WO2024113061A1 - Ciblage de mémoire immunitaire innée et d'ap-1 ou d'atf3 pour le traitement de maladies oculaires - Google Patents

Ciblage de mémoire immunitaire innée et d'ap-1 ou d'atf3 pour le traitement de maladies oculaires Download PDF

Info

Publication number
WO2024113061A1
WO2024113061A1 PCT/CA2023/051605 CA2023051605W WO2024113061A1 WO 2024113061 A1 WO2024113061 A1 WO 2024113061A1 CA 2023051605 W CA2023051605 W CA 2023051605W WO 2024113061 A1 WO2024113061 A1 WO 2024113061A1
Authority
WO
WIPO (PCT)
Prior art keywords
mice
expression
atf3
agent
activity
Prior art date
Application number
PCT/CA2023/051605
Other languages
English (en)
Inventor
Przemyslaw SAPIEHA
Masayuki Hata
Frédérik FOURNIER
Ariel M. WILSON
Guillaume Blot
Original Assignee
Sapieha Przemyslaw
Masayuki Hata
Fournier Frederik
Wilson Ariel M
Guillaume Blot
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sapieha Przemyslaw, Masayuki Hata, Fournier Frederik, Wilson Ariel M, Guillaume Blot filed Critical Sapieha Przemyslaw
Publication of WO2024113061A1 publication Critical patent/WO2024113061A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/42—Oxazoles
    • A61K31/423—Oxazoles condensed with carbocyclic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • the present disclosure generally relates to the field of ophthalmology, and more particularly to ocular diseases associated with inflammation and/or pathological angiogenesis/neovascularization.
  • Age-related macular degeneration is a multifactorial neuroinflammatory disease of the aging eye precipitated by genetic and environmental risk factors. It is a leading cause of irreversible blindness worldwide, with the number of affected individuals rising to over 11 million in North America and expected to double by 2050.
  • drusen insoluble extracellular deposits containing lipids, proteins, hydroxyapatite, and trace metals form in the sub-retinal pigment epithelium (RPE) space (A7-A9).
  • RPE sub-retinal pigment epithelium
  • Components of drusen also include various inflammatory factors such as immunogenic modified lipoproteins, complement proteins, vitronectin, amyloid proteins, and immunoglobulins (A10), which attract and activate cells of the innate immune system such as resident retinal microglia and recruited monocytes/macrophages (A11 , A12) in an attempt to achieve tissue repair through para-inflammation.
  • nAMD neovascular
  • CNV choroidal neovascularization
  • CNV progression leads to retinal edema or hemorrhage culminating in photoreceptor death.
  • Abnormal neovascularization ultimately precipitates fibrovascular scarring and can lead to permanent loss of central vision (A17).
  • A17 In addition to a local immune response, progression of AMD is also influenced by heightened systemic immunity (A18-A20). Importantly, how distal inflammation influences AMD remains improperly understood.
  • ROP retinopathy of prematurity
  • DR diabetic retinopathy
  • Neovascularization also occurs in other ocular diseases, such as retinopathy of prematurity (ROP) and diabetic retinopathy (DR).
  • ROP retinopathy of prematurity
  • DR diabetic retinopathy
  • the present disclosure provides the following items 1 to 31 :
  • a method for preventing or treating pathological retinal inflammation, atrophy, photoreceptor degeneration, angiogenesis or neovascularization such as age-related macular degeneration (AMD) (dry or wet form, early AMD, intermediate AMD, dry AMD, geographic atrophy and variants of AMD), diabetic retinopathy, retinal atrophy secondary to pathologic lipid accumulation, retinopathy of prematurity, retinal vein occlusion, retinitis pigmentosa, or choroidal neovascularization, in a subject comprising administering to the subject an effective amount of an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein.
  • AMD age-related macular degeneration
  • RNA interference RNA interference
  • RNA interference RNA interference
  • an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein for the manufacture of a medicament for preventing or treating pathological retinal inflammation, atrophy, photoreceptor degeneration, angiogenesis or neovascularization, such as age-related macular degeneration (AMD) (dry or wet form, early AMD, intermediate AMD, dry AMD, geographic atrophy and variants of AMD), diabetic retinopathy, retinal atrophy secondary to pathologic lipid accumulation, retinopathy of prematurity, retinal vein occlusion, retinitis pigmentosa, or choroidal neovascularization, in a subject.
  • AMD age-related macular degeneration
  • RNA interference RNA interference
  • the agent that inhibit the expression and/or activity of AP-1 is an RNA interference (RNAi) agent specific for an AP-1 transcript.
  • RNAi RNA interference
  • the agent that inhibit the expression and/or activity of AP-1 is a small molecule, such as those described in FIGs. 35A-H and at pages 27-28, for example T-5224 or an analog thereof.
  • any one of items 15 to 17, wherein the agent that inhibit the expression and/or activity of AP-1 is a peptide or polypeptide that inhibits the formation of AP-1 complexes, e.g., the dimerization of proteins forming AP-1 complexes.
  • RNA interference RNA interference
  • a method for identifying a test compound that may be useful for the prevention or treatment pathological retinal inflammation, atrophy, photoreceptor degeneration, angiogenesis or neovascularization comprising determining whether the test compound reduces or inhibits AP-1 and/or ATF3 expression and/or activity, wherein a reduction or inhibition of AP-1 and/or ATF3 expression and/or activity is indicative that the test compound may be useful for the prevention or treatment pathological retinal inflammation, atrophy, photoreceptor degeneration, angiogenesis or neovascularization.
  • the method comprises providing a cell comprising a nucleic acid sequence comprising a transcriptional regulatory sequence that is bound by AP-1 and/or ATF3 operably-linked to a suitable reporter gene, measuring the expression and/or activity of the reporter gene in the presence and absence of the test compound, wherein a lower expression and/or activity in the presence of the test compound is indicative that the test compound that may be useful for the prevention or treatment pathological retinal inflammation, atrophy, photoreceptor degeneration, angiogenesis or neovascularization.
  • FIG. 1A Time course of Chlamydia pneumoniae (Cpri) or mock infections starting at 7 weeks. Laser-induced CNV occurred at 16 weeks, euthanasia at 18 weeks.
  • FIG. 1 B Confocal images of isolectin B4-stained (IB4-stained) laser burns with FITC-dextran-labeled CNVs. Scale bars: 20 pm.
  • FIGs. 1C-E Quantification of FITC-dextran-labeled CNV area (FIG. 1C), IB4-stained laser impact area (FIG. 1D) and the ratio of FITC/IB4 per laser-burn (FIG.
  • FIG. 1E Representative confocal images of mononuclear phagocytes (MNPs) stained for ionized calcium-binding adaptor molecule 1 (IBA1). Scale bar: 20 pm.
  • FIG. 2A Time course of peripheral LPS stimuli, where C57BL/6J mice received 1 low-dose injection of LPS (1 xLPS), 4 daily injections of LPS (4*LPS), or 4 daily PBS injections (PBS) at 7 weeks old. Laser-induced CNV occurred at 11 weeks and euthanasia at 13 weeks.
  • FIG. 2A Time course of peripheral LPS stimuli, where C57BL/6J mice received 1 low-dose injection of LPS (1 xLPS), 4 daily injections of LPS (4*LPS), or 4 daily PBS injections (PBS) at 7 weeks old. Laser-induced CNV occurred at
  • FIG. 2G CNV confocal imaging of IB4 and FITC- dextran from PBS, 1 xLPS, and 4xLPS groups. Scale bars: 20 pm.
  • FIG. 3A Time course of peripheral LPS stimuli, where C57BL/6J mice received injections of LPS once (1 xLPS), 4 daily injections of LPS (4xLPS), or 4 daily injections of PBS (PBS) at 7 weeks. Laser-induced CNV occurred at 11 weeks and euthanasia 3 days or 2 weeks later. Naive mice received PBS injections but no laser burns.
  • FIGs. 3B-H mRNA expression in retina/RPE- choroid-sclera complexes 3 days after CNV induction (PBS, 1 xLPS, and 4xLPS) of 111b (FIG. 3B), Tnf (FIG. 3C), 116 (FIG. 3D), Vegfa (FIG.
  • FIGs. 3I and J mRNA expression in RPE-choroid-sclera complexes 3 days after CNV induction (PBS, 1 xLPS, and 4xLPS) or without CNV induction (naive) relative to PBS of (FIG. 3I) Tnf and (FIG. 3J) Vegfa’.
  • MNPs mononuclear phagocytes
  • 3M Confocal images of IBA1-stained MNPs on day 14 of PBS-, 1 x[_PS-, and 4x[_PS-treated groups. Scale bars: 20 pm.
  • FIGs. 4A-F show that CX3CR1 + myeloid cells in the retina mediate proangiogenic memory after systemic exposure to LPS.
  • FIG. 4A Time course of Cx3cr7 CreER/+ and Cx3cr7 CreER/+ :R26 iDTR/+ mice injected with 4x[_PS or PBS at 7 weeks.
  • tamoxifen TAM was administered i.p. starting at 6 weeks and diphtheria toxin intravitreally (ivt) at week 1 1 and 12. Laser-induced CNV occurred at 1 1 weeks, euthanasia at week 13.
  • FIG. 4B CNV confocal images of IB4, FITC-dextran, and IBA1 staining from Cx3cr7 CreER/+ and Cx3cr7 CreER/+ :R26 iDTR/+ mice with either 4xLPS or PBS injections. Scale bars: 20 pm.
  • FIGs. 4C-F Quantification of CNV area (FIG. 4C), IB4-stained laser impact area (FIG. 4D), FITC/IB4 ratio per laser burn (FIG. 4E), and number of IBA1 -positive MNPs (FIG.
  • FIGs. 5A-F show that adaptive immunity is not involved in the proangiogenic effect of LPS- induced immune memory.
  • FIG. 5A Time course of Rag 1 ⁇ ' ⁇ mice injected with either 4xLPS or PBS at 7 weeks. Laser-induced CNV occurred at 1 1 weeks, euthanasia at week 13.
  • FIG. 5B CNV confocal images of IB4, FITC-dextran, and IBA1 staining from Rag1 ⁇ ! ⁇ + PBS and Rag1 ⁇ ! ⁇ + 4xLPS mice. Scale bars: 20 pm.
  • FIGs. 5C-F Quantification of CNV area (FIG. 5C), IB4-stained laser impact area (FIG.
  • FIGs. 6A-D show that peripheral exposure to endotoxins induces epigenetic reprogramming of CX3CR1 + retina-resident microglia.
  • FIG. 6A Schematic of the experimental workflow for the single-cell assay for transposase-accessible chromatin sequencing (scATAC-seq) of FACS- isolated CX3CR1+ retinal cells from mice 3 days after CNV induction, preconditioned with either PBS or 4xLPS 1 month before, or naive retinas without CNV induction, preconditioned with PBS.
  • scATAC-seq transposase-accessible chromatin sequencing
  • FIG. 6B UMAP projections of scATAC-seq profiles of CX3CR1+ retinal myeloid cells (2244 cells from 20 mice) according to sample origin (left) and results of unbiased clustering using the Leiden algorithm (right). Each dot represents an individual cell.
  • FIG. 6C Bar graphs of sample components of each cluster in B. M ⁇ t>, macrophage; Mo, monocyte.
  • FIG. 6D Bar graphs of results of GSEA using differentially accessible regions (DARs) for each microglia cluster enriched in naive, PBS, and 4x
  • DARs differentially accessible regions
  • FIGs. 7A-G show that peripheral exposure to endotoxin induces transcriptional reprogramming of myeloid cells.
  • FIG. 7A Experimental time course schematic of LPS in vivo and in vitro manipulations (FIGs. 7B-G). C57BL/6J mice were treated with 4x
  • FIG. 7A Experimental time course schematic of LPS in vivo and in vitro manipulations. 7B-G.
  • C57BL/6J mice were treated with 4x
  • BM cells were differentiated to BM-derived macrophages (BM
  • FIG. 7B Volcano plot obtained from DESeq2 analysis of LPS-restimulated BMDMs from 4xLPS-prereated mice as compared with LPS-restimulated BMDMs from PBS- pretreated mice.
  • FIG. 7C Heatmap of the top 60 most differentially expressed genes of LPS- restimulated BMDMs from 4xLPS-pretreated mice as compared with LPS-restimulated BMDMs from PBS-pretreated mice.
  • FIG. 7C Heatmap of the top 60 most differentially expressed genes of LPS- restimulated BMDMs from 4xLPS-pretreated mice as compared with LPS-restimulated BMDMs from PBS-pretreated mice.
  • FIG. 7D Results of GSEA of Hallmark gene sets showing those enriched in LPS-restimulated BMDMs from mice pretreated with 4xLPS as compared with LPS- restimulated BMDMs from PBS-pretreated mice (FDR ⁇ 0.1 and a nominal Rvalue ⁇ 0.05).
  • a positive normalized enrichment score (NES) value indicates enrichment in the 4xLPS-treated mice.
  • FIGs. 8A-G show that prior peripheral exposure to endotoxins shifts myeloid cells toward proangiogenic polarization.
  • FIG. 8A Representative flow cytometry plots of M1- and M2-like macrophages in BMDMs of PBS-pretreated mice and 4xLPS-pretreated mice.
  • FIG. 8A Representative flow cytometry plots of M1- and M2-like macrophages in BMDMs of PBS-pretreated mice and 4xLPS-pretreated mice.
  • FIG. 8B-C Quantification of M2-like macrophages (F4/
  • BM-Mo BM monocytes
  • FIGs. 8F-G Quantitation of sprouting area at 2 (FIG. 8F) and 3 days (FIG. 8G) of coculture with BM-Mo from each group when compared with no BM-Mo.
  • n 19 (No BM-Mo)
  • n 14 (PBS BM-Mo)
  • n 15 (4x
  • FIGs. 9A-I show that peripheral exposure to endotoxins modulates myeloid cell response via ATF3 deregulation.
  • FIG. 9A Volcano plot of accessible regions with differentially accessible regions (DARs; defined by an FDR adjusted P value ⁇ 0.05, total of 51 DARs) identified between comparisons of microglial 4x[_PS cluster (C3) versus microglial PBS cluster (C2) as found by CX3CR1+ retinal myeloid cell scATAC-seq data.
  • FIG. 9C Representative immunoblots showing p-NF-KB, total NF-KB, p-c-JUN, total c-JUN, and ATF3 expression in BMDMs from PBS-pretreated and 4x[_PS- pretreated mice with and without LPS restimulation.
  • FIG. 9D Schematic representation of knockdown of Atf3 gene expression in BMDMs using siRNA. C57BL/6J mice were treated with 4x[_PS or PBS at 7 weeks of age and BM cells were collected at 11 weeks of age. BM cells were differentiated into BMDMs with M-CSF. BMDMs were transfected with Atf3 or control siRNA for 24 hours and then restimulated with LPS for 4 hours.
  • FIGs. 10A-N show the effect of in vivo exposure to Chlamydia pneumoniae (Cpn) or LPS.
  • FIG. 10A Agarose gel showing PCR amplification results confirming the existence of Cpn ribosomal DNA in peritoneal macrophages from infected mice at 3 days post-infection.
  • FIG. 10A Agarose gel showing PCR amplification results confirming the existence of Cpn ribosomal DNA in peritoneal macrophages from infected mice at 3 days post-infection.
  • FIG. 10A Agarose gel showing PCR amplification results confirming the existence of Cpn ribosomal DNA in peritoneal macrophages
  • FIGs. 10D-F Endotoxin levels in blood (FIG. 10D), brain (FIG. 10E), and retina/choroid (FIG.
  • FIGs. 101-M mRNA expression in retina/RPE-choroid-sclera complexes 4 weeks 24 hours after the last injection relative to PBS of 111 b (FIG.
  • FIGs. 11A-H show the timecourse of changes of circulating and retinal myeloid cells after LPS injections.
  • FIGs. 11 B, n 5, 4, 4, 4, 6 mice from left to right) of total leukocytes.
  • FIGs. 11 E-F Flow cytometry analysis of retinas 4 weeks after initial LPS or PBS injections.
  • FIGs. 11G-H Flow cytometry analysis of RPE-choroid-sclera 4 weeks after initial LPS or PBS injections. Quantification of the percentage of viable MNP (Ly6G7CD1 1 b + , FIG.
  • FIGs. 12A-H show that ablation of retinal myeloid cells in CX3CR1 CreER/+ :R26 iDTR/+ mice following intravitreal diphtheria toxin.
  • FIGs. 12A-B Flow cytometry analysis of blood and retina from CX3CR1 -fluorescence expressing mice.
  • FIG. 12A Representative histograms of FITC expression in blood monocytes, neutrophils, B cells, and T cells.
  • FIG. 12B Representative histograms of FITC expression in mononuclear phagocytes (MNPs).
  • MNPs mononuclear phagocytes
  • FIGs. 12D-E Quantification of % viable MNP (Ly6G7CD11 b + ) (FIG.
  • FIG. 12D Flow cytometry analysis of RPE-choroid- sclera from CX3CR1 CreER/+ and CX3CR1 CreER/+ :R26 iDTR/+ mice following intravitreal diphtheria toxin injection. Representative FACS plots of MNPs and CX3CR1 + microglia.
  • FIGs. 13A-B show the identification of subsets of myeloid cells in CX3CR1+ retinal cells. Chromatin accessibility in the promoter region of Tep1 (FIG. 13A) and Atf3 (FIG. 13B) in microglia isolated from mice 3 days after CNV induction, preconditioned with either PBS or 4xLPS 1 month before, or Naive retinas without CNV induction, preconditioned with PBS as analyzed by qPCR.
  • FIGs. 14A-F show the LPS priming induces a sustained altered transcriptional phenotype in myeloid cells.
  • FIG. 14A-B Principal component analysis (PCA) of RNA-seq data of BMDMs isolated from 1xLPS- pretreated, 4xLPS-pretreated, and PBS-pretreated mice without (FIG. 14A) and with LPS restimulation (FIG. 14B).
  • FIGs. 14C-F Quantification of the percentage of total BM monocytes (Ly6G7B2207CD37NK1 .17CD11 b + /SSC l0W , FIG.
  • Ly6C hi s h BM monocytes (Ly6G _ /B2207CD37NK1 .17CD11 b + /SSC l0W /Ly6C h '9 h , FIG. 14D), Ly6C inter BM monocytes (Ly6G7B220- /CD37NK1 .17CD11 b + /SSC l0W /Ly6C inter , FIG. 14E), and Ly6C l0W BM monocytes (Ly6G7B2207CD3- /NK1.17CD11 b + /SSC l0W /Ly6C l0W , FIG.
  • FIGs. 15A-S show that DIO triggers long-term changes in eWAT that exacerbate pathological angiogenesis.
  • FIG. 15A Experimental schematic in which mice started a HFD at 8 weeks of age and were then switched back to a RD at 19 weeks, which is time point 1 ; this group is HFD-RD. Control mice were fed a RD throughout and are referred to as RD-RD. At 28 weeks, which is time point 2, mice were subjected to laser-induced CNV. Two weeks after CNV induction, mice were euthanized and eyes collected.
  • FIG. 15F Representative confocal images of IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1-stained MNPs in RD-RD and HFD-RD mice. Scale bar, 50 pm.
  • FIGs. 151-K Quantification of the FITC-dextran-labeled CNV area (FIG. 151), the IB4-stained laser impact area (FIG. 15J), and the ratio of FITC/IB4 per laser burn (FIG.
  • FIG. 15M Experimental schematic of the ATT in which recipient mice were transplanted with eWAT fat pads at 8 weeks of age from either RD-RD or HFD-RD donor mice. Sham surgeries of controls were performed similarly but without ATT. Mice were subjected to laser burns at 1 1 weeks and euthanized at week 13.
  • FIG. 15N Adipose tissue grafts 3 weeks after ATT.
  • FIG. 150 Compilation of representative compressed Z-stack confocal images showing IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1 -stained MNPs in sham-operated mice and RD-RD ATT and HFD-RD ATT recipient mice. Scale bar, 50 pm.
  • FIG. 15P-R Quantification of the FITC-dextran-labeled CNV area (FIG. 15P), the IB4-stained laser impact area (FIG.
  • FIG. 15Q the ratio of FITC/IB4 per laser burn
  • FIG. 15R the ratio of FITC/IB4 per laser burn
  • Data information Comparisons between groups were analyzed using two-way ANOVA with Sidak’s multiple-comparisons test (FIG. 15B-G), Student’s unpaired f test (FIG.
  • FIGs. 16A-Q show that ATMs are primed by prior obesity and maintain a proinflammatory profile after weight loss.
  • FIG. 16A H&E staining of eWAT sections from HFD mice (HFD feeding for 1 1 weeks), RD-RD mice, and HFD-RD mice. Scale bar, 50 pm.
  • FIG. 16F-I Flow cytometry analysis of eWAT from RD-RD and HFD-RD mice.
  • FIG. 16F Representative flow plots of ATMs in eWAT of RD-RD and HFD-RD mice.
  • FIG. 16H Representative flow plots of CD38 + and CD206 + ATMs in eWAT of RD- RD and HFD-RD mice.
  • FIG. 16K Representative flow plots of MNPs (Ly6G ⁇ /CD11 b + /F4/80 + /CX3CR1 + /CD45.2 + ) and YFP + MNPs in retinas from sham-operated and LysM Cre/+ ATT and LysM Cre/+ :Ai3E YFP/+ ATT recipient mice.
  • FIG. 16K Representative flow plots of MNPs (Ly6G ⁇ /CD11 b + /F4/80 + /CX3CR1 + /CD45.2 + ) and YFP + MNPs in retinas from sham-operated and LysM Cre/+ ATT and LysM Cre/+ :Ai3E YFP/+ ATT recipient mice.
  • FIG. 16N Experimental schematic of BMT in which lethally irradiated B6.SJL (CD45.1) recipient mice were reconstituted with BM cells at 8 weeks of age from RD-RD or HFD-RD C57BL/6J (CD45.2) mice. Blood was collected from recipient mice for flow cytometry analysis 8 weeks after BMT, and then recipient mice were subjected to laser-induced CNV.
  • FIG. 160 Quantification of CD45.1+ and CD45.2 + circulating monocytes (Ly6G“/CD11 b + /F4/80 + /Ly6C + ) of a CD45.1 + control mouse and an irradiated CD45.1 + mouse having received CD45.2 + RD-RD or HFD-RD BM.
  • FIG. 16P Representative confocal images showing IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1-stained MNPs in RD-RD and HFD-RD BMT mice. Scale bar, 50 pm.
  • Data information Comparisons between groups were analyzed using one-way ANOVA with Tukey’s multiple-comparisons test (FIG. 16B-E, L, and O) or Student’s unpaired t test (FIG. 16G, I, M, and Q). *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****P ⁇ 0.0001. Error bars represent mean ⁇ SEM.
  • FIGs. 17A-G show that prior obesity induces epigenomic reprogramming of ATMs toward proinflammatory and proangiogenic phenotypes.
  • FIGs. 17A-B Heatmaps of DARs (z-score of normalized count) identified in the comparison of RD-RD versus HFD-RD ATMs with their nearest genes in the gene sets GO angiogenesis (FIG. 17A) and GO inflammatory response (FIG. 17B). AP-1 target genes are highlighted. If multiple DARs correspond to the same gene, then the number is indicated behind the gene.
  • FIGs. 17C-J mRNA expression in eWAT 48 hours after laser burn relative to RD-RD of 111b (FIG.
  • FIGs. 18A-Q show that SA potentiates macrophages through activation of TLR4 signaling and induces sustained metabolic rewiring.
  • FIG. 18C Experimental schematic of the in vitro SA-induced immune memory model.
  • BMDMs from C57BL/6J mice were pretreated with DMSO (control) or a TLR4-specific inhibitor (TAK-242) for 1 hour. The BMDMs were then stimulated with BSA (control) or SA. After 24 hours of stimulation, BMDMs were cultured in basal medium for another 5 days before a secondary stimulation with LPS for 4 hours (memory phase). Total RNA was extracted and analyzed for gene expression by qPCR. Seahorse assay was performed on BMDMs without TAK-242 pretreatment before secondary stimulation with LPS (FIGs. 18L-Q). FIG.
  • FIG. 18E Experimental schematic of the in vitro SA-induced immune memory model in TIM knockout (Tlr4-'- mice.
  • FIG. 18G Experimental schematic in which half of the TI '- mice were started on a HFD at 8 weeks of age and switched back to a RD at 19 weeks; this group is referred to as HFD-RD. Control mice were fed a RD throughout and are referred to as RD-RD.
  • FIG. 18H Representative confocal images of IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1 -stained MNPs in RD-RD and HFD-RD TI knockout mice. Scale bar, 50 pm.
  • FIG. 181-J Quantification of the FITC-dextran-labeled CNV area (FIG. 181) and the ratio of FITC/IB4 per laser burn (FIG.
  • FIG. 18J OCR of BMDMs from BSA- and SA-pretreated mice with or without LPS restimulation as indicated in FIG.
  • FIG. 18O-P Glycolysis (FIG. 180) and glycolytic capacity (FIG.
  • FIG. 18P Energy map of the four conditions tested charging ATP- linked respiration versus glycolytic capacity.
  • Data information Comparisons between groups were analyzed using a Student’s unpaired t test (FIGs. 18A, B, l-K, M, N, O, P), a multiple t test (FIG. 18F), or a one-way ANOVA with Tukey’s multiple-comparisons test (FIG. 18D).
  • FIGs. 19A-L show the role of AP-1 in chromatin remodeling during obesity-driven reprogramming of macrophages.
  • FIG. 19A GO enrichment analysis of MAPK signaling-related pathways enriched in ATAC-seq data from DARs between ATMs from RD-RD versus HFD-RD mice.
  • FIG. 19B Top 10 enriched transcription factor recognition sequences in ATAC-seq peaks of ATMs from the HFD-RD group on the basis of HOMER. Transcription factors indicated with asterisks are members of the AP-1 family.
  • FIG. 19A GO enrichment analysis of MAPK signaling-related pathways enriched in ATAC-seq data from DARs between ATMs from RD-RD versus HFD-RD mice.
  • FIG. 19B Top 10 enriched transcription factor recognition sequences in ATAC-seq peaks of ATMs from the HFD-RD group on the basis of HOMER. Transcription factors indicated with asterisks are members of the AP-1 family.
  • FIG. 19C Experimental schematic in which BMDMs were stimulated with BSA or SA for 1 or 4 hours and harvested for immunoblotting or ChlP-qPCR analysis of the Tnf promoter, respectively.
  • FIG. 19D Representative immunoblots showing c-JUN and phospho-c-JUN expression in BMDMs stimulated with BSA or SA.
  • FIGs. G-L ChIP qPCR showing the enrichment of eJun (FIGs. 19G and 191), EP300 (FIGs. 19H and 19K), and H3K27ac (FIGs.
  • FIGs. 20A-U show that depletion of adipose tissue or retinal myeloid cells reverses a proinflammatory and proangiogenic phenotype in formerly obese mice and restores vision loss associated with retinal degeneration after light exposure.
  • FIG. 20A Experimental schematic of ATT in which recipient C57BL/6J mice were transplanted with eWAT fat pads at 8 weeks of age from either LysM Cre/+ or LysM Cre/+ :R26 iDTR/+ donor mice fed either RD-RD or HFD-RD. DT was administered intraperitoneally for 3 consecutive days (at week 10), followed by one additional injection at week 12.
  • FIG. 20B Representative confocal images showing IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1-stained MNPs in LysM Cre/+ ATT and LysM Cre/+ :R26 iDTR/+ ATT mice after either RD-RD or HFD-RD. Scale bar, 50 pm.
  • FIGs. 20C- D Quantification of the FITC-dextran-labeled CNV area (FIG. 20C) and the ratio of FITC/IB4 per laser burn (FIG.
  • FIG. 20E Experimental schematic in which half of the Cx3cr1 CreER/+ and Cx3cr1 CreER/+ :R26 iDTR/+ mice started a HFD at 8 weeks of age and were then switched back to a RD at 19 weeks. This experimental group is referred to as HFD-RD.
  • FIG. 20F Representative confocal images showing IB4-stained laser burns with FITC-dextran-labeled CNV and IBA1-stained MNPs in Cx3cr1 CreER/+ and Cx3cr1 CreER/+ :R26 iDTR/+ mice after either RD-RD or HFD-RD feeding. Scale bar, 50 pm.
  • FIG. 20G Quantification of area of FITC-dextran-labeled CNV (FIG. 20G) and the ratio of FITC/IB4 per laser burn
  • FIG. 20I Experimental schematic of the blue LED light exposure AMD model. After 20 weeks of diet either RD-RD or HFD-RD, C57BL/6J mice were subjected to blue LED light exposure (1500 lux for 5 days) after dark adaptation overnight at 28 weeks of age. ERG was performed 3 days before (day -3) and 3 days after (day 8) light exposure. SD-OCT was performed 1 day before light exposure (baseline), just after light exposure (day 5), and 5 days after light exposure (day 10). Mice were euthanized and eyes were collected for flatmount analysis 5 days after light exposure (day 10). FIG. 20J: Representative SD-OCT images of RD-RD and HFD-RD mice before (baseline) and after blue LED light exposure (days 5 and 10). FIG.
  • FIG. 20L Representative images of IBA1 -stained choroidal flatmounts at day 10. Scale bar, 500 pm.
  • FIGs. 20O-Q Scotopic electroretinography before (baseline) and 3 days after light exposure (day 8). Representative images are shown in FIG. 200.
  • FIGs. 20P-Q Amplitudes of the a-waves (FIG. 20P) and b-waves (FIG.
  • FIG. 20P Experimental schematic of LysM Cre/+ and LysM Cre/+ :R26 iDTR/+ mice fed either RD-RD or HFD-RD and subjected to blue LED light exposure (1500 lux for 5 days) at 28 weeks of age. DT was administered intraperitoneally for 3 consecutive days at week 27. ERG was performed 3 days after (day 8) light exposure.
  • FIGs. 20S-U Scotopic electroretinography of LysM Cre/+ or LysM Cre/+ :R26 iDTR/+ mice after receiving either RD-RD or HFD-RD. Representative images are shown in FIG. 20S.
  • FIGs. 21 A-E show that a past history of obesity does not affect absolute numbers of lesion- associated mononuclear phagocytes in the retina.
  • ITT Insulin tolerance test
  • Data information Comparisons between groups were analyzed using two-way ANOVA with Sidak’s multiple comparisons test (FIGs. 21A-C) or a Student’s unpaired t-test (FIGs. 21D-E); *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , 0.0001 ; error bars represent mean ⁇ SEM.
  • FIGs. 22A-H show the changes in the inflammatory response following adipose tissue transplantation over time.
  • FIG. 22B Schematic representation of adipose tissue transplantation (ATT) experimental set-up where C57BL/6J recipient mice are transplanted with visceral white adipose tissue fat pads at 8 weeks of life from C57BL/6J donor mice.
  • ATT adipose tissue transplantation
  • MPs were defined as CD45 + /CD11 b + /F4/80 + , Neutrophils as CD45 + /CD11 b + /Ly6G + , B cells as CD45VCD11 b7CD3s7CD19 + , and T cells as CD45+/CD11 b7CD3s + /CD19-.
  • Data information Comparisons between groups were analyzed using two-way ANOVA with Sidak’s multiple comparisons test (FIG. 22A), two-way ANOVA with Dunnett’s multiple comparisons test (FIG. 22C), or two-way ANOVA with Tukey’s multiple comparisons test (FIGs. 22D-H); *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****p ⁇ 0.0001 ; error bars represent mean ⁇ SEM.
  • FIGs. 23A-I show the effect of the weight gain-weight loss paradigm on adipose tissue.
  • FIGs. 23C-I Flow cytometry analysis of T cells in eWAT from RD-RD and HFD-RD mice.
  • FIG 23C Quantification of T cells (CD45R(B220)7CD11 b7TCR
  • FIGs. 23E-F Frequency of TNF (FIG. 23E) and IFN-y (FIG. 23F) producing CD4 + and CD8 + T cells.
  • ATMs adipose tissue macrophages
  • FIG. 23I Flow cytometry analysis of ATMs in eWAT of HFD, RD-RD and HFD- RD mice without laser-burn.
  • FIGs. 24A-J show the effect of the weight gain-weight loss paradigm on bone marrow.
  • FIG. 24G Quantification of CD45.1 + and CD45.2 + ATMs isolated from chimeric eWAT in BMT recipient mice.
  • FIGs. 24H-J Quantification of the FITC-dextran-labeled CNV area (FIG. 24H), IB4-stained laser impact area (FIG.
  • FIGs. 26A-B show the lipidomic analysis of RD-RD and HFD-RD mice.
  • Data information Comparisons between groups were analyzed using a Student’s unpaired f-test; *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 ; error bars represent mean ⁇ SEM.
  • FIGs. 27A-H show the effect of stearic acid and palmitic acid on the expression of pro- inflammatory and pro-angiogenic genes.
  • FIG. 27A Schematic representation of the experimental set-up for the in vitro stearic acid-induced immune memory model. Bone marrow-derived macrophages (BMDMs) from C57BL/6J mice were pretreated with Dimethyl Sulfoxide (DMSO) (control) or a TLR4-specific inhibitor (TAK-242) for 1 h. The cells were subsequently stimulated with bovine serum albumin (BSA) (control) or stearic acid (SA). BMDMs were harvested at the acute phase, 6 hours post stimulation.
  • DMSO Dimethyl Sulfoxide
  • TLR4-specific inhibitor TLR4-specific inhibitor
  • FIG. 27D Schematic representation of the experimental timeline for the in vitro palmitic acid-induced immune memory model.
  • BMDMs from B6 mice were pretreated with DMSO or a TLR4-specific inhibitor (TAK-242) for 1 h. They were subsequently stimulated with BSA or palmitic acid (PA).
  • FIG. 27G Schematic representation of the experimental timeline for the in vitro SA-induced immune memory model.
  • BMDMs from B6 mice were stimulated with BSA or SA for 24 hours and were cultured in medium for another 5 days before being harvested after a secondary stimulation with HMGB1 for 6 hours.
  • Data information Comparisons between groups were analyzed using a one-way ANOVA with Tukey’s multiple comparisons test (FIGs. 27B, C, E and F) or a Student’s unpaired f-test (FIG. 27H); *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 , ****p ⁇ 0.0001 ; error bars represent mean ⁇ SEM.
  • FIGs. 28A-I show the effect of the weight gain-weight loss paradigm on Tlr4 knockout mice.
  • BMDMs bone marrow-derived macrophages
  • ITT Insulin tolerance test
  • FIGs. 29A-E show Adipose tissue macrophage depletion using LysM Cre/+ :R26 iDTR/+ mice.
  • FIG. 29B Flow cytometry analysis of whole retinas and RPE-choroid-sclera complexes of LysM- and CX3CRT fluorescence expressing mice with and without CNV induction.
  • FIG. 29D Flow cytometry analysis of eWAT of LysM Cre/+ and LysM Cre/+ :R26 iDTR/+ mice.
  • Data information Comparisons between groups were analyzed using a Student’s unpaired f-test; **P ⁇ 0.01 , ****p ⁇ 0.0001 ; error bars represent mean ⁇ SEM.
  • FIGs. 30A-M show the effect of myeloid cell depletion on obesity-induced trained immunity.
  • FIG. 30A Schematic representation of experimental set-up where half of the LysM Cre/+ and LysM Cre/+ :R26 iDTR/+ mice start a high-fat diet (HFD) at 8 weeks of age and are switched back to a regular diet (RD) aged 19 weeks. This experimental group is referred to as HFD-RD. Control mice are fed a RD throughout the study period (between 8 and 30 weeks) and are referred to as RD- RD. Diphtheria toxin (DT) was administered intraperitoneally (ip) three consecutive days (at week 27) followed by one additional injection at week 29.
  • HFD-RD high-fat diet
  • mice are subjected to laser burns to induce CNV and are euthanized at week 30 and eyes are collected for analysis.
  • FIGs. 30D-G Quantification of the FITC-dextran- labeled CNV area (FIG. 30D), IB4-stained laser impact area (FIG. 30E), the ratio of FITC/IB4 per laser-burn (FIG.
  • FIGs. 30H-I Quantification of the IB4-stained laser impact area (FIG. 30H) and the number of IBA1 -positive MNPs around the laser impact area (FIG. 30G).
  • Data information Comparisons between groups were analyzed using a Student’s unpaired f-test; *P ⁇ 0.05, **P ⁇ 0.01 , ***P ⁇ 0.001 ; error bars represent mean ⁇ SEM.
  • FIGs. 31A-N show the effect of obesity-induced trained immunity on blue LED light exposure AMD model.
  • FIG. 31A Schematic representation of experimental set-up of blue LED light exposure AMD model. At 12-16 weeks of age, C57BL/6J mice were subjected to blue LED light exposure (1500 lux, 5 days) following dark adaptation overnight. ERG was performed 3 days before (Day -3) and 3 days after (Day 8) light exposure. SD-OCT was performed 1 day before light exposure (Baseline), just after (Day 5) and 5 days after exposure (Day 10). Mice were euthanized, and eyes were collected for flatmount analysis on Day 10.
  • FIGs. 31B-C Quantification of subretinal (FIG. 31 B) and choroidal (FIG.
  • FIG. 31 D Representative SD-OCT images before (Baseline) and after blue LED light exposures (Day 5 and 10).
  • ORT outer retinal thickness.
  • FIGs. 31E-F Timecourse change of total retinal thickness (FIG. 31 E) and outer retinal thickness (FIG. 31 F) at increasing distances (-1750 pm: nasal, +1750 mm: temporal) from the center of the optic disc (0 pm) in 250 pm steps.
  • FIGs. 31G-I Scotopic electroretinography before (Baseline) and 3 days after light exposures (Day 8). Representative images (FIG. 31 G). Amplitudes of the a-waves (FIG.
  • FIGs. 32A-J show that the binding of the AP-1 inhibitor T-5224 prevents binding of constituents of AP-1 to DNA.
  • FIG. 32A Representative immunoblots for c-FOS to t, p-c-JUN, c- JUNtot, IL-1/?, and ATF3 protein expression in whole lysate of THP-1 cells 15 min, 30 min, 1 h, 2h, 3h, 4h, 6h and 8h after PMA stimulation.
  • FIG. 32B Representative immunoblots for c-FOS, c- JUN, and ATF3 protein in nuclear fractions of THP-1 cells 30 min, 2h, and 6h after PMA stimulation.
  • FIG. 32C Schematic of AP-1 subunit dimerization and activation.
  • FIGs. 32D-J Bar charts for levels of c-FOS (FIG. 32D), c-JUN (FIG. 32E), JUND (FIG. 32F), JUNB (FIG. 32G), FOSB (FIG. 32H), and FRA1 (FIG. 32I) bound to the DNA in presence of an increasing concentrations of T-5224 relative to PMA positive control (FIG. 32J).
  • Curves represent doseresponse of T-5224 for each assessed constituent of AP-1. Table summarizes the IC 5 o and R 2 for each curve.
  • Statistics One-way ANOVA and Dunnett’s multiple comparisons post-hoc test. * P ⁇ 0.05, ** P ⁇ 0.01 , ***P ⁇ 0.001 ; 95% Cl. Each n represents technical replicate.
  • FIGs. 33A-J show that AP-1 inhibition prevents c-JUN/cFOS dimerization and neuroinflammation.
  • FIG. 33A Schematic of experimental paradigm for of AP-1 activation with PMA and repression with the AP-1 inhibitor T-5224 in THP-1 cells.
  • FIG. 33B Representative immunoblot of c-JUN protein in whole lysate after PMA stimulation (+/- T-5224).
  • FIG. 33C Schematic of experimental paradigm in vivo.
  • FIGs. 33D-E Immunoblot of c-JUN, c-FOS and ATF3 proteins from nuclear extracts from liver, immunoprecipitated with c-JUN (FIG. 33D) or c- FOS (FIG. 33E).
  • FIG. 33A Schematic of experimental paradigm for of AP-1 activation with PMA and repression with the AP-1 inhibitor T-5224 in THP-1 cells.
  • FIG. 33B Representative immunoblot of c-JUN protein in whole lysate
  • FIGs. 33G-H Representative immunoblot of immunoprecipitation of c-JUN protein (nuclear) with c-FOS 1 h after LPS injection. Proteins were extracted from liver (FIG. 33G) and brain (FIG. 33H) of mice pre-treated with T-5224 at 300-0.0003 mg/kg or DMSO (Omg/kg).
  • FIGs. 33I-J Bar charts of 116, H1b, and Ccl2 transcripts in brain extracts following LPS-induced inflammation (mechanism engagement) (FIG. 331) and plotted in (FIG. 33J). Table summarizes IC 5 o values and R 2 for each curve.
  • FIGs. 34A-D show that oral administration of T-5224 prevents retinal degeneration in a light- induced model of retinal degeneration (in immune-trained animals).
  • FIG. 34A Experimental design for mice subjected to a blue light challenge. Mice were either naive (injected with PBS for 4 consecutive days) or immune-trained (injected with LPS 0.5 mg/kg for 4 consecutive days). At week 11 , mice were subjected to blue light exposure for 5 days (DO to D5) and administered either vehicle or T-5224 at 3 mg/kg for 9 days (DO to D9). Subsequently, they were evaluated by OCT (D10 and D17).
  • FIG. 34B Scatter plot showing similar weights in drug-treated and control mice after 9 days of T-5224.
  • FIG. 34C Representative infrared (IR) fundus image of mouse retina and Optical Coherence Tomography (OCT) sections of immune-trained mice exposed to blue light and treated with either vehicle or drug-treated demonstrate protective effect of T-5224 on bluelight exposure.
  • FIG. 34D Scatter plots of total retinal thickness and outer retinal thickness at D10 (left) and on D17 (right) reveal statistically significant retinal protection following T-5224 treatment in immune-trained mice. Inner limiting membrane (ILM), external limiting membrane (ELM), and Bruch's membrane (BM).
  • FIGs. 35A-H depict the chemical structures of SP100030 and analogs thereof (FIG. 35A), SPC-839 and analogs thereof (FIG. 35B), T-5224 and analogs thereof (FIG.
  • the term “about” has its ordinary meaning.
  • the term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% of the recited values (or range of values).
  • the present disclosure also provides a method for preventing or treating pathological retinal angiogenesis or neovascularization in a subject comprising administering to the subject an effective amount of an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein.
  • the present disclosure also provides the use of an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein for preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • the present disclosure also provides the use of an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein for the manufacture of a medicament for preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • the present disclosure also provides an agent that inhibits the expression and/or activity of an AP-1 and/or ATF3 protein for use in preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • pathological retinal inflammation refers to chronic parainflammation associated with recruitment of overly activated immune cells (such as phagocytes) and dysregulated complement system in the retinal epithelium or subretinal tissue.
  • Pathological (abnormal) retinal inflammation occurs in several ocular diseases including age-related macular degeneration (AMD) (dry form or early AMD), diabetic retinopathy, retinal vein occlusion and retinitis pigmentosa.
  • AMD age-related macular degeneration
  • AMD diabetic retinopathy
  • retinal vein occlusion retinal vein occlusion
  • retinitis pigmentosa retinitis pigmentosa.
  • pathological retinal angiogenesis or neovascularization refers to the formation of new dysfunctional and leaky blood vessels into the retinal epithelium or subretinal tissue, which then leads to the accumulation of fluid and blood.
  • the pathological retinal angiogenesis or neovascularization is pathological choroidal neovascularization.
  • Pathological (abnormal) retinal neovascularization typically leads to hemorrhage, retinal edema, fibrosis, and irreversible damages to the retinal tissue. It is a hallmark pathological process of numerous ocular diseases (sometimes referred to as “neovascular retinopathies”) such as proliferative diabetic retinopathy, AMD (wet form or late AMD), ischemic retinal vein occlusion, and retinopathy of prematurity. These diseases collectively comprise the most common causes of blindness and affect millions of people from infants to the elderly.
  • the present disclosure also provides a method for preventing or treating pathological retinal angiogenesis or neovascularization in a subject comprising administering to the subject an effective amount of an agent that inhibits the activity of a fatty acid, such as stearic acid and/or palmitic acid, on Toll-like receptor 4 (TLR4).
  • TLR4 Toll-like receptor 4
  • the present disclosure also provides the use of an agent that inhibits the activity of stearic acid on TLR4 for preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • the present disclosure also provides the use of an agent that inhibits the activity of stearic acid on TLR4 for the manufacture of a medicament for preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • the present disclosure also provides an agent that inhibits the activity of stearic acid on TLR4 for use in preventing or treating pathological retinal angiogenesis or neovascularization in a subject.
  • the present disclosure provides a method for (a) reducing the expression of angiogenesis-related genes (e.g., VEGF, COL3A1 , POSTN, and PDGFB) and/or (b) increasing the expression of pro-inflammatory genes (e.g., IL-1 p, IL-16, and TNF) in retina-resident myeloid cells comprising contacting the cells with an agent that inhibits the expression and/or activity of ATF3.
  • angiogenesis-related genes e.g., VEGF, COL3A1 , POSTN, and PDGFB
  • pro-inflammatory genes e.g., IL-1 p, IL-16, and TNF
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an ATF3 protein for (a) reducing the expression of angiogenesis- related genes (e.g., VEGF, COL3A1 , POSTN, and PDGFB) and/or (b) increasing the expression of pro-inflammatory genes (e.g., IL-1 p, IL-16, and TNF) in retina-resident myeloid cells.
  • angiogenesis- related genes e.g., VEGF, COL3A1 , POSTN, and PDGFB
  • pro-inflammatory genes e.g., IL-1 p, IL-16, and TNF
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an ATF3 protein for the manufacture of a medicament for (a) reducing the expression of angiogenesis-related genes (e.g., VEGF, COL3A1 , POSTN, and PDGFB) and/or (b) increasing the expression of pro-inflammatory genes (e.g., IL-1 p, IL-16, and TNF) in retina-resident myeloid cells.
  • angiogenesis-related genes e.g., VEGF, COL3A1 , POSTN, and PDGFB
  • pro-inflammatory genes e.g., IL-1 p, IL-16, and TNF
  • the present disclosure provides an agent that inhibits the expression and/or activity of an ATF3 protein for use in (a) reducing the expression of angiogenesis-related genes (e.g., VEGF, COL3A1 , POSTN, and PDGFB) and/or (b) increasing the expression of pro- inflammatory genes (e.g., IL-1 p, IL-16, and TNF) in retina-resident myeloid cells.
  • angiogenesis-related genes e.g., VEGF, COL3A1 , POSTN, and PDGFB
  • pro- inflammatory genes e.g., IL-1 p, IL-16, and TNF
  • the present disclosure provides a method for reducing the expression of angiogenesis-related genes and/or pro-inflammatory genes (e.g., IL-i p, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB) in adipose tissue macrophages (ATMs) comprising contacting the ATMs with an agent that inhibits the expression and/or activity of an AP-1 complex.
  • angiogenesis-related genes and/or pro-inflammatory genes e.g., IL-i p, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB
  • ATMs adipose tissue macrophages
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an AP-1 complex for reducing the expression of angiogenesis-related genes and/or pro-inflammatory genes (e.g., IL-1 p, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB) in adipose tissue macrophages (ATMs).
  • angiogenesis-related genes and/or pro-inflammatory genes e.g., IL-1 p, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB
  • ATMs adipose tissue macrophages
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an ATF3 protein for the manufacture of a medicament for reducing the expression of angiogenesis-related genes and/or pro-inflammatory genes (e.g., IL-1 , NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB) in adipose tissue macrophages (ATMs).
  • angiogenesis-related genes and/or pro-inflammatory genes e.g., IL-1 , NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB
  • ATMs adipose tissue macrophages
  • the present disclosure provides an agent that inhibits the expression and/or activity of an ATF3 protein for use in reducing the expression of angiogenesis-related genes and/or pro-inflammatory genes (e.g., IL-10, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB) in adipose tissue macrophages (ATMs).
  • angiogenesis-related genes and/or pro-inflammatory genes e.g., IL-10, NF-KB1 , TNFAIP3, VEGFA, ANGPT1 , and PDGFB
  • ATMs adipose tissue macrophages
  • the present disclosure provides a method for reducing angiogenesis in the retina of a subject comprising contacting the retina with an agent that inhibits the expression and/or activity of an ATF3 protein.
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an ATF3 protein for reducing angiogenesis in the retina of a subject.
  • the present disclosure provides the use of an agent that inhibits the expression and/or activity of an ATF3 protein for the manufacture of a medicament for reducing angiogenesis in the retina of a subject.
  • the present disclosure provides an agent that inhibits the expression and/or activity of an ATF3 protein for use in reducing angiogenesis in the retina of a subject.
  • the AP-1 family of transcription factors is composed of homodimers and heterodimers of Jun (v-Jun, c-Jun, JunB, and JunD), Fos (v-Fos, c-Fos, FosB, Fra1 , and Fra2), ATF (ATF2, ATF3/LRF1 , B-ATF, JDP1 , and JDP2), and MAF (c-Maf, MafB, MafA, MafG/F/K, and Nrl) protein families.
  • the AP-1 complex comprises c-Jun. In an embodiment, the AP-1 complex comprises c-Fos. In an embodiment, the AP-1 complex comprises Fra1. In an embodiment, the AP-1 complex comprises Fra2. In an embodiment, the AP-1 complex comprises JunB. In an embodiment, the AP-1 complex comprises B-ATF.
  • ATF3 is a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors.
  • ATF3 binds cAMP response element (CRE) (consensus: 5'-GTGACGT[AC][AG]-3', SEQ ID NO:1), and can act as either a transcriptional activator or repressor.
  • CRE cAMP response element
  • agents that inhibit the expression and/or activity of AP-1 and/or ATF3 include i) antibodies, antibody fragments and other binding molecules (e.g., aptamers, peptides, dominant-negative) specific for AP-1 or ATF3 capable of blocking their transcriptional activity; ii) RNA interference (RNAi) agents (siRNA, shRNA, miRNA, antisense oligonucleotides) specific for AP-1 or ATF3 transcripts (mRNA) capable of reducing AP-1 or ATF3 levels and iii) small molecules that block the transcriptional activity of AP-1 or ATF3.
  • RNAi RNA interference
  • shRNA shRNA, miRNA, antisense oligonucleotides
  • Such agents may either bind directly to AP-1 or ATF3, or bind to the DNA motif(s) recognized AP-1 or ATF3 (thereby competing with AP-1 or ATF3). Such agents may inhibit or reduce the phosphorylation of AP-1 (e.g., c-Jun) or ATF3.
  • Antibodies antigen-binding fragments and binding molecules
  • the agent that inhibits the activity of AP-1 is an anti-AP-1 antibody or an antigen-binding fragment thereof.
  • antibody or antigen-binding fragment thereof refers to any type of antibody/antibody fragment including monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, humanized antibodies, CDR-grafted antibodies, chimeric antibodies and antibody fragments so long as they exhibit the desired antigenic specificity/binding activity.
  • Antibody fragments comprise a portion of a full-length antibody, generally an antigen binding or variable region thereof.
  • antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules (e.g., single-chain FV, scFV), single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments.
  • Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, V H regions (V H , V H -V H ), anticalins, PepBodies, antibody-T- cell epitope fusions (Troybodies) or Peptibodies.
  • the anti-AP-1 antibody or an antigen-binding fragment thereof binds to an AP-1 complex monomer (Jun, Fos, ATF and/or MAF) and blocks the homo- or heterodimerization of the AP-1 complex.
  • the anti-AP-1 antibody or an antigenbinding fragment thereof inhibits the binding of AP-1 to its target sequence on the DNA, for example by specifically binding to the basic leucine zipper (bZIP) DNA-binding domain.
  • the agent that inhibits the activity of AP-1 is an aptamer, i.e., a short nucleic acid or peptide molecule that specifically binds to AP-1 .
  • the agent that inhibits the activity of AP-1 is a dominant-negative form of an AP-1 complex monomer, for example a dominant-negative form that lacks a transactivation domain.
  • a dominant-negative form dimerizes with native AP-1 complexes but yield low-activity dimers.
  • the dominant-negative form is a dominant-negative form of c-Jun, in a further embodiment the dominant-negative form is TAM67 that lacks the transactivation domain of c-Jun (amino acids 1-122).
  • the agent that inhibits the activity of AP-1 is a peptide that inhibits the homo- or hetero-dimerization of the AP-1 complex.
  • peptides include the c-Jun peptide of the sequence ILKQSMTLNLADPVGSLKPHLRAKN (SEQ ID NO:2).
  • the agent that inhibits the activity of ATF3 is an anti-ATF3 antibody or an antigen-binding fragment thereof.
  • the anti-ATF3 antibody or an antigenbinding fragment thereof blocks the dimerization of the ATF3 protein.
  • the anti-ATF3 antibody or an antigen-binding fragment thereof inhibits the binding of ATF3 to its target sequence on the DNA, for example by specifically binding to the basic leucine zipper (bZIP) DNA- binding domain.
  • bZIP basic leucine zipper
  • the agent that inhibits the activity of ATF3 is a dominant-negative form of AFT3, i.e., a form that competes with native ATF3 but that does not have the any effect on transcription.
  • the agent that inhibits the activity of ATF3 is a peptide that inhibits the dimerization of the ATF protein.
  • peptides include that inhibits the activity of ATF3 include peptides comprising or consisting of one of the following sequences: AESPLTNRGWNP (SEQ ID NO:3), MLDTNIQSRPNL (SEQ ID NO:4), TLGLRPVPVATT (SEQ ID NO:5) or VLNIPEHFTAQN (SEQ ID NO:6) (see EP3845551A1).
  • RNA interference (RNAi) agents RNA interference (RNAi) agents
  • the agent that inhibits the activity of AP-1 is an RNAi agent, e.g., a siRNA, shRNA, miRNA, or antisense oligonucleotide, specific for AP-1 mRNA.
  • RNAi agent e.g., a siRNA, shRNA, miRNA, or antisense oligonucleotide, specific for AP-1 mRNA.
  • the skilled person would be able to design RNAi agents capable of specifically binding to the transcripts encoding proteins forming AP-1 complexes and inducing their degradation.
  • RNAi agents specific for AP-1 mRNA examples include siRNAs commercialized by SignalSilence® (Cat. No. 6203S), Santa Cruz Biotechnology, Inc. (Cat. No. sc-29223), ThermoFisher Scientific (siRNA ID 106741 , 115273, 115274 or 145018), siRNA of the sequence CGGGAGGCAUCUUAAUUAATT (SEQ ID NO:66) (Xiao H et al. Mol Genet Genomic Med. 2020;8(1):e1047), miR-155 and miR-125b.
  • the agent that inhibits the activity of ATF3 is an RNAi agent, e.g., a siRNA, shRNA, miRNA, or antisense oligonucleotide, specific for an ATF3 transcript (mRNA).
  • RNAi agent e.g., a siRNA, shRNA, miRNA, or antisense oligonucleotide, specific for an ATF3 transcript (mRNA).
  • mRNA ATF3 transcript
  • RNAi agents specific for an ATF3 mRNA examples include siRNAs commercialized by Santa Cruz Biotechnology, Inc. (Cat. No. sc-29757), ThermoFisher Scientific (siRNA ID 106536, 115224, 115225 or 147205), Applied Biological Materials Inc. (Cat. No. 1260909) and Abbexa (Cat. No.
  • miRNAs such as miRNA-494, miR-27a-3p, and miR-488
  • an antisense oligonucleotide having the following sense AAAACTAGGCAATGTACTCTTCC, (SEQ ID NO:7) and antisense (GGAAGAGTACATTGCCTAGTTTT, SEQ ID NO:8) (Ishiguro etal., Jpn. J. Cancer Res. 91 , 833-836).
  • the agent that inhibits the activity of AP-1 is a small molecule.
  • Examples of small molecules that inhibit AP-1 complexes include SP100030 and analogs thereof (FIG. 35A), SPC-839 and analogs thereof (FIG. 35B), T-5224 and analogs thereof (FIG. 35C), K1115A and analogs thereof (FIG. 35E), curcumin and analogs thereof (FIG. 35E), Momordin I and analogs thereof (FIG. 35D), isosteviol and analogs thereof (FIG. 35F), nagilactone and inumakilactone and analogs thereof (FIG. 35G), Citrifolinin A and analogs thereof (FIG. 35F) (Ye et al., Small Molecule Inhibitors Targeting Activator Protein 1 (AP-1), J. Med. Chem. 2014, 57, 16, 6930-6948).
  • Another small molecule inhibitor of AP-1 is SR 11302
  • inhibitors of AP-1 include SP600125, Doxycycline, Glaucarubinone, and XR5944:
  • the agent that inhibits the activity of AP-1 is any of the compounds disclosed above and/or in FIGs. 35A-H.
  • the agent that inhibits the activity of AP-1 is T-5224 or an analog thereof.
  • the agent that inhibits the activity of ATF3 is a small molecule.
  • the AP-1 and ATF3 inhibitors of the present disclosure can be administered to a human subject by themselves or in pharmaceutical compositions where they are mixed with suitable carriers or excipient(s) at doses to treat or prevent pathological retinal inflammation, angiogenesis and associated symptoms. Mixtures of these compounds can also be administered to the subject as a simple mixture or in suitable formulated pharmaceutical compositions.
  • a therapeutically effective dose further refers to that amount of the compound or compounds sufficient to result in the prevention or treatment of pathological retinal inflammation, angiogenesis and/or associated symptoms (spotted or blurry vision, hyperpermeability, edema, retinal swelling, and/or blood retinal barrier leakage).
  • compositions for use in accordance with the present disclosure thus may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
  • the agents of the disclosure may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers suitable for ocular administration well known in the art.
  • the compounds may be formulated for ocular administration, e.g., eye drops or ocular injections (e.g., intravitreal injections).
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Liposomes and emulsions are well known examples of delivery vehicles or carriers for hydrophobic drugs.
  • Pharmaceutical compounds may also be delivered using ocular implants, which are devices that penetrate the sclera or reside within the deeper ocular structures to deliver drugs for an extended period.
  • one may administer the compounds in a targeted drug delivery system for example, in a liposome coated with a cell-specific antibody or other delivery system (e.g., to target for example a specific tissue (e.g., brain, eye) or cell type (e.g., microglia or macrophages, retinaresident myeloid cells, ATMs)).
  • a cell-specific antibody or other delivery system e.g., to target for example a specific tissue (e.g., brain, eye) or cell type (e.g., microglia or macrophages, retinaresident myeloid cells, ATMs)).
  • Nanosystems and emulsions are additional well known examples of delivery vehicles or carriers for drugs.
  • compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • Compositions comprising the AP- 1 and ATF3 inhibitors of the present disclosure formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition. Suitable conditions indicated on the label may include the prevention and treatment of pathological retinal inflammation or angiogenesis (e.g., retinopathies such as macular edema, diabetic macular edema and age-related macular edema, retinal vascular hyperpermeability, blood retinal barrier leakage or the like).
  • pathological retinal inflammation or angiogenesis e.g., retinopathies such as macular edema, diabetic macular edema and age-related macular edema, retinal vascular hyperpermeability, blood retinal barrier leakage or the like.
  • the subject treated with or administered with the AP-1 and/or ATF3 inhibitor suffers from an inflammatory and/or a neovascular retinopathy.
  • the inflammatory and/or neovascular retinopathy is proliferative diabetic retinopathy, age-related macular degeneration (AMD, dry and wet forms), ischemic retinal vein occlusion, retinitis pigmentosa, or retinopathy of prematurity.
  • AMD age-related macular degeneration
  • ischemic retinal vein occlusion ischemic retinal vein occlusion
  • retinitis pigmentosa or retinopathy of prematurity.
  • the methods and uses herein are for the treatment of early AMD, intermediate AMD, dry AMD, geographic atrophy and variants of AMD.
  • the subject treated with or administered with the AP-1 and/or ATF3 inhibitor is an obese subject or has a past history of obesity.
  • the subject treated with or administered with the AP-1 and/or ATF3 inhibitor is infected with or has a past history of infection with an endotoxin-producing bacterium (e.g., LPS-producing bacterium).
  • an endotoxin-producing bacterium e.g., LPS-producing bacterium
  • the present disclosure also provides the use of AP-1 and/or ATF3 as targets in screening assays used to identify compounds that are useful for the prevention or treatment pathological retinal angiogenesis.
  • the present disclosure provides a method for identifying a compound that may be useful for the prevention or treatment pathological retinal angiogenesis, the method comprising determining whether a test compound reduces or inhibits AP-1 and/or ATF3 expression and/or activity, wherein a reduction or inhibition of AP-1 and/or ATF3 expression and/or activity is indicative that the test compound may be useful for the prevention or treatment pathological retinal angiogenesis.
  • the method comprises measuring AP-1 and/or ATF3 expression and/or activity in the presence and absence of the test compound, wherein a lower expression and/or activity in the presence of the test compound relative to the absence thereof is indicative that the test compound may be useful for the prevention or treatment of pathological retinal angiogenesis.
  • the method comprises contacting a cell, such as a retinal cell or immune cell, with the test compound.
  • a reporter assay-based method of selecting agents which modulate AP-1 and/or ATF3 expression includes providing a cell comprising a nucleic acid sequence comprising a transcriptional regulatory sequence that is bound by AP-1 and/or ATF3 (e.g., comprising a cAMP and/or TPA response element) operably- linked to a suitable reporter gene.
  • the cell is then exposed to a test/candidate compound and the transcription efficiency is measured by the activity of the reporter gene.
  • the activity can then be compared to the activity of the reporter gene in cells unexposed to the test/candidate compound.
  • Suitable reporter genes include but are not limited to beta(P)-D-galactosidase, luciferase, chloramphenicol acetyltransferase and green fluorescent protein (GFP).
  • the method is an in vitro method.
  • the assay systems used to perform the screening method may comprise a variety of means to enable and optimize useful assay conditions.
  • Such means may include but are not limited to: suitable buffer solutions, for example, for the control of pH and ionic strength and to provide any necessary components for optimal AP-1 and/or ATF3 activity and stability (e.g., protease inhibitors), temperature control means for optimal AP-1 and/or ATF3 activity and or stability, and detection means to enable the detection of the AP-1 and/or ATF3 expression and/or activity.
  • a variety of such detection means may be used, including but not limited to one or a combination of the following: radiolabelling (e.g., 32 P, 14 C, 3 H), antibody-based detection, fluorescence, chemiluminescence, spectroscopic methods (e.g., generation of a product with altered spectroscopic properties), various reporter enzymes or proteins (e.g., horseradish peroxidase, green fluorescent protein), specific binding reagents (e.g., biotin/streptavidin), and others.
  • radiolabelling e.g., 32 P, 14 C, 3 H
  • antibody-based detection e.g., fluorescence, chemiluminescence
  • spectroscopic methods e.g., generation of a product with altered spectroscopic properties
  • reporter enzymes or proteins e.g., horseradish peroxidase, green fluorescent protein
  • specific binding reagents e.g., biotin/streptavidin
  • the above-noted assays may be applied to a single test compound or to a plurality or "library" of such compounds (e.g., a combinatorial library). Any such compound may be utilized as lead compound and further modified to improve its therapeutic, prophylactic and/or pharmacological properties for the prevention and treatment of pathological retinal angiogenesis.
  • mice Animals were housed in the animal facility of the Hospital Maisonneuve-Rosemont Research Center under a 12h light/dark cycle with ad libitum access to food and water unless indicated otherwise. Only male mice were used in this study, and were enrolled in the different studies at 6 to 8 weeks of age.
  • C57BI/6J as well as homozygous B6.129S7-Rag1 tm1 Mom/J referred as Rag and B6.B10ScN-Tlr4 ps rJe JthJ (referred as Tlr4 mice) were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and bred at the Hospital Maisonneuve-Rosemont Research Center animal facility.
  • CX3CR1 CreER Homozygous B6.129P2(C)-Cx3cr1 tm21 ⁇ cre/ERT2>Jun P/J mice were crossed in-house with homozygous C57BL/6- Gt(ROSA)26Sor tm1 ⁇ HBEGF > Awa 7J (referred as R20 DTR ) mice to obtain heterozygous CX3CR1 CreER/+ :R26' DTR/+ mice.
  • Homozygous B6.129P-Cx3cr1 tm1L ’ tt /J (referred as CX3CR1 GFP mice) were crossed in-house with C56BI/6J mice to obtain heterozygous CX3CR1 GFP/+ mice.
  • Homozygous B6.Cg- Gt(ROSA)26Sor tm3 ⁇ CAG - EYFP)Hze /J (referred as Ai3 EYFP mice) were crossed in-house with homozygous LysM Cre to obtain heterozygous LysM Cre/+ :AI3 EYFP/+ .
  • mice Myeloid cells depletion. Microglia depletion was performed using CX3CR1 CreER/+ :R26' DTR/+ or LysM Cre/+ :R26' DTR/+ mice. In CX3CR1 CreER/+ :R26' DTR/+ mice, the activation of Cre recombinase (under the control of the Cx3cr1 promoter) can be induced by tamoxifen treatment and leads to surface expression of DTR on CX3CR1 -expressing cells. At 24 weeks of age, mice were subjected to daily intraperitoneal injections with tamoxifen diluted in corn oil (4 mg per mouse per day, stock solution at 20 mg/ml) for 3 consecutive days.
  • Bone marrow monocyte isolation Primary monocytes were isolated from bone marrow of mice. After red blood cell (RBC) lysis using RBC Lysis buffer (Cat# 00-4333-57; eBioscience), the cell pellet was resuspended into isolation buffer (PBS containing 2% FBS and 1 mM EDTA). Monocytes were isolated from the resuspended cell solution using an EasySepTM Mouse Monocyte Isolation Kit (EasySepTM Mouse Monocyte Isolation Kit, STEMCELL Technologies, Cat#19861) according to manufacturer’s instructions. Isolated monocytes were resuspended into EGM-2 medium and used for choroidal sprouting assays. Primary bone marrow-derived macrophages.
  • Donor mice were euthanized, and leg bones were dissected. Femur and tibia cavities were flushed with PBS supplemented with 10% FBS using a syringe, resuspended and passed through a 70pm strainer. Red blood cells were removed using RBC Lysis buffer (Cat# 00-4333-57; eBioscience). After centrifugation, bone marrow cells were recovered and cultivated in DMEM supplemented with 10% FBS and antibiotics. Macrophage colony-stimulating factor (M-CSF) (20 ng/ml, Cat# PMC2044; Invitrogen) was used to select positively monocytes and differentiate them into macrophages.
  • M-CSF Macrophage colony-stimulating factor
  • mice were fed with either a high fat diet (HFD; 60% kcal fat) or a regular diet (RD; 10% kcal fat) to study weight gain experimentally. Time-course of the diet feeding is indicated when appropriate, and mice weight was regularly monitored. Upon sacrifice, the weight of the epididymal visceral white adipose tissue (eWAT) fat pads was evaluated.
  • HFD high fat diet
  • RD regular diet
  • eWAT epididymal visceral white adipose tissue
  • CNV Laser-induced choroidal neovascularization
  • mice 14 days after choroidal neovascularization (CNV) induction, mice were anesthetized with isoflurane gas and intracardially perfused with 0.5 mL of fluorescein isothiocyanate (FITC)-dextran (average mw: 2000000).
  • FITC-dextran was left in circulation for 5 minutes under anesthesia and afterwards the animal was sacrificed and the eye globes were enucleated and fixed in PFA 4% at room temperature for 30 minutes.
  • RPE-choroid- sclera complex was dissected and separated from the neuroretina.
  • Tissue was incubated for 1 hour in a blocking solution (3% BSA +0,3% Triton X-100) and was followed by an overnight incubation with antibodies.
  • Blood vessels were investigated using rhodamine-labeled Griffonia (bandeiraea) Simplicifolia Isolectin I (1 :100) whereas mononuclear phagocytes were detected with IBA1 (1 :350). After several washes with PBS, RPE-choroid-sclera complexes were incubated with secondary fluorochrome-conjugated species-appropriate antibodies for 1 hour.
  • the tissue was then mounted onto a glass slide and imaged using Olympus FluoView FV1000 laser scanning confocal inverted microscope (Olympus Canada, Richmond Hill, ON). For analysis, the Z-stacks were compressed into one image.
  • the area of neovascularization (FITC-dextran positive) and the burn area (Isolectin positive), as well as the number of mononuclear phagocytes (IBA1 positive) were quantified using Imaged software (Version 1.0; U. S. National Institutes of Health, Bethesda, Maryland, USA).
  • Serum cytokine profiling Mouse blood was obtained by cardiac puncture and serum was collected after centrifugation and preserved at -80°C until analysis. Cytokine concentration for IL1 p, IL2, IL6, IL10, IL12, IFNy and TNF were measured using the Bio-Plex Pro Mouse Cytokine Th1 Panel according to manufacturer instructions (Cat# L6000004C6; Bio-Rad). Cytokine levels are expressed as per total pg/ml.
  • Plasma phospholipid fatty acids profiling Mouse blood was collected by cardiac puncture and plasma was obtained after centrifugation and preserved at -80°C until analysis. Phospholipid free fatty acid content was evaluated using Gas Chromatography - Mass Spectrometry (GS-MS) as described previously (A65). In brief, total lipids were extracted with a mixture of methyl-tert- butyl ether, methanol, and water. Phospholipids were eluted on an aminopropyl column (Bond Elut LRC-NH 2 , 500 mg) (Agilent Technologies).
  • the free fatty acids (FAs) were analyzed as methyl esters after a direct transesterification with acetyl chloride/methanol on a 7890B gas chromatograph coupled to a 5977A Mass Selective Detector (Agilent Technologies) equipped with a capillary column (J&W Select FAME CP7420; 100 m x 250 m inner diameter; Agilent Technologies) and operated in the PCI (Positive Chemical Ionization) mode using ammonia as the reagent gas.
  • FAME CP7420 J&W Select FAME CP7420; 100 m x 250 m inner diameter; Agilent Technologies
  • RNA extraction was performed using TRIzol reagent (Cat# 15596026; Invitrogen) and digested with DNase I (Sigma Aldrich; Cat# D4527) following manufacturer instructions to avoid genomic DNA amplification.
  • Reverse transcription was possible using a 5X All-In-One RT MasterMix (Cat# G590; Applied Biological Materials Inc.), and gene expression was analyzed using Bright Green2X qPCR Master Mix-Low Rox in an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).
  • ChlP-qPCR experiments were performed using the iDealTM ChlP-seq kit for Histones (Diagenode, Basil, Belgium, Cat# C01010051) following the manufacturer’s protocol. Specifically, 5*10 6 bone marrow-derived macrophages were treated with 5% fatty acid free BSA, or 200 pM stearic acid for 6 h. Cells were then fixed with 1% formaldehyde for 8 min to crosslink chromatin.
  • Chromatin samples were sheared by 10 cycles 30 s ON and 30 s OFF with the BioruptorTM Pico sonicator (Diagenode, USA) and 1% samples derived from 1 xio 6 cells were kept for input measurements. Chromatin was immunoprecipitated using antibodies to c-Jun (Cat# 9165, Cell Signaling), P300 (Cat# MAI- 16622, Invitrogen), Histone 3K27ac (H3K27ac, Cat# ab4729, Abeam), or using 1 pg rabbit IgG from the kit as a negative control.
  • Table 2 Primer sequences used for ChlP-qPCR.
  • FACS Fluorescence-Activated Cell Sorting
  • Fluorescence-activated cell sorting was performed on a BD LSR FortessaTM X-20 cell analyzer, and data was analyzed using FlowJo software (Version 10.2; FlowJo, Ashland, OR, USA). Fluorescence-Activated Cell Sorting (FACS) on Adipose tissue macrophages (ATMs). eWAT fat pads were freshly dissected, homogenized using scissors and incubated in a solution containing 1 mg/ml Collagenase Type II (Cat# C6885, Sigma-Aldrich) during 45 min at 37°C. EDTA (10 mM) was used to stop the digestion and the sample was incubated 5 extra minutes at room temperature.
  • FACS Fluorescence-activated cell sorting
  • adipocyte suspension was filtered through a 100pm strainer and centrifuged at 500*g for 10 min at 4°C to separate the mature adipocytes from the stromal vascular fraction (SVF). Mature adipocytes and supernatant were discarded, and the SVF-containing pellet was resuspended with RBC lysis buffer (Cat# 00-4333-57; eBioscience) to remove red blood cells. After centrifugation, SVF cells were counted and resuspended in PBS+3% FBS. Viability of the cells was checked by Zombie Aqua (Cat# 423101 : Biolegend) staining for 15 min at room temperature.
  • Zombie Aqua Cat# 423101 : Biolegend
  • FACS Fluorescence-Activated Cell Sorting
  • Fluorescence-activated cell sorting was performed on a BD LSR FortessaTM X-20 cell analyzer, and data were analyzed using FlowJo software (Version 10.2; FlowJo, Ashland, OR, USA).
  • FACS Fluorescence-Activated Cell Sorting
  • Fluorescence-activated cell sorting was performed on a BD LSR FortessaTM X-20 cell analyzer, and data were analyzed using FlowJo software (Version 10.2; FlowJo, Ashland, OR, USA). Monocytes were gated as CD115 + CD11 b + Ly6C + CD45.2 + Ly6G population.
  • ATMs Adipose tissue macrophages (ATMs) cell sorting.
  • ATMs were stained with the antibodies mentioned above (except for CD206 and CD38 antibodies) and FACS-sorted from the stromal vascular fraction (SVF) of eWAT.
  • SVF stromal vascular fraction
  • Viable Ly6G7CD45.2 + /CD11 b + /CD64 + /F4/80 + cells were sorted using a FACS Aria instrument (BD Biosciences, Mississauga, ON, Canada) and recovered in FBS. After sorting, sorted ATMs immediately proceeded to ATAC-seq sample preparation mentioned later.
  • eWAT depots were dissected and fixed with 10% formalin overnight. Following standardized histological procedures, tissues were dehydrated, embedded in paraffin and posteriorly cut in 12pm thick sections. eWAT sections were then deparaffinized and rehydrated with decreasing concentrations of ethanol and stained with Harris hematoxylin and eosin (H&E). Followinged by dehydration and mounting with PERTEX (HistoLab Products AB) for the visualization of cellular components. DIC images were acquired at 20X using a Zeiss AxioObserver.ZI (Live cell Zeiss imaging system, Zeiss, Jena, Germany). Adipocyte size was evaluated and quantified using a custom-made program at MATLAB R2019b (9.7.0.1190202, The MathWorks, Inc).
  • GTT Glucose Tolerance Test
  • ITT Insulin Tolerance Test
  • Adipose tissue transplantation 8-week-old recipient mice were randomly assigned to the different groups independently of the origin of the donor eWAT. Donor mice were anesthetized, sacrificed, and their eWAT fat pads were carefully excised and weighted. The recipient mice were anesthetized with isoflurane and subjected to multiple dorsal incisions (4 to 6 incisions) to allow subcutaneous engraftment of the same amount ( ⁇ 500 mg) of donor eWAT. Sham surgeries of control animals were performed in the same manner, but without fat pad transplantation. Mice were closely monitored for three weeks before performing laser-induced choroidal neovascularization. Successful engraftment of the transplantation was verified by evaluating the transplanted tissue (e.g., blood vessel reperfusion, lack of necrosis) 14 days after laser-induced choroidal neovascularization.
  • transplanted tissue e.g., blood vessel reperfusion, lack of necrosis
  • ATAC-Sequencing sample preparation FACS-sorted ATMs were used for ATAC-seq and nuclei were isolated as previously described (A69). Briefly, isolated cells were centrifuged at 500xg for 5 min at 4°C and then resuspended in ice-cold PBS+0.04% BSA. The cell lysis was performed for 5 minutes on ice by adding 45 pl lysis buffer (10 mM Tris-HCI, pH 7.4, 10 mM NaCI, 3 mM MgCI 2 , 0.1% Tween TM -20, 0.1% NonidetTM P-40, 0.001% Digitonin, and 1% BSA).
  • 45 pl lysis buffer 10 mM Tris-HCI, pH 7.4, 10 mM NaCI, 3 mM MgCI 2 , 0.1% Tween TM -20, 0.1% NonidetTM P-40, 0.001% Digitonin, and 1% BSA).
  • the libraries were recovered from PCR by purification followed by size selection (180 bp to 750 bp) with KARA Pure Beads and were paired-end sequenced on Illumina (NovaSeq6000 flowcell SP -PE50). Tn5 tagmentation, DNA purification, library preparation, and bioinformatic analysis were performed at the Genomics Platform of the Institut de Recherches Cliniques de Montreal. Sequencing reaction was performed at the sequencing platform of Centre d'expertise et de services Genome Quebec. scATAC-Sequencing sample preparation. FACS-sorted GFP+ cells from CX3CR1GFP/+ mice were used for scATAC-seq and nuclei isolation was performed according to the protocol of 10x Genomics.
  • isolated cells were centrifuged at 300 x g for 5 min at 4°C and then resuspended in ice-cold PBS+0.04% BSA.
  • the cell lysis was performed for 4 minutes on ice by adding 45 pl lysis buffer (10 mM Tris-HCI, pH 7.4, 10 mM NaCI, 3 mM MgCI 2 , 0.1% TweenTM-20, 0.1% NonidetTM P-40, 0.01% Digitonin, and 1% BSA).
  • Nuclei suspension was then used according to the Chromium Single Cell AT AC Reagent Kits protocol (10x Genomics).
  • the calculated volume of the nuclei suspension (targeted nuclei recovery is 1600 nuclei/sample) was mixed with the Transposition mix and incubated for 1 h at 37°C.
  • the transposed nuclei were mixed with a barcoding mix and loaded into a 10x chip H (10x Genomics, Chromium Next GEM Chip H Single Cell Kit v1.1 ; Chromium Next GEM Single Cell AT AC Library & Gel Bead Kit v1.1) together with barcoded beads and partitioning oil and encapsulated using the Chromium controller.
  • the gel emulsion was transferred into a PCR tube to perform 12 cycles of amplification in a thermocycler.
  • the gel emulsion containing barcoded DNA was broken, purified (1 Ox Genomics, Dynabeads MyOne SILANE) and subjected to a final index PCR for 11 cycles.
  • size selection 0.4x/1.2x volume of beads
  • the library was examined on a fragment analyzer (Agilent, NGS High ensitivity Fragment Analysis Kit) for its quality and quantity and sequenced on an Illumina NovaSeq 6000 SP PE100. More information on the library prep can be found at the site https://www.10xgenomics.com/resources/support-documentation.
  • Bioinformatic analysis were performed at the Bioinformatics core facility of the Institut de Recherches Cliniques de Montreal. Sequencing reaction was performed at the sequencing platform of Centre d'expertise et de services Genome Quebec.
  • BMDM bone marrow derived macrophages
  • Serum and tissue endotoxin measurement The levels of endotoxin in serum, brain, and retina were measured using the PierceTM LAL Chromogenic Endotoxin Quantitation Kit (Cat # A39552, Thermo Fisher, Waltham, MA, USA), following the manufacturer’s instruction. Briefly, 50 pL of diluted protein samples, diluted serum samples, and endotoxin standards were added to each well of a 96-well plate. The plate was warmed to 37 °C, and 50 pL of Amebocyte Lysate Reagent were added to each well and incubated for 10 min following briefly mixing.
  • Evans Blue Permeation Assay Retinal and brain EB permeation was performed with modifications as previously described (74). EB was injected at 45 mg/kg intravenously, and it was allowed to circulate for 2 hr prior to tissues (retina and brain) extraction. Evans blue permeation was quantified by fluorimetry (620 nm max absorbance, 740 nm minimum absorbance background). Evans blue permeation (measured in pl / [g x hr]) is calculated as (EB [pg] I wet retinal weight [g]) I (plasma EB [pg/pl] x circulation time [hr]). Evans blue permeation was expressed relative to PBS controls.
  • RNA extraction was performed with frozen mouse tissues or BMDMs from in vitro assays using TRIzol reagent (Cat# 15596026; Invitrogen) and digested with DNase I (Sigma Aldrich; Cat# D4527) following manufacturer instructions to avoid genomic DNA amplification.
  • Total RNA was reverse-transcribed using a 5X All-In-One RT MasterMixTM (Cat# G590; Applied Biological Materials Inc.) according to the manufacturer’s instructions.
  • Gene expression was analyzed using Bright Green2X qPCR Master Mix-Low Rox in an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). Analysis of expression was followed using the AACT method. Actb expression was used as the reference housekeeping gene.
  • Statistical analysis was performed on AACT values, and data was represented as the expression of the target genes normalized to Actb (folds of increase).
  • BMDMs were collected by scraping the cells in 1 * RIPA on ice. Protein concentration was assessed by bicinchoninic acid (BCA) assay (Sigma-Aldrich), and 20 pg protein was loaded for each condition by standard SDS- PAGE technique.
  • BCA bicinchoninic acid
  • Anti-ATF3 (ab207434, Abeam) (1 :1 ,000)
  • Anti-P-cJun Cat# 3270, Cell Signaling
  • Anti-P-NF-KB p65 Cat# 3031 , Cell Signaling
  • MACS2 was used to identify significant peaks using q-value ⁇ 0.05 (A73).
  • Diffbind 2.10.0 R package was used to generate the count matrix of Tn5 insertion site numbers for each consensus peak (peaks that were present in at least 2 samples).
  • Differentially accessibility regions (DARs) were identified between conditions using DESeq2 R package with adjusted p-value ⁇ 0.05 and
  • a positive DAR value means that the chromatin is more open and a negative DAR value means that the chromatin is more closed in the HFD-RD or HFD samples compared to RD-RD samples.
  • DARs were annotated with their closest feature and different transcription binding motifs identified with HOMER (4.8.0).
  • Tn5 tagmentation, DNA purification, library preparation, sequencing and bioinformatics analysis were performed at the Molecular Biology and Functional genomics/Bioinformatics core facilities from Montreal Clinical Research Institute (IRCM).
  • RNA-seq analysis was analyzed using Torrent Suite Software 5.12.0 (Thermo Fisher Scientific). Differential expression analysis was performed with DESeq2 and gene set enrichment analysis GSEAwas conducted using GSEA v3.0 software provided by Broad Institute of Massachusetts Institute of Technology and Harvard University. scATAC-Sequencing analysis. FASTQ files were processed using Cellranger-atac (v1 .2.0). Sequencing reads for all 3 samples were aligned to mm10 (cellranger-atac reference v1.2.0, mm10) and pooled together while normalizing libraries for sequencing depth. Aggregated files were then used for quality control, filtering and downstream analyses in Signac v1.1 .1 (75).
  • Clusters were identified using the Leiden algorithm with a resolution of 0.4 and the differential accessible regions for each cluster (or comparing samples) through logistic regression with the total number of fragments as a latent variable to control for sequencing depth (or using the Wilcoxon Rank Sum test). Gene activity scores were then calculated based on the local accessibility of gene regions, and cluster-specific gene markers identified using the following cut-offs: FDR ⁇ 0.01 & min. pct > 0.1 and presented in a heatmap. C1 , C2 and C3 specific DARs were defined using adjusted p-value ⁇ 0.05 and min.pct>0.1 giving respectively 134/406, 276/547, 51/202 more closed/opened regions.
  • DARs between C2 PBS and C3 4xLPS were defined with adjusted p-value ⁇ 0.05 giving 51 DARs.
  • Clusters identified as microglia cells were subsetted and used for identification of cis-co- accessible networks using Cicero packages (47).
  • Blue LED light exposure AMD model Mice were dark-adapted overnight, then pupils were dilated using atropine sulfate ophthalmic ointment before exposure to light. Mice were exposed to blue light from a light emitting diode (wavelength 450 nm) at a light intensity of 1 ,500 lux for five days and then returned to regular conditions under a standard 12-h light/dark cycle until sacrifice on day 5 post-illumination.
  • a light emitting diode wavelength 450 nm
  • SD-OCT Spectral domain-optical coherence tomography
  • ORT outer retinal thickness
  • Mononuclear phagocyte quantification in choroidal and retinal flatmounts of blue LED light exposure mice Eyes were enucleated and fixed in 4% PFA at room temperature for 60 min. Dissected retinas and choroids were incubated with anti-IBA1 (1 :350) followed by secondary antibody anti-rabbit Alexa 488. Choroids and retinas were flatmounted and imaged using Zen Blue edition 3.2 software on the Zeiss AxiolmagerTM Z2 microscope (Zeiss, Jena, Germany).
  • Choroids and retina flatmounts are large and thick samples; the full images were obtained using mosaic and stitching features of the software, and Z-stacks with 3 m steps were optically sectioned using Apotome.2 with 3 phase images and processed using normalization, local bleaching correction and strong Fourier filter features provided by the software.
  • the number of mononuclear phagocytes (IBA1 positive) were counted on whole RPE/choroidal flatmounts and on the outer segment side of the retina; their density was determined using Imaged software.
  • Electroretinogram The retinal function of the blue LED light exposure AMD model mice was investigated with electroretinography (ERG). ERG measurements were performed after an overnight dark adaptation. Prior to measurements, mice were anesthetized with 10% ketamine and 4% xylazine (10 pl/g of body weight) injected intraperitoneally. The pupils were then dilated with Cyclopentolate Hydrochloride 1%. Proparacaine hydrochloride 0.5% was used to anesthetize the eye. Animals were placed on a heating pad (Harvard Apparatus, Holliston, MA) during the entire recording session to maintain their body temperature at 37°C. All manipulations were performed under dim red light.
  • ERG was recorded in the left eye by placing an electrode (DTL plus electrode from Diagnosys LLC) in contact with the cornea; a reference electrode was placed on the tongue and a neutral electrode was inserted in the tail. Mice were placed under the ERG dome (Diagnosys LLC color dome model number D125) and scotopic ERGs were recorded with 5 flashes of 25 (P)cd.s/m 2 . Results were analyzed with Diagnosys V6.63 software. The amplitude of the a-wave was measured from baseline to trough and the b-wave from the trough of the a- wave to the highest peak of the b-wave.
  • Chlamydia pneumonia infection Male C57BL/6J mice, 7 weeks of age, were inoculated intraperitoneally with C. pneumoniae (Cpn, strain AR-39) 5 x 10 5 IFU/mouse or mock suspended in sucrose-phosphate-glutamic acid medium. Mice primed 3 days prior to inoculation with thioglycollate broth (total volume, 1 .5 mL) injected intraperitoneally.
  • Chlamydia DNA detection DNA was extracted from peritoneal macrophages using TRIzolTM reagent (Cat# 15596026; Invitrogen) according to the manufacturer’s instructions. Extracted DNA was used for polymerase chain reaction (PCR) with pairs of primers specific for Cpn 16S rDNA and host cellular gapdh. The thermal cycling conditions were 95°C for 5 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 45 s. The amount of amplified DNA of chlamydial 16S rDNA was normalized to that of gapdh DNA. Primer sequences used in this study are listed in Table 3.
  • mice Male, seven-week-old mice were randomly assigned to treatment groups and were injected intraperitoneally (i.p.) with bacterial lipopolysaccharides (LPS, Cat# L6143, Sigma Aldrich) at a daily dose of 0.5 mg per kg bodyweight. Animals received either four LPS injections on four consecutive days (4*LPS), a single LPS injection followed by three vehicle injections on the following three days (1 *LPS) or four vehicle injections (PBS) as previously reported.
  • LPS bacterial lipopolysaccharides
  • RNA-seq sample preparation and sequencing Total RNA was isolated from BMDMs using the RNeasyTM Mini Kit (Qiagen). The mRNA was then purified from 500 ng of total RNA using the Dynabeads mRNA DIRECT Micro Kit (Thermo Fisher Scientific). Whole-transcriptome libraries were prepared using the Ion Total RNA-seq Kit v2. The yield and size distribution of the amplified libraries were assessed with the AgilentTM 2100 Bioanalyzer using the DNA 1000 Kit. Sequencing was performed on an Ion Proton instrument (Thermo Fisher Scientific).
  • BMDMs were transfected with 25 nM Atf3 siRNA (ON- TARGETplusTM Mouse Atf3 siRNA: Target Sequence GAAUGGACGGACACCGGAA (SEQ ID NO:57) or non-targeting siRNA (ON-TARGETplusTM Non-targeting Control Pool: Target Sequence UGGUUUACAUGUCGAGUAA (SEQ ID NO:58), UGGUUUACAUGUUGUGUGA (SEQ ID NO:59), UGGUUUACAUGUUUUCUGA (SEQ ID NQ:60), UGGUUUACAUGUUUUCCUA (SEQ ID NO:61)) using 0.2% DharmaFECT-4 according to manufacturer instructions.
  • BMDMs were incubated for 24h, and RNA was extracted after 4 hours of LPS stimulation for qPCR analysis.
  • Choroidal sprouting assay The ex vivo choroid explant analysis and quantification of microvascular sprouting were performed as described previously. Briefly, choroids from C57BI/6J mice were dissected shortly after enucleating eyes. After plating segmented choroids into 24-well tissue culture plates and covering with growth factor reduced Matrigel (BD Biosciences), choroids were cultured in EGM-2 medium.
  • Example 2 Prior infection with C. pneumoniae or systemic exposure to endotoxin aggravates pathological angiogenesis later in life.
  • FIG. 1A At day 60 after inoculation with C. pneumoniae (16 weeks of life), CNV was induced (FIG. 1A).
  • mice Fourteen days following laser burn, mice were perfused with FITC-dextran, choroids flatmounted and CNV area measured by scanning laser confocal microscopy as previously described (28) (FIG. 1B).
  • Quantification of FITC-dextran-perfused neovessels revealed a robust ⁇ 50% increase in CNV area in mice previously infected with C. pneumoniae compared to control mice (FIG. 1C).
  • IB4 isolectin B4
  • MNPs mononuclear phagocytes
  • LPS lipopolysaccharide
  • mice 7-week-old male C57BI/6J mice were given either four consecutive daily i.p. injections of LPS at 0.5 mg/kg (low-dose LPS; LPS Low ) to mimic sustained infection with gramnegative bacteria or a single bolus injection of LPS at 5 mg/kg (high-dose LPS; LPS H '9 h ) following three days of vehicle (PBS) injection.
  • Control mice received four consecutive injections of vehicle (FIG. 10C). Twenty-four hours after the last i.p. injection of high-dose LPS, endotoxin was detected in serum and brain, but not in retina/choroid complexes (FIGs. 10D-F). Consistent with previous reports (30, 31), i.p.
  • mice were next treated according to one of three paradigms: 1) A single i.p. injection of LPS, followed by vehicle (PBS) injections for the subsequent three days (1xLPS group) to model acute exposure to gram-negative bacteria, 2) A daily i.p. injection of LPS on four consecutive days (4xLPS group) to mimic sustained infection, and 3) a control group with four vehicle injections (PBS) (FIG. 2A). Both groups treated with LPS showed a decrease in body weight soon after initial LPS injection that returned to control levels in less than 30 days (FIG. 10N). The effect of LPS treatment paradigms on levels of circulating monocytes was first evaluated.
  • mice were then subjected to laser-induced CNV four weeks after LPS injection (when retinal numbers of MNPs were equal across groups) (FIGs. 2A and D). Both LPS paradigms heightened CNV formation at 14 days after laser-burn compared to control mice (FIGs. 2G-J). Notably, CNV was significantly more pronounced in mice subjected to repeat LPS (4xLPS) when compared to mice that received a single LPS dosing protocol (FIG. 2J).
  • 4xLPS repeat LPS
  • Example 3 CX3CR1 + retinal myeloid cells are primed through peripheral preconditioning by endotoxins and drive pathological angiogenesis.
  • mice were exposed to either acute 1xLPS or protracted 4xLPS paradigms, induced CNV and assessed the innate immune response (FIG. 3A).
  • levels of innate immunity-related pro-inflammatory genes were assessed in RPE-choroid-sclera complexes by RT-qPCR. //7/3, and Tnf expression was significantly decreased with II6 trending lower in the 4xLPS group when compared to control PBS groups.
  • Tgfbl and Vegf expression was increased, suggesting an altered retinal immune response following conditioning with repeated systemic exposure to LPS (FIGs. 3B-H). Similar to observations following Chlamydia pneumonia infections (FIGs.
  • flow cytometry of retinas showed that while number of MNPs increased following induction of CNV, and more specifically CX3CR1 + MNPs, at 3 days after laser-injury, proportions of CX3CR1+ MNPs did not vary between the PBS, the 1xLPS and 4xLPS groups (FIGs. 3C and E).
  • Immunofluorescence staining of flatmounted RPE-choroid-sclera complexes further confirmed that the number of MNPs, labeled with IBA1 , recruited to sites of injury in RPE- choroid-sclera complexes did not differ between the three groups (FIGs. 3M-N).
  • CX3CR1 + myeloid cells such as long-lived microglia but not in short-lived myeloid cells, including blood monocytes (36).
  • DTR diphtheria toxin receptor
  • CX3CR1 is preferentially expressed in myeloid cells, especially monocytes and tissue resident macrophages (microglia in the retina) (FIGs. 12A and B).
  • CX3CR1 CreER/+ :R26 iDTR/+ mice were given i.p. injections of tamoxifen for 3 consecutive days at 6 weeks of age and were treated i.p. with either 4xLPS or PBS a week later. Diphtheria toxin was administered locally to the vitreous at 1 1 and 12 weeks of age with laser-induced CNV at 1 1 weeks of age (FIG. 4A). At 14 day following laser-burn, CNV formation was assessed and the 4xLPS group showed an increase in CNV area when compared to PBS control group in CX3CR1 CreER/+ mice (FIGs. 4B-E).
  • Example 4 Peripheral exposure to endotoxin induces epigenetic reprogramming of retina-resident microglia.
  • CX3CR1+ myeloid cells in the retina retain memory and exacerbate neovascularization after peripheral exposure to LPS (FIG. 2).
  • CX3CR1 + myeloid cells are a heterogeneous population consisting of microglia, circulating monocytes, infiltrating monocytes, and macrophages (39).
  • scATAC-seq high-throughput sequencing
  • CX3CR1-eGFP mice were engineered with an eGFP sequence inserted into exon 2 of the Cx3cr1 gene (40). Heterozygous CX3CR1 GFP/+ mice were used since CX3CR1 GFP/GFP homozygous mice lack CX3CR1 expression (40). CX3CR1-eGFP mice were subjected to either 4xLPS or PBS only. After 30 days, CNV was induced and eGFP-expressing CX3CR1 + cells were sorted. Naive mice injected with PBS and without CNV served as controls (FIG. 6A).
  • UMAP Uniform Manifold Approximation and Projection
  • microglial populations harbor the greatest epigenetic diversity following induction of CNV or preconditioning.
  • C1 , C2, and C3 harbor the greatest epigenetic diversity following induction of CNV or preconditioning.
  • distribution varied depending on the group, with the majority of C1 specific to naive control (93.2%), C2 specific to PBS (83.7%) and C3 specific to 4xLPS (99.4%) (FIG. 6C).
  • GSEA Gene Set Enrichment Analysis
  • C5 a CNV-associated monocyte cluster
  • C6 a CNV-associated macrophage cluster
  • PBS control paradigms
  • Example 5 Peripheral exposure to endotoxin induces transcriptional reprogramming of myeloid cells towards reduced inflammatory but enhanced angiogenic phenotypes.
  • FIG. 7A Bone marrow-derived cells were differentiated from either control mice or LPS-pre-treated mice into mature macrophages (BMDM), re-stimulated with LPS in vitro, and bulk RNA sequencing was performed (FIG. 7A). Data revealed that pre-treatment with LPS, mimicking primary infection sustained over 4 days, leads to significantly altered gene expression (FIGs. 7A-C and 14A-B). Consistent with the global epigenetic silencing of genes coding for inflammation-related processes in retina-resident microglia previously exposed to LPS (FIG.
  • GSEA revealed a negative correlation in mRNA transcripts for processes related to inflammation, such as interferon gamma response, interferon alpha response, TNF-a signaling via NF-KB, inflammatory response, complement, and H6-Jak- Stat3 signaling, in BMDMs preconditioned with LPS (FIGs. 7D and E). Conversely, a positive correlation was observed in clusters of genes coding for angiogenic processes following LPS pretreatment (FIGs. 7D and E).
  • RT-qPCR confirmed that pro-inflammatory genes such as //7/3, 1116, and Tnf decreased significantly in mice preconditioned with LPS, and confirmed a rise in angiogenesis-related genes such as Vegf, Col3a1, Postn, and Pdgfb (FIGs. 7F and G).
  • BM had fewer monocytes, especially Ly6C hi inflammatory monocytes, in 4xLPS-pretreated mice compared with PBS-pretreated mice (FIGs. 14C-F).
  • Myeloid cells including microglia and monocytes/macrophages polarize to classically activated/ pro-inflammatory (M1-like) or alternatively activated/anti-inflammatory and proreparative (M2-like) phenotypes (42, 43).
  • Polarization of BMDMs from LPS-preconditioned mice was assessed by flow cytometry, and a significant increase in CD206-expressing M2-like cells (FIGs. 8A and B) and a decrease in M 1 -like cells (FIGs. 8A and C) were found.
  • Rebalancing of myeloid cells towards a M2-like state can contribute to disorders linked to heightened angiogenesis (44); therefore, prior exposure to LPS could exacerbate CNV.
  • monocytes from the bone marrow of laser-burned mice injected with PBS or preconditioned with 4xLPS were isolated. Monocytes were then co-cultured with choroidal explants and angiogenesis was evaluated 2 and 3 days later (FIG. 8D). A significant increase in sprouting area in choroids co-cultured with myeloid cells from 4xl_PS-primed mice was observed when compared to PBS-primed control mice (FIGs. 8E-G).
  • Example 7 Peripheral exposure to bacterial endotoxin suppresses inflammatory and potentiates angiogenic responses in myeloid cells via ATF3 deregulation.
  • scATAC-seq data on nuclei extracted from CX3CR1 + cells enriched from retinas was analyzed (FIG. 6).
  • Differential accessibility regions (DARs) for activating transcription factor 3 (ATF3) was identified as the most enriched accessible region when comparing microglia from the PBS cluster C2 (primarily microglia from PBS + CNV), and microglial 4xLPS cluster C3 (primarily microglia from 4xLPS + CNV) (FIG. 9A).
  • Cis-co- accessibility networks (CCANs) which are modules of sites that are highly co-accessible with one another, were then investigated using Cicero (47).
  • CCANs that include ATF3 have greater accessibility signals in C3 (4xLPS) microglia when compared to control C2 (PBS) microglia (FIG. 9B), suggesting that the ATF3 gene is preferentially epigenetically modulated following exposure to endotoxin, and hence could potentially be a regulator of LPS-driven immune memory.
  • ATF3 is a member of the ATF/cAMP response element binding (CREB) family, and it is a stress-induced transcription factor playing pivotal roles in modulating glucose metabolism and immune responses (48). ATF3 can act as either a transcriptional activator or repressor.
  • the functional role of ATF3 in LPS-driven innate immune memory was examined using BMDMs from mice preconditioned by 4xLPS or control PBS. Pretreatment of mice with control PBS and restimulation with LPS for 6h lead to a robust induction of ATF3 as well as p-cJun and p-NF-KB, two phosphorylated transcriptional factors involved in TLR4 signaling (49) (FIG. 9C).
  • FIG. 9D BMDMs from mice exposed to 4xLPS or PBS control were transfected with ATF3 siRNAs for 24h and then treated with LPS for 4h. Efficacy of siRNAs against Atf3 was confirmed in both preconditioning paradigms (PBS or 4xLPS) by qPCR (FIG. 9E). Consistent with the previous findings (FIG. 3), genes coding for inflammatory response such as Tnf and 116 were down- regulated following secondary exposure to LPS in 4xLPS primed BMDMs treated with control siRNA (FIGs. 9F and G).
  • Example 8 A past history of obesity triggers a persistent memory state in visceral adipose tissue and predisposed to pathological angiogenesis in the retina.
  • HFD-fed mice had gained 3 times more weight than RD-fed mice after 11 weeks of diet (FIG. 15B, Timepoint 1). Weights of HFD-RD mice gradually decreased after return to RD, reached weights similar to RD-RD mice within 6 weeks and remained similar throughout the remaining course of study (Timepoint 2) (FIGs. 15B and 21A). The systemic metabolic consequences of DIO in HFD-fed mice were normalized with subsequent weight loss upon return to RD as demonstrated by tolerance to glucose challenge (FIGs. 15D, E) and insulin challenge (FIGs. 15F, G) with all mice at Timepoint 2 showing comparable responses.
  • RD-RD mice and HFD-RD mice were subjected to laser-induced photocoagulation to trigger CNV (31) (FIG. 15A).
  • CNV lesions and laser-burned areas were quantified with high-molecular-weight Fluorescein isothiocyanate (FITC)-dextran and isolectin B4 (IB4) staining in choroid flatmounts.
  • FITC-dextran perfusion permits visualization of neovessels with lumen and IB4 stains endothelial cells in neovascularization and choriocapillaris beneath the laser-burned Bruch’s membrane.
  • adipose tissue transplantations were performed, where equal amounts (500mg) of epididymal visceral white adipose tissue (eWAT) fat pads from RD-RD mice or HFD-RD mice (A32, A33) were transplanted into C57BI/6J recipient mice (FIG. 15M). All mice progressively gained weight from 1 week after ATT, and no significant differences in weight were observed among groups (FIG. 22A).
  • eWAT epididymal visceral white adipose tissue
  • Lysozyme 2 (LysM) Cre/+ which drive expression in myeloid cell lineage was used and bred with Ai3 EYFP/+ mice that harbor a targeted mutation of the Gt(ROSA)26Sor locus with ⁇ oxP- flanked STOP cassette preventing transcription of enhanced yellow fluorescent protein (EYFP).
  • EYFP enhanced yellow fluorescent protein
  • the resulting mice show fluorescent monocytes, mature macrophages, and granulocytes.
  • eWAT fat pads from LysM Cre/+ :Ai3 EYFP/+ mice or LysM Cre/+ mice were transplanted into C57BL/6J recipient mice (FIG. 16J).
  • CNV was induced 3 weeks after transplantations once surgical inflammation had subsided to assess if myeloid cells within transplanted fat pads could migrate and contribute to AMD pathology locally.
  • YFP + MNPs were detected in retinas of mice that received eWAT fat pads from LysM Cre/+ :Ai3 EYFP/+ donor mice.
  • Transplants from LysM Cre/+ mice were used as controls to determine background autofluorescence.
  • myeloid cells from adipose tissue directly infiltrate CNV lesions and locally contribute to disease progression (FIGs. 16K & L).
  • Example 10 Bone marrow transfer from mice with past obesity aggravates CNV in lean mice.
  • BM-derived myeloid cells from HFD-fed mice might also impact CNV.
  • MPP3 myeloid-biased multipotent progenitor cells
  • Transcript levels of innate immunity-related genes was assessed in monocytes isolated from BM of RD-RD mice and HFD-RD mice by real-time quantitative PCR (RT-qPCR) and it was found that levels of interleukin 11)1/3 and 116 rose significantly in HFD-RD mice compared to RD-RD controls (FIG. 16M).
  • RT-qPCR real-time quantitative PCR
  • FIG. 16M To test whether the BM from formerly obese mice might contribute to the development of CNV, bone marrow transfers (BMT) from RD-RD or HFD-RD C57BI/6J (CD45.2) mice into lethally irradiated B6.SJL (CD45.1) recipient mice was performed (FIGs. 16N and 24E, F).
  • Example 11 Past obesity induces persistent epigenomic reprogramming of ATMs toward enhanced angiogenic and inflammatory responses.
  • Activator Protein-1 target genes such as //7/3, NfKbl, Tnfaip3, Vegfa, Angptl, Pdgfrb are more accessible, whereas 1110 is less accessible in HFD-RD (FIGs. 17A, B).
  • transcript levels of innate immunity- related genes were next assessed by real-time quantitative PCR (RT-qPCR).
  • RT-qPCR real-time quantitative PCR
  • visceral adipose tissue levels of pro-inflammatory genes such as 111/3, Tnf, Cxcl1, Ccl5, and Ifng rose significantly in HFD-RD mice compared to control RD-RD, supporting epigenetic changes in inflammatory genes (FIGs. 17C-J).
  • expression of Suppressor of Cytokine Signaling-3 (Socs3) decreased significantly.
  • Example 12 Stearic acid potentiates macrophage memory via activation of TLR4 signaling.
  • TLR4 signaling During obesity, several effectors such as free fatty acids (FFA), triglycerides, ceramides, gut-derived endotoxin, and damage-associated molecular patterns (DAMPS, such as S100A8/A9 and HMGB1) have been suggested to activate ATMs and other cells of the innate immune system (A37-A40) (A30).
  • FFA free fatty acids
  • DAMPS damage-associated molecular patterns
  • lipidomic analysis was first performed by Gas Chromatography-Mass Spectrometry (GC-MS), and stearic acid (C18:0) was identified as the most phospholipid-enriched fatty acid in the plasma of HFD-fed mice when compared to RD-fed mice during the WGWL timecourse (Timepoint 1 , FIGs. 18A and 26A).
  • GC-MS Gas Chromatography-Mass Spectrometry
  • C18:0 was identified as the most phospholipid-enriched fatty acid in the plasma of HFD-fed mice when compared to RD-fed mice during the WGWL timecourse.
  • no enrichment in plasma levels of stearic acid or any other analyzed fatty acid was observed in HFD-RD mice at Timepoint 2 following the return to RD and metabolic normalization (FIG. 18B and Fig. 26B), indicating that stearic acid was uniquely upregulated during HFD-feeding. Palmitic Acid (C16:0) did not differ between the two groups in the experimental paradigm (FIG. 18
  • TLR Toll-like receptor 4/JNK or NFkB signaling
  • FIGS. 27A-E Bone marrow cells from 8-week-old male C57BI/6J mice were differentiated into mature macrophages, and stimulated with stearic acid or palmitate with or without TAK-242 (specific inhibitor of TLR4 signaling) (FIGs. 27A-E).
  • stearic acid induced the expression of proinflammatory and proangiogenic genes, such as Tnf, Tnfaip3, 116, Ccl2, CxcH, NfKb, and Vegf in bone marrow-derived macrophages (BMDMs) (FIG. 27B).
  • proinflammatory and proangiogenic genes such as Tnf, Tnfaip3, 116, Ccl2, CxcH, NfKb, and Vegf in bone marrow-derived macrophages (BMDMs)
  • pretreatment with TAK242 abolished induction of several proinflammatory genes including Tnf, Tnfaip3, 116, and CxcH (FIG. 27B).
  • palmitate induced expression of pro-inflammatory and pro-angiogenic genes, in a TLR4-dependant manner (FIG. 27E).
  • stearic acid was the most differentially induced fatty acid during the obese phase of the WGWL paradigm (FIG. 18A)
  • BMDMs were primed with stearic acid for 24 hours and re-stimulated with LPS 5 days after a washout period.
  • stearic acid-primed macrophages triggered a significantly greater inflammatory response with heightened expression of Tnf, Tnfaip3, 116, and NfKb in response to secondary stimulation with LPS (FIGs. 18C-D).
  • FIG. 27C Heightened expression of lip, 116, and Tnf was observed in stearic acid pre-treated macrophages in response to secondary stimulation after a wash period of 10 days.
  • pretreatment with TAK242 completely abolished the effect of stearic acid- induced macrophage memory (FIGs. 18D and 27C).
  • stearic acid pretreated macrophages then stimulated with HMGB1 (a TLR4 ligand that provokes a lesser inflammatory response), showed greater cytokine production than control BSA pretreated macrophages (FIGs. 27G-H).
  • HMGB1 a TLR4 ligand that provokes a lesser inflammatory response
  • palmitate-primed macrophages did not show heightened regulation of gene expression in response to secondary LPS stimulation (FIG. 27F).
  • Tlr4 Lps - rJed a coding sequence deletion of Tlr4 causing loss-of-function
  • Tlr4 Lps - rJed a coding sequence deletion of Tlr4 causing loss-of-function
  • TI ' BMDMs retained response to LPS or stearic acid likely via other TLRs (FIGs. 28A, B).
  • Tlr4 - mice fed RD-RD or HFD-RD showed the same body weight change as observed in WT C57BL/6J mice.
  • Tlr4 - mice did not retain a memory phenotype as described above (FIGs. 1 & 2) and had similar magnitudes of CNV and FITC perfused area in RD-RD and HFD-RD-fed mice (FIGs. 18G-K and 29I).
  • stearic acid the most enriched fatty acid in plasma phospholipids of mice fed HFD, potentiates macrophages for future cytokine production via TLR4 and leads to innate memory in DIO that aggravates pathological angiogenesis in response to experimental injury.
  • Example 13 Prior exposure to stearic acid shifts macrophage metabolism towards glycolysis.
  • Extracellular acidification rate was measured to assess glycolysis in BSA (control) or stearic acid pretreated BMDMs. Consistent with a primed state for inflammatory response (FIG. 18D), stearic acid-treated BMDMs showed small significant shifts in glycolysis and glycolytic capacity (FIGs. 180 & P). Subsequent treatment with LPS caused a further increase in glycolysis and glycolytic capacity in both groups (FIGs. 180 & P). These results suggest that the memory state of myeloid cells is associated with metabolic reprogramming and exposure to stearic acid may shift myeloid cell metabolism towards glycolysis with less reliance on oxidative metabolism (FIG. 18Q), an effect that persists long after diet-induced obesity.
  • Example 14 Obesity-driven reprogramming of macrophages correlate with chromatin remodeling at AP-1 binding sites.
  • ATAC-seq from nuclei extracted from FACS-sorted ATMs of RD-RD or HFD-RD mice revealed a landscape of open chromatin regions that are enriched in proximity of genes related to MAPK/JNK or ERK signaling pathway in HFD-RD ATMs (FIG. 19A). It may be hypothesized that genes encoding effectors of the MAPK signaling pathway might be epigenetically modulated in ATMs of formerly obese mice. Specifically, more accessible DARs in HFD-RD ATMs were enriched for regions containing consensus binding sites for the Activator Protein-1 (AP-1) family of transcription factors, which comprises several members including c-JUN, c-FOS, and ATF.
  • AP-1 Activator Protein-1
  • the top 8 highest ranked motifs correspond to binding of AP-1 family members based on Hypergeometric Optimization of Motif EnRichment (HOMER) motif search (FIG. 19B).
  • HOMER Motif EnRichment
  • AP-1 binding itself leads to chromatin remodeling by recruiting histone modifying enzymes that trigger proinflammatory genes.
  • HAT histone acetyltransferase
  • Chromatin immunoprecipitation (ChlP)-qPCR assays of stearic acid-stimulated BMDMs revealed recruitment of c-JUN to the promoter region of the Tnf gene in cells treated with stearic acid (FIG. 19G). This was accompanied by recruitment of EP300 to the promoter region of the Tnf gene, and significant increases in acetylation of histone H3 on lysine 27 (H3K27ac), leading to higher activation of transcription (FIGs. 19H-I).
  • Example 15 CNV is influenced by obesity-induced reprograming of ATMs and retinal myeloid cells.
  • the LysM promoter drove expression preferentially in ATMs compared to the CX3CR1 promoter (78.9% vs 30.4% of total ATMs; FIG. 29A).
  • the CX3CR1 promoter drove expression in 83.8% of retinal MNPs vs 65.9% with LysM; three days after laser injury, this shifted to 69.4% vs 37.5%, respectively (FIG. 29B).
  • LysM and CX3CR1 promoters drove expression at similar levels in blood monocytes (69.7% vs 75.1%, respectively; FIG. 29C).
  • mice In order to deplete myeloid cells in vivo, compound heterozygous mice carrying the LysM Cre allele or the R2& D1R allele LyslV e/+ :R26i D1R/+ ') were generated. The resulting mice expressed diphtheria toxin receptor specifically in myeloid cells, rendering them susceptible to targeted elimination. Depletion of ATMs was investigated for proof of concept of targeted elimination of tissue-resident myeloid cells. Successful ablation of ATMs by diphtheria toxin was verified through FACS analysis, which confirmed a robust reduction of ATMs within visceral adipose tissue in LysM Cre/+ :R26 iDTR/+ mice (FIG. 29D).
  • LysM Cre/+ :R26i DTR/+ and control LysM Cre mice were put on specified RD-RD or HFD-RD diet paradigms, and then subjected to laser-induced CNV (FIG. 30A). At 48 hours post-laser- burn, no changes in the serum concentration of pro-inflammatory cytokines was observed between either diet paradigm in LysM Cre/+ :R26i DTR/+ mice (FIG. 30B). Importantly, 14 days after laser-burn, CNV was more pronounced in HFD-RD-fed LysM Cre mice when compared to RD-RD- fed mice.
  • eWAT fat pads from RD-RD or HFD-RD LysM Cre/+ :R20 D1R/+ or LysM Cre/+ mice were transplanted into C57BL/6J recipient mice. Mice were then subjected to laser-induced CNV with targeted ablation of ATMs by Diphtheria toxin (DT) injections (FIG. 20A). Fourteen days after laser injury, CNV was more pronounced in in recipients of fat pads from HFD-RD LysM Cre control mice when than in recipients of fat pads from RD-RD-fed LysM Cre mice.
  • RD-RD and HFD-RD mice were intraperitoneally injected with tamoxifen for three consecutive days and diphtheria toxin was administered intravitreally 4 and 5 weeks afterwards (FIG. 20E).
  • CX3CR1 CreER/+ control mice fed HFD-RD showed increased size of CNV area compared to RD- RD fed mice. This was in contrast to CX3CR1 CreER/+ :R26 iDTR/+ mice where no change was observed (FIGs. 20F-H, and 30L-M).
  • Example 16 Loss of retinal function associated with light-induced retinal degeneration in previously obese mice is prevented by depletion of myeloid cells.
  • FIG. 31A This non-neovascular model enables evaluation of photoreceptor damage and retinal function (A75-A77) (FIG. 31A).
  • Light exposure is associated with accumulation of myeloid cells in the subretina and choroid (FIGs. 31B-C) and photoreceptor damage (FIGs. 31D-F) leading to retinal dysfunction (FIGs. 31G-I).
  • Example 17 AP-1 inhibition prevents binding of AP-1 partners to DNA.
  • AP-1 activation human-derived leukemia monocytic THP-1 cells were stimulated with 50 ng/mL of Phorbol 12-myristate 13-acetate (PMA), a phorbol ester that upon PKC activation induces the AP-1 signaling pathway.
  • PMA Phorbol 12-myristate 13-acetate
  • Whole cell lysates were collected at 15 and 30 minutes, as well as 1 , 2, 3, 4, 6, and 8 hours after PMA stimulation. Immunoblotting of lysates revealed increased levels of c-FOS protein from 3 to 6 hours, phosphorylation of c-JUN from 15 minutes to 1 hour, as well as persistent increases in IL-1 (15 minutes - 8 hours) and ATF3 (15 minutes - 6 hours) (FIG. 32A).
  • T-5224 also reduced DNA-binding of AP-1 heterodimers containing FOSB (FIG. 32H) at 500 pM, but did not impact FRA1 (FIG. 32I) heterodimers from binding the AP-1 binding site.
  • Dose response curves, IC 5 o and R 2 for each AP-1 partner demonstrate significant inhibition of c-FOS, c-JUN, JUND and JUNB-containing heterodimers to the AP-1 binding site upon treatment with T-5224 (FIG. 32J).
  • Example 18 AP-1 inhibition prevents c-JUN/cFOS dimerization and neuroinflammation.
  • T-5224 blocked AP-1 binding to TRE-containing DNA sequences through direct inhibition of subunit binding or alternatively through inhibition of AP-1 multimerization.
  • THP-1 cells were pre-treated with 3- 500pM of T-5224 or vehicle for 1 hour followed by stimulation with PMA for 2 hours (FIG. 33A).
  • T-5224 demonstrated dose-dependent inhibition of AP-1 formation in vitro (FIG. 33B).
  • the ability of T-5224 to block AP-1 formation was subsequently assessed in vivo by administering 300 mg/kg of T-5224 or DMSO by gavage to C57BL/6 mice 1 hour prior to intraperitoneal administration of LPS or PBS (FIG. 33C).
  • liver and brain were harvested at 15 minutes, 30 minutes, 1 hour, and 2 hours following treatment.
  • dimerization of c-JUN and c-FOS with c-JUN, c-FOS and ATF3 was observed.
  • the dimerization of c-JUN with c-FOS and ATF3 was blocked by T-5224 30 min and 1 hour post-treatment (FIGs. 33D-E).
  • T-5224 prevented a drop in body temperature triggered by high dose LPS injection (FIG. 33F).
  • Subsequent analysis was performed at 1-hour post-LPS (maximal induction of AP-1).
  • a dose-response in liver and brain exposed to LPS and treated with T-5224 revealed inhibition of c-JUN/c-FOS dimerization in the liver following both high (5 mg/kg) or low doses (0.5 mg/kg) of LPS (Figure 2G).
  • T-5224 inhibited c-JUN/c-FOS dimerization in the liver (FIG. 33G) and brain (0.3-300 mg/kg) (FIG. 33H). Consistent with target engagement data above, T-5224 impeded production of transcripts for inflammatory cytokines directly in the brain.
  • Example 19 Oral administration of an AP-1 Inhibitor prevents retinal degeneration in a light-induced model of retinal degeneration (in immune-trained animals).
  • mice were exposed to 8000 lux of blue light starting from Day 0 (DO) for five consecutive days to induce photoreceptor degeneration. Concurrent with the onset of blue light exposure, mice received daily oral gavage of T-5224 (3 mg/kg) or vehicle from DO to D9 (FIGs. 34A-B). Body weight measurements taken throughout the treatment period revealed similar weights between control and drug treated mice suggesting absence of overt systemic toxicity (FIG. 34C).
  • Optical coherence tomography (OCT) imaging was performed on Day 10 (D10) and Day 17 (D17).
  • T-5224 showed a pronounced, statistically significant protective effect (FIG. 34D).
  • Quantitative analyses of retinal thickness demonstrated that treatment with T- 5224 significantly reduced retinal degeneration (total and outer retina) at both D10 and D17 (FIG. 34E).
  • AMD age-related macular degeneration
  • Fritsche LG Chen W, Schu M, Yaspan BL, Yu Y, Thorleifsson G, Zack DJ, Arakawa S, Cipriani V, Ripke S, et al. Seven new loci associated with age-related macular degeneration. Nature genetics. 2013;45(4):433-9, 9e1-2.
  • the transcription factor ATF7 mediates lipopolysaccharide-induced epigenetic changes in macrophages involved in innate immunological memory. Nat Immunol. 2015;16(10):1034-43.
  • Neuron-derived semaphorin 3A is an early inducer of vascular permeability in diabetic retinopathy via neuropilin-1. Cell Metab. 2013;18(4):505-18.
  • TLR4 links innate immunity and fatty acid-induced insulin resistance. J. Clin. Invest. 116, 3015-3025 (2006).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Wood Science & Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Ophthalmology & Optometry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente demande concerne le traitement de la DMLA (sèche et néovasculaire), des vasculopathies rétiniennes, de la dégénérescence du photorécepteur et de l'atrophie rétinienne par modulation d'une inflammation rétinienne pathologique à l'aide d'un agent qui inhibe l'expression et/ou l'activité d'une protéine AP-1 et/ou ATF3. La présente demande concerne un procédé d'identification d'un composé d'essai qui peut être utile pour la prévention ou le traitement de l'angiogenèse rétinienne pathologique sur la base de la capacité du composé d'essai à réduire ou inhiber l'expression et/ou l'activité d'AP-1 et/ou d'ATF3.
PCT/CA2023/051605 2022-12-02 2023-12-01 Ciblage de mémoire immunitaire innée et d'ap-1 ou d'atf3 pour le traitement de maladies oculaires WO2024113061A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263429631P 2022-12-02 2022-12-02
US63/429,631 2022-12-02

Publications (1)

Publication Number Publication Date
WO2024113061A1 true WO2024113061A1 (fr) 2024-06-06

Family

ID=91322651

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2023/051605 WO2024113061A1 (fr) 2022-12-02 2023-12-01 Ciblage de mémoire immunitaire innée et d'ap-1 ou d'atf3 pour le traitement de maladies oculaires

Country Status (1)

Country Link
WO (1) WO2024113061A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008050329A2 (fr) * 2006-10-25 2008-05-02 Quark Pharmaceuticals, Inc. NOUVEAUX ARNsi ET PROCÉDÉS D'UTILISATION DE CEUX-CI
WO2018094218A1 (fr) * 2016-11-17 2018-05-24 Children's Medical Center Corporation Modulation thérapeutique de c-fos dans l'oeil
US11090317B2 (en) * 2017-03-09 2021-08-17 Pharmaleads Aminophosphinic derivatives for preventing and treating eye inflammation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008050329A2 (fr) * 2006-10-25 2008-05-02 Quark Pharmaceuticals, Inc. NOUVEAUX ARNsi ET PROCÉDÉS D'UTILISATION DE CEUX-CI
WO2018094218A1 (fr) * 2016-11-17 2018-05-24 Children's Medical Center Corporation Modulation thérapeutique de c-fos dans l'oeil
US11090317B2 (en) * 2017-03-09 2021-08-17 Pharmaleads Aminophosphinic derivatives for preventing and treating eye inflammation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
FRANZONE FEDERICA, NEBBIOSO MARCELLA, PERGOLIZZI TIZIANO, ATTANASIO GIUSEPPE, MUSACCHIO ANGELA, GRECO ANTONIO, LIMOLI PAOLO, ARTIC: "Anti‑inflammatory role of curcumin in retinal disorders (Review)", EXPERIMENTAL AND THERAPEUTIC MEDICINE, SPANDIDOS PUBLICATIONS, GR, vol. 22, no. 1, GR , XP093181038, ISSN: 1792-0981, DOI: 10.3892/etm.2021.10222 *
RADOMSKA-LEŚNIEWSKA DOROTA M., OSIECKA-IWAN ANNA, HYC ANNA, GÓŹDŹ AGATA, DĄBROWSKA ANNA M., SKOPIŃSKI PIOTR: "Therapeutic potential of curcumin in eye diseases", CENTRAL EUROPEAN JOURNAL OF IMMUNOLOGY, vol. 44, no. 2, 1 January 2019 (2019-01-01), pages 181 - 189, XP093181037, ISSN: 1426-3912, DOI: 10.5114/ceji.2019.87070 *
YE, N. ET AL.: "Small Molecule Inhibitors Targeting Activator Protein 1 ( AP -1", J. MED. CHEM., vol. 57, 2014, pages 6930 - 6948, XP093138438, DOI: 10.1021/jm5004733 *

Similar Documents

Publication Publication Date Title
Ghaemmaghami et al. Role of exosomes in malignant glioma: microRNAs and proteins in pathogenesis and diagnosis
Delvalle et al. Communication between enteric neurons, glia, and nociceptors underlies the effects of tachykinins on neuroinflammation
Pelosi et al. Functional and morphological improvement of dystrophic muscle by interleukin 6 receptor blockade
US10683352B1 (en) Methods for treating cancer using GRM8 inhibitors
JP7395161B2 (ja) 老化細胞除去薬
Ma et al. Monocyte infiltration and proliferation reestablish myeloid cell homeostasis in the mouse retina following retinal pigment epithelial cell injury
Ravenscroft et al. Mouse models of dominant ACTA1 disease recapitulate human disease and provide insight into therapies
US11034751B1 (en) Methods and compositions for treating cancer using serotonin receptor inhibitors
US11078277B2 (en) Methods and pharmaceutical compositions for enhancing CD8+ T cell-dependent immune responses in subjects suffering from cancer
Kather et al. Angiopoietin-1 is regulated by miR-204 and contributes to corneal neovascularization in KLEIP-deficient mice
EP3541408A1 (fr) Compositions et méthodes pour le traitement de l'angiogenèse aberrante
JP2009541213A (ja) 高脂血症を改善するための組成物および方法
EP3220908B1 (fr) Compositions et méthodes de traitement de l'endométriose
US20210268030A1 (en) Fibroadipogenic progenitor-derived exosomes for regeneration of dystrophic muscles
Andriessen et al. Myeloid‐resident neuropilin‐1 promotes choroidal neovascularization while mitigating inflammation
Hata et al. Early-life peripheral infections reprogram retinal microglia and aggravate neovascular age-related macular degeneration in later life
Zhao et al. PGF2α facilitates pathological retinal angiogenesis by modulating endothelial FOS‐driven ELR+ CXC chemokine expression
Ma et al. Mannose Binding Lectin Activates the Nuclear Factor-κB and Renal Inflammation in the Progression of Diabetic Nephropathy
Sun et al. CD44 as a novel target for treatment of staphylococcal enterotoxin B-induced acute inflammatory lung injury
WO2024113061A1 (fr) Ciblage de mémoire immunitaire innée et d'ap-1 ou d'atf3 pour le traitement de maladies oculaires
Rojo Arias et al. Gene expression profile of the murine ischemic retina and its response to Aflibercept (VEGF-Trap)
US20200360364A1 (en) Methods and compositions for treating inflammatory or autoimmune diseases or conditions using chrna6 activators
Xu et al. Long noncoding RNA PPT2-EGFL8 regulates pathological retinal neovascularization in PDR by functioning as a competing endogenous RNA
US11208475B1 (en) Methods and compositions for treating inflammatory or autoimmune diseases or conditions using serotonin receptor activators
US11013717B1 (en) Methods and compositions for treating cancer using SERCA pump inhibitors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23895635

Country of ref document: EP

Kind code of ref document: A1