Example 2; the CpG island range is represented by a gray bar (below the peak graph), A) all CpG island information is retained, B) CpG island information is partially retained, and C) CpG island information is completely lost. The upper part shows the distribution of sequencing data in CpG islands for undigested libraries, and the lower part shows the distribution of sequencing data in CpG islands after the first round of AT digestion.

Figure 3 shows the ratio of the sequencing depth of each CpG island after the first round of AT digestion to the depth before digestion in Example 2 when the same amount of sequencing data is used, displayed in a histogram. The part corresponding to the black highlighted horizontal axis [0,1] indicates that after the first round of AT digestion, the sequencing depth is lower than the number of CpG islands without digestion.

Figure 4 shows a histogram of sequencing depths of the three libraries treated differently in Example 3 in the commonly detected CpG island regions, with the horizontal axis representing sequencing depths. The top, middle and bottom display the libraries of "no restriction enzyme digestion", "first round AT digestion + non-methylated site digestion" and "first round AT digestion + non-methylated site digestion + second round AT digestion". The dotted line represents the mean of the sequencing depths of the libraries in these common CpG islands.

Figure 5 shows the enrichment effect of enzyme digestion on methylated CpG islands. MseI and MluCI were used for the first round of AT digestion, and HpaII was used for non-methylated site digestion; MseI and MluCI were used for the second round of AT digestion before library construction and sequencing. The results of enrichment sequencing of CpG sites in the promoter region of SEPTIN9 are shown: gray lines represent sequencing reads, NEGATIVE and POSITIVE represent positive and negative strands, respectively; black squares represent methylated CpG sites, and white squares represent non-methylated CpG sites.

Detailed ways

After extensive and in-depth research, the inventors have developed a special methylation second-generation sequencing library construction method that introduces a restriction enzyme cutting step during the library construction process. Utilizing the characteristics of CpG islands rich in C and G bases, through the recognition site, the restriction enzyme cutting combination with different characteristics, the enrichment sequencing of CpG islands with methylation modification is realized. The present invention is suitable for the research and application of methylation of CpG islands, not only for conventional genomic DNA, but also for the methylome detection of trace ctDNA, providing a new solution for the field of tumor liquid biopsy that relies on ctDNA methylation. On this basis, the present invention is completed.

The present invention comprehensively applies AT digestion, CT conversion and non-methylation site digestion. Through the AT digestion step, the interference of a large number of AT-enriched fragments can be removed, the sequencing efficiency can be improved, and the CpG island can be enriched. By using non-methylation site digestion, the interference of non-methylated CG fragments can be removed, the sequencing efficiency can be improved, and the CpG island containing methylation sites can be enriched. Through the CT conversion step, on the one hand, non-methylated cytosine is converted, and only methylated cytosine is retained in the sequence; on the other hand, CT conversion further generates new AT digestion sites in the sequence, and secondary AT digestion can be performed to improve the enrichment efficiency.

the term

As used herein, the terms "methylation library" and "enzyme digestion sequencing library" have the same meaning, and refer to a double-stranded DNA fragment that is repaired at the end, A is added, and a Y-shaped methylated adapter is connected, followed by one or more steps selected from AT digestion, non-methylated site digestion, CT conversion, or a combination thereof, and finally PCR enrichment amplification to obtain the library.

As used herein, the term "AT digestion" refers to the use of a restriction endonuclease whose recognition sequence contains only A/T to digest the whole genome methylation sequencing library. In a preferred embodiment, the restriction endonuclease whose recognition sequence contains only A/T includes any enzyme that can cut AT-rich sequences, such as but not limited to MseI (recognition site is TTAA) and MluCI (recognition site AATT).

As used herein, the term "non-methylated site digestion" refers to the use of a 5mC methylation-sensitive restriction endonuclease to digest the whole genome methylation sequencing library. In a preferred embodiment, the 5mC methylation-sensitive restriction endonuclease includes but is not limited to HpaII (recognition site is CCGG).

As used herein, the term "CT conversion" refers to the deamination of cytosine into uracil or thymine. CT conversion can be performed using an enzyme treatment method, wherein the 5mC base is protected by TET2 enzyme oxidation, and then the unprotected C base (unmethylated C base) is completely deaminated and converted into U base using APOBEC deaminase. Conventional chemical methods can also be used to convert unmethylated C bases into U bases using traditional sulfite treatment. Enzyme treatment is preferred because it is milder and less likely to cause DNA chain breaks.

In the present invention, AT digestion can be performed before CT conversion and/or after CT conversion alone; it can also be performed before CT conversion and after CT conversion. Non-methylation site digestion is performed before CT conversion, and can be performed separately or in combination with AT digestion. After digestion, universal primers at both ends of the library are used to enrich DNA fragments whose insert fragments do not contain the above-mentioned digestion sites.

Technical principle

In order to facilitate the understanding of the present invention, the following principles are provided in this specification. It should be understood that the protection scope of the present invention is not limited by the principles.

The present invention utilizes the characteristics of CpG islands being rich in C and G bases, utilizes AT digestion and non-methylated site digestion to simplify the sequencing library, retains CpG island information, and can utilize the sequence changes after CT conversion to perform a second round of AT digestion to further improve the simplification efficiency. Non-methylated site digestion further enriches the CpG island information that has undergone methylation.

As shown in Figure 1, in the method of the present invention, two rounds of restriction enzyme digestion (before/after CT conversion) can be performed to remove AT-rich regions (AT digestion) or unmethylated regions (unmethylated site digestion). Performing two rounds of digestion steps can maximize the enrichment of CpG islands that have undergone methylation modification. After CT conversion, the sequence will change, and the new sequence may therefore constitute a new AT digestion site.

Methylation library construction method

Typically, the method of the present invention can refer to Figure 1, comprising the steps of:

1) The DNA fragments are first end-repaired and A-tailed, and methylated adapters are connected to both ends of the DNA fragments;

2) The methylated linker comprises a first strand and a second strand, all cytosine Cs are 5-methylated, wherein the 5' phosphate group of the first strand is modified, the 3' end of the first strand is partially complementary to the 5' end of the second strand, and after the two strands are annealed, a single A base of the first strand protrudes;

3) The type of DNA that can be used for library construction can be genomic DNA (gDNA) or cell-free DNA (cfDNA);

4) If you are building a library of genomic DNA, you first need to fragment it to the target size, such as 200-400 bp, or 100-600 bp;

5) If the cfDNA library is constructed, no fragmentation step is required;

6) After methylated adapter ligation, if you are building a library for gDNA, you need to use magnetic beads to sort the library with an appropriate insert fragment length, such as 250-350bp; suboptimal, 200-400bp; if you are building a library for cfDNA, use magnetic beads to purify the ligation products, and you need to recover as many DNA fragments as possible that are ligated to the methylated adapter at both ends;

7) Perform the first round of AT digestion, using a restriction endonuclease whose digestion recognition site contains only A and T bases, to perform AT digestion on the above ligation product. The best is to use MseI (recognition site is TTAA) and MluCI (recognition site AATT) for double digestion; the better is to use MseI (recognition site is TTAA) and MluCI (recognition site AATT) for single digestion respectively;

8) Use a 5mC methylation-sensitive restriction endonuclease to digest the ligation product at the non-methylated site. The best approach is to use HpaII (CCGG) for digestion;

9) If the first round of AT digestion and non-methylated site digestion are performed, multiple digestions can be performed simultaneously in the same reaction system;

10) After the enzyme digestion product is purified using magnetic beads, it is subjected to CT conversion treatment. The best is to use enzymatic treatment, after the 5mC base is oxidized and protected by TET2 enzyme, the unprotected C base (unmethylated C base) is completely deaminated and converted into U base using APOBEC deaminase; the better is to use traditional sulfite treatment to convert the unmethylated C base into U base;

11) After CT conversion, a high-fidelity DNA amplification enzyme capable of amplifying templates containing uracil (U base) is used to PCR amplify the fragments of the inserted fragments that do not contain restriction sites to obtain a single-round restriction digestion sequencing library;

12) After CT conversion, the sequence changes, and a second round of AT digestion can be performed, using a restriction endonuclease whose digestion recognition site contains only A and T bases, to perform AT digestion on the above ligation product. The best is to use MseI (recognition site is TTAA) and MluCI (recognition site AATT) for double digestion; the better is to use MseI (recognition site is TTAA) and MluCI (recognition site AATT) for single digestion;

13) After the second round of AT digestion, a second round of PCR amplification is performed using primers matching the universal adapter to enrich the fragments whose inserts still do not contain the digestion site after CT conversion, and obtain a twice-digested sequencing library;

14) The above first round of AT digestion, non-methylated site digestion, and second round of digestion can be performed in combination;

15) The sequencing library is sequenced on a sequencing machine. The sequencing platform is determined based on the connected methylated adapters. Preferably, the Illumina sequencing platform or the BGI sequencing platform is used.

The main advantages of the present invention include:

1) Compared with the traditional whole-genome methylation sequencing method, the method of the present invention reduces the sequencing cost while ensuring the acquisition of effective information of CpG islands as much as possible. Depending on the difference in enzyme cutting combinations, the CpG island enrichment effect can be as high as 10 times.

2) Compared with the target region enrichment methylation sequencing method based on probe capture, the method of the present invention eliminates the complex, high-cost and uncertain methylation probe design and capture steps.

3) The method of the present invention is compatible with various types of DNA samples, including genomic DNA and cell-free DNA.

The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and weight parts.

Example 1 Human genome enrichment simulation data

This example simulates the enrichment multiple of CpG islands in the human genome sequence (hg19) by performing the first round of AT digestion with MseI and MluCI, respectively, followed by the second round of AT digestion after CT conversion.

1) Using 100bp, 200bp, 300bp, 400bp, 500bp, and the characteristic length of ctDNA 170bp as sliding windows, and a step length of 1 base, the genome sequence was divided into N fragments; the number of fragments containing the AATT or TTAA base combination in the sequence was counted, recorded as N1; the number of fragments containing any one of the AATT, TTAA, AACC, AATC, AACT, CCAA, TCAA, and CTAA base combinations in the sequence was counted, recorded as N2;

2) Similarly, according to the above-mentioned sliding window length and step unit, the sequence of human CpG island (data source: UCSC database) is divided into M fragments; the number of fragments containing the base combination of AATT or TTAA in the sequence is counted, recorded as M1; the number of fragments containing any one of the base combinations of AATT, TTAA, AACC, AATC, AACT, CCAA, TCAA, and CTAA in the sequence is counted, recorded as M2;

3) Calculate the genome simplification efficiency of a single round of AT digestion: R1 = N/(N-N1); the genome simplification efficiency of two rounds of AT digestion: R2 = N/(N-N2). The genome simplification efficiency directly affects the sequencing volume and determines the experimental cost.

4) Calculate the CpG island retention ratio after a single round of AT digestion K1 = (M-M1)/M; the CpG island retention ratio after two rounds of AT digestion K2 = (M-M2)/M. The CpG island retention ratio directly affects the effective information that can be obtained.

5) The calculation results are shown in the following table. It can be seen that when the sliding window is 170bp (the characteristic length of ctDNA), after a single round of AT digestion, the genome simplification efficiency reaches 3.9 times, and 77% of the CpG island signal can be retained. After two rounds of AT digestion, the genome simplification efficiency reached 10.7 times, but the retained CpG island information dropped to 24%;

6) According to the simulation results, it can be seen that the genome simplification efficiency is positively correlated with the sliding window length regardless of single or double AT digestion. The genome simplification efficiency of single-round AT digestion is more susceptible to the sliding window length, and the genome simplification efficiency of double AT digestion is higher than that of single-round digestion, but is less affected by the sliding window length. On the other hand, the CpG island information retention ratio after single and double digestion is negatively correlated with the sliding window length, and the CpG island information retention ratio of single-round AT digestion is higher, and is less affected by the sliding window length; while the CpG island information retention ratio of double AT digestion is lower than that of single-round digestion, and is more affected by the sliding window length.

From this embodiment, it can be seen that by adjusting the library insertion length and the AT restriction enzyme cutting strategy, the two key parameters of genome simplification efficiency and CpG island information retention ratio can be adjusted, and the two need to be balanced to better meet actual needs.

Table 1 Relationship between sliding window, simplification efficiency and CpG island information retention ratio

Example 2: Results of the first round of AT restriction enzyme digestion and sequencing of human genomic DNA

1) Chemically synthesize the following linker sequences and HPLC purify;

5mC-AD-F: [ROX]ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO.1)

5mC-AD-R:GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[HEX] (SEQ ID NO.2) All Cs in the above sequences are 5mC bases;

2) Use annealing buffer (10mM Tris-Cl pH 8.0, 1mM EDTA, 50mM NaCl) to dissolve the above synthesized oligo to a final concentration of 100μM. Take 25μL 5mC-AD-F and 25μL 5mC-AD-R, mix them in a 0.2ml thin-walled tube to make 50μL 5mC-AD (final concentration 50μM);

3) Place the above 5mC-AD in a PCR instrument for annealing, the conditions are: denaturation at 95°C for 10 minutes, cooling to 25°C at 0.1°C/second; and maintaining at 25°C for 2 hours, to obtain the prepared methylated linker;

4) Take 30 μL 10 ng/μL genomic DNA and use Covaris ultrasonic to break it into 200-400 bp DNA fragments;

5) Use a DNA library construction kit (E7120, NEB) to perform end filling, add A, and methylate adapter ligation. The specific steps are as follows:

a. Prepare the following system to fill the end and add A

Reaction conditions: 20℃ for 30 minutes, 65℃ for 30 minutes

b. After the ends are filled and A is added, a methylated linker (5mC-AD) is connected to prepare the following system:

Reaction conditions: 20°C for 15 minutes;

c. Purify the ligation product using magnetic beads and finally dissolve in 50 μL H ₂ O;

6) Take half of the ligation product and directly perform the PCR amplification step in step 9) as a non-enzyme digestion control;

7) Prepare the following AT enzyme digestion system:

Reaction conditions: 37°C, 2 hours

8) Purify the AT digestion product using magnetic beads and finally dissolve it in 30 μL H ₂ O;

9) Prepare the following system on ice, mix well and centrifuge, place on a PCR instrument to react, and amplify and enrich the DNA fragments that do not contain the restriction site;

a. Reaction system

The primer sequences are:

b. Reaction conditions:

10) After the library was subjected to 2100 quality control for insert length and quantified by qPCR, Illumina

Novaseq on board;

Results: The sequencing results are shown in the following table. The number of bases aligned to the entire genome and the number of bases aligned to the CpG region are counted separately to calculate the average sequencing depth. After one round of AT digestion, the sequencing depth of each G sequencing data in the CpG island is 1.4X compared to 0.4X of the undigested library, and the CpG island enrichment efficiency is about 3.5 times;

Table 2 Effect of enzyme digestion on sequencing efficiency

At the same time, compared with the undigested treatment, the sequencing data aligned to the CpG island after one round of AT digestion is mainly divided into the following types: A) all CpG island information is retained, B) CpG island information is partially retained, and C) CpG island information is completely lost (Figure 2). After calculation, under the same sequencing amount, among the 27,949 CpG islands, the number of sequencing depths after one round of AT digestion is higher than that of sequencing without digestion reached 25,606, accounting for 91.6% (Figure 3).

It should be noted that each CpG site contained in a CpG island usually has a consistent methylation pattern, so After enzyme digestion, even if only part of the information in the CpG island is retained, it can be used to infer the methylation degree of the CpG island.

It can be seen from this example that a single round of AT digestion can reduce sequencing costs by more than 70%, and obtain a sequencing depth that is no less than that of whole genome sequencing in more than 90% of CpG island regions.

Example 3: CpG island enrichment sequencing after two rounds of AT digestion and non-methylated site digestion of cfDNA

1) 30 ng of cfDNA was taken, and the end was filled, A was added, and the methylated adapter was connected using a DNA library construction kit (E7120, NEB). The specific steps were the same as in Example 2;

2) The ligation product was purified using magnetic beads and finally dissolved in 45 μL H ₂ O. 15 μL was taken and directly carried out to step 4) CT conversion step as a non-enzyme digestion control;

3) Prepare the following system to perform AT digestion and non-methylated site digestion simultaneously;

Reaction conditions: 37°C, 2 hours

4) After purifying the enzyme digestion product using magnetic beads, use Enzymatic Methyl-seq Conversion Module (E7125L, NEB) was used for CT conversion;

a. Add 400 μL TET2 Reaction Buffer to a tube of TET2 Reaction Buffer Supplement and mix well. Mark it as TET2 Reaction Buffer (reconstituted).

b. Dilute Fe(II) Solution: Add 1 μL 500 mM Fe(II) Solution (yellow cap) to 1249 μL water, mix well, and place on ice for later use;

c. Prepare the reaction system on ice according to the table below, mix well, and centrifuge briefly:

d. Add 5 μL of diluted Fe(II)Solution to the mixed system, pipette 10 times to mix evenly and centrifuge briefly, then place on a PCR instrument for oxidation reaction:

Reaction conditions:

e. Transfer the sample after the oxidation reaction to ice, add 1 μL Stop Reagent, pipette 10 times to mix evenly, centrifuge briefly, and place on the PCR instrument to terminate the reaction:

Reaction conditions:

f. After the oxidation product was purified by magnetic beads, it was dissolved in 16 μL H ₂ O, 4 μL HIDI was added, and it was placed in a PCR instrument preheated to 85°C for 10 minutes, and immediately placed on ice after the reaction;

g. Prepare the reaction system according to the table below, mix well by pipetting, cover with film, centrifuge briefly, and place on PCR instrument for reaction:

reaction system:

Reaction conditions:

h. Purify the CT conversion product using magnetic beads, and finally dissolve it in H ₂ O. Divide the CT conversion product by enzyme digestion into two equal parts for subsequent amplification reaction;

5) Prepare the following three systems in parallel on ice, mix well and centrifuge, place on a PCR instrument for reaction, and amplify and enrich the DNA fragments that do not contain the restriction site and the uncut control;

reaction system

The primer sequences are the same as in Example 2.

Reaction conditions:

6) After the undigested control amplification product is purified, it is directly used as the undigested control sequencing library; after the two digested CT conversion amplification products are purified, one is used as the sequencing library of single-round AT digestion + non-methylated site digestion,

Another portion was prepared with the following system for the second round of AT digestion;

7) After the enzyme cleavage products are purified by magnetic beads, the following system is prepared to re-amplify and enrich the DNA fragments that do not contain the enzyme cleavage sites;

Primer sequences:

8) The amplified products were purified by magnetic beads and used as two-round AT digestion + non-methylated site digestion sequencing library;

9) All libraries were subjected to 2100 quality control for insert fragment length and quantified by qPCR before being loaded onto the Illumina Novaseq machine.

Results: The sequencing data were statistically analyzed. When the sequencing data volume was the same as 5G, there were 27949 CpG islands in total without enzyme digestion, of which 21223 CpG islands were sequenced to at least one read; after one round of AT digestion and unmethylated site digestion, at least one read could be detected in 17006 CpG islands, and the sequencing depth was higher than that of the undigested library for 9349 CpG islands; after a second round of AT digestion, at least one read could be detected in 15542 CpG islands, and the sequencing depth was higher than that of the undigested library for 10967 CpG islands.

The sequencing results counted the number of bases aligned to the entire genome and the number of bases aligned to the CpG island region, and calculated the average sequencing depth of each CpG island. Due to the differences in genome simplification efficiency of different processing libraries, the CpG islands shared by the sequencing data of the three libraries were counted; when the sequencing volume was 5G, in these effective regions, the average coverage depth was about 1.68X without enzyme digestion; after one round of AT digestion + non-methylated site digestion, the average coverage depth was about 2.99X; after two rounds of AT digestion + one round of non-methylated site digestion, the average coverage depth was 8.25X (Figure 4).

It should be noted that after restriction digestion of non-methylated sites, the sequencing data also enriches CpG islands that have undergone methylation modification. As shown in Figure 5, a CpG island located in the promoter region of the SEPTIN9 gene has 4 reads detected without restriction digestion, all of which are non-methylated. After restriction digestion of non-methylated sites, methylated reads are enriched, and the number of sequenced reads increases with the increase in the number of AT restriction digestions.

It can be seen from the example data that the method of the present invention is also applicable to cfDNA. AT enzyme cleavage can significantly increase the sequencing depth of the CpG island region, and enzyme cleavage at non-methylated sites can enrich the regions where methylation modification occurs.

All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

A method for constructing a DNA methylation sequencing library, characterized in that it comprises the steps of:

S1) providing a DNA sample to be tested;

S2) connecting the adapter sequences to both ends of the DNA to be tested, thereby obtaining DNA with adapters;

S3) performing AT digestion, non-methylation site digestion, and CT conversion on the DNA with the adapter to obtain the sequencing library.
The method according to claim 1, characterized in that, in step S1), the DNA sample to be tested is selected from the group consisting of genomic DNA (gDNA), cell-free DNA (cfDNA), or a combination thereof.
The method according to claim 1, characterized in that in step S2), the linker is a methylated linker in which all cytosine Cs are 5-methylated.
The method according to claim 1, characterized in that step S3) comprises the following steps:

a. Perform DNA digestion at non-methylated sites and AT sites, and

b. Perform CT conversion on the digested DNA, followed by the first round of PCR amplification to obtain a digested sequencing library.
The method according to claim 1, characterized in that step S3) comprises the following steps:

a. Enzyme digestion of DNA at non-methylated sites,

b. CT conversion of the digested DNA followed by the first round of PCR amplification, and

c. Perform AT digestion on the transformed DNA, followed by a second round of PCR amplification to obtain a digestion sequencing library.
The method according to claim 1, characterized in that step S3) comprises the following steps:

a. Perform enzyme digestion on non-methylated sites and the first round of AT digestion on DNA.

b. CT conversion of the digested DNA followed by the first round of PCR amplification, and

c. Perform AT digestion on the transformed DNA, followed by a second round of PCR amplification to obtain a digestion sequencing library.
The method according to claim 1, characterized in that, in step S1), the AT digestion is performed using a restriction endonuclease whose digestion recognition site contains only A and T bases.
The method according to claim 7, characterized in that the AT digestion is single digestion with MseI, single digestion with MluCI, or double digestion with MseI and MluCI.
The method according to claim 1, characterized in that in step S3), the CT conversion is sulfite chemical conversion or APOBEC deaminase conversion.
The method according to claim 1, characterized in that in step S3), the non-methylated site enzyme cleavage is performed using a 5mC methylation-sensitive restriction endonuclease or a combination of endonucleases.
The method according to claim 10, characterized in that the 5mC methylation-sensitive restriction endonuclease or endonuclease combination is selected from the group consisting of HpaII endonuclease, BstUI endonuclease, FspI endonuclease, or a combination thereof.
A DNA methylation sequencing library, characterized in that the methylation sequencing library is constructed using the method according to claim 1.
A method for detecting DNA methylation in a sample, characterized in that it comprises the steps of:

1) constructing a methylation library using the method according to claim 1; and

2) Sequencing the methylation library to detect DNA methylation in the sample.
A method for diagnosing or predicting a disease related to abnormal DNA methylation, characterized in that it comprises the steps of obtaining a DNA sample from a subject to be tested, and detecting the methylation of the DNA sample using the method as described in claim 1, thereby diagnosing or predicting the disease.
The method according to claim 14, characterized in that the disease is a tumor.