WO2024107850A1 - Halo-dehydro-3'-deoxyuracil phosphoramidates and related compounds and their use in treating medical conditions - Google Patents

Halo-dehydro-3'-deoxyuracil phosphoramidates and related compounds and their use in treating medical conditions Download PDF

Info

Publication number
WO2024107850A1
WO2024107850A1 PCT/US2023/079834 US2023079834W WO2024107850A1 WO 2024107850 A1 WO2024107850 A1 WO 2024107850A1 US 2023079834 W US2023079834 W US 2023079834W WO 2024107850 A1 WO2024107850 A1 WO 2024107850A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
certain embodiments
hydrogen
occurrence
compound
Prior art date
Application number
PCT/US2023/079834
Other languages
French (fr)
Inventor
Donna L. Romero
Oliver Saunders
Gregory Stuart Bisacchi
Dennis Zaller
Rosana Kapeller-Libermann
Original Assignee
Rome Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Rome Therapeutics, Inc. filed Critical Rome Therapeutics, Inc.
Publication of WO2024107850A1 publication Critical patent/WO2024107850A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
    • C07D405/04—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/645—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having two nitrogen atoms as the only ring hetero atoms
    • C07F9/6509—Six-membered rings
    • C07F9/6512—Six-membered rings having the nitrogen atoms in positions 1 and 3
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6558—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system
    • C07F9/65586—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system at least one of the hetero rings does not contain nitrogen as ring hetero atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals
    • C07H19/10—Pyrimidine radicals with the saccharide radical esterified by phosphoric or polyphosphoric acids

Definitions

  • Cancer continues to be a significant health problem despite the substantial research efforts and scientific advances reported in the literature for treating this disease.
  • Solid tumors, including prostate cancer, breast cancer, and lung cancer remain highly prevalent among the world population.
  • Leukemias and lymphomas also account for a significant proportion of new cancer diagnoses.
  • Current treatment options for these cancers are not effective for all patients and/or can have substantial adverse side effects.
  • New therapies are needed to address this unmet need in cancer therapy.
  • Substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, pharmaceutical compositions, their use for inhibiting LINE1 reverse transcriptase and/or HERV- K reverse transcriptase activity, and their use in the treatment of medical disorders, such as cancer, are disclosed herein.
  • one aspect of the disclosure provides a collection of substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula I: or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description.
  • Another aspect of the disclosure provides a collection of substituted halo-dehydro- 3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula 1-1:
  • Another aspect of the disclosure provides a collection of substituted bicyclo[3.1.0]hex- 2-ene phosphoramidates and related compounds, such as a compound represented by Formula II:
  • Another aspect of the disclosure provides a collection of substituted bicyclo[3.1.0]hex-2-ene phosphoramidates and related compounds, such as a compound represented by Formula II: or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Further description of additional collections of substituted bicyclo[3.1.0]hex-2-ene phosphoramidates and related compounds are described in the detailed description.
  • the compounds may be part of a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
  • Another aspect of the disclosure provides a collection of substituted halo-dehydro-3'- deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula III: or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description.
  • Another aspect of the disclosure provides a collection of substituted halo-dehydro- 3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula III-l :
  • Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder.
  • the method comprises administering a therapeutically effective amount of a compound described herein, such as a compound of Formula I, II, or III, to a subject in need thereof to treat the disorder, as further described in the detailed description.
  • the method comprises administering a therapeutically effective amount of a compound described herein, such as a compound of Formula I, II, III, 1-1, II- 1, or III- 1 , to a subject in need thereof to treat the disorder, as further described in the detailed description.
  • Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection.
  • the method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV, V, or VI to treat the disorder; wherein Formula IV, V, and VI are represented by:
  • Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection.
  • the method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV-1, V-l, or VI-1 to treat the disorder; wherein Formula IV-1, V-l, and VI-1 are represented by:
  • Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity.
  • the method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, or III, in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
  • Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection.
  • the method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, or VI, in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
  • method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, VI, IV-1, V-l, or VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
  • a compound described herein such as a compound of Formula IV, V, VI, IV-1, V-l, or VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
  • Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, or III, in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, III, 1-1, II- 1 , or III- 1 , in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
  • Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodeg enerative disorder, and an immune disorder other than a viral infection.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, or VI, in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, VI, IV-1, V-l, or Vl-lin order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
  • a compound described herein such as a compound of Formula IV, V, VI, IV-1, V-l, or Vl-lin order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
  • Figure 1 is a graph depicting interferon levels over time in THPl-DualTM KO-TREX1 xenografts from mice treated with vehicle or decitabine (DAC) at 5mg/kg IP, once daily, for four days, as described in Example 44.
  • DAC decitabine
  • aliphatic or “aliphatic group”, as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “cycloaliphatic”), that has a single point of attachment to the rest of the molecule.
  • aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms.
  • aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms.
  • “cycloaliphatic” refers to a monocyclic C3-C6 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.
  • Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
  • bicyclic ring or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system.
  • the term includes any permissible ring fusion, such as wz/vo-fused or spirocyclic.
  • heterocyclic is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle.
  • Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc.
  • a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
  • the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge.
  • a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen).
  • a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
  • Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups.
  • any substitutable nitrogen of a bridged bicyclic group is optionally substituted.
  • Exemplary bicyclic rings include: [0024]
  • Exemplary bridged bicyclics include: NH NH N H H .
  • Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.
  • the term “lower haloalkyl” refers to a C 1-4 straight or branched alkyl group that is substituted with one or more halogen atoms.
  • heteroatom means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR + (as in N-substituted pyrrolidinyl)).
  • unsaturated as used herein, means that a moiety has one or more units of unsaturation.
  • alkylene refers to a bivalent alkyl group.
  • An “alkylene chain” is a polymethylene group, i.e., –(CH2)n–, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3.
  • a substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent.
  • Suitable substituents include those described below for a substituted aliphatic group.
  • the term “-(C0 alkylene)-“ refers to a bond. Accordingly, the term “-(C0-3 alkylene)-” encompasses a bond (i.e., C 0 ) and a -(C 1-3 alkylene)- group.
  • alkenylene refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group.
  • halogen means F, Cl, Br, or I.
  • aryl used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members.
  • aryl may be used interchangeably with the term “aryl ring.”
  • aryl refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents.
  • aryl is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.
  • phenylene refers to a multivalent phenyl group having the appropriate number of open valences to account for groups attached to it. For example, “phenylene” is a bivalent phenyl group when it has two groups attached ); “phenylene” is a trivalent phenyl group when it has three groups attache ).
  • arylene refers to a bivalent aryl group.
  • heteroaryl and “heteroar-,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 % electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms.
  • heteroatom refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen.
  • Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl.
  • heteroaryl and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where unless otherwise specified, the radical or point of attachment is on the heteroaromatic ring or on one of the rings to which the heteroaromatic ring is fused.
  • Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4//-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, and tetrahydroisoquinolinyl.
  • a heteroaryl group may be mono- or bicyclic.
  • heteroaryl may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted.
  • heteroarylkyl refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.
  • heteroarylene refers to a multivalent heteroaryl group having the appropriate number of open valences to account for groups attached to it.
  • heteroarylene is a bivalent heteroaryl group when it has two groups attached to it; “heteroarylene” is a trivalent heteroaryl group when it has three groups attached to it.
  • pyridinylene refers to a multivalent pyridine radical having the appropriate number of open valences to account for groups attached to it.
  • pyridinylene is a bivalent pyridine radical when it has two groups [0037]
  • heterocycle is used interchangeably and refer to a stable 5- to 7-membered monocyclic or 7-10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above.
  • nitrogen includes a substituted nitrogen.
  • the nitrogen may be N (as in 3,4-dihydro- 2/7 pyrrol yl), NH (as in pyrrolidinyl), or + NR (as in //-substituted pyrrolidinyl).
  • a heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted.
  • saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, 2-oxa-6- azaspiro[3.3]heptane, and quinuclidinyl.
  • heterocycle used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3/f-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl.
  • a heterocyclyl group may be mono- or bicyclic.
  • heterocyclylalkyl refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.
  • oxo-heterocyclyl refers to a heterocyclyl substituted by an oxo group.
  • heterocyclylene refers to a multivalent heterocyclyl group having the appropriate number of open valences to account for groups attached to it. For example, “heterocyclylene” is a bivalent heterocyclyl group when it has two groups attached to it; “heterocyclylene” is a trivalent heterocyclyl group when it has three groups attached to it.
  • partially unsaturated refers to a ring moiety that includes at least one double or triple bond.
  • the term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.
  • compounds of the disclosure may contain “optionally substituted” moieties.
  • substituted whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent.
  • an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position.
  • Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds.
  • stable refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.
  • R* is C1-6 aliphatic
  • R* is optionally substituted with halogen, - R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH 2 , -NHR*, -NR* 2 , or -NO2, wherein each R* is independently selected from C1-4 aliphatic, -CH2PI1, -0(CH2)o-iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R* is unsubstituted or where preceded by halo is substituted only with one or more halogens.
  • An optional substituent on a substitutable nitrogen is independently -R ⁇ -NR ⁇ , - C(O)R T , -C(O)OR t , -C(O)C(O)R t , -C(O)CH 2 C(O)R t , -S(O) 2 R T , -S(O) 2 NR t 2, -C(S)NR t 2 , - C(NI I)NR'?, or -NfR'jSfOfR'; wherein each R 1 ' is independently hydrogen, C1-6 aliphatic, unsubstituted -OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, two independent occurrences of R ⁇ taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or
  • the term "pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1—19, incorporated herein by reference.
  • Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases.
  • Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid
  • organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pect
  • Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N + (C 1-4 alky 1)4 salts.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl sulfonate.
  • structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the disclosure. Unless otherwise stated, all tautomeric forms of the compounds of the disclosure are within the scope of the disclosure.
  • structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms.
  • compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a 13 C- or 14 C-enriched carbon are within the scope of this disclosure.
  • Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present disclosure.
  • this D represents a mixture of hydrogen and deuterium where the amount of deuterium is about 100% (i.e., the abundance of deuterium ranges from at least 90% up to 100%). In certain embodiments, the abundance of deuterium in D is from 95% to 100%, or from 97% to 100%.
  • Deuterium ( 2 H) is a stable, non-radioactive isotope of 'H hydrogen and has an atomic weight of 2.014. Hydrogen naturally occurs as a mixture of the isotopes L H hydrogen (z.c., protium), deuterium ( 2 H), and tritium ( 3 H).
  • deuterium The natural abundance of deuterium is 0.015%.
  • H atom actually represents a mixture of 'H hydrogen, deuterium ( 2 H), and tritium ( 3 H), where about 0.015% is deuterium.
  • Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization.
  • Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher’s acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers.
  • an appropriate optically active compound e.g., chiral auxiliary such as a chiral alcohol or Mosher’s acid chloride
  • a particular enantiomer of a compound of the present disclosure may be prepared by asymmetric synthesis.
  • diastereomeric salts are formed with an appropriate optically- active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means known in the art, and subsequent recovery of the pure enantiomers.
  • Individual stereoisomers of the compounds of the disclosure may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers.
  • Chiral center(s) in a compound of the present disclosure can have the S or R configuration as defined by the IUPAC 1974 Recommendations.
  • a compound described herein may exist as a atropisomer (e.g., substituted biaryls)
  • all forms of such atropisomer are considered part of this disclosure.
  • Chemical names, common names, and chemical structures may be used interchangeably to describe the same structure. If a chemical compound is referred to using both a chemical structure and a chemical name, and an ambiguity exists between the structure and the name, the structure predominates. It should also be noted that any carbon as well as heteroatom with unsatisfied valences in the text, schemes, examples and tables herein is assumed to have the sufficient number of hydrogen atom(s) to satisfy the valences.
  • alkyl refers to a saturated straight or branched hydrocarbon, such as a straight or branched group of 1-12, 1-10, or 1-6 carbon atoms, referred to herein as C1-C12 alkyl, C1-C10 alkyl, and Ci-Ce alkyl, respectively.
  • Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2 -methyl- 1 -propyl, 2-methyl-2-propyl, 2 -methyl- 1 -butyl, 3- methyl-1 -butyl, 2-methyl-3 -butyl, 2,2-dimethyl-l -propyl, 2-methyl-l -pentyl, 3-methyl-l-pentyl, 4-methyl-l -pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-l- butyl, 3,3-dimethyl-l-butyl, 2-ethyl-l-butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, etc.
  • cycloalkyl refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein, e.g., as “C3-C6 cycloalkyl,” derived from a cycloalkane.
  • exemplary cycloalkyl groups include cyclohexyl, cyclopentyl, cyclobutyl, and cyclopropyl.
  • cycloalkylene refers to a bivalent cycloalkyl group.
  • haloalkyl refers to an alkyl group that is substituted with at least one halogen.
  • exemplary haloalkyl groups include -CH2F, -CHF2, -CF3, -CH2CF3, -CF2CF3, and the like.
  • haloalkylene refers to a bivalent haloalkyl group.
  • halomethyl refers to a haloalkyl group containing a single carbon atom.
  • hydroxyalkyl refers to an alkyl group that is substituted with at least one hydroxyl.
  • exemplary hydroxyalkyl groups include -CH2CH2OH, -C(H)(OH)CH3, -CH2C(H)(OH)CH2CH 2 OH, and the like.
  • alkenyl and alkynyl are art-recognized and refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.
  • carbocyclylene refers to a multivalent carbocyclyl group having the appropriate number of open valences to account for groups attached to it.
  • carbocyclylene is a bivalent carbocyclyl group when it has two groups attached to it; “carbocyclylene” is a trivalent carbocyclyl group when it has three groups attached to it.
  • alkoxyl or “alkoxy” are art-recognized and refer to an alkyl group, as defined above, having an oxygen radical attached thereto. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like.
  • haloalkoxyl refers to an alkoxyl group that is substituted with at least one halogen.
  • exemplary haloalkoxyl groups include -OCH 2 F, -OCHF 2 , -OCF 3 , -OCH 2 CF 3 , -OCF 2 CF 3 , and the like.
  • the symbol “ ” indicates a point of attachment.
  • the substituent may be attached at any available position on the ring.
  • the chemical structur encompass , and .
  • the one or more substituent(s) may be independently attached to any of the rings crossed by the bond.
  • the chemical structur encompasses, for example, .
  • any substituent or variable occurs more than one time in any constituent or the compound of the disclosure, its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated.
  • One or more compounds of the disclosure may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the disclosure embrace both solvated and unsolvated forms.
  • “Solvate” means a physical association of a compound of this disclosure with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances, the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid.
  • Solidvate encompasses both solution-phase and isolatable solvates.
  • suitable solvates include ethanolates, methanolates, and the like.
  • “Hydrate” is a solvate wherein the solvent molecule is H2O.
  • the terms “subject” and “patient” are used interchangeable and refer to organisms to be treated by the methods of the present disclosure.
  • Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans.
  • IC50 is art-recognized and refers to the concentration of a compound that is required to achieve 50% inhibition of the target.
  • the term “effective amount” refers to the amount of a compound sufficient to effect beneficial or desired results (e.g., a therapeutic, ameliorative, inhibitory or preventative result).
  • An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
  • the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.
  • composition refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.
  • the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents.
  • the compositions also can include stabilizers and preservatives.
  • stabilizers and adjuvants see e.g, Martin, Remington’s Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA [1975],
  • salts of the compounds of the present disclosure are contemplated as being pharmaceutically acceptable.
  • salts of acids and bases that are non- pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.
  • a compound of the disclosure contains both a basic moiety (such as, but not limited to, a pyridine or imidazole) and an acidic moiety (such as, but not limited to, a carboxylic acid) zwitterions (“inner salts”) may be formed.
  • acidic and basic salts used within the scope of the disclosure are pharmaceutically acceptable (z.e., non-toxic, physiologically acceptable) salts.
  • Such salts of the compounds of the disclosure may be formed, for example, by reacting a compound of the disclosure with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.
  • compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present disclosure that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present disclosure that consist essentially of, or consist of, the recited processing steps.
  • compositions specifying a percentage are by weight unless otherwise specified.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, or -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 ));
  • R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro;
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 )2-CO2R 9 ;
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said
  • variables in Formula I above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula I, or an enantiomer thereof.
  • the compound is a compound of Formula I.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, or - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 ));.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is -P(O)(OR 4 ) 2 .
  • R 1 is -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is selected from the groups depicted in the compounds in Table 1 and 6- C, below.
  • R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro. In some embodiments, R 2 is fluoro and R 3 is hydrogen. In some embodiments, R 2 is hydrogen and R 3 is fluoro. In certain embodiments, R 2 and R 3 are selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0083] In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C 3-6 alkyl.
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH 2 -OC(O)O-(C 1-6 alkyl).
  • R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C 1-10 alkyl). [0085] In some embodiments, R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl. [0086] In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl).
  • R 4 is -(C 1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 .
  • R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 .
  • R 5 is naphthyl substituted with m instances of R 10 .
  • R 5 is .
  • R 5 is phenyl.
  • R 5 is naphthyl.
  • R 5 is 1-naphthyl.
  • R 5 is 2-naphthyl.
  • R 5 is selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 6 is hydrogen or C 1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is C 1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . . , certain embodiments,
  • R 7 is In certain embodiments, R 7 is is j ' ⁇ '' . In certain embodiments, R 7 is • A ⁇ v . In certain embodiments, R 7 is In certain embodiments, R 7 is . he groups depicted in the compounds in Table 1 and 6-C, below. [0098] As defined generally above, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0100] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0104] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0105] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0106] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0107] As defined generally above, R 9 is C 1-6 alkyl or C 2-6 alkenyl; wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R 9 is allyl or -CH 2 -phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0109] In certain embodiments, R 9 is C1-6 alkyl or C2-6 alkenyl. [0110] In certain embodiments, R 9 is C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C 1-6 alkyl substituted with phenyl. [0111] In certain embodiments, R 9 is C1-6 alkyl. In certain embodiments, R 9 is C1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C 4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0112] In certain embodiments, R 9 is C2-6 alkenyl. [0113] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0115] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C 1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C1-4 haloalkyl.
  • R 10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 1 and 6-C, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3.
  • R 11 is hydrogen, fluoro, -CH 3 , or -CF 3 .
  • R 11 is halo, -CH 3 , or -CF 3 .
  • R 11 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0120] As defined generally above In some embodiments, B 1 i . In some embodiment . [0121] In some embodiments, B 1 i , and R 11 is hydrogen or halo. In some 1 is [0122] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3.
  • m is selected from the values represented in the compounds in Table 1 and 6-C, below.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2;
  • R 2 is fluoro and R 3 is hydrogen, or
  • R 2 is hydrogen and R 3 is fluoro;
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C
  • variables in Formula I-1 above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula I-1, or an enantiomer thereof.
  • the compound is a compound of Formula I-1.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2. In certain embodiments, R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 ) 2 . In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 1, below. [0128] As defined generally above, R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro. In some embodiments, R 2 is fluoro and R 3 is hydrogen.
  • R 2 is hydrogen and R 3 is fluoro. In certain embodiments, R 2 and R 3 are selected from the groups depicted in the compounds in Table 1, below. [0129] As defined generally above, R 4 represents independently for each occurrence C 1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0130] In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C 3-6 alkyl. [0131] In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 is C 1-6 alkyl. In some embodiments, R 4 is C 1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl. [0133] In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 1, below. [0134] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0136] In certain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 1, below. [0137] As defined generally above, R 6 is hydrogen or C1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is C1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 1, below. [0139] As defined generally above, R 7 is -C(R 8 ) 2 -CO 2 R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . [0140] In certain embodiments , . In certain embodiments or . In certain embodiments In certain embodiments . [0143] In certain embodiments, R 7 i . In certain embodiments, R 7 is In certain embodiments, R 7 ertain embodiments, R 7 i .
  • R 7 is . In certain embodiments, R 7 . In certain embodiments, R 7 is tain embodiments . [0144] In certain embodiments, R 7 is selected from the groups depicted in the compounds in Table 1, below. [0145] As defined generally above, R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0146] In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0147] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0151] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0152] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0153] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 1, below. [0154] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0156] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0157] In certain embodiments, R 9 is C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0158] In certain embodiments, R 9 is C1-6 alkyl. In certain embodiments, R 9 is C1-4 alkyl.
  • R 9 is C 1-2 alkyl or C 4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0159] In certain embodiments, R 9 is C 2-6 alkenyl. [0160] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 1, below.
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0162] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence C1.4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 1, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R 11 is halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, halo, or - CF3. In some embodiments, R 11 is hydrogen, halo, or -CH3. In some embodiments, R 11 is -CH3 or -CF3. In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF3. In some embodiments, R 11 is halo or -CF3. In some embodiments, R 11 is halo or -CH3.
  • B 1 is . In some embodiments, [0168] In some embodiments, B 1 is , and R 11 is hydrogen or halo. In some embodiments, certain embodiments, B 1 is selected from the groups depicted in the compounds in Table 1, below.
  • m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 1, below.
  • Another aspect of the disclosure provides a compound represented by Formula II: or a pharmaceutically acceptable salt thereof; wherein:
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 ) 2 , or -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 ));;
  • R 2 and R 3 are hydrogen
  • R 4 represents independently for each occurrence -(Ci-4 alkylene)-OC(0)0-(Ci-io alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or Ci-4 alkyl
  • R 7 is -C(R 8 ) 2 -CO 2 R 9
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring
  • R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl
  • nd [0172]
  • the definitions of variables in Formula II above encompass multiple chemical groups.
  • the definition of a variable is a single chemical group selected from those chemical groups set forth above
  • the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above
  • the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula II.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 ) 2 , or - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is -P(O)(OR 4 ) 2 .
  • R 1 is -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is selected from the groups depicted in the compounds in Table 2, below.
  • R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH2-OC(O)O-(C1-6 alkyl).
  • R 4 is -(C1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 2, below. [0179] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl. [0180] In certain embodiments, R 5 is phenyl substituted with m instances of R 10 .
  • R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0181] In certain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 2, below. [0182] As defined generally above, R 6 is hydrogen or C1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl. [0183] In certain embodiments, R 6 is hydrogen. In certain embodiments, R 6 is C 1-4 alkyl.
  • R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 2, below. [0184] As defined generally above, R 7 is -C(R 8 ) 2 -CO 2 R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . . , certain embodiments,
  • R 7 is In certain embodiments, R 7 is is j ' ⁇ '' . In certain embodiments, R 7 is • A ⁇ v . In certain embodiments, R 7 is In certain embodiments, R 7 is . he groups depicted in the compounds in Table 2, below. [0190] As defined generally above, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0192] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0196] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0197] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0198] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 2, below. [0199] As defined generally above, R 9 is C 1-6 alkyl or C 2-6 alkenyl; wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R 9 is allyl or -CH 2 -phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0201] In certain embodiments, R 9 is C1-6 alkyl or C2-6 alkenyl. [0202] In certain embodiments, R 9 is C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C 1-6 alkyl substituted with phenyl. [0203] In certain embodiments, R 9 is C1-6 alkyl. In certain embodiments, R 9 is C1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C 4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0204] In certain embodiments, R 9 is C2-6 alkenyl. [0205] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 2, below.
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0207] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C 1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C1-4 haloalkyl.
  • R 10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 2, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3.
  • R 11 is hydrogen, fluoro, -CH 3 , or -CF 3 .
  • R 11 is halo, -CH 3 , or -CF 3 .
  • R 11 is hydrogen, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, halo, or - CF3. In some embodiments, R 11 is hydrogen, halo, or -CH3. In some embodiments, R 11 is -CH3 or -CF 3 . In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF3. In some embodiments, R 11 is halo or -CF3. In some embodiments, R 11 is halo or -CH3.
  • R 11 is selected from the groups depicted in the compounds in Table 2, below. [0212] As defined generally above me embodiments, B 1 i . In some embodiment . [0213] In some embodiments, B 1 , and R 11 is hydrogen or halo. In some embodiments, B 1 is selected from , below. [0214] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2.
  • n is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2, below. [0215] The description above describes multiple embodiments relating to compounds of Formula II. The patent application specifically contemplates all combinations of the embodiments.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2;
  • R 2 and R 3 are hydrogen;
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 )2-CO2R 9 ;
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring
  • variables in Formula II-1 above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula II-1.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 ) 2 .
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 )2. In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 2, below. [0220] As defined generally above, R 2 and R 3 are hydrogen. [0221] As defined generally above, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. [0222] In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C6-10 alkyl).
  • R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0223] In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 is -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 2, below. [0224] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0226] In certain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 2, below. [0227] As defined generally above, R 6 is hydrogen or C 1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is C1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 2, below. [0229] As defined generally above, R 7 is -C(R 8 )2-CO2R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO 2 R 9 . . , certain embodiments,
  • R 7 is In certain embodiments, R 7 is i I ertain embodiments, R 7 i . In certain embodiments, R 7 is . In certain embodiments, R 7 . In certain embodiments, R 7 is rtain embodiments . embodiments, R 7 he groups depicted in the compounds in Table 2, below. [0235] As defined generally above, R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0237] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0239] In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 1-4 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 1-3 alkyl. In certain embodiments, R 8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0241] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0242] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0243] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 2, below. [0244] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0246] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0247] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0248] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl.
  • R 9 is C2-6 alkenyl.
  • R 9 is selected from the groups depicted in the compounds in Table 2, below.
  • R 10 represents independently for each occurrence halo, CM alkyl, Ci-4 haloalkyl, or C1.4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, CM alkyl, or CM haloalkyl.
  • R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence CM alkyl. In certain embodiments, R 10 represents independently for each occurrence CM haloalkyl. In certain embodiments, R 10 represents independently for each occurrence CM alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 2, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R 11 is halo, -CH3, or -CF3. In some embodiments, R u is hydrogen, -CH3, or -CF3. In some embodiments, R n is hydrogen, halo, or - CF3. In some embodiments, R 11 is hydrogen, halo, or -CH3. In some embodiments, R 11 is -CH3 or -CF3. In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF3. In some embodiments, R 11 is halo or -CF3. In some embodiments, R 11 is halo or -CH3. In some embodiments, R 11 is halo or -CH3. In some embodiments, R 11 is halo
  • R u is -CH3, -CD3, or -CF3.
  • R 11 is -CH3 or -CD3.
  • R 11 is -CD3 or -CF3.
  • R 11 is hydrogen. In some embodiments, R 11 is halo.
  • B is , and R is hydrogen or halo. In some embodiments, certain embodiments, B is selected from the groups depicted in the compounds in Table 2, below.
  • m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2, below.
  • R 2 and R 3 are hydrogen
  • R 4 represents independently for each occurrence Ci-6 alkyl or -(CM alkylene)-OC(O)O- (Ci-io alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 represents independently for each occurrence hydrogen or Ci-4 alkyl
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 ;
  • R 8 represents independently for each occurrence Ci-6 alkyl or hydrogen, wherein said Ci-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring;
  • R 9 is Ci-6 alkyl or C 2 -6 alkenyl; wherein said Ci-6 alkyl is optionally substituted with phenyl;
  • R 10 represents independently for each occurrence halo, Ci-4 alkyl, CM haloalkyl, or CM alkoxyl;
  • R 12 is hydrogen, -CH 2 C1, -CH 2 F, -CH 2 Br, -CH 2 I, -CF 3 , or Ci- 3 aliphatic;
  • the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula III, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula III.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, - P(O)(N(R 6 )(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR 6 ), or - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is -P(O)(OR 4 ) 2 .
  • R 1 is P(O)(N(R 6 )(benzyl))(-O-(C 1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR 6 ). In certain embodiments, R 1 is - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )). In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0265] As defined generally above, R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C 1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl. [0268] In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl).
  • R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C 1-10 alkyl). [0269] In some embodiments, R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl.
  • R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH2-OC(O)O-(C1-6 alkyl).
  • R 4 is -(C1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0271] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl. [0272] In certain embodiments, R 5 is phenyl substituted with m instances of R 10 .
  • R 5 is naphthyl substituted with m instances of R 10 .
  • R 5 is . ertain embodiments, R 5 is phenyl.
  • R 5 is naphthyl.
  • R 5 is 1-naphthyl.
  • R 5 is 2-naphthyl.
  • R 5 is selected from the groups depicted in the compounds in Table 3, below. [0274] As defined generally above, R 6 represents independently for each occurrence, hydrogen or C 1-4 alkyl. In certain embodiments, R 6 represents independently for each occurrence hydrogen or methyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 represents independently for each occurrence C 1-4 alkyl. In certain embodiments, R 6 is C 1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0276] As defined generally above, R 7 is -C(R 8 ) 2 -CO 2 R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . . , certain embodiments, [0280] In certain embodiments, R 7 i . In certain embodiments, R 7 is R 7 . In certain embodiments, R 7 .
  • R 7 is tain embodiments .
  • R 7 he groups depicted in the compounds in Table 3 and 6-C, below.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0284] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0288] In certain embodiments, one occurrence of R 8 is C 1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0289] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0290] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0291] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0293] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0294] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0295] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0296] In certain embodiments, R 9 is C2-6 alkenyl. [0297] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 3 and 6-C, below.
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; provided that when R 5 is phenyl, R 6 is hydrogen, and R 7 is , then m is 1, 2, or 3, and R 10 represents independently for each occurrence halo, C 2-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. [0299] In certain embodiments, R 10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C 1-4 alkyl, or C 1-4 haloalkyl.
  • R 10 represents independently for each occurrence halo, C 2-4 alkyl, or C 1-4 haloalkyl. [0300] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 alkoxyl.
  • R 10 is selected from the groups depicted in the compounds in Table 3 and 6-C, below.
  • R 11 is halo or -CF3.
  • R 12 is hydrogen, -CH2CI, -CH2F, -CFbBr, -CH2I, -CF3, or C1.3 aliphatic.
  • R 12 is -CH2CI, -CH2F, -CFFBr, -CH2I, -CF3, or C1.3 aliphatic.
  • R 12 is hydrogen.
  • R 12 is -CH2CI.
  • R 12 is -CH2F.
  • R 12 is -CFBBr.
  • R 12 is -CH2I.
  • R 12 is -CF3.
  • R 12 is C1.3 aliphatic.
  • R 12 is C1.3 methyl.
  • R 12 is selected from the groups depicted in the compounds in Tables 3 and 6-C, below.
  • B 1 is selected from the groups d 6-C, below.
  • m is 0, 1, 2, or 3; provided that when R 5 is phenyl, R 6 is hydrogen, and R 7 is , then m is 1, 2, or 3, and R 10 represents independently for each occurrence halo, C 2-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl.
  • m is 0.
  • m is 1.
  • m is 2.
  • m is 3.
  • m is 0 or 1.
  • m is 1 or 2.
  • m is 2 or 3.
  • m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3 and 6-C, below. [0308] The description above describes multiple embodiments relating to compounds of Formula III. The patent application specifically contemplates all combinations of the embodiments.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2;
  • R 2 and R 3 are hydrogen;
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 )2-CO2R 9 ;
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon
  • variables in Formula III-1 above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula III-1, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula III-1.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2. In certain embodiments, R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 )2. In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 3, below. [0313] As defined generally above, R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl. [0316] In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl).
  • R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0317] In some embodiments, R 4 is C 1-6 alkyl. In some embodiments, R 4 is C 1-4 alkyl. In some embodiments, R 4 is C 3-6 alkyl.
  • R 4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 1-2 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl).
  • R 4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 3, below. [0319] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl. [0320] In certain embodiments, R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0321] In certain embodiments, R 5 is phenyl.
  • R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 3, below. [0322] As defined generally above, R 6 is hydrogen or C 1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl. [0323] In certain embodiments, R 6 is hydrogen. In certain embodiments, R 6 is C 1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 3, below.
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 .
  • R 7 is - C(H)(R 8 )-CO2R 9 . , . , certain embodiments,
  • R 7 is . In certain embodiments, R 7 is , . In certain embodiments, R 7 rtain embodiments, R 7 is . In certain embodiments, R 7 is In certain embodiments, R 7 is In certain embodiments, R 7 is . he groups depicted in the compounds in Table 3, below. [0330] As defined generally above, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0332] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0336] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0337] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0338] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 3, below. [0339] As defined generally above, R 9 is C 1-6 alkyl or C 2-6 alkenyl; wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R 9 is allyl or -CH 2 -phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0341] In certain embodiments, R 9 is C1-6 alkyl or C2-6 alkenyl. [0342] In certain embodiments, R 9 is C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C 1-6 alkyl substituted with phenyl. [0343] In certain embodiments, R 9 is C1-6 alkyl. In certain embodiments, R 9 is C1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C 4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0344] In certain embodiments, R 9 is C2-6 alkenyl. [0345] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 3, below.
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; provided that when R 5 is phenyl, R 6 is hydrogen, and R 7 is , then m is 1, 2, or 3, and R 10 represents independently for each occurrence halo, C 2-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. [0347] In certain embodiments, R 10 represents independently for each occurrence halo, C 2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl.
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, or C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence halo, C 2-4 alkyl, or C 1-4 haloalkyl. [0348] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl.
  • B 1 is and R 11 is halo. In some embodiments, certain embodiments, B 1 is selected from the groups depicted in the compounds in Table 3, below.
  • m is 0, 1, 2, or 3; provided that when R 5 is phenyl, R 6 is O
  • m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3, below.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, or -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 ));
  • R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro;
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C1-4 alkyl;
  • R 7 is -C(R 8 )2-CO2R 9 ;
  • R 8 represents independently for each occurrence C 1-6 alkyl
  • variables in Formula IV above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula IV, or an enantiomer thereof.
  • the compound is a compound of Formula IV.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, or - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is hydrogen or -P(O)(OR 4 )2.
  • R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2.
  • R 1 is hydrogen. In certain embodiments, R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 )2. In certain embodiments, R 1 is -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )). In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C below. [0360] As defined generally above, R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro. In some embodiments, R 2 is fluoro and R 3 is hydrogen.
  • R 2 is hydrogen and R 3 is fluoro.
  • R 2 and R 3 are selected from the groups depicted in the compounds in Table 1, 4, and 6-C, below.
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0362] In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C 3-6 alkyl. [0363] In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl).
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C 1-10 alkyl).
  • R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl. [0365] In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 is -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0366] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0368] In certain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0369] As defined generally above, R 6 is hydrogen or C1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is C1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0371] As defined generally above, R 7 is -C(R 8 )2-CO2R 9 . In certain embodiments, R 7 is -
  • R 7 is In certain embodiments, R 7 is rtain embodiments, R 7 is . In certain embodiments, R 7 is
  • R 7 is In certain embodiments, R 7 is ain embodiments,
  • R 7 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0379] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0383] In certain embodiments, one occurrence of R 8 is C 1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0384] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0385] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0386] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0388] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0389] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0390] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0391] In certain embodiments, R 9 is C 2-6 alkenyl. [0392] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below.
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0394] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C1-4 haloalkyl.
  • R 10 represents independently for each occurrence C 1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below.
  • R 11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R 11 is halo, -CH3, or -CF3.
  • R 11 is hydrogen, -CH 3 , or -CF 3 . In some embodiments, R 11 is hydrogen, halo, or - CF 3 . In some embodiments, R 11 is hydrogen, halo, or -CH 3 . In some embodiments, R 11 is -CH 3 or -CF3. In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF 3 . In some embodiments, R 11 is halo or -CF 3 . In some embodiments, R 11 is halo or -CH 3 . In some embodiments, R 11 is halo or -CH 3 .
  • R 11 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C, below. [0399] As defined generally above . In some embodiments, B 1 i . In some embodiment . [0400] In some embodiments, B 1 i , and R 11 is hydrogen or halo. In some embodiments, B 1 is selected from , 4, and 6-C , below. [0401] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3.
  • m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table IV. The patent application specifically contemplates all combinations of the embodiments.
  • Another aspect of the disclosure provides a compound represented by Formula IV-1: (IV-1) an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 ) 2 ; R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro; R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen; R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10
  • variables in Formula IV-1 above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula IV-1, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula IV-1.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 )2. In certain embodiments, R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is hydrogen or -P(O)(OR 4 ) 2 . In certain embodiments, R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or - P(O)(OR 4 ) 2 . [0406] In certain embodiments, R 1 is hydrogen.
  • R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 )2. In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0407] As defined generally above, R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro. In some embodiments, R 2 is fluoro and R 3 is hydrogen. In some embodiments, R 2 is hydrogen and R 3 is fluoro. In certain embodiments, R 2 and R 3 are selected from the groups depicted in the compounds in Table 1 and 4, below.
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C 1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl. [0410] In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl).
  • R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C 1-10 alkyl). [0411] In some embodiments, R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl.
  • R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1- 2 alkylene)-OC(O)O-(C6-10 alkyl).
  • R 4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0413] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl. [0414] In certain embodiments, R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [ ] n certain embodiments, R 5 is phenyl.
  • R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0416] As defined generally above, R 6 is hydrogen or C1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl. [0417] In certain embodiments, R 6 is hydrogen. In certain embodiments, R 6 is C 1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 1 and 4, below.
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . [0419] In certain embodiments ,
  • R 7 is R 7 is .
  • R 7 is 7 is [0423]
  • R is selected from the groups depicted in the compounds in Table 1 and 4, below.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0426] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C 1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C1-3 alkyl.
  • R 8 represents independently for each occurrence C 2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0430] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C 1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0431] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0432] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0433] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0435] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0436] In certain embodiments, R 9 is C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0437] In certain embodiments, R 9 is C1-6 alkyl. In certain embodiments, R 9 is C1-4 alkyl.
  • R 9 is C 1-2 alkyl or C 4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0438] In certain embodiments, R 9 is C 2-6 alkenyl. [0439] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 1 and 4, below.
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0441] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl.
  • R 10 represents independently for each occurrence C 1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 1 and 4, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R 11 is halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, -CH 3 , or -CF 3 .
  • m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 1 and 4, below.
  • Another aspect of the disclosure provides a compound represented by Formula V: or a pharmaceutically acceptable salt thereof; wherein:
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 ) 2 , or -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 ));
  • R 2 and R 3 are hydrogen
  • R 4 represents independently for each occurrence Ci-6 alkyl or -(C1-4 alkylene)-OC(O)O- (Ci-io alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 )2-CO2R 9 ;
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring;
  • R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl;
  • R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl;
  • the definition of a variable is a single chemical group selected from those chemical groups set forth above
  • the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above
  • the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula V.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, or - P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )).
  • R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is hydrogen or -P(O)(OR 4 ) 2 .
  • R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 )2.
  • R 1 is hydrogen. In certain embodiments, R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 ) 2 . In certain embodiments, R 1 is -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )). In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0455] As defined generally above, R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl or -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C 1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl. [0458] In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl).
  • R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). [0459] In some embodiments, R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl.
  • R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 .
  • R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is
  • R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 6 is hydrogen or Ci-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is Ci-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 7 is -C(R 8 )I-CO2R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO 2 R 9 . certain embodiments . [0470] In certain embodiments, R 7 i . In certain embodiments, R 7 is R 7 . In certain embodiments, R 7 . In certain embodiments, R 7 is . [ ce a e o e s, s se ec e o he groups depicted in the compounds in Table 2 and 5, below.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen. [0475] In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0476] In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 1-3 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 2-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C3-6 alkyl. [0477] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0479] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl.
  • R 9 is -CH2-phenyl. [0483] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0484] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0485] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl. In certain embodiments, R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl.
  • R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0486] In certain embodiments, R 9 is C 2-6 alkenyl. [0487] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0488] As defined generally above, R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl.
  • R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C 1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3.
  • R 11 is hydrogen, fluoro, -CH 3 , or -CF 3 .
  • R 11 is halo, -CH 3 , or -CF 3 .
  • R 11 is hydrogen, -CH3, or -CF3.
  • R 11 is hydrogen, halo, or - CF3.
  • R 11 is hydrogen, halo, or -CH3.
  • R 11 is -CH3 or -CF3. In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF3. In some embodiments, R 11 is halo or -CF3. In some embodiments, R 11 is halo or -CH3.
  • B 1 is . In some embodiments,
  • B 1 is and R 11 is hydrogen or halo. In some embodiments, certain embodiments, B 1 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2 and 5, below. [0497] The description above describes multiple embodiments relating to compounds of Formula V. The patent application specifically contemplates all combinations of the embodiments.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 )2;
  • R 2 and R 3 are hydrogen;
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 ;
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a
  • the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula V-1.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 )2.
  • R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is hydrogen or -P(O)(OR 4 ) 2 . In certain embodiments, R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or - P(O)(OR 4 )2. [0502] In certain embodiments, R 1 is hydrogen. In certain embodiments, R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 ) 2 .
  • R 1 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl).
  • R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0505] In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl. [0506] In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 2-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C 3-6 alkyl. [0508] In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 1-2 alkylene)-OC(O)O-(C 1-6 alkyl).
  • R 4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0509] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . [0511] In certain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0512] As defined generally above, R 6 is hydrogen or C 1-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is C1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0514] As defined generally above, R 7 is -C(R 8 )2-CO2R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO 2 R 9 . , . ,
  • R 7 is In certain embodiments, R 7 is , certain embodiments, R 7 is I i b di R 7 i . In certain embodiments, R 7 is 7 is in Table 2 and 5, below.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0522] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0526] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0527] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0528] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0529] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0531] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0532] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0533] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C 4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0534] In certain embodiments, R 9 is C2-6 alkenyl. [0535] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0537] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C1-4 haloalkyl.
  • R 10 represents independently for each occurrence C 1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 2 and 5, below.
  • R 11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R 11 is halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, -CH 3 , or -CF 3 .
  • R 11 is hydrogen, halo, or - CF 3 . In some embodiments, R 11 is hydrogen, halo, or -CH 3 . In some embodiments, R 11 is -CH 3 or -CF3. In some embodiments, R 11 is hydrogen or halo. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH3. In some embodiments, R 11 is hydrogen or -CF 3 . In some embodiments, R 11 is halo or -CF 3 . In some embodiments, R 11 is halo or -CH 3 .
  • R 11 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0542] As defined generally above In some embodiments, B 1 i . In some embodiment . [0543] In some embodiments, B 1 i , and R 11 is hydrogen or halo. In some 1 is [0544] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3.
  • m is selected from the values represented in the compounds in Table 2 and 5, below.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, -P(O)(N(R 6 )(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR 6 ), or -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )); R 2 and R 3 are hydrogen; R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4
  • variables in Formula VI above encompass multiple chemical groups.
  • the application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula VI, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula VI.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), -P(O)(OR 4 )2, - P(O)(N(R 6 )(benzyl))(-O-(Ci- 4 alkylene)-S-C(O)-(Ci-6alkylene)-OR 6 ), or -
  • R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is hydrogen or -P(O)(OR 4 )2. In certain embodiments, R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 ) 2 .
  • R 1 is hydrogen. In certain embodiments, R 1 is - P(O)(OR'')(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 )2. In certain embodiments, R 1 is -P(O)(N(R 6 )(benzyl))(-O-(Ci-4 alkylene)-S-C(O)-(Ci-6 alkylene)-OR 6 ). In certain embodiments, R 1 is -P(O)(N(R 6 )(R 7 ))(N(R 6 )(R 7 )). In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 3, 6- A, 6-B and 6-C, below.
  • R 2 and R 3 are hydrogen.
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl).
  • R 4 represents independently for each occurrence C1-6 alkyl and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0553] In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C 3-6 alkyl. [0554] In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • R 4 is C 1-6 alkyl. In some embodiments, R 4 is C 1-4 alkyl. In some embodiments, R 4 is C 3-6 alkyl. [0556] In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 1-2 alkylene)-OC(O)O-(C 1-6 alkyl).
  • R 4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0557] As defined generally above, R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 . In certain embodiments, R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 . In certain embodiments, R 5 is naphthyl substituted with m instances of R 10 . In certain embodiments, R 5 is . ertain embodiments, R 5 is phenyl. In certain embodiments, R 5 is naphthyl. In certain embodiments, R 5 is 1-naphthyl. In certain embodiments, R 5 is 2-naphthyl. In certain embodiments, R 5 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0560] As defined generally above, R 6 represents independently for each occurrence hydrogen or C1-4 alkyl.
  • R 6 represents independently for each occurrence hydrogen or methyl. In certain embodiments, R 6 is hydrogen or methyl. [0561] In certain embodiments, R 6 is hydrogen. In certain embodiments, R 6 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 6 is C1-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0562] As defined generally above, R 7 is -C(R 8 )2-CO2R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO2R 9 . , . , certain embodiments .
  • R 7 i is n certain embodiments R 7 certain embodiments, R 7 i . In certain embodiments, R 7 is . In certain embodiments, R 7 . In certain embodiments, R 7 is . [ ce a e o e s, s se ec e o he groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen. [0571] In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0572] In certain embodiments, R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 1-3 alkyl. In certain embodiments, R 8 represents independently for each occurrence C 2-6 alkyl. In certain embodiments, R 8 represents independently for each occurrence C3-6 alkyl. [0573] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0575] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 is taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring.
  • R 8 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below.
  • R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl.
  • R 9 is -CH2-phenyl. [0579] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0580] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0581] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl. In certain embodiments, R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C4 alkyl.
  • R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0582] In certain embodiments, R 9 is C 2-6 alkenyl. [0583] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0584] As defined generally above, R 10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl.
  • R 10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C 1-4 alkyl, or C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence halo, C2-4 alkyl, or C1-4 haloalkyl. [0585] In certain embodiments, R 10 represents independently for each occurrence halo. In certain embodiments, R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl.
  • R 11 is hydrogen. In some embodiments, R 11 is halo. In some embodiments, R 11 is chloro, bromo, or fluoro. In some embodiments, R 11 is bromo or fluoro. In some embodiments, R 11 is chloro or fluoro. In some embodiments, R 11 is chloro or bromo. In some embodiments, R 11 is chloro. In some embodiments, R 11 is bromo. In some embodiments, R 11 is fluoro. In some embodiments, R 11 is -CF 3 . In some embodiments, R 11 is -CH 3 . In some embodiments, R 11 is -CD3. In some embodiments, R 11 is -CH2CH3.
  • m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3, 6-A, and 6-B, below.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 ) 2 ;
  • R 2 and R 3 are hydrogen;
  • R 4 represents independently for each occurrence C 1-6 alkyl or -(C 1-4 alkylene)-OC(O)O- (C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C 1-4 alkyl;
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 ;
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are
  • the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
  • the compound is a compound of Formula VI, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula VI.
  • R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 )2.
  • R 1 is hydrogen or -P(O)(OR 5 )(N(R 6 )(R 7 )).
  • R 1 is hydrogen or -P(O)(OR 4 ) 2 .
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or - P(O)(OR 4 )2.
  • R 1 is hydrogen.
  • R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )). In certain embodiments, R 1 is -P(O)(OR 4 ) 2 . In certain embodiments, R 1 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0602] As defined generally above, R 2 and R 3 are hydrogen. [0603] As defined generally above, R 4 represents independently for each occurrence C 1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen.
  • R 4 represents independently for each occurrence C1-6 alkyl or - (C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence C 1-6 alkyl and one occurrence of R 4 is further selected from hydrogen. In some embodiments, R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl) and one occurrence of R 4 is further selected from hydrogen. [0604] In some embodiments, R 4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R 4 represents independently for each occurrence C 1-4 alkyl. In some embodiments, R 4 represents independently for each occurrence C3-6 alkyl.
  • R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C 1-2 alkylene)-OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 represents independently for each occurrence -CH 2 -OC(O)O-(C 1-6 alkyl).
  • R 4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R 4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C 1-10 alkyl). [0606] In some embodiments, R 4 is C1-6 alkyl. In some embodiments, R 4 is C1-4 alkyl. In some embodiments, R 4 is C3-6 alkyl. [0607] In some embodiments, R 4 is -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl). In some embodiments, R 4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl).
  • R 4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R 4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R 4 is -CH 2 -OC(O)O-(C 1-6 alkyl). In some embodiments, R 4 is -(C 1- 2 alkylene)-OC(O)O-(C 6-10 alkyl). In some embodiments, R 4 is -(C 2-4 alkylene)-OC(O)O-(C 1-10 alkyl). In certain embodiments, R 4 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below.
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 .
  • R 5 is phenyl or naphthyl.
  • R 5 is phenyl substituted with m instances of R 10 .
  • R 5 is naphthyl substituted with m instances of R 10 .
  • R 5 is .
  • R 3 is phenyl.
  • R 5 is naphthyl.
  • R 5 is 1-naphthyl.
  • R 5 is 2-naphthyl.
  • R 3 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6- B, below.
  • R 6 is hydrogen or Ci-4 alkyl. In certain embodiments, R 6 is hydrogen or methyl.
  • R 6 is hydrogen. In certain embodiments, R 6 is Ci-4 alkyl. In certain embodiments, R 6 is methyl. In certain embodiments, R 6 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below.
  • R 7 is -C(R 8 )2-CO2R 9 . In certain embodiments, R 7 is - C(H)(R 8 )-CO 2 R 9 .
  • R 7 is In certain embodiments, R 7 is , certain embodiments, R 7 is I i b di R 7 i . In certain embodiments, R 7 is 7 is in Table 3, 6-A, and 6-B, below.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl.
  • R 8 represents independently for each occurrence C 1-6 alkyl; wherein said C 1-6 alkyl is optionally substituted with phenyl. [0621] In certain embodiments, R 8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R 8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R 8 represents independently for each occurrence benzyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring.
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen.
  • R 8 represents independently for each occurrence C1-6 alkyl.
  • R 8 represents independently for each occurrence C1-4 alkyl.
  • R 8 represents independently for each occurrence C 1-3 alkyl.
  • R 8 represents independently for each occurrence C2-6 alkyl.
  • R 8 represents independently for each occurrence C3-6 alkyl.
  • one occurrence of R 8 is C 1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R 8 is hydrogen. [0625] In certain embodiments, one occurrence of R 8 is C1-6 alkyl or hydrogen, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is C1-4 alkyl, and the other occurrence of R 8 is hydrogen. In certain embodiments, one occurrence of R 8 is methyl, and the other occurrence of R 8 is hydrogen.
  • R 8 is methyl. In certain embodiments, R 8 is hydrogen. [0626] In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0627] In certain embodiments, R 8 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0628] As defined generally above, R 9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl.
  • R 9 is C 1-6 alkyl, allyl, or -CH 2 -phenyl. In certain embodiments, R 9 is allyl or -CH2-phenyl. In certain embodiments, R 9 is allyl. In certain embodiments, R 9 is -CH2-phenyl. [0630] In certain embodiments, R 9 is C 1-6 alkyl or C 2-6 alkenyl. [0631] In certain embodiments, R 9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R 9 is C1-6 alkyl substituted with phenyl. [0632] In certain embodiments, R 9 is C 1-6 alkyl. In certain embodiments, R 9 is C 1-4 alkyl.
  • R 9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R 9 is methyl, ethyl, or C 4 alkyl. In certain embodiments, R 9 is methyl, ethyl, or isopropyl. In certain embodiments, R 9 is methyl or ethyl. In certain embodiments, R 9 is ethyl or isopropyl. [0633] In certain embodiments, R 9 is C2-6 alkenyl. [0634] In certain embodiments, R 9 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below.
  • R 10 represents independently for each occurrence halo, C 1-4 alkyl, C 1-4 haloalkyl, or C 1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R 10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence halo, C 2-4 alkyl, or C 1-4 haloalkyl. [0636] In certain embodiments, R 10 represents independently for each occurrence halo.
  • R 10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R 10 is bromo. In certain embodiments, R 10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 haloalkyl. In certain embodiments, R 10 represents independently for each occurrence C 1-4 alkoxyl. In certain embodiments, R 10 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below.
  • R 11 is hydrogen or halo.
  • R 11 is halo or -CF3.
  • R 11 is halo, -CH3, or -CF3. In some embodiments, R 11 is hydrogen, -CH 3 , or -CF 3 . In some embodiments, R 11 is hydrogen, halo, or - CF3. In some embodiments, R 11 is hydrogen, halo, or -CH3. In some embodiments, R 11 is -CH3 or -CF3. In some embodiments, R 11 is hydrogen or fluoro. In some embodiments, R 11 is hydrogen or -CH 3 . In some embodiments, R 11 is hydrogen or -CF 3 . In some embodiments, R 11 is halo or -CH 3 .
  • B 1 is selected from g , 6-A, and 6-B, below.
  • m is 0, 1, 2, or 3.
  • m is 0.
  • m is 1.
  • m is 2.
  • m is 3.
  • m is 0 or 1.
  • m is 1 or 2.
  • m is 2 or 3.
  • m is 0, 1, or 2.
  • m is 1, 2, or 3.
  • m is selected from the values represented in the compounds in Table 3, 6-A, and 6-B, below.
  • Another aspect of the disclosure provides a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, below, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, below.
  • Another aspect of the disclosure provides a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, below, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, below.
  • the compound is a compound in Table 1, 2, 3, or 6-A, below, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, 3, or 6-A, below.
  • the compound is a compound in Table 1, 2, or 3, below, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, or 3, below.
  • the compound is a compound in Table 1 or 4 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1 or 4 below. In certain embodiments, the compound is a compound in Table 2 or 5, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 2 or 5, below. In certain embodiments, the compound is a compound in Table 3, 6-A, or 6-B, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 3, 6-A, or 6-B, below.
  • the compound is a compound in Table 1 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1 below. In certain embodiments, the compound is a compound in Table 2 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 2 below. In certain embodiments, the compound is a compound in Table 3 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 3 below. In certain embodiments, the compound is a compound in Table 4 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 4 below.
  • the compound is a compound in Table 5 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 5 below. In certain embodiments, the compound is a compound in Table 6-A below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-A below. In certain embodiments, the compound is a compound in Table 6-B below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-B below. In certain embodiments, the compound is a compound in Table 6-C below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-C below. In certain embodiments, the compound is a compound in Table 6-D below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-D below.
  • cytosine, and 5- substituted cytosine, nucleobases may be protected using, for example, a substituted trityl protecting group.
  • Another aspect of the disclosure provides methods for treating medical disorders. This is described in more detail below.
  • Transposable elements are genomic DNA sequences that have the ability to move within the genome which leads to altering its organization, increase its size and creates duplications and redundancy. (Ukadike and Mustelin, J. Clin. Med., 10:856 (2021)). These genomic sequences are believed to have been introduced into the human genome by either an infection by exogenous retroviruses that infected human ancestors millions of years ago or ancient descendants of retroviruses which retained the ability to embed and replicate in human germline genome. (Ukadike and Mustelin, 2021).
  • LINE-1 Long Interspersed Nuclear Element 1
  • LINE-1 are class I transposable elements in the DNA of some organisms and comprise about 17% of the human genome.
  • LINE-1 harbors two open reading frames, ORF1 and ORF2, which in turn respectively encode ORF Ip which has nucleic acid chaperone activity and ORF2p with reverse transcriptase (RT) and endonuclease activities.
  • RT reverse transcriptase
  • LINE-1 retrotransposition activity is mediated by ORF2p.
  • the majority of LINE- 1 elements in the human genome contain inactivating mutations but a small percentage of LINE- 1 elements are intact and have retained the ability to retrotranspose.
  • LINE-1 activity is normally tightly regulated in the germline by DNA methylation, histone modifications, and piRNA.
  • Retrotransposons are transposable elements which are associated with the pathogenesis of many diseases such as cancer, autoimmune disease and neurological disorders, among others.
  • LINE-1 RNA and protein overexpression can promote apoptosis, DNA damage and repair, and cellular plasticity, which can promote tumor progression.
  • DNA damage caused by repetitive sequences (genome-wide or interspersed) hypomethylation can induce an inflammatory microenvironment. (Zhang, 2020).
  • LINE-1 activity has been found in many tumor tissues.
  • LINE-1 mediated gene rearrangement can trigger oncogene amplification.
  • LINE-1 can mediate the deletion of tumor suppressor genes (Zhange, 2020).
  • Inhibition of LINE- 1 RT in cancer cells either via RNA interface-dependent silencing of active LINE-1 elements or using RT inhibitory compounds can reduce cancer cell proliferation, promote cancer cell differentiation and can retard tumor progression in certain animal models. (Sciamann et al, Frontiers in Chemistry, 4:6 (Feb. 2016)).
  • LINE-1 RT uses a procedure termed target-site-primed reverse transcription (TPRT) which involves nicking of the genomic DNA followed by reverse transcription and insertion of LINE-1 into the genome.
  • TPRT target-site-primed reverse transcription
  • the products of LINE- 1 reverse transcription are potential triggers of DNA sensing receptors such as cGAS, which is a DNA sensor that activates the STING pathway leading to type 1 interferon production.
  • LINE-1 hypom ethylated and highly expressed LINE-1 has been found in many patients with autoimmune diseases such as systemic lupus erythematosus (SLE), Sjogren’s syndrome (SS) and psoriasis. (Zhang et al). LINE-1 has also been found to be significantly upregulated in patients with dermatomyositis (DM), which patients also showed significantly elevated levels of interferon a and interferon 0. (Kuriyama et al, J. Am. Acad, Dermatol., 84(4): 1103-1105 (2020)).
  • Interferon overproduction is a characteristic feature of type I interferonopathies. These include rare genetic diseases with occurrence rates from 1 : 10,000 to 1 : 1,000,000. Pathological overexpression of type I interferon causes immune system hyperactivation that leads to systemic inflammation which can affect the nervous system, lung and blood vessels, among other organ systems. (Nesterova et al. "Congenital and Acquired Interferonopathies: Differentiated Approaches to Interferon Therapy". Innate Immunity in Health and Disease, Ed. Saxena and Prakash, IntechOpen, 2020). LINE-1 expression has been shown to induce type I interferons, which lead to type I interferonopathies. (Ukadike and Mustelin, 2021). These diseases have very limited effective treatment options so there is a high unmet medical need in this area.
  • LINE-1 expression is high in brain tissue as compared to other organs. LINE-1 is active in neural progenitor cells and overexpression of LINE-1 increases somatic mosaicism. LINE-1 has also been implicated in neurological disorders such as ataxia telangiectasia (AT) and Rett syndrome. LINE-1 is also implicated in the aging process and frontotemporal lobe degeneration. (Zhang, 2020).
  • HERVs Human endogenous retroviruses
  • HERVs Human endogenous retroviruses
  • RTs reverse transcriptases
  • HERVs play a role in early development by rewiring the gene regulatory network of the preimplantation embryo (Fu et al, Biomolecules, 11(6):829 (2021)). HERV expression appears to be a hallmark of the undifferentiated state, the acquisition of phenotypic plasticity and stem cell character (Balestrieri et al, Frontiers in Microbiology, 9:1448 (2018)); traits associated with aggressive cancer and poor patient outcomes. HERV expression is normally tightly controlled in normal adult tissues but is reported to be aberrantly expressed in cancer (Downey et al, Int. J.
  • Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder.
  • the method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, to a subject in need thereof to treat the disorder.
  • a compound described in Section I above such as a compound of Formula I, II, or III
  • the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, I- 1 , II- 1, or III- 1 to a subject in need thereof to treat the disorder.
  • a compound described in Section I above such as a compound of Formula I, II, III, I- 1 , II- 1, or III- 1
  • the particular compound of Formula I, II, III, 1-1, II- 1 , or III- 1 is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the disorder is an immune disorder that is a viral infection.
  • Additional exemplary features that may characterize the First Therapeutic Method described herein are provided below and include, for example, disorders and patients to be treated.
  • Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection.
  • the method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula IV, V, or VI, to a subject in need thereof to treat the disorder.
  • a compound described in Section I above such as a compound of Formula IV, V, or VI
  • the particular compound of Formula IV, V, or VI is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula IV, V, VI, IV-1, V-l, or VI- 1 to a subject in need thereof to treat the disorder.
  • a compound described in Section I above such as a compound of Formula IV, V, VI, IV-1, V-l, or VI- 1
  • the particular compound of Formula IV, V, VI, IV-1, V-l, or VI-1 is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the compound is a compound of Formula IV, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the compound is a compound of Formula V, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound of Formula VI, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the compound is a compound of Formula IV-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the compound is a compound of Formula V-l, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound of Formula VI-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, above, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, above.
  • the compound is a compound in Table 1 , 2, 3, 4, 5, 6-A, or 6-B, above, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, above.
  • the compound is a compound in Table 4, 5, or 6- B, above, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 4, 5, or 6-B, above.
  • the compound is a compound in Table 4, 5, 6-B, or 6-C, above, or a pharmaceutically acceptable salt thereof.
  • the compound is a compound in Table 4, 5, 6-B, or 6C, above.
  • Additional exemplary features that may characterize the First and Second Therapeutic Methods described herein are provided below and include, for example, disorders and patients to be treated. A more thorough description of such features is provided below. The disclosure embraces all permutations and combinations of these features.
  • the compound of Formula I, II, III, IV, V, or VI, or other compound defined by the embodiments above is administered in a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier, as further described in Section V, below.
  • the compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III- 1 , IV-1, V-l, or Vl-lor other compound defined by the embodiments above is administered in a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier, as further described in Section V, below.
  • the method further comprises administering an effective amount of an additional therapeutic agent, as further described in Section IV, below.
  • the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2), human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2), respiratory syncytial virus (RSV), human papilloma virus (HPV), adenovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), varicella zoster virus (VZV), cytomegalovirus (CMV), herpes simplex viruses 1 or 2 (HSV-1 or HSV-2), human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus), or a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
  • human immunodeficiency viruses 1 or 2 HIV-2
  • human T-cell leukemia viruses 1 or 2 HTLV-1 or HTLV-2
  • RSV respiratory syncytial virus
  • the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2). In certain embodiments, the viral infection is an infection by human immunodeficiency virus 1 (HIV-1). In certain embodiments, the viral infection is an infection by human immunodeficiency virus 2 (HIV-2). In certain embodiments, the viral infection is an infection by human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2). In certain embodiments, the viral infection is an infection by respiratory syncytial virus (RSV). In certain embodiments, the viral infection is an infection by human papilloma virus (HPV). In certain embodiments, the viral infection is an infection by adenovirus.
  • RSV respiratory syncytial virus
  • HPV human papilloma virus
  • the viral infection is an infection by adenovirus.
  • the viral infection is an infection by hepatitis B virus (HBV). In certain embodiments, the viral infection is an infection by hepatitis C virus (HCV). In certain embodiments, the viral infection is an infection by Epstein-Barr virus (EBV). In certain embodiments, the viral infection is an infection by varicella zoster virus (VZV). In certain embodiments, the viral infection is an infection by cytomegalovirus (CMV). In certain embodiments, the viral infection is an infection by herpes simplex viruses 1 or 2 (HSV-1 or HSV-2). In certain embodiments, the viral infection is an infection by human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus). In certain embodiments, the viral infection is an infection by a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
  • the viral infection is an infection by an adenovirus. In certain embodiments, the viral infection is an infection by a herpesvirus. In certain embodiments, the viral infection is an infection by a poxvirus. In certain embodiments, the viral infection is an infection by a parvovirus. In certain embodiments, the viral infection is an infection by a reovirus. In certain embodiments, the viral infection is an infection by a picomavirus. In certain embodiments, the viral infection is an infection by a rhinovirus or enterovirus. In certain embodiments, the viral infection is an infection by a togavirus. In certain embodiments, the viral infection is an infection by an orthomyxovirus. In certain embodiments, the viral infection is an infection by a rhabdovirus. In certain embodiments, the viral infection is an infection by a retrovirus. In certain embodiments, the viral infection is an infection by a hepadnavirus.
  • the viral infection is an infection by a coronavirus.
  • the coronavirus is an alpha, beta, gamma, or delta coronavirus.
  • the viral infection is an infection by a coronavirus selected from 229E (alpha coronavirus), NL63 (alpha coronavirus), OC43 (beta coronavirus), HKU1 (beta coronavirus), MERS-CoV (beta coronavirus), SARS-CoV (beta coronavirus), and SARS-CoV-2 (coronavirus disease 2019, or COVID- 19).
  • the viral infection is an infection by an influenza virus. In certain embodiments, the viral infection is an infection by a type A or type B influenza virus. In certain embodiments, the viral infection is an infection by an influenza virus selected from H5N1, H1N1, and H3N2.
  • the viral infection is an infection by a poliovirus. In certain embodiments, the viral infection is an infection by a type 1 poliovirus. In certain embodiments, the viral infection is an infection by a type 2 poliovirus. In certain embodiments, the viral infection is an infection by a type 3 poliovirus.
  • the disorder is cancer.
  • the cancer is a solid tumor or leukemia.
  • the cancer is a solid tumor.
  • the cancer is a carcinoma or melanoma.
  • the cancer is a carcinoma.
  • the cancer is a sarcoma.
  • the cancer is a melanoma.
  • the cancer is a lymphoma.
  • the cancer is a leukemia.
  • the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.
  • the cancer has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE 1 ORF2 polypeptide; (ii) activity of LINE 1 reverse transcriptase; (iii) expression of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
  • the cancer has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
  • the cancer has expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide.
  • the cancer has expression ofLINEl RNA.
  • the cancer has expression ofLINEl ORF1 polypeptide.
  • the cancer has expression ofLINEl ORF2 polypeptide.
  • the cancer has activity ofLINEl reverse transcriptase.
  • the cancer has (i) expression of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the cancer has expression of HERV-K RNA. In certain embodiments, the cancer has activity of HERV-K reverse transcriptase.
  • the cancer has elevated (i) levels of LINE1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) levels of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
  • the cancer has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
  • the cancer has elevated levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide.
  • the cancer has elevated levels ofLINEl RNA.
  • the cancer has elevated levels of LINE1 ORF1 polypeptide.
  • the cancer has elevated levels ofLINEl ORF2 polypeptide.
  • the cancer has elevated activity ofLINEl reverse transcriptase.
  • the cancer has elevated (i) levels of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the cancer has elevated levels of HERV-K RNA. In certain embodiments, the cancer has elevated activity of HERV-K reverse transcriptase.
  • the cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, esophageal cancer, head and neck cancer, renal cancer, ovarian cancer, or lung cancer.
  • the cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, ovarian cancer, or lung cancer.
  • the cancer is pancreatic cancer.
  • the cancer is pancreatic adenocarcinoma.
  • the cancer is colorectal cancer.
  • the cancer comprises microsatellite instable (MSI) colorectal cancer or microsatellite stable (MSS) colorectal cancer.
  • the cancer is breast cancer.
  • the cancer is prostate cancer. In certain embodiments, the cancer is esophageal cancer. In certain embodiments, the cancer is head and neck cancer. In certain embodiments, the cancer is renal cancer. In certain embodiments, the cancer is ovarian cancer. In certain embodiments, the cancer is lung cancer. In certain embodiments, the cancer is non-small cell lung carcinoma or small cell lung carcinoma. In certain embodiments, the cancer is non-small cell lung carcinoma . In certain embodiments, the cancer is small cell lung carcinoma.
  • the cancer is an epithelial cancer.
  • the epithelial cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, esophageal cancer, head and neck cancer, renal cancer, ovarian cancer, or lung cancer.
  • the epithelial cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, ovarian cancer, or lung cancer.
  • the colorectal cancer comprises microsatellite instable (MSI) colorectal cancer or microsatellite stable (MSS) colorectal cancer.
  • the cancer is a preneoplastic or early cancer lesion.
  • the cancer is intraductal papillary mucinous neoplasm (IPMN), pancreatic intraepithelial neoplasia (PanIN), ductal carcinoma in situ (DCIS), or Barrett’s Esophagus.
  • the cancer is pancreatic intraepithelial neoplasia (PanIN).
  • the cancer is ductal carcinoma in situ (DCIS).
  • the cancer is Barrett’s Esophagus.
  • the cancer has elevated levels of peri centrometric human satellite II (HSATII) RNA.
  • the cancer is a microsatellite instable (MSI) cancer.
  • the cancer is a microsatellite stable (MSS) cancer.
  • the cancer is selected from B cell lymphomas (e.g., B cell chronic lymphocytic leukemia, B cell non-Hodgkin lymphoma, cutaneous B cell lymphoma, diffuse large B cell lymphoma), basal cell carcinoma, bladder cancer, blastoma, brain metastasis, breast cancer, Burkitt lymphoma, carcinoma (e.g., adenocarcinoma (e.g., of the gastroesophageal junction)), cervical cancer, colon cancer, colorectal cancer (colon cancer and rectal cancer), endometrial carcinoma, esophageal cancer, Ewing sarcoma, follicular lymphoma, gastric cancer, gastroesophageal junction carcinoma, gastrointestinal cancer, glioblastoma (e.g., glioblastoma multiforme, e.g., newly diagnosed or recurrent), glioma, head and neck cancer (e.g., head and neck cancer (e.g., head and
  • the cancer is a virus-associated cancer.
  • virus-associated cancer means any cancer in which a virus is known to play a role.
  • Epstein-Barr virus (EBV) has been reported to be associated with the endemic variant of Burkitt lymphoma and certain other lymphomas. Infection by human papilloma virus (HPV) is believed to be responsible for certain types of cervical and/or genital cancer.
  • EBV Epstein-Barr virus
  • HPV human papilloma virus
  • HPV human papilloma virus
  • Human T-cell leukemia virus 1 has been reported to be linked adult T-cell leukemia/lymphoma (ATLL).
  • Human T-cell leukemia virus 2 (HTLV-2) has been reported to be linked to cutaneous T-cell lymphoma.
  • Human herpes virus 8 (HHV-8) is believed to cause Kaposi’s sarcoma in patients with AIDS.
  • the cancer is a cancer associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8.
  • the cancer is Burkitt lymphoma, cervical cancer, genital cancer, adult T-cell leukemia/lymphoma, cutaneous T-cell lymphoma, or Kaposi’s sarcoma.
  • the cancer is a cancer other than a virus-associated cancer.
  • the cancer is a cancer other than a cancer associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8.
  • the cancer is a cancer other than Burkitt lymphoma, cervical cancer, genital cancer, adult T-cell leukemia/lymphoma, cutaneous T-cell lymphoma, or Kaposi’s sarcoma.
  • the cancer is a tumor associated with Li-Fraumeni syndrome.
  • the cancer is mesothelioma, hepatobiliary (hepatic and biliary duct), bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, gastrointestinal (gastric, colorectal, and duodenal), uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin’s Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lympho
  • the cancer is hepatocellular carcinoma, ovarian cancer, ovarian epithelial cancer, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), prostate cancer, testicular cancer, gallbladder cancer, hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, Ewing sarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, gastrointestinal/stomach (GIST) cancer, lymphoma, squamous cell carcinoma of the head and neck (SCCHN), salivary gland cancer, glioma, or brain cancer, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST),
  • MPNST neurofibromat
  • the cancer is hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulin emi a, or medulloblastoma.
  • HCC hepatocellular carcinoma
  • UPSC uterine papillary serous carcinoma
  • the cancer is selected from renal cell carcinoma, or kidney cancer; hepatocellular carcinoma (HCC) or hepatoblastoma, or liver cancer; melanoma; breast cancer; colorectal carcinoma, or colorectal cancer; colon cancer; rectal cancer; anal cancer; lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC); ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine papillary serous carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; soft tissue and bone synovial sarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing sarcoma; anaplastic thyroid cancer; adrenocortical carcinoma; pancreatic cancer; pancreatic duct
  • the cancer is renal cell carcinoma, hepatocellular carcinoma (HCC), hepatoblastoma, colorectal carcinoma, colorectal cancer, colon cancer, rectal cancer, anal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, brain cancer, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulinemia, or medulloblastoma.
  • HCC hepatocellular
  • the cancer is hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulin emi a, or medulloblastoma.
  • HCC hepatocellular carcinoma
  • hepatoblastoma colon cancer
  • rectal cancer ovarian cancer
  • the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer, or ovarian carcinoma. In some embodiments, the cancer is ovarian epithelial cancer. In some embodiments, the cancer is fallopian tube cancer. In some embodiments, the cancer is papillary serous cystadenocarcinoma. In some embodiments, the cancer is uterine papillary serous carcinoma (UPSC). In some embodiments, the cancer is hepatocholangiocarcinoma.
  • HCC hepatocellular carcinoma
  • the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer, or ovarian carcinoma. In some embodiments, the cancer is ovarian epithelial cancer. In some embodiments,
  • the cancer is soft tissue and bone synovial sarcoma. In some embodiments, the cancer is rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is anaplastic thyroid cancer. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer, or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is glioma. In some embodiments, the cancer is malignant peripheral nerve sheath tumors (MPNST). In some embodiments, the cancer is neurofibromatosis- 1 associated MPNST. In some embodiments, the cancer is Waldenstrom’s macroglobulinemia. In some embodiments, the cancer is medulloblastoma.
  • MPNST peripheral nerve sheath tumors
  • the cancer is neurofibromatosis- 1 associated MPNST.
  • the cancer is Waldenstrom
  • the cancer is a leukemia (e.g, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin’s disease or non-Hodgkin’s disease), Waldenstrom's macroglobulinemia, multiple myeloma, or heavy chain disease.
  • a leukemia e.g, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leuk
  • the cancer is a solid tumor such as a sarcoma or carcinoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing’s tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma
  • the cancer is glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, or retinoblastoma.
  • GBM glioblastoma multiforme
  • medulloblastoma craniopharyngioma
  • ependymoma pinealoma
  • hemangioblastoma acoustic neuroma
  • oligodendroglioma schwannoma
  • neurofibrosarcoma meningioma, melanoma
  • neuroblastoma
  • the cancer is acoustic neuroma, astrocytoma (e.g. Grade I - Pilocytic Astrocytoma, Grade II - Low-grade Astrocytoma, Grade III - Anaplastic Astrocytoma, or Grade IV - Glioblastoma (GBM)), chordoma, CNS lymphoma, craniopharyngioma, brain stem glioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumors, primitive neuroectodermal (PNET) tumor, or schwannoma.
  • astrocytoma e.g. Grade I - Pilocytic Astrocytoma, Grade II - Low-grade Astrocytoma, Grade III - Anaplastic Astrocytoma, or Grade IV - G
  • the cancer is a type found more commonly in children than adults, such as brain stem glioma, craniopharyngioma, ependymomajuvenile pilocytic astrocytoma (JPA), medulloblastoma, optic nerve glioma, pineal tumor, primitive neuroectodermal tumors (PNET), or rhabdoid tumor.
  • JPA ependymomajuvenile pilocytic astrocytoma
  • PNET primitive neuroectodermal tumors
  • the cancer is associated with LINE1 reverse transcriptase. In certain embodiments, the cancer is associated with high levels of LINE1 RT activity and/or expression. In certain embodiments, the cancer is associated with HERV-K reverse transcriptase. In certain embodiments, the cancer is associated with high levels of HERV-K RT activity and/or expression.
  • the disorder is an inflammatory disorder.
  • the inflammatory disorder is rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, or sclerosing cholangitis, psoriasis, dermatitis, vasculitis, scleroderma, asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, pericarditis, gout, myositis, Sjogren’s syndrome, or systemic lupus erythematosus.
  • NASH nonalcoholic steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • COPD chronic obstructive pulmonary disease
  • COPD
  • the inflammatory disorder is rheumatoid arthritis, osteoarthritis, or ankylosing spondylitis.
  • the inflammatory disorder is inflammatory bowel disease, Crohn’s disease, or ulcerative colitis.
  • the inflammatory disorder is nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, or sclerosing cholangitis.
  • the inflammatory disorder is psoriasis, dermatitis, vasculitis, or scleroderma.
  • the inflammatory disorder is asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, or pericarditis.
  • the inflammatory disorder is gout, myositis, Sjogren’s syndrome, or systemic lupus erythematosus.
  • the inflammatory disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the inflammatory disorder is associated with high levels of LINE 1 RT activity and/or expression. In certain embodiments, the inflammatory disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the inflammatory disorder is associated with high levels of HERV-K RT activity and/or expression.
  • the disorder is an immune disorder other than a viral infection.
  • the immune disorder is a type I interferonopathy.
  • the type I interferonopathy is a congenital disorder associated with type I interferon overexpression.
  • the immune disorder is selected from Aicardi-Goutieres syndrome (AGS), Singleton-Merten syndrome, proteasome-associated autoinfl am m at ory syndromes, chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), STING-associated vasculopathy with onset in infancy (SAVI), Japanese autoinflammatory syndrome with lipodystrophy (JASL), spondyloenchondrodysplasia (SPENCD), ISG15 deficiency, Ubiquitin-Specific Peptidase 18 deficiency (pseudo-TORCH syndrome), chronic atypical neurophilic dermatitis with lipodystrophy, DNA II deficiency, trichoheptoenteric syndrome 2, retinal
  • Aicardi-Goutieres syndrome Aicardi
  • the immune disorder results in an overproduction of interferon. In certain embodiments, the immune disorder results in an overproduction of type I interferon.
  • the immune disorder is selected from the group consisting of achalasia, Addison’s disease, adult Still’s disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM/anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune dysautonomia, autoimmune encephalitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, benign mucosal pemphigoid, bullous pemphigoid, Castleman disease (CD), celiac disease, Chagas disease, chronic inflammatory demyelinating polyneuropathy
  • the immune disorder is arthritis, psoriasis, systemic lupus erythematosus (SLE), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter's syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism,
  • the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter’s syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome
  • the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter’s syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome
  • the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, dermatomyositis, inflammatory bowel disease, Crohn’s disease, or ulcerative colitis.
  • Aicardi-Goutieres syndrome Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjo
  • the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome.
  • Aicardi-Goutieres syndrome Aicardi-Goutieres syndrome
  • SLE systemic lupus erythematosus
  • CLE cutaneous lupus erythematosus
  • dermatomyositis or Sjogren’s syndrome.
  • the immune disorder is a type 1 interferonopathy.
  • the immune disorder is type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, or dermatomyositis.
  • the immune disorder is systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), or familial chilblain lupus.
  • the immune disorder is systemic lupus erythematosus (SLE), lupus nephritis, or cutaneous lupus erythematosus (CLE).
  • the immune disorder is type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, or dermatomyositis.
  • the immune disorder is Aicardi- Goutieres syndrome (AGS), familial chilblain lupus, or STING-associated vasculopathy with onset in infancy (SAVI).
  • the immune disorder is type 1 diabetes.
  • the immune disorder is Aicardi-Goutieres syndrome (AGS).
  • the immune disorder is systemic lupus erythematosus (SLE).
  • the immune disorder is lupus nephritis.
  • the immune disorder is cutaneous lupus erythematosus (CLE).
  • the immune disorder is familial chilblain lupus.
  • the immune disorder is systemic sclerosis.
  • the immune disorder is STING-associated vasculopathy with onset in infancy (SAVI).
  • the immune disorder is Sjogren’s syndrome.
  • the immune disorder is dermatomyositis.
  • the immune disorder is inflammatory bowel disease, Crohn’s disease, or ulcerative colitis. In certain embodiments, the immune disorder is inflammatory bowel disease. In certain embodiments, the immune disorder is Crohn’s disease. In certain embodiments, the immune disorder is ulcerative colitis. In certain embodiments, the autoimmune disorder is drug-induced colitis. In certain embodiments, the autoimmune disorder is colitis associated with the administration of checkpoint inhibitors.
  • the immune disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the immune disorder is associated with high levels of LINE1 RT activity and/or expression. In certain embodiments, the immune disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the immune disorder is associated with high levels of HERV-K RT activity and/or expression.
  • the disorder is a neurodegenerative disorder.
  • the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression.
  • ALS amyotrophic lateral sclerosis
  • Parkinson Parkinson’s disease
  • Huntington the peripheral neuropathy
  • age-related macular degeneration Creutzfeldt-Jacob disease
  • Creutzfeldt-Jacob disease stroke
  • prion disease frontotemporal dementia
  • Pick’s disease progressive supranuclear palsy
  • spinocerebellar ataxias Lewy body disease
  • dementia dementia
  • the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, or dementia.
  • the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or progressive supranuclear palsy.
  • the neurological disorder is peripheral neuropathy, age- related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression.
  • the neurodegenerative disorder is Alzheimer’s disease. In certain embodiments, the neurodegenerative disorder is amyotrophic lateral sclerosis (ALS). In certain embodiments, the neurodegenerative disorder is multiple sclerosis. In certain embodiments, the neurodegenerative disorder is Parkinson’s disease. In certain embodiments, the neurodegenerative disorder is Huntington’s disease. In certain embodiments, the neurodegenerative disorder is dementia. In certain embodiments, the neurodegenerative disorder is age-related macular degeneration. In certain embodiments, the neurodegenerative disorder is progressive supranuclear palsy.
  • ALS amyotrophic lateral sclerosis
  • the neurodegenerative disorder is multiple sclerosis.
  • the neurodegenerative disorder is Parkinson’s disease.
  • the neurodegenerative disorder is Huntington’s disease.
  • the neurodegenerative disorder is dementia.
  • the neurodegenerative disorder is age-related macular degeneration. In certain embodiments, the neurodegenerative disorder is progressive supranuclear palsy.
  • the neurodegenerative disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the neurodegenerative disorder is associated with high levels ofLINEl RT activity and/or expression. In certain embodiments, the neurodegenerative disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the neurodegenerative disorder is associated with high levels of HERV-K RT activity and/or expression.
  • the subject has (i) expression of LINE 1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) expression of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
  • the subject has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
  • the subject has (i) elevated expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) elevated activity of LINE1 reverse transcriptase.
  • the subject has expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide.
  • the subject has expression ofLINEl RNA.
  • the subject has expression of LINE1 ORF1 polypeptide.
  • the subject has expression ofLINEl ORF2 polypeptide.
  • the subject has activity of LINEl reverse transcriptase.
  • the subject has (i) expression of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the subject has expression of HERV-K RNA. In certain embodiments, the subject has activity of HERV-K reverse transcriptase.
  • the subject has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) levels of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
  • the subject has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
  • the subject has elevated levels of LINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide.
  • the subject has elevated levels ofLINEl RNA.
  • the subject has elevated levels of LINE1 0RF1 polypeptide.
  • the subject has elevated levels of LINE1 0RF2 polypeptide.
  • the subject has elevated activity of LINE 1 reverse transcriptase.
  • the subject has elevated (i) levels of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the subject has elevated levels of HERV-K RNA. In certain embodiments, the subject has elevated activity of HERV-K reverse transcriptase.
  • the subject is a human. In certain embodiments, the subject is an adult human. In certain embodiments, the subject is a pediatric human. In certain embodiments, the subject is a companion animal. In certain embodiments, the subject is a canine, feline, or equine.
  • Another aspect of the disclosure provides for the use of a compound described herein (such as a compound of Formula I, II, III, IV, V, VI, or other compounds described above) for treating a medical disorder, such as a medical disorder described herein (for example, cancer).
  • a compound described herein such as a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • a medical disorder such as a medical disorder described herein (for example, cancer).
  • Another aspect of the disclosure provides for the use of a compound described herein (such as a compound of Formula I, II, III, IV, V, VI, or other compounds described above) in the manufacture of a medicament.
  • the medicament is for treating a disorder described herein, such as cancer.
  • Another aspect of the disclosure provides methods for inhibiting reverse transcriptase activity. This is described in more detail below.
  • Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity.
  • the method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, in order to inhibit the activity of said LINE1 reverse transcriptase.
  • a compound described in Section I above such as a compound of Formula I, II, or III
  • the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject.
  • Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodeg enerative disorder, and an immune disorder other than a viral infection.
  • the method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section 1 above, such as a compound of Formula I, II, III, IV, V, or VI, in order to inhibit the activity of said LINE1 reverse transcriptase.
  • a compound described in Section 1 above such as a compound of Formula I, II, III, IV, V, or VI
  • the particular compound of Formula I, II, III, IV, V, or VI is a compound defined by embodiments described above, either singly or in combination.
  • the method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III- 1 , IV-1, VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase.
  • a compound described in Section I above such as a compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III- 1 , IV-1, VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase.
  • the particular compound of Formula I, II, III, IV, V, VI, , I- 1, II- 1 , III- 1 , IV-1, V-l, or VI-1 is a compound defined by embodiments described above, either singly or in combination.
  • the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject.
  • the disorder is a disorder defined by one of the embodiments described in Section II, above, such as cancer.
  • Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, in order to inhibit the activity of said HERV-K reverse transcriptase.
  • a compound described in Section I above such as a compound of Formula I, II, or III
  • the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination.
  • the method further comprises inhibiting LINE1 reverse transcriptase activity in the subject.
  • Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection.
  • the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, IV, V, or VI, in order to inhibit the activity of said HERV-K reverse transcriptase.
  • the particular compound of Formula I, II, III, IV, V, or VI is a compound defined by embodiments described above, either singly or in combination.
  • the method further comprises inhibiting LINE1 reverse transcriptase activity in the subject.
  • the disorder is a disorder defined by one of the embodiments described in Section II, above, such as cancer.
  • Compounds may be tested for ability to inhibit activity of LINE 1 reverse transcriptase or HERV-K reverse transcriptase, for example, as described in the Examples.
  • halo- dehydro-3 '-deoxyuracil phosphoramidates or related compounds described herein e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • additional therapeutic agents e.g., according to the methods described in Section II, with disorders such as a cancer.
  • Substituted halo-dehydro-3'-deoxyuracil phosphoramidates or related compounds described herein e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III-l, IV- 1, V-l, or VI- 1 or other compounds described above
  • additional therapeutic agents e.g., according to the methods described in Section II, with disorders such as a cancer.
  • a method of the disclosure further comprises administering an effective amount of an additional therapeutic agent.
  • each of the methods described herein for treating disease using combination therapy may be further characterized according to the additional therapeutic agent used in the method.
  • the additional therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the additional therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the additional therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex. [0744] In certain embodiments, the additional therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir. In certain embodiments, the additional therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir alafenamide. In certain embodiments, the additional therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof.
  • the additional therapeutic agent is tenofovir amibufenamide. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil. In certain embodiments, the additional therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir exalidex.
  • the present disclosure provides a method of treating a disclosed disease or condition comprising administering to a patient in need thereof an effective amount of a compound disclosed herein or a pharmaceutically acceptable salt thereof and co-administering simultaneously or sequentially an effective amount of one or more additional therapeutic agents, such as those described herein.
  • the method includes co-administering one additional therapeutic agent.
  • the method includes co-administering two additional therapeutic agents.
  • the combination of the disclosed compound and the additional therapeutic agent or agents acts synergistically.
  • One or more other therapeutic agent may be administered separately from a compound or composition of the disclosure, as part of a multiple dosage regimen.
  • one or more other therapeutic agents may be part of a single dosage form, mixed together with a compound of this disclosure in a single composition.
  • one or more other therapeutic agent and a compound or composition of the disclosure may be administered simultaneously, sequentially or within a period of time from one another, for example within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours from one another.
  • one or more other therapeutic agent and a compound or composition of the disclosure are administered as a multiple dosage regimen more than 24 hours apart.
  • the doses and dosage regimen of the active ingredients used in the combination therapy may be determined by an attending clinician.
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g, a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the substituted halo-dehydro-3 '- deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the substituted halo-dehydro-3 '- deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • a synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy.
  • a lower dosage or less frequent administration of one or more agents may lower toxicity of the therapy without reducing the efficacy of the therapy.
  • kits comprising a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above), a pharmaceutically acceptable carrier, vehicle or diluent, and optionally at least one additional therapeutic agent listed above.
  • a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • a pharmaceutically acceptable carrier e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • optionally at least one additional therapeutic agent listed above e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g, a compound of Formula I, II, III, IV, V, VI, I- 1 , II- 1 , III-l, IV-1, VI-1, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the additional therapeutic agent(s) are administered in doses commonly employed when such agents are used as monotherapy for treating the disorder.
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV- 1, VI-1, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the additional therapeutic agent(s) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating the disorder.
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, 1-1 , II-l, III-l, IV-1, VI-1, or other compounds described above
  • the additional therapeutic agent(s) e.g. the second, third, or fourth, or fifth anti-cancer agent, described below
  • a synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy.
  • a lower dosage or less frequent administration of one or more agents may lower toxicity of the therapy without reducing the efficacy of the therapy.
  • kits comprising a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above), a pharmaceutically acceptable carrier, vehicle or diluent, and optionally at least one additional therapeutic agent listed above.
  • a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above
  • a pharmaceutically acceptable carrier e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above
  • another aspect of the disclosure provides a method of treating cancer in a patient.
  • the method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second anti-cancer agent, in order to treat the cancer.
  • the second anti-cancer agent is radiation therapy.
  • the second anti-cancer agent is a therapeutic antibody.
  • the therapeutic antibody targets one of the following: CD20, CD30, CD33, CD52, EpCAM, CEA, gpA33, a mucin, TAG-72, CAIX, PSMA, a folate-binding protein, a ganglioside, Le, VEGF, VEGFR, VEGFR2, VEGFR3, integrin aVp3, integrin a5p i .
  • EGFR EGFR
  • ERBB2, ERBB3, MET IGF1R
  • FAP tenascin, CD 19, KIR, NKG2A, CD47, CEACAM1, c-MET, VISTA, CD73, CD38, BAFF, interleukin- 1 beta, B4GALNT1, interleukin-6, and interleukin-6 receptor.
  • the second anti-cancer agent is a therapeutic antibody selected from the group consisting of rituximab, ibritumomab tiuxetan, tositumomab, obinutuzumab, ofatumumab, brentuximab vedotin, gemtuzumab ozogamicin, alemtuzumab, IGN101, adecatumumab, labetuzumab, huA33, pemtumomab, oregovomab, minetumomab, cG250, 1591, Movl 8, farletuzumab, 3F8, chi 4.18, KW-2871, hu3S193, lgN31 1, bevacizumab, IM-2C6, CDP791, ramucirumab, etaracizumab, volociximab, cetuximab, panitum
  • the second anti-cancer agent is a cytokine.
  • the cytokine is IL-12, IL-15, GM-CSF, or G-CSF.
  • the second anti-cancer agent is sipuleucel-T, aldesleukin (a human recombinant interleukin-2 product having the chemical name des-alanyl- 1, serine- 125 human interleukin-2), dabrafenib (a kinase inhibitor having the chemical name A- ⁇ 3-[5-(2- aminopyrimidin-4-yl)-2-/c'/7-butyl-l ,3-thiazol-4-yl]-2-fluorophenyl ⁇ -2,6- difluorobenzenesulfonamide), vemurafenib (a kinase inhibitor having the chemical name propane- 1 -sulfonic acid ⁇ 3-[5-(4-chlorophenyl)-17/-pyrrolo[2,3-Z>]pyridine-3-carbonyl]-2,4- difluoro-phenyl (-amide), or 2-chloro-deoxyadenosine.
  • aldesleukin a human
  • the second anticancer agent is pazopanib, sorafenib, axitinib, lenvatinib, afatinib, erlotinib, gefitinib, osimertinib, or vandetanib.
  • the second anti-cancer agent is a placental growth factor, an antibody-drug conjugate, an oncolytic virus, or an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is a placental growth factor. In certain embodiments, the second anti-cancer agent is a placental growth factor comprising ziv-aflibercept. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate selected from the group consisting of brentoxumab vedotin and trastuzumab emtransine.
  • the second anti-cancer agent is an oncolytic virus. In certain embodiments, the second anti-cancer agent is the oncolytic virus talimogene laherparepvec. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine selected from the group consisting of a GM-CSF tumor vaccine, a STING/GM-CSF tumor vaccine, and NY-ESO-1. In certain embodiments, the second anti-cancer agent is a cytokine selected from IL-12, IL-15, GM- CSF, and G-CSF.
  • the second anti-cancer agent is an immune checkpoint inhibitor (also referred to as immune checkpoint blockers).
  • Immune checkpoint inhibitors are a class of therapeutic agents that have the effect of blocking immune checkpoints. See, for example, Pardoll in Nature Reviews Cancer (2012) vol. 12, pages 252-264.
  • the immune checkpoint inhibitor is an agent that inhibits one or more of (i) cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), (ii) programmed cell death protein 1 (PD1), (iii) PDL1, (iv) LAB3, (v) B7-H3, (vi) B7-H4, and (vii) TIM3.
  • CTL4 cytotoxic T-lymphocyte-associated antigen 4
  • PD1 programmed cell death protein 1
  • PDL1 programmed cell death protein 1
  • PDL1 programmed cell death protein 1
  • PD1 programmed cell death protein 1
  • PDL1 programmed cell death protein 1
  • PD1 programmed cell death protein 1
  • PDL1 programmed
  • the immune checkpoint inhibitor is ipilumumab. In certain embodiments, the immune checkpoint inhibitor is pembrolizumab. In certain embodiments, the immune checkpoint inhibitor is atezolizumab, cemiplimab, cemiplimab-rwlc, dostarlimab, durvalumab, or nivolumab.
  • the second anti -cancer agent is a monoclonal antibody that targets a non-checkpoint target (e.g., Herceptin). In certain embodiments, the second anti-cancer agent is a non-cytoxic agent (e.g., a tyrosine-kinase inhibitor).
  • the second anti-cancer agent is selected from mitomycin, ribomustin, vincristine, tretinoin, etoposide, cladribine, gemcitabine, mitobronitol, methotrexate, doxorubicin, carboquone, pentostatin, nitracrine, zinostatin, cetrorelix, letrozole, raltitrexed, daunorubicin, fadrozole, fotemustine, thymalfasin, sobuzoxane, nedaplatin, aminoglutethimide, amsacrine, proglumide, elliptinium acetate, ketanserin, doxifluridine, etretinate, isotretinoin, streptozocin, nimustine, vindesine, cytarabine, bicalutamide, vinorelbine, vesn
  • the second anti-cancer agent is paclitaxel, docetaxel, cisplatin, epirubicin, 5-fluorouracil, or capecitabine. In certain embodiments, the second anticancer agent is ixabepilone or eribulin. In certain embodiments, the second anti-cancer agent is ART558. In certain embodiments, the second anti-cancer agent is lapatinib, neratinib, or tucatinib. In certain embodiments, the second anti-cancer agent is fulvestrant. In certain embodiments, the second anti-cancer agent is anastrozole or exemestane. In certain embodiments, the second anti-cancer agent is MK2206.
  • the second anti-cancer agent is dacomitinib, mobocertinib, necitumumab, or amivantamab. In certain embodiments, the second anti-cancer agent is pemetrexed. In certain embodiments, the second anti-cancer agent is brigatinib. In certain embodiments, the second anti-cancer agent is capmatinib or tepotinib. In certain embodiments, the second anti-cancer agent is entrectinib. In certain embodiments, the second anti-cancer agent is pralsetinib or selpercatinib. In certain embodiments, the second anti-cancer agent is ipilimumab.
  • the second anti-cancer agent is sotorasib. In certain embodiments, the second anti-cancer agent is topotecan or irinotecan. In certain embodiments, the second anti-cancer agent is lurbinectedin, melphalan, or thiotepa. In certain embodiments, the second anti-cancer agent is trifluridine or tipiracil. In certain embodiments, the second anti-cancer agent is megestrol. In certain embodiments, the second anti-cancer agent is sunitinib. In certain embodiments, the second anti-cancer agent is lanreotide or lutetium. In certain embodiments, the second anti-cancer agent is belzutifan.
  • the second anti-cancer agent is an ALK Inhibitor, an ATR Inhibitor, an A2A Antagonist, a Base Excision Repair Inhibitor, a Bcr-Abl Tyrosine Kinase Inhibitor, a Bruton's Tyrosine Kinase Inhibitor, a CDC7 Inhibitor, a CHK1 Inhibitor, a Cyclin- Dependent Kinase Inhibitor, a DNA-PK Inhibitor, an Inhibitor of both DNA-PK and mTOR, a DNMT1 Inhibitor, a DNMTl Inhibitor plus 2-chloro-deoxyadenosine, an HD AC Inhibitor, a Hedgehog Signaling Pathway Inhibitor, an IDO Inhibitor, a JAK Inhibitor, an mTOR Inhibitor, a MEK Inhibitor, a MELK Inhibitor, an M
  • the second anti-cancer agent is an ALK Inhibitor. In certain embodiments, the second anti-cancer agent is an ALK Inhibitor comprising ceritinib, lorlatinib, or crizotinib. In certain embodiments, the second anti-cancer agent is an ATR Inhibitor. In certain embodiments, the second anti-cancer agent is an ATR Inhibitor comprising AZD6738, BAY1895344, M4344, or VX-970. In certain embodiments, the second anti-cancer agent is an A2A Antagonist. In certain embodiments, the second anti-cancer agent is a Base Excision Repair Inhibitor comprising methoxyamine.
  • the second anti-cancer agent is a Base Excision Repair Inhibitor, such as methoxyamine.
  • the second anti-cancer agent is a Bcr-Abl Tyrosine Kinase Inhibitor.
  • the second anti-cancer agent is a Bcr-Abl Tyrosine Kinase Inhibitor comprising dasatinib or nilotinib.
  • the second anti-cancer agent is a Bruton's Tyrosine Kinase Inhibitor.
  • the second anti-cancer agent is a Bruton's Tyrosine Kinase Inhibitor comprising ibrutinib.
  • the second anti-cancer agent is a CDC7 Inhibitor.
  • the second anti-cancer agent is a CDC7 Inhibitor comprising RXDX-103 or AS-141.
  • the second anti-cancer agent is a CHK1 Inhibitor. In certain embodiments, the second anti-cancer agent is a CHK1 Inhibitor comprising MK-8776, ARRY- 575, AZD7762, or SAR-020106. In certain embodiments, the second anti-cancer agent is a Cyclin-Dependent Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Cyclin-Dependent Kinase Inhibitor comprising abemaciclib, palbociclib, or ribociclib. In certain embodiments, the second anti-cancer agent is a DNA-PK Inhibitor.
  • the second anti-cancer agent is a DNA-PK Inhibitor comprising MSC2490484A. In certain embodiments, the second anti-cancer agent is Inhibitor of both DNA-PK and mTOR. In certain embodiments, the second anti-cancer agent comprises CC-115.
  • the second anti-cancer agent is a DNMT1 Inhibitor.
  • the second anti-cancer agent is a DNMT1 Inhibitor comprising decitabine, RX-3117, guadecitabine, NUC-8000, or azacytidine.
  • the second anticancer agent comprises a DNMT1 Inhibitor and 2-chloro-deoxyadenosine.
  • the second anti-cancer agent comprises ASTX-727.
  • the second anti-cancer agent is an HDAC Inhibitor.
  • the second anti-cancer agent is an HDAC Inhibitor comprising OBP-801, CHR-3996, etinostate, resminostate, pracinostat, CG-200745, panobinostat, romidepsin, mocetinostat, belinostat, AR-42, ricolinostat, KA-3000, or ACY-241.
  • the second anti-cancer agent is a Hedgehog Signaling Pathway Inhibitor. In certain embodiments, the second anti-cancer agent is a Hedgehog Signaling Pathway Inhibitor comprising sonidegib or vismodegib. In certain embodiments, the second anti-cancer agent is an IDO Inhibitor. In certain embodiments, the second anti-cancer agent is an IDO Inhibitor comprising INCB024360. In certain embodiments, the second anticancer agent is a JAK Inhibitor. In certain embodiments, the second anti-cancer agent is a JAK Inhibitor comprising ruxolitinib or tofacitinib.
  • the second anti-cancer agent is an mTOR Inhibitor. In certain embodiments, the second anti-cancer agent is an mTOR Inhibitor comprising everolimus or temsirolimus. In certain embodiments, the second anticancer agent is a MEK Inhibitor. In certain embodiments, the second anti-cancer agent is a MEK Inhibitor comprising cobimetinib or trametinib. In certain embodiments, the second anti-cancer agent is a MELK Inhibitor. In certain embodiments, the second anti-cancer agent is a MELK Inhibitor comprising ARN-7016, APTO-500, or OTS-167.
  • the second anti-cancer agent is an MTH1 Inhibitor. In certain embodiments, the second anti-cancer agent is an MTH1 Inhibitor comprising (5)-crizotinib, TH287, or TH588.
  • the second anti-cancer agent is a PARP Inhibitor.
  • the second anti-cancer agent is a PARP Inhibitor comprising MP-124, olaparib, BGB-290, talazoparib, veliparib, niraparib, E7449, rucaparib, or ABT-767.
  • the second anti-cancer agent is a Phosphoinositide 3-Kinase Inhibitor.
  • the second anti-cancer agent is a Phosphoinositide 3-Kinase Inhibitor comprising alpelisib or idelalisib.
  • the second anti-cancer agent is an inhibitor of both PARP1 and DHODH (z.c., an agent that inhibits both poly ADP ribose polymerase 1 and dihydroorotate dehydrogenase).
  • the second anti-cancer agent is a Proteasome Inhibitor. In certain embodiments, the second anti-cancer agent is a Proteasome Inhibitor comprising bortezomib or carfdzomib. In certain embodiments, the second anti-cancer agent is a Topoisomerase-II Inhibitor. In certain embodiments, the second anti-cancer agent is a Topoisomerase-II Inhibitor comprising vosaroxin.
  • the second anti-cancer agent is a Tyrosine Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Tyrosine Kinase Inhibitor comprising bosutinib, cabozantinib, imatinib or ponatinib. In certain embodiments, the second anti-cancer agent is a VEGFR Inhibitor. In certain embodiments, the second anti-cancer agent is a VEGFR Inhibitor comprising regorafenib. In certain embodiments, the second anti -cancer agent is a WEE1 Inhibitor. In certain embodiments, the second anti-cancer agent is a WEE1 Inhibitor comprising AZDI 775.
  • the second anti-cancer agent is an agonist of 0X40, CD137, CD40, GITR, CD27, HVEM, TNFRSF25, or ICOS. In certain embodiments, the second anticancer agent is an agonist of 0X40, CD 137, CD40, or GITR. In certain embodiments, the second anti-cancer agent is an agonist of CD27, HVEM, TNFRSF25, or ICOS.
  • the second anti -cancer agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the second anti-cancer agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the second anti-cancer agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
  • the second anti-cancer agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir. In certain embodiments, the second anti-cancer agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir alafenamide. In certain embodiments, the second anti-cancer agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir amibufenamide.
  • the second anticancer agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second anticancer agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir disoproxil. In certain embodiments, the second anti-cancer agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir exalidex.
  • the method further comprises administering to the subject a third anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fourth anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fifth anti-cancer agent.
  • the third anti-cancer agent is one of the second anti-cancer agents described above.
  • the fourth anti-cancer agent is one of the second anti-cancer agents described above.
  • the fifth anti-cancer agent is one of the second anti-cancer agents described above.
  • Another aspect of the disclosure provides a method of treating an inflammatory disorder in a patient.
  • the method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the inflammatory disorder.
  • the second therapeutic agent is a small molecule or a recombinant biologic agent.
  • the second therapeutic agent is selected from acetaminophen, non-steroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, and the like, probenecid, allopurinol, febuxostat (Uloric®), sulfasalazine (Azulfidine®), antimalarials such as hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®), methotrexate (Rheumatrex®), gold salts such as gold thioglucose (Solganal®
  • NAIDS non-steroidal anti-inflammatory
  • the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
  • the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
  • the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
  • the third therapeutic agent is one of the second therapeutic agents described above.
  • the fourth therapeutic agent is one of the second therapeutic agents described above.
  • the fifth therapeutic agent is one of the second therapeutic agents described above.
  • Another aspect of the disclosure provides a method of treating an immune disorder other than a viral infection in a patient.
  • the method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the immune disorder other than a viral infection.
  • the second therapeutic agent is pentoxifylline, propentofylline, torbafylline, cyclosporine, methotrexate, tamoxifen, forskolin and analogs thereof, tar derivatives, steroids, vitamin A and its derivatives, vitamin D and its derivatives, a cytokine, a chemokine, a stem cell growth factor, a lymphotoxin, an hematopoietic factor, a colony stimulating factor (CSF), erythropoietin, thrombopoietin, tumor necrosis factor-a (TNF), I NF- ⁇ , granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon-a, interferon-P, interferon-y, interferon-L, stem cell growth factor designated “SI factor”, human growth hormone, N-methionyl human growth hormone
  • the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
  • the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
  • the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
  • the third therapeutic agent is one of the second therapeutic agents described above.
  • the fourth therapeutic agent is one of the second therapeutic agents described above.
  • the fifth therapeutic agent is one of the second therapeutic agents described above.
  • Another aspect of the disclosure provides a method of treating an immune disorder that is a viral infection in a patient.
  • the method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphorami date or related compound described herein and (ii) a second therapeutic agent, in order to treat the immune disorder that is a viral infection.
  • the immune disorder is a viral infection other than an influenza viral infection.
  • the second therapeutic agent is an anti-HIV agent.
  • the second therapeutic agent is a nucleoside reverse transcriptase inhibitor (NRTI), non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or fusion inhibitor.
  • NRTI nucleoside reverse transcriptase inhibitor
  • non-nucleoside reverse transcriptase inhibitor non-nucleoside reverse transcriptase inhibitor
  • protease inhibitor or fusion inhibitor.
  • the second therapeutic agent is 3TC (Lamivudine), AZT (Zidovudine), (-)- FTC, ddl (Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir (PMPA), D-D4FC (Reverset), D4T (Stavudine), Racivir, L-FddC, L-FD4C, NVP (Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM (Saquinavir mesylate), RTV (Ritonavir), IDV (Indinavir), SQV (Saquinavir), NFV (Nelfinavir), APV (Amprenavir), LPV (Lopinavir), or the fusion inhibitor T20.
  • the second therapeutic agent is ddC, abacavir, ddl, ddA, 3TC, AZT, D4T, FTC, FddC, Fd4C, Atazanavir, Adefovir dipivoxyl, Tenofovir disoproxil, Etecavir, Indinavir, KHI-227.2-[3-[3-(S)-[[(Tetrahydrofuranyloxy)carbonyl]amino]-4-phenyl-2(R)- hydroxybutyl]]-N-(l,l-dimethylethyl)decahydro-3-isoquinolinecarboxamide, VB-11,328, KNI- 174, Val-Val-Sta, CPG53820, HOEt-N2 aza-peptide isostere, 2,5-Diamino-N,N'-bis(N- benzyloxycarbonyluelyl)-l,6-dip
  • the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
  • the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
  • the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
  • the third therapeutic agent is one of the second therapeutic agents described above.
  • the fourth therapeutic agent is one of the second therapeutic agents described above.
  • the fifth therapeutic agent is one of the second therapeutic agents described above.
  • Another aspect of the disclosure provides a method of treating a neurodegenerative disorder in a patient.
  • the method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the neurodegenerative disorder.
  • the second therapeutic agent is a dopaminergic treatment, a cholinesterase inhibitor, an antipsychotic drug, deep brain stimulation (for example, to stop tremor and refractory movement disorders), riluzole, a caffein A2A receptor antagonist, pramipexole, or rasagilin.
  • the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
  • the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof.
  • the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
  • the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
  • the third therapeutic agent is one of the second therapeutic agents described above.
  • the fourth therapeutic agent is one of the second therapeutic agents described above.
  • the fifth therapeutic agent is one of the second therapeutic agents described above.
  • compositions which comprise a therapeutically effective amount of one or more of the compounds described above, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
  • the pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary,
  • the disclosure provides a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I or II) and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I, II, III, or IV), an additional therapeutic agent (e.g., a compound described in Section IV), and a pharmaceutically acceptable carrier.
  • terapéuticaally effective amount means that amount of a compound, material, or composition comprising a compound of the present disclosure which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment.
  • pharmaceutically acceptable is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • wetting agents such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
  • antioxidants examples include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
  • water soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like
  • oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), le
  • Formulations of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and/or the particular mode of administration.
  • the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.
  • a formulation of the present disclosure comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g, bile acids, and polymeric carriers, e.g, polyesters and polyanhydrides; and a compound of the present disclosure.
  • an aforementioned formulation renders orally bioavailable a compound of the present disclosure.
  • Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present disclosure with the carrier and, optionally, one or more accessory ingredients.
  • the formulations are prepared by uniformly and intimately bringing into association a compound of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
  • Formulations of the disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound of the present disclosure as an active ingredient.
  • a compound of the present disclosure may also be administered as a bolus, electuary or paste.
  • the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds and surfactants, such as po
  • compositions may also comprise buffering agents.
  • Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
  • a tablet may be made by compression or molding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent.
  • Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets, and other solid dosage forms of the pharmaceutical compositions of the present disclosure may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profde, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., freeze-dried.
  • compositions may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use.
  • These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner.
  • embedding compositions which can be used include polymeric substances and waxes.
  • the active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
  • Liquid dosage forms for oral administration of the compounds of the disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs.
  • Suspensions in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.
  • Dosage forms for the topical or transdermal administration of a compound of this disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants.
  • the active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • a pharmaceutically acceptable carrier such as a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.
  • the ointments, pastes, creams and gels may contain, in addition to an active compound of this disclosure, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.
  • Ophthalmic formulations, eye ointments, powders, solutions and the like, may be used for compounds described herein.
  • the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
  • adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
  • Transdermal patches have the added advantage of providing controlled delivery of a compound of the present disclosure to the body.
  • dosage forms can be made by dissolving or dispersing the compound in the proper medium.
  • Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel.
  • compositions of this disclosure suitable for parenteral administration comprise one or more compounds of the disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use.
  • aqueous and nonaqueous carriers examples include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate.
  • polyols such as glycerol, propylene glycol, polyethylene glycol, and the like
  • vegetable oils such as olive oil
  • injectable organic esters such as ethyl oleate.
  • Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.
  • These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents.
  • isotonic agents such as sugars, sodium chloride, and the like into the compositions.
  • prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • the compounds of the present disclosure are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
  • the preparations of the present disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.
  • parenteral administration and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
  • systemic administration means the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient’s system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
  • These compounds may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intraci sternally and topically, as by powders, ointments or drops, including buccally and sublingually.
  • any suitable route of administration including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intraci sternally and topically, as by powders, ointments or drops, including buccally and sublingually.
  • the compounds of the present disclosure which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present disclosure, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
  • the selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present disclosure employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
  • a physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required.
  • the physician or veterinarian could start doses of the compounds of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • a suitable daily dose of a compound of the disclosure will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.
  • the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg.
  • the effective amount may be less than when the agent is used alone.
  • the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Preferred dosing is one administration per day.
  • the disclosure further provides a unit dosage form (such as a tablet or capsule) comprising a substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein in a therapeutically effective amount for the treatment of a medical disorder described herein.
  • a unit dosage form such as a tablet or capsule
  • a substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein in a therapeutically effective amount for the treatment of a medical disorder described herein.
  • a compound represented by Formula I an enantiomer thereof, or a ph ceptable salt of either of the foregoing; wherein: R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 ) 2 ; R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro; R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen; R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ; R 6 is hydrogen or C 1-4 alkyl; R 7 is -C(R 8 )2-CO2R 9 ; R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R
  • Embodiment 3 The compound of embodiment 1 or 2, wherein R 2 is fluoro and R 3 is hydrogen.
  • Embodiment 4 The compound of embodiment 1 or 2, wherein R 2 is hydrogen and R 3 is fluoro.
  • R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 ) 2 ;
  • R 2 and R 3 are hydrogen;
  • R 4 represents independently for each occurrence -(C 1-4 alkylene)-OC(O)O-(C 1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen;
  • R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ;
  • R 6 is hydrogen or C1-4 alkyl;
  • R 7 is -C(R 8 ) 2 -CO 2 R 9 ;
  • R 8 represents independently for each occurrence C 1-6 alkyl or hydrogen, wherein said C 1-6 alkyl is optionally substituted with phenyl; or two instances of R 8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring;
  • R 9 is C 1-6
  • Embodiment 7 A compound represented by Formula III: an enantiomer thereof, or a pha y ceptable salt of either of the foregoing; wherein: R 1 is -P(O)(OR 5 )(N(R 6 )(R 7 )) or -P(O)(OR 4 ) 2 ; R 2 and R 3 are hydrogen; R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen; R 5 is phenyl or naphthyl, each of which is substituted with m instances of R 10 ; R 6 is hydrogen or C1-4 alkyl; R 7 is -C(R 8 ) 2 -CO 2 R 9 ; R 8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with
  • Embodiment 8 The compound of embodiment 1, wherein the compound is a compound of Formula III.
  • Embodiment 9. The compound of any one of embodiments 1-6, wherein R 11 is hydrogen.
  • Embodiment 10. The compound of any one of embodiments 1-6, wherein R 11 is -CH 3 .
  • Embodiment 11 The compound of any one of embodiments 1-8, wherein R 11 is halo.
  • Embodiment 12. The compound of any one of embodiments 1-8, wherein R 11 is -CF3.
  • Embodiment 13 Embodiment 13.
  • Embodiment 14 The compound of any one of embodiments 1-13, wherein B 1 is
  • Embodiment 15 The compound of any one of embodiments 1-13, wherein B 1 is
  • Embodiment 16 The compound of any one of embodiments 1-15, wherein R 1 is - P(O)(OR 5 )(N(R 6 )(R 7 )).
  • Embodiment 17 The compound of any one of embodiments 1-16, wherein R 6 is hydrogen.
  • Embodiment 18 The compound of any one of embodiments 1-17, wherein R 8 represents independently for each occurrence Ci-6 alkyl or hydrogen.
  • Embodiment 19 The compound of any one of embodiments 1-18, wherein R 7 is
  • Embodiment 20 The compound of any one of embodiments 1-19, wherein R 9 is Ci-6 alkyl.
  • Embodiment 21 The compound of any one of embodiments 1-20, wherein R 5 is phenyl substituted with m instances of R 10 .
  • Embodiment 22 The compound of any one of embodiments 1-20, wherein R 3 is naphthyl substituted with m instances of R 10 .
  • Embodiment 23 The compound of any one of embodiments 1-20, wherein R 5 is [0859] Embodiment 24. The compound of any one of embodiments 1-23, wherein R 10 represents independently for each occurrence halo.
  • Embodiment 25 The compound of any one of embodiments 1-15, wherein R 1 is - P(O)(OR 4 ) 2 .
  • Embodiment 26 The compound of any one of embodiments 1-15 or 25, wherein R 4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl).
  • Embodiment 27 Embodiment 27.
  • Embodiment 28 A compound in Table 1, 2, 3, or 6-A herein, or a pharmaceutically acceptable salt thereof.
  • Embodiment 29 A pharmaceutical composition comprising a compound of any one of embodiments 1-28 and a pharmaceutically acceptable carrier.
  • Embodiment 30 A method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of embodiments 1-28 to treat the disorder.
  • Embodiment 31 Embodiment 31.
  • a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV, V, or VI to treat the disorder;
  • Formula IV is represented by: an enantiomer thereof, or a pha rmaceutically acceptable salt of either of the foregoing; wherein: R 1 is hydrogen, -P(O)(OR 5 )(N(R 6 )(R 7 )), or -P(O)(OR 4 )2; R 2 is fluoro and R 3 is hydrogen, or R 2 is hydrogen and R 3 is fluoro; R 4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R 4 is further selected from hydrogen; R 5 is phenyl or naphthyl, each of which is substituted with m instances
  • Embodiment 32 The method of embodiment 31, wherein the compound is a compound of Formula IV, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • Embodiment 33 The method of embodiment 31, wherein the compound is a compound of Formula V, or a pharmaceutically acceptable salt thereof.
  • Embodiment 34 The method of embodiment 31, wherein the compound is a compound of Formula VI, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
  • Embodiment 35 The method of embodiment 30, wherein the disorder is an immune disorder that is a viral infection.
  • Embodiment 36 The method of embodiment 35, wherein the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2), human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2), respiratory syncytial virus (RSV), human papilloma virus (HPV), adenovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), varicella zoster virus (VZV), cytomegalovirus (CMV), herpes simplex viruses 1 or 2 (HSV-1 or HSV-2), human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus), or a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
  • HCV-1 or HIV-2 human immunodeficiency viruses 1 or 2
  • HTLV-1 or HTLV-2 human T-cell leukemia viruses
  • Embodiment 37 The method of any one of embodiments 30-34, wherein the disorder is cancer.
  • Embodiment 38 The method of embodiment 37, wherein the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.
  • the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.
  • Embodiment 39 The method of any one of embodiments 30-34, wherein the disorder is an inflammatory disorder.
  • Embodiment 40 The method of embodiment 39, wherein the inflammatory disorder is rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, psoriasis, dermatitis, vasculitis, scleroderma, asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, pericarditis, gout, myositis, Sjogren's syndrome, or systemic lupus erythematosus.
  • NASH nonalcoholic steatohepatitis
  • NAFLD non-alcoholic fatty liver disease
  • COPD chronic obstructive pulmonary disease
  • Embodiment 41 The method of any one of embodiments 30-34, wherein the disorder is an immune disorder other than a viral infection.
  • Embodiment 42 The method of embodiment 41, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter's syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myo
  • Embodiment 43 The method of embodiment 41, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome.
  • Aicardi-Goutieres syndrome Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome.
  • AGS Aicardi-Goutieres syndrome
  • SLE systemic lupus erythematosus
  • CLE cutaneous lupus erythematosus
  • dermatomyositis or Sjogren’s
  • Embodiment 44 The method of any one of embodiments 30-34, wherein the disorder is a neurodeg enerative disorder.
  • Embodiment 45 The method of embodiment 44, wherein the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression.
  • Embodiment 46 The method of any one of embodiments 30-45, wherein the method further comprises administering an effective amount of an additional therapeutic agent.
  • Embodiment 47 The method of any one of embodiments 30-46, wherein the subject has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
  • Embodiment 48 The method of any one of embodiments 30-47, wherein the subject has (i) expression of HERV-K RNA and/or (ii) activity of HERV-K reverse transcriptase.
  • Embodiment 49 The method of any one of embodiments 30-48, wherein the subject is a human.
  • Embodiment 50 A method of inhibiting LINE1 reverse transcriptase activity, comprising contacting a LINE1 reverse transcriptase with an effective amount of a compound of any one of embodiments 1-28, in order to inhibit the activity of said LINE1 reverse transcriptase.
  • Embodiment 51 A method of inhibiting HERV-K reverse transcriptase activity, comprising contacting a HERV-K reverse transcriptase with an effective amount of a compound of any one of embodiments 1-28, in order to inhibit the activity of said HERV-K reverse transcriptase.
  • the crude product was purified by Prep-HPLC with the following conditions (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5pm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 45% B in 6.2 min, 45% B; Wave Length: 210/254 nm; RTl(min): 5.26) to afford l-[(2R,5S)-5-[( ⁇ di[(isopropoxycarbonyl)oxy] methoxyphosphoryl ⁇ oxy) methyl]-2,5-dihydrofuran-2-yl]-5-methyl-3H-pyrimidine-2, 4-dione (5.3 mg, 0.01 mmol, 7.38%) as an off-white solid.
  • Step 1 To a stirred solution of 5-chloro-2'-deoxyuridine (100 mg, 0.38 mmol) in pyridine (5 mL) was added triphenylmethyl chloride (117 mg, 0.42 mmol). The resulting mixture was stirred for 2h at 100°C and cooled to room temperature. To the above mixture was added methanesulfonyl chloride (131 mg, 1 .14 mmol) at 0°C. The resulting mixture was stirred for additional 2h at room temperature. Desired product could be detected by LCMS. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EAto afford (2R,3S,5R)-5-(5-chloro-2,4-dioxo-3H-pyrimidin-
  • Step 2 To a stirred solution of (2R,3S,5R)-5-(5-chloro-2,4-dioxo-3H-pyrimidin-l-yl)-
  • Step 3 A solution of 5-chloro-l-[(2R,5S)-5-[(triphenylmethoxy)methyl]-2,5- dihydrofuran-2-yl]-3H-pyrimidine-2, 4-dione (50 mg, 0.10 mmol) in acetic acid (0.80 mL) and water (0.20 mL) was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure.
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: Sunfire prep C18 column, 30*150 mm, 5 ⁇ m; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 26% B to 46% B in 10 min, 46% B; Wavelength: 254/220 nm; RT1(min): 10.1).
  • LC/MS (ES, m/z): 540 [M+H] + ; 93.1% purity.
  • LC/MS conditions (Column: HALO C18, 30*3.0 mm, 3 pm; Mobile Phase A: Water/0.05% TFA, Mobile Phase B: Acetonitrile/0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 5% B to 95% B in 2.00 min, 95% B to 95% B in 0.60 min, 95% B to 5% B in 0.10 min; Wavelength: 254/220 nm; RTl(min): 1.386).
  • Step 1 To a stirred mixture of 4-amino-l-((27?,57?)-4-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidin-2(lH)-one (42 mg, 185 pmol) in pyridine (4 mL) was added TBSC1 (56 mg, 371 pmol) at room temperature under an inert atmosphere.
  • Step 2 To a stirred mixture of 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-l- ((27?,57?)-5-(((tert-butyldimethylsilyl) oxy) methyl)-4-fluoro-2,5-dihydrofuran-2-yl) pyrimidin- 2(lH)-one (110 mg, crude) in MeOH (5 mL) was added NH4F (198 mg, 5.35 mmol) at room temperature under an inert atmosphere. The mixture was stirred for 15 h at 60 °C, then cooled to room temperature, diluted with water and extracted with EtOAc (2 x 100 mL).
  • Step 3 A mixture of ((hydroxyphosphoiyl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (87 mg, 263 pmol) and 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-l- ((27?,57?)-4-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(lH)-one (35 mg, 66 pmol) was suspended in pyridine (2 mL).
  • Step 4 To a stirred solution of ((((2R,5R)-5-(4-(bis(4-methoxyphenyl) (phenyl)methylamino)-2-oxopyrimidin-1(2H)-yl)-3-fluoro-2,5-dihydrofuran-2-yl) methoxy) phosphoryl) bis(oxy)bis(methylene) diisopropyl dicarbonate (68 mg, 81 ⁇ mol) in water (1 mL) was added AcOH (4 mL) at room temperature under an inert atmosphere.
  • the resulting mixture was purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD 5 ⁇ m, 19*250 mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 47% B in 10 min; Wavelength: 220 nm/254 nm; RT1(min): 7.35).
  • LC/MS conditions (Column: Luna Omega PS C18, 30*2.1 mm,3 ⁇ m; Mobile Phase A: water/0.1% FA, Mobile Phase B: Acetonitrile/0.1% FA; Flow rate: 1.20 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 0.60 min, 100% B to 5% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.747).
  • Methyl L-alaninate hydrochloride 70 mg, 500 ⁇ mol
  • TEA 76 mg, 700 ⁇ mol
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 25% B to 45% B in 8 min, Wavelength: 254 nm; RT1(min): 7.63).
  • Step 2 1-((1S,2R,5R)-5-(hydroxymethyl)bicycle[3.1.0]hex-3-en-2-yl)-5- methylpyrimidine-2,4(1H,3H)-dione (20 mg, 85 ⁇ mol) and TEA (25 mg, 1.6 mmol) in DCM (3 mL) were then added at -40 °C under an inert atmosphere, then stirred for 15 h at 0 °C under an inert atmosphere. The reaction mixture was filtered and the filter cake was washed with DCM.
  • Methyl L-alaninate hydrochloride 50 mg, 300 ⁇ mol
  • TEA 54 mg, 500 ⁇ mol
  • LC/MS ES, m/z: 356/358/360 [M+H] + .
  • Step 2 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-iodopyrimidine- 2,4(1H,3H)-dione (30 mg, 89 ⁇ mol) and TEA (27 mg, 200 ⁇ mol) in DCM (5 mL) were then added at -40 °C under an inert atmosphere, and stirred for 16 h at 0°C, followed by filtration and washing of the filter cake with DCM.
  • LC/MS (ES, m/z): 563, 565, 567 [M+H] + 99.4% purity.
  • LC/MS conditions (Column: Luna Omega C18, 30 mm, 2.1 mm; Mobile Phase A: Water/0.1% FA; Mobile Phase B: ACN/0.1% FA; Flow rate: 1.2000 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 1.80 min, 100% B to 5.0% B in 1.82 min; Wavelength: 254 nm; RT1(min): 0.680).
  • Methyl L-alaninate hydrochloride (179 mg, 1.2 mmol) and TEA (194 mg, 1.9 mmol) were then added at -78 °C under an inert atmosphere, followed by stirring for 2 h at -40 °C under an inert atmosphere.
  • Step 2 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-5-fluoro-1-((2R,5S)-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (150 mg, 283 ⁇ mol) and TEA (85 mg, 849 ⁇ mol) in DCM (5 mL) were added at -40 °C under an inert atmosphere, followed by stirring for 16 h at 0 °C under an inert atmosphere. The reaction mixture was filtered, the filter cake was washed with DCM.
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH 4 HCO 3 +0.1% NH 3 .H 2 O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min; Wavelength: 254/210 nm; RT1(min): 6.56).
  • Step 1 To a stirred solution of 4-bromophenyl phosphorodichloridate (300 mg, 1.12 mmol) in DCM (10 mL) was added 4 A molecular sieves, followed by cooling to -78 °C. Methyl L-alaninate hydrochloride (139 mg, 1.2 mmol) and TEA (120 mg, 1.2 mmol) were then added at -78 °C under N 2 atmosphere, followed by stirring for 2 h at -40 °C under N 2 atmosphere.
  • Step 2 To a stirred solution of 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)- 5-(trifluoromethyl) pyrimidine-2,4(1H,3H)-dione (20 mg, 72 ⁇ mol) in DCM (2 mL), at -40 °C under an inert atmosphere was added TEA (43 mg, 400 ⁇ mol) , which was armed to 0 °C followed by stirring for 15 h at under an inert atmosphere.
  • TEA 43 mg, 400 ⁇ mol
  • the crude product was purified by Prep-HPLC under the following conditions: (SunFire Prep C18 OBD Column, 19*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH 4 HCO 3 +0.1%NH 3 .H 2 O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min, 70% B; Wavelength: 254 nm; RT1(min): 3.8, RT2(min): 4.05).
  • the first fraction was collected and concentrated under reduced pressure.
  • the residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(2,4-dioxo-5- (trifluoromethyl)-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)- L-alaninate (4.9 mg, 8 ⁇ mol, 11.3%) as a white solid.
  • the second fraction was collected and concentrated under reduced pressure.
  • Step 2 4-Amino-5-fluoro-1-((2S,5R)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (40 mg, 176 ⁇ mol) and TEA (50 mg, 2.1 mmol) in DCM (5 mL) were added at -40 °C under inert atmosphere. The mixture was then warmed to 0 °C and allowed to stir for an additional 15 h under an inert atmosphere.
  • Step 2 A solution of (2R,3S,5R)-5-(5-fluoro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (3.5 g, 6.1 mmol) and NaOH (271 mg, 6.7 mmol) in EtOH (30 mL) and H 2 O (10 mL) was stirred for 2 h at 100 °C under an inert atmosphere, then cooled to room temperature. The mixture was diluted with water and extracted with EtOAc (3 x 200 mL).
  • Step 3 A solution of (3R,5R)-8-fluoro-3-((trityloxy)methyl)-2,3-dihydro-5H,9H-2,5- methanopyrimido[2,1-b] [1,5,3] dioxazepin-9-one (2.6 g, 5.5 mmol) in TBAF (6.6 mL, 6.6 mmol, 1 M in THF) was stirred for 2 h at 60 °C under an inert atmosphere, then cooled to room temperature, and concentrated under reduced pressure.
  • Step 4 A solution of 5-fluoro-1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (1.5 g, 3.1 mmol) in AcOH (20 mL) and H2O (5 mL) was stirred for 4 h at room temperature under N2 atmosphere, then concentrated under reduced pressure.
  • Step 5 To a stirred solution of 5-fluoro-1-((2R,5S)-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (630 mg, 2.7 mmol) and imidazole (563 mg, 8.2 mmol) in DMF (10 mL) was added TBS-Cl (624 mg, 4.1 mmol) at room temperature under an inert atmosphere. The resulting solution was stirred for 16 h at 60 °C under an inert atmosphere, then cooled to room temperature, followed by dilution with water and extraction with EtOAc (3 x 80 mL).
  • Step 6 A solution of 1-((2R,5S)-5-(((tert-butyldimethylsilyl) oxy) methyl)-2,5- dihydrofuran-2-yl)-5-fluoropyrimidine-2,4(1H,3H)-dione (700 mg, 2 mmol), DMAP (499 mg, 4 mmol) and TEA (413 mg, 4 mmol) in ACN (10 mL) was treated with TIPS-Cl (1.2 g, 4 mmol) for 16 h at room temperature under N 2 atmosphere followed by the addition of conc. NH 3 -H 2 O (143 mg, 4 mmol) dropwise at room temperature.
  • Step 7 A solution of 4-amino-1-((2R,5S)-5-(((tert-butyldimethylsilyl) oxy) methyl)- 2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2(1H)-one (440 mg, 1.2 mmol) and DMTrCl (873 mg, 2.5 mmol) in pyridine (5 mL) was stirred for 16 h at 60 °C under an inert atmosphere followed by cooling to room temperature.
  • Step 8 A solution of 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-1-((2R,5S)-5- (((tert-butyldimethylsilyl) oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2(1H)-one (230 mg, 357 ⁇ mol) and TBAF (400 ⁇ L, 400 ⁇ mol, 1 M in THF) in THF (5 mL) was stirred for 16 h at room temperature under an inert atmosphere, then concentrated under reduced pressure.
  • Step 9 ((Hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (149 mg, 454 ⁇ mol) and 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-5-fluoro-1-((2R,5S)- 5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (120 mg, 227 ⁇ mol) were suspended in pyridine (5 mL). The mixture was evaporated to a residue under reduced pressure.
  • Step 10 A solution of 4- ⁇ (bis(4-methoxyphenyl) (phenyl)methyl) amino ⁇ -1-((2R,5S)- 5-(( ⁇ di((isopropoxycarbonyl)oxy) methoxyphosphoryl ⁇ oxy) methyl)-2,5-dihydrofuran-2-yl)-5- fluoropyrimidin-2-one (140 mg, 166 ⁇ mol) in AcOH (3.2 mL) and H2O (0.8 mL) was stirred for 2 h at room temperature under an inert atmosphere.
  • reaction mixture was then concentrated under reduced pressure and purified via Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min; Wavelength: 254/210 nm; RT1(min): 6.35).
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 29% B to 54% B in 7 min, 54% B; Wavelength: 254 nm; RT1(min): 6).
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: XSelect CSH Prep C18 OBD Column, 19*250 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH 4 HCO 3 ), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 43% B to 48% B in 8 min; Wavelength: 254 nm; RT1(min): 8). The product-containing fraction was collected and concentrated under vacuum.
  • Step 2 To a stirred solution of 1-((2R,4S,5R)-4-(benzoyloxy)-5-((benzoyloxy)methyl) tetrahydrofuran-2-yl)-5-iodo-2-oxo-1,2-dihydropyrimidin-4-yl benzoate (1.1 g, 1.72 mmol) in NMP (15 mL) were added tris(furan-2-yl) phosphane (160 mg, 690 ⁇ mol), Pd2(dba)3 (160 mg, 100 ⁇ mol) and tributyl(vinyl)stannane (820 mg, 2.58 mmol) under inert atmosphere, followed by stirring for 12 h at rt.
  • Step 3 To a solution of NH 3 (g) in MeOH (8 mL, 7 M) was added (2R,3S,5R)-5-(4- (benzoyloxy)-2-oxo-5-vinylpyrimidin-1(2H)-yl)-2-((benzoyloxy)methyl) tetrahydrofuran-3-yl benzoate (860 mg, 1.51 mmol), followed by stirring for 15 hours at room temperature under an inert atmosphere.
  • Step 4 To a stirred solution of 1-((2R,4S,5R)-4-hydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl)-5-vinylpyrimidine-2,4(1H,3H)-dione (320 mg, 1.25 mmol) in pyridine (5 mL) was added TrtCl (385 mg, 1.38 mmol) under an inert atmosphere, followed by stirring for 2 h at 110 °C under N2 atmosphere, and subsequent cooling to rt. MsCl (288 mg, 2.51 mmol) was added dropwise at room temperature, and stirred for an additional 2 h at rt followed by concentration under reduced pressure.
  • Step 5 A solution of (2R,3S,5R)-5-(2,4-dioxo-5-vinyl-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (362 mg, 630 ⁇ mol) in TBAF (5 mL, 5 mmol, 1 M in THF) was heated to 60 °C for 12 h at under an inert atmosphere, then cooled to rt.
  • TBAF 5 mL, 5 mmol, 1 M in THF
  • Step 6 A solution of 1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl)-5- vinylpyrimidine-2,4(1H,3H)-dione (190 mg, 397 ⁇ mol) in AcOH (4 mL) and H2O (1 mL) was stirred for 3 h at rt, then concentrated under reduced pressure and purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 ⁇ m; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% B to 18% B in 9 min; Wavelength: 254/210 nm; RT1(min): 7.21).
  • LC/MS conditions (Column: Luna Omega PS C18, 30*2.1 mm, 3.0 ⁇ m; Mobile Phase A: Water/0.1% FA, Mobile Phase B: ACN/0.1% FA; Flow rate: 1.20 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 0.60 min, 100% B to 5% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.361).
  • the mixture was evaporated to a residue by under reduced pressure for 20 min.
  • the residue was resuspended in ACN (5 mL), and BOP-Cl (375 mg, 1.47 mmol) was added at rt under N2 atmosphere, followed by additional stirring for 3 h at rt.
  • the resulting mixture was filtered, the filter cake was washed with ACN, and the filtrate was concentrated under reduced pressure.
  • Step 3 5-Methylpyrimidine-2,4(1H,3H)-dione (20.0 g, 158 mmol) and (NH 4 ) 2 SO 4 (3.00 g, 23.8 mmol) were stirred in HMDS (857 mL) at 130 °C under an inert atmosphere until homogeneous, then cooled to room temperature and concentrated under reduced pressure to afford 5-methyl-2,4-bis((trimethylsilyl)oxy)pyrimidine (25.6 g, 59%) as an off-white crude semi- solid.
  • Step 4 A solution of (2S,3S,4R,5S)-4-(benzoyloxy)-5-((benzoyloxy)methyl)tetra- hydrofuran-2,3-diyl diacetate (28.0 g, 63.2 mmol) in anhydrous DCE (224 mL) was added to 5- methyl-2,4-bis((trimethylsilyl)oxy)pyrimidine (23.0 g, 86.0 mmol), followed by the dropwise addition of trimethylsilyl triflate (37.3 mL, 206 mmol).
  • Step 5 (2S,3R,4S,5S)-4-Acetoxy-2-((benzoyloxy)methyl)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl benzoate (10.5 g, 20.6 mmol) was added to AcOH (21.0 mL) and pyridine (84.0 mL) at 0 °C under N2 followed by the addition of NH 2 NH 2 . H 2 O (6.50 g, 103 mmol, 80%) dropwise, then stirred for 12 h at rt under an inert atmosphere.
  • Step 6a A mixture of ((2S,3S,4S,5S)-3-(benzoyloxy)-4-hydroxy-5-(5-methyl-2,4- dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (8.60 g, 18.4 mmol), O-phenylchlorothionoformate (6.40 g, 36.8 mmol) and DMAP (9.00 g, 73.7 mmol) in ACN (170 mL) was stirred for 20 min at rt.
  • Step 6b A solution of ((2S,3R,4S,5S)-3-(benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-4-((phenoxycarbonothioyl)oxy)tetrahydrofuran-2-yl)methyl benzoate (7.00 g, 11.6 mmol), n-Bu 3 SnH (5.40 g, 18.5 mmol,) and AIBN (763 mg, 4.60 mmol) in dry toluene (70.0 mL) was heated and stirred for 12 h at 80 °C under an inert atmosphere.
  • Step 7 A mixture of ((2S,3S,5S)-3-(benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (3.70 g, 8.20 mmol) and NaOH (657 mg, 16.4 mmol) in MeOH (90.0 mL) was stirred for 30 min at rt, then concentrated under reduced pressure to remove solvent.
  • Step 8 A mixture of 1-((2S,4S,5S)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2- yl)-5-methylpyrimidine-2,4(1H,3H)-dione (1.00 g, 4.11 mmol) and Trt-Cl (1.38 g, 4.90 mmol) in pyridine (6.50 mL) was stirred at 100 °C under N2 until the dione was consumed completely, and the mixture was then cooled to 0 °C. MsCl (3.00 mL) was added, and the mixture was stirred at room temperature under an inert atmosphere until complete conversion was observed.
  • Step 9 A solution of (2S,3S,5S)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl)tetrahydrofuran-3-yl methanesulfonate (1.30 g, 2.30 mmol) in TBAF (90.0 mL, 90.0 mmol, 1.0 M in THF) was stirred for 12 h at 60 °C, then cooled to rt and concentrated under reduced pressure.
  • Step 10 5-Methyl-1-((2S,5R)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (100 mg, 214 ⁇ mol) in AcOH (1.50 mL, 80% in H2O) was stirred for 12 h at rt, then concentrated under reduced pressure.
  • Step 11 1-((2S,5R)-5-(Hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-methylpyrimidine- 2,4(1H,3H)-dione (30 mg, 134 ⁇ mol), ((hydroxyphosphoryl)bis(oxy))bis(methylene) di- isopropyl bis(carbonate) TEA salt (132 mg, 307 ⁇ mol) and NMI (329 mg, 4.00 mmol) were dissolved in pyridine (0.50 mL), then concentrated under reduced pressure. This process was repeated three times. The residue was dissolved in anhydrous ACN (2.00 mL) and degassed three times with N2.
  • LC/MS conditions (Column: HALOWA C18, 30*3.0 mm, 1.9 ⁇ m; Mobile Phase A: Water/0.05% TFA, Mobile Phase B: Acetonitrile/0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 5% B to 100% B in 1.30 min, 100% B to 100% B in 0.50 min, 100% B to 5% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.061).
  • Step 2 A mixture of (2R,3S,5R)-5-(5-bromo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (1.50 g, 2.39 mmol) and TBAF (100 mL, 100 mmol, 1M in THF) was stirred for overnight at 60 °C under an inert atmosphere. The reaction wasthen cooled to rt and concentrated under reduced pressure.
  • Step 3 To a stirred solution of 5-bromo-1-((2R,5S)-5-((trityloxy)methyl)-2,5- dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (390 mg, 0.73 mmol) in DCM (7.00 mL) was added dichloroacetic acid (DCA) (167 mg, 0.73 mmol) and TES-H (301 mg, 1.80 mmol) at rt, stirring until the starting material was completely converted to product as judged by LC/MS analysis. The reaction was then concentrated under reduced pressure, and the residue was purified by Prep-TLC (DCM / MeOH 10:1) to afford 200 mg crude product.
  • DCA dichloroacetic acid
  • TES-H 301 mg, 1.80 mmol
  • the crude product was re-purified by Prep-HPLC under the following conditions: (Column: C18 silica gel; Mobile phase A: water (6 mmol/L NH4HCO3) and B: ACN; Gradient: 0% to 100% B in 30 min; Detector: 254/220 nm).
  • the product-containing fraction was collected and concentrated under reduced pressure to remove the solvent, and lyophilized to afford 5-bromo-1-((2R,5S)-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4 (1H,3H)-dione (50 mg, 23%) as an off- white solid.
  • LC/MS (ES, m/z): 287/289 [M-H]-.98.5% purity.
  • LC/MS conditions (Column: Shim ⁇ pack Scepter C18, 33 x 3.0 mm; 3.0 ⁇ m; Mobile Phase A: water/ /5mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, hold 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254 nm; RT1(min): 0.370).
  • Step 4 5-Bromo-1-[(2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl]-3H- pyrimidine-2,4-dione (40 mg, 0.10 mmol), ((hydroxyphosphoryl)bis(oxy))bis(methylene) di- isopropyl bis(carbonate) (137 mg, 0.40 mmol) and NMI (341 mg, 4.10 mmol) were dissolved in pyridine (0.40 mL), then concentrated under reduced pressure. This process was repeated three times. The residue was dissolved in anhydrous ACN (2.00 mL) and degassed three times with N2.
  • Step 2 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-methyl-4-thioxo-3,4- dihydropyrimidin-2(1H)-one (80 mg, 333 ⁇ mol) and TEA (101 mg, 1 mmol) in DCM (6 mL) was added at -40 °C under N 2 atmosphere, then stirred for 48 hours at 5 °C. The mixture was filtered and the filter cake was washed with additional DCM.
  • LC/MS conditions (Column: Luna Omega PS C18, 30*2.1 mm, 3 ⁇ m; Mobile Phase A: water/0.1% FA, Mobile Phase B: Acetonitrile; Flow rate: 1.20 mL/min; Gradient: 5% B to 60% B in 1.70 min, 60% B to 100% B in 0.50 min,100% B to 100% B in 0.50 min, 100% B to 5% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.219).
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: Xselect CSH PrepC18 Column, 19*250 mm, 5 ⁇ m; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 41% B to 51% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 7).
  • the product-containing fraction was collected and concentrated under reduced pressure.
  • Step 2 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-(methyl-d3) pyrimidine-2,4 (1H,3H)-dione (20 mg, 88 ⁇ mol)) and TEA (45 mg, 440 ⁇ mol)) in DCM (5 mL) were added at -40 °C under N 2 atmosphere. The resulting mixture was warmed to 0 °C and stirred for 16 h, then filtered and washed with DCM.
  • Methyl ((4-bromophenoxy) (perfluorophenoxy)phosphoryl)-L- alaninate (153 mg, 304 ⁇ mol) was added at 0 °C, and the mixture was stirred for 12 hours at rt, filtered, and washed with MeOH (3 x 5 mL).
  • the crude product was further purified by Prep-HPLC under the following conditions: (Column: X-Select Prep OBD C18 Column, 30*150 mm, 5 ⁇ m; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 30% B to 50% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 6.56).
  • Step 1 (4R,5S)-5-(hydroxymethyl) oxolane-2,4-diol (6 g, 44.77 mmol) in MeOH (50 mL) and acetyl chloride (0.1 mL) were combined at 0°C, and the solution was stirred for 1 h at room temperature, then concentrated under reduced pressure to afford crude (2S,3R)-2- (hydroxymethyl)-5-methoxyoxolan-3-ol (6 g). The crude material was redissolved in DCM (60 mL) and treated with TEA (12.2 g, 120.8 mmol). Benzoyl chloride (6.2 g, 44.29 mmol) was added portion-wise at 0°C.
  • Step 2 To a solution of [(2S,3R)-3-hydroxy-5-methoxyoxolan-2-yl] methyl benzoate (4.1 g, 16.20 mmol) and Ac2O (6.1 mL) in DCM (40 mL) was added PDC (12.18 g, 32.40 mmol) at room temperature. The reaction was then stirred for 1 h at rt, then filtered and washed with additional portions of DCM. The combined filtrate was concentrated under reduced pressure, and the crude product (3.4 g) was used directly in the next step. LC/MS (ES, m/z): 249 (M-H-).
  • Step 3 DAST (10.00 g, 62.1 mmol) was added at rt, and the resulting solution was stirred overnight at 40oC and quenched by the addition of ice-water, followed by extraction with DCM. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then purified by silica gel column chromatography, eluting with petroleum ether/EtOAc (1:1) to afford [(2S)-3,3-difluoro-5-methoxyoxolan-2-yl] methyl benzoate (1.8 g, 40.9% yield over two steps) as a yellow oil.
  • Step 4 To a solution of [(2S)-3,3-difluoro-5-methoxyoxolan-2-yl] methyl benzoate (1.8 g, 6.6 mmol) in AcOH (18 mL) and Ac2O (2.7 mL) was added H2SO4 (0.7 mL) at 0°C, followed by stirring for 1 h at rt and then quenching by the addition of water. The solution was adjusted to pH 7 with saturated NaHCO3 (aq.), and the mixture was extracted with EtOAc. The combined organic layers were washed with brine and dried over anhydrous Na2SO4.
  • Step 5 To a solution of fluorouracil (1.17 g, 9 mmol) in CH 3 CN (10 mL) was added trimethylsilyl N-(trimethylsilyl) ethanecarboximidate (3.65 g, 18 mmol) at rt.
  • Step 6 To a solution of [(2S,5S)-3,3-difluoro-5-(5-fluoro-2,4-dioxo-3H-pyrimidin-1- yl) oxolan-2-yl] methyl benzoate (160 mg, 0.43 mmol) in CH3CN (1 mL) was added DMAP (158 mg, 1.29 mmol) and TEA (131 mg, 1.29 mmol) at 0°C, followed by the addition of 2,4,6- tris(propan-2-yl) benzene-1-sulfonyl chloride (391 mg, 1.29 mmol) portion-wise at 0°C.
  • reaction was, then stirred for 12 h at room temperature. After which point, the reaction was cooled to 0°C, and treated with a dropwise addition of NH3 . H2O (1 mL). The resulting solution was stirred for 1 h at rt and then quenched by the addition of ice water. The resulting mixture was extracted with EtOAc. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4.
  • Step 7 To a solution of 4-amino-1-[(2S,5S)-4,4-difluoro-5-(hydroxymethyl) oxolan-2- yl]-5-fluoropyrimidin-2-one (90 mg, 33.96 mmol) in DMF (1 mL) was added NaOMe (82 mg, 1.52 mmol) at rt. The reaction was then stirred for 12 h at rt before being concentrated at reduced pressure.
  • the crude product was purified by Prep-HPLC under the following conditions: (Column: YMC-Actus Triart C 18ExRS, 19*250 mm, 5 ⁇ m; Mobile Phase A: Water (10mmol/L NH 4 HCO 3 ), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 3% B to 35% B in 7min; Wavelength: 254nm/220nm nm; RT1(min): 6.98).
  • the first eluting isomer fraction was collected and concentrated under reduced pressure, re-dissolved in ACN and H2O, then lyophilized to afford Compound VIII-12, methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (957 mg, 35.2%) as a white solid.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Genetics & Genomics (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Psychiatry (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Substituted halo-dehydro-3'-deoxyuracil phosphoramidates and related compounds, pharmaceutical compositions, their use for inhibiting LINE1 reverse transcriptase and/or HERV-K reverse transcriptase activity, and their use in the treatment of medical disorders, such as cancer, are disclosed herein.

Description

HALO-DEHYDRO-3'-DEOXYURACIL PHOSPHORAMIDATES AND RELATED COMPOUNDS AND THEIR USE IN TREATING MEDICAL CONDITIONS
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of and priority to United States Provisional Patent Application serial number 63/425,412, filed November 15, 2022; the contents of which are hereby incorporated by reference in their entirety.
REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0002] This application contains a Sequence Listing which has been submitted electronically via Patent Center in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on November 14, 2023, is named 205647_seqlist.xml and is 2,700 bytes in size.
FIELD OF THE DISCLOSURE
[0003] Substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, pharmaceutical compositions, their use for inhibiting LINE1 reverse transcriptase and/or HERV- K reverse transcriptase activity, and their use in the treatment of medical disorders, such as cancer, are disclosed herein.
BACKGROUND
[0004] Cancer continues to be a significant health problem despite the substantial research efforts and scientific advances reported in the literature for treating this disease. Solid tumors, including prostate cancer, breast cancer, and lung cancer remain highly prevalent among the world population. Leukemias and lymphomas also account for a significant proportion of new cancer diagnoses. Current treatment options for these cancers are not effective for all patients and/or can have substantial adverse side effects. New therapies are needed to address this unmet need in cancer therapy.
[0005] Accordingly, the need exists for new therapeutic methods that provide improved efficacy and/or reduced side effects for treating medical disorders, such as cancer, inflammatory or immune disorders, or neurodegenerative disorders. The present disclosure addresses the foregoing needs and provides other related advantages.
SUMMARY
[0006] Substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, pharmaceutical compositions, their use for inhibiting LINE1 reverse transcriptase and/or HERV- K reverse transcriptase activity, and their use in the treatment of medical disorders, such as cancer, are disclosed herein. In particular, one aspect of the disclosure provides a collection of substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula I:
Figure imgf000003_0001
or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Another aspect of the disclosure provides a collection of substituted halo-dehydro- 3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula 1-1:
Figure imgf000003_0002
(1-1) or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Further description of additional collections of substituted halo-dehydro-3'- deoxyuracil phosphoramidates and related compounds are described in the detailed description. The compounds may be part of a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
[0007] Another aspect of the disclosure provides a collection of substituted bicyclo[3.1.0]hex- 2-ene phosphoramidates and related compounds, such as a compound represented by Formula II:
Figure imgf000004_0001
[0008] or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Another aspect of the disclosure provides a collection of substituted bicyclo[3.1.0]hex-2-ene phosphoramidates and related compounds, such as a compound represented by Formula II:
Figure imgf000004_0002
or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Further description of additional collections of substituted bicyclo[3.1.0]hex-2-ene phosphoramidates and related compounds are described in the detailed description. The compounds may be part of a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
[0009] Another aspect of the disclosure provides a collection of substituted halo-dehydro-3'- deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula III:
Figure imgf000004_0003
or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Another aspect of the disclosure provides a collection of substituted halo-dehydro- 3 '-deoxyuracil phosphoramidates and related compounds, such as a compound represented by Formula III-l :
Figure imgf000005_0001
(III-l) or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Further description of additional collections of substituted halo-dehydro-3'- deoxyuracil phosphorami dates and related compounds are described in the detailed description. The compounds may be part of a pharmaceutical composition comprising a pharmaceutically acceptable carrier.
[0010] Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder. The method comprises administering a therapeutically effective amount of a compound described herein, such as a compound of Formula I, II, or III, to a subject in need thereof to treat the disorder, as further described in the detailed description. The method comprises administering a therapeutically effective amount of a compound described herein, such as a compound of Formula I, II, III, 1-1, II- 1, or III- 1 , to a subject in need thereof to treat the disorder, as further described in the detailed description.
[0011] Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection. The method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV, V, or VI to treat the disorder; wherein Formula IV, V, and VI are represented by:
Figure imgf000005_0002
(IV) (V) (VI)
[0012] or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. [0013] Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection. The method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV-1, V-l, or VI-1 to treat the disorder; wherein Formula IV-1, V-l, and VI-1 are represented by:
Figure imgf000006_0001
(IV-1) (V-l) (VI-1) or a pharmaceutically acceptable salt thereof, where the variables are as defined in the detailed description. Additional features of the method are described in the detailed description.
[0014] Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity. The method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, or III, in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
[0015] Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection. The method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, or VI, in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description. In another aspect, method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, VI, IV-1, V-l, or VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase, as further described in the detailed description.
[0016] Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity. The method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, or III, in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description. In another aspect, the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula I, II, III, 1-1, II- 1 , or III- 1 , in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
[0017] Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodeg enerative disorder, and an immune disorder other than a viral infection. The method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, or VI, in order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description. In another aspect the method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described herein, such as a compound of Formula IV, V, VI, IV-1, V-l, or Vl-lin order to inhibit the activity of said HERV-K reverse transcriptase, as further described in the detailed description.
BRIEF DESCRIPTION OF FIGURES
[0018] Figure 1 is a graph depicting interferon levels over time in THPl-Dual™ KO-TREX1 xenografts from mice treated with vehicle or decitabine (DAC) at 5mg/kg IP, once daily, for four days, as described in Example 44.
DETAILED DESCRIPTION
[0019] Substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, pharmaceutical compositions, their use for inhibiting LINE1 reverse transcriptase and/or HERV- K reverse transcriptase activity, and their use in the treatment of medical disorders, such as cancer, are disclosed herein. The practice of the present disclosure employs, unless otherwise indicated, conventional techniques of organic chemistry, pharmacology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology. Such techniques are explained in the literature, such as in “Comprehensive Organic Synthesis” (B.M. Trost & I. Fleming, eds., 1991-1992); “Handbook of experimental immunology” (D.M. Weir & C.C. Blackwell, eds.); “Current protocols in molecular biology” (F.M. Ausubel etal., eds., 1987, and periodic updates); and “Current protocols in immunology” (J.E. Coligan et al., eds., 1991), each of which is herein incorporated by reference in its entirety.
[0020] Various aspects of the disclosure are set forth below in sections; however, aspects of the disclosure described in one particular section are not to be limited to any particular section. Further, when a variable is not accompanied by a definition, the previous definition of the variable controls.
Definitions
[0021] Compounds of the present disclosure include those described generally herein, and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise indicated. These definitions apply regardless of whether a term is used by itself or in combination with other terms, unless otherwise indicated. Hence, the definition of “alkyl” applies to “alkyl” as well as the “alkyl” portions of “-O-alkyl” etc. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in “Organic Chemistry”, Thomas Sorrell, University Science Books, Sausalito: 1999, and “March’s Advanced Organic Chemistry”, 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are hereby incorporated by reference.
[0022] The term “aliphatic” or “aliphatic group”, as used herein, means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as “cycloaliphatic”), that has a single point of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-6 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms. In some embodiments, “cycloaliphatic” refers to a monocyclic C3-C6 hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
[0023] As used herein, the term “bicyclic ring” or “bicyclic ring system” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or having one or more units of unsaturation, having one or more atoms in common between the two rings of the ring system. Thus, the term includes any permissible ring fusion, such as wz/vo-fused or spirocyclic. As used herein, the term “heterobicyclic” is a subset of “bicyclic” that requires that one or more heteroatoms are present in one or both rings of the bicycle. Such heteroatoms may be present at ring junctions and are optionally substituted, and may be selected from nitrogen (including N-oxides), oxygen, sulfur (including oxidized forms such as sulfones and sulfonates), phosphorus (including oxidized forms such as phosphates), boron, etc. In some embodiments, a bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. As used herein, the term “bridged bicyclic” refers to any bicyclic ring system, i.e. carbocyclic or heterocyclic, saturated or partially unsaturated, having at least one bridge. As defined by IUPAC, a “bridge” is an unbranched chain of atoms or an atom or a valence bond connecting two bridgeheads, where a “bridgehead” is any skeletal atom of the ring system which is bonded to three or more skeletal atoms (excluding hydrogen). In some embodiments, a bridged bicyclic group has 7-12 ring members and 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Such bridged bicyclic groups are well known in the art and include those groups set forth below where each group is attached to the rest of the molecule at any substitutable carbon or nitrogen atom. Unless otherwise specified, a bridged bicyclic group is optionally substituted with one or more substituents as set forth for aliphatic groups. Additionally or alternatively, any substitutable nitrogen of a bridged bicyclic group is optionally substituted. Exemplary bicyclic rings include:
Figure imgf000009_0001
[0024] Exemplary bridged bicyclics include: NH NH N H H . [0025]
Figure imgf000010_0001
p. Exemplary lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl. [0026] The term “lower haloalkyl” refers to a C1-4 straight or branched alkyl group that is substituted with one or more halogen atoms. [0027] The term “heteroatom” means one or more of oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring, for example N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR+ (as in N-substituted pyrrolidinyl)). [0028] The term “unsaturated,” as used herein, means that a moiety has one or more units of unsaturation. [0029] As used herein, the term “bivalent C1-8 (or C1-6) saturated or unsaturated, straight or branched, hydrocarbon chain”, refers to bivalent alkylene, alkenylene, and alkynylene chains that are straight or branched as defined herein. [0030] The term “alkylene” refers to a bivalent alkyl group. An “alkylene chain” is a polymethylene group, i.e., –(CH2)n–, wherein n is a positive integer, preferably from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. A substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group. [0031] The term “-(C0 alkylene)-“ refers to a bond. Accordingly, the term “-(C0-3 alkylene)-” encompasses a bond (i.e., C0) and a -(C1-3 alkylene)- group. [0032] The term “alkenylene” refers to a bivalent alkenyl group. A substituted alkenylene chain is a polymethylene group containing at least one double bond in which one or more hydrogen atoms are replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group. [0033] The term “halogen” means F, Cl, Br, or I. [0034] The term “aryl” used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic or bicyclic ring systems having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic and wherein each ring in the system contains 3 to 7 ring members. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present disclosure, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like. The term “phenylene” refers to a multivalent phenyl group having the appropriate number of open valences to account for groups attached to it. For example, “phenylene” is a bivalent phenyl group when it has two groups attached ); “phenylene” is a trivalent phenyl group when it has three groups attache ). The term “arylene” refers to a bivalent aryl group.
Figure imgf000011_0001
[0035] The terms “heteroaryl” and “heteroar-,” used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to groups having 5 to 10 ring atoms, preferably 5, 6, or 9 ring atoms; having 6, 10, or 14 % electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. The term “heteroatom” refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. The terms “heteroaryl” and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where unless otherwise specified, the radical or point of attachment is on the heteroaromatic ring or on one of the rings to which the heteroaromatic ring is fused. Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4//-quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, and tetrahydroisoquinolinyl. A heteroaryl group may be mono- or bicyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, wherein the alkyl and heteroaryl portions independently are optionally substituted.
[0036] The term “heteroarylene” refers to a multivalent heteroaryl group having the appropriate number of open valences to account for groups attached to it. For example, “heteroarylene” is a bivalent heteroaryl group when it has two groups attached to it; “heteroarylene” is a trivalent heteroaryl group when it has three groups attached to it. The term “pyridinylene” refers to a multivalent pyridine radical having the appropriate number of open valences to account for groups attached to it. For example, “pyridinylene” is a bivalent pyridine radical when it has two groups
Figure imgf000012_0001
[0037] As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring” are used interchangeably and refer to a stable 5- to 7-membered monocyclic or 7-10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4-dihydro- 2/7 pyrrol yl), NH (as in pyrrolidinyl), or +NR (as in //-substituted pyrrolidinyl).
[0038] A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothiophenyl pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, 2-oxa-6- azaspiro[3.3]heptane, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3/f-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be mono- or bicyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted. The term “oxo-heterocyclyl” refers to a heterocyclyl substituted by an oxo group. The term “heterocyclylene” refers to a multivalent heterocyclyl group having the appropriate number of open valences to account for groups attached to it. For example, “heterocyclylene” is a bivalent heterocyclyl group when it has two groups attached to it; “heterocyclylene” is a trivalent heterocyclyl group when it has three groups attached to it.
[0039] As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined. [0040] As described herein, compounds of the disclosure may contain “optionally substituted” moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.
[0041] Each optional substituent on a substitutable carbon is a monovalent substituent independently selected from halogen; -(CIUjo-iR0; -(CH2)O-40R°; -0(CH2)O-4R°, -0-(CH2)O- 4C(O)ORO; -(CH2)O-4CH(OR°)2; -(CH2)O 4SR0; -(CH2)O 4Ph, which may be substituted with R°; -(CH2)o-40(CH2)o-iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)O-40(CH2)O-I -pyridyl which may be substituted with R°; -NO2; -CN; - N3; -(CH2)O-4N(R0)2; -(CH2)O-4N(R°)C(0)R°; -N(R°)C(S)R°; -(CH2)O^N(R0)C(0)NR0 2; -N(RO)C(S)NR°2; -(CH2)O^N(R°)C(0)OR°; -N(R°)N(R°)C(O)R°; -N(RO)N(R°)C(O)NR°2; -N(R°)N(R°)C(O)OR°; -(CH2)o-4C(0)R°; -C(S)R°; -(CH2)o^C(0)OR°; -(CH2)o-4C(0)SR°; -(CH2)o^C(0)OSiR°3; -(CH2)o-40C(0)R°; -OC(0)(CH2)o^SR-, SC(S)SR°; -(CH2)o-4SC(0)R°; -(CH2)O-4C(0)NR°2; -C(S)NRO 2; -C(S)SR°; -SC(S)SR°, -(CH2)O^OC(0)NR°2;
-C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)R°; -C(NOR°)R°; -(CH2)O-4SSR°; -(CH2)O- 4S(O)2RO; -(CH2)O-4S(0)2OR°; -(CH2)0^OS(O)2RO; -S(O)2NRO 2; -S(O)(NR°)R°; - S(O)2N=C(NR°2)2; -(CH2)O-4S(0)R0; -N(RO)S(O)2NR°2; -N(RO)S(O)2R°; -N(OR°)R°; - C(NH)NR°2; -P(O)2RO; -P(O)R°2; -OP(O)R°2; -OP(O)(OR°)2; SiR°3; -(Ci^ straight or branched alkylene)O-N(R°)2; or -(C1-4 straight or branched alkylene)C(O)O-N(R°)2.
[0042] Each R° is independently hydrogen, C1-6 aliphatic, -CH2Ph, -0(CH2)o-iPh, -CH2-(5-6 membered heteroaryl ring), or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted by a divalent substituent on a saturated carbon atom of R° selected from =0 and =S; or each R° is optionally substituted with a monovalent substituent independently selected from halogen, -(CH2)o-2R*, -(haloR*), -(CH2)o-20H, -(CH2)o-20R*, - (CH2)o-2CH(OR*)2; -O(haloR’), -CN, -N3, -(CH2)o-2C(0)R*, -(CH2)o-2C(0)OH, -(CH2)o- 2C(O)OR*, -(CH2)O-2SR*, -(CH2)O-2SH, -(CH2)O-2NH2, -(CH2)O-2NHR*, -(CH2)O-2NR*2, -NO2, -SiR*3, -OSiR*3, -C(O)SR* -(CI-4 straight or branched alkylene)C(O)OR*, or -SSR*.
[0043] Each R* is independently selected from Ci-4 aliphatic, -CEEPh, -0(CH2)o-iPh, or a 5- 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R* is unsubstituted or where preceded by halo is substituted only with one or more halogens; or wherein an optional substituent on a saturated carbon is a divalent substituent independently selected from =0, =S, =NNR*2, =NNHC(0)R*, =NNHC(0)0R*, =NNHS(O)2R*, =NR\ =NOR\ O(C(R*2))2-3O , or S(C(R*2))2-3S-, or a divalent substituent bound to vicinal substitutable carbons of an “optionally substituted” group is -O(CR* 2)2-30-, wherein each independent occurrence of R4 is selected from hydrogen, C1-6 aliphatic or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.
[0044] When R* is C1-6 aliphatic, R* is optionally substituted with halogen, - R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is independently selected from C1-4 aliphatic, -CH2PI1, -0(CH2)o-iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R* is unsubstituted or where preceded by halo is substituted only with one or more halogens.
[0045] An optional substituent on a substitutable nitrogen is independently -R\ -NR^, - C(O)RT, -C(O)ORt, -C(O)C(O)Rt, -C(O)CH2C(O)Rt, -S(O)2RT, -S(O)2NRt2, -C(S)NRt 2, - C(NI I)NR'?, or -NfR'jSfOfR'; wherein each R1' is independently hydrogen, C1-6 aliphatic, unsubstituted -OPh, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, two independent occurrences of R\ taken together with their intervening atom(s) form an unsubstituted 3-12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur; wherein when R' is Ci-6 aliphatic, R' is optionally substituted with halogen, -R*, -(haloR*), -OH, -OR*, - O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is independently selected from C1-4 aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, and wherein each R* is unsubstituted or where preceded by halo is substituted only with one or more halogens.
[0046] As used herein, the term "pharmaceutically acceptable salt" refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1—19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphor sulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. [0047] Further, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl el al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley-VCH; S. Berge et al., Journal of Pharmaceutical Sciences (1977) 66(1) 1-19; P. Gould, International J. of Pharmaceutics (1986) 33 201-217; Anderson et al., The Practice of Medicinal Chemistry (1996), Academic Press, New York; and in The Orange Book (Food & Drug Administration, Washington, D.C. on their website). These disclosures are incorporated herein by reference.
[0048] Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N+(C 1-4 alky 1)4 salts. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, loweralkyl sulfonate and aryl sulfonate.
[0049] Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the disclosure. Unless otherwise stated, all tautomeric forms of the compounds of the disclosure are within the scope of the disclosure. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a 13C- or 14C-enriched carbon are within the scope of this disclosure. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents in accordance with the present disclosure.
[0050] Unless indicated otherwise, when a D is specifically recited at a position or is shown in a chemical formula, this D represents a mixture of hydrogen and deuterium where the amount of deuterium is about 100% (i.e., the abundance of deuterium ranges from at least 90% up to 100%). In certain embodiments, the abundance of deuterium in D is from 95% to 100%, or from 97% to 100%. Deuterium (2H) is a stable, non-radioactive isotope of 'H hydrogen and has an atomic weight of 2.014. Hydrogen naturally occurs as a mixture of the isotopes LH hydrogen (z.c., protium), deuterium (2H), and tritium (3H). The natural abundance of deuterium is 0.015%. One of ordinary skill in the art recognizes that in all chemical compounds with an H atom, the H atom actually represents a mixture of 'H hydrogen, deuterium (2H), and tritium (3H), where about 0.015% is deuterium.
[0051] Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher’s acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Alternatively, a particular enantiomer of a compound of the present disclosure may be prepared by asymmetric synthesis. Still further, where the molecule contains a basic functional group (such as amino) or an acidic functional group (such as carboxylic acid) diastereomeric salts are formed with an appropriate optically- active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means known in the art, and subsequent recovery of the pure enantiomers.
[0052] Individual stereoisomers of the compounds of the disclosure may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. Chiral center(s) in a compound of the present disclosure can have the S or R configuration as defined by the IUPAC 1974 Recommendations. Further, to the extent a compound described herein may exist as a atropisomer (e.g., substituted biaryls), all forms of such atropisomer are considered part of this disclosure.
[0053] Chemical names, common names, and chemical structures may be used interchangeably to describe the same structure. If a chemical compound is referred to using both a chemical structure and a chemical name, and an ambiguity exists between the structure and the name, the structure predominates. It should also be noted that any carbon as well as heteroatom with unsatisfied valences in the text, schemes, examples and tables herein is assumed to have the sufficient number of hydrogen atom(s) to satisfy the valences.
[0054] The terms “a” and “an” as used herein mean “one or more” and include the plural unless the context is inappropriate.
[0055] The term “alkyl” refers to a saturated straight or branched hydrocarbon, such as a straight or branched group of 1-12, 1-10, or 1-6 carbon atoms, referred to herein as C1-C12 alkyl, C1-C10 alkyl, and Ci-Ce alkyl, respectively. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2 -methyl- 1 -propyl, 2-methyl-2-propyl, 2 -methyl- 1 -butyl, 3- methyl-1 -butyl, 2-methyl-3 -butyl, 2,2-dimethyl-l -propyl, 2-methyl-l -pentyl, 3-methyl-l-pentyl, 4-methyl-l -pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-l- butyl, 3,3-dimethyl-l-butyl, 2-ethyl-l-butyl, butyl, isobutyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, heptyl, octyl, etc.
[0056] The term “cycloalkyl” refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3-12, 3-8, 4-8, or 4-6 carbons, referred to herein, e.g., as “C3-C6 cycloalkyl,” derived from a cycloalkane. Exemplary cycloalkyl groups include cyclohexyl, cyclopentyl, cyclobutyl, and cyclopropyl. The term “cycloalkylene” refers to a bivalent cycloalkyl group.
[0057] The term “haloalkyl” refers to an alkyl group that is substituted with at least one halogen. Exemplary haloalkyl groups include -CH2F, -CHF2, -CF3, -CH2CF3, -CF2CF3, and the like. The term “haloalkylene” refers to a bivalent haloalkyl group. The term “halomethyl” refers to a haloalkyl group containing a single carbon atom.
[0058] The term “hydroxyalkyl” refers to an alkyl group that is substituted with at least one hydroxyl. Exemplary hydroxyalkyl groups include -CH2CH2OH, -C(H)(OH)CH3, -CH2C(H)(OH)CH2CH2OH, and the like.
[0059] The terms “alkenyl” and “alkynyl” are art-recognized and refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.
[0060] The term “carbocyclylene” refers to a multivalent carbocyclyl group having the appropriate number of open valences to account for groups attached to it. For example, “carbocyclylene” is a bivalent carbocyclyl group when it has two groups attached to it; “carbocyclylene” is a trivalent carbocyclyl group when it has three groups attached to it. [0061] The terms “alkoxyl” or “alkoxy” are art-recognized and refer to an alkyl group, as defined above, having an oxygen radical attached thereto. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like. The term “haloalkoxyl” refers to an alkoxyl group that is substituted with at least one halogen. Exemplary haloalkoxyl groups include -OCH2F, -OCHF2, -OCF3, -OCH2CF3, -OCF2CF3, and the like. [0062] The term “oxo” is art-recognized and refers to a “=O” substituent. For example, a cyclopentane substituted with an oxo group is cyclopentanone. [0063] The symbol “ ” indicates a point of attachment. [0064] When a chemical structure containing a ring is depicted with a substituent having a bond that crosses a ring bond, the substituent may be attached at any available position on the ring. For example, the chemical structur encompass ,
Figure imgf000020_0001
Figure imgf000020_0002
and . In the context of a polycyclic fused ring, when a chemical structure containing a pol
Figure imgf000020_0003
sed ring is depicted with one or more substituent(s) having a bond that crosses multiple rings, the one or more substituent(s) may be independently attached to any of the rings crossed by the bond. To illustrate, the chemical structur encompasses, for
Figure imgf000020_0004
example, . [0065]
Figure imgf000020_0005
When any substituent or variable occurs more than one time in any constituent or the compound of the disclosure, its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated. [0066] One or more compounds of the disclosure may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the disclosure embrace both solvated and unsolvated forms. “Solvate” means a physical association of a compound of this disclosure with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances, the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. “Solvate” encompasses both solution-phase and isolatable solvates. Non-limiting examples of suitable solvates include ethanolates, methanolates, and the like. “Hydrate” is a solvate wherein the solvent molecule is H2O.
[0067] As used herein, the terms “subject” and “patient” are used interchangeable and refer to organisms to be treated by the methods of the present disclosure. Such organisms preferably include, but are not limited to, mammals (e.g., murines, simians, equines, bovines, porcines, canines, felines, and the like), and most preferably includes humans.
[0068] The term “IC50” is art-recognized and refers to the concentration of a compound that is required to achieve 50% inhibition of the target.
[0069] As used herein, the term “effective amount” refers to the amount of a compound sufficient to effect beneficial or desired results (e.g., a therapeutic, ameliorative, inhibitory or preventative result). An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route. As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.
[0070] As used herein, the term “pharmaceutical composition” refers to the combination of an active agent with a carrier, inert or active, making the composition especially suitable for diagnostic or therapeutic use in vivo or ex vivo.
[0071] As used herein, the term “pharmaceutically acceptable carrier” refers to any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions (e.g., such as an oil/water or water/oil emulsions), and various types of wetting agents. The compositions also can include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see e.g, Martin, Remington’s Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA [1975],
[0072] For therapeutic use, salts of the compounds of the present disclosure are contemplated as being pharmaceutically acceptable. However, salts of acids and bases that are non- pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.
[0073] In addition, when a compound of the disclosure contains both a basic moiety (such as, but not limited to, a pyridine or imidazole) and an acidic moiety (such as, but not limited to, a carboxylic acid) zwitterions (“inner salts”) may be formed. Such acidic and basic salts used within the scope of the disclosure are pharmaceutically acceptable (z.e., non-toxic, physiologically acceptable) salts. Such salts of the compounds of the disclosure may be formed, for example, by reacting a compound of the disclosure with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization.
[0074] Throughout the description, where compositions are described as having, including, or comprising specific components, or where processes and methods are described as having, including, or comprising specific steps, it is contemplated that, additionally, there are compositions of the present disclosure that consist essentially of, or consist of, the recited components, and that there are processes and methods according to the present disclosure that consist essentially of, or consist of, the recited processing steps.
[0075] As a general matter, compositions specifying a percentage are by weight unless otherwise specified.
I. Substituted Halo-Dehydro-3'-Deoxyuracil Phosphoramidates and Related Compounds
[0076] Substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds, are disclosed herein. The compounds may be used in the pharmaceutical compositions and therapeutic methods described herein. Exemplary compounds are described in the following sections, along with exemplary procedures for making the compounds. [0077] One aspect of the disclosure provides a compound represented by Formula I: or a pharmaceutically acceptab
Figure imgf000023_0001
herein: R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000023_0002
m is 0, 1, 2, or 3. [0078] The definitions of variables in Formula I above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0079] In certain embodiments, the compound is a compound of Formula I, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula I. [0080] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or - P(O)(N(R6)(R7))(N(R6)(R7));. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 1 and 6- C, below. [0081] As defined generally above, R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro. In some embodiments, R2 is fluoro and R3 is hydrogen. In some embodiments, R2 is hydrogen and R3 is fluoro. In certain embodiments, R2 and R3 are selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0082] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0083] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0084] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0085] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0086] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0087] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0088] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000025_0001
[0089] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0090] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0091] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0092] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. . ,
Figure imgf000026_0001
Figure imgf000027_0001
Figure imgf000027_0002
certain embodiments,
Figure imgf000027_0003
[0096] In certain embodiments, R7 is
Figure imgf000027_0004
In certain embodiments, R7 is
Figure imgf000027_0007
is j'~'' . In certain embodiments, R7 is •A~v . In certain embodiments, R7 is
Figure imgf000027_0005
In certain embodiments, R7 is
Figure imgf000027_0006
In certain embodiments, R7 is .
Figure imgf000028_0001
he groups depicted in the compounds in Table 1 and 6-C, below. [0098] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0099] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0100] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0101] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0102] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0103] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0104] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0105] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0106] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0107] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0108] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0109] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0110] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0111] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0112] In certain embodiments, R9 is C2-6 alkenyl. [0113] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0114] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0115] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0116] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0117] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3. [0118] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0119] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 1 and 6-C, below. [0120] As defined generally above In some
Figure imgf000031_0001
embodiments, B1 i . In some embodiment .
Figure imgf000031_0003
Figure imgf000031_0002
[0121] In some embodiments, B1 i , and R11 is hydrogen or halo. In some
Figure imgf000031_0004
1 is
Figure imgf000031_0005
[0122] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 1 and 6-C, below. [0123] The description above describes multiple embodiments relating to compounds of Formula I. The patent application specifically contemplates all combinations of the embodiments. [0124] One aspect of the disclosure provides a compound represented by Formula I-1:
Figure imgf000031_0006
an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000032_0001
m s 0, , , or 3. [0125] The definitions of variables in Formula I-1 above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0126] In certain embodiments, the compound is a compound of Formula I-1, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula I-1. [0127] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 1, below. [0128] As defined generally above, R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro. In some embodiments, R2 is fluoro and R3 is hydrogen. In some embodiments, R2 is hydrogen and R3 is fluoro. In certain embodiments, R2 and R3 are selected from the groups depicted in the compounds in Table 1, below. [0129] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0130] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0131] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0132] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0133] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 1, below. [0134] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0135] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000034_0001
[0136] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 1, below. [0137] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0138] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 1, below. [0139] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. [0140] In certain embodiments ,
Figure imgf000034_0002
Figure imgf000035_0001
Figure imgf000035_0002
. In certain embodiments or
Figure imgf000036_0001
. In certain embodiments In
Figure imgf000036_0002
Figure imgf000036_0003
certain embodiments .
Figure imgf000036_0004
[0143] In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000036_0005
In certain embodiments, R7
Figure imgf000036_0006
ertain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000036_0007
Figure imgf000036_0008
. In certain embodiments, R7 . In certain embodiments, R7 is
Figure imgf000036_0010
tain embodiments .
Figure imgf000036_0009
[0144] In certain embodiments, R7
Figure imgf000036_0011
is selected from the groups depicted in the compounds in Table 1, below. [0145] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0146] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0147] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0148] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0149] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0150] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0151] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0152] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0153] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 1, below. [0154] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0155] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0156] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0157] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0158] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0159] In certain embodiments, R9 is C2-6 alkenyl. [0160] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 1, below. [0161] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0162] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1.4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 1, below.
[0163] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3.
[0164] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3.
[0165] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2.
[0166] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, Ru is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 1, below.
[0167] As defined generally above,
Figure imgf000039_0001
embodiments, B1 is
Figure imgf000039_0003
. In some embodiments,
Figure imgf000039_0002
[0168] In some embodiments, B1 is
Figure imgf000040_0001
, and R11 is hydrogen or halo. In some embodiments,
Figure imgf000040_0002
certain embodiments, B1 is selected from the groups depicted in the compounds in Table 1, below.
[0169] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 1, below.
[0170] The description above describes multiple embodiments relating to compounds of Formula 1-1. The patent application specifically contemplates all combinations of the embodiments.
[0171] Another aspect of the disclosure provides a compound represented by Formula II:
Figure imgf000040_0003
or a pharmaceutically acceptable salt thereof; wherein:
R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7));;
R2 and R3 are hydrogen;
R4 represents independently for each occurrence -(Ci-4 alkylene)-OC(0)0-(Ci-io alkyl), and one occurrence of R4 is further selected from hydrogen;
R5 is phenyl or naphthyl, each of which is substituted with m instances of R10;
R6 is hydrogen or Ci-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000041_0001
[0172] The definitions of variables in Formula II above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0173] In certain embodiments, the compound is a compound of Formula II. [0174] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or - P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 2, below. [0175] As defined generally above, R2 and R3 are hydrogen. [0176] As defined generally above, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. [0177] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0178] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 2, below. [0179] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0180] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000042_0001
[0181] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 2, below. [0182] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0183] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 2, below. [0184] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. . ,
Figure imgf000043_0001
Figure imgf000044_0001
Figure imgf000044_0002
certain embodiments,
Figure imgf000044_0003
[0188] In certain embodiments, R7 is
Figure imgf000044_0004
In certain embodiments, R7 is
Figure imgf000044_0007
is j'~'' . In certain embodiments, R7 is •A~v . In certain embodiments, R7 is
Figure imgf000044_0005
In certain embodiments, R7 is
Figure imgf000044_0006
In certain embodiments, R7 is .
Figure imgf000045_0001
he groups depicted in the compounds in Table 2, below. [0190] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0191] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0192] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0193] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0194] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0195] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0196] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0197] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0198] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 2, below. [0199] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0200] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0201] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0202] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0203] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0204] In certain embodiments, R9 is C2-6 alkenyl. [0205] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 2, below. [0206] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0207] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 2, below. [0208] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0209] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3. [0210] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0211] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 2, below. [0212] As defined generally above me
Figure imgf000048_0001
embodiments, B1 i . In some embodiment .
Figure imgf000048_0003
Figure imgf000048_0002
[0213] In some embodiments, B1 , and R11 is hydrogen or halo. In some
Figure imgf000048_0004
embodiments, In certain embodiments, B1 is selected from
Figure imgf000048_0005
, below. [0214] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2, below. [0215] The description above describes multiple embodiments relating to compounds of Formula II. The patent application specifically contemplates all combinations of the embodiments. [0216] Another aspect of the disclosure provides a compound represented by Formula II-1:
Figure imgf000048_0006
or a pharmaceutically acceptable salt thereof; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000049_0001
m s , , , or . [0217] The definitions of variables in Formula II-1 above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0218] In certain embodiments, the compound is a compound of Formula II-1. [0219] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 2, below. [0220] As defined generally above, R2 and R3 are hydrogen. [0221] As defined generally above, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. [0222] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0223] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 2, below. [0224] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0225] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000050_0001
[0226] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 2, below. [0227] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0228] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 2, below. [0229] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. . ,
Figure imgf000051_0001
Figure imgf000052_0001
certain embodiments,
Figure imgf000052_0002
[0233] In certain embodiments, R7 is
Figure imgf000052_0003
In certain embodiments, R7 is
Figure imgf000052_0004
i I ertain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000053_0001
. In certain embodiments, R7 . In certain embodiments, R7 is
Figure imgf000053_0002
rtain embodiments .
Figure imgf000053_0003
embodiments, R7
Figure imgf000053_0004
he groups depicted in the compounds in Table 2, below. [0235] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0236] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0237] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0238] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0239] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0240] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0241] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0242] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0243] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 2, below. [0244] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0245] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0246] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0247] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0248] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl.
[0249] In certain embodiments, R9 is C2-6 alkenyl.
[0250] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 2, below.
[0251] As defined generally above, R10 represents independently for each occurrence halo, CM alkyl, Ci-4 haloalkyl, or C1.4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, CM alkyl, or CM haloalkyl.
[0252] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence CM alkyl. In certain embodiments, R10 represents independently for each occurrence CM haloalkyl. In certain embodiments, R10 represents independently for each occurrence CM alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 2, below.
[0253] As defined generally above, R11 is hydrogen, halo, -CH?, -CD3, -CH2CH3, - C(H)=CH2, or -CF3.
[0254] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, Ru is hydrogen, -CH3, or -CF3. In some embodiments, Rn is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3.
[0255] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, Ru is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0256] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, Rn is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 2, below.
Figure imgf000056_0001
[0258] In some embodiments, B is
Figure imgf000056_0002
, and R is hydrogen or halo. In some embodiments,
Figure imgf000056_0003
certain embodiments, B is selected from the groups depicted in the compounds in Table 2, below.
[0259] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2, below.
[0260] The description above describes multiple embodiments relating to compounds of Formula II-l . The patent application specifically contemplates all combinations of the embodiments. [0261] Another aspect of the disclosure provides a compound represented by Formula III:
Figure imgf000057_0001
an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; whereimR1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, -P(O)(N(R6)(benzyl))(-O-(Ci-4 alkylene)-S- C(O)-(Ci.6 alkylene)-OR6), or -P(O)(N(R6)(R7))(N(R6)(R7));
R2 and R3 are hydrogen;
R4 represents independently for each occurrence Ci-6 alkyl or -(CM alkylene)-OC(O)O- (Ci-io alkyl), and one occurrence of R4 is further selected from hydrogen;
R5 is phenyl or naphthyl, each of which is substituted with m instances of R10;
R6 represents independently for each occurrence hydrogen or Ci-4 alkyl;
R7 is -C(R8)2-CO2R9;
R8 represents independently for each occurrence Ci-6 alkyl or hydrogen, wherein said Ci-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring;
R9 is Ci-6 alkyl or C2-6 alkenyl; wherein said Ci-6 alkyl is optionally substituted with phenyl;
R10 represents independently for each occurrence halo, Ci-4 alkyl, CM haloalkyl, or CM alkoxyl;
R11 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2;
R12 is hydrogen, -CH2C1, -CH2F, -CH2Br, -CH2I, -CF3, or Ci-3 aliphatic;
R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2;
Figure imgf000057_0002
m is 0, 1, 2, or 3; provided that when R5 is phenyl, R6 is hydrogen, and R7 , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C 4 haloalkyl, or C1-4
Figure imgf000058_0001
alkoxyl, and O O provided that the compound is no . [0262] The definitions of variables in
Figure imgf000058_0002
hemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0263] In certain embodiments, the compound is a compound of Formula III, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula III. [0264] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, - P(O)(N(R6)(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR6), or - P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is P(O)(N(R6)(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR6). In certain embodiments, R1 is - P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0265] As defined generally above, R2 and R3 are hydrogen. [0266] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0267] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0268] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0269] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0270] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0271] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0272] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000060_0001
ertain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 3, below. [0274] As defined generally above, R6 represents independently for each occurrence, hydrogen or C1-4 alkyl. In certain embodiments, R6 represents independently for each occurrence hydrogen or methyl. In certain embodiments, R6 is hydrogen or methyl. [0275] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0276] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. . ,
Figure imgf000060_0002
Figure imgf000061_0001
Figure imgf000061_0002
certain embodiments,
Figure imgf000061_0003
[0280] In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000062_0001
R7
Figure imgf000062_0005
. In certain embodiments, R7 . In certain embodiments, R7 is
Figure imgf000062_0002
tain embodiments .
Figure imgf000062_0003
[ ] n certa n embodiments, R7
Figure imgf000062_0004
he groups depicted in the compounds in Table 3 and 6-C, below. [0282] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0283] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0284] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0285] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0286] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0287] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0288] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0289] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0290] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0291] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0292] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0293] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0294] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0295] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0296] In certain embodiments, R9 is C2-6 alkenyl. [0297] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0298] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; provided that when R5 is phenyl, R6 is hydrogen, and R7 is , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. [0299] In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, or C1-4 haloalkyl. [0300] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 3 and 6-C, below. [0301] As defined generally above, R11 is halo, -CF3, -CH3, -CDs, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is halo, -CF3, -CD3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is halo, -CF3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is halo or -CF3. In some embodiments, Ru is -CF3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CH2CH3 or - C(H)=CH2. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CD3, - CH2CH3, or -C(H)=CH2.
[0302] In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CF3. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In certain embodiments, Ru is selected from the groups depicted in the compounds in Table 3 and 6-C, below.
[0303] As defined generally above, R12 is hydrogen, -CH2CI, -CH2F, -CFbBr, -CH2I, -CF3, or C1.3 aliphatic. In some embodiments, R12 is -CH2CI, -CH2F, -CFFBr, -CH2I, -CF3, or C1.3 aliphatic. In some embodiments, R12 is hydrogen. In some embodiments, R12 is -CH2CI. In some embodiments, R12 is -CH2F. In some embodiments, R12 is -CFBBr. In some embodiments, R12 is -CH2I. In some embodiments, R12 is -CF3. In some embodiments, R12 is C1.3 aliphatic. In some embodiments, R12 is C1.3 methyl. In certain embodiments, R12 is selected from the groups depicted in the compounds in Tables 3 and 6-C, below.
[0304] As defined generally above, R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2. In some embodiments, R13 is halo. In some embodiments, R13 is -CH3. In some embodiments, R13 is -CF3. In some embodiments, R13 is -CD3. In some embodiments, R13 -CH2CH3 In some embodiments, R13 is -C(H)=CH2. In certain embodiments, R13 is selected from the groups depicted in the compounds in Tables 3 and 6-C, below. [0305] As defined generally above or
Figure imgf000066_0001
B1
Figure imgf000066_0004
[0306] In some embodiments, B1 i , and R11 is halo. In some embodiments,
Figure imgf000066_0002
n certain embodiments, B1 is selected from the groups
Figure imgf000066_0003
d 6-C, below. [0307] As defined generally above, m is 0, 1, 2, or 3; provided that when R5 is phenyl, R6 is hydrogen, and R7 is , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3 and 6-C, below. [0308] The description above describes multiple embodiments relating to compounds of Formula III. The patent application specifically contemplates all combinations of the embodiments. [0309] Another aspect of the disclosure provides a compound represented by Formula III-1:
Figure imgf000067_0001
an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is halo, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000067_0002
m is 0, 1, 2, or 3; provided that when R5 is phenyl, R6 is hydrogen, and R7 , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C 4 haloalkyl, or C1-4
Figure imgf000068_0001
alkoxyl. [0310] The definitions of variables in Formula III-1 above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0311] In certain embodiments, the compound is a compound of Formula III-1, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula III-1. [0312] As defined generally above, R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 3, below. [0313] As defined generally above, R2 and R3 are hydrogen. [0314] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0315] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0316] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0317] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0318] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 3, below. [0319] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0320] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is . [0321] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 3, below. [0322] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0323] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 3, below. [0324] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. , . ,
Figure imgf000070_0001
Figure imgf000071_0001
Figure imgf000071_0002
certain embodiments,
Figure imgf000071_0003
O
[0328] In certain embodiments, R7 is
Figure imgf000071_0004
. In certain embodiments, R7 is
Figure imgf000071_0008
, . In certain embodiments, R7 rtain embodiments, R7 is
Figure imgf000071_0005
. In certain embodiments, R7 is
Figure imgf000071_0006
In certain embodiments, R7 is
Figure imgf000071_0007
In certain embodiments, R7 is .
Figure imgf000072_0001
he groups depicted in the compounds in Table 3, below. [0330] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0331] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0332] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0333] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0334] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0335] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0336] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0337] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0338] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 3, below. [0339] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0340] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0341] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0342] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0343] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0344] In certain embodiments, R9 is C2-6 alkenyl. [0345] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 3, below. [0346] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; provided that when R5 is phenyl, R6 is hydrogen, and R7 is , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. [0347] In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, or C1-4 haloalkyl. [0348] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 3, below. [0349] As defined generally above, R11 is halo, -CF3, -CD3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is halo, -CF3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is -CF3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0350] In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CF3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 3, below. [0351] As defined generally above,
Figure imgf000075_0001
. In some embodiments, B1 is
Figure imgf000075_0003
In some embodiments,
Figure imgf000075_0002
[0352] In some embodiments, B1 is
Figure imgf000075_0004
and R11 is halo. In some embodiments,
Figure imgf000075_0005
certain embodiments, B1 is selected from the groups depicted in the compounds in Table 3, below.
[0353] As defined generally above, m is 0, 1, 2, or 3; provided that when R5 is phenyl, R6 is O
V T)R9 hydrogen, and R7 is , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C2-4 alkyl, Cm haloalkyl, or C1.4 alkoxyl. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3, below.
[0354] The description above describes multiple embodiments relating to compounds of Formula III-l . The patent application specifically contemplates all combinations of the embodiments.
[0355] Another aspect of the disclosure provides a compound represented by Formula IV:
Figure imgf000075_0006
(IV) or a pharmaceutically acceptable salt thereof; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000076_0001
m is 0, 1, 2, or 3. [0356] The definitions of variables in Formula IV above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0357] In certain embodiments, the compound is a compound of Formula IV, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula IV. [0358] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or - P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2. [0359] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C below. [0360] As defined generally above, R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro. In some embodiments, R2 is fluoro and R3 is hydrogen. In some embodiments, R2 is hydrogen and R3 is fluoro. In certain embodiments, R2 and R3 are selected from the groups depicted in the compounds in Table 1, 4, and 6-C, below. [0361] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0362] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0363] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0364] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0365] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0366] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0367] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000078_0001
[0368] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0369] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0370] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0371] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is -
C(H)(R8)-CO2R9.
Figure imgf000079_0001
Figure imgf000080_0001
In certain embodiments,
Figure imgf000080_0002
Figure imgf000080_0003
In certain embodiments,
Figure imgf000080_0004
certain embodiments,
Figure imgf000080_0005
[0375] In certain embodiments, R7 is
Figure imgf000080_0006
In certain embodiments, R7 is
Figure imgf000080_0007
Figure imgf000080_0008
rtain embodiments, R7 is . In certain embodiments, R7 is
In certain embodiments, R7 is
Figure imgf000080_0010
In certain embodiments, R7 is
Figure imgf000080_0009
ain embodiments,
Figure imgf000080_0011
[0376] In certain embodiments, R7 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0377] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0378] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0379] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0380] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0381] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0382] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0383] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0384] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0385] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0386] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0387] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0388] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0389] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0390] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0391] In certain embodiments, R9 is C2-6 alkenyl. [0392] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0393] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0394] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C , below. [0395] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0396] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3. [0397] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0398] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 1, 4, and 6-C, below. [0399] As defined generally above . In some
Figure imgf000084_0001
embodiments, B1 i . In some embodiment .
Figure imgf000084_0003
Figure imgf000084_0002
[0400] In some embodiments, B1 i , and R11 is hydrogen or halo. In some
Figure imgf000084_0004
embodiments, In certain embodiments, B1 is selected from , 4, and 6-C , below.
Figure imgf000084_0005
[0401] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table IV. The patent application specifically contemplates all combinations of the embodiments. [0402] Another aspect of the disclosure provides a compound represented by Formula IV-1:
Figure imgf000084_0006
(IV-1) an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000085_0001
, , , . [0403] The definitions of variables in Formula IV-1 above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0404] In certain embodiments, the compound is a compound of Formula IV-1, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula IV-1. [0405] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2. In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)) or - P(O)(OR4)2. [0406] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0407] As defined generally above, R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro. In some embodiments, R2 is fluoro and R3 is hydrogen. In some embodiments, R2 is hydrogen and R3 is fluoro. In certain embodiments, R2 and R3 are selected from the groups depicted in the compounds in Table 1 and 4, below. [0408] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0409] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0410] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0411] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0412] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0413] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0414] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is . [
Figure imgf000087_0001
] n certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0416] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0417] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0418] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. [0419] In certain embodiments ,
Figure imgf000087_0002
Figure imgf000088_0001
[0421] In certain embodiments,
Figure imgf000088_0002
Figure imgf000088_0003
. In certain embodiments or
Figure imgf000089_0001
. In certain embodiments In
Figure imgf000089_0002
Figure imgf000089_0003
certain embodiments .
Figure imgf000089_0004
[0422] In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000089_0005
R7
Figure imgf000089_0006
is . In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000089_0007
Figure imgf000089_0008
7 is
Figure imgf000089_0009
[0423] In certain embodiments, R is selected from the groups depicted in the compounds in Table 1 and 4, below. [0424] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0425] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0426] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0427] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0428] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0429] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0430] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0431] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0432] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0433] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0434] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0435] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0436] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0437] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0438] In certain embodiments, R9 is C2-6 alkenyl. [0439] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0440] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0441] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0442] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0443] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3. [0444] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0445] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 1 and 4, below. [0446] As defined generally above me
Figure imgf000092_0001
embodiments, B1 i . In some embodiment .
Figure imgf000092_0003
Figure imgf000092_0002
[0447] In some embodiments, B is
Figure imgf000093_0001
, and R is hydrogen or halo. In some embodiments,
Figure imgf000093_0002
certain embodiments, B is selected from the groups depicted in the compounds in Table 1 and 4, below.
[0448] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 1 and 4, below.
[0449] The description above describes multiple embodiments relating to compounds of Formula IV-1 . The patent application specifically contemplates all combinations of the embodiments.
[0450] Another aspect of the disclosure provides a compound represented by Formula V:
Figure imgf000093_0003
or a pharmaceutically acceptable salt thereof; wherein:
R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7));
R2 and R3 are hydrogen;
R4 represents independently for each occurrence Ci-6 alkyl or -(C1-4 alkylene)-OC(O)O- (Ci-io alkyl), and one occurrence of R4 is further selected from hydrogen;
R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000094_0001
, , , [0451] The definitions of variables in Formula V above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0452] In certain embodiments, the compound is a compound of Formula V. [0453] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or - P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2. [0454] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0455] As defined generally above, R2 and R3 are hydrogen. [0456] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0457] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0458] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0459] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0460] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 2 and 5, below.
[0461] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl.
[0462] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is
Figure imgf000096_0001
[0463] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 2 and 5, below.
[0464] As defined generally above, R6 is hydrogen or Ci-4 alkyl. In certain embodiments, R6 is hydrogen or methyl.
[0465] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is Ci-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 2 and 5, below.
[0466] As defined generally above, R7 is -C(R8)I-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9.
Figure imgf000096_0002
Figure imgf000097_0001
certain embodiments .
Figure imgf000098_0001
[0470] In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000098_0002
R7
Figure imgf000098_0003
Figure imgf000098_0004
. In certain embodiments, R7 . In certain embodiments, R7 is
Figure imgf000098_0005
Figure imgf000098_0006
. [
Figure imgf000098_0007
ce a e o e s, s se ec e o he groups depicted in the compounds in Table 2 and 5, below. [0472] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0473] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0474] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0475] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0476] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0477] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0478] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0479] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0480] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0481] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0482] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0483] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0484] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0485] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0486] In certain embodiments, R9 is C2-6 alkenyl. [0487] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0488] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0489] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0490] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0491] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3.
[0492] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2.
[0493] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 2 and 5, below.
[0494] As defined generally above,
Figure imgf000101_0001
some embodiments, B1 is
Figure imgf000101_0003
. In some embodiments,
Figure imgf000101_0002
[0495] In some embodiments, B1 is
Figure imgf000101_0004
and R11 is hydrogen or halo. In some embodiments,
Figure imgf000101_0005
certain embodiments, B1 is selected from the groups depicted in the compounds in Table 2 and 5, below.
[0496] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2 and 5, below. [0497] The description above describes multiple embodiments relating to compounds of Formula V. The patent application specifically contemplates all combinations of the embodiments. [0498] Another aspect of the disclosure provides a compound represented by Formula V-1:
Figure imgf000102_0001
or a pharmaceutically acceptable salt thereof; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000103_0001
[0499] The definitions of variables in Formula V-1 above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0500] In certain embodiments, the compound is a compound of Formula V-1. [0501] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2. In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)) or - P(O)(OR4)2. [0502] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0503] As defined generally above, R2 and R3 are hydrogen. [0504] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0505] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0506] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0507] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0508] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0509] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0510] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000104_0001
[0511] In certain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0512] As defined generally above, R6 is hydrogen or C1-4 alkyl. In certain embodiments, R6 is hydrogen or methyl. [0513] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0514] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. , . ,
Figure imgf000105_0001
Figure imgf000106_0001
In certain embodiments,
Figure imgf000106_0002
Figure imgf000106_0003
Figure imgf000106_0004
certain embodiments,
Figure imgf000106_0005
[0518] In certain embodiments, R7 is
Figure imgf000106_0006
In certain embodiments, R7 is
Figure imgf000106_0007
, certain embodiments, R7 is I i b di R7 i . In certain embodiments, R7 is
Figure imgf000107_0001
Figure imgf000107_0002
7 is
Figure imgf000107_0003
in Table 2 and 5, below. [0520] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0521] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0522] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0523] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0524] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0525] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0526] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0527] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0528] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0529] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0530] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0531] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0532] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0533] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0534] In certain embodiments, R9 is C2-6 alkenyl. [0535] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0536] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. [0537] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0538] As defined generally above, R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, - C(H)=CH2, or -CF3. [0539] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is halo or -CH3. [0540] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. In some embodiments, R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0541] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In some embodiments, R11 is -CF3. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 2 and 5, below. [0542] As defined generally above In some
Figure imgf000110_0001
embodiments, B1 i . In some embodiment .
Figure imgf000110_0003
Figure imgf000110_0002
[0543] In some embodiments, B1 i , and R11 is hydrogen or halo. In some
Figure imgf000110_0004
1 is
Figure imgf000110_0005
[0544] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 2 and 5, below. [0545] The description above describes multiple embodiments relating to compounds of Formula V-1. The patent application specifically contemplates all combinations of the embodiments. [0546] Another aspect of the disclosure provides a compound represented by Formula VI: an enantiomer thereof, or a ph
Figure imgf000111_0001
ceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, -P(O)(N(R6)(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR6), or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 represents independently for each occurrence hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or -C(H)=CH2; R12 is hydrogen, -CH2Cl, -CH2F, -CH2Br, -CH2I, -CF3, or C1-3 aliphatic; R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2;
Figure imgf000112_0001
m is 0, 1, 2, or 3; provided that the compound of Formula (VI) is not
Figure imgf000112_0002
[0547] The definitions of variables in Formula VI above encompass multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii).
[0548] In certain embodiments, the compound is a compound of Formula VI, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula VI.
[0549] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, - P(O)(N(R6)(benzyl))(-O-(Ci-4 alkylene)-S-C(O)-(Ci-6alkylene)-OR6), or -
P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2.
[0550] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR'')(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(N(R6)(benzyl))(-O-(Ci-4 alkylene)-S-C(O)-(Ci-6 alkylene)-OR6). In certain embodiments, R1 is -P(O)(N(R6)(R7))(N(R6)(R7)). In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 3, 6- A, 6-B and 6-C, below.
[0551] As defined generally above, R2 and R3 are hydrogen. [0552] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0553] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0554] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0555] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0556] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0557] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0558] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000114_0001
ertain embodiments, R5 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R5 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0560] As defined generally above, R6 represents independently for each occurrence hydrogen or C1-4 alkyl. In certain embodiments, R6 represents independently for each occurrence hydrogen or methyl. In certain embodiments, R6 is hydrogen or methyl. [0561] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R6 is C1-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0562] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9. , . ,
Figure imgf000114_0002
Figure imgf000115_0001
certain embodiments .
Figure imgf000116_0001
[0566] In certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000116_0002
n certain embodiments R7
Figure imgf000116_0003
certain embodiments, R7 i . In certain embodiments, R7 is
Figure imgf000116_0004
Figure imgf000116_0005
Figure imgf000116_0006
. In certain embodiments, R7 . In certain embodiments, R7 is
Figure imgf000116_0007
Figure imgf000116_0008
. [
Figure imgf000116_0009
ce a e o e s, s se ec e o he groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0568] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0569] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0570] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0571] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0572] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0573] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0574] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0575] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0576] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0577] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0578] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0579] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0580] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0581] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0582] In certain embodiments, R9 is C2-6 alkenyl. [0583] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0584] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, or C1-4 haloalkyl. [0585] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0586] As defined generally above, R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or - C(H)=CH2. [0587] In some embodiments, R11 is hydrogen, halo, -CF3, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is hydrogen, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CF3, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CF3, -CH2CH3, or - C(H)=CH2. In some embodiments, R11 is -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CH3 or -CH2CH3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. [0588] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CH3. [0589] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CD3, -CH2CH3, or - C(H)=CH2. [0590] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CF3. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 3, 6-A, 6-B and 6-C, below. [0591] As defined generally above, R12 is hydrogen, -CH2Cl, -CH2F, -CH2Br, -CH2I, -CF3, or C1-3 aliphatic. In some embodiments, R12 is -CH2Cl, -CH2F, -CH2Br, -CH2I, -CF3, or C1-3 aliphatic. In some embodiments, R12 is hydrogen. In some embodiments, R12 is -CH2Cl. In some embodiments, R12 is -CH2F. In some embodiments, R12 is -CH2Br. In some embodiments, R12 is -CH2I. In some embodiments, R12 is -CF3. In some embodiments, R12 is C1-3 aliphatic. In some embodiments, R12 is C1-3 methyl. In certain embodiments, R12 is selected from the groups depicted in the compounds in Tables 3, 6-A, 6-B and 6-C, below. [0592] As defined generally above, R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2. In some embodiments, R13 is halo. In some embodiments, R13 is -CH3. In some embodiments, R13 is -CF3. In some embodiments, R13 is -CD3. In some embodiments, R13 -CH2CH3. In some embodiments, R13 is -C(H)=CH2. In certain embodiments, R13 is selected from the groups depicted in the compounds in Tables 3, 6-A, 6-B and 6-C, below. [0593] As defined generally above or
Figure imgf000120_0001
B1
Figure imgf000120_0004
[0595] In some embodiments, B1 i , and R11 is hydrogen or halo. In some
Figure imgf000120_0002
embodiments, In certain embodiments, B1 is selected from
Figure imgf000120_0003
, 6-A, and 6-B, below. [0596] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3, 6-A, and 6-B, below. [0597] Another aspect of the disclosure provides a compound represented by Formula VI: an enantiomer thereof, or a ph
Figure imgf000121_0001
ceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000121_0002
m is 0, 1, 2, or 3; provided that the compound of Formula (VI) is not .
Figure imgf000122_0001
multiple chemical groups. The application contemplates embodiments where, for example, i) the definition of a variable is a single chemical group selected from those chemical groups set forth above, ii) the definition of a variable is a collection of two or more of the chemical groups selected from those set forth above, and iii) the compound is defined by a combination of variables in which the variables are defined by (i) or (ii). [0599] In certain embodiments, the compound is a compound of Formula VI, or an enantiomer thereof. In certain embodiments, the compound is a compound of Formula VI. [0600] As defined generally above, R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2. In certain embodiments, R1 is hydrogen or -P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is hydrogen or -P(O)(OR4)2. In certain embodiments, R1 is -P(O)(OR5)(N(R6)(R7)) or - P(O)(OR4)2. [0601] In certain embodiments, R1 is hydrogen. In certain embodiments, R1 is - P(O)(OR5)(N(R6)(R7)). In certain embodiments, R1 is -P(O)(OR4)2. In certain embodiments, R1 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0602] As defined generally above, R2 and R3 are hydrogen. [0603] As defined generally above, R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence C1-6 alkyl or - (C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence C1-6 alkyl and one occurrence of R4 is further selected from hydrogen. In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl) and one occurrence of R4 is further selected from hydrogen. [0604] In some embodiments, R4 represents independently for each occurrence C1-6 alkyl. In some embodiments, R4 represents independently for each occurrence C1-4 alkyl. In some embodiments, R4 represents independently for each occurrence C3-6 alkyl. [0605] In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 represents independently for each occurrence -(C1-2 alkylene)-OC(O)O- (C6-10 alkyl). In some embodiments, R4 represents independently for each occurrence -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). [0606] In some embodiments, R4 is C1-6 alkyl. In some embodiments, R4 is C1-4 alkyl. In some embodiments, R4 is C3-6 alkyl. [0607] In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1-4 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C1-2 alkylene)-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -CH2-OC(O)O-(C1-6 alkyl). In some embodiments, R4 is -(C1- 2 alkylene)-OC(O)O-(C6-10 alkyl). In some embodiments, R4 is -(C2-4 alkylene)-OC(O)O-(C1-10 alkyl). In certain embodiments, R4 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0608] As defined generally above, R5 is phenyl or naphthyl, each of which is substituted with m instances of R10. In certain embodiments, R5 is phenyl or naphthyl. [0609] In certain embodiments, R5 is phenyl substituted with m instances of R10. In certain embodiments, R5 is naphthyl substituted with m instances of R10. In certain embodiments, R5 is .
Figure imgf000123_0001
[0610] In certain embodiments, R3 is phenyl. In certain embodiments, R5 is naphthyl. In certain embodiments, R5 is 1-naphthyl. In certain embodiments, R5 is 2-naphthyl. In certain embodiments, R3 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6- B, below.
[0611] As defined generally above, R6 is hydrogen or Ci-4 alkyl. In certain embodiments, R6 is hydrogen or methyl.
[0612] In certain embodiments, R6 is hydrogen. In certain embodiments, R6 is Ci-4 alkyl. In certain embodiments, R6 is methyl. In certain embodiments, R6 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below.
[0613] As defined generally above, R7 is -C(R8)2-CO2R9. In certain embodiments, R7 is - C(H)(R8)-CO2R9.
Figure imgf000124_0001
Figure imgf000125_0001
In certain embodiments,
Figure imgf000125_0002
Figure imgf000125_0003
Figure imgf000125_0004
certain embodiments,
Figure imgf000125_0005
[0617] In certain embodiments, R7 is
Figure imgf000125_0006
In certain embodiments, R7 is
Figure imgf000125_0007
, certain embodiments, R7 is I i b di R7 i . In certain embodiments, R7 is
Figure imgf000126_0001
Figure imgf000126_0002
7 is
Figure imgf000126_0003
in Table 3, 6-A, and 6-B, below. [0619] As defined generally above, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0620] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0621] In certain embodiments, R8 represents independently for each occurrence methyl, benzyl, or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R8 represents independently for each occurrence methyl or benzyl. In certain embodiments, R8 represents independently for each occurrence benzyl or hydrogen. [0622] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. [0623] In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl or hydrogen. In certain embodiments, R8 represents independently for each occurrence C1-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R8 represents independently for each occurrence C1-3 alkyl. In certain embodiments, R8 represents independently for each occurrence C2-6 alkyl. In certain embodiments, R8 represents independently for each occurrence C3-6 alkyl. [0624] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-6 alkyl optionally substituted with phenyl, and the other occurrence of R8 is hydrogen. [0625] In certain embodiments, one occurrence of R8 is C1-6 alkyl or hydrogen, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is C1-4 alkyl, and the other occurrence of R8 is hydrogen. In certain embodiments, one occurrence of R8 is methyl, and the other occurrence of R8 is hydrogen. In certain embodiments, R8 is methyl. In certain embodiments, R8 is hydrogen. [0626] In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring. In certain embodiments, two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-membered saturated carbocyclic ring. [0627] In certain embodiments, R8 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0628] As defined generally above, R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl. [0629] In certain embodiments, R9 is C1-6 alkyl, allyl, or -CH2-phenyl. In certain embodiments, R9 is allyl or -CH2-phenyl. In certain embodiments, R9 is allyl. In certain embodiments, R9 is -CH2-phenyl. [0630] In certain embodiments, R9 is C1-6 alkyl or C2-6 alkenyl. [0631] In certain embodiments, R9 is C1-6 alkyl optionally substituted with phenyl. In certain embodiments, R9 is C1-6 alkyl substituted with phenyl. [0632] In certain embodiments, R9 is C1-6 alkyl. In certain embodiments, R9 is C1-4 alkyl. In certain embodiments, R9 is C1-2 alkyl or C4-6 alkyl. In certain embodiments, R9 is methyl, ethyl, or C4 alkyl. In certain embodiments, R9 is methyl, ethyl, or isopropyl. In certain embodiments, R9 is methyl or ethyl. In certain embodiments, R9 is ethyl or isopropyl. [0633] In certain embodiments, R9 is C2-6 alkenyl. [0634] In certain embodiments, R9 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0635] As defined generally above, R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. In certain embodiments, R10 represents independently for each occurrence halo, C1-4 alkyl, or C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence halo, C2-4 alkyl, or C1-4 haloalkyl. [0636] In certain embodiments, R10 represents independently for each occurrence halo. In certain embodiments, R10 represents independently for each occurrence fluoro, chloro, or bromo. In certain embodiments, R10 is bromo. In certain embodiments, R10 represents independently for each occurrence C1-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C2-4 alkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 haloalkyl. In certain embodiments, R10 represents independently for each occurrence C1-4 alkoxyl. In certain embodiments, R10 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. [0637] As defined generally above, R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or - C(H)=CH2. [0638] In some embodiments, R11 is hydrogen, halo, -CF3, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is hydrogen or halo. In some embodiments, R11 is halo or -CF3. In some embodiments, R11 is hydrogen, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CF3, -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CF3, -CH2CH3, or - C(H)=CH2. In some embodiments, R11 is -CH3, -CH2CH3, or -C(H)=CH2. In some embodiments, R11 is -CH3 or -CH2CH3. In some embodiments, R11 is -CH2CH3 or -C(H)=CH2. [0639] In some embodiments, R11 is hydrogen, halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, fluoro, -CH3, or -CF3. In some embodiments, R11 is halo, -CH3, or -CF3. In some embodiments, R11 is hydrogen, -CH3, or -CF3. In some embodiments, R11 is hydrogen, halo, or - CF3. In some embodiments, R11 is hydrogen, halo, or -CH3. In some embodiments, R11 is -CH3 or -CF3. In some embodiments, R11 is hydrogen or fluoro. In some embodiments, R11 is hydrogen or -CH3. In some embodiments, R11 is hydrogen or -CF3. In some embodiments, R11 is halo or -CH3. [0640] In some embodiments, R11 is -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3. In some embodiments, R11 is -CH3, -CD3, or -CF3. In some embodiments, R11 is -CH3 or -CD3. In some embodiments, R11 is -CD3 or -CF3. In some embodiments, R11 is -CD3, -CH2CH3, or - C(H)=CH2. [0641] In some embodiments, R11 is hydrogen. In some embodiments, R11 is halo. In some embodiments, R11 is chloro, bromo, or fluoro. In some embodiments, R11 is bromo or fluoro. In some embodiments, R11 is chloro or fluoro. In some embodiments, R11 is chloro or bromo. In some embodiments, R11 is chloro. In some embodiments, R11 is bromo. In some embodiments, R11 is fluoro. In some embodiments, R11 is -CF3. In some embodiments, R11 is -CH3. In some embodiments, R11 is -CD3. In some embodiments, R11 is -CH2CH3. In some embodiments, R11 is -C(H)=CH2. In certain embodiments, R11 is selected from the groups depicted in the compounds in Table 3, 6-A, and 6-B, below. me
Figure imgf000129_0001
[0643] In some embodiments, 11 is hydrogen or halo. In some
Figure imgf000129_0002
embodiments, In certain embodiments, B1 is selected from
Figure imgf000129_0003
g , 6-A, and 6-B, below. [0644] As defined generally above, m is 0, 1, 2, or 3. In certain embodiments, m is 0. In certain embodiments, m is 1. In certain embodiments, m is 2. In certain embodiments, m is 3. In certain embodiments, m is 0 or 1. In certain embodiments, m is 1 or 2. In certain embodiments, m is 2 or 3. In certain embodiments, m is 0, 1, or 2. In certain embodiments m is 1, 2, or 3. In certain embodiments, m is selected from the values represented in the compounds in Table 3, 6-A, and 6-B, below.
[0645] The description above describes multiple embodiments relating to compounds of Formula VI. The patent application specifically contemplates all combinations of the embodiments.
[0646] Another aspect of the disclosure provides a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, below. Another aspect of the disclosure provides a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, below. In certain embodiments, the compound is a compound in Table 1, 2, 3, or 6-A, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, 3, or 6-A, below. In certain embodiments, the compound is a compound in Table 1, 2, or 3, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, or 3, below.
[0647] In certain other embodiments, the compound is a compound in Table 1 or 4 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1 or 4 below. In certain embodiments, the compound is a compound in Table 2 or 5, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 2 or 5, below. In certain embodiments, the compound is a compound in Table 3, 6-A, or 6-B, below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 3, 6-A, or 6-B, below.
[0648] In certain embodiments, the compound is a compound in Table 1 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1 below. In certain embodiments, the compound is a compound in Table 2 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 2 below. In certain embodiments, the compound is a compound in Table 3 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 3 below. In certain embodiments, the compound is a compound in Table 4 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 4 below. In certain embodiments, the compound is a compound in Table 5 below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 5 below. In certain embodiments, the compound is a compound in Table 6-A below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-A below. In certain embodiments, the compound is a compound in Table 6-B below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-B below. In certain embodiments, the compound is a compound in Table 6-C below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-C below. In certain embodiments, the compound is a compound in Table 6-D below, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 6-D below.
TABLE 1.
Figure imgf000131_0001
Figure imgf000132_0001
TABLE 2.
Figure imgf000133_0001
TABLE 3.
Figure imgf000134_0001
Figure imgf000135_0001
Figure imgf000136_0001
TABLE 5.
Figure imgf000136_0002
Figure imgf000137_0001
TABLE 6-A.
Figure imgf000137_0002
Figure imgf000138_0002
TABLE 6-B.
Figure imgf000138_0001
Figure imgf000139_0001
Figure imgf000140_0001
Figure imgf000141_0001
TABLE 6-C.
Figure imgf000142_0001
Figure imgf000143_0001
Figure imgf000144_0001
Figure imgf000145_0002
TABLE 6-D.
Figure imgf000145_0001
Figure imgf000146_0001
[0649] Methods for preparing compounds described herein are illustrated in the Examples below, and the following literature references. Strategies and procedures for preparing compounds in Table 4 are described in, for example, Martin, J. A. et al. J. Med. Chem., 1990, Vol. 33, No. 8, p. 2137-2145 and Zhou, W. et al. J. Med. Chem., 2004, Vol. 47, No. 13, p. 3399- 3408. Strategies and procedures for preparing compounds in Table 5 are described in, for example, Park, A.-Y. et al. Bioorg. Med. Chem., 2011, Vol. 19, No. 13, p. 3945-3955 and Russ, P. L. et al. ChemMedChem, 2009, Vol. 4, No. 8, p. 1354-1363. Strategies and procedures for preparing compounds in Table 6-B and Table 6-C are described in, for example, Joshi, B. V. et al. J. Chem. Soc., Perkin 1: Org. Bio-Org. Chem., 1992, Vol. 19, p. 2537-2544; Lin, T.-S. et al.
J. Med. Chem., 1996, Vol. 39, No. 9, p. 1757-1759; and WO 2001/030791. Each of the foregoing is hereby incorporated by reference in its entirety.
[0650] Strategies and procedures for preparing phosphoramidate, and other phosphorous- containing, compounds described herein (such as compounds in Tables 1, 2, and 3) are described in, for example, WO 2004/096286, WO 2006/110157, WO 2006/015261, U.S. 7,871,991, WO 2010/005986, WO 2012/159047, and Slusarczyk, M. et al. “Phosphoramidates and phosphonamidates (ProTides) with antiviral activity,” Antiviral Chemistry and Chemotherapy (2018), Vol. 26, p. 1 -31 , and references in each of the foregoing. Each of the foregoing is hereby incorporated by reference in its entirety.
[0651] It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions will be apparent to one skilled in the art, and alternate methods are therefore indicated (for example, use of protecting groups or alternative reactions). Protecting group chemistry and strategy is well known in the art, for example, as described in detail in “Protecting Groups in Organic Synthesis”, T. W.
Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entire contents of which are hereby incorporated by reference. For example, the exocyclic nitrogen atom of cytosine, and 5- substituted cytosine, nucleobases may be protected using, for example, a substituted trityl protecting group.
[0652] The modular synthetic routes described herein and in the foregoing references can also be readily modified by one of skill in the art of organic synthesis to provide additional substituted halo-dehydro-3 '-deoxyuracil phosphoramidates and related compounds using strategies and reactions well known in the art, as described in, for example, “Comprehensive Organic Synthesis” (B.M. Trost & I. Fleming, eds., 1991-1992).
II. Methods of Treating Medical Disorders
[0653] Another aspect of the disclosure provides methods for treating medical disorders. This is described in more detail below.
[0654] Transposable elements (or transposons) are genomic DNA sequences that have the ability to move within the genome which leads to altering its organization, increase its size and creates duplications and redundancy. (Ukadike and Mustelin, J. Clin. Med., 10:856 (2021)). These genomic sequences are believed to have been introduced into the human genome by either an infection by exogenous retroviruses that infected human ancestors millions of years ago or ancient descendants of retroviruses which retained the ability to embed and replicate in human germline genome. (Ukadike and Mustelin, 2021).
[0655] Long Interspersed Nuclear Element 1 (LINE-1) are class I transposable elements in the DNA of some organisms and comprise about 17% of the human genome. LINE-1 harbors two open reading frames, ORF1 and ORF2, which in turn respectively encode ORF Ip which has nucleic acid chaperone activity and ORF2p with reverse transcriptase (RT) and endonuclease activities. (Reviewed in Babushok and Kazazian, Hum. Mut. 28:527-539, (2007)). LINE-1 retrotransposition activity is mediated by ORF2p. The majority of LINE- 1 elements in the human genome contain inactivating mutations but a small percentage of LINE- 1 elements are intact and have retained the ability to retrotranspose. This ability varies both among individuals and among cell types within an individual. Active LINE-1 elements are thought to disrupt the genome through insertions, deletions, rearrangements and recombinations. (Garcia-Perez et al, Development, 143:4101-4114 (2016)). LINE-1 activity is normally tightly regulated in the germline by DNA methylation, histone modifications, and piRNA.
[0656] Retrotransposons are transposable elements which are associated with the pathogenesis of many diseases such as cancer, autoimmune disease and neurological disorders, among others. (Zhang, et al, Frontiers in Cell and Dev. Bio., 8:657 (Aug. 2020); Kuriyama et al, Nature: Scientific Reports, 11 :23146 (2021)). LINE-1 RNA and protein overexpression can promote apoptosis, DNA damage and repair, and cellular plasticity, which can promote tumor progression. Furthermore, DNA damage caused by repetitive sequences (genome-wide or interspersed) hypomethylation can induce an inflammatory microenvironment. (Zhang, 2020).
[0657] High LINE-1 activity has been found in many tumor tissues. LINE-1 mediated gene rearrangement can trigger oncogene amplification. Additionally, LINE-1 can mediate the deletion of tumor suppressor genes (Zhange, 2020). Inhibition of LINE- 1 RT in cancer cells, either via RNA interface-dependent silencing of active LINE-1 elements or using RT inhibitory compounds can reduce cancer cell proliferation, promote cancer cell differentiation and can retard tumor progression in certain animal models. (Sciamann et al, Frontiers in Chemistry, 4:6 (Feb. 2016)).
[0658] LINE-1 RT uses a procedure termed target-site-primed reverse transcription (TPRT) which involves nicking of the genomic DNA followed by reverse transcription and insertion of LINE-1 into the genome. The products of LINE- 1 reverse transcription are potential triggers of DNA sensing receptors such as cGAS, which is a DNA sensor that activates the STING pathway leading to type 1 interferon production. (Zhao, J. Autoimmunity, 90:105-115 (2018)).
Hypom ethylated and highly expressed LINE-1 has been found in many patients with autoimmune diseases such as systemic lupus erythematosus (SLE), Sjogren’s syndrome (SS) and psoriasis. (Zhang et al). LINE-1 has also been found to be significantly upregulated in patients with dermatomyositis (DM), which patients also showed significantly elevated levels of interferon a and interferon 0. (Kuriyama et al, J. Am. Acad, Dermatol., 84(4): 1103-1105 (2020)).
[0659] Interferon overproduction is a characteristic feature of type I interferonopathies. These include rare genetic diseases with occurrence rates from 1 : 10,000 to 1 : 1,000,000. Pathological overexpression of type I interferon causes immune system hyperactivation that leads to systemic inflammation which can affect the nervous system, lung and blood vessels, among other organ systems. (Nesterova et al. "Congenital and Acquired Interferonopathies: Differentiated Approaches to Interferon Therapy". Innate Immunity in Health and Disease, Ed. Saxena and Prakash, IntechOpen, 2020). LINE-1 expression has been shown to induce type I interferons, which lead to type I interferonopathies. (Ukadike and Mustelin, 2021). These diseases have very limited effective treatment options so there is a high unmet medical need in this area.
[0660] LINE-1 expression is high in brain tissue as compared to other organs. LINE-1 is active in neural progenitor cells and overexpression of LINE-1 increases somatic mosaicism. LINE-1 has also been implicated in neurological disorders such as ataxia telangiectasia (AT) and Rett syndrome. LINE-1 is also implicated in the aging process and frontotemporal lobe degeneration. (Zhang, 2020).
[0661] Human endogenous retroviruses (HERVs) comprise nearly 8% of the human genome and are believed to be derived from ancient integrations of retroviruses into the germline. The biology of HERVs is poorly defined, but there is accumulating evidence supporting pathological roles in diverse diseases such as cancer, autoimmune and neurodegenerative diseases. Functional proteins are produced by HERV-encoded genes including reverse transcriptases (RTs), which could be a contributor to the pathology attributed to aberrant HERV-K expression.
[0662] HERVs play a role in early development by rewiring the gene regulatory network of the preimplantation embryo (Fu et al, Biomolecules, 11(6):829 (2021)). HERV expression appears to be a hallmark of the undifferentiated state, the acquisition of phenotypic plasticity and stem cell character (Balestrieri et al, Frontiers in Microbiology, 9:1448 (2018)); traits associated with aggressive cancer and poor patient outcomes. HERV expression is normally tightly controlled in normal adult tissues but is reported to be aberrantly expressed in cancer (Downey et al, Int. J. Cancer, \37(6y.Y2A9-Y151 (2015)), inflammatory diseases (Greenig, PeerJ 7:e6711 (2019)), neurological diseases (Kury et al, Trends Mol. Med., 24(4):379-394 (2018)), aging (Gorbunova et al, Nature, 596(7870):43-53 (2021)), and viral disease (Romer, Frontiers in Neuroscience, 15:648629-648629 (2021)). There are numerous reports of upregulation of HERV-K [HML-2 (human endogenous MMTV-like) subtype] derived mRNA and protein in a variety of solid and liquid tumor types (Dervan et al, Front. One., 1 1 :658489 (2021); Hohn et al, Front. One., 3:246 (2013)). The disease association with endogenous retroviruses and the expression of HERV encoded proteins during disease states suggests that anti-retroviral therapy could be explored in the management of these conditions.
A. First Therapeutic Method
[0663] Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder. The method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, to a subject in need thereof to treat the disorder. In certain embodiments, the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination.
[0664] The method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, I- 1 , II- 1, or III- 1 to a subject in need thereof to treat the disorder. In certain embodiments, the particular compound of Formula I, II, III, 1-1, II- 1 , or III- 1 is a compound defined by embodiments described in Section I, above, either singly or in combination.
[0665] In certain embodiments, the disorder is an immune disorder that is a viral infection.
[0666] Additional exemplary features that may characterize the First Therapeutic Method described herein are provided below and include, for example, disorders and patients to be treated.
B. Second Therapeutic Method
[0667] Another aspect of the disclosure provides a method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection. The method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula IV, V, or VI, to a subject in need thereof to treat the disorder. In certain embodiments, the particular compound of Formula IV, V, or VI is a compound defined by embodiments described in Section I, above, either singly or in combination. [0668] The method comprises administering a therapeutically effective amount of a compound described in Section I above, such as a compound of Formula IV, V, VI, IV-1, V-l, or VI- 1 to a subject in need thereof to treat the disorder. In certain embodiments, the particular compound of Formula IV, V, VI, IV-1, V-l, or VI-1 is a compound defined by embodiments described in Section I, above, either singly or in combination.
[0669] In certain embodiments, the compound is a compound of Formula IV, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the compound is a compound of Formula V, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound of Formula VI, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the compound is a compound of Formula IV-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the compound is a compound of Formula V-l, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound of Formula VI-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
[0670] In certain embodiments, the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, above, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, 6-B, or 6-C, above. In certain embodiments, the compound is a compound in Table 1 , 2, 3, 4, 5, 6-A, or 6-B, above, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 1, 2, 3, 4, 5, 6-A, or 6-B, above. In certain embodiments, the compound is a compound in Table 4, 5, or 6- B, above, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 4, 5, or 6-B, above. In certain embodiments, the compound is a compound in Table 4, 5, 6-B, or 6-C, above, or a pharmaceutically acceptable salt thereof. In certain embodiments, the compound is a compound in Table 4, 5, 6-B, or 6C, above.
[0671] Additional exemplary features that may characterize the Second Therapeutic Method described herein are provided below and include, for example, disorders and patients to be treated. C. Additional Exemplary Features of the First and Second Therapeutic Methods
[0672] Additional exemplary features that may characterize the First and Second Therapeutic Methods described herein are provided below and include, for example, disorders and patients to be treated. A more thorough description of such features is provided below. The disclosure embraces all permutations and combinations of these features.
Pharmaceutical Compositions and Additional Therapeutic Agents
[0673] In certain embodiments, the compound of Formula I, II, III, IV, V, or VI, or other compound defined by the embodiments above, is administered in a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier, as further described in Section V, below. In certain embodiments, the compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III- 1 , IV-1, V-l, or Vl-lor other compound defined by the embodiments above, is administered in a pharmaceutical composition comprising the compound and a pharmaceutically acceptable carrier, as further described in Section V, below.
[0674] In certain embodiments, the method further comprises administering an effective amount of an additional therapeutic agent, as further described in Section IV, below.
Viral Infection
[0675] In certain embodiments, the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2), human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2), respiratory syncytial virus (RSV), human papilloma virus (HPV), adenovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), varicella zoster virus (VZV), cytomegalovirus (CMV), herpes simplex viruses 1 or 2 (HSV-1 or HSV-2), human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus), or a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
[0676] In certain embodiments, the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2). In certain embodiments, the viral infection is an infection by human immunodeficiency virus 1 (HIV-1). In certain embodiments, the viral infection is an infection by human immunodeficiency virus 2 (HIV-2). In certain embodiments, the viral infection is an infection by human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2). In certain embodiments, the viral infection is an infection by respiratory syncytial virus (RSV). In certain embodiments, the viral infection is an infection by human papilloma virus (HPV). In certain embodiments, the viral infection is an infection by adenovirus. In certain embodiments, the viral infection is an infection by hepatitis B virus (HBV). In certain embodiments, the viral infection is an infection by hepatitis C virus (HCV). In certain embodiments, the viral infection is an infection by Epstein-Barr virus (EBV). In certain embodiments, the viral infection is an infection by varicella zoster virus (VZV). In certain embodiments, the viral infection is an infection by cytomegalovirus (CMV). In certain embodiments, the viral infection is an infection by herpes simplex viruses 1 or 2 (HSV-1 or HSV-2). In certain embodiments, the viral infection is an infection by human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus). In certain embodiments, the viral infection is an infection by a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
[0677] In certain embodiments, the viral infection is an infection by an adenovirus. In certain embodiments, the viral infection is an infection by a herpesvirus. In certain embodiments, the viral infection is an infection by a poxvirus. In certain embodiments, the viral infection is an infection by a parvovirus. In certain embodiments, the viral infection is an infection by a reovirus. In certain embodiments, the viral infection is an infection by a picomavirus. In certain embodiments, the viral infection is an infection by a rhinovirus or enterovirus. In certain embodiments, the viral infection is an infection by a togavirus. In certain embodiments, the viral infection is an infection by an orthomyxovirus. In certain embodiments, the viral infection is an infection by a rhabdovirus. In certain embodiments, the viral infection is an infection by a retrovirus. In certain embodiments, the viral infection is an infection by a hepadnavirus.
[0678] In certain embodiments, the viral infection is an infection by a coronavirus. In some embodiments, the coronavirus is an alpha, beta, gamma, or delta coronavirus. In certain embodiments, the viral infection is an infection by a coronavirus selected from 229E (alpha coronavirus), NL63 (alpha coronavirus), OC43 (beta coronavirus), HKU1 (beta coronavirus), MERS-CoV (beta coronavirus), SARS-CoV (beta coronavirus), and SARS-CoV-2 (coronavirus disease 2019, or COVID- 19).
[0679] In certain embodiments, the viral infection is an infection by an influenza virus. In certain embodiments, the viral infection is an infection by a type A or type B influenza virus. In certain embodiments, the viral infection is an infection by an influenza virus selected from H5N1, H1N1, and H3N2.
[0680] In certain embodiments, the viral infection is an infection by a poliovirus. In certain embodiments, the viral infection is an infection by a type 1 poliovirus. In certain embodiments, the viral infection is an infection by a type 2 poliovirus. In certain embodiments, the viral infection is an infection by a type 3 poliovirus.
Cancer
[0681] In certain embodiments, the disorder is cancer. In certain embodiments, the cancer is a solid tumor or leukemia. In certain embodiments, the cancer is a solid tumor. In certain embodiments, the cancer is a carcinoma or melanoma. In certain embodiments, the cancer is a carcinoma. In certain embodiments, the cancer is a sarcoma. In certain embodiments, the cancer is a melanoma. In certain embodiments, the cancer is a lymphoma. In certain embodiments, the cancer is a leukemia.
[0682] In certain embodiments, the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.
[0683] In certain embodiments, the cancer has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE 1 ORF2 polypeptide; (ii) activity of LINE 1 reverse transcriptase; (iii) expression of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
[0684] In certain embodiments, the cancer has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase. In certain embodiments, the cancer has expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide. In certain embodiments, the cancer has expression ofLINEl RNA. In certain embodiments, the cancer has expression ofLINEl ORF1 polypeptide. In certain embodiments, the cancer has expression ofLINEl ORF2 polypeptide. In certain embodiments, the cancer has activity ofLINEl reverse transcriptase. [0685] In certain embodiments, the cancer has (i) expression of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the cancer has expression of HERV-K RNA. In certain embodiments, the cancer has activity of HERV-K reverse transcriptase.
[0686] In certain embodiments, the cancer has elevated (i) levels of LINE1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) levels of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
[0687] In certain embodiments, the cancer has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase. In certain embodiments, the cancer has elevated levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide. In certain embodiments, the cancer has elevated levels ofLINEl RNA. In certain embodiments, the cancer has elevated levels of LINE1 ORF1 polypeptide. In certain embodiments, the cancer has elevated levels ofLINEl ORF2 polypeptide. In certain embodiments, the cancer has elevated activity ofLINEl reverse transcriptase.
[0688] In certain embodiments, the cancer has elevated (i) levels of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the cancer has elevated levels of HERV-K RNA. In certain embodiments, the cancer has elevated activity of HERV-K reverse transcriptase.
[0689] In certain embodiments, the cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, esophageal cancer, head and neck cancer, renal cancer, ovarian cancer, or lung cancer. In certain embodiments, the cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, ovarian cancer, or lung cancer. In certain embodiments, the cancer is pancreatic cancer. In certain embodiments, the cancer is pancreatic adenocarcinoma. In certain embodiments, the cancer is colorectal cancer. In certain embodiments, the cancer comprises microsatellite instable (MSI) colorectal cancer or microsatellite stable (MSS) colorectal cancer. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is esophageal cancer. In certain embodiments, the cancer is head and neck cancer. In certain embodiments, the cancer is renal cancer. In certain embodiments, the cancer is ovarian cancer. In certain embodiments, the cancer is lung cancer. In certain embodiments, the cancer is non-small cell lung carcinoma or small cell lung carcinoma. In certain embodiments, the cancer is non-small cell lung carcinoma . In certain embodiments, the cancer is small cell lung carcinoma.
[0690] In certain embodiments, the cancer is an epithelial cancer. In certain embodiments, the epithelial cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, esophageal cancer, head and neck cancer, renal cancer, ovarian cancer, or lung cancer. In certain embodiments, the epithelial cancer is pancreatic cancer, colorectal cancer, breast cancer, prostate cancer, renal cancer, ovarian cancer, or lung cancer. In certain embodiments, the colorectal cancer comprises microsatellite instable (MSI) colorectal cancer or microsatellite stable (MSS) colorectal cancer.
[0691] In certain embodiments, the cancer is a preneoplastic or early cancer lesion. In certain embodiments, the cancer is intraductal papillary mucinous neoplasm (IPMN), pancreatic intraepithelial neoplasia (PanIN), ductal carcinoma in situ (DCIS), or Barrett’s Esophagus. In certain embodiments, the cancer intraductal papillary mucinous neoplasm (IPMN). In certain embodiments, the cancer is pancreatic intraepithelial neoplasia (PanIN). In certain embodiments, the cancer is ductal carcinoma in situ (DCIS). In certain embodiments, the cancer is Barrett’s Esophagus.
[0692] In certain embodiments, the cancer has elevated levels of peri centrometric human satellite II (HSATII) RNA. In some embodiments, the cancer is a microsatellite instable (MSI) cancer. In some embodiments, the cancer is a microsatellite stable (MSS) cancer.
[0693] In certain embodiments, the cancer is selected from B cell lymphomas (e.g., B cell chronic lymphocytic leukemia, B cell non-Hodgkin lymphoma, cutaneous B cell lymphoma, diffuse large B cell lymphoma), basal cell carcinoma, bladder cancer, blastoma, brain metastasis, breast cancer, Burkitt lymphoma, carcinoma (e.g., adenocarcinoma (e.g., of the gastroesophageal junction)), cervical cancer, colon cancer, colorectal cancer (colon cancer and rectal cancer), endometrial carcinoma, esophageal cancer, Ewing sarcoma, follicular lymphoma, gastric cancer, gastroesophageal junction carcinoma, gastrointestinal cancer, glioblastoma (e.g., glioblastoma multiforme, e.g., newly diagnosed or recurrent), glioma, head and neck cancer (e.g., head and neck squamous cell carcinoma), hepatic metastasis, Hodgkin1 s and non-Hodgkin' s lymphoma, kidney cancer (e.g., renal cell carcinoma and Wilms' tumors), laryngeal cancer, leukemia (e.g., chronic myelocytic leukemia, hairy cell leukemia), liver cancer (e.g, hepatic carcinoma and hepatoma), lung cancer (e.g, non-small cell lung cancer and small-cell lung cancer), lymphoblastic lymphoma, lymphoma, mantle cell lymphoma, metastatic brain tumor, metastatic cancer, myeloma (e.g, multiple myeloma), neuroblastoma, ocular melanoma, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer (e.g, pancreatic ductal adenocarcinoma), prostate cancer (e.g, hormone refractory (e.g, castration resistant), metastatic, metastatic hormone refractory (e.g., castration resistant, androgen independent)), renal cell carcinoma (e.g, metastatic), salivary gland carcinoma, sarcoma (e.g, rhabdomyosarcoma), skin cancer (e.g, melanoma (e.g, metastatic melanoma)), soft tissue sarcoma, solid tumor, squamous cell carcinoma, synovia sarcoma, testicular cancer, thyroid cancer, transitional cell cancer (urothelial cell cancer), uveal melanoma (e.g., metastatic), verrucous carcinoma, vulval cancer, and Waldenstrom macroglobulinemia.
[0694] In some embodiments, the cancer is a virus-associated cancer. As used herein, the term “virus-associated cancer” means any cancer in which a virus is known to play a role. For example, Epstein-Barr virus (EBV) has been reported to be associated with the endemic variant of Burkitt lymphoma and certain other lymphomas. Infection by human papilloma virus (HPV) is believed to be responsible for certain types of cervical and/or genital cancer. Human T-cell leukemia virus 1 (HTLV-1) has been reported to be linked adult T-cell leukemia/lymphoma (ATLL). Human T-cell leukemia virus 2 (HTLV-2) has been reported to be linked to cutaneous T-cell lymphoma. Human herpes virus 8 (HHV-8) is believed to cause Kaposi’s sarcoma in patients with AIDS. In certain embodiments, the cancer is a cancer associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8. In certain embodiments, the cancer is Burkitt lymphoma, cervical cancer, genital cancer, adult T-cell leukemia/lymphoma, cutaneous T-cell lymphoma, or Kaposi’s sarcoma.
[0695] In some embodiments, the cancer is a cancer other than a virus-associated cancer. In certain embodiments, the cancer is a cancer other than a cancer associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8. In certain embodiments, the cancer is a cancer other than Burkitt lymphoma, cervical cancer, genital cancer, adult T-cell leukemia/lymphoma, cutaneous T-cell lymphoma, or Kaposi’s sarcoma. In some embodiments, the cancer is a tumor associated with Li-Fraumeni syndrome. [0696] In some embodiments, the cancer is mesothelioma, hepatobiliary (hepatic and biliary duct), bone cancer, pancreatic cancer, skin cancer, cancer of the head or neck, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, cancer of the anal region, stomach cancer, gastrointestinal (gastric, colorectal, and duodenal), uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin’s Disease, cancer of the esophagus, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, prostate cancer, testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, lymphocytic lymphomas, cancer of the bladder, cancer of the kidney or ureter, renal cell carcinoma, carcinoma of the renal pelvis, non-Hodgkin’s lymphoma, spinal axis tumors, brain stem glioma, pituitary adenoma, adrenocortical cancer, gall bladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, or a combination of one or more of the foregoing cancers.
[0697] In some embodiments, the cancer is hepatocellular carcinoma, ovarian cancer, ovarian epithelial cancer, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), prostate cancer, testicular cancer, gallbladder cancer, hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, Ewing sarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, gastrointestinal/stomach (GIST) cancer, lymphoma, squamous cell carcinoma of the head and neck (SCCHN), salivary gland cancer, glioma, or brain cancer, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulinemia, or medulloblastoma.
[0698] In some embodiments, the cancer is hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical adenoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulin emi a, or medulloblastoma.
[0699] In some embodiments, the cancer is selected from renal cell carcinoma, or kidney cancer; hepatocellular carcinoma (HCC) or hepatoblastoma, or liver cancer; melanoma; breast cancer; colorectal carcinoma, or colorectal cancer; colon cancer; rectal cancer; anal cancer; lung cancer, such as non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC); ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, or fallopian tube cancer; papillary serous cystadenocarcinoma or uterine papillary serous carcinoma (UPSC); prostate cancer; testicular cancer; gallbladder cancer; hepatocholangiocarcinoma; soft tissue and bone synovial sarcoma; rhabdomyosarcoma; osteosarcoma; chondrosarcoma; Ewing sarcoma; anaplastic thyroid cancer; adrenocortical carcinoma; pancreatic cancer; pancreatic ductal carcinoma or pancreatic adenocarcinoma; gastrointestinal/stomach (GIST) cancer; lymphoma; squamous cell carcinoma of the head and neck (SCCHN); salivary gland cancer; glioma, or brain cancer; neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST); Waldenstrom’s macroglobulinemia; and medulloblastoma.
[0700] In some embodiments, the cancer is renal cell carcinoma, hepatocellular carcinoma (HCC), hepatoblastoma, colorectal carcinoma, colorectal cancer, colon cancer, rectal cancer, anal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, chondrosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, brain cancer, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulinemia, or medulloblastoma.
[0701] In some embodiments, the cancer is hepatocellular carcinoma (HCC), hepatoblastoma, colon cancer, rectal cancer, ovarian cancer, ovarian epithelial cancer, ovarian carcinoma, fallopian tube cancer, papillary serous cystadenocarcinoma, uterine papillary serous carcinoma (UPSC), hepatocholangiocarcinoma, soft tissue and bone synovial sarcoma, rhabdomyosarcoma, osteosarcoma, anaplastic thyroid cancer, adrenocortical carcinoma, pancreatic cancer, pancreatic ductal carcinoma, pancreatic adenocarcinoma, glioma, neurofibromatosis- 1 associated malignant peripheral nerve sheath tumors (MPNST), Waldenstrom’s macroglobulin emi a, or medulloblastoma.
[0702] In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer, or ovarian carcinoma. In some embodiments, the cancer is ovarian epithelial cancer. In some embodiments, the cancer is fallopian tube cancer. In some embodiments, the cancer is papillary serous cystadenocarcinoma. In some embodiments, the cancer is uterine papillary serous carcinoma (UPSC). In some embodiments, the cancer is hepatocholangiocarcinoma. In some embodiments, the cancer is soft tissue and bone synovial sarcoma. In some embodiments, the cancer is rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is anaplastic thyroid cancer. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer, or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is glioma. In some embodiments, the cancer is malignant peripheral nerve sheath tumors (MPNST). In some embodiments, the cancer is neurofibromatosis- 1 associated MPNST. In some embodiments, the cancer is Waldenstrom’s macroglobulinemia. In some embodiments, the cancer is medulloblastoma.
[0703] In certain embodiments, the cancer is a leukemia (e.g, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin’s disease or non-Hodgkin’s disease), Waldenstrom's macroglobulinemia, multiple myeloma, or heavy chain disease. In certain embodiments, the cancer is a solid tumor such as a sarcoma or carcinoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing’s tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, uterine cancer, testicular cancer, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, and retinoblastoma).
[0704] In some embodiments, the cancer is glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, or retinoblastoma.
[0705] In some embodiments, the cancer is acoustic neuroma, astrocytoma (e.g. Grade I - Pilocytic Astrocytoma, Grade II - Low-grade Astrocytoma, Grade III - Anaplastic Astrocytoma, or Grade IV - Glioblastoma (GBM)), chordoma, CNS lymphoma, craniopharyngioma, brain stem glioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumors, primitive neuroectodermal (PNET) tumor, or schwannoma. In some embodiments, the cancer is a type found more commonly in children than adults, such as brain stem glioma, craniopharyngioma, ependymomajuvenile pilocytic astrocytoma (JPA), medulloblastoma, optic nerve glioma, pineal tumor, primitive neuroectodermal tumors (PNET), or rhabdoid tumor.
[0706] In certain embodiments, the cancer is associated with LINE1 reverse transcriptase. In certain embodiments, the cancer is associated with high levels of LINE1 RT activity and/or expression. In certain embodiments, the cancer is associated with HERV-K reverse transcriptase. In certain embodiments, the cancer is associated with high levels of HERV-K RT activity and/or expression.
Inflammatory Disorders
[0707] In certain embodiments, the disorder is an inflammatory disorder. In certain embodiments, the inflammatory disorder is rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, or sclerosing cholangitis, psoriasis, dermatitis, vasculitis, scleroderma, asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, pericarditis, gout, myositis, Sjogren’s syndrome, or systemic lupus erythematosus.
[0708] In certain embodiments, the inflammatory disorder is rheumatoid arthritis, osteoarthritis, or ankylosing spondylitis. In certain embodiments, the inflammatory disorder is inflammatory bowel disease, Crohn’s disease, or ulcerative colitis. In certain embodiments, the inflammatory disorder is nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, or sclerosing cholangitis. In certain embodiments, the inflammatory disorder is psoriasis, dermatitis, vasculitis, or scleroderma. In certain embodiments, the inflammatory disorder is asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, or pericarditis. In certain embodiments, the inflammatory disorder is gout, myositis, Sjogren’s syndrome, or systemic lupus erythematosus.
[0709] In certain embodiments, the inflammatory disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the inflammatory disorder is associated with high levels of LINE 1 RT activity and/or expression. In certain embodiments, the inflammatory disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the inflammatory disorder is associated with high levels of HERV-K RT activity and/or expression.
Immune Disorders
[0710] In certain embodiments, the disorder is an immune disorder other than a viral infection.
[0711] In certain embodiments, the immune disorder is a type I interferonopathy. In certain embodiments, the type I interferonopathy is a congenital disorder associated with type I interferon overexpression. In certain embodiments, the immune disorder is selected from Aicardi-Goutieres syndrome (AGS), Singleton-Merten syndrome, proteasome-associated autoinfl am m at ory syndromes, chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), STING-associated vasculopathy with onset in infancy (SAVI), Japanese autoinflammatory syndrome with lipodystrophy (JASL), spondyloenchondrodysplasia (SPENCD), ISG15 deficiency, Ubiquitin-Specific Peptidase 18 deficiency (pseudo-TORCH syndrome), chronic atypical neurophilic dermatitis with lipodystrophy, DNA II deficiency, trichoheptoenteric syndrome 2, retinal vasculopathy with cerebral leukodystrophy, familial chilblain lupus, and X-linked reticulate pigmentary disorder (XLPDR). In another embodiment, the type I interferonopathy is an acquired disorder in the interferon (IFN) system.
[0712] In certain embodiments, the immune disorder results in an overproduction of interferon. In certain embodiments, the immune disorder results in an overproduction of type I interferon.
[0713] In certain embodiments, the immune disorder is selected from the group consisting of achalasia, Addison’s disease, adult Still’s disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM/anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune dysautonomia, autoimmune encephalitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, benign mucosal pemphigoid, bullous pemphigoid, Castleman disease (CD), celiac disease, Chagas disease, chronic inflammatory demyelinating polyneuropathy (C1DP), chronic recurrent multifactorial osteomyelitis (CRMO), Churg-Strauss syndrome or eosinophilic granulomatosis, cicatricial pemphigoid, Cogan’s syndrome, cold agglutinin disease, complex regional pain syndrome (previously called reflex sympathetic dystrophy), congenital heart block, coxsackle myocarditis, CREST syndrome, Crohn’s disease, cutaneous lupus erythematosus (CLE), dermatitis herpetiformis, dermatomyositis, Devic’s disease (neuromyelitis optica), discoid lupus, Dressier’s syndrome, endometriosis, eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture’s syndrome, granulomatosis with polyangiitis, graft versus host disease, Graves’ disease, Guillain-Barre syndrome, Hashimoto’s thyroiditis, hemolytic anemia, Henoch-Schonlein purpura (HSP), herpes gestationis or pemphigoid gestationis (PG), hidradenitis suppurativa (acne inversa), inflammatory bowel disease, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenic pupura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), juvenile arthritis, juvenile diabetes (type I diabetes), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, lichen planus, lichen sclerosus, ligneous conjunctivitis, linear IgA disease (LAD), lupus nephritis, lyme disease (chronic), Meniere’s disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), multifocal motor neuropathy, multiple sclerosis, myasthenia gravis, myelin oligodendrocyte glycoprotein antibody disorder, myositis, narcolepsy, neonatal lupus, neutropenia, ocular cicatricial pemphigoid, optic neuritis, palindromic rheumatism, pediatric autoimmune neuropsychiatric disorders associated with streptococcus infections (PANDAS), paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), pars planitis (peripheral uveitis), Parsonage-Turner syndrome, pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polyarteritis rheumatica, polymyositis, postmyocardial infarction syndrome, postpericardiotomy syndrome, primary biliary cholangitis, primary sclerosing cholangitis, progesterone dermatitis, progressive hemifacial atrophy (Parry Romberg syndrome), psoriasis, psoriatic arthritis, pure red cell aplasia, pyoderma gangrenosum, Raynoud’s phenomena, reactive arthritis, relapsing polychondritis, restless leg syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis (RA), sarcoidosis, Schmidt syndrome (autoimmune poly endocrine syndrome type II), scleritis, scleroderma, Sjogren’s disease, stiff person syndrome, Susac’s syndrome, sympathetic ophthalmia, systemic lupus erythematosus (SLE), Takayasu’s arteritis, thrombotic thrombocytopenic pupura, thyroid eye disease, Tolosa-Hunt syndrome, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, uveitis, vasculitis, vitiligo, Vogt-Koyanagi-Harada disease, and warm autoimmune hemolytic anemia.
[0714] In certain embodiments, the immune disorder is arthritis, psoriasis, systemic lupus erythematosus (SLE), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter's syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism, alopecia, psoriasis, malabsorption syndrome, pernicious anemia, hepatitis, hypopituitarism, diabetes insipidus, or sicca syndrome.
[0715] In certain embodiments, the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter’s syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism, alopecia, malabsorption syndrome, pernicious anemia, hepatitis, hypopituitarism, diabetes insipidus, or sicca syndrome.
[0716] In certain embodiments, the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter’s syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism, alopecia, malabsorption syndrome, pernicious anemia, hypopituitarism, diabetes insipidus, or sicca syndrome.
[0717] In certain embodiments, the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, dermatomyositis, inflammatory bowel disease, Crohn’s disease, or ulcerative colitis.
[0718] In certain embodiments, the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome. [0719] In certain embodiments, the immune disorder is a type 1 interferonopathy. In certain embodiments, the immune disorder is type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, or dermatomyositis. In certain embodiments, the immune disorder is systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), or familial chilblain lupus. In certain embodiments, the immune disorder is systemic lupus erythematosus (SLE), lupus nephritis, or cutaneous lupus erythematosus (CLE). In certain embodiments, the immune disorder is type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), Sjogren’s syndrome, or dermatomyositis. In certain embodiments, the immune disorder is Aicardi- Goutieres syndrome (AGS), familial chilblain lupus, or STING-associated vasculopathy with onset in infancy (SAVI).
[0720] In certain embodiments, the immune disorder is type 1 diabetes. In certain embodiments, the immune disorder is Aicardi-Goutieres syndrome (AGS). In certain embodiments, the immune disorder is systemic lupus erythematosus (SLE). In certain embodiments, the immune disorder is lupus nephritis. In certain embodiments, the immune disorder is cutaneous lupus erythematosus (CLE). In certain embodiments, the immune disorder is familial chilblain lupus. In certain embodiments, the immune disorder is systemic sclerosis. In certain embodiments, the immune disorder is STING-associated vasculopathy with onset in infancy (SAVI). In certain embodiments, the immune disorder is Sjogren’s syndrome. In certain embodiments, the immune disorder is dermatomyositis.
[0721] In certain embodiments, the immune disorder is inflammatory bowel disease, Crohn’s disease, or ulcerative colitis. In certain embodiments, the immune disorder is inflammatory bowel disease. In certain embodiments, the immune disorder is Crohn’s disease. In certain embodiments, the immune disorder is ulcerative colitis. In certain embodiments, the autoimmune disorder is drug-induced colitis. In certain embodiments, the autoimmune disorder is colitis associated with the administration of checkpoint inhibitors.
[0722] In certain embodiments, the immune disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the immune disorder is associated with high levels of LINE1 RT activity and/or expression. In certain embodiments, the immune disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the immune disorder is associated with high levels of HERV-K RT activity and/or expression.
Neurodegenerative Disorders
[0723] In certain embodiments, the disorder is a neurodegenerative disorder. In certain embodiments, the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression. In certain embodiments, the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, or dementia. In certain embodiments, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS) or progressive supranuclear palsy.
[0724] In certain embodiments, the neurological disorder is peripheral neuropathy, age- related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression.
[0725] In certain embodiments, the neurodegenerative disorder is Alzheimer’s disease. In certain embodiments, the neurodegenerative disorder is amyotrophic lateral sclerosis (ALS). In certain embodiments, the neurodegenerative disorder is multiple sclerosis. In certain embodiments, the neurodegenerative disorder is Parkinson’s disease. In certain embodiments, the neurodegenerative disorder is Huntington’s disease. In certain embodiments, the neurodegenerative disorder is dementia. In certain embodiments, the neurodegenerative disorder is age-related macular degeneration. In certain embodiments, the neurodegenerative disorder is progressive supranuclear palsy.
[0726] In certain embodiments, the neurodegenerative disorder is associated with LINE1 reverse transcriptase. In certain embodiments, the neurodegenerative disorder is associated with high levels ofLINEl RT activity and/or expression. In certain embodiments, the neurodegenerative disorder is associated with HERV-K reverse transcriptase. In certain embodiments, the neurodegenerative disorder is associated with high levels of HERV-K RT activity and/or expression.
Subjects
[0727] In certain embodiments, the subject has (i) expression of LINE 1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) expression of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
[0728] In certain embodiments, the subject has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase. In certain embodiments, the subject has (i) elevated expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) elevated activity of LINE1 reverse transcriptase. In certain embodiments, the subject has expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide. In certain embodiments, the subject has expression ofLINEl RNA. In certain embodiments, the subject has expression of LINE1 ORF1 polypeptide. In certain embodiments, the subject has expression ofLINEl ORF2 polypeptide. In certain embodiments, the subject has activity of LINEl reverse transcriptase.
[0729] In certain embodiments, the subject has (i) expression of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the subject has expression of HERV-K RNA. In certain embodiments, the subject has activity of HERV-K reverse transcriptase.
[0730] In certain embodiments, the subject has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; (ii) activity ofLINEl reverse transcriptase; (iii) levels of HERV-K RNA, and/or (iv) activity of HERV-K reverse transcriptase.
[0731] In certain embodiments, the subject has elevated (i) levels ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase. In certain embodiments, the subject has elevated levels of LINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide. In certain embodiments, the subject has elevated levels ofLINEl RNA. In certain embodiments, the subject has elevated levels of LINE1 0RF1 polypeptide. In certain embodiments, the subject has elevated levels of LINE1 0RF2 polypeptide. In certain embodiments, the subject has elevated activity of LINE 1 reverse transcriptase.
[0732] In certain embodiments, the subject has elevated (i) levels of HERV-K RNA, and/or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the subject has elevated levels of HERV-K RNA. In certain embodiments, the subject has elevated activity of HERV-K reverse transcriptase.
[0733] In certain embodiments, the subject is a human. In certain embodiments, the subject is an adult human. In certain embodiments, the subject is a pediatric human. In certain embodiments, the subject is a companion animal. In certain embodiments, the subject is a canine, feline, or equine.
Uses of Compounds
[0734] Another aspect of the disclosure provides for the use of a compound described herein (such as a compound of Formula I, II, III, IV, V, VI, or other compounds described above) for treating a medical disorder, such as a medical disorder described herein (for example, cancer).
[0735] Another aspect of the disclosure provides for the use of a compound described herein (such as a compound of Formula I, II, III, IV, V, VI, or other compounds described above) in the manufacture of a medicament. In certain embodiments, the medicament is for treating a disorder described herein, such as cancer.
III. Methods of Inhibiting LINE1 and/or HERV-K Reverse Transcriptase Activity
[0736] Another aspect of the disclosure provides methods for inhibiting reverse transcriptase activity. This is described in more detail below.
[0737] Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity. The method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, in order to inhibit the activity of said LINE1 reverse transcriptase. In certain embodiments, the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination. In certain embodiments, the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject.
[0738] Another aspect of the disclosure provides a method of inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodeg enerative disorder, and an immune disorder other than a viral infection. The method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section 1 above, such as a compound of Formula I, II, III, IV, V, or VI, in order to inhibit the activity of said LINE1 reverse transcriptase. In certain embodiments, the particular compound of Formula I, II, III, IV, V, or VI, is a compound defined by embodiments described above, either singly or in combination. The method comprises contacting a LINE1 reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III- 1 , IV-1, VI-1 in order to inhibit the activity of said LINE1 reverse transcriptase. In certain embodiments, the particular compound of Formula I, II, III, IV, V, VI, , I- 1, II- 1 , III- 1 , IV-1, V-l, or VI-1 is a compound defined by embodiments described above, either singly or in combination. In certain embodiments, the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject. In certain embodiments, the disorder is a disorder defined by one of the embodiments described in Section II, above, such as cancer.
[0739] Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity. The method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, or III, in order to inhibit the activity of said HERV-K reverse transcriptase. In certain embodiments, the particular compound of Formula I, II, or III is a compound defined by embodiments described in Section I, above, either singly or in combination. In certain embodiments, the method further comprises inhibiting LINE1 reverse transcriptase activity in the subject.
[0740] Another aspect of the disclosure provides a method of inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection. The method comprises contacting a HERV-K reverse transcriptase with an effective amount of a compound described in Section I above, such as a compound of Formula I, II, III, IV, V, or VI, in order to inhibit the activity of said HERV-K reverse transcriptase. In certain embodiments, the particular compound of Formula I, II, III, IV, V, or VI, is a compound defined by embodiments described above, either singly or in combination. In certain embodiments, the method further comprises inhibiting LINE1 reverse transcriptase activity in the subject. In certain embodiments, the disorder is a disorder defined by one of the embodiments described in Section II, above, such as cancer.
[0741] Compounds may be tested for ability to inhibit activity of LINE 1 reverse transcriptase or HERV-K reverse transcriptase, for example, as described in the Examples.
IV. Combination Therapy
[0742] Another aspect of the disclosure provides for combination therapy. Substituted halo- dehydro-3 '-deoxyuracil phosphoramidates or related compounds described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above) or their pharmaceutically acceptable salts may be used in combination with additional therapeutic agents to treat medical disorders (e.g., according to the methods described in Section II, with disorders such as a cancer). Substituted halo-dehydro-3'-deoxyuracil phosphoramidates or related compounds described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II- 1, III-l, IV- 1, V-l, or VI- 1 or other compounds described above) or their pharmaceutically acceptable salts may be used in combination with additional therapeutic agents to treat medical disorders (e.g., according to the methods described in Section II, with disorders such as a cancer). Accordingly, in some embodiments, a method of the disclosure further comprises administering an effective amount of an additional therapeutic agent.
[0743] Each of the methods described herein for treating disease using combination therapy may be further characterized according to the additional therapeutic agent used in the method. For example, in certain embodiments, the additional therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the additional therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex. [0744] In certain embodiments, the additional therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir. In certain embodiments, the additional therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir alafenamide. In certain embodiments, the additional therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir amibufenamide. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir disoproxil. In certain embodiments, the additional therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the additional therapeutic agent is tenofovir exalidex.
[0745] In some embodiments, the present disclosure provides a method of treating a disclosed disease or condition comprising administering to a patient in need thereof an effective amount of a compound disclosed herein or a pharmaceutically acceptable salt thereof and co-administering simultaneously or sequentially an effective amount of one or more additional therapeutic agents, such as those described herein. In some embodiments, the method includes co-administering one additional therapeutic agent. In some embodiments, the method includes co-administering two additional therapeutic agents. In some embodiments, the combination of the disclosed compound and the additional therapeutic agent or agents acts synergistically.
[0746] One or more other therapeutic agent may be administered separately from a compound or composition of the disclosure, as part of a multiple dosage regimen. Alternatively, one or more other therapeutic agents may be part of a single dosage form, mixed together with a compound of this disclosure in a single composition. If administered as a multiple dosage regime, one or more other therapeutic agent and a compound or composition of the disclosure may be administered simultaneously, sequentially or within a period of time from one another, for example within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours from one another. In some embodiments, one or more other therapeutic agent and a compound or composition of the disclosure are administered as a multiple dosage regimen more than 24 hours apart.
[0747] The doses and dosage regimen of the active ingredients used in the combination therapy may be determined by an attending clinician. In certain embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g, a compound of Formula I, II, III, IV, V, VI, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are administered in doses commonly employed when such agents are used as monotherapy for treating the disorder. In other embodiments, the substituted halo-dehydro-3 '- deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating the disorder. In certain embodiments, the substituted halo-dehydro-3 '- deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are present in the same composition, which is suitable for oral administration.
[0748] In certain embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) may act additively or synergistically. A synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy. A lower dosage or less frequent administration of one or more agents may lower toxicity of the therapy without reducing the efficacy of the therapy.
[0749] Another aspect of this disclosure is a kit comprising a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, or other compounds described above), a pharmaceutically acceptable carrier, vehicle or diluent, and optionally at least one additional therapeutic agent listed above.
[0750] In certain embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g, a compound of Formula I, II, III, IV, V, VI, I- 1 , II- 1 , III-l, IV-1, VI-1, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are administered in doses commonly employed when such agents are used as monotherapy for treating the disorder. In other embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV- 1, VI-1, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating the disorder. In certain embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) are present in the same composition, which is suitable for oral administration.
[0751] In certain embodiments, the substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1 , II-l, III-l, IV-1, VI-1, or other compounds described above) and the additional therapeutic agent(s) (e.g. the second, third, or fourth, or fifth anti-cancer agent, described below) may act additively or synergistically. A synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy. A lower dosage or less frequent administration of one or more agents may lower toxicity of the therapy without reducing the efficacy of the therapy.
[0752] Another aspect of this disclosure is a kit comprising a therapeutically effective amount of the substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein (e.g., a compound of Formula I, II, III, IV, V, VI, 1-1, II-l, III-l, IV-1, VI-1, or other compounds described above), a pharmaceutically acceptable carrier, vehicle or diluent, and optionally at least one additional therapeutic agent listed above. Cancer
[0753] Accordingly, another aspect of the disclosure provides a method of treating cancer in a patient. The method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second anti-cancer agent, in order to treat the cancer.
[0754] In certain embodiments, the second anti-cancer agent is radiation therapy.
[0755] In certain embodiments, the second anti-cancer agent is a therapeutic antibody. In certain embodiments, the therapeutic antibody targets one of the following: CD20, CD30, CD33, CD52, EpCAM, CEA, gpA33, a mucin, TAG-72, CAIX, PSMA, a folate-binding protein, a ganglioside, Le, VEGF, VEGFR, VEGFR2, VEGFR3, integrin aVp3, integrin a5p i . EGFR, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, TRAILR3, RANKL, FAP, tenascin, CD 19, KIR, NKG2A, CD47, CEACAM1, c-MET, VISTA, CD73, CD38, BAFF, interleukin- 1 beta, B4GALNT1, interleukin-6, and interleukin-6 receptor.
[0756] In certain embodiments, the second anti-cancer agent is a therapeutic antibody selected from the group consisting of rituximab, ibritumomab tiuxetan, tositumomab, obinutuzumab, ofatumumab, brentuximab vedotin, gemtuzumab ozogamicin, alemtuzumab, IGN101, adecatumumab, labetuzumab, huA33, pemtumomab, oregovomab, minetumomab, cG250, 1591, Movl 8, farletuzumab, 3F8, chi 4.18, KW-2871, hu3S193, lgN31 1, bevacizumab, IM-2C6, CDP791, ramucirumab, etaracizumab, volociximab, cetuximab, panitumumab, nimotuzumab, 806, trastuzumab, pertuzumab, MM- 121, AMG 102, METMAB, SCH 900105, AVE1642, IMC-A12, MK-0646, R1507, CP 751871, KB004, IIIA-4, mapatumumab, HGS- ETR2, CS-1008, denosumab, sibrotuzumab, F19, 81C6, MEDI551, lirilumab, MEDI9447, daratumumab, belimumab, canakinumab, dinutuximab, siltuximab, and tocilizumab.
[0757] In certain embodiments, the second anti-cancer agent is a cytokine. In certain embodiments, the cytokine is IL-12, IL-15, GM-CSF, or G-CSF.
[0758] In certain embodiments, the second anti-cancer agent is sipuleucel-T, aldesleukin (a human recombinant interleukin-2 product having the chemical name des-alanyl- 1, serine- 125 human interleukin-2), dabrafenib (a kinase inhibitor having the chemical name A-{3-[5-(2- aminopyrimidin-4-yl)-2-/c'/7-butyl-l ,3-thiazol-4-yl]-2-fluorophenyl }-2,6- difluorobenzenesulfonamide), vemurafenib (a kinase inhibitor having the chemical name propane- 1 -sulfonic acid {3-[5-(4-chlorophenyl)-17/-pyrrolo[2,3-Z>]pyridine-3-carbonyl]-2,4- difluoro-phenyl (-amide), or 2-chloro-deoxyadenosine. In certain embodiments, the second anticancer agent is pazopanib, sorafenib, axitinib, lenvatinib, afatinib, erlotinib, gefitinib, osimertinib, or vandetanib.
[0759] In certain embodiments, the second anti-cancer agent is a placental growth factor, an antibody-drug conjugate, an oncolytic virus, or an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is a placental growth factor. In certain embodiments, the second anti-cancer agent is a placental growth factor comprising ziv-aflibercept. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate selected from the group consisting of brentoxumab vedotin and trastuzumab emtransine.
[0760] In certain embodiments, the second anti-cancer agent is an oncolytic virus. In certain embodiments, the second anti-cancer agent is the oncolytic virus talimogene laherparepvec. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine selected from the group consisting of a GM-CSF tumor vaccine, a STING/GM-CSF tumor vaccine, and NY-ESO-1. In certain embodiments, the second anti-cancer agent is a cytokine selected from IL-12, IL-15, GM- CSF, and G-CSF.
[0761] In certain embodiments, the second anti-cancer agent is an immune checkpoint inhibitor (also referred to as immune checkpoint blockers). Immune checkpoint inhibitors are a class of therapeutic agents that have the effect of blocking immune checkpoints. See, for example, Pardoll in Nature Reviews Cancer (2012) vol. 12, pages 252-264. In certain embodiments, the immune checkpoint inhibitor is an agent that inhibits one or more of (i) cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), (ii) programmed cell death protein 1 (PD1), (iii) PDL1, (iv) LAB3, (v) B7-H3, (vi) B7-H4, and (vii) TIM3. In certain embodiments, the immune checkpoint inhibitor is ipilumumab. In certain embodiments, the immune checkpoint inhibitor is pembrolizumab. In certain embodiments, the immune checkpoint inhibitor is atezolizumab, cemiplimab, cemiplimab-rwlc, dostarlimab, durvalumab, or nivolumab. [0762] In certain embodiments, the second anti -cancer agent is a monoclonal antibody that targets a non-checkpoint target (e.g., Herceptin). In certain embodiments, the second anti-cancer agent is a non-cytoxic agent (e.g., a tyrosine-kinase inhibitor).
[0763] In certain embodiments, the second anti-cancer agent is selected from mitomycin, ribomustin, vincristine, tretinoin, etoposide, cladribine, gemcitabine, mitobronitol, methotrexate, doxorubicin, carboquone, pentostatin, nitracrine, zinostatin, cetrorelix, letrozole, raltitrexed, daunorubicin, fadrozole, fotemustine, thymalfasin, sobuzoxane, nedaplatin, aminoglutethimide, amsacrine, proglumide, elliptinium acetate, ketanserin, doxifluridine, etretinate, isotretinoin, streptozocin, nimustine, vindesine, cytarabine, bicalutamide, vinorelbine, vesnarinone, flutamide, drogenil, butocin, carmofur, razoxane, sizofilan, carboplatin, mitolactol, tegafur, ifosfamide, prednimustine, picibanil, levamisole, teniposide, improsulfan, enocitabine, lisuride, oxymetholone, tamoxifen, progesterone, mepitiostane, epitiostanol, formestane, colony stimulating factor-1, colony stimulating factor-2, denileukin diftitox, interleukin-2, leutinizing hormone releasing factor, interferon-alpha, interferon-2 alpha, interferon-beta, and interferongamma.
[0764] In certain embodiments, the second anti-cancer agent is paclitaxel, docetaxel, cisplatin, epirubicin, 5-fluorouracil, or capecitabine. In certain embodiments, the second anticancer agent is ixabepilone or eribulin. In certain embodiments, the second anti-cancer agent is ART558. In certain embodiments, the second anti-cancer agent is lapatinib, neratinib, or tucatinib. In certain embodiments, the second anti-cancer agent is fulvestrant. In certain embodiments, the second anti-cancer agent is anastrozole or exemestane. In certain embodiments, the second anti-cancer agent is MK2206. In certain embodiments, the second anti-cancer agent is dacomitinib, mobocertinib, necitumumab, or amivantamab. In certain embodiments, the second anti-cancer agent is pemetrexed. In certain embodiments, the second anti-cancer agent is brigatinib. In certain embodiments, the second anti-cancer agent is capmatinib or tepotinib. In certain embodiments, the second anti-cancer agent is entrectinib. In certain embodiments, the second anti-cancer agent is pralsetinib or selpercatinib. In certain embodiments, the second anti-cancer agent is ipilimumab. In certain embodiments, the second anti-cancer agent is sotorasib. In certain embodiments, the second anti-cancer agent is topotecan or irinotecan. In certain embodiments, the second anti-cancer agent is lurbinectedin, melphalan, or thiotepa. In certain embodiments, the second anti-cancer agent is trifluridine or tipiracil. In certain embodiments, the second anti-cancer agent is megestrol. In certain embodiments, the second anti-cancer agent is sunitinib. In certain embodiments, the second anti-cancer agent is lanreotide or lutetium. In certain embodiments, the second anti-cancer agent is belzutifan.
[0765] In certain embodiments, the second anti-cancer agent is an ALK Inhibitor, an ATR Inhibitor, an A2A Antagonist, a Base Excision Repair Inhibitor, a Bcr-Abl Tyrosine Kinase Inhibitor, a Bruton's Tyrosine Kinase Inhibitor, a CDC7 Inhibitor, a CHK1 Inhibitor, a Cyclin- Dependent Kinase Inhibitor, a DNA-PK Inhibitor, an Inhibitor of both DNA-PK and mTOR, a DNMT1 Inhibitor, a DNMTl Inhibitor plus 2-chloro-deoxyadenosine, an HD AC Inhibitor, a Hedgehog Signaling Pathway Inhibitor, an IDO Inhibitor, a JAK Inhibitor, an mTOR Inhibitor, a MEK Inhibitor, a MELK Inhibitor, an MTH1 Inhibitor, a PARP Inhibitor, a Phosphoinositide 3- Kinase Inhibitor, an Inhibitor of both PARP1 and DHODH, a Proteasome Inhibitor, a Topoisomerase-II Inhibitor, a Tyrosine Kinase Inhibitor, a VEGFR Inhibitor, or a WEE1 Inhibitor.
[0766] In certain embodiments, the second anti-cancer agent is an ALK Inhibitor. In certain embodiments, the second anti-cancer agent is an ALK Inhibitor comprising ceritinib, lorlatinib, or crizotinib. In certain embodiments, the second anti-cancer agent is an ATR Inhibitor. In certain embodiments, the second anti-cancer agent is an ATR Inhibitor comprising AZD6738, BAY1895344, M4344, or VX-970. In certain embodiments, the second anti-cancer agent is an A2A Antagonist. In certain embodiments, the second anti-cancer agent is a Base Excision Repair Inhibitor comprising methoxyamine. In certain embodiments, the second anti-cancer agent is a Base Excision Repair Inhibitor, such as methoxyamine. In certain embodiments, the second anti-cancer agent is a Bcr-Abl Tyrosine Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Bcr-Abl Tyrosine Kinase Inhibitor comprising dasatinib or nilotinib. In certain embodiments, the second anti-cancer agent is a Bruton's Tyrosine Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Bruton's Tyrosine Kinase Inhibitor comprising ibrutinib. In certain embodiments, the second anti-cancer agent is a CDC7 Inhibitor. In certain embodiments, the second anti-cancer agent is a CDC7 Inhibitor comprising RXDX-103 or AS-141.
[0767] In certain embodiments, the second anti-cancer agent is a CHK1 Inhibitor. In certain embodiments, the second anti-cancer agent is a CHK1 Inhibitor comprising MK-8776, ARRY- 575, AZD7762, or SAR-020106. In certain embodiments, the second anti-cancer agent is a Cyclin-Dependent Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Cyclin-Dependent Kinase Inhibitor comprising abemaciclib, palbociclib, or ribociclib. In certain embodiments, the second anti-cancer agent is a DNA-PK Inhibitor. In certain embodiments, the second anti-cancer agent is a DNA-PK Inhibitor comprising MSC2490484A. In certain embodiments, the second anti-cancer agent is Inhibitor of both DNA-PK and mTOR. In certain embodiments, the second anti-cancer agent comprises CC-115.
[0768] In certain embodiments, the second anti-cancer agent is a DNMT1 Inhibitor. In certain embodiments, the second anti-cancer agent is a DNMT1 Inhibitor comprising decitabine, RX-3117, guadecitabine, NUC-8000, or azacytidine. In certain embodiments, the second anticancer agent comprises a DNMT1 Inhibitor and 2-chloro-deoxyadenosine. In certain embodiments, the second anti-cancer agent comprises ASTX-727.
[0769] In certain embodiments, the second anti-cancer agent is an HDAC Inhibitor. In certain embodiments, the second anti-cancer agent is an HDAC Inhibitor comprising OBP-801, CHR-3996, etinostate, resminostate, pracinostat, CG-200745, panobinostat, romidepsin, mocetinostat, belinostat, AR-42, ricolinostat, KA-3000, or ACY-241.
[0770] In certain embodiments, the second anti-cancer agent is a Hedgehog Signaling Pathway Inhibitor. In certain embodiments, the second anti-cancer agent is a Hedgehog Signaling Pathway Inhibitor comprising sonidegib or vismodegib. In certain embodiments, the second anti-cancer agent is an IDO Inhibitor. In certain embodiments, the second anti-cancer agent is an IDO Inhibitor comprising INCB024360. In certain embodiments, the second anticancer agent is a JAK Inhibitor. In certain embodiments, the second anti-cancer agent is a JAK Inhibitor comprising ruxolitinib or tofacitinib. In certain embodiments, the second anti-cancer agent is an mTOR Inhibitor. In certain embodiments, the second anti-cancer agent is an mTOR Inhibitor comprising everolimus or temsirolimus. In certain embodiments, the second anticancer agent is a MEK Inhibitor. In certain embodiments, the second anti-cancer agent is a MEK Inhibitor comprising cobimetinib or trametinib. In certain embodiments, the second anti-cancer agent is a MELK Inhibitor. In certain embodiments, the second anti-cancer agent is a MELK Inhibitor comprising ARN-7016, APTO-500, or OTS-167. In certain embodiments, the second anti-cancer agent is an MTH1 Inhibitor. In certain embodiments, the second anti-cancer agent is an MTH1 Inhibitor comprising (5)-crizotinib, TH287, or TH588.
[0771] In certain embodiments, the second anti-cancer agent is a PARP Inhibitor. In certain embodiments, the second anti-cancer agent is a PARP Inhibitor comprising MP-124, olaparib, BGB-290, talazoparib, veliparib, niraparib, E7449, rucaparib, or ABT-767. In certain embodiments, the second anti-cancer agent is a Phosphoinositide 3-Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Phosphoinositide 3-Kinase Inhibitor comprising alpelisib or idelalisib. In certain embodiments, the second anti-cancer agent is an inhibitor of both PARP1 and DHODH (z.c., an agent that inhibits both poly ADP ribose polymerase 1 and dihydroorotate dehydrogenase).
[0772] In certain embodiments, the second anti-cancer agent is a Proteasome Inhibitor. In certain embodiments, the second anti-cancer agent is a Proteasome Inhibitor comprising bortezomib or carfdzomib. In certain embodiments, the second anti-cancer agent is a Topoisomerase-II Inhibitor. In certain embodiments, the second anti-cancer agent is a Topoisomerase-II Inhibitor comprising vosaroxin.
[0773] In certain embodiments, the second anti-cancer agent is a Tyrosine Kinase Inhibitor. In certain embodiments, the second anti-cancer agent is a Tyrosine Kinase Inhibitor comprising bosutinib, cabozantinib, imatinib or ponatinib. In certain embodiments, the second anti-cancer agent is a VEGFR Inhibitor. In certain embodiments, the second anti-cancer agent is a VEGFR Inhibitor comprising regorafenib. In certain embodiments, the second anti -cancer agent is a WEE1 Inhibitor. In certain embodiments, the second anti-cancer agent is a WEE1 Inhibitor comprising AZDI 775.
[0774] In certain embodiments, the second anti-cancer agent is an agonist of 0X40, CD137, CD40, GITR, CD27, HVEM, TNFRSF25, or ICOS. In certain embodiments, the second anticancer agent is an agonist of 0X40, CD 137, CD40, or GITR. In certain embodiments, the second anti-cancer agent is an agonist of CD27, HVEM, TNFRSF25, or ICOS.
[0775] In certain embodiments, the second anti -cancer agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the second anti-cancer agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
[0776] In certain embodiments, the second anti-cancer agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir. In certain embodiments, the second anti-cancer agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir alafenamide. In certain embodiments, the second anti-cancer agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir amibufenamide. In certain embodiments, the second anticancer agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second anticancer agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir disoproxil. In certain embodiments, the second anti-cancer agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second anti-cancer agent is tenofovir exalidex.
[0777] In certain embodiments, the method further comprises administering to the subject a third anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fourth anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fifth anti-cancer agent.
[0778] In certain embodiments, the third anti-cancer agent is one of the second anti-cancer agents described above. In certain embodiments, the fourth anti-cancer agent is one of the second anti-cancer agents described above. In certain embodiments, the fifth anti-cancer agent is one of the second anti-cancer agents described above.
Inflammatory Disorders
[0779] Another aspect of the disclosure provides a method of treating an inflammatory disorder in a patient. The method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the inflammatory disorder.
[0780] In certain embodiments, the second therapeutic agent is a small molecule or a recombinant biologic agent. In certain embodiments, the second therapeutic agent is selected from acetaminophen, non-steroidal anti-inflammatory drugs (NSAIDS) such as aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids such as prednisone, prednisolone, methylprednisolone, hydrocortisone, and the like, probenecid, allopurinol, febuxostat (Uloric®), sulfasalazine (Azulfidine®), antimalarials such as hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®), methotrexate (Rheumatrex®), gold salts such as gold thioglucose (Solganal®), gold thiomalate (Myochrysine®) and auranofm (Ridaura®), D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (Cytoxan11), chlorambucil (Leukeran®), cyclosporine (Sandimmune®, Neoral®), tacrolimus, sirolimus, mycophenolate, leflunomide (Arava®) and “anti-TNF” agents such as etanercept (Enbrel®), infliximab (Remicade®), golimumab (Simponi®), certolizumab pegol (Cimzia®) and adalimumab (Humira®), “anti-IL-1” agents such as anakinra (Kineret*) and rilonacept (Arcalyst®), anti-T cell antibodies such as Thymoglobulin, IV Immunoglobulins (IVIg), canakinumab (Haris®), anti-Jak inhibitors such as tofacitinib, antibodies such as rituximab (Rituxan®), “anti-T-cell” agents such as abatacept (Orencia®), “anti-IL-6” agents such as tocilizumab (Actemra®), diclofenac, cortisone, hyaluronic acid (Synvisc® or Hyalgan®), monoclonal antibodies such as tanezumab, anticoagulants such as heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®), antidiarrheals such as diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binding agents such as cholestyramine, alosetron (Lotronex®), lubiprostone (Amitiza®), laxatives such as Milk of Magnesia, polyethylene glycol (MiraLax®), Dulcolax®, Correctol® and Senokot®, anticholinergics or antispasmodics such as dicyclomine (Bentyl®), Singulair®, beta-2 agonists such as albuterol (Ventolin® HF A, Proventil® HF A), levalbuterol (Xopenex®), metaproterenol (Alupent®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergic agents such as ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids such as beclomethasone dipropionate (Beclovent®, Qvar®, and Vanceril®), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), and flunisolide (Aerobid®), Afviar®, Symbicort®, Dulera®, cromolyn sodium (Intal ®), methylxanthines such as theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®, Theo-24®) and aminophylline, IgE antibodies such as omalizumab (Xolair®), nucleoside reverse transcriptase inhibitors such as zidovudine (Retrovir®), abacavir (Ziagen®), abacavir/lamivudine (Epzicom®), abacavir/lamivudine/zidovudine (Trizivir®), didanosine (Videx®), emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine/zidovudine (Combivir®), stavudine (Zerit®), and zalcitabine (Elivid®), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor®), efavirenz (Sustiva®), nevirapine (Viramune®) and etravirine (Intelence®), nucleotide reverse transcriptase inhibitors such as tenofovir (Viread®), protease inhibitors such as amprenavir (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®), and tipranavir (Aptivus®), entry inhibitors such as enfuvirtide (Fuzeon®) and maraviroc (Selzentry®), integrase inhibitors such as raltegravir (Isentress®), doxorubicin (Hydrodaunorubicin®), vincristine (Oncovin®), bortezomib (Velcade®), and dexamethasone (Decadron®) in combination with lenalidomide (Revlimid®), anti-IL36 agents such as BI655130, Dihydroorotate dehydrogenase inhibitors such as IMU-838, anti-OX40 agents such as KHK-4083, microbiome agents such as RBX2660, SER-287, Narrow spectrum kinase inhibitors such as TOP-1288, anti-CD40 agents such as BI-655064 and FFP-104, guanylate cyclase agonists such as dolcanatide, sphingosine kinase inhibitors such as opaganib, anti-IL-12/IL-23 agents such as AK-101, Ubiquitin protein ligase complex inhibitors such as BBT- 401, sphingosine receptors modulators such as BMS-986166, P38MAPK/PDE4 inhibitors such as CBS-3595, CCR9 antagonists such as CCX-507, FimH antagonists such as EB-8018, HIF-PH inhibitors such as FG-6874, HIF-la stabilizer such as GB-004, MAP3K8 protein inhibitors such as GS-4875, LAG-3 antibodies such as GSK-2831781, RIP2 kinase inhibitors such as GSK- 2983559, Farnesoid X receptor agonist such as MET-409, CCK2 antagonists such as PNB-001, IL-23 Receptor antagonists such as PTG-200, Purinergic P2X7 receptor antagonists such as SGM-1019, PDE4 inhibitors such as Apremilast, ICAM-1 inhibitors such as alicaforsen sodium, Anti- IL23 agents such as guselkumab, brazikumab and mirkizumab, ant-IL-15 agents such as AMG-714, TYK-2 inhibitors such as BMS-986165, NK Cells activators such as CNDO-201, RIP-1 kinase inhibitors such as GSK-2982772, anti-NKGD2 agents such as JNJ-4500, CXCL-10 antibodies such as JT-02, IL-22 receptor agonists such as RG-7880, GATA-3 antagonists such as SB-012, and Colony-stimulating factor-1 receptor inhibitors such as edicotinib.
[0781] In certain embodiments, the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
[0782] In certain embodiments, the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
[0783] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
[0784] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.
Immune Disorders Other Than a Viral Infection
[0785] Another aspect of the disclosure provides a method of treating an immune disorder other than a viral infection in a patient. The method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the immune disorder other than a viral infection.
[0786] In certain embodiments, the second therapeutic agent is pentoxifylline, propentofylline, torbafylline, cyclosporine, methotrexate, tamoxifen, forskolin and analogs thereof, tar derivatives, steroids, vitamin A and its derivatives, vitamin D and its derivatives, a cytokine, a chemokine, a stem cell growth factor, a lymphotoxin, an hematopoietic factor, a colony stimulating factor (CSF), erythropoietin, thrombopoietin, tumor necrosis factor-a (TNF), I NF-©, granulocyte-colony stimulating factor (G-CSF), granulocyte macrophage-colony stimulating factor (GM-CSF), interferon-a, interferon-P, interferon-y, interferon-L, stem cell growth factor designated “SI factor”, human growth hormone, N-methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prorelaxin, follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), luteinizing hormone (LH), hepatic growth factor, prostaglandin, fibroblast growth factor, prolactin, placental lactogen, OB protein, mullerian-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothelial growth factor, integrin, NGF-P, platelet-growth factor, TGF-a, TGF-P, insulin-like growth factor-I, insulin-like growth factor-II, macrophage-CSF (M- CSF), IL-1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL- 14, IL-15, IL-16, IL-17, IL-18, IL-21, IL -25, LIF, FLT-3, angiostatin, thrombospondin, endostatin, or lymphotoxin.
[0787] In certain embodiments, the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
[0788] In certain embodiments, the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
[0789] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
[0790] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.
Viral Infection
[0791] Another aspect of the disclosure provides a method of treating an immune disorder that is a viral infection in a patient. The method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphorami date or related compound described herein and (ii) a second therapeutic agent, in order to treat the immune disorder that is a viral infection. In certain embodiments, the immune disorder is a viral infection other than an influenza viral infection.
[0792] In certain embodiments, the second therapeutic agent is an anti-HIV agent. In certain embodiments, the second therapeutic agent is a nucleoside reverse transcriptase inhibitor (NRTI), non-nucleoside reverse transcriptase inhibitor, protease inhibitor, or fusion inhibitor. In certain embodiments, the second therapeutic agent is 3TC (Lamivudine), AZT (Zidovudine), (-)- FTC, ddl (Didanosine), ddC (zalcitabine), abacavir (ABC), tenofovir (PMPA), D-D4FC (Reverset), D4T (Stavudine), Racivir, L-FddC, L-FD4C, NVP (Nevirapine), DLV (Delavirdine), EFV (Efavirenz), SQVM (Saquinavir mesylate), RTV (Ritonavir), IDV (Indinavir), SQV (Saquinavir), NFV (Nelfinavir), APV (Amprenavir), LPV (Lopinavir), or the fusion inhibitor T20.
[0793] In certain embodiments, the second therapeutic agent is ddC, abacavir, ddl, ddA, 3TC, AZT, D4T, FTC, FddC, Fd4C, Atazanavir, Adefovir dipivoxyl, Tenofovir disoproxil, Etecavir, Indinavir, KHI-227.2-[3-[3-(S)-[[(Tetrahydrofuranyloxy)carbonyl]amino]-4-phenyl-2(R)- hydroxybutyl]]-N-(l,l-dimethylethyl)decahydro-3-isoquinolinecarboxamide, VB-11,328, KNI- 174, Val-Val-Sta, CPG53820, HOEt-N2 aza-peptide isostere, 2,5-Diamino-N,N'-bis(N- benzyloxycarbonyluelyl)-l,6-diphenyl-3(S),4(S)-hexanediol BzOCValPhe[diCHOH(SS] PheValBzOC, 2,5,-Diamino-N,N'-bis(N-benzyloxycarbonyluelyl)-l,6-diphenyl-3(R),4(R)- hexanediol BzOCValPhe[diCHOH(RR]PheValBzOC, [bis(SATE)ddAMP], BILA 2186 BS, Agenerase, A-98881, A-83962, A-80987, (2-Naphthalcarbonyl)Asn[decarbonylPhe- hydroxyethyl]ProOtertButyl, A-81525, XM323, Tipranavir, SDZ PRI 053, SD146, Telinavir, (R)2QuinCOAsnPhe[CHOHCH2]PipCONHtBu, Saquinavir, R-87366, DMP 460, L685,434, L685,434-OEtNMe2, L689,502, Lasinavir, Aluviran P9941, Palinavir, or Penicillin. In certain embodiments, the second therapeutic agent is ddC, abacavir, ddl, ddA, 3TC, AZT, D4T, FTC, FddC, or Fd4C.
[0794] In certain embodiments, the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
[0795] In certain embodiments, the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
[0796] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
[0797] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.
Neurodegenerative Disorders
[0798] Another aspect of the disclosure provides a method of treating a neurodegenerative disorder in a patient. The method comprises administering to a subject in need thereof (i) a therapeutically effective amount of a substituted halo-dehydro-3 '-deoxyuracil phosphoramidate or related compound described herein and (ii) a second therapeutic agent, in order to treat the neurodegenerative disorder.
[0799] In certain embodiments, the second therapeutic agent is a dopaminergic treatment, a cholinesterase inhibitor, an antipsychotic drug, deep brain stimulation (for example, to stop tremor and refractory movement disorders), riluzole, a caffein A2A receptor antagonist, pramipexole, or rasagilin.
[0800] In certain embodiments, the second therapeutic agent is tenofovir, a prodrug thereof, or a pharmaceutically acceptable salt of either of the foregoing. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex; or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir, tenofovir alafenamide, tenofovir amibufenamide, tenofovir disoproxil, or tenofovir exalidex.
[0801] In certain embodiments, the second therapeutic agent is tenofovir, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir. In certain embodiments, the second therapeutic agent is tenofovir alafenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir alafenamide. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir amibufenamide. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, maleate, orotate, aspartate, or phosphate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil, or a fumarate, succinate, or maleate salt thereof. In certain embodiments, the second therapeutic agent is tenofovir disoproxil. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a pharmaceutically acceptable salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex, or a potassium salt thereof. In certain embodiments, the second therapeutic agent is tenofovir exalidex.
[0802] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.
[0803] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.
V. Pharmaceutical Compositions and Dosing Considerations
[0804] As indicated above, the disclosure provides pharmaceutical compositions, which comprise a therapeutically effective amount of one or more of the compounds described above, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; or (8) nasally.
[0805] In certain embodiments, the disclosure provides a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I or II) and a pharmaceutically acceptable carrier. In certain embodiments, the disclosure provides a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I, II, III, or IV), an additional therapeutic agent (e.g., a compound described in Section IV), and a pharmaceutically acceptable carrier.
[0806] The phrase “therapeutically effective amount” as used herein means that amount of a compound, material, or composition comprising a compound of the present disclosure which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal at a reasonable benefit/risk ratio applicable to any medical treatment. [0807] The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
[0808] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
[0809] Examples of pharmaceutically acceptable antioxidants include: (1) water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[0810] Formulations of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, and/or the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about ninety-nine percent of active ingredient, preferably from about 5 percent to about 70 percent, most preferably from about 10 percent to about 30 percent.
[0811] In certain embodiments, a formulation of the present disclosure comprises an excipient selected from the group consisting of cyclodextrins, celluloses, liposomes, micelle forming agents, e.g, bile acids, and polymeric carriers, e.g, polyesters and polyanhydrides; and a compound of the present disclosure. In certain embodiments, an aforementioned formulation renders orally bioavailable a compound of the present disclosure.
[0812] Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present disclosure with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
[0813] Formulations of the disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored basis, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or a suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as pastilles (using an inert base, such as gelatin and glycerin, or sucrose and acacia) and/or as mouth washes and the like, each containing a predetermined amount of a compound of the present disclosure as an active ingredient. A compound of the present disclosure may also be administered as a bolus, electuary or paste.
[0814] In solid dosage forms of the disclosure for oral administration (capsules, tablets, pills, dragees, powders, granules, troches and the like), the active ingredient is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds and surfactants, such as poloxamer and sodium lauryl sulfate; (7) wetting agents, such as, for example, cetyl alcohol, glycerol monostearate, and non-ionic surfactants; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) controlled release agents such as crospovidone or ethyl cellulose. In the case of capsules, tablets and pills, the pharmaceutical compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shelled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.
[0815] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
[0816] The tablets, and other solid dosage forms of the pharmaceutical compositions of the present disclosure, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical-formulating art. They may also be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profde, other polymer matrices, liposomes and/or microspheres. They may be formulated for rapid release, e.g., freeze-dried. They may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved in sterile water, or some other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents and may be of a composition that they release the active ingredient(s) only, or preferentially, in a certain portion of the gastrointestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-described excipients.
[0817] Liquid dosage forms for oral administration of the compounds of the disclosure include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof. [0818] Dosage forms for the topical or transdermal administration of a compound of this disclosure include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active compound may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required. The ointments, pastes, creams and gels may contain, in addition to an active compound of this disclosure, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof. Ophthalmic formulations, eye ointments, powders, solutions and the like, may be used for compounds described herein.
[0819] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.
[0820] Transdermal patches have the added advantage of providing controlled delivery of a compound of the present disclosure to the body. Such dosage forms can be made by dissolving or dispersing the compound in the proper medium. Absorption enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by either providing a rate controlling membrane or dispersing the compound in a polymer matrix or gel.
[0821] Pharmaceutical compositions of this disclosure suitable for parenteral administration comprise one or more compounds of the disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use.
[0822] Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. [0823] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
[0824] When the compounds of the present disclosure are administered as pharmaceuticals, to humans and animals, they can be given per se or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably, 10 to 30%) of active ingredient in combination with a pharmaceutically acceptable carrier.
[0825] The preparations of the present disclosure may be given orally, parenterally, topically, or rectally. They are of course given in forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, etc. administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral administrations are preferred.
[0826] The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
[0827] The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patient’s system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.
[0828] These compounds may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intraci sternally and topically, as by powders, ointments or drops, including buccally and sublingually. [0829] Regardless of the route of administration selected, the compounds of the present disclosure, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present disclosure, are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
[0830] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
[0831] The selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present disclosure employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion or metabolism of the particular compound being employed, the rate and extent of absorption, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.
[0832] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
[0833] In general, a suitable daily dose of a compound of the disclosure will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above. Preferably, the compounds are administered at about 0.01 mg/kg to about 200 mg/kg, more preferably at about 0.1 mg/kg to about 100 mg/kg, even more preferably at about 0.5 mg/kg to about 50 mg/kg. When the compounds described herein are co-administered with another agent (e.g., as sensitizing agents), the effective amount may be less than when the agent is used alone.
[0834] If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms. Preferred dosing is one administration per day. [0835] The disclosure further provides a unit dosage form (such as a tablet or capsule) comprising a substituted halo-dehydro-3'-deoxyuracil phosphoramidate or related compound described herein in a therapeutically effective amount for the treatment of a medical disorder described herein. ENUMERATED EMBODIMENTS [0836] Embodiment 1. A compound represented by Formula I: an enantiomer thereof, or a ph
Figure imgf000197_0001
ceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000198_0001
[0837] Embodiment 2. The compound of embodiment 1, wherein the compound is a compound of Formula I. [0838] Embodiment 3. The compound of embodiment 1 or 2, wherein R2 is fluoro and R3 is hydrogen. [0839] Embodiment 4. The compound of embodiment 1 or 2, wherein R2 is hydrogen and R3 is fluoro. [0840] Embodiment 5. A compound represented by Formula II: or a pharmaceutically acceptab
Figure imgf000198_0002
; herein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000199_0001
[0841] Embodiment 6. The compound of embodiment 5, wherein the compound is a compound of Formula II. [0842] Embodiment 7. A compound represented by Formula III: an enantiomer thereof, or a pha
Figure imgf000199_0002
y ceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is halo, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000200_0001
provided that when R5 is phenyl, R6 is hydrogen, and R7 is , then m is 1, 2, or 3, and R10 represents independently for each occurrence halo, C2-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl. [0843] Embodiment 8. The compound of embodiment 1, wherein the compound is a compound of Formula III. [0844] Embodiment 9. The compound of any one of embodiments 1-6, wherein R11 is hydrogen. [0845] Embodiment 10. The compound of any one of embodiments 1-6, wherein R11 is -CH3. [0846] Embodiment 11. The compound of any one of embodiments 1-8, wherein R11 is halo. [0847] Embodiment 12. The compound of any one of embodiments 1-8, wherein R11 is -CF3. [0848] Embodiment 13. The compound of any one of embodiments 1-8, wherein R11 is -CD3, -CH2CH3, or -C(H)=CH2. [0849] Embodiment 14. The compound of any one of embodiments 1-13, wherein B1 is
Figure imgf000201_0001
[0850] Embodiment 15. The compound of any one of embodiments 1-13, wherein B1 is
Figure imgf000201_0002
[0851] Embodiment 16. The compound of any one of embodiments 1-15, wherein R1 is - P(O)(OR5)(N(R6)(R7)).
[0852] Embodiment 17. The compound of any one of embodiments 1-16, wherein R6 is hydrogen.
[0853] Embodiment 18. The compound of any one of embodiments 1-17, wherein R8 represents independently for each occurrence Ci-6 alkyl or hydrogen.
[0854] Embodiment 19. The compound of any one of embodiments 1-18, wherein R7 is
Figure imgf000201_0003
[0855] Embodiment 20. The compound of any one of embodiments 1-19, wherein R9 is Ci-6 alkyl.
[0856] Embodiment 21. The compound of any one of embodiments 1-20, wherein R5 is phenyl substituted with m instances of R10.
[0857] Embodiment 22. The compound of any one of embodiments 1-20, wherein R3 is naphthyl substituted with m instances of R10.
[0858] Embodiment 23. The compound of any one of embodiments 1-20, wherein R5 is
Figure imgf000201_0004
[0859] Embodiment 24. The compound of any one of embodiments 1-23, wherein R10 represents independently for each occurrence halo. [0860] Embodiment 25. The compound of any one of embodiments 1-15, wherein R1 is - P(O)(OR4)2. [0861] Embodiment 26. The compound of any one of embodiments 1-15 or 25, wherein R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl). [0862] Embodiment 27. The compound of any one of embodiments 1-15 or 25, wherein R4 is -CH2-OC(O)O-(C1-6 alkyl). [0863] Embodiment 28. A compound in Table 1, 2, 3, or 6-A herein, or a pharmaceutically acceptable salt thereof. [0864] Embodiment 29. A pharmaceutical composition comprising a compound of any one of embodiments 1-28 and a pharmaceutically acceptable carrier. [0865] Embodiment 30. A method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of embodiments 1-28 to treat the disorder. [0866] Embodiment 31. A method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV, V, or VI to treat the disorder; wherein Formula IV is represented by: an enantiomer thereof, or a pha
Figure imgf000202_0001
rmaceutically acceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000203_0001
, , , ; wherein Formula V is represented by: or a pharmaceutically acceptab
Figure imgf000203_0002
le salt thereof; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000204_0001
, , , wherein Formula VI is represented by: an enantiomer thereof, or a pha
Figure imgf000204_0002
rmaceutically acceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000205_0001
, , , provided that the compound of Formula (VI) is not .
Figure imgf000205_0002
[0867] Embodiment 32. The method of embodiment 31, wherein the compound is a compound of Formula IV, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. [0868] Embodiment 33. The method of embodiment 31, wherein the compound is a compound of Formula V, or a pharmaceutically acceptable salt thereof.
[0869] Embodiment 34. The method of embodiment 31, wherein the compound is a compound of Formula VI, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
[0870] Embodiment 35. The method of embodiment 30, wherein the disorder is an immune disorder that is a viral infection.
[0871] Embodiment 36. The method of embodiment 35, wherein the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2), human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2), respiratory syncytial virus (RSV), human papilloma virus (HPV), adenovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), varicella zoster virus (VZV), cytomegalovirus (CMV), herpes simplex viruses 1 or 2 (HSV-1 or HSV-2), human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma-associated virus), or a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus.
[0872] Embodiment 37. The method of any one of embodiments 30-34, wherein the disorder is cancer.
[0873] Embodiment 38. The method of embodiment 37, wherein the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.
[0874] Embodiment 39. The method of any one of embodiments 30-34, wherein the disorder is an inflammatory disorder.
[0875] Embodiment 40. The method of embodiment 39, wherein the inflammatory disorder is rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, psoriasis, dermatitis, vasculitis, scleroderma, asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, pericarditis, gout, myositis, Sjogren's syndrome, or systemic lupus erythematosus.
[0876] Embodiment 41. The method of any one of embodiments 30-34, wherein the disorder is an immune disorder other than a viral infection.
[0877] Embodiment 42. The method of embodiment 41, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SAVI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter's syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism, alopecia, malabsorption syndrome, pernicious anemia, hepatitis, hypopituitarism, diabetes insipidus, or sicca syndrome.
[0878] Embodiment 43. The method of embodiment 41, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome.
[0879] Embodiment 44. The method of any one of embodiments 30-34, wherein the disorder is a neurodeg enerative disorder.
[0880] Embodiment 45. The method of embodiment 44, wherein the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression. [0881] Embodiment 46. The method of any one of embodiments 30-45, wherein the method further comprises administering an effective amount of an additional therapeutic agent.
[0882] Embodiment 47. The method of any one of embodiments 30-46, wherein the subject has (i) expression ofLINEl RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity ofLINEl reverse transcriptase.
[0883] Embodiment 48. The method of any one of embodiments 30-47, wherein the subject has (i) expression of HERV-K RNA and/or (ii) activity of HERV-K reverse transcriptase.
[0884] Embodiment 49. The method of any one of embodiments 30-48, wherein the subject is a human.
[0885] Embodiment 50. A method of inhibiting LINE1 reverse transcriptase activity, comprising contacting a LINE1 reverse transcriptase with an effective amount of a compound of any one of embodiments 1-28, in order to inhibit the activity of said LINE1 reverse transcriptase.
[0886] Embodiment 51. A method of inhibiting HERV-K reverse transcriptase activity, comprising contacting a HERV-K reverse transcriptase with an effective amount of a compound of any one of embodiments 1-28, in order to inhibit the activity of said HERV-K reverse transcriptase.
EXAMPLES
[0887] The disclosure now being generally described, will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present disclosure, and are not intended to limit the disclosure. Starting materials described herein can be obtained from commercial sources or may be readily prepared from commercially available materials using transformations known to those of skill in the art.
EXAMPLE 1 - Synthesis of Compound VIT-17: l-[(21?,5A)-5-[({di[(isopropoxycarbonyl) oxy]methoxyphosphoryl}oxy)methyl]-2,5-dihydrofuran-2-yl]-5-methyl-3H-pyrimidine-2,4- dione
Figure imgf000209_0001
[0888] To a stirred mixture of stavudine (30 mg, 0.13 mmol) and di [(isopropoxy carbonyl) oxy]methoxyphosphinic acid (133 mg, 0.4 mmol) in ACN (5 mL) was added NMI (330 mg, 4 mmol) at room temperature under nitrogen atmosphere. Then bis(2-oxo-l,3-oxazolidin-3-yl) phosphinoyl chloride (375 mg, 1.5 mmol) was added at room temperature under nitrogen atmosphere. The mixture was stirred for 3 hours at room temperature. The resulting mixture was filtered; the filter cake was washed with ACN. The filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (DCM/MeOH = 10/1) to afford a crude product. The crude product was purified by Prep-HPLC with the following conditions (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5pm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 45% B in 6.2 min, 45% B; Wave Length: 210/254 nm; RTl(min): 5.26) to afford l-[(2R,5S)-5-[({di[(isopropoxycarbonyl)oxy] methoxyphosphoryl } oxy) methyl]-2,5-dihydrofuran-2-yl]-5-methyl-3H-pyrimidine-2, 4-dione (5.3 mg, 0.01 mmol, 7.38%) as an off-white solid.
[0889] LC-MS (ES, m/z): 537(M+H+), 99.8 % purity. Conditions for the LCMS: (Column: Shim-pack Scepter C18, 33*3.0 mm; Mobile Phase A: water/SmMNELHCO?,, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 20% B to 60% B in 1.70 min, 60% B to 95% B in 0.50 min, 95% B to 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wave Length: 254 nm; RTl(min): 1.206). XH NMR (400 MHz, DMSO-t/6) 8 11.35 (s, 1H), 7.21 (s, 1H), 6.96 - 6.77 (m, 1H), 6.49 - 6.30 (m, 1H), 6.02 (d, J= 5.7 Hz, 1H), 5.59 (dd, J= 13.9, 5.2 Hz, 4H), 4.97 (s, 1H), 4.90 - 4.76 (m, 2H), 4.37 - 4.15 (m, 2H), 1.74 (s, 3H), 1.25 (d, J= 5.6 Hz, 12H).
EXAMPLE 2 - Synthesis of Compound VII-4: 5-chloro-l-((2R,5S)-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidine-2,4(lH,3H)-dione
Figure imgf000210_0001
[0890] Step 1 : To a stirred solution of 5-chloro-2'-deoxyuridine (100 mg, 0.38 mmol) in pyridine (5 mL) was added triphenylmethyl chloride (117 mg, 0.42 mmol). The resulting mixture was stirred for 2h at 100°C and cooled to room temperature. To the above mixture was added methanesulfonyl chloride (131 mg, 1 .14 mmol) at 0°C. The resulting mixture was stirred for additional 2h at room temperature. Desired product could be detected by LCMS. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EAto afford (2R,3S,5R)-5-(5-chloro-2,4-dioxo-3H-pyrimidin-
1-yl)-2-[(triphenylmethoxy)methyl] oxolan-3-yl methanesulfonate (100 mg, 0.17 mmol, 45.05%) as an off-white solid. LC-MS (ES, m/z): 583 [M+H] +.
[0891] Step 2: To a stirred solution of (2R,3S,5R)-5-(5-chloro-2,4-dioxo-3H-pyrimidin-l-yl)-
2-[(triphenylmethoxy)methyl] oxolan-3-yl methanesulfonate (100 mg, 0.17 mmol) in THF (5 mL) was added tetrabutyl azanium fluoride (28 mg, 0.86 mmol). The resulting mixture was stirred overnight at 60°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA to afford 5- chloro-l-[(2R,5S)-5-[(triphenylmethoxy)methyl]-2,5-dihydrofuran-2-yl]-3H-pyrimidine-2,4- dione (50 mg, 0.10 mmol, 59.87%) as a light-yellow solid. LC-MS (ES, m/z): 485 [M-H] '. [0892] Step 3: A solution of 5-chloro-l-[(2R,5S)-5-[(triphenylmethoxy)methyl]-2,5- dihydrofuran-2-yl]-3H-pyrimidine-2, 4-dione (50 mg, 0.10 mmol) in acetic acid (0.80 mL) and water (0.20 mL) was stirred overnight at room temperature. The reaction mixture was concentrated under reduced pressure. The residue was purified by Prep-HPLC with the following conditions (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 pm; Mobile Phase A: Water (10 mmol/L NH4HCO3 + 0.1%NH3.H2O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 20% B in 7 min; Wave Length: 210/254 nm; RTl(min): 5.93) to afford 5-chloro-l- [(2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl]-3H-pyrimidine-2, 4-dione (10.9 mg, 0.04 mmol, 43.00%) as an off-white solid.
[0893] LC-MS (ES, m/z): 243 [M-H] ', 99.1% purity. Conditions for the LCMS: (Column: Shim-pack Scepter 33 mm 3.0 mm; Mobile Phase A: H2O + 5Mm NH4HCO3; Mobile Phase B: ACN; Flow rate: 1.500 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 1.80 min, 95% B to 10% B in 1.82 min; Wave Length: 254 nm; RTl(min): 0.313). 'IT NMR (400 MHz, DMSO-t/e) 8 11.73 (s, 1H), 8.25 (s, 1H), 6.80-6.82 (m, J = 3.3, 1.6 Hz, 1H), 6.39-6.43 (m, 1H), 5.92-5.96 (m, 1H), 5.15 (t, J= 5.1 Hz, 1H), 4.83 (q, J= 2.5 Hz, 1H), 3.64 (t, J= 3.2 Hz, 2H).
EXAMPLE 3 - Synthesis of Compound III-2: Methyl ((4-bromophenoxy)(((2S,5R)-5-(5- chloro-2,4-dioxo-3,4-dihydropyrimidin-l(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000211_0001
[0894] To a stirred mixture of 4-bromophenyl chlorophosphonochloridate (164 mg, 0.57 mmol) in DCM (5 mL) were added methyl D-alanyl ester hydrochloride (68 mg, 0.50 mmol) and TEA (7.5 mg, 0.07 mmol). The resulting mixture was stirred for 2 h at -78°C under nitrogen atmosphere. To the above mixture were added 5-chloro-l-[(2R,5S)-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl]-3H-pyrimidine-2, 4-dione (30 mg, 0.12 mmol) in DCM (5 mL) and TEA (149 mg, 1.48 mmol) successively. The resulting mixture was stirred for additional 12 h at -40 °C under nitrogen atmosphere. The resulting mixture was filtered; the filter cake was washed with DCM. The filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC with the following conditions (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 pm; Mobile Phase A: Water (10 mmol/L NH4HCO3 + 0.1% NH3.H2O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 40% B to 60% B in 6 min; Wave Length: 254/210 nm) to afford methyl (2S)-2-{ [4-bromophenoxy([(2S,5R)-5-(5-chl oro-2, 4-dioxo-3 H-pyrimidin-l-yl)- 2,5-dihydrofuran-2-yl] methoxy) phosphoryl] amino] propanoate (4 mg, 1.44%) as an off-white solid.
[0895] LC-MS (ES, m/z): 564 (M+H+), 99.4% purity. Conditions for the LCMS: (Column: Luna Omega C18, 30 mm, 2.1 mm; Mobile Phase A: Water/0.1% FA; Mobile Phase B: ACN/0.1% FA; Flow rate: 1.2000 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 1.80 min, 100% B to 5.0% B in 1.82 min; Wave Length: 254 nm; RTl(min): 0.680) LH NMR (400 MHz, DMSO-r/r,) 8 10.27 (s, 1H), 7.57 (d, J= 4.4 Hz, 1H), 7.48 (d, J= 8.4 Hz, 2H), 7.06 (dd, J= 11.5, 8.5 Hz, 2H), 6.73 (d, J= 4.5 Hz, 1H), 6.37 (dd, J= 26.7, 6.1 Hz, 1H), 6.08 - 5.92 (m, 2H), 4.97 - 4.93 (m, 1H), 4.10-4.15 (m, 2H), 3.78 - 3.56 (m, 1H), 3.50 (s, 3H), 1.11-1.17 (m, 3H).
EXAMPLE 4 - Synthesis of Compound 1-1: isopropyl ((((2A,5/?)-4-fluoro-5-(5-methyl-2,4- dioxo-3,4-dihydropyrimidin-l(2H)-yI)-2,5-dihydrofuran-2-yl)methoxy)(phenoxy) phosphoryl)-L-alaninate
Figure imgf000212_0001
Compound 1-1 [0896] To a stirred solution of 1-((2R,5S)-3-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran-2- yl)-5-methylpyrimidine-2,4(1H,3H)-dione (80 mg, 330 μmol) in THF (5 mL) was added t- BuMgCl (660 μL, 660 μmol, 1 M in THF) dropwise at 0 °C under an inert atmosphere. The mixture was stirred for 30 min at 0 °C, then isopropyl ((perfluorophenoxy)(phenoxy) phosphoryl)-L-alaninate (180 mg, 397 μmol) in THF (2 mL) was added at 0 °C under an inert atmosphere. The mixture was stirred for 15 h at room temperature, filtered, and the filter cake was washed with MeOH. The residue was purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was purified by Prep-HPLC under the following conditions (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 30% B to 47% B in 10 min; Wavelength: 254/210 nm; RT1(min): 8.6). The product-containing fraction was collected and concentrated under vacuum. The residue was re-dissolved in ACN and H2O, and lyophilized to afford isopropyl ((((2S,5R)-4-fluoro-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) (phenoxy)phosphoryl)-L-alaninate (40.7 mg, 24%) as an off-white solid. LC/MS (ES, m/z): 512 [M+H]+; 99.8% purity. [0897] LC/MS conditions: (Column: Ascentis Express C18, 50*3.0 mm; 2.7 μm; Mobile Phase A: Water/0.05% TFA, Mobile Phase B: ACN/0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 20% B to 50% B in 1.90 min, 50% B to 100% B in 0.10 min, 100% B to 100% B in 0.70 min, 100% B to 5% B in 0.05 min; Wavelength: 254/220 nm; RT1(min): 1.496).1H NMR (400 MHz, DMSO-d6) δ 11.48 (s, 1H), 7.54 – 7.42 (m, 1H), 7.40 – 7.32 (m, 2H), 7.23 – 7.09 (m, 3H), 6.86 – 6.78 (m, 1H), 6.13 – 5.99 (m, 2H), 5.13 – 4.96 (m, 1H), 4.90 – 4.80 (m, 1H), 4.38 – 4.06 (m, 2H), 3.82 – 3.64 (m, 1H), 1.72 (dd, J = 11.4, 1.3 Hz, 3H), 1.25 – 1.08 (m, 9H).
EXAMPLE 5 – Synthesis of Compound I-2: 1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-3-fluoro-2,5-dihydrofuran-2-yl)-5-methyl-3H- pyrimidine-2,4-dione
Figure imgf000214_0001
[0898] To a stirred solution of ((hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (78 mg, 234 μmol) and 1-((2R,5S)-3-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran- 2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (19 mg, 78 μmol) in pyridine (1 mL) was added NMI (96 mg, 1.17 mmol.) This mixture was concentrated under reduced pressure for 20 minutes. The residue was resuspended in ACN (2 mL) and BOP-Cl (109 mg, 430 μmol) was added under an inert atmosphere. The reaction was stirred at room temperature for 3 h. When the reaction was complete, ice water was added and the resulting mixture extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (PE/EA=1:3) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: Sunfire prep C18 column, 30*150 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 26% B to 46% B in 10 min, 46% B; Wavelength: 254/220 nm; RT1(min): 10.1). The product-containing fraction was collected and concentrated under under reduced pressure., The residue was re-dissolved in ACN and H2O, and then lyophilized to afford 1-((2R,5S)-5- (({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-3-fluoro-2,5-dihydrofuran-2- yl)-5-methyl-3H-pyrimidine-2,4-dione (11.9 mg, 27.3%) as an off-white oil. [0899] LC/MS (ES, m/z): 555 [M+H]+; 99.6% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C18, 30*3 mm, 2.7 μm; Mobile Phase A: water/0.05% TFA, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 20% B to 60% B in 1.75 min, 60% B to 100% B in 0.25 min, 100% B to 100% B in 0.65 min; 100% B to 5% B in 0.15 min, Wavelength: 254/220 nm; RT1(min): 1.235).1H NMR (400 MHz, DMSO-d6) δ 11.51 (s, 1H), 7.37 (d, J = 1.6 Hz, 1H), 6.85 – 6.74 (m, 1H), 6.03 (t, J = 1.7 Hz, 1H), 5.76 – 5.48 (m, 4H), 4.99 (s, 1H), 4.88 – 4.75 (m, 2H), 4.24 (dd, J = 6.1, 3.3 Hz, 2H), 1.77 (d, J = 1.3 Hz, 3H), 1.35 – 1.10 (m, 12H). EXAMPLE 6 – Synthesis of Compound I-3: 4-amino-1-((2R,5S)-5-(({di((isopropoxy- carbonyl)oxy) methoxyphosphoryl}oxy)methyl)-3-fluoro-2,5-dihydrofuran-2-yl) pyrimidin- 2-one
Figure imgf000215_0001
[0900] To a stirred solution of ((hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (44 mg, 132 μmol) and 4-amino-1-((2R,5S)-3-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidin-2(1H)-one (10 mg, 44 μmol) in pyridine (1 mL) was added NMI (54 mg, 660 μmol.) This mixture was concentrated under reduced pressure for 20 minutes. The residue was resuspended in ACN (2 mL) and BOP-Cl (62 mg, 242 μmol) was added under an inert atmosphere. The reaction was stirred at room temperature for 3 h. When the reaction was complete, ice water was added and the resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine, and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (PE/EA=1:3) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: Xselect CSH C18 OBD Column 30*150 mm, 5 μm, Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% B to 40% B in 7 min; Wavelength: 254/220 nm; RT1(min): 5.5). The product-containing fraction was collected and concentrated under reduced pressure., The residue was re-dissolved in ACN and H2O, and lyophilized to afford 4-amino-l-((27?,55J-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-3-fluoro-2,5-dihydrofuran-2-yl) pyrimidin-2-one (0.3 mg, 1.1%) as an off-white oil.
LC/MS (ES, m/z): 540 [M+H]+; 93.1% purity. LC/MS conditions: (Column: HALO C18, 30*3.0 mm, 3 pm; Mobile Phase A: Water/0.05% TFA, Mobile Phase B: Acetonitrile/0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 5% B to 95% B in 2.00 min, 95% B to 95% B in 0.60 min, 95% B to 5% B in 0.10 min; Wavelength: 254/220 nm; RTl(min): 1.386).
EXAMPLE 7 - Synthesis of Compound 1-4: 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-l-((21?,51?)-5-(((tert-butyldimethylsilyl)oxy)methyl)-4-fluoro-2,5-dihydrofuran-2-yl) pyrimidin-2(lH)-on
Figure imgf000216_0001
[0901] Step 1 : To a stirred mixture of 4-amino-l-((27?,57?)-4-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidin-2(lH)-one (42 mg, 185 pmol) in pyridine (4 mL) was added TBSC1 (56 mg, 371 pmol) at room temperature under an inert atmosphere. The mixture was stirred for 2 h at 60 °C, cooled to room temperature, and DMTrCl (125 mg, 369 pmol) was added. The mixture was stirred for 2 h at room temperature, then diluted with water and extracted with EtOAc (2 x 100 mL). The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration of the drying agent, the filtrate was concentrated under reduced pressure to afford 4-((bis(4-methoxy phenyl) (phenyl)methyl) amino)- 1 -((27?, 57?)-5-(((tert-butyldimethylsilyl) oxy) methyl)-4-fluoro-2,5-dihydrofuran-2-yl) pyrimidin-2(lH)-one (110 mg, crude) which was used in the next step directly without further purification. LC/MS (ES, m/z): 644 [M+H]+.
[0902] Step 2: To a stirred mixture of 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-l- ((27?,57?)-5-(((tert-butyldimethylsilyl) oxy) methyl)-4-fluoro-2,5-dihydrofuran-2-yl) pyrimidin- 2(lH)-one (110 mg, crude) in MeOH (5 mL) was added NH4F (198 mg, 5.35 mmol) at room temperature under an inert atmosphere. The mixture was stirred for 15 h at 60 °C, then cooled to room temperature, diluted with water and extracted with EtOAc (2 x 100 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with (PE/EtOAc=5: l) to afford 4-((bis(4-methoxy phenyl) (phenyl)methyl) amino)- 1 -((27?, 57?)-4-fluoro-5-(hydroxymethyl)-2, 5 -dihydrofuran -2-yl) pyrimidin-2(lH)-one (90 mg, 95.1%) as a light yellow solid. LC/MS (ES, m/z): 530 [M+H]+.
[0903] Step 3: A mixture of ((hydroxyphosphoiyl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (87 mg, 263 pmol) and 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-l- ((27?,57?)-4-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(lH)-one (35 mg, 66 pmol) was suspended in pyridine (2 mL). The mixture was concentrated under reduced pressure for 20 minutes, then resuspended in THF (6 mL), and BOP-CI (67 mg, 263 pmol), DIEA (68 mg, 581 pmol), and 3-nitro-lH-l,2,4-triazole (30 mg, 263 pmol) were added at 0 °C under an inert2 atmosphere. The mixture was stirred for 16 h at room temperature. When the reaction was complete, ice water was added and the resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (DCM/MeOH=10:1) to afford ((((2R,5R)-5-(4-(bis(4-methoxyphenyl) (phenyl)methylamino)-2-oxopyrimidin-1(2H)-yl)-3-fluoro-2,5-dihydrofuran-2-yl) methoxy) phosphoryl) bis(oxy)bis(methylene) diisopropyl dicarbonate (40 mg, 71.9%) as a light yellow solid. LC/MS (ES, m/z): 842 [M+H]+. [0904] Step 4: To a stirred solution of ((((2R,5R)-5-(4-(bis(4-methoxyphenyl) (phenyl)methylamino)-2-oxopyrimidin-1(2H)-yl)-3-fluoro-2,5-dihydrofuran-2-yl) methoxy) phosphoryl) bis(oxy)bis(methylene) diisopropyl dicarbonate (68 mg, 81 μmol) in water (1 mL) was added AcOH (4 mL) at room temperature under an inert atmosphere. The mixture was stirred for 6 h at room temperature, then concentrated under reduced pressure and purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 54% B in 6 min; Wavelength: 210/254 nm; RT1(min): 5.28). The product- containing fraction was collected and concentrated under reduced pressure., The residue was re- dissolved in ACN and H2O, and lyophilized to afford ((((2R,5R)-5-(4-amino-2-oxopyrimidin- 1(2H)-yl)-3-fluoro-2,5-dihydrofuran-2-yl) methoxy) phosphoryl) bis(oxy)bis(methylene) diisopropyl dicarbonate (9.2 mg, 20.8%) as an off-white solid. [0905] LC/MS (ES, m/z): 540 [M+H]+; 98.7% purity. LC/MS conditions: (Column: Shim- pack Scepter C18, 33*3.0 mm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.793).1H NMR (400 MHz, DMSO-d6) δ 7.50 (d, J = 7.4 Hz, 1H), 7.28 (d, J = 18.3 Hz, 2H), 6.92 (s, 1H), 5.75 – 5.66 (m, 2H), 5.60 (dd, J = 13.8, 1.5 Hz, 4H), 4.96 (s, 1H), 4.86 – 4.72 (m, 2H), 4.22 (s, 2H), 1.25 (dd, J = 6.3, 3.1 Hz, 12H).
EXAMPLE 8 – Synthesis of Compound I-5: 1-((2R,5R)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-4-fluoro-2,5-dihydrofuran-2-yl)-5-methyl-3H- pyrimidine-2,4-dione
Figure imgf000219_0001
[0906] A mixture of ((hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (109 mg, 332 μmol) and 1-((2R,5R)-4-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (20 mg, 83 μmol) was suspended in pyridine (2 mL). The mixture was concentrated under reduced pressure for 20 minutes and the residue was resuspended in THF (5 mL), and BOP-Cl (210 mg, 830 μmol), DIEA (53 mg, 415 μmol) and 3-nitro-1H-1,2,4-triazole (47 mg, 415 μmol) were added at 0 °C under an inert atmosphere. The mixture was stirred for 3 h at room temperature. When the reaction was complete, ice water was added and the resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD 5 μm, 19*250 mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 47% B in 10 min; Wavelength: 220 nm/254 nm; RT1(min): 7.35). The product-containing fraction was collected and concentrated under reduced pressure, the residue was re-dissolved in ACN and H2O, and then lyophilized to afford 1-((2R,5R)-5- (({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-4-fluoro-2,5-dihydrofuran-2- yl)-5-methyl-3H-pyrimidine-2,4-dione (1 mg, 2.4%) as an off-white oil. [0907] LC/MS (ES, m/z): 555 [M+H]+; 98.0% purity. LC/MS conditions: (Column: Luna Omega PS C18, 30*2.1 mm,3 μm; Mobile Phase A: water/0.1% FA, Mobile Phase B: Acetonitrile/0.1% FA; Flow rate: 1.20 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 0.60 min, 100% B to 5% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.747).1H NMR (400 MHz, Methanol-d4) δ 7.50 (d, J = 1.5 Hz, 1H), 7.01 – 6.95 (m, 1H), 5.75 – 5.61 (m, 4H), 5.57 (t, J = 1.8 Hz, 1H), 5.00 – 4.87 (m, 3H), 4.45 – 4.30 (m, 2H), 1.91 (d, J = 1.2 Hz, 3H), 1.32 (dd, J = 6.2, 1.6 Hz, 12H). EXAMPLE 9 – Synthesis of Compound II-2: Methyl ((4-bromophenoxy) (((1R,4S,5S)-4-(5- methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)bicycle[3.1.0]hex-2-en-1-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000220_0001
[0908] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (167 mg, 500 μmol) in DCM (10 mL) was added 4 A molecular sieves and the reaction mixture was cooled to - 78 °C. Methyl L-alaninate hydrochloride (70 mg, 500 μmol) and TEA (76 mg, 700 μmol) were then added at -78 °C under inert atmosphere, and stirred for 2 h at -40 °C under inert atmosphere. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0909] Step 2: To the above mixture was added 1-((1S,2S,5R)-5-(hydroxymethyl) bicycle [3.1.0] hex-3-en-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (25 mg, 107 μmol) and TEA (32 mg, 300 μmol) in DCM (5 mL) at -40 °C under an inert atmosphere, then stirred for 15 h at 0 °C under an inert atmosphere. The mixture was filtered and the filter cake washed with DCM. The filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 25% B to 45% B in 8 min, Wavelength: 254 nm; RT1(min): 7.63). The product-containing fraction was collected and concentrated under reduced pressure and, the residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((4-bromophenoxy) (((1R,4S,5S)-4-(5-methyl-2,4-dioxo- 3,4-dihydropyrimidin-1(2H)-yl) bicycle [3.1.0] hex-2-en-1-yl) methoxy) phosphoryl)-L-alaninate (4.1 mg6.5%) as an off-white solid. [0910] LC/MS (ES, m/z): 554/556 [M+H]+; 99.9% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 2.7 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 60% B in 1.70 min, 60% B to 95% B in 0.60 min, 95% B to 95% B in 0.50 min; Wavelength: 254/220 nm; RT1(min): 1.468).1H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 7.60 – 7.52 (m, 2H), 7.24 – 7.15 (m, 2H), 7.05 (dd, J = 2.3, 1.3 Hz, 1H), 6.48 – 6.35 (m, 1H), 6.18 – 6.05 (m, 1H), 5.45 – 5.35 (m, 1H), 5.31 – 5.25 (m, 1H), 4.65 – 4.42 (m, 1H), 4.08 – 3.94 (m, 1H), 3.91 – 3.76 (m, 1H), 3.59 (s, 3H), 1.86 – 1.75 (m, 1H), 1.66 (dd, J = 6.1, 1.2 Hz, 3H), 1.29 – 1.25 (m, 1H), 1.21 – 1.15 (m, 3H), 0.54 – 0.46 (m, 1H).
EXAMPLE 10 – Synthesis of Compound II-3: 1-((1S,2S,5R)-5-(({di((isopropoxy- carbonyl)oxy)methoxyphosphoryl}oxy)methyl) bicycle[3.1.0] hex-3-en-2-yl)-5-methyl-3H- pyrimidine-2,4-dione
Figure imgf000222_0001
[0911] To a solution of ((hydroxyphosphoryl)bis(oxy))bis(methylene)diisopropyl bis(carbonate) (34 mg, 100 μmol) and 1-((1S,2S,5R)-5-(hydroxymethyl) bicycle [3.1.0] hex-3- en-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (8 mg, 34 μmol) in pyridine (2 mL) was added NMI (42 mg, 500 μmol); the mixture was concentrated under reduced pressure for 20 minutes and the residue was resuspended in ACN (2 mL) and BOP-Cl (48 mg, 200 μmol) was added under an inert atmosphere, followed by stirring at room temperature for 3 h. When the reaction was complete, ice water was added, and the mixtures extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 29% B to 54% B in 7 min; Wavelength: 254 nm; RT1(min): 6.35). The product-containing fraction was collected and concentrated under reduced pressure and, the residues re-dissolved in ACN and H2O, and lyophilized to afford 1- ((1S,2S,5R)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl) bicycle [3.1.0] hex-3-en-2-yl)-5-methyl-3H-pyrimidine-2,4-dione (2.1 mg, 11.7%) as an off-white oil. [0912] LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3 mm, 3 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.908). LC/MS(ES, m/z): 547 [M+H]+; 96.8% purity. 1H NMR (400 MHz, DMSO-d6) δ 11.05 (s, 1H), 6.99 (d, J = 1.4 Hz, 1H), 6.42 (dd, J = 5.5, 1.7 Hz, 1H), 5.67 – 5.54 (m, 4H), 5.46 – 5.41 (m, 1H), 5.33 (t, J = 2.1 Hz, 1H), 4.90 – 4.76 (m, 2H), 4.61 (dd, J = 11.2, 6.1 Hz, 1H), 4.04 (dd, J = 11.2, 7.1 Hz, 1H), 1.84 (dd, J = 8.4, 4.4 Hz, 1H), 1.76 – 1.69 (m, 3H), 1.30 (dd, J = 8.5, 4.3 Hz, 1H), 1.25 (d, J = 6.2 Hz, 12H), 0.53 (t, J = 4.4 Hz, 1H). EXAMPLE 11 – Synthesis of Compound II-6: Methyl ((4-bromophenoxy) (((1R,4R,5S)-4- (5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)bicycle[3.1.0]hex-2-en-1-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000223_0001
[0913] Step 1: To a stirred solution of 4-bromophenyl chlorophosphonochloridate (121 mg, 420 μmol) in DCM (5 mL) was added 4A molecular sieves and the reaction mixture was cooled to -78°C. To the above solution was added methyl L-alaninate hydrochloride (43 mg, 420 μmol) and TEA (86 mg, 600 μmol) at -78 °C under inert atmosphere. The resulting mixture was stirred for 2 h at -40°C under an inert atmosphere. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0914] Step 2: 1-((1S,2R,5R)-5-(hydroxymethyl)bicycle[3.1.0]hex-3-en-2-yl)-5- methylpyrimidine-2,4(1H,3H)-dione (20 mg, 85 μmol) and TEA (25 mg, 1.6 mmol) in DCM (3 mL) were then added at -40 °C under an inert atmosphere, then stirred for 15 h at 0 °C under an inert atmosphere. The reaction mixture was filtered and the filter cake was washed with DCM. The filtrate was then concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was then purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 19*250 mm, 10 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 20% B to 39% B in 2 min, 39% B to 39% B in 7 min; Wavelength: 254 nm; RT1(min): 5.6). The product-containing fraction was collected and concentrated under reduced pressure and the residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((4- bromophenoxy) (((1R,4R,5S)-4-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl) bicycle [3.1.0] hex-2-en-1-yl) methoxy) phosphoryl)-L-alaninate (6.7 mg, 14.2%) as an off-white solid. [0915] LC/MS (ES, m/z): 554/556 [M+H]+; 90.8% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: water/ 5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 60% B in 1.70 min, 60% B to 95% B in 0.60 min, 95% B to 95% B in 0.50 min; 95% B to 10% B in 0.03 min, Wavelength: 254/220 nm; RT1(min): 1.503).1H NMR (400 MHz, Methanol-d4) δ 7.58 – 7.46 (m, 2H), 7.34 (s, 1H), 7.22 – 7.11 (m, 2H), 6.35 – 6.26 (m, 1H), 5.71 – 5.62 (m, 1H), 5.48 (s, 1H), 4.47 – 4.31 (m, 1H), 4.20 – 4.06 (m, 1H), 3.99 – 3.85 (m, 1H), 3.75 – 3.62 (m, 3H), 2.18 – 2.08 (m, 1H), 1.84 (d, J = 3.7 Hz, 3H), 1.42 – 1.20 (m, 4H), 0.79 – 0.71 (m, 1H).
EXAMPLE 12 – Synthesis of Compound III-1: Methyl ((4-bromophenoxy) (((2S,5R)-5-(5- iodo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy) phosphoryl)-L-alaninate O I NH
Figure imgf000225_0001
[0916] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (119 mg, 400 μmol) in DCM (8 mL) was added 4 A molecular sieves and the reaction mixture cooled to -78°C. Methyl L-alaninate hydrochloride (50 mg, 300 μmol) and TEA (54 mg, 500 μmol) were added at -78 °C under an inert atmosphere, and the mixture was stirred for 2 h at -40 °C under an inert atmosphere. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0917] Step 2: 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-iodopyrimidine- 2,4(1H,3H)-dione (30 mg, 89 μmol) and TEA (27 mg, 200 μmol) in DCM (5 mL) were then added at -40 °C under an inert atmosphere, and stirred for 16 h at 0°C, followed by filtration and washing of the filter cake with DCM. The filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: XBridge BEH C18 OBD Prep Column, 19*250 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 32% B to 57% B in 6 min, Wavelength: 254 nm; RT1(min): 5.68). The product-containing fraction was collected and concentrated under reduced pressure. The residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((4- bromophenoxy) (((2S,5R)-5-(5-iodo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5- dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (13.1 mg, 22.3%) as a white solid. [0918] LC/MS (ES, m/z): 654/656 [M-H]-; 99.9% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 2.7 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.81). 1H NMR (400 MHz, DMSO-d6) δ 11.69 (s, 1H), 7.71 (d, J = 6.1 Hz, 1H), 7.58 – 7.50 (m, 2H), 7.20 – 7.15 (m, 2H), 6.82 – 6.74 (m, 1H), 6.48 – 6.38 (m, 1H), 6.12 – 6.01 (m, 2H), 5.03 (s, 1H), 4.27 – 4.00 (m, 2H), 3.95 – 3.69 (m, 1H), 3.58 (d, J = 5.3 Hz, 3H), 1.22 (dd, J = 16.2, 7.1 Hz, 3H). EXAMPLE 13 – Synthesis of Compound III-2: methyl ((4-bromophenoxy) (((2S,5R)-5-(5- chloro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000226_0001
[0919] To a stirred mixture of 4-bromophenyl chlorophosphonochloridate (164 mg, 0.57 mmol) in DCM (5 mL) were added methyl L-alaninate hydrochloride (68 mg, 0.50 mmol) and TEA (7.5 mg, 0.07 mmol), followed by stirring for 2 h at -78°C under an inert atmosphere. 5- chloro-1-[(2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl]-3H-pyrimidine-2,4-dione (30 mg, 0.12 mmol) in DCM (5 mL) and TEA (149 mg, 1.48 mmol) were successively added, followed by stirring for an additional 12 h at -40 °C under an inert atmosphere. The resulting mixture was filtered, the filter cake washed with DCM, then the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3 + 0.1% NH3.H2O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 40% B to 60% B in 6 min; Wavelength: 254/210 nm) to afford methyl (2S)-2-{[4- bromophenoxy([(2S,5R)-5-(5-chloro-2,4-dioxo-3H-pyrimidin-1-yl)-2,5-dihydrofuran-2-yl] methoxy) phosphoryl] amino} propanoate (4 mg, 1.44%) as an off-white solid. [0920] LC/MS (ES, m/z): 563, 565, 567 [M+H] +99.4% purity. LC/MS conditions: (Column: Luna Omega C18, 30 mm, 2.1 mm; Mobile Phase A: Water/0.1% FA; Mobile Phase B: ACN/0.1% FA; Flow rate: 1.2000 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 1.80 min, 100% B to 5.0% B in 1.82 min; Wavelength: 254 nm; RT1(min): 0.680). 1H NMR (400 MHz, DMSO-d6) δ 10.27 (s, 1H), 7.57 (d, J = 4.4 Hz, 1H), 7.48 (d, J = 8.4 Hz, 2H), 7.06 (dd, J = 11.5, 8.5 Hz, 2H), 6.73 (d, J = 4.5 Hz, 1H), 6.37 (dd, J = 26.7, 6.1 Hz, 1H), 6.08 – 5.92 (m, 2H), 4.97 – 4.93 (m, 1H), 4.10-4.15 (m, 2H), 3.78 – 3.56 (m, 1H), 3.50 (s, 3H), 1.11-1.17 (m, 3H). EXAMPLE 14 – Synthesis of Compound III-3: Methyl ((((2S,5R)-5-(4-amino-5-fluoro-2- oxopyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy)(4-bromophenoxy)phosphoryl)-L- alaninate [
Figure imgf000227_0001
09 ] Step : o a st rred so ut on o -bromop eny p osp orod c ordate (37 mg, .2 mmol) in DCM (5 mL) was added 4 A molecular sieves, followed by cooling to -78°C. Methyl L-alaninate hydrochloride (179 mg, 1.2 mmol) and TEA (194 mg, 1.9 mmol) were then added at -78 °C under an inert atmosphere, followed by stirring for 2 h at -40 °C under an inert atmosphere. [0922] Step 2: 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-5-fluoro-1-((2R,5S)-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (150 mg, 283 μmol) and TEA (85 mg, 849 μmol) in DCM (5 mL) were added at -40 °C under an inert atmosphere, followed by stirring for 16 h at 0 °C under an inert atmosphere. The reaction mixture was filtered, the filter cake was washed with DCM. The filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3+0.1% NH3.H2O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min; Wavelength: 254/210 nm; RT1(min): 6.56). The product-containing fraction was collected and concentrated under reduced pressure and, the residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((((2S,5R)-5-(4-amino-5-fluoro-2-oxopyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) (4-bromophenoxy) phosphoryl)-L-alaninate (6.6 mg, 4.2%) as a white solid. [0923] LC/MS (ES, m/z): 547/549 [M+H]+; 99.7% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.716).1H NMR (400 MHz, DMSO-d6) δ 7.84 (s, 1H), 7.66 – 7.46 (m, 4H), 7.14 (dd, J = 16.8, 8.6 Hz, 2H), 6.87 (s, 1H), 6.38 (dd, J = 26.1, 6.0 Hz, 1H), 6.19 – 6.07 (m, 1H), 6.01 (s, 1H), 4.99 (d, J = 17.1 Hz, 1H), 4.30 – 4.09 (m, 2H), 3.89 – 3.69 (m, 1H), 3.58 (d, J = 2.1 Hz, 3H), 1.19 (t, J = 7.3 Hz, 3H). EXAMPLE 15 – Synthesis of Compound III-4 (methyl((R or S)-(4-bromophenoxy) (((2S,5R)-5-(2,4-dioxo-5-(trifluoromethyl)-3,4-dihydropyrimidin-1(2H)-yl)-2,5- dihydrofuran-2-yl)methoxy)phosphoryl)-L-alaninate) and Compound III-5 (methyl((S or R)-(4-bromophenoxy) (((2S,5R)-5-(2,4-dioxo-5-(trifluoromethyl)-3,4-dihydropyrimidin- 1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy)phosphoryl)-L-alaninate):
Figure imgf000228_0001
Figure imgf000229_0001
[0924] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (300 mg, 1.12 mmol) in DCM (10 mL) was added 4 A molecular sieves, followed by cooling to -78 °C. Methyl L-alaninate hydrochloride (139 mg, 1.2 mmol) and TEA (120 mg, 1.2 mmol) were then added at -78 °C under N2 atmosphere, followed by stirring for 2 h at -40 °C under N2 atmosphere. [0925] Step 2: To a stirred solution of 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)- 5-(trifluoromethyl) pyrimidine-2,4(1H,3H)-dione (20 mg, 72 μmol) in DCM (2 mL), at -40 °C under an inert atmosphere was added TEA (43 mg, 400 μmol) , which was armed to 0 °C followed by stirring for 15 h at under an inert atmosphere. The resulting mixture was filtered, the filter cake was washed with DCM, and the filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (SunFire Prep C18 OBD Column, 19*150 mm, 5μm; Mobile Phase A: Water (10 mmol/L NH4HCO3+0.1%NH3.H2O), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min, 70% B; Wavelength: 254 nm; RT1(min): 3.8, RT2(min): 4.05). The first fraction was collected and concentrated under reduced pressure. The residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(2,4-dioxo-5- (trifluoromethyl)-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)- L-alaninate (4.9 mg, 8 μmol, 11.3%) as a white solid. The second fraction was collected and concentrated under reduced pressure. The residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((S or R)-(4-bromophenoxy) (((2S,5R)-5-(2,4-dioxo-5- (trifluoromethyl)-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)- L-alaninate (4.4 mg, 7 μmol, 10%) as a white solid. [0926] Compound III-4 LC/MS: 596/598 [M-H]-.99.2% purity. Conditions for the HPLC: (X‐bridge RP183.5 um, 100*4.6 mm, 2.2 μm; Mobile Phase A: 5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.20 mL/min; Gradient: 10% B to 95% B in 8.00 min, 95% B to 95% B in 2.00 min, 95% B to 10% B in 0.50 min; Wavelength: 254/220 nm; RT1(min): 4.789). [0927] Compound III-41H NMR (400 MHz, DMSO-d6) δ 11.97 (s, 1H), 7.83 (s, 1H), 7.57 – 7.51 (m, 2H), 7.10 – 7.03 (m, 2H), 6.84 – 6.76 (m, 1H), 6.56 – 6.51 (m, 1H), 6.14 – 6.00 (m, 2H), 5.09 (s, 1H), 4.30 – 4.15 (m, 2H), 3.76 – 3.64 (m, 1H), 3.57 (s, 3H), 1.18 (d, J = 7.2 Hz, 3H). [0928] Compound III-5 LC/MS (ES, m/z): 596/598 [M-H]-; 97.9% purity. Conditions for the HPLC: (X‐bridge RP183.5 um, 100*4.6 mm, 2.2 μm; Mobile Phase A: 5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.20 mL/min; Gradient: 10% B to 95% B in 8.00 min, 95% B to 95% B in 2.00 min, 95% B to 10% B in 0.50 min; Wavelength: 254/220 nm; RT1(min): 4.851). [0929] Compound III-51H NMR (400 MHz, DMSO-d6) δ 11.91 (s, 1H), 7.80 (s, 1H), 7.55 (dd, J = 8.9, 1.6 Hz, 2H), 7.12 (d, J = 8.4 Hz, 2H), 6.85 – 6.77 (m, 1H), 6.48 – 6.41 (m, 1H), 6.10 – 5.99 (m, 2H), 5.04 (s, 1H), 4.20 (s, 1H), 4.14 – 4.06 (m, 1H), 3.78 (d, J = 7.4 Hz, 1H), 3.57 (d, J = 1.5 Hz, 3H), 1.21 (d, J = 7.1 Hz, 3H).
EXAMPLE 16 – Synthesis of Compound III-6: methyl ((((2R,5S)-5-(4-amino-5-fluoro-2- oxopyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy)(4-bromophenoxy)phosphoryl)-L- alaninate NH2 O F N O NH2.HCl
Figure imgf000231_0001
[0930] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (146 mg, 500 μmol) in DCM (3 mL) was added 4 A molecular sieves and the reaction mixture was cooled to - 78°C, followed by addition of methyl L-alaninate hydrochloride (52 mg, 500 μmol) and TEA (76 mg, 800 μmol) at -78 °C under an inert atmosphere. The solution was warmed to -40 °C while stirring was continued for 2 additional hours at under an inert atmosphere. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0931] Step 2: 4-Amino-5-fluoro-1-((2S,5R)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (40 mg, 176 μmol) and TEA (50 mg, 2.1 mmol) in DCM (5 mL) were added at -40 °C under inert atmosphere. The mixture was then warmed to 0 °C and allowed to stir for an additional 15 h under an inert atmosphere. The reaction mixture was filtered, the filter cake was washed with DCM and the filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 19*250 mm, 10 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 20% B to 39% B in 2 min, 39% B to 39% B in 7 min; Wavelength: 254 nm; RT1(min): 5.60). The product-containing fraction was collected and concentrated under reduced pressure, the residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((((2R,5S)-5-(4-amino-5-fluoro-2-oxopyrimidin-1(2H)-yl)-2,5- dihydrofuran-2-yl) methoxy) (4-bromophenoxy) phosphoryl)-L-alaninate (1.1 mg, 1.1%) as a yellow semi-solid. [0932] LC/MS (ES, m/z): 547/549 [M+H]+; 99.5% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 10% B in 0.01 min, 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.719).1H NMR (400 MHz, DMSO-d6) δ 7.85 (s, 1H), 7.60 (s, 1H), 7.63 – 7.55 (m, 1H), 7.58 – 7.47 (m, 2H), 7.17 – 7.09 (m, 2H), 6.89 – 6.84 (m, 1H), 6.41 – 6.35 (m, 1H), 6.19 (dd, J = 14.2, 10.0 Hz, 1H), 6.11 – 5.93 (m, 1H), 4.98 (d, J = 11.9 Hz, 1H), 4.25 – 4.07 (m, 2H), 3.83 – 3.64 (m, 1H), 3.55 (d, J = 14.1 Hz, 3H), 1.18 (dd, J = 7.2, 3.2 Hz, 3H). EXAMPLE 17 – Synthesis of Compound III-7: 4-amino-1-((2R,5S)-5-(({di((isopropoxy- carbonyl)oxy)methoxyphosphoryl}oxy)methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin- 2-one O O F F O NH NH N F
Figure imgf000232_0001
O O O O O P OH NHDMTr F O
Figure imgf000233_0001
o pou - [0933] Step 1: A solution of 5-fluoro-1-((2R,4S,5R)-4-hydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (5 g, 20.3 mmol) and TrtCl (6.2 g, 22.3 mmol) in pyridine (50 mL) was stirred for 2 h at 100 °C under an inert atmosphere. The reaction was then cooled to room temperature, followed by addition of MsCl (3.4 g, 30.4 mmol) dropwise at room temperature, and stirring for an additional 1 h at room temperature. The mixture was diluted with water and extracted with EtOAc (3 x 200 mL). The combined organic layers were washed with brine, and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then purified by silica gel column chromatography, eluting with (PE/EtOAc = 1:1) to afford (2R,3S,5R)-5-(5-fluoro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (3.5 g, 30.4%) as a white solid. LC/MS (ES, m/z): 567 [M+H]+. [0934] Step 2: A solution of (2R,3S,5R)-5-(5-fluoro-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (3.5 g, 6.1 mmol) and NaOH (271 mg, 6.7 mmol) in EtOH (30 mL) and H2O (10 mL) was stirred for 2 h at 100 °C under an inert atmosphere, then cooled to room temperature. The mixture was diluted with water and extracted with EtOAc (3 x 200 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with (PE/EtOAc = 1:2) to afford (3R,5R)-8-fluoro-3-((trityloxy)methyl)-2,3-dihydro-5H,9H-2,5- methanopyrimido[2,1-b] [1,5,3] dioxazepin-9-one (2.6 g, 89.4%) as a white solid. LC/MS (ES, m/z): 471 [M+H]+. [0935] Step 3: A solution of (3R,5R)-8-fluoro-3-((trityloxy)methyl)-2,3-dihydro-5H,9H-2,5- methanopyrimido[2,1-b] [1,5,3] dioxazepin-9-one (2.6 g, 5.5 mmol) in TBAF (6.6 mL, 6.6 mmol, 1 M in THF) was stirred for 2 h at 60 °C under an inert atmosphere, then cooled to room temperature, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with (DCM/MeOH=20:1) to afford 5-fluoro-1-((2R,5S)-5- ((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (1.5 g, , 57.7%) as a white solid. LC/MS (ES, m/z): 469 [M-H]-. [0936] Step 4: A solution of 5-fluoro-1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (1.5 g, 3.1 mmol) in AcOH (20 mL) and H2O (5 mL) was stirred for 4 h at room temperature under N2 atmosphere, then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with (DCM/MeOH=15:1) to afford 5-fluoro-1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)- dione (630 mg, 86.6%) as a white solid. LC/MS (ES, m/z): 229 [M+H]+. [0937] Step 5: To a stirred solution of 5-fluoro-1-((2R,5S)-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (630 mg, 2.7 mmol) and imidazole (563 mg, 8.2 mmol) in DMF (10 mL) was added TBS-Cl (624 mg, 4.1 mmol) at room temperature under an inert atmosphere. The resulting solution was stirred for 16 h at 60 °C under an inert atmosphere, then cooled to room temperature, followed by dilution with water and extraction with EtOAc (3 x 80 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by Prep-TLC (PE/ EtOAc = 1:3) to afford 1-((2R,5S)-5-(((tert- butyldimethylsilyl) oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidine-2,4(1H,3H)-dione (700 mg, 74%) as a white solid. LC/MS (ES, m/z): 343 [M+H]+. [0938] Step 6: A solution of 1-((2R,5S)-5-(((tert-butyldimethylsilyl) oxy) methyl)-2,5- dihydrofuran-2-yl)-5-fluoropyrimidine-2,4(1H,3H)-dione (700 mg, 2 mmol), DMAP (499 mg, 4 mmol) and TEA (413 mg, 4 mmol) in ACN (10 mL) was treated with TIPS-Cl (1.2 g, 4 mmol) for 16 h at room temperature under N2 atmosphere followed by the addition of conc. NH3-H2O (143 mg, 4 mmol) dropwise at room temperature. Upon complete addition stirring was continued for 2 h at room temperature under an inert atmosphere. Upon completion of the reaction as judged by LC/MS, the reaction was diluted with water and the mixture was extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and purification by Prep-TLC (PE/EtOAc = 1:3) to afford 4-amino-1-((2R,5S)-5-(((tert- butyldimethylsilyl) oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2(1H)-one (440 mg, 63%) as a white solid. LC/MS (ES, m/z): 342 [M+H]+. [0939] Step 7: A solution of 4-amino-1-((2R,5S)-5-(((tert-butyldimethylsilyl) oxy) methyl)- 2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2(1H)-one (440 mg, 1.2 mmol) and DMTrCl (873 mg, 2.5 mmol) in pyridine (5 mL) was stirred for 16 h at 60 °C under an inert atmosphere followed by cooling to room temperature. The mixture was concentrated under reduced pressure and purified by Prep-TLC (PE/ EtOAc = 2:1) to afford 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-1-((2R,5S)-5-(((tert-butyldimethylsilyl) oxy) methyl)-2,5-dihydrofuran-2-yl)-5- fluoropyrimidin-2(1H)-one (230 mg, 27.7%) as a yellow solid. LC/MS (ES, m/z): 644 [M+H]+. [0940] Step 8: A solution of 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-1-((2R,5S)-5- (((tert-butyldimethylsilyl) oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2(1H)-one (230 mg, 357 μmol) and TBAF (400 μL, 400 μmol, 1 M in THF) in THF (5 mL) was stirred for 16 h at room temperature under an inert atmosphere, then concentrated under reduced pressure. The residue was purified by Prep-TLC (DCM/MeOH=20:1) to afford 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-5-fluoro-1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (120 mg, 63.4%) as a yellow solid. LC/MS (ES, m/z): 530 [M+H]+. [0941] Step 9: ((Hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (149 mg, 454 μmol) and 4-((bis(4-methoxyphenyl) (phenyl)methyl) amino)-5-fluoro-1-((2R,5S)- 5-(hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidin-2(1H)-one (120 mg, 227 μmol) were suspended in pyridine (5 mL). The mixture was evaporated to a residue under reduced pressure. The residue was resuspended in THF (10 mL), and BOP-Cl (115 mg, 454 μmol) and DIEA (117 mg, 908 μmol), 3-nitro-1H-1,2,4-triazole (51 mg, 454 μmol) were added sequentially at 0 °C under an inert atmosphere, followed by warming to rt and stirring for 16 h. When the reaction was complete, ice water was added to quench the reaction. The resulting mixture was extracted with EtOAC (3 x 50 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then was purified by Prep-TLC (DCM/MeOH=20:1) to afford 4-{(bis(4-methoxyphenyl) (phenyl)methyl) amino}-1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2-one (150 mg, 78.6%) as a yellow solid. LC/MS (ES, m/z): 842 [M+H]+. [0942] Step 10: A solution of 4-{(bis(4-methoxyphenyl) (phenyl)methyl) amino}-1-((2R,5S)- 5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2,5-dihydrofuran-2-yl)-5- fluoropyrimidin-2-one (140 mg, 166 μmol) in AcOH (3.2 mL) and H2O (0.8 mL) was stirred for 2 h at room temperature under an inert atmosphere. The reaction mixture was then concentrated under reduced pressure and purified via Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 50% B to 70% B in 6.35 min; Wavelength: 254/210 nm; RT1(min): 6.35). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and then lyophilized to afford Compound III-7, 4-amino-1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2,5-dihydrofuran-2-yl)-5-fluoropyrimidin-2-one (53.7 mg, 59.7%) as a white solid. [0943] LC/MS (ES, m/z): 540 [M+H]+; 99.7% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C18, 33*3.0 mm, 3 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 55% B in 1.70 min, 55% B to 95% B in 0.60 min, 95% B to 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.366).1H NMR (400 MHz, DMSO-d6) δ 7.85 (s, 1H), 7.59 (s, 1H), 7.47 (d, J = 6.7 Hz, 1H), 6.82 – 6.75(m, 1H), 6.40 – 6.25 (m, 1H), 6.05 – 5.98 (m, 1H), 5.63 – 5.52 (m, 4H), 5.01 – 4.92 (m, 1H), 4.88 – 4.78 (m, 2H), 4.22 (dd, J = 6.5, 3.4 Hz, 2H), 1.24 (dd, J = 6.3, 2.5 Hz, 12H). EXAMPLE 18 – Synthesis of Compound III-8: ((((2S,5R)-5-(5-Ethyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy)phosphoryl)bis(oxy)bis- (methylene) diisopropyl dicarbonate [094
Figure imgf000237_0001
bis(carbonate) (208 mg, 630 μmol) and 5-ethyl-1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran- 2-yl) pyrimidine-2,4(1H,3H)-dione (50 mg, 210 μmol) in pyridine (2 mL) was added NMI (258 mg, 3.15 mmol). The mixture was evaporated to dryness under reduced pressure for 20 minutes, and the residue was resuspended in ACN (5 mL), followed by addition of BOP-Cl (268 mg, 1.1 mmol) under N2 atmosphere. The reaction was stirred at room temperature for 3 h. When the reaction was complete, ice water was added to quench. The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (PE/EA=1:3) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 29% B to 54% B in 7 min, 54% B; Wavelength: 254 nm; RT1(min): 6). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and then was lyophilized to afford ((((2S,5R)-5- (5-ethyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl) bis(oxy)bis(methylene) diisopropyl dicarbonate (22.6 mg, 19.6%) as a light yellow solid. [0945] LC/MS (ES, m/z): 551 [M+H]+; 99.7% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C18, 33*3.0 mm; Mobile Phase A: water/ 5mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.890).1H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 7.15 (s, 1H), 6.89 – 6.81 (m, 1H), 6.45 – 6.37 (m, 1H), 6.11 – 5.98 (m, 1H), 5.59 (dd, J = 13.8, 2.6 Hz, 4H), 4.98 (s, 1H), 4.90 – 4.77 (m, 2H), 4.30 – 4.18 (m, 2H), 2.30 – 2.14 (m, 2H), 1.38 – 1.19 (m, 12H), 0.99 (t, J = 7.4 Hz, 3H). EXAMPLE 19 – Synthesis of Compound III-9: 1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl}oxy)methyl)-2,5-dihydrofuran-2-yl)-5-ethenyl-3H-pyrimidine-2,4- dione
Figure imgf000238_0001
[0946] To a solution of ((hydroxyphosphoryl)bis(oxy)) bis(methylene) diisopropyl bis(carbonate) (223 mg, 670 μmol) and 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5- vinylpyrimidine-2,4(1H,3H)-dione (40 mg, 169 μmol) in pyridine (2 mL) was added NMI (278 mg, 3.38 mmol) followed by concentration under reduced pressure for 20 minutes. The remaining residue was resuspended in ACN (5 mL), and BOP-Cl (318 mg, 1.25 mmol) was added under N2 atmosphere. The reaction was stirred at room temperature for 3 h. When the reaction was complete, ice water was added to quench. The resulting mixture was extracted with EtOAC (3 x 10 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then purified by Prep-TLC (PE/EA=1:3) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: XSelect CSH Prep C18 OBD Column, 19*250 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 43% B to 48% B in 8 min; Wavelength: 254 nm; RT1(min): 8). The product-containing fraction was collected and concentrated under vacuum. The residue was re-dissolved in ACN and H2O, and was then lyophilized to afford 1-((2R,5S)-5- (({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2,5-dihydrofuran-2-yl)-5- ethenyl-3H-pyrimidine-2,4-dione (4.6 mg, 4.7%) as an off-white solid. [0947] LC/MS (ES, m/z): 549 [M+H]+; 97.4% purity. LC/MS conditions: (Column: Shim- pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 10% B in 0.01 min, 10% B to 95% B in 1.00 min, 95% B to 95% B in 0.40 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.801).1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 7.41 (s, 1H), 6.88 – 6.83 (m, 1H), 6.42 (d, J = 5.8 Hz, 1H), 6.43 – 6.29 (m, 1H), 6.09 – 5.99 (m, 2H), 5.63 – 5.54 (m, 4H), 5.15 – 5.07 (m, 1H), 5.00 (s, 1H), 4.88 – 4.75 (m, 2H), 4.25 (dd, J = 6.7, 3.9 Hz, 2H), 1.25 (dd, J = 6.3, 2.7 Hz, 12H). EXAMPLE 20 – Synthesis of Compound VI-1: 1-((2R,5S)-5-(Hydroxymethyl)-2,5- dihydrofuran-2-yl)-5-vinylpyrimidine-2,4(1H,3H)-dione
Figure imgf000239_0001
[0948] Step 1: To a stirred solution of 1-((2R,4S,5R)-4-hydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl)-5-iodopyrimidine-2,4(1H,3H)-dione (650 mg, 1.83 mmol) in pyridine (10 mL) was added BzCl (1 g, 7.34 mmol) under an inert atmosphere, followed by stirring for 12 h at room temperature. The resulting mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with (PE/EtOAc = 4:1) to afford 1-((2R,4S,5R)-4-(benzoyloxy)-5-((benzoyloxy)methyl) tetrahydrofuran-2-yl)-5-iodo-2- oxo-1,2-dihydropyrimidin-4-yl benzoate (1.1 g, 94%) as an off-white semi-solid. LC/MS (ES, m/z): 667 [M+H]+. [0949] Step 2: To a stirred solution of 1-((2R,4S,5R)-4-(benzoyloxy)-5-((benzoyloxy)methyl) tetrahydrofuran-2-yl)-5-iodo-2-oxo-1,2-dihydropyrimidin-4-yl benzoate (1.1 g, 1.72 mmol) in NMP (15 mL) were added tris(furan-2-yl) phosphane (160 mg, 690 μmol), Pd2(dba)3 (160 mg, 100 μmol) and tributyl(vinyl)stannane (820 mg, 2.58 mmol) under inert atmosphere, followed by stirring for 12 h at rt. Upon completion of the reaction as judged by LC/MS analysis, the mixture was diluted with water and extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then purified by silica gel column chromatography, eluting with (PE/EtOAc=3:1) to afford (2R,3S,5R)-5-(4-(benzoyloxy)-2-oxo-5-vinylpyrimidin-1(2H)- yl)-2-((benzoyloxy)methyl) tetrahydrofuran-3-yl benzoate (860 mg, 87.9%) as a dark green semi-solid. LC/MS (ES, m/z): 567 [M+H]+. [0950] Step 3: To a solution of NH3 (g) in MeOH (8 mL, 7 M) was added (2R,3S,5R)-5-(4- (benzoyloxy)-2-oxo-5-vinylpyrimidin-1(2H)-yl)-2-((benzoyloxy)methyl) tetrahydrofuran-3-yl benzoate (860 mg, 1.51 mmol), followed by stirring for 15 hours at room temperature under an inert atmosphere. The mixture was concentrated under reduced pressure, then purified by reverse-phase flash chromatography with the following conditions: column, C18 silica gel; mobile phase, ACN in Water (10 mmol/L NH4HCO3), 0% to 100% gradient in 20 min; detector, UV at 254 nm. 1-((2R,4S,5R)-4-hydrox y-5-(hydroxymethyl) tetrahydrofuran-2-yl)-5- vinylpyrimidine-2,4(1H,3H)-dione (320 mg, 82.9%) was isolated as a light yellow semi-solid following chromatography. LC/MS (ES, m/z): 255 [M+H]+. [0951] Step 4: To a stirred solution of 1-((2R,4S,5R)-4-hydroxy-5-(hydroxymethyl) tetrahydrofuran-2-yl)-5-vinylpyrimidine-2,4(1H,3H)-dione (320 mg, 1.25 mmol) in pyridine (5 mL) was added TrtCl (385 mg, 1.38 mmol) under an inert atmosphere, followed by stirring for 2 h at 110 °C under N2 atmosphere, and subsequent cooling to rt. MsCl (288 mg, 2.51 mmol) was added dropwise at room temperature, and stirred for an additional 2 h at rt followed by concentration under reduced pressure. The residue was purified by silica gel column chromatography, eluting with (PE/EtOAc=2:1) to afford (2R,3S,5R)-5-(2,4-dioxo-5-vinyl-3,4- dihydropyrimidin-1(2H)-yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (362 mg, 50.1%) as a light yellow semi-solid. LC/MS (ES, m/z): 575 [M+H]+. [0952] Step 5: A solution of (2R,3S,5R)-5-(2,4-dioxo-5-vinyl-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (362 mg, 630 μmol) in TBAF (5 mL, 5 mmol, 1 M in THF) was heated to 60 °C for 12 h at under an inert atmosphere, then cooled to rt. The mixture was concentrated and purified by silica gel column chromatography, eluting with (PE/EA=1:1) to afford 1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl)-5- vinylpyrimidine-2,4(1H,3H)-dione (190 mg, 62.4%) as a light yellow semi-solid. LC/MS (ES, m/z): 477 [M-H]-. [0953] Step 6: A solution of 1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl)-5- vinylpyrimidine-2,4(1H,3H)-dione (190 mg, 397 μmol) in AcOH (4 mL) and H2O (1 mL) was stirred for 3 h at rt, then concentrated under reduced pressure and purified by Prep-HPLC under the following conditions: (Column: XBridge Shield RP18 OBD Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% B to 18% B in 9 min; Wavelength: 254/210 nm; RT1(min): 7.21). The product- containing fraction was collected and concentrated under reduced pressure at which point the residue was re-dissolved in ACN and H2O. The solution was lyophilized to afford Compound VI-1, 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-vinylpyrimidine-2,4(1H,3H)- dione (14.1 mg, 15.1%) as an off-white solid. [0954] LC/MS (ES, m/z): 235 [M-H]-; 95.9% purity. LC/MS conditions: (Column: Luna Omega PS C18, 30*2.1 mm, 3.0 μm; Mobile Phase A: Water/0.1% FA, Mobile Phase B: ACN/0.1% FA; Flow rate: 1.20 mL/min; Gradient: 5% B to 100% B in 1.20 min, 100% B to 100% B in 0.60 min, 100% B to 5% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.361). 1H NMR (400 MHz, DMSO-d6) δ 11.42 (s, 1H), 8.10 (s, 1H), 6.84 – 6.88 (m, 1H), 6.40 – 6.45 (m, 1H), 6.33 (dd, J = 17.7, 11.4 Hz, 1H), 5.91 – 5.99 (m, 1H), 5.84 (dd, J = 17.6, 2.0 Hz, 1H), 5.15 – 5.06 (m, 2H), 4.83 (t, J = 3.6 Hz, 1H), 3.68 – 3.62 (m, 2H). EXAMPLE 21 – Synthesis of Compound VII-17: diisopropyl ((((2S,5R)-5-(5-methyl-2,4- dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy)phosphoryl) bis(oxy)bis(methylene)dicarbonate [0955
Figure imgf000242_0001
2,4(1H,3H)-dione (30 mg, 134 μmol), ((hydroxyphosphoryl)bis(oxy))bis(methylene)diisopropyl bis(carbonate) (133 mg, 403 μmol) and NMI (330 mg, 4.02 mmol) were suspended in pyridine (5 mL). The mixture was evaporated to a residue by under reduced pressure for 20 min. The residue was resuspended in ACN (5 mL), and BOP-Cl (375 mg, 1.47 mmol) was added at rt under N2 atmosphere, followed by additional stirring for 3 h at rt. The resulting mixture was filtered, the filter cake was washed with ACN, and the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was then purified by Prep-HPLC under the following conditions: (Column: SunFire Prep C18 OBD Column, 19*150 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 35% B to 45% B in 6.2 min, 45% B; Wavelength: 210/254 nm; RT1(min): 5.26). The product-containing fraction was collected and concentrated under reduced pressure. The subsequent residue was re-dissolved in ACN and H2O, and lyophilized to afford di-isopropyl ((((2S,5R)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy)phosphoryl) bis(oxy)bis(methylene)dicarbonate (5.3 mg, 7.4%) as an off-white solid. [0956] LC/MS (ES, m/z): 537 [M+H]+; 99.8 % purity. LC/MS conditions: (Column: Shim- pack Scepter C18, 33*3.0 mm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 20% B to 60% B in 1.70 min, 60% B to 95% B in 0.50 min, 95% B to 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wavelength: 254 nm; RT1(min): 1.206).1H NMR (400 MHz, DMSO-d6) δ 11.35 (s, 1H), 7.21 (s, 1H), 6.96 – 6.77 (m, 1H), 6.49 – 6.30 (m, 1H), 6.02 (d, J = 5.7 Hz, 1H), 5.59 (dd, J = 13.9, 5.2 Hz, 4H), 4.97 (s, 1H), 4.90 – 4.76 (m, 2H), 4.37 – 4.15 (m, 2H), 1.74 (s, 3H), 1.25 (d, J = 5.6 Hz, 12H). EXAMPLE 22 – Synthesis of Compound VII-18: ((di((isopropoxycarbonyl)oxy)methoxy- phosphoryl)oxy)methyl)-2,5-dihydrofuran-2-yl)-5-methyl-3H-pyrimidine-2,4-dione) O O OH BzCl, pyridine OBz O O Ac 2 O, AcOH, H 2 SO 4 AcO O OBz step 1 step 2
Figure imgf000243_0001
[0957] Step 1: To a stirred solution of (3aS,5S,6R,6aS)-5-(hydroxymethyl)-2,2- dimethyltetrahydrofuro[2,3-d][1,3]dioxol-6-ol (30.0 g, 158 mmol) in anhydrous pyridine (207 mL) at 0 °C was added dropwise benzoyl chloride (62.0 mL). The mixture was stirred for 12 h at rt. After which point, the solvent was removed under reduced pressure and the residue was diluted with water (300 mL) and extracted with EtOAc (2x300 mL.) The combined organic layers were washed with saturated NaHCO3 (2 x 300 mL) dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with PE / EA (84:16). The collected fraction was concentrated under vacuum to afford ((3aS,5S,6R,6aS)-6-(benzoyloxy)-2,2-dimethyl- tetrahydrofuro[2,3-d][1,3]dioxol-5-yl)methyl benzoate (56.0 g, 89%) as a light yellow oil. [0958] Step 2: Conc. H2SO4 (18.6 mL, 348 mmol) was added dropwise to a stirred solution of ((3aS,5S,6R,6aS)-6-(benzoyloxy)-2,2-dimethyltetrahydrofuro[2,3-d][1,3]dioxol-5-yl)methyl benzoate (53.0 g, 133 mmol) in AcOH (500 mL) and Ac2O (185 mL). After stirring for 12 h at rt, the mixture was poured into ice water (500 mL) and extracted with CHCl3 (2 x 300 mL). The combined organic layers were washed with saturated NaHCO3 (2x 300mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography and eluted with PE/EtOAc (3:2) to afford (2S,3S,4R,5S)-4-(benzoyloxy)-5-((benzoyloxy)methyl) tetrahydrofuran-2,3-diyl diacetate (39.0 g, 66%) as a light yellow oil. LC/MS (ES): m/z 383 [M-OAc] +. [0959] Step 3: 5-Methylpyrimidine-2,4(1H,3H)-dione (20.0 g, 158 mmol) and (NH4)2SO4 (3.00 g, 23.8 mmol) were stirred in HMDS (857 mL) at 130 °C under an inert atmosphere until homogeneous, then cooled to room temperature and concentrated under reduced pressure to afford 5-methyl-2,4-bis((trimethylsilyl)oxy)pyrimidine (25.6 g, 59%) as an off-white crude semi- solid. [0960] Step 4: A solution of (2S,3S,4R,5S)-4-(benzoyloxy)-5-((benzoyloxy)methyl)tetra- hydrofuran-2,3-diyl diacetate (28.0 g, 63.2 mmol) in anhydrous DCE (224 mL) was added to 5- methyl-2,4-bis((trimethylsilyl)oxy)pyrimidine (23.0 g, 86.0 mmol), followed by the dropwise addition of trimethylsilyl triflate (37.3 mL, 206 mmol). The resulting solution was stirred overnight at 80 ℃ under an inert atmosphere, then cooled to rt, quenched with saturated NaHCO3 (100 mL), and extracted with CH2Cl2 (2 x 200 mL). The combined organic layers were washed with saturated NaHCO3 (2 x 100mL) and brine (2 x 100 mL) and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with DCM/EtOAc (2:1) to afford (2S,3R,4S,5S)-4-acetoxy-2-((benzoyloxy)methyl)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)tetrahydrofuran-3-yl benzoate (16.5 g, 51%) as an off-white solid. LC/MS (ES): m/z 509 [M+H]+. [0961] Step 5: (2S,3R,4S,5S)-4-Acetoxy-2-((benzoyloxy)methyl)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)tetrahydrofuran-3-yl benzoate (10.5 g, 20.6 mmol) was added to AcOH (21.0 mL) and pyridine (84.0 mL) at 0 °C under N2 followed by the addition of NH2NH2 .H2O (6.50 g, 103 mmol, 80%) dropwise, then stirred for 12 h at rt under an inert atmosphere. The mixture was diluted with water, and the aqueous layer was extracted with EtOAc. The combined organic layers were washed with saturated NaHCO3 and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with DCM/EtOAc (1:1) to afford ((2S,3S,4S,5S)-3-(benzoyloxy)-4-hydroxy-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (8.60 g, 89%) as a white solid. LC/MS (ES): m/z 467 [M+H]+. [0962] Step 6a: A mixture of ((2S,3S,4S,5S)-3-(benzoyloxy)-4-hydroxy-5-(5-methyl-2,4- dioxo-3,4-dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (8.60 g, 18.4 mmol), O-phenylchlorothionoformate (6.40 g, 36.8 mmol) and DMAP (9.00 g, 73.7 mmol) in ACN (170 mL) was stirred for 20 min at rt. The solvent was removed under reduced pressure and the residue was extracted with EtOAc. The combined organic layers were washed with ice-cold 1% AcOH in saturated NaCl and saturated NaHCO3, and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with PE/EtOAc (1:1) to afford ((2S,3R,4S,5S)-3- (benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-4-((phenoxy- carbonothioyl)oxy)tetrahydrofuran-2-yl)methyl benzoate (7.00 g, 63%) as a white solid. [0963] Step 6b: A solution of ((2S,3R,4S,5S)-3-(benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-4-((phenoxycarbonothioyl)oxy)tetrahydrofuran-2-yl)methyl benzoate (7.00 g, 11.6 mmol), n-Bu3SnH (5.40 g, 18.5 mmol,) and AIBN (763 mg, 4.60 mmol) in dry toluene (70.0 mL) was heated and stirred for 12 h at 80 °C under an inert atmosphere. The resulting mixture was cooled to room temperature and concentrated under reduced pressure. At which point, the residue was purified by silica gel column chromatography, eluting with DCM/EtOAc (3:2) to afford ((2S,3S,5S)-3-(benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (4.50 g, 86%) as a white solid. LC/MS (ES): m/z 451 [M+H]+. [0964] Step 7: A mixture of ((2S,3S,5S)-3-(benzoyloxy)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)tetrahydrofuran-2-yl)methyl benzoate (3.70 g, 8.20 mmol) and NaOH (657 mg, 16.4 mmol) in MeOH (90.0 mL) was stirred for 30 min at rt, then concentrated under reduced pressure to remove solvent. The residue was purified by silica gel column chromatography, eluting with DCM/MeOH (10:1) to afford 1-((2S,4S,5S)-4-hydroxy-5- (hydroxymethyl)tetrahydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (1.00 g, 50%) as a light yellow solid. LC/MS (ES): m/z 243 [M+H]+. [0965] Step 8: A mixture of 1-((2S,4S,5S)-4-hydroxy-5-(hydroxymethyl)tetrahydrofuran-2- yl)-5-methylpyrimidine-2,4(1H,3H)-dione (1.00 g, 4.11 mmol) and Trt-Cl (1.38 g, 4.90 mmol) in pyridine (6.50 mL) was stirred at 100 °C under N2 until the dione was consumed completely, and the mixture was then cooled to 0 °C. MsCl (3.00 mL) was added, and the mixture was stirred at room temperature under an inert atmosphere until complete conversion was observed. The resulting mixture was concentrated under reduced pressure and diluted with water, then extracted with EtOAc. The combined organic layers were washed with citric acid and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with PE/EtOAc (1:4) to afford (2S,3S,5S)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (1.50 g, 64%) as a white solid. LC/MS (ES): m/z 561 [M-H]-. [0966] Step 9: A solution of (2S,3S,5S)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl)tetrahydrofuran-3-yl methanesulfonate (1.30 g, 2.30 mmol) in TBAF (90.0 mL, 90.0 mmol, 1.0 M in THF) was stirred for 12 h at 60 °C, then cooled to rt and concentrated under reduced pressure. The residue was purified via reverse phase chromatography under the following conditions (Column: C18 silica gel; Mobile phase A: water (containing 6 mmol/L NH4HCO3) and B: ACN; Gradient: 0% to 100% B in 30 min; Detector: 254/220 nm). The desired fraction was collected and concentrated under reduced pressure to afford 5-methyl-1-((2S,5R)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl)pyrimidine-2,4(1H,3H)- dione (800 mg, 74%) as a yellow oil. LC/MS (ES): m/z 465 [M-H]-. [0967] Step 10: 5-Methyl-1-((2S,5R)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (100 mg, 214 μmol) in AcOH (1.50 mL, 80% in H2O) was stirred for 12 h at rt, then concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM/MeOH (20:1) to afford 1-((2S,5R)-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (40 mg, 83%) as a white solid. LC/MS (ES): m/z 449 [2M+H]+.1H NMR (400 MHz, DMSO-d6) δ 11.27 (s, 1H), 7.64 (d, J = 1.2 Hz, 1H), 6.83 – 6.81 (m, 1H), 6.40 – 6.38 (m, 1H), 5.92 – 5.90 (m, 1H), 5.02 (t, J = 5.2 Hz, 1H), 4.78 - 4.76 (m, 1H), 3.61 - 3.59 (m, 2H), 1.73 (d, J = 0.8 Hz, 3H). [0968] Step 11: 1-((2S,5R)-5-(Hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-methylpyrimidine- 2,4(1H,3H)-dione (30 mg, 134 μmol), ((hydroxyphosphoryl)bis(oxy))bis(methylene) di- isopropyl bis(carbonate) TEA salt (132 mg, 307 μmol) and NMI (329 mg, 4.00 mmol) were dissolved in pyridine (0.50 mL), then concentrated under reduced pressure. This process was repeated three times. The residue was dissolved in anhydrous ACN (2.00 mL) and degassed three times with N2. A solution of BOP-Cl (374 mg, 1.5 mmol) in 11 mL THF was then added. After stirring for 3 h at rt, the resulting mixture was extracted with EtOAc (2 x 10 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-HPLC under the following conditions: (Column: XSelect CSH Prep C18 OBD Column, 19x250 mm, 5 μm; Mobile Phase A: water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 38% B to 43% B in 8 min, 43% B; Wavelength: 254 nm; RT1(min): 7). The product- containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in CH3CN and H2O, and then was lyophilized to afford Compound VII-18, (1-((2S,5R)-5- (((di((isopropoxycarbonyl)oxy) methoxyphosphoryl)oxy)methyl)-2,5-dihydrofuran-2-yl)-5- methyl-3H-pyrimidine-2,4-dione) (21.1 mg, 28.9%) as a colorless oil. [0969] LC/MS MS (ES): m/z 537 [M+H]+; 98.3% purity. LC/MS conditions: (Column: Ascentis Express C18, 33x3.0 mm; 3.0 μm; Mobile Phase A: water/5mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 0.99 min, 95% B to 95% B in 0.40 min, 95% B to 10% B in 0.05 min; Wavelength: 254 nm; RT1(min): 0.763).1H NMR (400 MHz, DMSO-d6) δ 7.21 (d, J = 0.8 Hz, 1H), 6.84-6.83 (m, 1H), 6.40-6.38 (m, 1H), 6.02- 6.01 (m, 1H), 5.61-5.56 (m, 4H), 4.96 (s, 1H), 4.83-4.80 (m, 2H), 4.25-4.21 (m, 2H), 1.74 (s, 3H), 1.25-1.23 (m, 12H). EXAMPLE 23 – Synthesis of Compound VIII-1: 1-((2R,5S)-5-(chloromethyl)-5- (({di((isopropoxycarbonyl)oxy)methoxyphosphoryl}oxy) methyl)-2H-furan-2-yl)-5-methyl- 3H-pyrimidine-2,4-dione [0970]
Figure imgf000248_0001
yl bis(carbonate) (36 mg, 111 μmol) and 1-((2R,5S)-5-(chloromethyl)-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl)-5-methylpyrimidine-2,4(1H,3H)-dione (10 mg, 37 μmol) in pyridine (1 mL) was added NMI (69 mg, 555 μmol.) The mixture was evaporated to a residue under reduced pressure for 20 minutes. After which point the residue was resuspended in ACN (2 mL), and BOP-Cl (51 mg, 203 μmol) were added under an inert atmosphere. The reaction was stirred at rt for 3 h. Upon completion of the reaction as judged by LC/MS analysis, ice water was added to quench the reaction, and the mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the resulting mixture was purified by Prep- Achiral-SFC under the following conditions (Column: Viridis BEH Prep 2-EP OBD, 19*250 mm, 5 μm; Mobile Phase A: CO2, Mobile Phase B: IPA (0.1% FA); Flow rate: 60 mL/min; Gradient: isocratic 20% B; Column Temperature (℃): 35; Back Pressure(bar): 100; Wavelength: 254 nm; RT1(min): 2.5; Sample Solvent: MeOH--HPLC; Injection Volume: 2 mL; Number of Runs: 2). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and then was lyophilized to afford 1-((2R,5S)-5- (chloromethyl)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2H-furan- 2-yl)-5-methyl-3H-pyrimidine-2,4-dione (3 mg, 13.3%) as an off-white oil. [0971] LC/MS (ES, m/z): 585/587 [M+H]+; 95.1% purity. LC/MS conditions: (Column: HALOWA C18, 30*3.0 mm, 1.9 μm; Mobile Phase A: Water/0.05% TFA, Mobile Phase B: Acetonitrile/0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 5% B to 100% B in 1.30 min, 100% B to 100% B in 0.50 min, 100% B to 5% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.061).1H NMR (400 MHz, DMSO-d6) δ 11.39 (s, 1H), 7.20 (d, J = 1.5 Hz, 1H), 6.92 (t, J = 1.7 Hz, 1H), 6.32 (dd, J = 6.0, 2.1 Hz, 1H), 6.18 (dd, J = 6.0, 1.4 Hz, 1H), 5.66 – 5.55 (m, 4H), 4.88 – 4.78 (m, 2H), 4.35 (dd, J = 11.0, 5.4 Hz, 1H), 4.19 (dd, J = 11.0, 5.3 Hz, 1H), 3.82 (s, 2H), 1.74 (d, J = 1.3 Hz, 3H), 1.25 (dd, J = 6.2, 1.9 Hz, 12H). EXAMPLE 24 – Synthesis of Compound VIII-2: 5-bromo-1-((2R,5S)-5-(((di[(isopropoxy- carbonyl)oxy]methoxyphosphoryl)oxy)methyl)-2,5-dihydrofuran-2-yl)-3H-pyrimidine-2,4- dione [
Figure imgf000249_0001
, , tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione (1.00 g, 3.30 mmol) and Trt-Cl (1.09 g, 3.90 mmol) in pyridine (10.0 mL) was heated to 100 °C under an inert atmosphere until the SM was consumed as judged by LC/MS analysis. The mixture was cooled to 0 °C, and MsCl (2.50 mL, 32.3 mmol) was added. The mixture was stirred at rt under an inert atmosphere until the intermediate was converted to the desired product completely as judged by LC/MS analysis. The mixture was concentrated under reduced pressure, diluted with water (50 mL), and then extracted with EtOAc (2 x 50 mL). The combined organic layers were washed with aqueous citric acid and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with PE / EA (1:1) to afford (2R,3S,5R)-5-(5-bromo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2- ((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (1.50 g, 73%) as an off-white solid. LC/MS (ES, m/z): 625/627 [M-H]-. [0973] Step 2: A mixture of (2R,3S,5R)-5-(5-bromo-2,4-dioxo-3,4-dihydropyrimidin-1(2H)- yl)-2-((trityloxy)methyl) tetrahydrofuran-3-yl methanesulfonate (1.50 g, 2.39 mmol) and TBAF (100 mL, 100 mmol, 1M in THF) was stirred for overnight at 60 °C under an inert atmosphere. The reaction wasthen cooled to rt and concentrated under reduced pressure. The residue was purified by Prep-HPLC under the following conditions: (Column: C18 silica gel; Mobile phase A: water (6 mmol/L NH4HCO3) and B: ACN; Gradient: 0% to 100% B in 30 min; Detector: 254/220 nm). The product-containing fraction was collected and concentrated under reduced pressure to give rise to 5-bromo-1-((2R,5S)-5-((trityloxy)methyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (740 mg, 58%) as a semi-solid. LC/MS (ES, m/z): 529/531 [M- H]-. [0974] Step 3: To a stirred solution of 5-bromo-1-((2R,5S)-5-((trityloxy)methyl)-2,5- dihydrofuran-2-yl) pyrimidine-2,4(1H,3H)-dione (390 mg, 0.73 mmol) in DCM (7.00 mL) was added dichloroacetic acid (DCA) (167 mg, 0.73 mmol) and TES-H (301 mg, 1.80 mmol) at rt, stirring until the starting material was completely converted to product as judged by LC/MS analysis. The reaction was then concentrated under reduced pressure, and the residue was purified by Prep-TLC (DCM / MeOH 10:1) to afford 200 mg crude product. The crude product was re-purified by Prep-HPLC under the following conditions: (Column: C18 silica gel; Mobile phase A: water (6 mmol/L NH4HCO3) and B: ACN; Gradient: 0% to 100% B in 30 min; Detector: 254/220 nm). The product-containing fraction was collected and concentrated under reduced pressure to remove the solvent, and lyophilized to afford 5-bromo-1-((2R,5S)-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl) pyrimidine-2,4 (1H,3H)-dione (50 mg, 23%) as an off- white solid. [0975] LC/MS (ES, m/z): 287/289 [M-H]-.98.5% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33 x 3.0 mm; 3.0μm; Mobile Phase A: water/ /5mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 1.20 min, hold 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254 nm; RT1(min): 0.370).1H NMR (400 MHz, DMSO-d6) δ 11.53 (s, 1H), 8.29 (s, 1H), 6.80 (s, 1H), 6.41 – 6.39 (m, 1H), 5.94 – 5.92 (m, 1H), 5.13 (s, 1H), 4.82 (s, 1H), 3.63 (s, 2H). [0976] Step 4: 5-Bromo-1-[(2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl]-3H- pyrimidine-2,4-dione (40 mg, 0.10 mmol), ((hydroxyphosphoryl)bis(oxy))bis(methylene) di- isopropyl bis(carbonate) (137 mg, 0.40 mmol) and NMI (341 mg, 4.10 mmol) were dissolved in pyridine (0.40 mL), then concentrated under reduced pressure. This process was repeated three times. The residue was dissolved in anhydrous ACN (2.00 mL) and degassed three times with N2. A solution of BOP-Cl (387 mg, 1.50 mmol) in ACN (8.00 mL) was added to the system, then stirred for 2.5 h at rt. The reaction was quenched with water (30 mL), and the mixture was extracted with EtOAc (2 x 10 mL). The combined organic layers were dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by Prep-HPLC under the following conditions: (Column: YMC-Actus Triart C18 150 x 30 mml; Mobile Phase A: water (10 mmol NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 10% B to 20% B in 10 min; Wavelength: 254 nm/220 nm; RT1(min): 9.12). The product-containing fraction was collected and concentrated under reduced pressure to remove solvent, then lyophilized to afford Compound VIII-2, 5-bromo-1-[(2R,5S)-5- [({di[(isopropoxycarbonyl)oxy]methoxyphosphoryl}oxy)methyl]-2,5-dihydrofuran-2-yl]-3H- pyrimidine-2,4-dione (10 mg, 11%) as a white solid. [0977] LC/MS (ES, m/z): 601/603 [M+H]+.96.8% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33 x 3.0 mm; 3.0 μm; Mobile Phase A: water/ /5mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 60% B in 1.70 min, 60% B to 95% B in 0.60 min, hold 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wavelength: 254 nm; RT1(min): 1.422).1H NMR (400 MHz, DMSO-d6) δ 7.44 (s, 1H), 6.85 – 6.84 (m, 1H), 6.35 – 6.34 (m, 1H), 6.01 – 6.00 (m, 1H), 5.61 – 5.57 (m, 4H), 4.93 (s, 1H), 4.87 – 4.80 (m, 2H), 4.21 – 4.18 (m, 2H), 1.26 – 1.21 (m, 12H). EXAMPLE 25 – Synthesis of Compound VIII-3: methyl ((4-bromophenoxy) (((2S,5R)-5-(5- methyl-2-oxo-4-thioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000252_0001
[0978] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (228 mg, 800 μmol) in DCM (8 mL) was added 4 A molecular sieves. The reaction mixture was then cooled to -78 °C, then methyl L-alaninate hydrochloride (120 mg, 800 μmol) and TEA (97 mg, 959 μmol) were added under an inert atmosphere, followed by warming to -40°C with stirring for 2 additional hours. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0979] Step 2: 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-methyl-4-thioxo-3,4- dihydropyrimidin-2(1H)-one (80 mg, 333 μmol) and TEA (101 mg, 1 mmol) in DCM (6 mL) was added at -40 °C under N2 atmosphere, then stirred for 48 hours at 5 °C. The mixture was filtered and the filter cake was washed with additional DCM. The filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30 * 150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 37% B to 38% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 7.38). The product-containing fraction was collected and concentrated under vacuum and the residue was re-dissolved in ACN and H2O, which was lyophilized to afford methyl ((4-bromophenoxy) (((2S,5R)-5-(5-methyl-2-oxo-4-thioxo-3,4- dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (9.3 mg, 5.1%) as a yellow solid. [0980] LC/MS (ES, m/z): 560/562 [M+H]+; 99% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C18, 33 * 3.0 mm, 3.0 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 30% B in 0.01 min, 30% B to 70% B in 1.70 min, 70% B to 95% B in 0.60 min, 95% B to 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 0.984).1H NMR (400 MHz, DMSO-d6) δ 12.42 (s, 1H), 7.55 (dd, J = 8.9, 3.8 Hz, 2H), 7.40 (d, J = 1.2 Hz, 1H), 7.19 – 7.10 (m, 2H), 6.86 – 6.81 (m, 1H), 6.51 – 6.41 (m, 1H), 6.20 – 5.99 (m, 2H), 5.06 (s, 1H), 4.39 – 4.06 (m, 2H), 3.90 – 3.69 (m, 1H), 3.58 (d, J = 7.6 Hz, 3H), 1.87 (dd, J = 11.6, 1.0 Hz, 3H), 1.20 (t, J = 6.6 Hz, 3H). EXAMPLE 26 – Synthesis of Compound VIII-4: 1-((2R,5S)-5-(({di((isopropoxy- carbonyl)oxy)methoxyphosphoryl}oxy)methyl)-2,5-dihydrofuran-2-yl)-5-methyl-4- sulfanylidene-3H-pyrimidin-2-one
Figure imgf000253_0001
[0981] To a solution of ((hydroxyphosphoryl)bis(oxy)) bis(methylene) di-isopropyl bis(carbonate) (60 mg, 300 μmol) and 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5- methyl-4-thioxo-3,4-dihydropyrimidin-2(1H)-one (60 mg, 300 μmol) in pyridine (2 mL) was added NMI (615 mg, 7.5 mmol), then the mixture was evaporated to a residue by rotary evaporation for 20 minutes, followed by resuspension in ACN (8 mL), and addition of BOP-Cl (700 mg, 2.7 mmol) under N2 atmosphere. The reaction was stirred at rt for 3 h. When the reaction was complete as judged by LC/MS analysis, ice water was added to quench the reaction, and the mixture was extracted with EtOAc (3 x 15 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by Prep-TLC (PE/EtOAc=1:10) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: xBridge Prep Phenyl OBD 19*250 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 45% B to 55% B in 9 min; Wavelength: 220/254 nm; RT1(min): 7.6). The product-containing fraction was collected and concentrated under reduced pressure. Theresidue was re-dissolved in ACN and H2O, and lyophilized to afford 1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy) methoxyphosphoryl} oxy) methyl)-2,5-dihydrofuran-2-yl)-5-methyl-4-sulfanylidene-3H- pyrimidin-2-one (38.5 mg26.4%) as a yellow solid. [0982] LC/MS (ES, m/z): 553 [M+H]+; 94.7% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 10% B in 0.01 min, 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.974).1H NMR (400 MHz, DMSO-d6) δ 12.77 (s, 1H), 7.32 (s, 1H), 6.85 – 6.79 (m, 1H), 6.43 (d, J = 6.0 Hz, 1H), 6.08 – 6.02 (m, 1H), 5.59 (dd, J = 13.8, 4.7 Hz, 4H), 5.01 (s, 1H), 4.88 – 4.76 (m, 2H), 4.30 – 4.18 (m, 2H), 1.94 (s, 3H), 1.24 (t, J = 4.7 Hz, 12H). EXAMPLE 27 – Synthesis of Compound VIII-5: 1-((2R,5S)-5-(({Di((isopropoxy- carbonyl)oxy)methoxyphosphoryl}oxy)methyl)-5-methyl-2H-furan-2-yl)-5-methyl-3H- pyrimidine-2,4-dione O O H
Figure imgf000254_0001
[0983] To ((hydroxyphosphoryl)bis(oxy)) bis(methylene) di-isopropyl bis(carbonate) (124 mg, 380 μmol) and 1-((2R,5S)-5-(hydroxymethyl)-5-methyl-2,5-dihydrofuran-2-yl)-5- methylpyrimidine-2,4(1H,3H)-dione (30 mg, 126 μmol) in pyridine (1 mL) was added NMI (155 mg, 1.89 mmol), followed by concentration under reduced pressure for 20 minutes. The resulting residue was resuspended in ACN (5 mL), and BOP-Cl (176 mg, 690 μmol) were added sequentially under an inert atmosphere. The reaction was mixture was allowed to stir at room temperature for 3 h. Upon completion of the reaction as judged by LC/MS analysis, ice water was added to quench the reaction, and the resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by Prep-TLC (PE/EA=1:3) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: Xselect CSH PrepC18 Column, 19*250 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 42% B to 50% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 7). The product-containing fraction was collected and concentrated under reduced pressure. The residue was re-dissolved in ACN and H2O and lyophilized to afford 1-((2R,5S)-5-(({di((isopropoxycarbonyl)oxy)methoxy- phosphoryl}oxy)methyl)-5-methyl-2H-furan-2-yl)-5-methyl-3H-pyrimidine-2,4-dione (2.7 mg, 3.9%) as an off-white solid. [0984] LC/MS (ES, m/z): 551 [M+H]+; 96.6% purity. LC/MS conditions: (Column: Luna Omega PS C18, 30*2.1 mm, 3 μm; Mobile Phase A: water/0.1% FA, Mobile Phase B: Acetonitrile; Flow rate: 1.20 mL/min; Gradient: 5% B to 60% B in 1.70 min, 60% B to 100% B in 0.50 min,100% B to 100% B in 0.50 min, 100% B to 5% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.219).1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 7.24 (d, J = 1.4 Hz, 1H), 6.85 (t, J = 1.7 Hz, 1H), 6.37 (dd, J = 5.9, 2.0 Hz, 1H), 5.95 (dd, J = 5.9, 1.4 Hz, 1H), 5.59 (dd, J = 13.9, 5.5 Hz, 4H), 4.83 – 4.75 (m, 2H), 4.18 (dd, J = 11.0, 5.4 Hz, 1H), 4.03 (dd, J = 11.0, 5.4 Hz, 1H), 1.74 (d, J = 1.2 Hz, 3H), 1.25 (dd, J = 6.3, 2.2 Hz, 15H). EXAMPLE 28 – Synthesis of Compound VIII-6: Methyl ((4-bromophenoxy) (((2S,5R)-2- methyl-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy)phosphoryl)-L-alaninate
Figure imgf000255_0001
[0985] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (228 mg, 800 μmol) in DCM (8 mL) was added 4 A molecular sieves and the reaction mixture was cooled to - 78 °C. At which point, methyl L-alaninate hydrochloride (120 mg, 800 μmol) and TEA (97 mg, 959 μmol) were added at -78 °C under an inert atmosphere. The reaction was subsequently warmed to -40 °C, and stirred for 2 h. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0986] Step 2: 1-((2R,5S)-5-(hydroxymethyl)-5-methyl-2,5-dihydrofuran-2-yl)-5- methylpyrimidine-2,4(1H,3H)-dione (60 mg, 252 μmol) and TEA (76 mg, 800 μmol) in DCM (10 mL) were added at -40 °C under an inert atmosphere. The reaction mixture was then warmed to 0°C, and stirred for 16 h. The mixture was filtered, the filter cake was washed with DCM, and the filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product. The crude product was purified by Prep-HPLC under the following conditions: (Column: Xselect CSH PrepC18 Column, 19*250 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 41% B to 51% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 7). The product-containing fraction was collected and concentrated under reduced pressure. The residue was re-dissolved in ACN and H2O, and lyophilized to afford methyl ((4-bromophenoxy) (((2S,5R)-2-methyl-5-(5- methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (17.8 mg, 12.4%) as an off-white solid. [0987] LC/MS (ES, m/z): 558/560 [M+H]+; 98.4% purity. Conditions for the HPLC: (Column: HALO C18, 100*4.6 mm,2.7 μm; Mobile Phase A: H2O+0.05% TFA, Mobile Phase B: H2O+0.05% TFA; Flow rate: 1.50 mL/min; Gradient: 10% B to 95% B in 6.00 min, 95% B to 95% B in 2.00 min; Wavelength: 254/220 nm; RT1(min): 3.05 and 3.11).1H NMR (400 MHz, DMSO-d6) δ 11.34 (s, 1H), 7.59 – 7.48 (m, 2H), 7.32 (t, J = 1.6 Hz, 1H), 7.20 – 7.09 (m, 2H), 6.88 – 6.82 (m, 1H), 6.44 – 6.33 (m, 1H), 6.17 – 6.05 (m, 1H), 5.96 (d, J = 5.9 Hz, 1H), 4.22 – 3.97 (m, 2H), 3.87 – 3.70 (m, 1H), 3.64 – 3.55 (m, 3H), 1.66 (dd, J = 19.3, 1.2 Hz, 3H), 1.28 (d, J = 11.0 Hz, 3H), 1.20 (t, J = 6.6 Hz, 3H).
EXAMPLE 29 – Synthesis of Compound VIII-7: 1-((2R,5S)-5-(({Di((isopropoxy- carbonyl)oxy) methoxyphosphoryl}oxy) methyl)-2,5-dihydrofuran-2-yl)-5-(methyl-d3) methyl-3H-pyrimidine-2,4-dione
Figure imgf000257_0001
[0988] To ((hydroxyphosphoryl)bis(oxy)) bis(methylene)di-isopropyl bis(carbonate) (174 mg, 530 μmol) and 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-(methyl-d3) pyrimidine-2,4(1H,3H)-dione (20 mg, 90 μmol) in pyridine (1 mL) was added NMI (217 mg, 2.64 mmol). The mixture was evaporated to a residue via rotary evaporation under reduced pressure for 20 minutes. The residue was then resuspended in ACN (5 mL), and BOP-Cl (246 mg, 970 μmol) was added under an inert atmosphere. The reaction was stirred at rt for 3 h. Upon completion of the reaction as judged by LC/MS analysis, ice water was added to quench the reaction. The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (PE/EtOAc=1:3) to afford the crude product, which was purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 31% B to 41% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 6.18). The product-containing fraction was collected and concentrated under vacuum, the residue was re- dissolved in ACN and H2O, and was lyophilized to afford 1-((2R,5S)-5-(({di((isopropoxy- carbonyl)oxy) methoxyphosphoryl}oxy) methyl)-2,5-dihydrofuran-2-yl)-5-(methyl-d3) methyl- 3H-pyrimidine-2,4-dione (10.6 mg, 19 μmol, 22%) as a light yellow semi-solid. [0989] LC/MS (ES, m/z): 540 [M+H]+; 98.6% purity. LC/MS conditions: (Column: Shim- pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 10% B to 10% B in 0.01 min, 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.873).1H NMR (400 MHz, DMSO-d6) δ 11.14 (s, 1H), 7.21 (s, 1H), 6.87 – 6.81 (m, 1H), 6.40 (d, J = 6.0 Hz, 1H), 6.05 – 5.99 (m, 1H), 5.59 (dd, J = 13.8, 5.1 Hz, 4H), 5.12 – 4.97 (m, 1H), 4.89 – 4.75 (m, 2H), 4.30 – 4.16 (m, 2H), 1.25 (d, J = 5.9 Hz, 12H). EXAMPLE 30 – Synthesis of Compound VIII-8: methyl ((4-bromophenoxy)(((2S,5R)-5-(5- (methyl-d3)-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl)methoxy) phosphoryl)-L-alaninate
Figure imgf000258_0001
[0990] Step 1: To a stirred solution of 4-bromophenyl phosphorodichloridate (130 mg, 440 μmol) in DCM (5 mL) was added 4 A molecular sieves and the reaction mixture was cooled to - 78 °C. At which point, methyl L-alaninate hydrochloride (62 mg, 440 μmol) and TEA (45 mg, 440 μmol) were added at -78 °C under an inert atmosphere. The reaction was subsequently warmed to -40 °C, and stirring continued for 2 h. LC/MS (ES, m/z): 356/358/360 [M+H]+. [0991] Step 2: 1-((2R,5S)-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl)-5-(methyl-d3) pyrimidine-2,4 (1H,3H)-dione (20 mg, 88 μmol)) and TEA (45 mg, 440 μmol)) in DCM (5 mL) were added at -40 °C under N2 atmosphere. The resulting mixture was warmed to 0 °C and stirred for 16 h, then filtered and washed with DCM. The filtrate was concentrated under reduced pressure and purified by Prep-TLC (DCM/MeOH=10:1) to afford the crude product, which was further purified by Prep-HPLC under the following conditions: (Column: XBridge Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (10 mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 29% B to 30% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 6.53). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and was lyophilized to afford methyl ((4-bromophenoxy) (((2S,5R)-5-(5-(methyl-d3)-2,4-dioxo-3,4-dihydropyrimidin- 1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (18.2 mg, 37.5%) as an off- white solid. [0992] LC/MS (ES, m/z): 547/549 [M+H]+; 99.9% purity. LC/MS conditions: (Column: Shim-pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: water/5 mM NH4HCO3; Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 10% B in 0.01 min, 10% B to 95% B in 1.20 min, 95% B to 95% B in 0.60 min, 95% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.778).1H NMR (400 MHz, DMSO-d6) δ 11.33 (s, 1H), 7.56 (dd, J = 9.0, 3.2 Hz, 2H), 7.29 (s, 1H), 7.21 – 7.07 (m, 2H), 6.88 – 6.81 (m, 1H), 6.49 – 6.36 (m, 1H), 6.18 – 6.07 (m, 1H), 6.06 – 5.99 (m, 1H), 5.03 (d, J = 4.6 Hz, 1H), 4.31 – 4.19 (m, 1H), 4.23 – 4.08 (m, 1H), 3.89 – 3.69 (m, 1H), 3.58 (d, J = 4.5 Hz, 3H), 1.26 – 1.16 (m, 3H). EXAMPLE 31 – Synthesis of Compound VIII-9: Methyl ((R or S)-(((2R,5R)-5-(4-amino-2- oxopyrimidin-1(2H)-yl)-3-fluoro-2,5-dihydrofuran-2-yl)methoxy)(4-bromophenoxy) phosphoryl)-L-alaninate
Figure imgf000259_0001
[0993] To a stirred solution of 4-amino-1-((2R,5R)-4-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidin-2(1H)-one (60 mg, 264 μmol) in THF (8 mL) was added t- BuMgCl (304 μL, 304 μmol, 1.0 M in THF) at 0 °C under an inert atmosphere, then stirred for an additional 30 min at 0 °C. Methyl ((4-bromophenoxy) (perfluorophenoxy)phosphoryl)-L- alaninate (153 mg, 304 μmol) was added at 0 °C, and the mixture was stirred for 12 hours at rt, filtered, and washed with MeOH (3 x 5 mL). The filtrate was concentrated under reduced pressure, and the residue was purified by Prep-HPLC under the following conditions: (Column: X-Select Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 30% B to 50% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 6.56). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and then was lyophilized to afford methyl ((R or S)-(((2R,5R)-5-(4-amino-2-oxopyrimidin-1(2H)-yl)-3-fluoro- 2,5-dihydrofuran-2-yl)methoxy)(4-bromophenoxy)phosphoryl)-L-alaninate (25.3 mg, 38.7%) as a white solid. [0994] LC/MS (ES, m/z): 547/549 [M+H]+, 99.7% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 10% B in 0.01 min, 10% B to 65% B in 1.70 min, 65% B to 95% B in 0.60 min, 95% B to 95% B in 0.50 min, 95% B to 10% B in 0.03 min; Wavelength: 254/220 nm; RT1(min): 1.176).1H NMR (400 MHz, DMSO-d6) δ 7.68 – 7.51 (m, 3H), 7.32 – 7.11 (m, 4H), 6.96 – 6.89 (m, 1H), 6.21 (dd, J = 13.4, 10.0 Hz, 1H), 5.75 – 5.62 (m, 2H), 4.95 (s, 1H), 4.22 – 4.13 (m, 2H), 3.89 – 3.78 (m, 1H), 3.58 (s, 3H), 1.19 (d, J = 7.1 Hz, 3H). EXAMPLE 32 – Synthesis of Compound VIII-10: isopropyl ((((2S,5R)-5-(4-amino-5-fluoro- 2-oxopyrimidin-1(2H)-yl)-4-fluoro-2,5-dihydrofuran-2-yl)methoxy)(phenoxy)phosphoryl)- L-alaninate
Figure imgf000260_0001
[0995] To a stirred solution of 4-amino-5-fluoro-1-((2R,5S)-3-fluoro-5-(hydroxymethyl)-2,5- dihydrofuran-2-yl) pyrimidin-2(1H)-one (50 mg, 200 μmol) in THF (4 mL) was added t- BuMgCl (230 μL, 230 μmol, 1 M in THF) dropwise at 0 °C under an inert atmosphere, then stirred for an additional 30 min at 0 °C under an inert atmosphere. Isopropyl ((perfluorophenoxy)(phenoxy)phosphoryl)-L-alaninate (106 mg, 230 μmol) in THF (2 mL) was added at 0 °C under an inert atmosphere, and stirred for additional 48 h at room temperature, followed by filtration, washing with MeOH and purification by Prep-TLC (DCM/MeOH=10:1) to afford the crude product. The crude product was further purified by Prep-HPLC under the following conditions: (Column: X-Select Prep OBD C18 Column, 30*150 mm, 5 μm; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 30% B to 50% B in 7 min; Wavelength: 254 nm/220 nm; RT1(min): 6.56). The product-containing fraction was collected and concentrated under vacuum, the residue was re-dissolved in ACN and H2O, and then was lyophilized to afford isopropyl ((((2S,5R)-5-(4-amino-5-fluoro-2- oxopyrimidin-1(2H)-yl)-4-fluoro-2,5-dihydrofuran-2-yl) methoxy) (phenoxy)phosphoryl)-L- alaninate (36.2 mg, 34.5%) as an off-white solid. [0996] LC/MS (ES, m/z): 515 [M+H]+; 98.5% purity. LC/MS conditions: (Column: Shim‐ pack Scepter C1833*3.0 mm, 3 μm; Mobile Phase A: water/5 mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.50 mL/min; Gradient: 0% B to 60% B in 1.70 min, 60% B to 90% B in 0.60 min, 90% B to 90% B in 0.50 min; Wavelength: 254/220 nm; RT1(min): 1.199 and 1.232). 1H NMR (400 MHz, DMSO-d6) δ 8.03 (d, J = 6.3 Hz, 1H), 7.81 – 7.70 (m, 2H), 7.41 – 7.26 (m, 2H), 7.24 – 7.13 (m, 3H), 6.88 – 6.78 (m, 1H), 6.07 – 5.92 (m, 2H), 5.06 – 4.95 (m, 1H), 4.88 – 4.78 (m, 1H), 4.27 – 4.10 (m, 2H), 3.85 – 3.66 (m, 1H), 1.22 – 1.11 (m, 9H). EXAMPLE 33 – Synthesis of Compound VIII-11: 4-Amino-5-fluoro-1-[(2S,5S)-4-fluoro-5- (hydroxymethyl)-2,5-dihydrofuran-2-yl]pyrimidin-2-one
Figure imgf000261_0001
Figure imgf000262_0001
[0997] Step 1: (4R,5S)-5-(hydroxymethyl) oxolane-2,4-diol (6 g, 44.77 mmol) in MeOH (50 mL) and acetyl chloride (0.1 mL) were combined at 0℃, and the solution was stirred for 1 h at room temperature, then concentrated under reduced pressure to afford crude (2S,3R)-2- (hydroxymethyl)-5-methoxyoxolan-3-ol (6 g). The crude material was redissolved in DCM (60 mL) and treated with TEA (12.2 g, 120.8 mmol). Benzoyl chloride (6.2 g, 44.29 mmol) was added portion-wise at 0°C. and the mixture was stirred for 1 h at rt, quenched by the careful addition of ice water, and extracted with DCM. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under vacuum, then purified by silica gel column chromatography, eluting with petroleum ether/EtOAc (1:1) to afford [(2S,3R)-3-hydroxy-5-methoxyoxolan-2-yl] methyl benzoate (4.1 g, 36.3% yield over two steps) as a yellow oil. LC/MS (ES, m/z): 270 (M+NH4 +). [0998] Step 2: To a solution of [(2S,3R)-3-hydroxy-5-methoxyoxolan-2-yl] methyl benzoate (4.1 g, 16.20 mmol) and Ac2O (6.1 mL) in DCM (40 mL) was added PDC (12.18 g, 32.40 mmol) at room temperature. The reaction was then stirred for 1 h at rt, then filtered and washed with additional portions of DCM. The combined filtrate was concentrated under reduced pressure, and the crude product (3.4 g) was used directly in the next step. LC/MS (ES, m/z): 249 (M-H-). [0999] Step 3: DAST (10.00 g, 62.1 mmol) was added at rt, and the resulting solution was stirred overnight at 40ºC and quenched by the addition of ice-water, followed by extraction with DCM. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, then purified by silica gel column chromatography, eluting with petroleum ether/EtOAc (1:1) to afford [(2S)-3,3-difluoro-5-methoxyoxolan-2-yl] methyl benzoate (1.8 g, 40.9% yield over two steps) as a yellow oil. [1000] Step 4: To a solution of [(2S)-3,3-difluoro-5-methoxyoxolan-2-yl] methyl benzoate (1.8 g, 6.6 mmol) in AcOH (18 mL) and Ac2O (2.7 mL) was added H2SO4 (0.7 mL) at 0℃, followed by stirring for 1 h at rt and then quenching by the addition of water. The solution was adjusted to pH 7 with saturated NaHCO3 (aq.), and the mixture was extracted with EtOAc. The combined organic layers were washed with brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the crude product (1.8 g, crude) was used in the next step directly without further purification. LC/MS (ES, m/z): 318 (M+NH4+). [1001] Step 5: To a solution of fluorouracil (1.17 g, 9 mmol) in CH3CN (10 mL) was added trimethylsilyl N-(trimethylsilyl) ethanecarboximidate (3.65 g, 18 mmol) at rt. The resulting solution was stirred for 2 h at 80°C, then cooled to room temperature, and [(2S)-5-(acetyloxy)- 3,3-difluorooxolan-2-yl] methyl benzoate (1.8 g, crude) and TMS-OTf (1.99 g, 9 mmol) were added. The resulting mixture was stirred for 12 h at rt. The reaction was then quenched by the addition of ice-water, and extracted with EtOAc. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with petroleum ether/EtOAc (1:1) to afford a mixture of ^ and ^ isomers. (450 mg, 20.3% yield over two steps). This was further purified by CHIRAL-HPLC (Column: JW-CHIRALPAK IG, 20*250mm, 5um; Mobile Phase A: EtOH: DCM = 1: 1, Mobile Phase B: Hexane (0.5% 2M NH3-MeOH); Flow rate: 20 mL/min; Gradient: 65% B to 65% B in 19min; Wavelength: 220/254 nm; RT 1(min): 12.52; RT 2(min): 15.63). This afforded [(2S,5S)- 3,3-difluoro-5-(5-fluoro-2,4-dioxo-3H-pyrimidin-1-yl) oxolan-2-yl] methyl benzoate (160 mg, 0.43 mmol, second peak) as a white solid. LC/MS (ES, m/z): 371 (M+H+). [1002] Step 6: To a solution of [(2S,5S)-3,3-difluoro-5-(5-fluoro-2,4-dioxo-3H-pyrimidin-1- yl) oxolan-2-yl] methyl benzoate (160 mg, 0.43 mmol) in CH3CN (1 mL) was added DMAP (158 mg, 1.29 mmol) and TEA (131 mg, 1.29 mmol) at 0°C, followed by the addition of 2,4,6- tris(propan-2-yl) benzene-1-sulfonyl chloride (391 mg, 1.29 mmol) portion-wise at 0°C. The reaction was, then stirred for 12 h at room temperature. After which point, the reaction was cooled to 0°C, and treated with a dropwise addition of NH3.H2O (1 mL). The resulting solution was stirred for 1 h at rt and then quenched by the addition of ice water. The resulting mixture was extracted with EtOAc. The combined organic layers were washed with saturated aqueous brine and dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography, eluting with DCM/MeOH (10:1) to afford 4-amino-1-[(2S,5S)-4,4-difluoro-5-(hydroxymethyl) oxolan-2-yl]- 5-fluoropyrimidin-2-one (90 mg, 81.45%) as a white solid. LC/MS (ES, m/z): 266 (M+H+). [1003] Step 7: To a solution of 4-amino-1-[(2S,5S)-4,4-difluoro-5-(hydroxymethyl) oxolan-2- yl]-5-fluoropyrimidin-2-one (90 mg, 33.96 mmol) in DMF (1 mL) was added NaOMe (82 mg, 1.52 mmol) at rt. The reaction was then stirred for 12 h at rt before being concentrated at reduced pressure. The crude product was purified by Prep-HPLC under the following conditions: (Column: YMC-Actus Triart C 18ExRS, 19*250 mm, 5μm; Mobile Phase A: Water (10mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 3% B to 35% B in 7min; Wavelength: 254nm/220nm nm; RT1(min): 6.98). The product-containing fractions were combined and evaporated partially to remove the solvents, then lyophilized overnight to afford 4- amino-5-fluoro-1-[(2S,5S)-4-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl] pyrimidin-2-one (30.2 mg, 46.66%) as a white solid. [1004] LC/MS (ES, m/z): 246 (M+H+); 98.4% purity. Conditions for the HPLC: (Column: HPH C18, 100*4.6 mm, 2.7 μm; Mobile Phase A: 5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.5000 mL/min; Gradient: 5% B to 60% B in 9.99 min,60% B to 95% B in 2 min, 95% B to 95% B in 1.7 min; 95% B to 10% B in 0.3 min. Wavelength: 254 nm; RT1(min): 2.422).1H NMR (400 MHz, DMSO-d6) δ 8.21 (d, J = 7.2 Hz, 1H), 7.86 (br-s, 1H), 7.61 (br-s, 1H), 6.84 (t, J = 2.0 Hz, 1H), 5.60 (s, 1H), 5.43 (t, J = 4.8 Hz, 1H), 4.74 - 4.73 (m, 1H), 3.66 - 3.65 (m, 2H).
EXAMPLE 34 – Synthesis of Compound VIII-12 (Methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (peak 1)) and Compound VIII-13 (methyl ((R or S)-(4- bromophenoxy) (((2S,5R)-5-(5-methyl-2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-2,5- dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (peak 2)): [1005]
Figure imgf000265_0001
y y , y , , y yrimidin- 1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (2.7 g, 5 mmol) was separated by Prep-Chiral-HPLC under the following conditions (Column: JW-CHIRALPAK IH, 20*250 mm, 5 μm; Mobile Phase A: IPA: DCM=1:1, Mobile Phase B: Hex(0.5% 2M NH3- MeOH); Flow rate: 20 mL/min; Gradient: 50% B to 50% B in 15 min; Wavelength: 220/254 nm; RT1(min): 4.63; RT2(min): 10.21). The first eluting isomer fraction was collected and concentrated under reduced pressure, re-dissolved in ACN and H2O, then lyophilized to afford Compound VIII-12, methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (957 mg, 35.2%) as a white solid. The second eluting isomer fraction was collected and concentrated under reduced pressure, residue was re-dissolved in ACN and H2O, then lyophilized to afford Compound VIII-13, methyl ((R or S)-(4-bromophenoxy) (((2S,5R)-5-(5-methyl-2,4-dioxo-3,4- dihydropyrimidin-1(2H)-yl)-2,5-dihydrofuran-2-yl) methoxy) phosphoryl)-L-alaninate (967 mg, 35.6%) as a white solid. [1006] Compound VIII-12: LC/MS (ES, m/z): 544 [M+H]+; 98.5% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 90% B in 1.20 min, 90% B to 90% B in 0.60 min, 90% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.807). Conditions for the Chiral-HPLC: (Column: CHIRALPAK IH‐3, 50*4.6 mm; Mobile Phase: Hex (0.1% DEA): (EtOH/DCM=1:1) = 50:50; Flow rate: 1.0 mL/min; Wavelength: 254 nm; RT1(min): 1.004). [1007] Compound VIII-12: 1H NMR (400 MHz, DMSO-d6) δ 11.36 (s, 1H), 7.59 – 7.51 (m, 2H), 7.29 (d, J = 1.3 Hz, 1H), 7.16 – 7.08 (m, 2H), 6.85 (dt, J = 3.6, 1.7 Hz, 1H), 6.45 (dt, J = 6.1, 1.8 Hz, 1H), 6.12 (dd, J = 13.3, 9.9 Hz, 1H), 6.06 – 5.99 (m, 1H), 5.02 (s, 1H), 4.33 – 4.13 (m, 2H), 3.83 – 3.71 (m, 1H), 3.59 (s, 3H), 1.65 (d, J = 1.2 Hz, 3H), 1.20 (dd, J = 7.2, 1.1 Hz, 3H). [1008] Compound VIII-13: LC/MS (ES, m/z): 544 [M+H]+; 99.1% purity. LC/MS conditions: (Column: Shim‐pack Scepter C18, 33*3.0 mm; Mobile Phase A: Water/5 mM NH4HCO3, Mobile Phase B: ACN; Flow rate: 1.50 mL/min; Gradient: 10% B to 90% B in 1.20 min, 90% B to 90% B in 0.60 min, 90% B to 10% B in 0.02 min; Wavelength: 254/220 nm; RT1(min): 0.815). Conditions for the Chiral-HPLC: (Column: CHIRALPAK IH‐3, 50*4.6 mm; Mobile Phase: Hex (0.1%DEA): (EtOH/DCM=1:1) = 50:50; Flow rate: 1.0 mL/min; Wavelength: 254 nm; RT1(min): 1.469). [1009] Compound VIII-13: 1H NMR (400 MHz, DMSO-d6) δ 11.35 (s, 1H), 7.61 – 7.52 (m, 2H), 7.31 – 7.26 (m, 1H), 7.21 – 7.12 (m, 2H), 6.84 (dt, J = 3.5, 1.7 Hz, 1H), 6.39 (dt, J = 6.0, 1.8 Hz, 1H), 6.10 (dd, J = 13.2, 9.9 Hz, 1H), 6.05 – 6.00 (m, 1H), 4.97 (d, J = 3.9 Hz, 1H), 4.25 – 4.09 (m, 2H), 3.88 – 3.75 (m, 1H), 3.58 (s, 3H), 1.69 (d, J = 1.2 Hz, 3H), 1.24 – 1.18 (m, 3H).
EXAMPLE 35 – Synthesis of Compound VIII-14: methyl (2S)-2-({[(2S,5S)-5-(4-amino-5- fluoro-2-oxopyrimidin-1-yl)-3-fluoro-2,5-dihydrofuran-2-yl] methoxy(4-bromophenoxy) phosphoryl} amino) propanoate
Figure imgf000267_0001
[1010] Step 1: To a solution of 4-bromophenyl chlorophosphonochloridate (2 g, 6.90 mmol) and TEA (1.39 g, 13.80 mmol) in DCM (40 mL) was added 2,3,4,5,6-pentafluorophenol (1.40 g, 7.59 mmol) dropwise at -78℃ under nitrogen atmosphere, then stirred for 30 min, followed by the addition of TEA (1.39 g, 13.80 mmol) and methyl (2S)-2-aminopropanoate hydrochloride (1.44 g, 10.35 mmol) at -20°C, stirring overnight at room temperature, and concentration under vacuum. The crude product was purified by reverse phase flash chromatography under the following conditions (Column: C18; Mobile Phase A: Water (0.1% NH4HCO3), Mobile Phase B: ACN; Flow rate: 100 mL/min; Gradient: 0% B to 100% in 15 min, detector: UV 254nm) to afford methyl (2S)-2-{[4-bromophenoxy(2,3,4,5,6-pentafluorophenoxy) phosphoryl] amino} propanoate (850 mg, 24.44%) as a white solid. LC/MS (ES, m/z): 504;506 (M+H+). [1011] Step 2: To a stirred solution of methyl (2S)-2-{[4-bromophenoxy(2,3,4,5,6- pentafluorophenoxy) phosphoryl] amino} propanoate (400 mg, 0.79 mmol) and 4-amino-5- fluoro-1-[(2S,5S)-4-fluoro-5-(hydroxymethyl)-2,5-dihydrofuran-2-yl] pyrimidin-2-one (214 mg, 0.87 mmol) in anhydrous THF (2 mL) was added tert-butyl(chloro)magnesium (0.8 mL, 2M in THF) dropwise at 0°C. then stirred for 2h at room temperature under an inert atmosphere, and concentrated under reduced pressure. The crude product was purified by Prep-HPLC under the following conditions: Column: XBridge Prep OBD RP18 Column, 30*150 mm, 5μm; Mobile Phase A: Water (10mmol/L NH4HCO3), Mobile Phase B: ACN; Flow rate: 60 mL/min; Gradient: 35% B to 55% B in 10 min; Wavelength: 254nm/220nm; RT1(min): 7.5. The product- containing fractions were combined and evaporated partially to remove the solvents, then lyophilized to afford methyl (2S)-2-({[(2S,5S)-5-(4-amino-5-fluoro-2-oxopyrimidin-1-yl)-3- fluoro-2,5-dihydrofuran-2-yl] methoxy(4-bromophenoxy) phosphoryl} amino) propanoate (24.1 mg, 5.37%) as a white solid. [1012] LC/MS (ES, m/z): 565;567 (M+H+); 97.7% purity. Conditions for the HPLC: (Column: Shim‐pack Scepter C18, 33*3.0 mm, 3.0 μm; Mobile Phase A: Water/5mM NH4HCO3, Mobile Phase B: Acetonitrile; Flow rate: 1.5000 mL/min; Gradient: 10% B to 90% B in 1.19min,90% B to 90% B in 0.2 min, 90% B to 10% B in 0.02 min. Wavelength: 254 nm; RT1(min): 0.773). 1H NMR (400 MHz, DMSO-d6) 7.93 (brs, 1H), 7.78 - 7.76 (m, 1H), 7.64 (d, J = 6.4 Hz, 1H), 7.58 (d, J = 8.4 Hz, 2H), 7.15 (d, J = 8.4 Hz, 2H), 6.87 (s,1H), 6.33 - 6.27 (m, 1H), 5.69 - 5.67 (m, 1H), 4.98 - 4.96 (m, 1H), 4.23 - 4.12 (m, 2H), 3.76 - 3.72 (s, 1H), 3.52 (s, 3H), 1.20 (d, J = 7.2 Hz, 3H). EXAMPLE 36 – Synthesis of Additional Compounds ^ [1013] The compounds listed in Table 7 below were prepared using experimental procedures and strategies described in Examples 1-3, the Detailed Description, and related strategies and procedures known to those skilled in the art of organic synthesis. Table 7 also lists each compound’s 1H NMR characterization data and mass-to-charge ratio observed by LC/MS. Chemical structures are presented in Tables 1, 2, 3, 4, 5, 6-A, and 6-B, above. TABLE 7. Compound Mass Spec. 1H NMR Chemical Shift Data (ppm) = d, , ,
Figure imgf000268_0001
Figure imgf000269_0001
Figure imgf000270_0001
Figure imgf000271_0001
EXAMPLE 37 - Stable Cellular Assay for Tnhibiting LINE1 Reverse Transcriptase
[1014] Exemplary compounds were tested for ability to inhibit LINE1 reverse transcriptase using a stable artificial-intron Cis LINE1 reporter assay. Assay procedures and results are described below.
Part I - Procedure for Stable Artificial-Intron Cis LINE1 Reporter Assay
[1015] A stable HeLa Tet-On 3G (Takara, cat no 631183) cell line expressing a bi-directional inducible LINE1 construct was generated as described in Xie, Y. etal. “Cell division promotes efficient retrotransposition in a stable LI reporter cell line,” Mobile DNA (2013) 4: 10. Single cell clones were screened for high Luciferase expression and the highest expression Firefly expressing clone was chosen for compound testing.
[1016] Test compounds were serially diluted in DMSO and spotted in 96-well plates. Subsequently the HeLa LI artificial-intron reporter cells were plated into the compoundcontaining wells (8,000 cells/well), and the cells were induced for reporter expression with doxycycline (Sigma cat no D9891) at a final concentration of 500 ng/mL. Luminescence was measured 72 h after plating using the Dual-Glo Luciferase Assay System (Promega cat no E2940) following the manufacturer’s instructions. The Firefly Luciferase activity (normalized against its activity in a control well without test compound) was used to report LINE1 activity.
Part II- Results
[1017] Experimental results are provided in Table 8, below. The symbol “***” indicates an IC50 less than or equal to 0.05 pM. The symbol “**” indicates an IC50 in the range of greater than 0.05 pM to less than or equal to 0.5 pM. The symbol indicates an IC50 greater than 0.5 pM.
TABLE 8.
Figure imgf000272_0001
Figure imgf000273_0001
Figure imgf000274_0001
EXAMPLE 38 - Biochemical Assay for Inhibiting LINE1 Reverse Transcriptase
[1018] Exemplary compounds may be tested for ability to inhibit LINE1 reverse transcriptase using a homogeneous time-resolved fluorescence (HTRF) assay. Assay procedures are described below. Part I – Procedure for Homogeneous Time-Resolved Fluorescence LINE1 RT Assay [1019] The LINE1 reverse transcriptase homogeneous time-resolved fluorescence (HTRF) assay is performed with recombinant MBP-tagged LINE1 protein (238-1061) (generated and purified according to procedures in Dai L. et al. BMC Biochemistry 2011; 12:18) in a 384-well format. Test compound is serially diluted in DMSO and further diluted in the assay buffer (50 mM Tris-HCl, 50 mM KCl, 10 mM MgCl2, 10 mM DTT, pH 8.1) to achieve a final DMSO concentration of 1%. The serially diluted compound is mixed with 64 ng/well of LINE1 enzyme, 5 nM of pre-annealed template/biotin-primer pair (synthesized at Generay Biotechnology), 10 nM of Fluorescein-12-dCTP or dUTP fluorescent probe (Perkin Elmer), and 1 µM dGTP/dCTP/dTTP (Thermo Fisher Scientific) in the assay buffer. The template/biotin-primer sequences are as follows: (SEQ ID NO:1) (SEQ ID NO:2) . [1020] After incubating at 25°C for 60 minutes, the detection reagent (20 mM EDTA with streptavidin-terbium cryptate, Cisbio Bioassay) in the PPI buffer (Cisbio Bioassay) is added, and the mixture is incubated at 25°C for 30 minutes. At the end of the incubation, fluorescence is read at ex/em=337/485 nm and ex/em=337/520 nm on an Envision 2104 plate reader (Perkin Elmer). The fluorescence ratio at 520/485 nm is used for the calculation. Percent inhibition is calculated with the DMSO sample as 0% inhibition and no enzyme as 100% inhibition. The IC50 is calculated by fitting the compound dose inhibition curve with a 4-parameter non-linear regression equation. Part II - Results [1021] The following triphosphate analogs were made and tested in this assay. The triphosphates were synthesized from the parent at NuBlocks LLC (Oceanside, CA). [1022] Results are shown in Table 9, below. In the table “A” represents values ≤ 0.050 µM; “B” represents values from > 0.050 µM to ≤ 0.100 µM; “C” represents values from > 0.100 µM to ≤ 0.250µM; “D” represents values from > 0.250 µM to ≤ 1 µM; “E” represents values >1 µM. Table 9.
Figure imgf000276_0001
EXAMPLE 39 - Biochemical Assay for Inhibiting HERV-K Reverse Transcriptase
[1023] Exemplary compounds may be tested for ability to inhibit HERV-K reverse transcriptase using a homogeneous time-resolved fluorescence (HTRF) assay. Assay procedures are described below.
Part I - Procedure for Homogeneous Time-Resolved Fluorescence HERV-K RT Assay
[1024] The HERV-K reverse transcriptase homogeneous time-resolved fluorescence (HTRF) assay is performed in a 384-well format with HERV-K reverse transcriptase (2-596)-
8His protein. Baculoviruses are created using Bac-to-Bac technology (fnvitrogen). pFastBac donor plasmids containing HERV-K reverse transcriptase sequence (NCBI GenBank number AAC63291.1, J. Virology (1999) Vol. 73, No. 3, pp. 2365-2375) are transformed into DH10 Bac cells following the manufacturer’s instructions. Recombinant bacmids are then isolated clonally and transfected into SF9 cells with lipofectin. HERV-K reverse transcriptase is expressed in the SF9 insect cells and then purified using immobilized metal affinity chromatography (IMAC) followed by size-exclusion chromatography (SEC).
[1025] Test compound is serially diluted in DMSO and further diluted in the assay buffer (50 mM Tris-HCl, 50 mM KC1, 10 mM MgCh, 10 mM DTT, pH 8.1) to achieve a final DMSO concentration of 1%. The serially diluted compound is mixed with 16 ng/well of HERV-K enzyme, 5 nM of pre-annealed template/biotin-primer pair (synthesized at Geneway Biotechnology), and 10 nM of Fluorescein- 12-dCTP fluorescent probe (Perkin Elmer). The template/biotin-primer sequences are:
S’ to 3* GUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGAAU (SEQ ID NO: 1) 5! to 3* Biottn-TTCTGACTAAAAGGGTCTGAGGGAT (SEQ ,D NO:2)
[1026] After incubating at 25°C for 30 minutes, the detection reagent 20 mM EDTA with streptavidin-terbium cryptate (Cisbio Bioassay) in the PPI buffer (Cisbio Bioassay) is added, and the mixture is incubated at 25°C for 60 minutes. At the end of the incubation, fluorescence is read at ex/em=337/485 nm and ex/em=337/520 nm on an Envision 2104 plate reader (Perkin Elmer). The fluorescence ratio at 520/485 nm is used for the calculation. Percent inhibition is calculated with the DMSO sample as 0% inhibition and no enzyme as 100% inhibition. The IC50 are calculated by fitting the compound dose inhibition curve with a 4-parameter non-linear regression equation.
EXAMPLE 40 - Cellular Assay for Altering IFN Production in THP1 TREX1 KO Cells
[1027] Exemplary compounds were tested for their ability to alter the type 1 interferon response in THP1 Dual TREX1 KO cells treated with 5-aza-2'-deoxy cytidine. Assay procedures and results are described below.
Part I - Procedure
[1028] TUP 1 -Dual™ KO-TREX1 cells were purchased from Invivogen (cat# thpd-kotrex). The THPl-Dual™ KO-TREX1 cells were cultured in RPMI 1640, 10% heat-inactivated fetal bovine serum, 25 mM HEPES, 10 pg/mL Blasticidin, and 100 pg/mL Zeocin. THPl-Dual™ KO-TREX1 cells were treated with a dose titration of test compound in the presence of 1 pM 5- aza-2'Aieoxycytidine (Sigma, cat# 189825). Type 1 Interferon and cell viability were assessed after five days of treatment.
[1029] Stock solution of test compound was prepared in DMSO followed by a three-fold dilution in DMSO. Additional 50x dilution was prepared in cell culture media for each dilution. 10 pL of diluted test compound was then added to a 384-well plate.
[1030] THPl-Dual™ KO-TREX1 cells were treated with 1 pM 5-aza-2'-deoxycytidine. THPl-Dual™ KO- 1 REX 1 cells (50 pL) were added to each well of the 384-well plate containing test compound titration at 10,000 cells/well. Cells were incubated at 37ºC, 5% CO2 in a humidified incubator for five days. On day five, 20 µL of cell supernatant was transferred to a 384-well, white-walled plate, followed by addition to each well of 50 µL of QUANTI-LUC solution containing stabilizer. Luminescence was detected on a plate reader according to manufacturer’s instructions. [1031] For certain compounds, the assay was run in a 96-well format, with the following modifications: ^ 190 ^L, instead of 50 ^L, of cells were added to each well, to provide 50,000 cells/well, instead of 10,000 cells/well, ^ Cells were incubated for 6 days, instead of 5 days, ^ 25 ^L, instead of 20 ^L, of cell supernatant was added to the white-walled plate for QUANTI-LUC treatment; and ^ 25 ^L, instead of 30 ^L, of CellTiter-Glo was added to assess cell viability. [1032] Percent inhibition of interferon was calculated using the following analysis: (Average DMSO-Sample)/(Average DMSO-Average 30 µM control reagent)*100. The control reagent for inhibition of interferon was stampidine. Percent induction of interferon was calculated using the following analysis: (Sample-Average DMSO)/(10 µM control reagent-Average DMSO)*100. The control reagent for induction of interferon was a specific nucleoside reverse-transcriptase inhibitor with molecular weight < 600 a.m.u. [1033] The remaining cells were assessed for cell viability by adding 30 µL of CellTiter-Glo (Promega, G9683) solution to each well, and placed on a shaker for 10 minutes at room temperature. Luminescence was detected on a plate reader, according to manufacturer’s instructions. Percent inhibition of cell viability using CellTiter-Glo was calculated using the following analysis: (Average DMSO-Sample)/(Average DMSO-Average 20 µM control reagent)*100. The control reagent was Z-Leu-Leu-leucinal (benzyl N-[(2S)-4-methyl-1-[[(2S)- 4-methyl-1-[[(2S)-4-methyl-1-oxopentan-2-yl]amino]-1-oxopentan-2-yl]amino]-1-oxopentan-2- yl]carbamate). Part TT - Results
[849] Results are shown in Table 10, below. In the table “A” represents values < 0.050 pM; “B” represents values from > 0.050 pM to < 0.100 pM; “C” represents values from > 0.100 pM to < 0.250pM; “D” represents values from > 0.250 pM to < 1 pM; “E” represents values >1 pM; and “NT” = not tested:
Table 10
Figure imgf000279_0001
Figure imgf000280_0002
EXAMPLE 41 - Cancer Cell Viability Assay with 3D Cell Colonies
[1034] Exemplary compounds may be tested for the ability to reduce cancer cell viability using a CellTiter-Glo assay with cancer cells cultured in 3D colonies. Assay procedures are described below.
Part I - Procedure for Cancer Cell Viability Assay with 3D Cell Colonies
[1035] Cancer cell lines are cultured in the following media:
• Ovarian cancer OVCAR-8 cells - RPMI media containing 10% FBS
• Ovarian cancer SK-OV-3 cells - McCoy’s 5a media containing 10% FBS
• Ovarian cancer SW756 cells - L-15 (100% air) + 10% FBS
• Esophageal cancer TE-1 cells - RPMI 1640 + 10% FBS
• Esophageal cancer KYSE-410 cells - RPMI 1640 + 5 10% FBS
• Esophageal cancer KYSE-70 cells - RPMI 1640 + 10% h.i.FBS.
• Pharyngeal cancer FaDu cells - MEM + O.OlmM NEAA + 10% FBS
[1036] Cell colony formation is tested using a 3D methylcellulose-based CellTiter-Glo (CTG) viability assay (Cat. No: G7573, Promega). Briefly, cells are inoculated into 96-well plates (at 1,500 cells per well) into a solution of 0.65% methylcellulose in growth media and incubated overnight at 37 °C in 5% CO2. The next day, serially diluted test compound or positive control (cisplatin, Cat. No. 6J015A89, Qilu Pharma) are added at the indicated concentrations, and the cells are incubated for 7 days. On day seven, 100 pL of CTG reagent is added, and the plates are incubated at room temperature for 20 min. Luminescence is read on an Envision Multi Label Reader according to manufacturer’s instructions. IC50 values are determined using the following calculation: '
Figure imgf000280_0001
EXAMPLE 42 - In-Vivo Decitabine Challenge Model
[1037] Twenty 9-11 week old C57BL/6 mice are acclimated to the lab for at least 5 days. Test compound is prepared for p.o. administration. Decitabine (Sigma) is dissolved in sterile PBS (pH 7.4) and dosed within 30 minutes of preparation of the solution. Doses of both test compound and decitabine are administered once a day, every day from Day 0 to Day 4.
[1038] On Day 0, mice are split into four groups of five mice and given their first dose of decitabine (i.p., 5 mg/kg) and test compound. Dosing groups were:
Figure imgf000281_0001
[1039] Decitabine and test compound are administered daily from Day 0 to Day 4. All mice are euthanized 1 hour after the last dose administration on Day 4. Spleens, liver, and terminal colon are collected, along with plasma from each animal. The fold changes in interferon- stimulated gene (ISG) expression are calculated by first normalizing to GAPDH gene using the Delta CT method. The CT (gene of interest) - CT (reference gene) is calculated to generate a delta CT for all samples. The fold change is then calculated by taking the Log2(Delta CT(control) - Delta CT (experimental). The control in this example is the PBS control animal group. The Taqman duplex assay (Thermo Fisher 4331182 and 4448489) is used according to the manufacturer’s instructions to determine levels of GAPDH v. IFIT2.
EXAMPLE 43 - Decitabine-Stimulated Human PBMC Assay
[1040] EasySep buffer (32 mL, Stem Cell, cat. #20144) is used to dilute 8 mL of LRSC buffy coat (from fresh Leukopak) with gentle mixing. The diluted buffy coat (20 mL) is transferred into each of two SepMate 50 tubes, and the tubes are filled with 15 mL of Lyphoprep (Stem Cell, ct. #07851) density gradient. The SepMate tubes are then centrifuged at 1200G for 10 minutes at room temperature with the brake on. The top layer of supernatant is collected in SepMate tubes by quickly pouring it into a new 50 mL conical tube. The PBMCs are washed with EasySep buffer x2 by centrifuging at 300G for 5 minutes. The cells are resuspended in 30 mL of EasySep and centrifuged at 100G for 5 minutes with the brake off, and the platelets are removed. The cells are then resuspended in 6 mL of lx RBC lysis buffer (InvitroGen) and incubated at 37 °C for 5 minutes. Then, 25 mL of EasySep buffer is mixed into the tube and it is centrifuged at 300G for 5 minutes. The cells are resuspended in 10 mL of EasySep buffer and the cells are then counted with Cellometer (AO/PI). The PBMCs are resuspended in RPMI 1640 (ThermoFisher) + 10% FBS (HyClone) + p/s at 3xl06/mL. The PBMCs (100 pL, 300k PBMCs) are then seeded in a 96-well flat bottom microplate (Corning) that is precoated with lOOpL of anti-CD3 antibody (lOpg/mL in PBS, Biolegend) or PBS at 4 °C, one day before the assay is commenced.
[1041] To each well, the following solutions are added: 1) 100 pL of cells (final cell number per well is 3xl05 cell/well); 2) 25 pL of anti-CD28 antibody at 6x (5 pg/mL final concentration, Biolegend); 3) 25 pL of decitabine at 6x (10 pM final concentration); and 4) the Compound in DMSO is dispensed directly into each well with a d300e digital dispense (Tecan). The final concentration of DMSO for each well is normalized to 0.3%. The plate is incubated at 37 °C without any agitation for 5 days. Samples are collected 120 hours after incubation to determine IFN-P and IL -2 levels using a U-PLEX Human IFNb Assay Sector (5PL) (MSD, cat. #K151VIK-2).
[1042] After 5 days, the plate is spun down at lOOxG for 5 minutes. Supernatants (lOOpL) are collected for interferon p (IFN-P) analysis using the MSD assay noted above, and any residual supernatant is stored at -80°C. Cell viability is checked to determine if cell death has an impact on the IFN-P levels detected.
EXAMPLE 44 - Producing THP1 TREX1 KO Xenografts with Decitabine-Induced IFN
[1043] The ability to produce THPl-Dual1M KO-TREX1 xenografts in mice that displayed decitabine-dependent IFN induction was tested. Assay procedures and results are described below.
Part 1 - Procedure for Producing THP1 TREX1 KO Xenografts with Decitabine-Induced IFN
[1044] CB-17 SCID female mice were inoculated subcutaneously with 10 million THP1-
Dual™ KO-TREX1 cells in 200 pl PBS with Matrigel (1 : 1). Mice were randomized when tumor volume reached 350-400 mm3 and grouped at N=3 per treatment. Mice bearing THPl-Dual™ KO-TREX1 xenograft tumors were then administered vehicle or decitabine (DAC) at 5mg/kg IP, once daily, starting on day 1, for 4 days. Decitabine was formulated in sterile PBS, pH 7.4. Tumors were harvested daily for 5 days starting on day 2, lysed with RIPA lysis buffer containing protease and phosphatase inhibitors, and grinded at 50 Hz for 5 min. Tumors were then centrifuged, and Pierce1M BCA Protein Assay Kit was used to measure protein concentration. Equal amounts of proteins were added to 96-well black plates, and luciferase signal was measured using the QUANTI-Luc™ detection medium according to manufacturer’s instructions. Luminescence was measured using the EnVision® 2105 Multimode Plate Reader.
Part II - Results
[1045] Experimental results are depicted in Figure 1. Data was normalized relative to vehicle. In Figure 1, “DAC” is an abbreviation for decitabine; “D2, 4h” depicts interferon data from day 2, with tumor harvested 4 hours after decitabine dosing; “D3, 4h” depicts interferon data from day 3, with tumor harvested 4 hours after decitabine dosing; “D4, 4h” depicts interferon data from day 4, with tumor harvested 4 hours after decitabine dosing; and “D4, 24h” depicts interferon data from day 5, with tumor harvested 24 hours after the final decitabine dosing on day 4.
EXAMPLE 45 - Assay for Altering IFN Production in THP1 TREX1 KO Xenografts
[1046] Exemplary compounds may be tested for their ability to alter IFN levels in THP1- Dual™ KO-TREX1 xenografts in mice (produced according to the procedure described in Example 44). Assay procedures are described below.
Part I - Procedure for Altering IFN Production in THP1 TREX1 KO Xenografts
[1047] CB-17 SCID female mice are inoculated subcutaneously with 10 million THP1-
Dual™ KO-TREX1 cells in 200 pl PBS with Matrigel (1 : 1) and grouped when tumor volume reaches 350-400 mm3. Mice bearing THPl-Dual™ KO-TREX1 xenograft tumors are then separated into 5 groups. Three groups are administered: (1) decitabine (DAC) at 5mg/kg IP, once daily, for 4 days, and (2) test compound at one of three doses, once daily, for 4 days. One group is administered decitabine (DAC) at 5mg/kg IP, once daily, for 4 days, and the test compound vehicle control. The final group is administered the vehicle control from both the test compound and the vehicle control from decitabine. Decitabine is formulated in sterile PBS, pH 7.4. [1048] Tumors are harvested daily for 5 days starting on day 2, lysed with RIPA lysis buffer containing protease and phosphatase inhibitors, and grinded at 50 Hz for 5 min. Tumors are then centrifuged, and Pierce™ BCA Protein Assay Kit is used to measure protein concentration.
Equal amounts of proteins are added to 96-well black plates, and luciferase signal is measured using the QUANTI-Luc™ detection medium according to manufacturer’s instructions.
Luminescence is measured using the EnVision® 2105 Multimode Plate Reader.
INCORPORATION BY REFERENCE
[1049] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.
EQUIVALENTS
[1050] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

Claims:
1. A compound represented by Formula I:
Figure imgf000285_0002
or a pharmaceutically acceptable salt thereof; wherein:
R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7));
R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro;
R4 represents independently for each occurrence Ci-6 alkyl or -(CM alkylene)-OC(O)O- (Ci-io alkyl), and one occurrence of R4 is further selected from hydrogen;
R5 is phenyl or naphthyl, each of which is substituted with m instances of R10;
R6 is hydrogen or CM alkyl;
R7 is -C(R8)2-CO2R9;
R8 represents independently for each occurrence Ci-6 alkyl or hydrogen, wherein said Ci-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring;
R9 is Ci-6 alkyl or C2-6 alkenyl; wherein said Ci-6 alkyl is optionally substituted with phenyl;
R10 represents independently for each occurrence halo, CM alkyl, CM haloalkyl, or CM alkoxyl;
R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3;
Figure imgf000285_0001
m is 0, 1, 2, or 3.
2. The compound of claim 1, wherein the compound is a compound of Formula I.
3. The compound of claim 1 represented by Formula I-1:
Figure imgf000286_0001
an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000286_0002
m is 0, 1, 2, or 3.
4. The compound of claim 3, wherein the compound is a compound of Formula I-1.
5. The compound of any one of claims 1-4, wherein R2 is fluoro and R3 is hydrogen.
6. The compound of any one of claims 1-4, wherein R2 is hydrogen and R3 is fluoro.
7. A compound represented by Formula II: or a pharmaceutically accepta
Figure imgf000287_0001
herein: R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 and R3 are hydrogen; R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000288_0001
8. The compound of claim 7, wherein the compound is a compound of Formula II.
9. A compound represented by Formula II-1: or a pharmaceutically acceptab
Figure imgf000288_0002
herein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2 R2 and R3 are hydrogen; R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000289_0001
10. The compound of claim 9, wherein the compound is a compound of Formula II-1.
11. A compound represented by Formula III: an enantiomer thereof, or a ph
Figure imgf000289_0002
ceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, -P(O)(N(R6)(benzyl))(-O-(C1-4 alkylene)-S- C(O)-(C1-6 alkylene)-OR6), or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 represents independently for each occurrence hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; R12 is hydrogen, -CH2Cl, -CH2F, -CH2Br, -CH2I, -CF3, or C1-3 aliphatic; R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000290_0001
provided that when R5 is phenyl, R6 is hydrogen, and R7 , or 3, and R10 represents independently for each occurrence halo, C
Figure imgf000290_0002
alkoxyl, provided that the compound is no .
12. The compound of claim 11, wherei
Figure imgf000290_0003
n the compound is a compound of Formula III.
13. The compound of any one of claims 11 or 12, wherein R12 is hydrogen.
14. The compound of any one of claims 11 or 12, wherein R12 is -CH2Cl, -CH2F, -CH2Br, - CH2I, -CF3, or C1-3 aliphatic.
15. The compound of any one of claims 11-14, wherein R11 is halo, -CF3, -CD3, -CH2CH3, or - C(H)=CH2.
16. The compound of claim 11 represented by Formula III-1:
Figure imgf000291_0001
an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is -P(O)(OR5)(N(R6)(R7)) or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is halo, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000291_0002
m is 0, 1, 2, or 3; provided that when R5 is phenyl, R6 is hydrogen, and R7 , or 3, and R10 represents independently for each occurrence halo, C
Figure imgf000292_0001
alkoxyl.
17. The compound of claim 16, wherein the compound is a compound of Formula III-1.
18. The compound of any one of claims 1-8, wherein R11 is hydrogen.
19. The compound of any one of claims 1-14, wherein R11 is -CH3.
20. The compound of any one of claims 1-17, wherein R11 is halo.
21. The compound of any one of claims 1-17, wherein R11 is -CF3.
22. The compound of any one of claims 1-17, wherein R11
Figure imgf000292_0002
D3, -CH2CH3, or -C(H)=CH2.
23. The compound of any one of claims 1-22, wherein B1 .
Figure imgf000292_0003
24. The compound of any one of claims 1-22, wherei .
25. The compound of any one of claims 1-24, wherei
Figure imgf000292_0004
n s - ( )( )(N(R6)(R7)).
26. The compound of any one of claims 1-25, wherein R6 is hydrogen.
27. The compound of any one of claims 1-26, wherein R8 represents independently for each occurrence C1-6 alkyl or hydrogen.
28. The compound of any one of claims 1-27, wherein R7 is .
Figure imgf000292_0005
29. The compound of any one of claims 1-28, wherein R9 is C1-6 alkyl.
30. The compound of any one of claims 1-29, wherein R5 is phenyl substituted with m instances of R10.
31. The compound of any one of claims 1-29, wherein R5 is naphthyl substituted with m instances of R10.
32. The compound of any one of claims 1-29, wherein R5 .
33. The compound of any one of claims 1-32, wherein R10
Figure imgf000293_0001
pendently for each occurrence halo.
34. The compound of any one of claims 1-24, wherein R1 is -P(O)(OR4)2.
35. The compound of any one of claims 1-24 or 34, wherein R4 represents independently for each occurrence -(C1-4 alkylene)-OC(O)O-(C1-10 alkyl).
36. The compound of any one of claims 1-24 or 34, wherein R4 is -CH2-OC(O)O-(C1-6 alkyl).
37. A compound in Table 1, 2, 3, 6-A, or 6-C herein, or a pharmaceutically acceptable salt thereof.
38. A pharmaceutical composition comprising a compound of any one of claims 1-37 and a pharmaceutically acceptable carrier.
39. A method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of any one of claims 1-37 to treat the disorder.
40. A method of treating a disorder selected from the group consisting of cancer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV, V, or VI to treat the disorder; wherein Formula IV is represented by: or a pharmaceutically accepta
Figure imgf000294_0001
herein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000294_0002
m is 0, 1, 2, or 3; wherein Formula V is represented by: or a pharmaceutically acceptab
Figure imgf000295_0001
herein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000295_0002
m is 0, 1, 2, or 3; and wherein Formula VI is represented by: an enantiomer thereof, or a ph
Figure imgf000296_0001
ceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), -P(O)(OR4)2, -P(O)(N(R6)(benzyl))(-O-(C1-4 alkylene)-S-C(O)-(C1-6 alkylene)-OR6), or -P(O)(N(R6)(R7))(N(R6)(R7)); R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or -C(H)=CH2; R12 is hydrogen, -CH2Cl, -CH2F, -CH2Br, -CH2I, -CF3, or C1-3 aliphatic; R13 is halo, -CH3, -CF3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000297_0001
provided that the compound of Formula (VI) is not .
41.
Figure imgf000297_0002
ncer, an inflammatory disorder, a neurodegenerative disorder, and an immune disorder other than a viral infection, comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula IV-1, V-1, or VI-1 to treat the disorder; wherein Formula IV-1 is represented by:
Figure imgf000297_0003
( - ) an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 is fluoro and R3 is hydrogen, or R2 is hydrogen and R3 is fluoro; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000298_0001
wherein Formula V-1 is represented by:
Figure imgf000298_0002
( - ) or a pharmaceutically acceptable salt thereof; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CH3, -CD3, -CH2CH3, -C(H)=CH2, or -CF3; nd
Figure imgf000299_0001
wherein Formula VI-1 is represented by:
Figure imgf000299_0002
- an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing; wherein: R1 is hydrogen, -P(O)(OR5)(N(R6)(R7)), or -P(O)(OR4)2; R2 and R3 are hydrogen; R4 represents independently for each occurrence C1-6 alkyl or -(C1-4 alkylene)-OC(O)O- (C1-10 alkyl), and one occurrence of R4 is further selected from hydrogen; R5 is phenyl or naphthyl, each of which is substituted with m instances of R10; R6 is hydrogen or C1-4 alkyl; R7 is -C(R8)2-CO2R9; R8 represents independently for each occurrence C1-6 alkyl or hydrogen, wherein said C1-6 alkyl is optionally substituted with phenyl; or two instances of R8 are taken together with the carbon atom to which they are attached to form a 3-5 membered saturated carbocyclic ring; R9 is C1-6 alkyl or C2-6 alkenyl; wherein said C1-6 alkyl is optionally substituted with phenyl; R10 represents independently for each occurrence halo, C1-4 alkyl, C1-4 haloalkyl, or C1-4 alkoxyl; R11 is hydrogen, halo, -CF3, -CH3, -CD3, -CH2CH3, or -C(H)=CH2; nd
Figure imgf000300_0001
provided that the compound of Formula (VI-1) is not .
42.
Figure imgf000300_0002
e met od o c a m 0, w ere n t e compound s a compound o ormula IV or a pharmaceutically acceptable salt thereof.
43. The method of claim 40, wherein the compound is a compound of Formula V or a pharmaceutically acceptable salt thereof.
44. The method of claim 40, wherein the compound is a compound of Formula VI, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
45. The method of claim 41, wherein the compound is a compound of Formula IV-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing.
46. The method of claim 41, wherein the compound is a compound of Formula V-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. The method of claim 41, wherein the compound is a compound of Formula VI-1, an enantiomer thereof, or a pharmaceutically acceptable salt of either of the foregoing. The method of claim 39, wherein the disorder is an immune disorder that is a viral infection. The method of claim 48, wherein the viral infection is an infection by human immunodeficiency viruses 1 or 2 (HIV-1 or HIV-2), human T-cell leukemia viruses 1 or 2 (HTLV-1 or HTLV-2), respiratory syncytial virus (RSV), human papilloma virus (HPV), adenovirus, hepatitis B virus (HBV), hepatitis C virus (HCV), Epstein-Barr virus (EBV), varicella zoster virus (VZV), cytomegalovirus (CMV), herpes simplex viruses 1 or 2 (HSV-1 or HSV-2), human herpes virus 8 (HHV-8, also known as Kaposi's sarcoma- associated virus), or a flavivirus selected from Yellow Fever virus, Dengue virus, Japanese Encephalitis, and West Nile virus. The method of any one of claims 39-47, wherein the disorder is cancer. The method of claim 50, wherein the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, stomach cancer, bile duct and gallbladder cancers, bladder cancer, urinary tract cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer. The method of any one of claims 39-47, wherein the disorder is an inflammatory disorder. The method of claim 52, wherein the inflammatory disorder is rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, inflammatory bowel disease, Crohn’s disease, ulcerative colitis, nonalcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), cholestatic liver disease, sclerosing cholangitis, psoriasis, dermatitis, vasculitis, scleroderma, asthma, bronchitis, chronic obstructive pulmonary disease (COPD), pulmonary fibrosis, pulmonary hypertension, sarcoidosis, myocarditis, pericarditis, gout, myositis, Sjogren's syndrome, or systemic lupus erythematosus. The method of any one of claims 39-47, wherein the disorder is an immune disorder other than a viral infection. The method of claim 54, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), arthritis, psoriasis, systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial chilblain lupus, systemic sclerosis, STING-associated vasculopathy with onset in infancy (SA VI), graft versus host disease, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn’s disease, vasculitis, psoriatic arthritis, Reiter's syndrome, exfoliative psoriatic dermatitis, pemphigus vulgaris, Sjogren’s syndrome, autoimmune uveitis, glomerulonephritis, post myocardial infarction cardiotomy syndrome, pulmonary hemosiderosis, amyloidosis, sarcoidosis, aphthous stomatitis, thyroiditis, gastritis, adrenalitis (Addison's disease), ovaritis, primary biliary cirrhosis, myasthenia gravis, gonadal failure, hypoparathyroidism, alopecia, malabsorption syndrome, pernicious anemia, hepatitis, hypopituitarism, diabetes insipidus, or sicca syndrome. The method of claim 54, wherein the immune disorder is a type 1 interferonopathy, type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), dermatomyositis, or Sjogren’s syndrome. The method of any one of claims 39-47, wherein the disorder is a neurodegenerative disorder. The method of claim 57, wherein the neurodegenerative disorder is Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson’s disease, Huntington’s disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt- Jacob disease, stroke, prion disease, frontotemporal dementia, Pick’s disease, progressive supranuclear palsy, spinocerebellar ataxias, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, an anxiety disorder, or major depression. The method of any one of claims 39-58, wherein the method further comprises administering an effective amount of an additional therapeutic agent. The method of any one of claims 39-59, wherein the subject has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and/or LINE1 ORF2 polypeptide; and/or (ii) activity of LINE1 reverse transcriptase. The method of any one of claims 39-60, wherein the subject has (i) expression of HERV-K RNA and/or (ii) activity of HERV-K reverse transcriptase. The method of any one of claims 39-61, wherein the subject is a human. A method of inhibiting LINE1 reverse transcriptase activity, comprising contacting a LINE1 reverse transcriptase with an effective amount of a compound of any one of claims 1-37, in order to inhibit the activity of said LINE1 reverse transcriptase. A method of inhibiting HERV-K reverse transcriptase activity, comprising contacting a HERV-K reverse transcriptase with an effective amount of a compound of any one of claims 1-37, in order to inhibit the activity of said HERV-K reverse transcriptase.
PCT/US2023/079834 2022-11-15 2023-11-15 Halo-dehydro-3'-deoxyuracil phosphoramidates and related compounds and their use in treating medical conditions WO2024107850A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263425412P 2022-11-15 2022-11-15
US63/425,412 2022-11-15

Publications (1)

Publication Number Publication Date
WO2024107850A1 true WO2024107850A1 (en) 2024-05-23

Family

ID=91085492

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/079834 WO2024107850A1 (en) 2022-11-15 2023-11-15 Halo-dehydro-3'-deoxyuracil phosphoramidates and related compounds and their use in treating medical conditions

Country Status (1)

Country Link
WO (1) WO2024107850A1 (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109627272A (en) * 2018-12-21 2019-04-16 佛山科学技术学院 With the active nucleotide phosphate of suppressing virus replication similar to object, preparation method and its medicinal usage
WO2020142629A1 (en) * 2019-01-02 2020-07-09 The General Hospital Corporation Reverse transcriptase blocking agents and methods of using the same
WO2022256625A1 (en) * 2021-06-04 2022-12-08 Transposon Therapeutics, Inc. Line-1 inhibitors as cognitive enhancers
WO2023192491A2 (en) * 2022-03-30 2023-10-05 Transposon Therapeutics, Inc. Nucleoside line-1 inhibitors
WO2023205786A1 (en) * 2022-04-22 2023-10-26 Rome Therapeutics, Inc. Didehydro-3'-deoxy-4'-ethynylthymidines and related compounds and their use in treating medical conditions

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109627272A (en) * 2018-12-21 2019-04-16 佛山科学技术学院 With the active nucleotide phosphate of suppressing virus replication similar to object, preparation method and its medicinal usage
WO2020142629A1 (en) * 2019-01-02 2020-07-09 The General Hospital Corporation Reverse transcriptase blocking agents and methods of using the same
WO2022256625A1 (en) * 2021-06-04 2022-12-08 Transposon Therapeutics, Inc. Line-1 inhibitors as cognitive enhancers
WO2023192491A2 (en) * 2022-03-30 2023-10-05 Transposon Therapeutics, Inc. Nucleoside line-1 inhibitors
WO2023205786A1 (en) * 2022-04-22 2023-10-26 Rome Therapeutics, Inc. Didehydro-3'-deoxy-4'-ethynylthymidines and related compounds and their use in treating medical conditions

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
ARBELO ROMAN, C. ET AL.: "Diastereoselective Synthesis of (Aryloxy)phosphoramidate Prodrugs.", EUROPEAN JOURNAL OF ORGANIC CHEMISTRY, vol. 2011, no. 25, 2011, pages 4899 - 4909, XP072112359, DOI: 10.1002/ejoc.201100614 *
CARDONNA, V.M.F. ET AL.: "Synthesis and anti-HIV activity of some novel arylphosphate and H-phosphonate derivatives of 3'-azido-2',3'-dideoxythymidine and 2',3'-didehydro-2',3'-dideoxythymidine.", ANTIVIRAL RESEARCH, vol. 42, no. 3, 1999, pages 189 - 196, XP000944433, DOI: 10.1016/S0166-3542(99)00021-2 *
CUI, H. ET AL.: "Potential application of thymidylate kinase in nucleoside analogue activation in Plasmodium falciparum.", BIOORGANIC & MEDICINAL CHEMISTRY, vol. 18, no. 20, 2010, pages 7302 - 7309, XP027357153 *
KANDIL, S. ET AL.: "Polyfluoroaromatic stavudine (d4T) ProTides exhibit enhanced anti-HIV activity.", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 29, no. 24, 2019, pages 126721, XP085913627, DOI: 10.1016/j.bmcl.2019.126721 *
MCGUIGAN, C. ET AL.: "Design, synthesis and biological evaluation of phosphorodiamidate prodrugs of antiviral and anticancer nucleosides", EUROPEAN JOURNAL OF MEDICINAL CHEMISTRY, vol. 70, 2013, pages 326 - 340, XP028794140, DOI: 10.1016/j.ejmech.2013.09.047 *
YING HANGLU, YAO JIE; WU FAN; ZHAO YUFEN; NI FENG: "A mild and concise synthesis of aryloxy phosphoramidate prodrug of alcohols via transesterification reaction", RSC ADVANCES, ROYAL SOCIETY OF CHEMISTRY, GB, vol. 12, no. 21, 28 April 2022 (2022-04-28), GB , pages 13111 - 13115, XP093175103, ISSN: 2046-2069, DOI: 10.1039/D2RA01995G *
YOUNIS, Y. ET AL.: "d4U]-Spacer-[HI-236] double-drug inhibitors of HIV-1 reverse- transcriptase", BIOORGANIC & MEDICINAL CHEMISTRY, vol. 18, no. 13, 2010, pages 4661 - 4673, XP027083654 *

Similar Documents

Publication Publication Date Title
AU2018229497C1 (en) Heterocyclic amides useful as protein modulators
JP5656976B2 (en) Pyrrolotriazine compounds
EP3731869A1 (en) Irak degraders and uses thereof
UA123785C2 (en) Pyrrolotriazine compounds as tam inhibitors
CN114401952A (en) Substituted cycloalkyl compounds as modulators of integrated stress pathways
CN113939300A (en) STAT degradants and uses thereof
CN112218869A (en) Modulators of integrated stress pathways
EA032430B1 (en) Fused pyrimidines for the treatment of hiv
CA3005921A1 (en) Substituted-(pyrrolo[2,3-b]pyridin-3-yl)-pyrimidin derivatives and use thereof as inhibitors of influenza virus replication
CN102421739A (en) Carboxylic acid compound
TW202136242A (en) Smarca degraders and uses thereof
US20240016942A1 (en) Stat degraders and uses thereof
WO2023205786A1 (en) Didehydro-3&#39;-deoxy-4&#39;-ethynylthymidines and related compounds and their use in treating medical conditions
US20240293423A1 (en) Stat degraders and uses thereof
JP2024138421A (en) Chromene Derivatives as Inhibitors of TCR-NCK Interaction - Patent application
WO2022087216A1 (en) Double degraders and uses thereof
US20240261317A1 (en) Methods of treating medical conditions and inhibiting line1 reverse transcriptaseusing a substituted 4-fluoro-2,5-dihydrofuranyl phosphonic acid or related compound
WO2022271878A1 (en) 4-ethynyl-3-hydroxy-tetrahydrofuranyl-adenine phosphoramidates and related compounds and their use in treating medical conditions
WO2024107850A1 (en) Halo-dehydro-3&#39;-deoxyuracil phosphoramidates and related compounds and their use in treating medical conditions
WO2024107859A1 (en) Cyclopentene-oxymethylene phosphonamidates and related compounds and their use in treating medical conditions
WO2024103016A1 (en) 4&#39;-halomethyl-cytidine phosphoramidates and related compounds and their use in treating medical conditions
WO2022271880A1 (en) Methods of treating medical conditions and inhibiting line1 reverse transcriptase using a substituted adeninyl-propyloxy phosphonic acid or related compound
US20230295212A1 (en) Compounds and methods for treating disease
CN113583020B (en) JAK2 inhibitor and application
WO2023178127A1 (en) Methods of treating medical conditions using stampidine or a related compound

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23892485

Country of ref document: EP

Kind code of ref document: A1