WO2024097521A2

WO2024097521A2 - Compositions for treatment of osteogenesis imperfecta

Info

Publication number: WO2024097521A2
Application number: PCT/US2023/076695
Authority: WO
Inventors: Jae-Hyuck SHIM; Guangping Gao; Jun Xie; Yeon-Suk YANG; Sachin CHAUGULE
Original assignee: University Of Massachusetts
Priority date: 2022-11-03
Filing date: 2023-10-12
Publication date: 2024-05-10

Abstract

In some aspects, the disclosure relates to compositions and methods for modulating (e.g., increasing and/or decreasing) expression of COL1A1 or COL1A2 in a subject. In some aspects, the disclosure provides isolated nucleic acids, and vectors such as rAAV vectors, configured to express transgenes that decrease the expression of mutant COL1A1 or COL1A2 (e.g., amiRNAs) and/or provide a wildtype copy of COL1A1 or COL1A2 in certain types of bone cells, for example osteoblasts, osteoclasts, osteocytes, etc. In some embodiments, the isolated nucleic acids and vectors described by the disclosure are useful for treating disorders and conditions associated with mutant COL1A1 or COL1A2 expression, such as osteogenesis imperfecta (OI).

Description

COMPOSITIONS FOR TREATMENT OF OSTEOGENESIS IMPERFECTA

RELATED APPLICATIONS

This application claims the benefit under 35 U.S.C. § 119(e) of the filing date of U.S. provisional application serial number USSN 63/422,062, filed November 3, 2022, the entire content of which is incorporated herein by reference.

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

The contents of the electronic sequence listing (U012070160WO00-SEQ-MSB.xml; Size: 128,243 bytes; and Date of Creation: October 10, 2023) is herein incorporated by reference in its entirety.

BACKGROUND

Collagen production is important for healthy bone development; mutations in collagen production can lead to lifelong issues with bone development, such as osteogenesis imperfecta (01), the most common bone-fragility disease. OI is an inherited genetic disorder that primarily affects the skeleton, including low bone mass, recurrent bone fractures following minor trauma, bowing of the long bones, vertebral compression, scoliosis, bone pain, stunted growth, and ligamentous and joint laxity. The majority of OI patients have a mutation in either the COL1A1 or COL1A2 gene, both of which encode a portion of the type 1 collagen protein. Current treatments for OI include surgical intervention with intramedullary stabilization and the use of prostheses, and pharmacological agents that are mostly borrowed from those developed for the treatment of osteoporosis or osteolytic bone metastasis and their complications. However, these drugs show limited success in clinic since they do not correct the underlying genetic defects in collagen production.

SUMMARY

Aspects of the disclosure relate to compositions and methods for modulating (e.g., increasing or decreasing) COL1A expression, for example expression of COL1A1 and/or COL1A2 expression. The disclosure is based, in part, on isolated nucleic acids, recombinant adeno-associated viruses (rAAVs), and compositions that encode one or more transgenes that modulate COL1A expression. In some embodiments, rAAVs described by the disclosure are useful for treating a disease or disorder associated with dysfunctional COL1A expression (e.g., osteogenesis imperfecta).

Accordingly, in some aspects, the disclosure provides an isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding a COL1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

In some embodiments, a COL1A2 protein is a human COL1A2 protein. In some embodiments, a COL1A2 protein is a mouse COL1A2 protein.

In some embodiments, a nucleic acid sequence encoding the COL1A2 protein is a codon-optimized sequence. In some embodiments, a codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or 2. In some embodiments, a codon-optimized nucleic acid sequence comprises at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 1 or 2 (e.g., wherein the codon-optimized nucleic acid does not comprise the wild-type nucleic acid sequences of SEQ ID NO: 7 or 8).

In some embodiments, a COL1A2 protein comprises the amino acid sequence set forth in SEQ ID NO: 3 or 4.

In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding a COL1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs); and at least one AAV capsid protein.

In some embodiments, at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof. In some embodiments, at least one AAV capsid protein is an AAV9 capsid protein.

In some aspects, the disclosure provides an isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A mRNA transcript flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

In some embodiments, at least one inhibitory nucleic acid is a dsRNA, siRNA, shRNA, miRNA, or artificial miRNA (ami-RNA).

In some embodiments, at least one inhibitory nucleic acid comprises a region of complementarity with a mutant COL1A2 sequence. In some embodiments, a mutant COL1A2 mRNA transcript comprises a AG deletion at position 3978 or 3983 of a wild-type C0L1A2 sequence.

In some embodiments, at least one inhibitory nucleic acid does not inhibit expression of wild-type C0L1A2.

In some embodiments, at least one inhibitory nucleic acid is an artificial miRNA (ami- RNA). In some embodiments, an ami-RNA comprises a miRNA backbone selected from: mlR- 33, miR-168, miR-157, miR-155, and miR-30 backbone. In some embodiments, at least one inhibitory nucleic acid comprises the sequence set forth in any one of SEQ ID NOs: 20-24.

In some embodiments, a transgene further comprises a promoter operably linked to the nucleic acid sequence, optionally wherein the promoter comprises or consists of a Ula promoter sequence (e.g., comprising the nucleic acid sequence of SEQ ID NO: 19).

In some embodiments, AAV ITRs are AAV2 ITRs.

In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding a COL1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs); and at least one AAV capsid protein; and at least one AAV capsid protein.

In some aspects, the disclosure provides an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a COL1A2 protein; and a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A mRNA transcript, wherein the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

In some embodiments, a nucleic acid sequence encoding a COL1A2 protein is a codon- optimized sequence. In some embodiments, a codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In some embodiments, a codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 2. In some embodiments, the codon-optimized nucleic acid sequence encodes a wild-type COL1A2 protein and has at least 80%, at least 85%, at least 90%, or at least 95% identity to the nucleic acid sequence set forth in SEQ ID NO: 1. In some embodiments, the codon-optimized nucleic acid sequence encodes a wild-type COL1A2 protein and has at least 80%, at least 85%, at least 90%, or at least 95% identity to the nucleic acid sequence set forth in SEQ ID NO: 2.

In some embodiments, an isolated nucleic acid comprising a first nucleic acid sequence encoding a COL1A2 protein; and a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A mRNA transcript further comprises a promoter operably linked to the nucleic acid sequence encoding the COL1A2 protein. In some embodiments, the promoter comprises a chicken P-actin promoter (CBA) and/or a synthetic intron. In some embodiments, the promoter comprises a Ula promoter.

In some embodiments, a Ula promoter comprises the nucleic acid sequence of SEQ ID NO: 19.

In some embodiments, at least one inhibitory nucleic acid comprises a region of complementarity with a COL1A2 mRNA transcript (e.g., a mutant COL1A2 mRNA transcript). In some embodiments, a wild-type COL1A2 mRNA transcript comprises or consists of the nucleic acid sequence set forth in NCBI Reference Sequence: NM_000089.4. In some embodiments, a mutant COL1A2 mRNA transcript comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence (e.g., a wild-type COL1A2 sequence comprising or consisting of the nucleic acid sequence set forth in NCBI Reference Sequence: NM_000089.4).

In some embodiments, the at least one inhibitory nucleic acid does not inhibit expression of wild-type COL1A2.

In some embodiments, the at least one inhibitory nucleic acid is an artificial miRNA (ami-RNA). In some embodiments, an ami-RNA comprises a miRNA backbone selected from: miR-33, miR-168, miR-157, miR-155, and miR-30 backbone. In some embodiments, at least one inhibitory nucleic acid comprises the sequence set forth in any one of SEQ ID NOs: 20-24.

In some embodiments, an isolated nucleic acid comprising a first nucleic acid sequence encoding a COL1A2 protein; and a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A sequence further comprises a promoter operably linked to the nucleic acid sequence encoding one or more inhibitory nucleic acids. In some embodiments, a promoter comprises a chicken P-actin (CBA) promoter or a Ula promoter.

In some embodiments, AAV ITRs are AAV2 ITRs.

In some embodiments, a second nucleic acid sequence (e.g., an isolated nucleic acid encoding one or more inhibitory nucleic acids) is positioned 5’ relative to a first nucleic acid sequence (e.g., an isolated nucleic acid encoding a C0L1A2 protein). In some embodiments, a second nucleic acid sequence (e.g., an isolated nucleic acid encoding one or more inhibitory nucleic acids) is positioned in an intron (e.g., an intron of the first nucleic acid, such as an isolated nucleic acid encoding a C0L1A2 protein).

In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a C0L1A2 protein; and a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a C0L1A mRNA transcript; and at least one AAV capsid protein.

In some aspects, the disclosure provides a nucleic acid comprising a first nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene; and a second nucleic acid sequence encoding a CRISPR/Cas protein, optionally wherein the nucleic acid further comprises adeno-associated virus (AAV) inverted terminal repeats (ITRs).

In some embodiments, a sgRNA comprises a region of complementarity with a mutant COL1A2 gene. In some embodiments, a mutant COL1A2 gene comprises a AG deletion at position 3978 or 3983 of a wild-type C0L1A2 sequence. In some embodiments, a sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

In some embodiments, a nucleic acid further comprises a promoter. In some embodiments, a promoter comprises a chicken P-actin (CBA) promoter or a U6 promoter. In some embodiments, a promoter is positioned between a first (e.g., nucleic acid encoding a single guide RNA) and a second (e.g., nucleic acid encoding a CRISPR/Cas protein) nucleic acid sequence.

In some embodiments, a CRISPR/Cas protein is a Staphylococcus aureus Cas9 protein (saCas9). In some embodiments, AAV ITRs are AAV2 ITRs.

In some aspects, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene; and a second nucleic acid sequence encoding a CRISPR/Cas protein; and at least one AAV capsid protein.

In some aspects, the disclosure provides an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a portion of a wild-type COL1A2 protein; and a second nucleic acid sequence encoding a Precise Integration into Target Chromosome (PITCH) gRNA binding site, wherein the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

In some embodiments, the first nucleic acid sequence encoding a portion of a wild-type CollA2 protein comprises the sequence set forth in any one of SEQ ID NO: 33-35.

In some embodiments, a transgene further comprises an intron and/or a 3’ untranslated region (3’ UTR). In some embodiments, a 3’ UTR is a COL1A2 3’ UTR.

In some embodiments, a transgene further comprises a poly-adenylation (poly A) signal. In some embodiments, a polyA signal is an SV40 polyA signal. In some embodiments, a 3’UTR and/or a polyA signal is positioned between the first nucleic acid sequence (e.g., isolated nucleic acid encoding a single guide RNA (sgRNA) targeting a COL1A2 gene) and a second nucleic acid sequence (e.g., isolated nucleic acid encoding a CRISPR/Cas protein).

In some embodiments, a PITCH gRNA binding site comprises a sequence having a region of complementarity to the nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

In some embodiments, AAV ITRs are AAV2 ITRs.

In some embodiments, the disclosure provides a recombinant adeno-associated virus (rAAV) comprising an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a portion of a wild-type COL1A2 protein; and a second nucleic acid sequence encoding a Precise Integration into Target Chromosome (PITCH) gRNA binding site; and at least one AAV capsid protein. In some embodiments, at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof. In some embodiments, at least one AAV capsid protein is an AAV9 capsid protein.

In some aspects, the disclosure provides a composition comprising an rAAV comprising an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene; and a second nucleic acid sequence encoding a CRISPR/Cas protein; and an rAAV comprising an isolated nucleic acid comprising a transgene comprising a first nucleic acid sequence encoding a portion of a wildtype C0L1A2 protein; and a second nucleic acid sequence encoding a Precise Integration into Target Chromosome (PITCH) gRNA binding site.

In some embodiments, a composition further comprises a nucleic acid sequence encoding a PITCH gRNA.

Some aspects of the disclosure provide a system comprising one or more the gene editing techniques described herein. For example, in some embodiments, provided herein is a system comprising (i) a nucleic acid for C0L1A2 gene replacement (e.g., a nucleic comprising a transgene comprising a nucleic acid sequence encoding a C0L1A2 protein flanked by adeno- associated virus (AAV) inverted terminal repeats (ITRs)); (ii) a nucleic acid for C0L1A2 gene knockdown (e.g., a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a C0L1A mRNA transcript); and/or (iii) one or more nucleic acids for CRISPR/Cas editing of C0L1A2 gene (e.g., a nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene and a nucleic acid sequence encoding a CRISPR/Cas protein).

In some embodiments, a system comprises (i) a nucleic acid for C0L1A2 gene replacement (e.g., a nucleic comprising a transgene comprising a nucleic acid sequence encoding a C0L1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs)); and (ii) a nucleic acid for C0L1A2 gene knockdown (e.g., a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a C0L1A mRNA transcript).

In some embodiments, a system comprises (i) a nucleic acid for C0L1A2 gene replacement (e.g., a nucleic comprising a transgene comprising a nucleic acid sequence encoding a C0L1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs)); and (ii) one or more nucleic acids for CRISPR/Cas editing of C0L1A2 gene (e.g., a nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene and a nucleic acid sequence encoding a CRISPR/Cas protein). In some embodiments, a system comprises (i) a nucleic acid for COL1A2 gene knockdown (e.g., a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A mRNA transcript); and (ii) one or more nucleic acids for CRISPR/Cas editing of COL1A2 gene (e.g., a nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene and a nucleic acid sequence encoding a CRISPR/Cas protein).

In some embodiments, a system comprises (i) a nucleic acid for COL1A2 gene replacement (e.g., a nucleic comprising a transgene comprising a nucleic acid sequence encoding a COL1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs)); (ii) a nucleic acid for COL1A2 gene knockdown (e.g., a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A mRNA transcript); and (iii) one or more nucleic acids for CRISPR/Cas editing of COL1A2 gene (e.g., a nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene and a nucleic acid sequence encoding a CRISPR/Cas protein).

In some aspects, the disclosure provides a method for inducing collagen production in a subject, the method comprising administering to the subject an isolated nucleic acid or rAAV as described herein.

In some aspects, the disclosure provides a method for treating a disease associated with a mutation of the COL1A1 or COL1A2 gene, the method comprising administering to a subject in need thereof an isolated nucleic acid, rAAV, or composition as described herein.

In some embodiments, a disease is selected from osteogenesis imperfecta (01), arthrochalasia type Ehlers-Danlos syndrome (aEDS), cardiac-valvular type Ehlers-Danlos syndrome (cvEDS), Caffey disease.

In some aspects, the disclosure provides a method for treating osteogenesis imperfecta (01) in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid, rAAV, or composition as described herein.

In some embodiments, a subject is a mammal. In some embodiments, a subject is a human.

In some embodiments, a subject has one or more mutations in a COL1A2 gene. In some embodiments, one or more mutations in a COL1A2 gene comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence. In some embodiments, administration comprises injection. In some embodiments, injection comprises intravenous injection, intramuscular injection, or injection into a joint of the subject.

In some embodiments, administration comprises implantation of a tissue or graft comprising an isolated nucleic acid, rAAV, or composition as described herein to a subject.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 is a schematic diagram depicting an exemplary frameshift mutation in a mouse COL1A2 gene.

FIGs. 2A-2C show experimental results demonstrating that OIM-OI mice display multiple skeletal abnormalities. FIGs. 2A and 2B show X-ray images of 3-month-old male OIM- OI mice display multiple bone fractures (arrows, FIG. 2A) and pelvic bone deformity (FIG. 2B). MicroCT analysis of the femur demonstrates severe osteoporosis and skeletal deformity (FIG. 2C). n=3 mice/group, +/+; WT, m/m; OIM-OI.

FIGs. 3A-3D show graphical representations of 01 phenotypes in OIM-BMSCs. Primary BMSCs were isolated from 2-month-old OIM^+/+ and OIM^1117111 mice and cultured under osteogenic conditions. ALP activity at day 6 and mineralization at day 18 were assessed for early and late OB marker, respectively (data shown in FIGs. 3A and 3B). Alamar blue staining was used to analyze cell proliferation. COL1A1 mRNA levels and unfolded collagen fibers were analyzed by RT-PCR and collagen peptide staining, respectively (results shown in FIGs. 3C and 3D).

FIG. 4 shows a schematic diagram of an AAV vector genome for gene addition, silencing, or replacement. hColla2 and mColla2: human and mouse Colla2, respectively.

FIG. 5 shows a schematic diagram of amiR-sensor plasmids for mouse Colla2-AG, -WT, or -opt. Flue indicates firefly luciferase; Rluc indicates renilla luciferase.

FIG. 6A and 6B show schematic diagrams of an exemplary CRISPR/Cas9-mediated homology-directed gene editing strategy. FIG. 6A shows three major double stranded break (DSB) repair mechanisms induced by CRISPR/Cas9. Red lines indicate the MMEJ pathway. FIG. 6B shows MMEJ-mediated precise integration into target chromosome (PITCH) strategies. DSB: DNA double-strand break, HR: homologous recombination, NHEJ: non-homologous end joining, MMEJ: microhomology-mediated end joining. GOI: gene of interest.

FIG. 7A-7C show schematic diagrams of AAV vector genomes for CRISPR/Cas9- mediated gene editing. FIG. 7A shows an IM mutation strategy in the mouse Colla2 gene showing the deletion of G at 3978 in the C-terminal pro-peptide domain. PAM: protospacer- adjacent motif. T1 and T2: sgRNAl and sgRNA2 target sites. FIG. 7B shows a CRISPR/saCas9 strategy: AAV vector genome containing sgRNA 1 or 2 and saCas9. FIG. 7C shows a Gene ride strategy: AAV vector genome containing a partial Colla2 sequences for homologous recombination. ITR: inverted terminal repeats, CB: chicken P-actin promoter, PAM: protospacer-adjacent motif.

FIG. 8 shows a graphical representation of effects of CRISPR/SaCas9-mediated gene editing in OIM-OI osteoblasts (OBs). OIM+/+ BMSCs and OIMm/m BMSCs infected with the indicated AAV vectors and cultured under osteogenic conditions. 6 days after infection, ALP activity was measured for osteogenic activity and cell viability was assessed using Alamar blue staining (n=10/group).

FIG. 9 shows a schematic of experimental plans for skeletal analyses in engineered mice.

FIGs. 10A-10F show therapeutic effects of CRISPR/Cas9-mediated gene editing in OIM-OI mice. 1 month old (FIG. 10A) or postnatal day 1 (Pl, FIG. 10B) OIM^+/+ OIM'"⁷'" mice (n=l~7/group) were i.v. injected with rAAV9 carrying vector control (ctrl) or the CRISPR/SaCas9 (sgRNAl. SaCas9, 5xl0¹³ vg/kg). At 3 months of age, X-radiography (FIGS. 10A, 10B, 10D, 10F) and microCT (FIG. 10C) and Kondziela scoring (FIG. 10E) were performed to assess skeletal phenotypes and grab strength, respectively. Tra.BV/TV; trabecular bone volume/tissue volume. Circles in FIG. 9A indicate areas of bone fracture and skeletal deformity.

FIGs. 11A-11B show schematics of nucleic acids encoding Colla2 and a Precise Integration into Target Chromosome (PITCH) guide RNA site.

FIG. 12 provides schematics for exemplary nucleic acids for delivery of a SaCas9/sgRNA system (top) and/or a partial Colla2 gene (bottom).

FIG. 13 A provides a schematic diagram showing a frameshift mutation in the Colla2 gene of homozygous OIM (OIM) mice. Deletion of a guanine (G) at nucleotide 3983 of the Coll a2 gene induces a frameshift of approximately 50 terminal amino acids of the pro-oc2 C-terminal propeptide domain.

FIG. 13B provides a schematic diagram shows the repairing template sequences of pro- oc2 C-terminal propeptide domain. Eight nucleotides were replaced as codon optimization to stabilize the corrected Colla2 protein expression. FIGs. 13C-13E demonstrate that AAV vectors encoding Cas9/guide RNA systems or replacement gene systems are capable of correcting Colla2 mutations in OIM mice.

FIGs. 13F-13H demonstrates that AAV vectors encoding Cas9/guide RNA systems or replacement gene systems are capable of restoring ALP activity in OIM mice back to wild-type levels following administration of the AAV vectors to the OIM mice.

FIG. 14A provides a graph showing that AAV9 preferentially targets liver, muscle, and bone tissues.

FIG. 14B demonstrates the ability of AAV9 encoding a Colla2 replacement gene or a combination of a Cas9/guide RNA and a Colla2 replacement gene to correct genetic mutation.

FIG. 14C demonstrates the ability of AAV9 encoding a Colla2 replacement gene or a combination of a Cas9/guide RNA and a Colla2 replacement gene to express the corrected Coll a2 gene (CoZ7tz2^G/OIM) and/or SaCas9 nuclease in the tibia.

FIGs. 15A-15E provides graphs that demonstrate that AAV-mediated Colla2 gene correction ameliorates 01 skeletal phenotypes in OIM mice.

FIG. 16 provides graphs that demonstrate that AAV-mediated delivery of a codon- optimized Colla2 gene ameliorates 01 skeletal phenotypes in OIM mice.

FIG. 17A provides a schematic of a nucleic acid encoding an amiR targeting mouse Colla2 and a codon-optimized human Colla2 gene.

FIG. 17B provides a graph showing that delivery of an AAV encoding an amiR targeting mouse Colla2 and a codon-optimized human Colla2 gene is capable of reducing mouse Colla2 expression and increasing human Colla2 expression in mice.

FIG. 17C provides a graph showing that delivery of an AAV encoding an amiR targeting mouse Colla2 and a codon-optimized human Colla2 gene is capable of reducing Tnalp and Bglap expression in mice.

FIGs. 18A-18D provide validation of an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl°^PT) in HEK293T cells.

FIG. 19 provides a graph showing the biodistribution of AAV9 expressing EGFP under the control of a U1 A promoter in mice.

FIGs. 20A-20E demonstrate the ability of an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl°^PT) to ameliorate skeletal phenotypes in OIM mice.

FIGs. 21A-21J demonstrate the ability of an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl°^PT) to ameliorate skeletal phenotypes in OIM mice. FIGs. 22A-22F demonstrate the ability of an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl^OPT) to ameliorate skeletal phenotypes in newborn OIM mice (e.g., as a preventative treatment).

FIGs. 23A-23E provide microscopic assessment of collagen structure in OIM mice treated with an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl^OPT).

FIGs. 24A-4D provide transcriptome analysis in OIM mice treated with an AAV9 plasmid expressing codon-optimized human COL1A2 (hCOLlAl^OPT).

FIGs. 25A-25E demonstrates that AAV-mediated expression of hCOLlAl^OPT reduces osteogenic differentiation of OIM osteoblasts.

DETAILED DESCRIPTION

Aspects of the disclosure relate to compositions (e.g., isolated nucleic acids, rAAVs, etc.) that when delivered to a subject are effective for modulating expression of COL1A genes, for example by silencing a mutant Collagen, type I, alpha 1 (COL1A 1) or Collagen, type I, alpha 2 (COLJA2) allele and introducing a wild-type COL1A1 or COL1A2 allele to replace said mutant allele. In some aspects, the disclosure relates to delivery of one or more components (e.g., isolated nucleic acids, rAAVs, single guide RNAs (sgRNAs), gene editing proteins such as CRISPR/Cas proteins, etc.) that mediate gene editing of mutant COL1A genes. Accordingly, methods and compositions described by the disclosure are useful, in some embodiments, for the treatment of diseases and disorders associated with mutations in the COL1A1 or COL1A2 gene, such as osteogenesis imperfecta (01).

Osteogenesis imperfecta (01) is the most common bone-fragility disease with an incidence of approximately 1 in 15,000 worldwide. OI is an inherited genetic disorder that primarily affects the skeleton, including low bone mass, recurrent bone fractures following minor trauma, bowing of the long bones, vertebral compression, scoliosis, bone pain, stunted growth, and ligamentous and joint laxity. Approximately 85% of OI patients have autosomal dominant mutations in either the COL1A1 or COL1A2 gene that encode the pro-alphal(I) or pro- alpha2(I) polypeptide chains of type I collagen, the major structural protein of bone. Other OI patients have dominant, recessive or X-linked mutations in the genes associated with collagen synthesis, processing or crosslinking. A mild form of OI (type 1) results from a quantitative loss of alphal(I) chain by heterozygous COL1A1 mutations causing null allele while the other normal allele produces healthy collagen. Conversely, dominant negative mutations in the COL1A1 or COL1A2 gene result in most often glycine substitutions in the Gly-X-Y collagen repeat, causing structural defects of the collagen triple helix, which hinders the formation of normal collagen chains. These structural mutations induce protracted collagen folding with overmodification of lysine residues in the ER, enlargement of the ER due to accumulation of misfolded chains, abnormal collagen trafficking, and delayed secretion in the extracellular matrix, and therefore cause highly heterogenous 01 phenotypes, ranging from perinatal lethal (type 2), to severe (type 3), to moderate 01 (type 4). Treatments of 01 depend mainly on the clinical severity with the primary goal to improve bone strength, reduce fracture risk and pain, increase mobility and functional independence, and prevent long-term complications.

Mutations in C0L1A genes can lead to other ailments, such as arthrochalasia type Ehlers-Danlos syndrome (aEDS), cardiac-valvular type Ehlers-Danlos syndrome (cvEDS), Caffey disease, or an overlap syndrome of any of the foregoing. In some embodiments, a human subject experiencing 01 (or predisposed to developing 01) has a four nucleotide deletion (c.4001_4004del) that induces a frameshift of 33 terminal amino acids of the pro-COLlA2 (p.(Asnl334Serfs*34)).

In some aspects, the present disclosure provides compositions and methods for silencing a mutant allele of COL1A (for example, COL1A1 or COL1A2). In some embodiments, the mutant allele is a dominant negative allele, meaning that production of the gene product of the allele detracts from the presence of the gene product of a wild-type allele. For example, production of dominant negative C0L1A21 or C0L1A2 interferes with production of normal collagen, even in the presence of a wild-type C0L1A1 or C0L1A2 allele. In some embodiments, compositions and methods described herein comprise providing isolated nucleic acids using a recombinant adeno-associated virus (rAAV) particle.

In some aspects, the present disclosure provides compositions and methods for providing a construct encoding a wildtype C0L1A1 or C0L1A2 peptide. In some aspects, the present disclosure provides compositions and methods for both silencing a mutant allele of C0L1A (for example, C0L1A1 or C0L1A2) and for providing a construct encoding a wildtype C0L1A1 or C0L1A2 peptide. In some embodiments, these compositions and methods comprise providing isolated nucleic acids using an rAAV delivery system.

Isolated Nucleic Acids Compositions and methods for delivering a transgene (e.g. an inhibitory RNA, such as an shRNA, miRNA, etc.) to a subject are provided in the disclosure. The compositions typically comprise an isolated nucleic acid comprising a transgene (e.g., a protein, an inhibitory nucleic acid, etc.) that decreases expression of a mutant COL1A1 or COL1A2 allele or provides a wildtype copy of a COL1A1 or COL1A2 allele. For example, in some embodiments, a transgene reduces expression of a mutant COL1A1 or COL1A2 allele. In some embodiments, a transgene encodes a wildtype COL1A1 or COL1A2 protein.

In some aspects, the present disclosure provides isolated nucleic acids encoding a COL1A2 protein (e.g., a wild-type COL1A2 protein). In some embodiments, an isolated nucleic acid comprises a nucleic acid sequence encoding a COL1A2 protein flanked by adeno- associated virus (AAV) inverted terminal repeats (ITRs). A COL1A2 protein may be a human COL1A2 protein (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 3) or a mouse COL1A2 protein (e.g., comprising or consisting of the amino acid sequence of SEQ ID NO: 4).

A nucleic acid encoding a COL1A2 protein may be a codon-optimized sequence. In some embodiments, a codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In some embodiments, a codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 2. A codon-optimized nucleic acid sequence may comprise at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 1 or 2 (e.g., wherein the codon- optimized nucleic acid does not comprise a wild-type COL1A2 allele, e.g., the nucleic acid sequence of SEQ ID NO: 7 or 8).

In an aspect, the present disclosure provides isolated nucleic acids. In some embodiments, the isolated nucleic acid is an inhibitory nucleic acid, described below. In some embodiments, the isolated nucleic acid is a transgene encoding a COL1A1 or COL1A2 peptide. In some embodiments, the COL1A1 or COL1A2 peptide is a wildtype COL1A1 or COL1A2 peptide. In an aspect, the present disclosure provides a composition comprising both an inhibitory nucleic acid and a transgene encoding a COL1A1 or COL1A2 peptide. In some embodiments, the present disclosure provides a method for ameliorating type 1 collagen defects by reducing expression of a mutant allele while providing a wildtype copy of the allele by way of replacement. In some embodiments, an isolated nucleic acid encodes one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) inhibitory nucleic acids, for example dsRNA, siRNA, shRNA, miRNA, artificial microRNA (ami-RNA), etc.). Generally, an inhibitory nucleic acid specifically binds to (e.g., hybridizes with) at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) continuous bases of a COL1A1 or COL1A2 gene. As used herein “continuous bases” refers to two or more nucleotide bases that are covalently bound (e.g., by one or more phosphodiester bond, etc.) to each other (e.g. as part of a nucleic acid molecule). In some embodiments, the at least one inhibitory nucleic acid is about 50%, about 60% about 70% about 80% about 90%, about 95%, about 99% or about 100% identical to the two or more ( e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more) continuous nucleotide bases of a gene encoding COL1A1 or COL1A2.

A “microRNA” or “miRNA” is a small non-coding RNA molecule capable of mediating transcriptional or post-translational gene silencing. Typically, miRNA is transcribed as a hairpin or stem- loop (e.g., having a self-complementarity, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. The length of a pri-miRNA can vary. In some embodiments, a pri-miRNA ranges from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs) in length. In some embodiments, a pri-miRNA is greater than 200 base pairs in length (e.g., 2500, 5000, 7000, 9000, or more base pairs in length.

In some embodiments, a miRNA or ami-RNA that targets Colla2 for inhibition comprises one or more nucleic acid miRNA sequences provided in Table 1. In some embodiments, a miRNA or ami-RNA that targets Colla2 for inhibition comprises a miR-33 backbone. In some embodiments, a miRNA or ami-RNA that targets Colla2 for inhibition comprises a antisense sequence comprising or consisting of a nucleic acid sequence of any one of SEQ ID NOs: 20-24. In some embodiments, a miRNA or ami-RNA that targets Colla2 for inhibition comprises or consists of a nucleic acid sequence of any one of SEQ ID NOs: 25-29.

Table 1. miRNA sequences for targeting Colla2

Pre-miRNA, which is also characterized by a hairpin or stem-loop duplex structure, can also vary in length. In some embodiments, pre-miRNA ranges in size from about 40 base pairs in length to about 500 base pairs in length. In some embodiments, pre-miRNA ranges in size from about 50 to 100 base pairs in length. In some embodiments, pre-miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length).

Generally, pre-miRNA is exported into the cytoplasm, and enzymatically processed by Dicer to first produce an imperfect miRNA/miRNA* duplex and then a single-stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC). Typically, a mature miRNA molecule ranges in size from about 19 to about 30 base pairs in length. In some embodiments, a mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length.

In some aspects, the disclosure provides isolated nucleic acids and vectors (e.g., rAAV vectors) that encode one or more artificial miRNAs. As used herein “artificial miRNA” or “amiRNA” refers to an endogenous pri-miRNA or pre-miRNA (e.g., a miRNA backbone, which is a precursor miRNA capable of producing a functional mature miRNA), in which the miRNA and miRNA* (e.g., passenger strand of the miRNA duplex) sequences have been replaced with corresponding amiRNA/amiRNA* sequences that direct highly efficient RNA silencing of the targeted gene, for example as described by Eamens et al. (2014), Methods Mol. Biol. 1062:211- 224. For example, in some embodiments an artificial miRNA comprises a miR-155 pri-miRNA backbone into which a sequence encoding an inhibitory miRNA has been inserted in place of the endogenous miR-155 mature miRNA-encoding sequence. In some embodiments, miRNA (e.g., an artificial miRNA) as described by the disclosure comprises a miR-33 backbone sequence, a miR-155 backbone sequence, a miR-30 backbone sequence, a mir-64 backbone sequence, or a miR-122 backbone sequence.

In some embodiments, the present disclosure provides vectors comprising the isolated nucleic acids described herein. Exemplary vectors include plasmids and baculoviral vectors. In some embodiments, the present disclosure provides an isolated nucleic acid comprising a transgene encoding an artificial microRNA targeting the COL1A1 gene (GenelD: 1277), which encodes the pro-alpha 1 chain portion of a type 1 collagen protein. In some embodiments, the present disclosure provides an isolated nucleic acid comprising a transgene encoding an artificial microRNA targeting the COL1A2 gene (GenelD: 1278), which encodes the pro-alpha 2 chain portion of a type 1 collagen protein. Type 1 collagen is a fibril forming collagen found in most connective tissues.

In some aspects, the disclosure relates to an isolated nucleic acid comprising a transgene encoding an artificial microRNA is used to reduce expression of a mutant COL1A allele (e.g., expression of one or more gene products from a dominant negative allele of COL1A1 or COL1A2).

In some embodiments, an artificial microRNA targets (e.g., binds to, or comprises a region of complementarity with) at least 6 continuous nucleotides of a COL1A1 or COL1A2 gene. In some embodiments, an artificial microRNA targets (e.g., binds to, or comprises a region of complementarity with) between 6 and 30 continuous nucleotides of a COL1A1 or COL1A2 gene. In some embodiments, an artificial microRNA targets between 12-24 continuous nucleotides of a COL1A1 or COL1A2 gene. In some embodiments, an artificial microRNA targets between 9-27 continuous nucleotides of the COL1A1 or COL1A2 gene. In some embodiments, an artificial microRNA targets at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 continuous nucleotides of a COL1A1 or COL1A2 gene.

In some embodiments, at least one inhibitory nucleic acid comprises a region of complementarity with a COL1A2 mRNA transcript (e.g., a mutant COL1A2 mRNA transcript). In some embodiments, a wild-type COL1A2 mRNA transcript comprises or consists of the nucleic acid sequence set forth in NCBI Reference Sequence: NM_000089.4. In some embodiments, a mutant COL1A2 mRNA transcript comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence (e.g., a wild-type COL1A2 sequence comprising or consisting of the nucleic acid sequence set forth in NCBI Reference Sequence: NM_000089.4). In some embodiments, a mutant COL1A2 sequence comprises or consists of the nucleic acid sequence set forth in NCBI Reference Sequence: NM_007743.3:c.3978del. A mutant COL1A2 comprising a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence is as described in Chipman, S.D. et al. Proc. Natl. Acad. Sci. USA., Vol.90, pp.1701- 1705, March 1993; or Lu, Y. et al., Intractable Rare Dis Res. 2019 May; 8(2): 98-107.

In some embodiments, an artificial microRNA is between 6-50 nucleotides in length. In some embodiments, an artificial microRNA is between 8-24 nucleotides in length. In some embodiments, an artificial microRNA is between 12-36 nucleotides in length. In some embodiments, an artificial microRNA is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

In some embodiments, an isolated inhibitory nucleic acid decreases expression of a target gene by between 50% and 99% (e.g., any integer between 50% and 99%, inclusive). In some aspects, an isolated inhibitory nucleic acid decreases expression of a target gene by between 75% and 90%. In some aspects, an isolated inhibitory nucleic acid decreases expression of a target gene by between 80% and 99%. In some embodiments, an isolated inhibitory nucleic acid decreases expression of a COL1A1 or COL1A2 gene by between 50% and 99% (e.g., any integer between 50% and 99%, inclusive). In some embodiments, an isolated inhibitory nucleic acid decreases expression of a COL1A1 or COL1A2 gene by between 75% and 90%. In some aspects, an isolated inhibitory nucleic acid decreases expression of a COL1A1 or COL1A2 gene by between 80% and 99%.

A region comprising a transgene (e.g., a second region, third region, fourth region, etc.) may be positioned at any suitable location of the isolated nucleic acid. The region may be positioned in any untranslated portion of the nucleic acid, including, for example, an intron, a 5’ or 3’ untranslated region, etc.

In some cases, it may be desirable to position the region (e.g., the second region, third region, fourth region, etc.) upstream of the first codon of a nucleic acid sequence encoding a protein (e.g., a protein coding sequence). For example, the region may be positioned between the first codon of a protein coding sequence) and 2000 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 1000 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 500 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 250 nucleotides upstream of the first codon. The region may be positioned between the first codon of a protein coding sequence and 150 nucleotides upstream of the first codon. In some cases (e.g., when a transgene lacks a protein coding sequence), it may be desirable to position the region (e.g., the second region, third region, fourth region, etc.) upstream of the poly-A tail of a transgene. For example, the region may be positioned between the first base of the poly-A tail and 2000 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 1000 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 500 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 250 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 150 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 100 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 50 nucleotides upstream of the first base. The region may be positioned between the first base of the poly-A tail and 20 nucleotides upstream of the first base. In some embodiments, the region is positioned between the last nucleotide base of a promoter sequence and the first nucleotide base of a poly-A tail sequence.

In some cases, the region may be positioned downstream of the last base of the poly-A tail of a transgene. The region may be between the last base of the poly-A tail and a position 2000 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 1000 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 500 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 250 nucleotides downstream of the last base. The region may be between the last base of the poly-A tail and a position 150 nucleotides downstream of the last base.

It should be appreciated that in cases where a transgene encodes more than one miRNA, each miRNA may be positioned in any suitable location within the transgene. For example, a nucleic acid encoding a first miRNA may be positioned in an intron of the transgene and a nucleic acid sequence encoding a second miRNA may be positioned in another untranslated region (e.g., between the last codon of a protein coding sequence and the first base of the poly-A tail of the transgene).

In some embodiments, an isolated nucleic acid comprises a transgene comprising: (i) a first nucleic acid sequence encoding a COL1A2 protein (e.g., a human COL1A2 protein); and (ii) a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A sequence (e.g., a miRNA or ami-RNA that targets Colla2 for inhibition comprises a antisense sequence comprising or consisting of a nucleic acid sequence of any one of SEQ ID NOs: 20-24). In some embodiments, the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs) (e.g., AAV2 ITRs).

In some aspects, the present disclosure provides isolated nucleic comprising a guide RNA (e.g., a single guide RNA (sgRNA)) that targets a COL1A2 gene, and a gene editing molecule (e.g., a CRISPR/Cas protein).

As used herein, “gene editing molecule” refers to a biologically active molecule (e.g., a protein, one or more proteins, a nucleic acid, one or more nucleic acids, or any combination of the foregoing) configured for adding, disrupting or changing genomic sequences (e.g., a gene sequence), for example by causing a double stranded break (DSB) in a target DNA or inhibiting transcription of a target DNA sequence. Examples of gene editing molecules include but are not limited to Transcription Activator-like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), engineered meganuclease re-engineered homing endonucleases, the CRISPR/Cas system, and meganucleases (e.g., Meganuclease I-Scel). In some embodiments, a gene editing molecule comprises proteins or molecules (e.g., recombinant gene editing proteins) related to the CRISPR/Cas system, including but not limited to Cas9, Cas6, dCas9, Cpfl, CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and variants thereof.

In some embodiments, a recombinant gene editing protein is a nuclease. As used herein, the terms “endonuclease” and “nuclease” refer to an enzyme that cleaves a phosphodiester bond or bonds within a polynucleotide chain. Nucleases may be naturally occurring or genetically engineered. Genetically engineered nucleases are particularly useful for genome editing and are generally classified into four families: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases (e.g., engineered meganucleases) and CRISPR- associated proteins (Cas nucleases). In some embodiments, the nuclease is a ZFN. In some embodiments, the ZFN comprises a FokI cleavage domain. In some embodiments, the ZFN comprises Cys2His2 fold group. In some embodiments, the nuclease is a TALEN. In some embodiments, the TALEN comprises a FokI cleavage domain. In some embodiments, the nuclease is a meganuclease. Examples of meganucleases include but are not limited to I-Scel, I- Crel, I-Dmol, and combinations thereof (e.g., E-Drel, DmoCre).

The term “CRISPR” refers to “clustered regularly interspaced short palindromic repeats”, which are DNA loci containing short repetitions of base sequences. CRISPR loci form a portion of a prokaryotic adaptive immune system that confers resistance to foreign genetic material. Each CRISPR loci is flanked by short segments of “spacer DNA”, which are derived from viral genomic material. In the Type II CRISPR system, spacer DNA hybridizes to transactivating RNA (tracrRNA) and is processed into CRISPR-RNA (crRNA) and subsequently associates with CRISPR-associated nucleases (Cas nucleases) to form complexes that recognize and degrade foreign DNA. In certain embodiments, the nuclease is a CRISPR- associated nuclease (Cas nuclease). Examples of CRISPR nucleases include, but are not limited to Cas9, dCas9, Cas6, Cpfl, and variants thereof. In some embodiments, the nuclease is Cas9. In some embodiments, the Cas9 is derived from the bacteria Streptococcus pyogenes (e.g., SpCas9) or Staphylococcus aureus (e.g., SaCas9). In some embodiments, a Cas protein is modified (e.g. genetically engineered) to lack nuclease activity. For example, dead Cas9 (dCas9) protein binds to a target locus but does not cleave said locus. In some embodiments, a Cas protein or variant thereof does not exceed the packaging capacity of a viral vector, such as a lentiviral vector or an adeno-associated virus (AAV) vector, for example as described by Ran et al. (2015) Nature. 520(7546); 186-91. For example, in some embodiments, a nucleic acid encoding a Cas protein is less than about 4.6 kb in length. In some embodiments, the CRISPR nuclease is a Cpfl 30 or Cas9-nickase. In some embodiments, the CRISPR nuclease increases the efficiency of precise gene editing relative to a control (e.g., a control CRISPR nuclease).

CRISPR/Cas-mediated gene-editing can be useful in permanently correcting diseasecausing mutations. Such a permanent correction is a highly desirable therapeutic option for early onset genetic disorders (e.g., severe form of OI). However, this approach has several limitations, which can result from immune reactions against the bacterial nuclease Cas, off-target cleavage and mutagenesis, and induction of chromosomal aberrations. Accordingly, in order to combat these limitations, in some embodiments, the CRISPR nuclease is capable of decreasing immune reactions against the bacterial nuclease Cas. In some embodiments, the CRISPR nuclease is highly specific and performs little off-target cleavage and mutagenesis. In some embodiments, the CRISPR nuclease is capable of induction of chromosomal aberrations.

In some embodiments, a Cas protein is capable of modulating (e.g., inhibiting) gene expression via nuclease activity (e.g., DNA cleavage). Generally, Cas9 cleaves DNA at a site targeted by the guide RNA and then repaired by either non-homologous end joining (NHEJ), which is imprecise and often results in a small insertion or deletion (InDei) that disrupts the targeted sequence, or homology directed DNA repair, which allows for the insertion of a changed or new DNA sequence into the genome at a specific location. Without wishing to be bound by any particular theory, DNA cleavage by a Cas protein and subsequent repair introduce modifications into a target DNA sequence that may adversely affect (e.g., inhibit) gene expression. Accordingly, in some aspects, the disclosure relates to a gene editing molecule that hybridizes to a COL1A2 gene and that is capable of reducing expression of COL1A2 in a subject (e.g., a cell of a subject). In some embodiments, the guide RNA targets COL1A2 comprises or consists of the nucleic acid set forth in SEQ ID NO: 30 or 31.

For the purpose of genome editing, the CRISPR system can be modified to combine the tracrRNA and crRNA into a single guide RNA (sgRNA) or just (gRNA). As used herein, the terms “guide RNA”, “gRNA”, and “sgRNA” refer to a polynucleotide sequence that is complementary to a target sequence in a cell and associates with a Cas nuclease, thereby directing the Cas nuclease to the target sequence. In some embodiments, a gRNA (e.g., sgRNA) ranges between 1 and 30 nucleotides in length. In some embodiments, a gRNA (e.g., sgRNA) ranges between 5 and 25 nucleotides in length. In some embodiments, a gRNA (e.g., sgRNA) ranges between 10 and 22 nucleotides in length. In some embodiments, a gRNA (e.g., sgRNA) ranges between 14 and 24 nucleotides in length. In some embodiments, a Cas protein and a guide RNA (e.g., sgRNA) are expressed from the same vector. In some embodiments, a Cas protein and a guide RNA (e.g., sgRNA) are expressed from separate vectors (e.g., two or more vectors).

Typically, a guide RNA (e.g., a gRNA or sgRNA) hybridizes (e.g., binds specifically to, for example by Watson-Crick base pairing) to a target sequence and thus directs the CRISPR/Cas protein to the target sequence. In some embodiments, a guide RNA hybridizes to (e.g., targets) a nucleic acid sequence encoding a COL1A2.

In some embodiments, the isolated nucleic acids described herein are modified for use in a Precise Integration into Target Chromosome (PITCH) strategy. PITCH is mediated by 5-25 bases of microhomology-mediated end-joining (MMEJ). MMEJ is related to the NHEJ pathway. For the PITCH strategy, a nuclease creates a DSB in a donor DNA (e.g., a donor COE1A2 sequence) and the genomic target site with subsequent DNA insertion stimulated by MMEJ. In some embodiments, a PITCH strategy is as described in Yamamoto, Y and S.A. Gerbi, Chromosoma. 2018 Dec; 127(4): 405-420.

Thus, in some embodiments, an isolated nucleic acid comprises (i) a first nucleic acid sequence encoding a portion of a COE1A2 protein (e.g., wild-type COE1A2 protein); and (ii) a second nucleic acid sequence encoding a Precise Integration into Target Chromosome (PITCH) gRNA binding site. The portion of the COL1A2 protein may be encoded by the nucleic sequence set forth in any one of SEQ ID NO: 33-35. In some embodiments, the portion of the COL1A2 protein is a functional segment of a COL1A2 protein. In some embodiments, the PITCH gRNA binding site comprises a sequence having a region of complementarity to a guide RNA that targets COL1A2. In some embodiments, the PITCH gRNA binding site comprises a sequence having a region of complementarity to a nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

In some embodiments, the transgene further comprises a nucleic acid sequence encoding one or more expression control sequences (e.g., a promoter, etc.). Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. A great number of expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized.

A “promoter” refers to a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The phrases “operatively positioned,” “under control” or “under transcriptional control” means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.

For nucleic acids encoding proteins, a poly adenylation sequence generally is inserted following the transgene sequences and before the 3’ AAV ITR sequence. A rAAV construct useful in the present disclosure may also contain an intron, desirably located between the promoter/enhancer sequence and the transgene. One possible intron sequence is derived from SV-40, and is referred to as the SV-40 T intron sequence. Another vector element that may be used is an internal ribosome entry site (IRES). An IRES sequence is used to produce more than one polypeptide from a single gene transcript. An IRES sequence would be used to produce a protein that contain more than one polypeptide chains. Selection of these and other common vector elements are conventional and many such sequences are available [see, e.g., Sambrook et al., and references cited therein at, for example, pages 3.18 3.26 and 16.17 16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989]. In some embodiments, a Foot and Mouth Disease Virus 2A sequence is included in polyprotein; this is a small peptide (approximately 18 amino acids in length) that has been shown to mediate the cleavage of polyproteins (Ryan, M D et al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459). The cleavage activity of the 2A sequence has previously been demonstrated in artificial systems including plasmids and gene therapy vectors (AAV and retroviruses) (Ryan, M D et al., EMBO, 1994; 4: 928-933; Mattion, N M et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459; de Felipe, P et al., Gene Therapy, 1999; 6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000; 11: 1921-1931.; and Klump, H et al., Gene Therapy, 2001; 8: 811-817).

Examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) ETR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the P-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EFla promoter [Invitrogen]. In some embodiments, a promoter is an enhanced chicken P-actin promoter. In some embodiments, a promoter is a U6 promoter. In some embodiments, a promoter is a U1 a promoter.

Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98/10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline -repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline-inducible system (Gossen et al., Science, 268: 1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), the RU486-inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.

In another embodiment, the native promoter for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue- specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression.

In some embodiments, the regulatory sequences impart tissue- specific gene expression capabilities. In some cases, the tissue- specific regulatory sequences bind tissue- specific transcription factors that induce transcription in a tissue specific manner. Such tissue- specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to the following tissue specific promoters: a liver- specific thyroxin binding globulin (TBG) promoter, an insulin promoter, a glucagon promoter, a somatostatin promoter, a pancreatic polypeptide (PPY) promoter, a synapsin-1 (Syn) promoter, a creatine kinase (MCK) promoter, a mammalian desmin (DES) promoter, a a-myosin heavy chain (a-MHC) promoter, or a cardiac Troponin T (cTnT) promoter. Other exemplary promoters include Beta-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther., 3: 1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther., 7: 1503-14 (1996)), bone osteocalcin promoter (Stein et al., Mol. Biol. Rep., 24: 185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol., 161: 1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor a-chain promoter, neuronal such as neuron- specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light-chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron- specific vgf gene promoter (Piccioli et al., Neuron, 15:373- 84 (1995)), among others which will be apparent to the skilled artisan. In some embodiments, a tissue- specific promoter is a bone tissue- specific promoter. Examples of bone tissue-specific promoters include but are not limited to promoters of osterix, osteocalcin, type 1 collagen al, DMP1, cathepsin K, Rank, etc.

Aspects of the disclosure relate to an isolated nucleic acid comprising more than one promoter (e.g., 2, 3, 4, 5, or more promoters). For example, in the context of a construct having a transgene comprising a first region encoding a protein and an second region encoding an inhibitory RNA (e.g., miRNA), it may be desirable to drive expression of the protein coding region using a first promoter sequence (e.g., a first promoter sequence operably linked to the protein coding region), and to drive expression of the inhibitory RNA encoding region with a second promoter sequence (e.g., a second promoter sequence operably linked to the inhibitory RNA encoding region). Generally, the first promoter sequence and the second promoter sequence can be the same promoter sequence or different promoter sequences. In some embodiments, the first promoter sequence (e.g., the promoter driving expression of the protein coding region) is a RNA polymerase III (polIII) promoter sequence. Non-limiting examples of polIII promoter sequences include U6 and Hl promoter sequences. In some embodiments, the second promoter sequence (e.g., the promoter sequence driving expression of the inhibitory RNA) is a RNA polymerase II (polll) promoter sequence. Non-limiting examples of polll promoter sequences include T7, T3, SP6, RSV, and cytomegalovirus promoter sequences. In some embodiments, a polIII promoter sequence drives expression of an inhibitory RNA (e.g., miRNA) encoding region. In some embodiments, a polll promoter sequence drives expression of a protein coding region.

Recombinant A A Vs (rAAVs)

The isolated nucleic acids of the disclosure may be recombinant adeno-associated virus (AAV) vectors (rAAV vectors). In some embodiments, an isolated nucleic acid as described by the disclosure comprises a region (e.g., a first region) comprising a first adeno-associated virus (AAV) inverted terminal repeat (ITR), or a variant thereof. The isolated nucleic acid (e.g., the recombinant AAV vector) may be packaged into a capsid protein and administered to a subject and/or delivered to a selected target cell. “Recombinant AAV (rAAV) vectors” are typically composed of, at a minimum, a transgene and its regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). The transgene may comprise, as disclosed elsewhere herein, one or more regions that encode one or more proteins and/or inhibitory nucleic acids (e.g., shRNA, miRNAs, etc.) comprising a nucleic acid that targets an endogenous mRNA of a subject. The transgene may also comprise a region encoding, for example, a protein and/or an expression control sequence (e.g., a poly-A tail), as described elsewhere in the disclosure.

Generally, ITR sequences are about 145 bp in length. Preferably, substantially the entire sequences encoding the ITRs are used in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al., “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996)). An example of such a molecule employed in the present invention is a “cis-acting” plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5’ and 3’ AAV ITR sequences. The AAV ITR seque”ces may be obtained from any known AAV, including presently identified mammalian AAV types. In some embodiments, the isolated nucleic acid (e.g., the rAAV vector) comprises at least one ITR having a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAVrh8, AAV9, AAVrhlO, AAVrh39, AAVrh43, AAV2/2-66, AAV2/2-84, AAV2/2-125, and variants thereof. In some embodiments, the isolated nucleic acid comprises a region (e.g., a first region) encoding an AAV2 ITR.

In some embodiments, the isolated nucleic acid further comprises a region (e.g., a second region, a third region, a fourth region, etc.) comprising a second AAV ITR. In some embodiments, the second AAV ITR has a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAVrh8, AAV9, AAVrhlO, AAVrh39, AAVrh43, AAV2/2-66, AAV2/2-84, AAV2/2-125, and variants thereof. In some embodiments, the second ITR is a mutant ITR that lacks a functional terminal resolution site (TRS). The term “lacking a terminal resolution site” can refer to an AAV ITR that comprises a mutation (e.g., a sense mutation such as a non-synonymous mutation, or missense mutation) that abrogates the function of the terminal resolution site (TRS) of the ITR, or to a truncated AAV ITR that lacks a nucleic acid sequence encoding a functional TRS (e.g., a ATRS ITR). Without wishing to be bound by any particular theory, a rAAV vector comprising an ITR lacking a functional TRS produces a self-complementary rAAV vector, for example as described by McCarthy (2008) Molecular Therapy 16(10): 1648-1656.

As used herein, the term “self-complementary AAV vector” (scAAV) refers to a vector containing a double-stranded vector genome generated by the absence of a terminal resolution site (TR) from one of the ITRs of the AAV. The absence of a TR prevents the initiation of replication at the vector terminus where the TR is not present. In general, scAAV vectors generate single-stranded, inverted repeat genomes, with a wild-type (wt) AAV TR at each end and a mutated TR (mTR) in the middle. The instant invention is based, in part, on the recognition that DNA fragments encoding RNA hairpin structures (e.g. shRNA, miRNA, and AmiRNA) can serve a function similar to a mutant inverted terminal repeat (mTR) during viral genome replication, generating self-complementary AAV vector genomes. For example, in some embodiments, the disclosure provides rAAV (e.g. self-complementary AAV; scAAV) vectors comprising a single- stranded self-complementary nucleic acid with inverted terminal repeats (ITRs) at each of two ends and a central portion comprising a promoter operably linked with a sequence encoding a hairpin-forming RNA (e.g., shRNA, miRNA, ami-RNA, etc.). In some embodiments, the sequence encoding a hairpin-forming RNA (e.g., shRNA, miRNA, ami- RNA, etc.) is substituted at a position of the self-complementary nucleic acid normally occupied by a mutant ITR.

“Recombinant AAV (rAAV) vectors” are typically composed of, at a minimum, a transgene and its regulatory sequences, and 5’ and 3’ AAV inverted terminal repeats (ITRs). It is this recombinant AAV vector which is packaged into a capsid protein and delivered to a selected target cell. In some embodiments, the transgene is a nucleic acid sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor) or other gene product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a cell of a target tissue.

The instant disclosure provides a vector comprising a single, cis-acting wild-type ITR. In some embodiments, the ITR is a 5’ ITR. In some embodiments, the ITR is a 3’ ITR Generally, ITR sequences are about 145 bp in length. Preferably, substantially the entire sequences encoding the ITR(s) is used in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al, "Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996)). For example, an ITR may be mutated at its terminal resolution site (TR), which inhibits replication at the vector terminus where the TR has been mutated and results in the formation of a self-complementary AAV. Another example of such a molecule employed in the present disclosure is a “cis-acting” plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' AAV ITR sequence and a 3’ hairpin-forming RNA sequence. AAV ITR sequences may be obtained from any known AAV, including presently identified mammalian AAV types. In some embodiments, an ITR sequence is an AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, and/or AAVrhlO ITR sequence.

In some embodiments, the rAAVs of the disclosure are pseudotyped rAAVs. For example, a pseudotyped AAV vector containing the ITRs of serotype X encapsidated with the proteins of Y will be designated as AAVX/Y (e.g. AAV2/1 has the ITRs of AAV2 and the capsid of AAV1). In some embodiments, pseudotyped rAAVs may be useful for combining the tissue-specific targeting capabilities of a capsid protein from one AAV serotype with the viral DNA from another AAV serotype, thereby allowing targeted delivery of a transgene to a target tissue.

Methods for obtaining recombinant AAVs having a desired capsid protein are well known in the art. (See, for example, US 2003/0138772), the contents of which are incorporated herein by reference in their entirety). Typically the methods involve culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid protein; a functional rep gene; a recombinant AAV vector composed of, AAV inverted terminal repeats (ITRs) and a transgene; and sufficient helper functions to permit packaging of the recombinant AAV vector into the AAV capsid proteins. In some embodiments, capsid proteins are structural proteins encoded by the cap gene of an AAV. AAVs comprise three capsid proteins, virion proteins 1 to 3 (named VP1, VP2 and VP3), all of which are transcribed from a single cap gene via alternative splicing. In some embodiments, the molecular weights of VP1, VP2 and VP3 are respectively about 87 kDa, about 72 kDa and about 62 kDa. In some embodiments, upon translation, capsid proteins form a spherical 60-mer protein shell around the viral genome. In some embodiments, the functions of the capsid proteins are to protect the viral genome, deliver the genome and interact with the host. In some aspects, capsid proteins deliver the viral genome to a host in a tissue specific manner.

In some embodiments, an AAV capsid protein is of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAVrh8, AAV9, AAVrhlO, AAVrh39, AAVrh43, AAV2/2-66, AAV2/2-84, AAV2/2-125. In some embodiments, an AAV capsid protein is of a serotype derived from a non-human primate, for example scAAV.rh8, AAV.rh39, or AAV.rh43 serotype. In some embodiments, an AAV capsid protein is of an AAV9 serotype.

The disclosure is based, in part, on rAAVs comprising capsid proteins that have increased tropism for bone tissue. In some embodiments, the capsid proteins are grafted to a bone-targeting peptide. A heterologous bone-targeting peptide may target OCs (e.g., specifically, or preferentially targets OCs relative to OBs) or OBs (e.g., specifically, or preferentially targets OBs relative to OCs). In some embodiments, a bone-targeting peptide is an (AspSerSer)6 peptide, which may also be referred to as a DSS6 peptide (e.g. SEQ ID NO: 16). Additional bone-targeting peptide is a HABP-19 peptide (CYEPRRYEVAYELYEPRRYEVAYEL; SEQ ID NO: 17), which may also be referred to as a HABP peptide. In some embodiments, a bone-targeting peptide is an (Asp)8-14 peptide comprising 8-14 aspartic acid residues (e.g., as set forth in SEQ ID NOs: 57-63). Further examples of bone-targeting peptides include but are not limited to those described by Ouyang et al. (2009) Lett. Organic Chem 6(4):272-277. In some embodiments, bone-targeting peptides comprise the sequence set forth in SEQ ID NO: 16,17, 57, 58, 59, 60, 61, 62, and 63.

As used herein, “grafting” refers to joining or uniting of one molecule with another molecule. In some embodiments, the term grafting refers to joining or uniting of at least two molecules such that one of the at least two molecules is inserted within another of at least two molecules. In some embodiments, the term grafting refers to joining or uniting of at least two polymeric molecules such that one of at least two molecules is appended to another of at least two molecules. In some embodiments, the term grafting refers to joining or uniting of one polymeric molecule (e.g., a nucleic acid, a polypeptide) with another polymeric molecule (e.g., a nucleic acid, a polypeptide). In some embodiments, the term grafting refers to joining or uniting of at least two nucleic acid molecules such that one of at least two molecules is appended to another of at least two nucleic acid molecules.

In some embodiments, the term grafting refers to joining or uniting of at least two nucleic acid molecules such that one of the at least two nucleic acid molecules is inserted within another of the at least two nucleic acid molecules. For example, it has been observed that targeting peptides may be grafted to certain loci of a nucleic acid encoding a VP2 AAV capsid protein. In some embodiments, a targeting peptide (e.g. a bone-targeting peptide) is inserted at a position corresponding to the position between the codons encoding Q588 and A589 and/or N587 and R588 of an AAV2 or AAV9 VP2 capsid protein. In some embodiments, a targeting peptide is inserted at a position between the codons encoding N587 and R588 of an VP3 capsid protein (or a position corresponding to such amino acid positions in AAV2 or AAV9). In some embodiments, a targeting peptide is inserted at a position between the codons encoding S452 and G453 of an VP1 capsid protein. Other potential positions may be N587 and R588.

In some embodiments, a nucleic acid formed through grafting (a grafted nucleic acid) encodes a chimeric protein. In some embodiments, a grafted nucleic acid encodes a chimeric protein, such that one polypeptide is effectively inserted into another polypeptide (e.g. not directly conjugated before the N-terminus or after the C-terminus), thereby creating a contiguous fusion of two polypeptides. In some embodiments, a grafted nucleic acid encodes a chimeric protein, such that one polypeptide is effectively appended to another polypeptide (e.g. directly conjugated before the N-terminus or after the C-terminus), thereby creating a contiguous fusion of two polypeptides. In some embodiments, the term grafting refers to joining or uniting of at least two polypeptides, or fragments thereof, such that one of the at least two polypeptides or fragments thereof is inserted within another of the at least two polypeptides or fragments thereof. In some embodiments, the term grafting refers to joining or uniting of at least two polypeptides or fragments thereof such that one of the at least two polypeptides or fragments thereof is appended to another of the at least two polypeptides or fragments thereof.

In some embodiments, the disclosure relates to an adeno-associated virus (AAV) capsid protein that is conjugated to one or more bone-targeting moieties. A “bone-targeting moiety” generally refers to a small molecule, peptide, nucleic acid, etc., that facilitates trafficking of an rAAV to bone or bone tissue. For example, in some embodiments, a bone-targeting moiety is a peptide or small molecule that binds to a receptor on a bone cell (e.g., OB, OC, osteocyte, etc.). Examples of bone-targeting moieties include but are not limited to alendronate (ALE), polypeptides such as cyclic arginine-glycine-aspartic acid-tyrosine-lysine (cRGCyk), Asp-Asp- Asp-Asp-Asp-Asp-Asp-Asp (D-Asp8), and aptamers such as CH6. A bone-targeting moiety may be conjugated directly to a capsid protein or conjugated to a capsid protein via a linker molecule (e.g., an amino acid linker, a PEG linker, etc.).

In some embodiments, a linker is a glycine-rich linker. In some embodiments, a linker comprises at least two glycine residues. In some embodiments, a linker comprises GGGGS (SEQ ID NO: 64). In some embodiments, the linker comprises a formula selected from the group consisting of: [G]n (SEQ ID NO: 65), [G]nS (SEQ ID NO: 66), [GS]n (SEQ ID NO: 67), and [GGSG]n (SEQ ID NO: 68), wherein G is glycine and wherein n is an integer greater than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, n is an integer in a range of 2 to 10, 2 to 20, 5 to 10, 5 to 15, or 5 to 25. Accordingly, in some embodiments, a heterologous targeting peptide is conjugated to a linker.

In some embodiments, a capsid protein comprises one or more azide-bearing unnatural amino acids which are capable of reacting with an ADIBO-tagged bone-targeting moiety (e.g., via “click chemistry” to form a capsid protein-bone-targeting moiety conjugate. Capsid proteins comprising unnatural azide-bearing amino acids are described, for example by Zhang et al. (2016) Biomaterials 80: 134-145, and use of ADIBO-based click chemistry for peptide conjugation is described, for example by Prim et al. (2013) Molecules 18(8) :9833-49.

The components to be cultured In the host cell to package a rAAV vector in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., recombinant AAV vector, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art. Most suitably, such a stable host cell will contain the required component(s) under the control of an inducible promoter. However, the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion of regulatory elements suitable for use with the transgene. In still another alternative, a selected stable host cell may contain selected component(s) under the control of a constitutive promoter and other selected component(s) under the control of one or more inducible promoters. For example, a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contain the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.

The recombinant AAV vector, rep sequences, cap sequences, and helper functions required for producing the rAAV of the disclosure may be delivered to the packaging host cell using any appropriate genetic element (vector). The selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present disclosure. See, e.g., K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Pat. No. 5,478,745.

In some embodiments, recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650). Typically, the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector. An AAV helper function vector encodes the“"AAV helper functio”" sequences (i.e., rep and cap), which function in trans for productive AAV replication and encapsidation. Preferably, the AAV helper function vector supports efficient “AV vector productio” without generating any detectable wild-type AAV virions (i.e., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use with the present disclosure include pHLP19, described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector, described in U.S. Pat. No. 6,156,303, the entirety of both incorporated by reference herein. The accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication (i.e., “"accessory function”"). The accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.

In some aspects, the disclosure provides transfected host cells. The term“"transfectio”" is used to refer to the uptake of foreign DNA by a cell, and a cell has been“"transfecte”" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier, and Chu et al. (1981) Gene 13: 197. Such techniques can be used to introduce one or more exogenous nucleic acids, such as a nucleotide integration vector and other nucleic acid molecules, into suitable host cells.

A “host cell” refers to any cell that harbors, or is capable of harboring, a substance of interest. Often a host cell is a mammalian cell. In some embodiments, a host cell is a bacterial cell, yeast cell, insect cell (Sf9), or a mammalian (e.g., human, rodent, non-human primate, etc.) cell. A host cell may be used as a recipient of an AAV helper construct, an AAV minigene plasmid, an accessory function vector, or other transfer DNA associated with the production of recombinant AAVs. The term includes the progeny of the original cell which has been transfected. Thus, a “host cell” as used herein may refer to a cell which has been transfected with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation.

As used herein, the term“"cell lin”" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.

As used herein, the terms “recombinant cell” refers to a cell into which an exogenous DNA segment, such as DNA segment that leads to the transcription of a biologically-active polypeptide or production of a biologically active nucleic acid such as an RNA, has been introduced.

In some aspects, the present disclosure provides a recombinant AAV comprising a capsid protein and an isolated nucleic acid comprising a first region encoding an AAV ITR and a second region comprising a transgene, wherein the transgene encodes an artificial microRNA. The artificial microRNA may decrease the expression of a target gene in a cell (e.g. osteoblasts, osteoclasts, osteocytes, chondrocytes) or a subject. In some embodiments, the rAAV comprises an artificial microRNA that decreases the expression of COL1A1 or COL1A2 in a cell or a subject.

The rAAV may comprise at least one modification which increases targeting of the rAAV to bone cells (e.g., osteoblasts, osteoclasts, osteocytes, chondrocytes). Non-limiting examples of modifications which increase targeting of the rAAV to bone cells include heterologous bone-targeting peptides (e.g., as set forth in any one of SEQ ID NOs: 16,17, 57, 58, 59, 60, 61, 62, or 63), AAV capsid serotypes (e.g., AAV1, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, AAV10, AAVrh39, AAVrh43). Expression of COL1A1 or COL1A2 in a cell or subject may be decreased by between 50% and 99% (e.g., any integer between 50% and 99%, inclusive) using rAAVs of the present disclosure. Expression of COL1A1 or COL1A2 in a cell or subject may be decreased by between 75% and 90% using rAAVs of the present disclosure. Expression of COL1A1 or COL1A2 in a cell or subject may be decreased by between 80% and 99% using rAAVs of the present disclosure.

The foregoing methods for packaging recombinant vectors in desired AAV capsids to produce the rAAVs of the disclosure are not meant to be limiting and other suitable methods will be apparent to the skilled artisan.

Modes of Administration and Pharmaceutical Compositions

The rAAVs of the disclosure may be delivered to a subject in compositions according to any appropriate methods known in the art. For example, an rAAV, preferably suspended in a physiologically compatible carrier (e.g., in a composition), may be administered to a subject, e.g., host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or a non-human primate (e.g., Macaque). In some embodiments a host animal does not include a human.

Delivery of the rAAVs to a mammalian subject may be by, for example, intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. In some embodiments, the rAAVs are administered into the bloodstream by way of isolated limb perfusion, a technique well known in the surgical arts, the method essentially enabling the artisan to isolate a limb from the systemic circulation prior to administration of the rAAV virions. A variant of the isolated limb perfusion technique, described in U.S. Pat. No. 6,177,403, can also be employed by the skilled artisan to administer the virions into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue. Moreover, in certain instances, it may be desirable to deliver the virions to the bone (e.g., bone tissue) of a subject. By “bone tissue” is meant all cells and tissue of the bone and/or joint (e.g., cartilage, axial and appendicular bone, etc.) of a vertebrate. Thus, the term includes, but is not limited to, osteoblasts, osteocytes, osteoclasts, chondrocytes, and the like. Recombinant AAVs may be delivered directly to the bone by injection into, e.g., directly into the bone, via intrasynovial injection, knee injection, femoral intramedullary injection, etc., with a needle, catheter or related device, using surgical techniques known in the art. In some embodiments, rAAV as described in the disclosure are administered by intravenous injection. In some embodiments, the rAAV are administered by intramuscular injection.

Aspects of the instant disclosure relate to compositions comprising a recombinant AAV comprising a capsid protein and a nucleic acid encoding a transgene, wherein the transgene comprises a nucleic acid sequence encoding an inhibitory RNA and/or a transgene encoding a COL1A1 or COL1A2 peptide. In some embodiments, the nucleic acid further comprises one or more AAV ITRs. In some embodiments, the rAAV comprises an rAAV vector comprising the sequence set forth in any one of SEQ ID NO: 5 or 6 (or the complementary sequence thereof), or a portion thereof. In some embodiments, a composition further comprises a pharmaceutically acceptable carrier.

In some embodiments, compositions comprise a recombinant AAV comprising a capsid protein and a nucleic acid comprising a first region encoding an AAV ITR and a second region comprising a transgene, wherein the transgene encodes an artificial microRNA that targets COL1A1 or COL1A2. In some embodiments, the recombinant AAV comprises a sequence as set forth in SEQ ID NO: 5 or 6.

Aspects of the disclosure provide a method of decreasing expression of mutant COL1A1 or COL1A2 alleles in a cell. A cell may be a single cell or a population of cells (e.g., culture). A cell may be in vivo (e.g., in a subject) or in vitro (e.g., in culture). A subject may be a mammal, optionally a human, a mouse, a rat, a non-human primate, a pig, a dog, a cat, a chicken, or a cow.

Expression of mutant COL1A1 or COL1A2 in a cell or subject may be decreased by between 50% and 99% (e.g., any integer between 50% and 99%, inclusive) using isolated nucleic acids, rAAVs, or compositions of the present disclosure. Expression of mutant COL1A1 or COL1A2 in a cell or subject may be decreased by between 75% and 90% using isolated nucleic acids, rAAVs, or compositions of the present disclosure. Expression of mutant COL1A1 or COL1A2 in a cell or subject may be decreased by between 80% and 99% using isolated nucleic acids, rAAVs, or compositions of the present disclosure.

Aspects of the disclosure provide a method of treating disease (e.g., OI) using the nucleic acid and vector compositions of the disclosure. As used herein, the terms “treatment”, “treating”, and “therapy” refer to therapeutic treatment and prophylactic or preventative manipulations. The terms further include ameliorating existing symptoms, preventing additional symptoms, ameliorating or preventing the underlying causes of symptoms, preventing or reversing causes of symptoms, for example, symptoms associated with 01. Thus, the terms denote that a beneficial result has been conferred on a subject having 01, or with the potential to develop such a disorder. Furthermore, the term "treatment" is defined as the application or administration of an agent (e.g., therapeutic agent or a therapeutic composition) to a subject, or an isolated tissue or cell line from a subject, who may have a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease or the predisposition toward disease.

The compositions of the disclosure may comprise an rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In some embodiments, a composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different rAAVs each having one or more different transgenes.

Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the rAAV is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present disclosure.

Optionally, the compositions of the disclosure may contain, in addition to the rAAV and carrier(s), other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

The rAAVs are administered in sufficient amounts to transfect the cells of a desired tissue and to provide sufficient levels of gene transfer and expression without undue adverse effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the selected organ (e.g., intraportal delivery to the liver), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, and other parental routes of administration. Routes of administration may be combined, if desired.

The dose of rAAV virions required to achieve a particular “therapeutic effect” e.g., the units of dose in genome copies/per kilogram of body weight (GC/kg), will vary based on several factors including, but not limited to: the route of rAAV virion administration, the level of gene or RNA expression required to achieve a therapeutic effect, the specific disease or disorder being treated, and the stability of the gene or RNA product. One of skill in the art can readily determine a rAAV virion dose range to treat a patient having a particular disease or disorder based on the aforementioned factors, as well as other factors that are well known in the art.

An “effective amount” of an rAAV is an amount sufficient to target infect an animal, target a desired tissue (e.g., bone tissue). The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, an effective amount of the rAAV is generally in the range of from about 1 ml to about 100 ml of solution containing from about 109 to 1016 genome copies. In some cases, a dosage between about 1011 to 1013 rAAV genome copies is appropriate. In certain embodiments, 1012 or 1013 rAAV genome copies is effective to target bone tissue.

In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar day (e.g., a 24-hour period). In some embodiments, a dose of rAAV is administered to a subject no more than once per 2, 3, 4, 5, 6, or 7 calendar days. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar week (e.g., 7 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than bi-weekly (e.g., once in a two calendar week period). In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar month (e.g., once in 30 calendar days). In some embodiments, a dose of rAAV is administered to a subject no more than once per six calendar months. In some embodiments, a dose of rAAV is administered to a subject no more than once per calendar year (e.g., 365 days or 366 days in a leap year).

In some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly where high rAAV concentrations are present (e.g., ~10¹³ GC/ml or more). Methods for reducing aggregation of rAAVs are well known in the art and, include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright FR, et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference.)

Formulation of pharmaceutically-acceptable excipients and carrier solutions is well- known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens.

Typically, these formulations may contain at least about 0.1% of the active compound or more, although the percentage of the active ingredient(s) may, of course, be varied and may conveniently be between about 1 or 2% and about 70% or 80% or more of the weight or volume of the total formulation. Naturally, the amount of active compound in each therapeutically- useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.

In certain circumstances it will be desirable to deliver the rAAV-based therapeutic constructs in suitably formulated pharmaceutical compositions disclosed herein either subcutaneously, intraopancreatically, intranasally, parenterally, intravenously, intramuscularly, intrathecally, femoral intramedullary, or orally, intraperitoneally, or by inhalation. In some embodiments, the administration modalities as described in U.S. Pat. Nos. 5,543,158; 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety) may be used to deliver rAAVs. In some embodiments, a preferred mode of administration is by portal vein injection.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. In many cases the form is sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

For administration of an injectable aqueous solution, for example, the solution may be suitably buffered, if necessary, and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, a sterile aqueous medium that can be employed will be known to those of skill in the art. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, “"Remingto”s Pharmaceutical Science”" l^5th Edition, pages 1035-1038 and 1570- 1580). Some variation in dosage will necessarily occur depending on the condition of the host. The person responsible for administration will, in any event, determine the appropriate dose for the individual host.

Sterile injectable solutions are prepared by incorporating the active rAAV in the required amount in the appropriate solvent with various of the other ingredients enumerated herein, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The rAAV compositions disclosed herein may also be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.

As used herein, “"carrie”" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase“"pharmaceutically-acceptabl”" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host.

Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present disclosure into suitable host cells. In particular, the rAAV vector delivered transgenes may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, or a nanoparticle or the like.

Such formulations may be preferred for the introduction of pharmaceutically acceptable formulations of the nucleic acids or the rAAV constructs disclosed herein. The formation and use of liposomes is generally known to those of skill in the art. Recently, liposomes were developed with improved serum stability and circulation half-times (U.S. Pat. No. 5,741,516). Further, various methods of liposome and liposome like preparations as potential drug carriers have been described (U.S. Pat. Nos. 5,567,434; 5,552,157; 5,565,213; 5,738,868 and 5,795,587).

Liposomes have been used successfully with a number of cell types that are normally resistant to transfection by other procedures. In addition, liposomes are free of the DNA length constraints that are typical of viral-based delivery systems. Liposomes have been used effectively to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors and allosteric effectors into a variety of cultured cell lines and animals. In addition, several successful clinical trials examining the effectiveness of liposome-mediated drug delivery have been completed.

Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form multilamellar concentric bilayer vesicles (also termed multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to 4 pm. Sonication of MLVs results in the formation of small unilamellar vesicles (SUVs) with diameters in the range of 200 to 500 A, containing an aqueous solution in the core. Alternatively, nanocapsule formulations of the rAAV may be used. Nanocapsules can generally entrap substances in a stable and reproducible way. To avoid side effects due to intracellular polymeric overloading, such ultrafine particles (sized around 0.1 pm) should be designed using polymers able to be degraded in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are contemplated for use.

In addition to the methods of delivery described above, the following techniques are also contemplated as alternative methods of delivering the rAAV compositions to a host. Sonophoresis (i.e., ultrasound) has been used and described in U.S. Pat. No. 5,656,016 as a device for enhancing the rate and efficacy of drug permeation into and through the circulatory system. Other drug delivery alternatives contemplated are intraosseous injection (U.S. Pat. No. 5,779,708), microchip devices (U.S. Pat. No. 5,797,898), ophthalmic formulations (Bourlais et al., 1998), transdermal matrices (U.S. Pat. Nos. 5,770,219 and 5,783,208) and feedback- controlled delivery (U.S. Pat. No. 5,697,899).

Therapeutic Methods

Methods for delivering an effective amount of a transgene (e.g., an isolated nucleic acid or rAAV encoding COL1A1 or COL1A2) to a subject are provided by the disclosure. In some embodiments, the methods comprise the step of administering to a subject an effective amount of an isolated nucleic acid encoding an interfering RNA capable of decreasing expression of mutant COL1A1 or COL1A2 peptides. In some embodiments, the methods comprise the step of administering to a subject an effective amount of an isolated nucleic acid encoding a transgene encoding a wildtype COL1A1 or COL1A2 peptide. Thus, in some embodiments, isolated nucleic acids, rAAVs, and compositions described herein are useful for treating a subject having or suspected of having a disease or disorder associated with dysregulated COL1A1 or COL1A2 peptide production.

Aspects of the present disclosure provide methods of treating a disease or disorder associated with dysregulated type 1 collagen metabolism.

As used herein, a “disease or disorder associated with dysregulated COL1A1 or COL1A2 peptide production” refers to a condition characterized by production of a dominant negative COL1A1 or COL1A2 peptide or by production of too little COL1A1 or COL1A2, based on a defect in the gene. In some embodiments, methods of treating a disease or disorder associated with a dysregulated type 1 collagen metabolism comprise administering to a subject in need thereof a recombinant AAV (rAAV) comprising a transgene. A rAAV may comprise a modification that promotes its targeting to bone cells (e.g., osteoclasts and osteoblasts). Non-limiting modifications of rAAVs that promote its targeting to bone cells include heterologous bonetargeting peptides, bone-specific promoters, and AAV serotypes with increased targeting to bone relative to other tissues.

In some embodiments, the rAAV comprising the heterologous bone-targeting peptide comprises a transgene which downregulates a target gene associated with dysregulation of type 1 collagen metabolism. In some embodiments, the transgene downregulates the expression of a COL1A allele that is expressed in a disorder associated with deficiencies in type 1 collagen production, such as an allele encoding a dominant negative COL1A1 or COL1A2 peptide. In some embodiments, the rAAV comprising the heterologous bone-targeting peptide comprises a transgene which encodes a wildtype COL1A peptide. In some embodiments, the transgene increases production of wildtype COL1A1 or COL1A2 peptides in a subject by providing a wildtype copy of the gene. In some embodiments, the nucleic acid encoding the wildtype COL1A1 or COL1A2 is codon-optimized.

As used herein “codon optimization” is a method of altering a nucleic acid sequence, without affecting the amino acid sequence, such that a particular host organism’s preferred codons are used. In some embodiments, codon-optimization improves synthesis of the wildtype COL1A1 or COL1A2 allele.

Aspects of the disclosure provide methods for treating a disease or disorder associated with a disease of disorder characterized by deficiencies in collagen metabolism comprising administering to a subject a rAAV comprising a capsid protein and an isolated nucleic acid encoding an inhibitory nucleic acid. The rAAV may comprise an inhibitory nucleic acid (e.g., siRNA, shRNA, miRNA, or amiRNA). The inhibitory nucleic acid may decrease expression of a mutant COL1A peptide.

Expression of mutant COL1A1 or COL1A2 alleles in a cell or subject may be decreased by between 50% and 99% (e.g., any integer between 50% and 99%, inclusive) using methods of the present disclosure. Expression of mutant COL1A1 or COL1A2 alleles in a cell or subject may be decreased by between 75% and 90% using methods of the present disclosure. Expression of mutant COL1A1 or COL1A2 alleles in a cell or subject may be decreased by between 80% and 99% using methods of the present disclosure.

In some embodiments, an “effective amount” of a substance is an amount sufficient to produce a desired effect (e.g., to transduce bone cells or bone tissue). In some embodiments, an effective amount of an isolated nucleic acid is an amount sufficient to transfect (or infect in the context of rAAV-mediated delivery) a sufficient number of target cells of a target tissue of a subject. In some embodiments, a target tissue is bone tissue (e.g., bone and bone tissue cells, such as OBs, OCs, osteocytes, chondrocytes, etc.). In some embodiments, an effective amount of an isolated nucleic acid (e.g., which may be delivered via an rAAV) may be an amount sufficient to have a therapeutic benefit in a subject, e.g., to increase expression of wildtype COL1A1 or COL1A2 genes, to decrease expression of dominant negative mutant COL1A alleles, etc. The effective amount will depend on a variety of factors such as, for example, the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among subject and tissue as described elsewhere in the disclosure.

Exemplary embodiments of the invention will be described in more detail by the following examples. These embodiments are exemplary of the invention, which one skilled in the art will recognize is not limited to the exemplary embodiments.

EXAMPLES

Example 1: OIM-OI mouse model

The OIM-OI mouse model is well-characterized for the moderate to severe dominant form of human 01 (type 3). Deletion of a single nucleotide (G) at 3978 in the COL1A2 gene causes a frameshift mutation in the C-terminal pro-peptide domain of pro-alpha 2(1) chains (FIG. 1), preventing the incorporation of alpha-2(I) chains into the collagen triple helix and generating alphal(I) homotrimers. As seen in FIGs. 2A-2C, 0IM^m/lllmice display smaller body size, multiple non-union bone fractures, and pelvic bone deformity. Additionally, severe osteoporosis, along with reduced biomechanical properties was observed in these mice due to a high bone turnover rate compared to OIM^+/+ (control) mice. Intriguingly, bone marrow-derived stromal cells (BMSCs) isolated from OIMm/m mice show a significant increase in osteogenic activity compared to OIM"'^/+ and OIM^+/+ BMSCs, evidenced by greater alkaline phosphatase (ALP) activity for early osteogenesis and alizarin red staining for late osteogenesis (FIGs. 3A- 3B). However, COL1A1 mRNA levels were markedly reduced in these cells along with generation of unfolded collagen fibers (FIGs. 3C-3D), indicating that production of defective collagen fibers in osteoblasts (OBs) may be responsible for the development of OI-skeletal phenotypes in OIM^1117111 mice. As OIM^1117111 mice display characteristic features seen in human patients with the type 3 01, OIM-OI OBs and mice were used to examine in vitro and in vivo therapeutic effects of AAV-mediated gene therapeutics.

Example 2: Development ofAAV9 particles for COL1A gene addition, silencing, and replacement:

A gene addition strategy was initiated by generating AAV vector genome that expresses codon-optimized, wild type human COL1A2 cDNA (opt-hCOLlA2) and mouse COL1A2 cDNA (opt-mCOLlA2, 4,738 bp) under control of a promoter (FIG. 4, top). In some embodiments, the promoter comprised a chicken beta-actin (CBA) promoter and/or a Ula promoter. Next, AAV vector genome expressing four artificial miRNAs (amiRs) that target different sequence sites of mouse COL1A2 mRNA with G deletion under the CBA promoter (amiR-Colla2-AG) was generated for gene silencing (FIG. 4, middle). Additionally, amiR-sensor plasmids containing renilla luciferase reporter gene followed by miRNA binding sites specific to mouse Colla2-AG, -WT, or -opt were generated to screen which amiRs are effective to knockdown mouse Colla2- AG mRNA without any decrease in mouse Colla2-WT and/or -opt mRNA levels (FIG. 5).

Either amiR-ctrl or four different amiR-Colla2-AG are transiently transfected into HEK293 cells along with amiR-sensor plasmids specific to Colla2-AG, -WT, or -opt and a luciferase assay is performed to measure renilla and firefly activities. Lower ratio of renilla to firefly indicates higher silencing efficacy of amiRs. Among them, amiR-Colla2-AG, which is most effective for reduction of renilla luciferase activity of Colla2-AG, not Colla2-WT and - opt, is selected, transfected into mouse calvarial OBs isolated from OIM^1117111 and OIM^+/+ neonates, and their knockdown efficiency is assessed using qPCR analysis. The amiR-Colla2- AG, which can reduce Colla2-AG mRNA levels in OIM^1117111 OBs while having little to no effect on Colla2-WT mRNA in OIM^+/+ OBs, is packaged into AAV9 capsid. Finally, the combination of the selected amiR-Colla2-AG and opt-hCOLlA2 or opt-mCOLlA2 is cloned into AAV vector genome for gene replacement strategy (FIG. 4, bottom). Similar to the gene silencing plasmids, these plasmids are effective to decrease Colla2-AG luciferase activity without affecting Colla2-WT activity. Likewise, they decrease mRNA levels of Colla2-AG in OIM^1117111 OBs, not Colla2-WT in OIM^+/+ OBs, while opt-hCOLlA2 or opt-mCOLlA2 is highly expressed. Once validated, these AAV vector genomes are packaged into AAV9 capsid to produce rAAV particles.

Example 3: Development ofAAV9 particles for CRISPR/Cas9-mediated gene editing of COLlA Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) systems have been developed as a genome-editing tool that can correct DNA mutations underlying human diseases. In principle, many heterozygous mutations can be individually corrected by homology-directed repair (HDR) using an exogenous DNA template (FIGs. 6A-6B). Given that AAV-mediated delivery of Cas9 and single guide RNAs (sgRNA) has been reported successfully in mouse liver and muscle in vitro and in vivo, AAV9-mediated delivery of CRISPR/SaCas9 to bone-residing OBs may be able to correct collagen mutations in the skeleton.

As seen in FIG. 7A, OIM-OI mice contain a spontaneous frameshift mutation in the C- terminal pro-peptide domain of COL1A2 protein induced by the deletion of single nucleotide (G) in the junction of the intron and exon. To correct this mutation, the following were generated: 1) two AAV vector genomes encoding either sgRNA targeting the OIM allele only (sgRNAl) or sgRNA targeting both OIM and wildtype alleles (sgRNA2), followed by an AAV- compatible Cas9 nuclease (CRISPR/SaCas9, FIG. 7B), and 2) two AAV vector genomes encoding partial Colla2 complementary sequences and the PITCH gRNA binding site in the absence or presence of SV40 poly-adenylation sequences (SV40-pA, gene ride, FIG. 7C).

The nucleic acid sequence of sgRNAl was gtctattatacagaaaaaacaa (SEQ ID NO: 30). The nucleic acid sequence of sgRNA2 was gaatgaatggggcaagacaatc (SEQ ID NO: 31).

AAV-compatible Cas9 nuclease (SaCas9), derived from Staphylococcus aureus, is ~1 kb shorter than ~4.3 kb sized Streptococcus pyogenes Cas9 (SpCas9), which fits within the genome packaging limits of AAV (-4.85 kb including both ITRs). The gene ride cassette contains 1707 bp-sized complementary sequences to the pro-peptide domain of mouse COL1A2 (810 bp intron, 147 bp exon including G3983 and stop codon, and 881 bp 3’-UTR) and PITCH gRNA-binding site. Insertion of the SV40-pA (131 bp) has been reported to improve homologous recombination of the gene ride. Finally, these AAV vector genomes were packaged into rAAV9 capsid.

The rAAV9 particles described here are expected to deliver the CRISPR/SaCas9 and gene ride to bone-residing OBs, where the SaCas9 nuclease induces a double DNA break at T1 site 3 bp ahead of sgRNAl-guided protospacer-adjacent motif (PAM1) or at T2 site 3 bp ahead of sgRNA2-guided PAM2, and G will be inserted into OIM mutation site at 3978 via the gene ride-mediated homologous recombination.

In vitro assessment of the effects of CRISPR/SaCas9-mediated gene editing in OIMm/m OBs:

To examine the effects of CRISPR/SaCas9-mediated gene editing on osteogenesis of OIMm/m OBs, AAV9 vectors carrying sgRNAl + SaCas9 (sgRNAl), sgRNA2 + SaCas9 (sgRNA2), gene ride (GR1), gene ride + SV40-pA (GR2), or the combination (sgRNAl + GR1 or GR2) were transduced to primary BMSCs isolated from 2-month-old OIM^1117111 mice, cultured under osteogenic conditions, and ALP activity at day 6 was measured for early OB differentiation (FIG. 8). While ALP activity was markedly increased in OIM^1117111 OBs compared to OIM^+/+ OBs, this increased activity in OIM^1117111 OBs was reversed when the CRISPR/SaCas9 and the gene ride were both expressed. However, little effects of a single AAV vector carrying the CRISPR/SaCas9 (sgRNAl or sgRNA2) or the gene ride (GR1 or GR2) on ALP activity in OIMm/m OBs were observed. These results indicate that CRISPR/SaCas9-mediated homology- directed gene editing by the CRISPR/SaCas9 and the gene ride is more effective to reverse 01 phenotypes of OIM^1117111 OBs than CRISPR/SaCas9-mediated gene editing and homologous recombination-mediated gene editing by the gene ride in the cell culture.

To examine genome editing efficiency of the AAV vectors, genomic DNA extracted from AAV-transduced OIMm/m BMSCs (day 2) is used as a template for PCR- mediated amplification with the primers that cover the CRISPR/Cas9-targeting site, and the PCR products are subjected for next-generation sequencing (NGS) analysis. Alternatively, the extracted RNA is PCR-amplified using the same primers and subjected for NGS analysis. The assessment of gene editing efficiency of these AAV vectors is performed. Next, early OB differentiation of AAV-transduced OIM^1117111 BMSCs is assessed by measuring ALP activity (day 10) and extracellular mineralization is analyzed by alizarin red staining for late OB differentiation (day 20). To examine the quality of collagen fibers, extracellular matrix produced by AAV- transduced OIM^1117111 BMSCs is stained with FITC-conjugated collagen hybridizing peptide specific to an unfolded state of type 1 collagen alphal (COLlal) and alpha2 (COLla2) proteins. This is accompanied with immunoblotting for COLla2 in the supernatant and cell lysate to examine the expression of secreted and intracellular Colla2 proteins, respectively. Finally, RNAs are analyzed for expression of osteogenic marker genes (i.e., Runx2, Bglap, Sp7, etc.), Col lai, and Colla2 in AAV-transduced cells. As seen in FIG. 8, the combinatory treatment with the CRISPR/SaCas9 and the gene ride may be more effective for the correction of OIM mutation at DNA and mRNA levels, the production of normal collagen fibers, reverse of OB phenotypes in AAV-transduced OIM^1117111 BMSCs than single treatment with the CRISPR/SaCas9 or the gene ride.

In vivo assessment of the effects of CRISPR/SaCas9-mediated gene editing in OIMm/m mice:

As described in FIG. 9, dynamic histomorphometry and histology in the long bone of AAV-treated OIM^1117111 mice (e.g. by H&E and toluidine blue staining) is performed to assess in vivo OB activity, which is accompanied with qPCR analysis measuring the expression of osteogenic genes in the tibial bone RNA. Systemic OB activity is analyzed by measuring serum bone turnover markers (e.g., bglap, ALP, etc.) using ELISA. Additionally, to assess collagen quality in the skeleton of AAV-treated OIM^1117111 mice, paraffin-sectioned femur and vertebrae are stained with FITC-conjugated collagen hybridizing peptide. Alternatively, the structure of collagen fibers on the femur is examined using scanned electron microscopy (SEM). Protein levels of Colla2 in the bone extracts are analyzed by immunoblotting. Off-target side effects are examined by monitoring weight and behavior of AAV-treated mice weakly and at the end point, tissue histopathology is performed. Combinatory treatment with the CRISPR/SaCas9 and the gene ride via i.v. injection of AAV9 vectors is effective for reversal of the existing skeletal phenotypes of adult OIM-OI mice as well as prevention of the development of 01 in newborn OIM-OI mice, compared to a single treatment with the CRISPR/SaCas9 or the gene ride. Exemplary models are described below: ii) Treatment model:

To examine the ability of systemically delivered AAV9 vectors to ameliorate existing skeletal phenotypes of adult OIM-OI mice, 1 month old OIMm/m mice are treated with a single i.v. injection of rAAV9 vectors carrying control vector (ctrl), sgRNAl.SaCas9 (5 x 10¹³ vg/kg). As a healthy mouse control, OIM+/+ mice are treated with rAAV9.ctrl.

2) Prevention model:

To examine the ability of systemically delivered AAV vectors to prevent the development of skeletal phenotypes in OIM-OI newborn pups, neonates at postnatal day 1 (Pl) from the breeding of OIM^m/+ mice are randomly treated with a single facial vein injection of the A AV vectors (5 x 10¹³ vg/kg). Experimental design for the assessment of skeletal phenotypes and grab strength are described in FIG. 9. 3) Grab strength test of live mice: At the age of 3 months old, live mice were placed on an inverted screen and Kondziela scoring was performed to assess bone and skeletal muscle strength. Compared to ctrl-expressing OIM^+/+ mice, ctrl-expressing OIM^m/m mice show a significant decrease in grab strength and this decrease was partially restored in OIM^m/m mice when AAV9.sgRNA1.SaCas9 was treated at the age of 4 weeks old or P1 (FIG. 10E). 4) End point analyses: AAV-treated mice were euthanized at the age of 3 months in order to examine genome editing efficiency, skeletal phenotypes, collagen quality, and off-target side effects. i) Genomic DNA was isolated from the liver of ctrl-expressing OIM^+/+ and ctrl- or sgRNA1.SaCas9- expressing OIM^m/m mice, PCR-amplified, and subjected for NGS analysis to assess AAV’s genome editing efficiency at DNA levels (Table 2). The NGS readouts from ctrl-expressing OIM^m/m liver DNA show 100% deletion of a single nucleotide (G) in the C-terminal pro-peptide domain while no deletion was detected in ctrl-expressing OIM^+/+ liver. Remarkably, the deletion was corrected in approximately 75% NGS readou s when AAV9.sgRNA1.SaCas9 was treated at the age of 4 weeks old or P1. ii) X-ray imaging of whole body was used to examine bone fracture and skeletal deformities (FIGs. 10A, 10B, 10D, 10F). The ctrl-expressing OIM^m/m mice show multiple bone fractures and deformities of calcaneus bone, knee joints, and pelvic bone while these skeletal phenotypes were ameliorated in OIM^m/m mice treated with AAV9.sgRNA1.SaCas9 at the age of 4 weeks old. Remarkably, these therapeutic effects were further improved when AAV9.sgRNA1.SaCas9 was treated at P1 for the prevention. Additionally, since OI patients show severe osteoporosis, trabecular bone mass of the femurs was measured by microCT analysis (FIG. 10C), demonstrating that a single injection of AAV9.sgRNA1.SaCas9 does not only prevent osteoporosis, but also suppress the progression of osteoporosis. Table 2. Next generation sequencing analysis of AAV-treated liver DNA samples

Example 4. AAV-based gene editing of type 1 collagen mutation to treat osteogenesis imperfecta An 01 mouse model (OIM mice) harboring the deletion of a guanine (G) at nucleotide 3983 of the Colla2 gene, which induces a frameshift of the approximately 50 terminal amino acids of the pro-oc2 C-terminal propeptide (resulting in accumulation of abnormal homotrimeric type 1 collagen in the extracellular matrix) was used to examine the AAV-mediated gene-editing efficiency to correct a mutation in type I collagen. Homozygous OIM mice show characterized features of 01, such as small body size, progressive skeletal deformities, low bone mass, spontaneous fractures, and poor biomechanical properties, similar to the skeletal phenotypes seen in a severe, nonlethal, and receive form of human type III 01. The OIM mutation and its biological consequences in homozygous OIM mice are similar to those found in patients with 01. Compared to OIM mice harboring one nucleotide deletion in the Colla2 gene, four nucleotide deletion (c.4001_4004del) in 01 patients induces a frameshift of 33 terminal amino acids of the pro-COLlA2 (p.(Asnl334Serfs*34)). Both of these mutations result in the synthesis of nonfunctional pro-COLlA2, thereby accumulating abnormal homotrimeric type 1 collagen. It was hypothesized that the systemic delivery of CRISPR/Cas9 to bone-residing osteoblasts via rAAV9 could be used to correct the OIM mutation. Therefore, a plasmid that expresses Staphylococcus aureus -derived SaCas9 nuclease was constructed, which fits within the genome packaging limits of AAV (-4.85 kb, including both inverted terminal repeats), and a sgRNA sequence targeting a protospacer adjacent motif (PAM) at nucleotide 3987-3992 under the transcriptional control of the Ula and U6 promoters, respectively (FIG. 12). The sgRNA sequence comprised the nucleic acid sequence of SEQ ID NO: 36. Alternatively, the GeneRide strategy (replacement gene therapy) enables the correction of the OIM mutation via the targeted insertion of a promoterless partial Colla2 complementary DNA sequences without a nuclease. A plasmid containing the 1838 bp-sized complementary sequence to the pro-oc2 C-terminal propeptide (810 bp intron, 147 bp exon including G3983 and stop codon, and 881 bp 3’-UTR), and 131 bp SV40 polyadenylation sequence was constructed (FIG. 12). The plasmids were packaged into AAV9 capsid (hereafter, referred to as AAV9.SaCas9 and AAV9.GR) to transduce to osteoblast-lineage cells in vitro and in vivo. To further increase AAV-mediated gene editing efficacy, the GeneRide strategy was combined with the CRISPR/Cas9 platform by simultaneously delivering two AAV9 vectors to OIM osteoblasts in vitro and in vivo (AAV9.Cas9/GR). An AAV9 carrying a non-targeting control (NTC), AAV9.NTC, was used as a negative control.

AAV-mediated gene editing in OIM osteoblasts

Since the heterogeneity of primary OIM osteoblasts may cause variations in gene-editing efficiency, calvarial osteoblasts isolated from homozygous OIM (OIM) newborn mice pups were immortalized by expressing a heat- sensitive SV40 large T antigen and clonally selected to obtain a homogeneous cell population. AAV-mediated expression and subcellular localization of SaCas9 in OIM osteoblasts were confirmed by qPCR and immunofluorescence analyses (data not shown). Three days after treatment with AAV9 carrying non-targeting control (NTC), sgRNA + SaCas9 (SaCas9), GeneRide (GR), or sgRNA + SaCas9 + GeneRide (Cas9/GR), genomic DNA was isolated from the cells, PCR-amplified, and subjected to Sanger sequencing (FIG. 13C) or next-generation sequencing to determine Colla2 gene correction efficiency in OIM osteoblasts (FIG. 13B). Protein expression of Colla2 in OIM osteoblasts was confirmed by immunoblotting analysis (data not shown). NGS analysis of sequence reads revealed that -30% of the edited genomes in GR- or Cas9/GR-treated cells carried insertions of the missing guanine (G) in the Colla2 gene via HDR, while treatment with Cas9/GR or SaCas9 resulted in less than 1% of adenine insertions via non-homologous end joining (NHEJ, FIG. 13D). The variant frequency analysis showed that the number of reads with gaps in any nucleotide positions near SaCas9-induced cuts reached to -2% in SaCas9- or Cas9/GR-treated cells relative to NTC- or GR-treated cells showing noise signals (FIG. 13D). Expression of the resultant Colla2 (Col/a2^c’^/(m]) mRNA in AAV-treated cells corresponds to higher on-target gene correction efficiency of AAV9 vectors carrying GR than SaCas9, which was further increased in the combination of GR and SaCas9 (FIG. 13E). It has been reported that low bone mass in OI results from dysregulation of osteogenic activity rather than the incapacity of osteoblasts to produce enough organic bone matrix proteins. To test AAV’s ability to reverse dysregulated osteogenic differentiation of OIM osteoblasts, bone marrow-derived stromal cells (BMSCs) were isolated from OIM or littermate control (WT) mice and treated with AAV9 vectors. Six days later, alkaline phosphatase (ALP) activity and expression of tissue non-specific alkaline phosphatase (Tnalp), an osteoblast differentiation marker, were examined (FIG. 13F-H). ALP activity and expression were markedly elevated in control-treated OIM BMSCs relative to control-treated WT BMSCs, which was almost completely reversed by treatment with GR or Cas9/GR. SaCas9-treated cells showed only a mild reduction. Thus, GR- or Cas9/GR-mediated HDR is more effective for Colla2 gene correction in OIM osteoblasts than SaCas9-mediated NHEJ, thereby ameliorating dysregulated differentiation of OIM osteoblasts.

In vivo gene editing in OIM mice

To test whether systemically delivered AAV9 can transduce type 1 collagen-producing osteoblasts in the skeleton, the bio-distribution of AAVs were determined in individual tissues by GFP expression. One-month-old OIM mice were injected intravenously (i.v.) with AAV9 expressing GFP protein under the Ula promoter control (AAV9.egfp) or PBS, and one month later, GFP expression in individual tissues was examined by IVIS-100 optical imaging system, qPCR analysis, and fluorescence microscopy in cryo- sectioned tissues. These results demonstrated a high expression in the liver, a modest expression in skeletal muscle and bone, and little to no expression in the brain, heart, lung, kidney, and spleen (FIG. 14A). Next, OIM mice or littermate controls (WT) were injected i.v. with a single dose of AAV9 carrying NTC, GR, or Cas9/GR and one month later, genomic DNA was isolated from A AV-transduced liver, skeletal muscle, and femur and subjected to Sanger sequencing or NGS analysis. Given that the liver is primarily transduced by rAAV9 when systemically administered, i.v. administration of rAAV9 carrying GR- or Cas9/GR was most effective for Colla2 gene correction in the liver showing the highest AAV transduction efficiency relative to skeletal muscle or femur showing a modest transduction efficiency (FIG. 14B, left). Protein expression of Colla2 in OIM liver was confirmed by immunoblotting analysis (data not shown). NGS analysis of sequence reads showed that approximately 8% (GR) and 12% (Cas9/GR) of the edited genomes in AAV-treated femurs carried insertions of the missing guanine (G) in the Colla2 gene via HDR, while Cas9/GR showed less than 1% of adenine insertions via NHEJ (FIG. 14B, right). Notably, the number of reads with variant sequences reached to ~2% in Cas9/GR-treated femurs relative to NTC- or GR-treated femurs showing noise signals. The resultant Colla2 (Col/a2^c’^/(m]) expression was also markedly elevated in GR-treated femurs compared to NTC-treated femurs, which was further increased when combined with CRISPR/Cas9 and GR (FIG. 14C). Collectively, it was shown that systemic delivery of rAAV9 in OIM mice could correct the Coll a2 mutation in bone- forming osteoblasts via GR- or Cas9/GR- mediated HDR. The combination approach of CRISPR/Cas9 and GR was more effective for in vivo Colla2 gene correction than GR alone.

Coll a2 gene correction in OIM mice ameliorates skeletal phenotypes.

OIM neonates have been reported to display hemorrhages into joint cavities, visible breaks in the long bones, and a “drooping wrist” appearance due to subluxation on one or both forepaws at different degree of severity. At the age of one month old, spontaneous fractures, deformities of long bones, pelvic bones and calcaneus bones, and low bone mass are also found in these mice. To examine the ability of systemically delivered AAV to reverse 01 skeletal phenotypes, one-month-old OIM mice were i.v. injected with dual AAV9 vectors expressing SaCas9 and GR (AAV9.Cas9/GR), and two months later, a full phenotypic characterization of these mice, including skeletal deformities, spontaneous fractures, grip strength, and bone mass, was performed. Radiographic analysis of the whole body of NTC-treated OIM mice demonstrated a high incidence of fractures with persistent non-unions or abnormal fracture healing in the humerus, femur, and tibia and skeletal deformities in calcaneus and olecranon. These phenotypes were substantially ameliorated by a single dose of AAV9.Cas9/GR (FIG. 15 A). Cas9/GR-treated mice also showed an increased ratio of inter- femoral distance to inter- ischia distance in the pelvis, suggesting a significant improvement of skeletal deformities in OIM pelvic bone (FIG. 15B). Additionally, grip strength of these mice was increased, as shown by the greater Kondziela score (FIG. 15B). Finally, microCT analysis demonstrated a significant increase in trabecular bone mass and cortical thickness of Cas9/GR- treated femurs relative to NTC-treated femurs (FIG. 15B). Thus, a single dose of systemically delivered AAV9 expressing Cas9/GR enables to partly reverses 01 skeletal phenotypes in OIM mice, including improvements in fracture healing, bone mass, and grip strength along with reduced skeletal deformities. 01 bone is characterized by bone fragility due to abnormal processing and/or synthesis of type 1 collagen, followed by decreased bone mineral density. These characteristics could impact mechano-sensing networks of osteocytes residing within the mineralized bone matrix that are critical for maintaining bone remodeling and minerals. Compared to NTC-treated WT femurs, NTC-treated OIM femurs display disorganized bone architecture and extracellular matrix deposition, accompanied by cuboidal- shaped morphology of osteocytes and decreased number and length of osteocyte dendrites (FIG. 15C). Additionally, the expression of sclerostin, a marker of mature osteocytes, was markedly reduced, demonstrating a lack of mature osteocytes in the bone matrix of OIM mice (FIG. 15D). Notably, in vivo osteogenesis and osteoclastogenesis in NTC-treated OIM femurs were both upregulated, resulting in high bone matrix turnover (FIG. 15E). When systemically administered with AAV9.Cas9/GR, bone architecture and extracellular matrix deposition, osteocyte morphology, dendrites, and number, and high bone turnover rates were partly reversed. Next, gene editing efficiency in AAV-treated femurs was assessed five months after AAV’s injection to examine the duration of AAV’s effectiveness in OIM mice. Sanger sequencing analysis showed approximately 10% of the edited genomes carried insertions of the missing guanine (G) in the Colla2 gene via HDR. Notably, OI skeletal phenotypes in these mice were significantly improved. However, further experiments with longer durations (12 and 18 months post AAV injection) will be needed to clarify AAV’s durability in the skeleton. Taken together, an AAV-mediated gene editing approach that enables correction of the Colla2 mutation in OI osteoblasts is a promising strategy to treat disabling OI, providing the potential for clinical translation to OI patients.

As shown in this Example, three AAV-based gene-editing approaches for OI, including (1) NHEJ-mediated gene correction by CRISPR/Cas9, (2) HDR- mediated gene correction by GeneRide (gene replacement), and (3) HDR-mediated gene correction by the combination of CRISPR/Cas9 and GeneRide were tested. CRISPR/Cas9 showed a low gene correction efficiency in OIM osteoblasts while producing -2% variant sequence reads. Compared to CRISPR/Cas9-mediated gene editing, HDR-mediated gene correction by GeneRide or Cas9/GR was improved up to -30% in OIM osteoblasts and -10% in OIM femurs, demonstrating higher gene correction efficiency by GeneRide alone or the combination of CRISPR/Cas9 and GeneRide (relative to CRISPR/Cas9 alone). Notably, although gene correction rates at genomic levels are comparable between GeneRide alone and the combination, mRNA levels of the corrected Colla2 gene were markedly increased by treatment with the combination compared to GeneRide. This discrepancy may result from an inability of NGS primers to distinguish Colla2 sequences in genomic DNA vs. residual GeneRide. This study demonstrated that HDR-mediated gene correction by the combination of CRISPR/Cas9 and GeneRide is most effective in OIM osteoblasts since CRISPR/Cas9 creates double-strand DNA breaks (DSBs) near the OIM mutation site, which facilitates the targeted insertion of GeneRide into the Colla2 gene.

Treatment of OIM osteoblasts with GeneRide or Cas9/GR restored the missing guanine in the Colla2 gene and reversed dysregulated osteogenic differentiation. In contrast to OIM osteoblasts, OIM bone marrow-derived monocytes normally differentiate into mature osteoclasts, which was unaltered by the treatment with GeneRide or Cas9/GR. These results suggest that the Colla2 mutation does not affect osteoclast development. A single dose of systemically administered dual AAV9 vectors effectively delivered Cas9/GR to osteoblastlineage cells residing in the skeleton, corrected the Colla2 mutation, and ameliorated 01 skeletal phenotypes in OIM mice, such as spontaneous fractures, skeletal deformities, and weak grip strength. Mechanistically, AAV-mediated gene-editing not only dampened bone matrix turnover rates by reducing osteoblast and osteoclast development in vivo but also improved the cellular network of mechano- sensing osteocytes embedded in the bone matrix, which ameliorates bone architecture, mass, and mineralization of OIM mice. Thus, these findings provide the first in vivo evidence that AAV-based gene-editing is a promising option for treating 01. Specifically, these data demonstrate that AAV-based methodologies of the disclosure (Cas9 gene editing using a Coll a2-targcting guide RNA; and/or gene replacement, e.g., using a codon-optimized Colla.2') are capable of treating 01 and improving bone phenotypes.

Materials and Methods

AAV vector design and production for expressing SaCas9 and GR: The TBG promoter in pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA; U6::BsaI-sgRNA (Addgene plasmid # 61593) was replaced with Ula promoter to construct pAAV-Ula-SaCas9-U6-BsaI- sgRNA plasmid. The sgRNA targeting a protospacer adjacent motif (PAM) at nucleotide 3987- 3992 of Colla2 was incorporated into the pAAV-Ula-SaCas9-U6-BsaI-sgRNA to generate the pAAV-Ula-SaCas9-U6- sgColla2 plasmid for gene editing (Figure 12). pAAV-Ula-egfp plasmid was used as a negative control. Gene Ride: 1838 bp-sized sequences to the pro-oc2 C- terminal propeptide (810 bp intron, 147 bp exon including G3983 and stop codon, and 881 bp 3’-UTR) and 131 bp SV40 poly adenylation sequences were incorporated into the promoterless pAAV plasmid (FIG. 12). The sequences of gB locks for plasmid construction are in Table 3. AAV9 was produced by transient HEK 293 cell transfection and CsCl sedimentation. Vector preparations were determined by ddPCR, and purity was assessed by 4%-12% SDS-acrylamide gel electrophoresis and silver staining.

Table 3: Sequences of qPCR primers

Cell lines and cell culture: For osteoblast culture, calvarial osteoblasts (COBs) or bone marrow stromal cells (BMSCs) were obtained from OIM

mice or littermate controls

(C57BL/6J). Primary COBs were isolated from OIM newborn pups at postnatal days 3-5 using collagenase and dispase II and immortalized via lentivirus-mediated expression of a heatsensitive SV40 large T antigen. The cells were clonally selected to obtain homogenous COBs. Alternatively, the femurs and tibias were surgically removed from 4-week-old OIM mice and crushed using mortar and pestle. After removing red blood cells, BMSCs were cultured under growth medium (a-MEM medium, 10% FBS, 2 mM L-glutamine, 1% nonessential amino acids, and 1% penicillin/ streptomycin). For osteogenic differentiation, ascorbic acid (200 pM) and P- glycerophosphate (10 mM) were added to the growth medium. For the alkaline phosphatase (AFP) activity assay, osteoblasts were incubated with Alamar Blue solution to check cell viability. Subsequently, cells were washed with PBS and incubated with a solution containing 6.5 mM NaiCCh, 18.5 mM NaHCCh, 2 mM MgCh, and phosphatase substrate, and ALP activity was measured by spectrometer. For ALP staining, osteoblasts were fixed with 10% neutral formalin buffer and stained with the solution containing Fast Blue and Naphthol AS-MX. At day 6 of the osteogenic culture, total RNA was extracted using Qiazol and subjected to qPCR analysis.

For osteoclast culture, bone marrow cells were flushed from the femurs and tibias of 2- month-old mice (C57BL/6 J) and cultured in Petri dishes in a-MEM medium with 10% FBS and 10 ng/ml of M-CSF to obtain bone marrow monocytes (BMMs). After 12 h, nonadherent cells were collected and replated into 24-well plates at a density of 0.5xl0⁶ cells/well in the same medium for 2 days. BMMs were differentiated into osteoclasts in the presence of RANKL (20 ng/ml) and M-CSF (20 ng/ml) for 6 days. The osteoclast differentiation medium was changed every 48h.

Sanger sequencing, next-generation sequencing (NGS), and qPCR analyses: Genomic DNA was extracted from AAV-transduced osteoblasts, liver, muscle, or femur/tibia, PCR- amplified, and subjected to Sanger sequencing or NGS analysis. For NGS analysis, the cDNAs synthesized from cellular or tissue genomic DNA were amplified using Colla2-targeting primers and the PCR products were subjected to NGS. For qPCR, total RNA was extracted from AAV-transduced cells or femur and mRNA levels of the corrected Colla2 gene were assessed by qPCR analysis and normalized to P-actin. Primer sequences are provided in Table 3.

Mice: OIM mice were maintained on the C57BL/6 background. Mouse genotypes were determined by PCR on tail genomic DNA.

The experiments were carried out on OIM mice and littermate controls. One-month-old mice were randomly divided into six groups (PBS, AAV9.egfp, AAV9.NTC, AAV9.SaCas9, AAV9.GR, AAV9.Cas9/GR) and intravenously injected with a single dose of AAV9.NTC (200 pl of 5 x 10¹² genome copies (GC)/ml), AAV9.SaCas9 (200 pl of 5 x 10¹² GC/ml), AAV9.GR (200 |11 of 5 x 10¹² GC/ml), or AAV9.GR (100 p.1 of 10¹³ GC/ml) + AAV9.Cas9 (100 p.1 of 10¹³ GC/ml) at a concentration of 5 x 10¹³ vg/kg. Four weeks later, mice were euthanized and AAV’s biodistribution in individual tissues was assessed by GFP expression, qRT-PCR analysis, and fluorescence microscopy cryo- sectioned tissues. Additionally, genomic DNA or RNA was isolated, PCR-amplified, and subjected to Sanger sequencing, NGS, and qRT-PCR analysis. Eight weeks after AAV injection, mice were placed on an inverted screen, and Kondziela scoring was performed to examine grip strength. Kondziela test measures muscle strength of all four limbs using the inverted screen. For skeletal analysis, radiography analysis of the whole body, microCT and histologic analyses of femurs, and qRT-PCR analysis of tibial RNA were performed. Clinical scoring of 01 skeletal phenotypes: Euthanized mice were processed for radiographic (2D images) and microCT (3D images) analyses of the whole body to perform a clinical assessment of 01 skeletal phenotypes. Each mouse was independently scored by a minimum of two researchers, blinded as to the identity of the groups, and each score was recorded. Any skeletal deformity and fracture at the target site were scored as a point “1” (without consideration of severity) to highlight the incident frequency.

MicroCT analysis: Micro-computed tomography of femur bones was carried out using microCT 35, to determine qualitative and quantitative assessments of trabecular bone microarchitecture. Briefly, femurs dissected from the indicated mice groups were fixed with 10% neutral buffered formalin and scanned using a microCT 35 with a spatial resolution of 7 pm. For trabecular bone analysis of the distal femur, an upper 2.1 mm region beginning 280 pm proximal to the growth plate was contoured. Three-dimensional reconstruction images were obtained from contoured two-dimensional images by methods based on the distance transformation of the binarized images. Alternatively, the Inveon multimodality 3D visualization program was used to generate fused 3D viewing of multiple static or dynamic volumes of microCT modalities. Trabecular bone parameters, i.e., bone volume/tissue volume ratio (BV/TV) and trabecular number (Tb.N.), were calculated. For cortical bone analysis of the femur, a mid-shaft region of 0.6 mm in length was used. All images presented are representative of the respective genotypes (n = 6).

Histology and Immunofluorescence: Femurs were dissected from AAV-treated mice for histological studies. Briefly, femurs were fixed in 10% neutral buffered formalin for 2 days, followed by decalcification for 2-4 weeks using 0.5M tetrasodium EDTA. Further, tissues were dehydrated by passage through an ethanol series, cleared twice in xylene, embedded in paraffin, and sectioned at a thickness of 6 pm along the coronal plate from anterior to posterior. Decalcified femoral sections were stained with silver nitrate. For immunofluorescence, the femoral bone was fixed with 4% paraformaldehyde (PFA) for 2 days and decalcified in 0.5M tetrasodium EDTA solution for 10 days. Semi-decalcified samples were infiltrated with 25% sucrose phosphate for 4 days. All samples were embedded in a 50/50 mixture of 25% sucrose solution and OCT compound and cut into 12-pm-thick sagittal sections using a cryostat. Nuclei were stained with 4-6, diamidino-2-phenylindole (DAPI).

Statistical Analysis: Except where indicated, all data are graphically represented as the mean ± SD. For experiments with three or more samples, statistical analysis was performed using one-way ANOVA followed by a Bonferroni-corrected Student’s t-test. For two-sample comparisons, a two-tailed, unpaired Student’s t-test was applied. Values were considered statistically significant at p <0.05. Results shown are representative of three or more individual experiments. Example 5. Assessment of the effects of Gene Ride (gene replacement) in OIM mice The ability of systemically delivered AAV9 vectors to ameliorate existing skeletal phenotypes of adult OIM-OI mice. OIM^m/m mice (1 month-old) were treated with a single intravenous injection of rAAV9 vectors encoding control vector (ctrl) or codon-optimized human Col1a2 (hCol1A2^opt). As a control, wild-type OIM^+/+ mice (1 month-old) were treated with rAAV9 vector carrying control vector (ctrl). At the age of 3 months old, live mice were placed on an inverted screen and Kondziela scoring was performed to assess bone and skeletal muscle strength. Compared to ctrl-expressing OIM^+/+ mice, ctrl-expressing OIM^m/m mice showed a significant decrease in grab strength (according to Kondziela scoring). This decrease in grab strength was partially restored in OIM^m/m mice treated with rAAV9 encoding hCol1A2^opt (FIG. 16). The mice were subsequently euthanized (at the age of 3 months) and evaluated for trabecular bone volume fraction (BV/TV) and connectivity density (Conn. Dens). As shown in FIG. 16, ctrl-expressing OIM^m/m mice showed a significant decrease in trabecular bone volume fraction and connectivity density relative to ctrl-expressing OIM^+/+ mice. Notably, these decreases were completely reversed in OIM^m/m mice treated with rAAV9 encoding hCol1A2^opt. These data demonstrate that AAV delivery of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of treating osteogenesis imperfecta (OI) and improving bone phenotypic outcomes. Example 6. Assessment of the effects of the combination of an inhibitory nucleic acid and Gene Ride (gene replacement) in OIM mice The ability of systemically delivered AAV9 vectors to ameliorate existing skeletal phenotypes of adult OIM-OI mice. OIM^m/m mice (1 month-old) were treated with a single intravenous injection of rAAV9 vectors encoding (1) green fluorescent protein (GFP) (negative control), (2) codon-optimized human Col1a2 (hCol1A2^opt), or (3) the combination of an inhibitory nucleic acid targeting mouse Col1A2 (amiR-pan-mCol1a2) and codon-optimized human Col1a2 (hCol1A2^opt). A schematic of the combination (3) in FIG. 17A. As a control, wild-type OIM^+/+ mice (1 month-old) were treated with rAAV9 vector carrying GFP. The mice were euthanized at the age of 3 months and evaluated for mRNA levels of mouse Col1a2 (i.e., Col1a2 endogenous to the mice), human Col1a2 (i.e., Col1a2 expressed from hCol1A2^opt), Tnalp, and Bglap. As shown in FIG. 17B, the mRNA levels of mouse Col1a2 are decreased in OIM^m/m mice treated with the combination of amiR-pan-mCol1a2 and hCol1A2^opt. OIM^m/m mice treated with hCol1A2^opt alone had no change in mouse Col1a2 mRNA relative to OIM^m/m mice treated with GFP. Treatment of OIM^m/m mice with hCol1A2^opt causes an increase in human Col1a2 mRNA, relative to OIM^m/m mice treated with GFP. As shown in FIG. 17C, OIM^m/m mice treated with GFP control have significantly increased mRNA expression of tissue non-specific alkaline phosphatase (Tnalp) (an osteoblast differentiation marker that is a marker of bone disease, e.g., OI), relative to wild-type OIM^+/+ mice treated with GFP control. The treatment of OIM^m/m mice with hCol1A2^opt provides a reduction in Tnalp expression. Furthermore, notably, the combination treatment of hCol1A2^opt and amiR-pan-mCol1a2 restores Tnalp to the same levels as in the wild-type OIM^+/+ mice. The combination treatment of hCol1A2^opt and amiR-pan-mCol1a2 in OIM^m/m mice similarly restores the expression of an osteogenic marker gene (Bglap) to normal levels shown in OIM^+/+ mice. These data demonstrate that AAV delivery of a combination of (1) a nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein, and (2) a nucleic acid comprising a transgene comprising a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A sequence, is capable of treating osteogenesis imperfecta (OI) and improving bone phenotypic outcomes. Example 8. HEK293T cells were transfected with empty vector or a plasmid encoding hCOL1A1^OPT and subsequently lysed after a 72-hour period. Lysed cells were subjected to immunoblotting with antibodies specific to Col1A (FIG. 18A) or Col1A2 (FIG. 18B). Total RNA was subjected to qPCR analysis to measure human COL1A1 mRNA expression (FIG. 18C). WT and OIM calvarial osteoblasts were infected with AAV9 encoding hCOL1A1OPT and cultured under osteogenic conditions. 72 hours later, hCOL1A1OPT mRNA expression was measured using qPCR analysis. NTC: non-treated control (FIG. 18D). These data demonstrate that delivery of hCOLlAl^opt to both HEK293T cells and calvarial osteoblasts provides expression of human CollAl.

8-week-old mice (n=3) were intravenously injected with PBS or 5 x 10¹² vg/kg of AAV9 encoding GFP (with U1A promoter). Two weeks later, individual tissue distribution of AAVs was assessed via EGFP expression using an optical imaging system. Histology was performed on frozen sections of AAV-treated tissues and qPCR analysis was conducted to assess tissue distribution of AAVs. As shown in FIG. 19, AAV9 directed delivery of GFP plasmid to the lungs, liver, and bone. This data suggests that AAV9 can be useful in preferentially targeting bone tissues.

4-week-old OIM mice (n=7/group) were intravenously injected with 5 x 10¹³ vg/kg of AAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, skeletal phenotypes and grip strength were assessed by whole body radiography, Kondziela scoring (FIG. 20A), fracture and skeletal deformity incidence (FIG. 20B), and pelvic bone radiography (FIGs. 20C-20D). The distance of inter-femur and inter- ischia in the pelvic bone was measured (arrows, FIG. 20C). The OIM mice treated with vector control experienced a significant decrease in Kondziela score and ratio of inter-femur to inter- ischia (see, FIG. 20C and FIG. 20D), relative to wild-type mice. Notably, the treatment of the OIM mice with hCOLl A 1^OPT partially rescued these phenotypic markers (see, increased Kondziela score and increased ratio of inter-femur to inter-ischia). mRNA expression of hCOLlAl^OPT in tibial RNA was assessed by qPCR analysis (FIG. 20E). Only the mice that were delivered the hCOLlAl^OPT-containing vector had positive expression of human Colla2. These data demonstrate that delivery to a disease subject (OIM mice) of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of restoring normal, healthy phenotypes in bone tissue.

4-week-old OIM mice (n=7/group) were intravenously injected with 5 x 10¹³ vg/kg of AAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, bone mass and microarchitecture of the femur (FIGs. 21A-21E) and lumbar vertebrae (L4) (FIGs. 21F-21J) were assessed by micro-CT analysis. Relative to wild-type mice, the OIM mice treated with vector control experienced significant worsening of several key phenotypic markers in the femur. Specifically, the femurs of OIM mice experienced a significant decrease in the ratio of trabecular bone volume to tissue volume (Tb. BV/TV) (FIG. 2 IB), a significant increase in trabecular space (Tb. Sp) (FIG. 21C), a significant decrease in trabecular number (Tb. N) (FIG. 2 ID), and a significant decrease in trabecular connectivity density (Tb. Conn. Dens) (FIG. 2 IE), relative to wild-type mice. Notably, the treatment of the OIM mice with hCOLlAl^OPT rescued each of these phenotypic markers (note the lack of significance between the assessed values for OIM treated with hC OL1 A 1^OPT relative to wild-type mice). The data present a similar story for bone phenotypic markers in lumbar vertebrae (L4). The lumbar vertebrae (L4) of OIM mice experienced a significant increase in trabecular space (Tb. Sp) (FIG. 21H), a significant decrease in trabecular number (Tb. N) (FIG. 211), and a significant decrease in trabecular connectivity density (Tb. Conn. Dens) (FIG. 21 J), relative to wild-type mice. Treatment of OIM mice with hCOL 1 A 1^OPT rescued each of these phenotypic markers (note the lack of significance between the assessed values for OIM treated with hCOLl A 1^OPT relative to wild-type mice in FIGs. 21H-21J). These data demonstrate that delivery to a disease subject (OIM mice) of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of restoring normal, healthy phenotypes in bone tissue.

OIM mice (n=7/group) at postnatal day 1 (Pl) (e.g., one day after birth) were intravenously injected with 5 x 10¹³ vg/kg of AAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, skeletal phenotypes and grip strength were assessed by whole body radiography (FIG. 22A), Kondziela scoring (FIG. 22B), pelvic bone deformity as assessed by the inter-femoral to inter-ischial ratio (FIG. 22C), trabecular bone mass in the femur fracture (FIGs. 22D-22E), and fracture and skeletal deformity incidence (FIG. 22F). Arrows and circles indicate areas of bone fracture and skeletal deformity in FIG. 22A. OIM Mice treated with the vector control had worsened phenotypic outcomes relative to wild-type mice. As shown in earlier results, delivery of hCOLlAl^OPT to OIM mice at least partially restored phenotypic markers to be similar to the phenotype of wildtype (healthy) mice. These data demonstrate that delivery to a newborn subject who has not yet experienced disease (but has the genetic markers of disease) of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of providing the subject with normal, healthy phenotypes in bone tissue. This study is useful in suggesting that a Colla2 gene replacement therapy can be used as a preventative measure for subjects who are predisposed to suffer from a bone condition.

4-week-old OIM mice (n=7/group) were intravenously injected with 5 x 10¹³ vg/kg of AAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, Raman spectra of Phosphate (-959 cm-1), Carbonate (1,070 cm-1), Amide III (1,340 cm-1), and Amide I (1,665 cm-1) bands in AAV-treated femurs were assessed by a Raman microscope (FIG. 23A). Mineral to matrix ratio (Phosphate/ Amide I) (FIG. 23B), Carbonate substitution (FIG. 23C), Collagen content (FIG. 23D), and Mineral Crystallinity (FIG. 23 E) were also determined. These data demonstrate that delivery of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of providing restored phenotypes in OIM mice relating to bone mineralization, collagen, and others.

4-week-old OIM mice (n=7/group) were intravenously injected with 5 x 10¹³ vg/kg of AAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, longitudinal sectioned femurs were stained with TRAP. Relative quantification of osteoclasts number (FIG. 24 A) and surface area (FIG. 24B) were displayed. Serum levels of type I collagen cross-linked C-telopeptide (CTX-1, FIG. 24C), bone gla-protein (BGP, FIG. 24D), and type I collagen (FIG. 24E) were measured using ELISA. These data demonstrate that delivery of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a COL1A2 protein is capable of providing restored phenotypes in OIM mice relating to number of osteoclasts and specific protein biomarkers.

4-week-old OIM mice (n=3/group) were intravenously injected with 5 x 10¹³ vg/kg of rAAV9 encoding vector control (NTC) or hCOLlAl^OPT. Wild-type mice were used as a control. Two months later, tibial bone RNA was subjected to bulk RNA sequencing. As shown in FIG. 25 A, there were 213 differentially expressed genes (DEGs) in wild-type mice compared to OIM mice treated with hCOLlAl^OPT (“WT vs OE”); and 61 DEGs in wild-type mice compared to OIM mice treated with vector control (“WT vs OIM”) (FIG. 25A). Gene Ontology and Heat map analysis were performed using gene enrichment technique (FIG. 25B-25D). These data demonstrate that several genes, including the selection of genes provided in FIG. 25B, are differently expressed in OIM treated with hCOL 1 A 1^OPT compared to wild-type mice.

Primary bone marrow-derived stromal cells (BMSCs) were isolated from 1-month-old wild-type (WT) or OIM mice, transduced with rAAV9 encoding vector control (NTC) or hCOLlAl^OPT, and cultured under osteogenic conditions (n=3). Six days later, mRNA expression of osteogenic marker genes, including alkaline phosphatase (ALP), type 1 collagen Al (Collal), osteopontin (OPN), and osteocalcin (OCN) were assessed by qPCR analysis. The transduction efficiency of AAVs was assessed by measuring hCOLlAl^OPT expression. These data demonstrate that expression of osteogenic marker genes is elevated in OIM mice treated with vector control relative to wild-type mice. Notably, administration of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a C0L1A2 protein (hCOLlAl^OPT) to the OIM mice was able to restore the expression of osteogenic marker genes to wild-type mouse levels.

These data collectively demonstrate that Colla2 gene replacement therapy can be useful in treating diseases such as 01. Specifically, these data suggest that administration of an isolated nucleic acid comprising a transgene comprising a codon-optimized nucleic acid sequence encoding a C0L1A2 protein (such as hCOLlAl^OPT) can provide a therapeutically relevant benefit to gene expression profiles of tested subjects.

Claims

CLAIMS What is claimed is:

1. An isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding a COL1A2 protein flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

2. The isolated nucleic acid of claim 1, wherein the COL1A2 protein is a human COL1A2 protein.

3. The isolated nucleic acid of claim 1, wherein the COL1A2 protein is a mouse COL1A2 protein.

4. The isolated nucleic acid of any one of claims 1 to 3, wherein the nucleic acid sequence encoding the COL1A2 protein is a codon-optimized sequence.

5. The isolated nucleic acid of claim 4, wherein the codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or 2.

6. The isolated nucleic acid of claim 5, wherein the codon-optimized nucleic acid sequence comprises at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 1 or 2; and wherein the codon-optimized nucleic acid does not comprise the nucleic acid sequence of SEQ ID NO: 7 or 8.

7. The isolated nucleic acid sequence of any one of claims 1 to 6, wherein the COL1A2 protein comprises the amino acid sequence set forth in SEQ ID NO: 3 or 4.

8. The isolated nucleic acid of any one of claims 1 to 7, wherein the transgene further comprises a promoter operably linked to the nucleic acid sequence encoding the COL1A2 protein, optionally wherein the promoter comprises or consists of a Ula promoter sequence.

9. The isolated nucleic acid of claim 8, wherein the U la promoter sequence comprises the nucleic acid sequence of SEQ ID NO: 19.

10. The isolated nucleic acid of any one of claims 1 to 9, wherein the AAV ITRs are AAV2 ITRs.

11. A recombinant adeno-associated virus (rAAV) comprising:

(i) the isolated nucleic acid of any one of claims 1 to 10; and

(ii) at least one AAV capsid protein.

12. The rAAV of claim 11, wherein the at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof.

13. The rAAV of claim 11 or 12, wherein the at least one AAV capsid protein is an AAV9 capsid protein.

14. An isolated nucleic acid comprising a transgene comprising a nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A sequence flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

15. The isolated nucleic acid of claim 14, wherein the at least one inhibitory nucleic acid is a dsRNA, siRNA, shRNA, miRNA, or artificial miRNA (ami-RNA).

16. The isolated nucleic acid of claim 14 or 15, wherein the at least one inhibitory nucleic acid comprises a region of complementarity with a mutant COL1A2 sequence.

17. The isolated nucleic acid of claim 16, wherein the mutant COL1A2 sequence comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence.

18. The isolated nucleic acid of any one of claims 14 to 17, wherein the at least one inhibitory nucleic acid does not inhibit expression of wild-type COL1A2.

19. The isolated nucleic acid of any one of claims 14 to 18, wherein the at least one inhibitory nucleic acid is an artificial miRNA (ami-RNA).

20. The isolated nucleic acid of claim 19, wherein the ami-RNA comprises a comprises a miRNA backbone selected from: miR-33, miR-168, miR-157, miR-155, and miR- 30 backbone.

21. The isolated nucleic acid of any one of claims 14 to 20, wherein the at least one inhibitory nucleic acid comprises the sequence set forth in any one of SEQ ID NOs: 20-24.

22. The isolated nucleic acid of any one of claims 14 to 21, further comprising a promoter operably linked to the nucleic acid sequence encoding one or more inhibitory nucleic acids, optionally wherein the promoter comprises or consists of a Ula promoter sequence.

23. The isolated nucleic acid of claim 22, wherein the Ula promoter sequence comprises the nucleic acid sequence of SEQ ID NO: 19.

24. The isolated nucleic acid of any one of claims 14 to 23, wherein the AAV ITRs are AAV2 ITRs.

25. The isolated nucleic acid of any one of claims 1 to 24, wherein the nucleic acid further encodes a Precise Integration into Target Chromosome (PITCH) gRNA binding site.

26. A recombinant adeno-associated virus (rAAV) comprising:

(i) the isolated nucleic acid of any one of claims 14 to 25; and

(ii) at least one AAV capsid protein.

27. The rAAV of claim 26, wherein the at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof.

28. The rAAV of claim 26 or 27, wherein the at least one AAV capsid protein is an

AAV9 capsid protein.

29. An isolated nucleic acid comprising a transgene comprising:

(i) a first nucleic acid sequence encoding a COL1A2 protein; and

(ii) a second nucleic acid sequence encoding one or more inhibitory nucleic acids targeting a COL1A sequence, wherein the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

30. The isolated nucleic acid of claim 29, wherein the COL1A2 protein is a human COL1A2 protein.

31. The isolated nucleic acid of claim 29, wherein the COL1A2 protein is a mouse COL1A2 protein.

32. The isolated nucleic acid of any one of claims 29 to 31, wherein the nucleic acid sequence encoding the COL1A2 protein is a codon-optimized sequence.

33. The isolated nucleic acid of claim 32, wherein the codon-optimized nucleic acid sequence comprises the nucleic acid sequence set forth in SEQ ID NO: 1 or 2.

34. The isolated nucleic acid of claim 33, wherein the codon-optimized nucleic acid sequence comprises at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 97% identity, at least 98% identity, or at least 99% identity to the nucleic acid sequence set forth in SEQ ID NO: 1 or 2; and wherein the codon-optimized nucleic acid does not comprise the nucleic acid sequence of SEQ ID NO: 7 or 8.

35. The isolated nucleic acid sequence of any one of claims 29 to 34, wherein the COL1A2 protein comprises the amino acid sequence set forth in SEQ ID NO: 3 or 4.

36. The isolated nucleic acid of any one of claims 29 to 35, wherein the at least one inhibitory nucleic acid comprises a region of complementarity with a mutant COL1A2 sequence.

37. The isolated nucleic acid of claim 36, wherein the mutant COL1A2 sequence comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence.

38. The isolated nucleic acid of any one of claims 29 to 37, wherein the at least one inhibitory nucleic acid does not inhibit expression of wild-type COL1A2.

39. The isolated nucleic acid of any one of claims 29 to 38, wherein the at least one inhibitory nucleic acid is an artificial miRNA (ami-RNA).

40. The isolated nucleic acid of claim 39, wherein the ami-RNA comprises a comprises a miRNA backbone selected from: miR-33, miR-168, miR-157, miR-155, and miR- 30 backbone.

41. The isolated nucleic acid of any one of claims 29 to 40, wherein the at least one inhibitory nucleic acid comprises the sequence set forth in any one of SEQ ID NOs: 20-24.

42. The isolated nucleic acid of any one of claims 29 to 41, further comprising a promoter operably linked to the nucleic acid sequence encoding one or more inhibitory nucleic acids, optionally wherein the promoter comprises or consists of a Ula promoter sequence.

43. The isolated nucleic acid of claim 42, wherein the Ula promoter sequence comprises the nucleic acid sequence of SEQ ID NO: 19.

44. The isolated nucleic acid of any one of claims 29 to 43, wherein the AAV ITRs are AAV2 ITRs.

45. The isolated nucleic acid of any one of claims 29 to 44, wherein the second nucleic acid sequence is positioned 5’ relative to the first nucleic acid sequence.

46. The isolated nucleic acid of any one of claims 29 to 45, wherein the second nucleic acid sequence is positioned in an intron.

47. A recombinant adeno-associated virus (rAAV) comprising:

(i) the isolated nucleic acid of any one of claims 29 to 46; and

(ii) at least one AAV capsid protein.

48. The rAAV of claim 47, wherein the at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof.

49. The rAAV of claim 47 or 48, wherein the at least one AAV capsid protein is an AAV9 capsid protein.

50. A nucleic acid comprising:

(i) a first nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene; and

(ii) a second nucleic acid sequence encoding a CRISPR/Cas protein, optionally wherein the nucleic acid further comprises adeno-associated virus (AAV) inverted terminal repeats (ITRs).

51. The nucleic acid of claim 50, wherein the sgRNA comprises a region of complementarity with a mutant COL1A2 gene.

52. The nucleic acid of claim 51, wherein the mutant COL1A2 gene comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence.

53. The nucleic acid of any one of claims 50 to 52, wherein the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

54. The nucleic acid of any one of claims 50 to 53, wherein the first nucleic acid sequence and/or the second nucleic acid sequence further comprise a promoter, optionally wherein the promoter comprises a U6 promoter (optionally a U6 promoter comprising or consisting of SEQ ID NO: 32), further optionally wherein the promoter is positioned between the first and second nucleic acid sequences.

55. The nucleic acid of any one of claims 50 to 54, wherein the CRISPR/Cas protein is a Staphylococcus aureus Cas9 protein (saCas9).

56. The nucleic acid of any one of claims 50 to 55, wherein the AAV ITRs are AAV2 ITRs.

57. A recombinant adeno-associated virus (rAAV) comprising:

(i) the nucleic acid of any one of claims 50 to 56; and

(ii) at least one AAV capsid protein.

58. The rAAV of claim 57, wherein the at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof.

59. The rAAV of claim 57 or 58, wherein the at least one AAV capsid protein is an AAV9 capsid protein.

60. An isolated nucleic acid comprising a transgene comprising:

(i) a first nucleic acid sequence encoding a portion of a wild-type COL1A2 protein; and

(ii) a second nucleic acid sequence encoding a Precise Integration into Target Chromosome (PITCH) gRNA binding site, wherein the transgene is flanked by adeno-associated virus (AAV) inverted terminal repeats (ITRs).

61. The isolated nucleic acid of claim 60, wherein the first nucleic acid sequence encoding a portion of a wild-type CollA2 protein comprises the sequence set forth in any one of SEQ ID NO: 33-35.

62. The isolated nucleic acid of claim 60 or 61, wherein the transgene further comprises an intron and/or a 3’ untranslated region (3’ UTR), optionally wherein the 3’ UTR is a COL1A2 3’ UTR.

63. The isolated nucleic acid of any one of claims 60 to 62, wherein the transgene further comprises a poly-adenylation (poly A) signal, optionally wherein the polyA signal is an SV40 polyA signal.

64. The isolated nucleic acid of claim 62 or 63, wherein the 3 ’UTR and/or the polyA signal is positioned between the first nucleic acid sequence and the second nucleic acid sequence.

65. The isolated nucleic acid of any one of claims 60 to 64, wherein the PITCH gRNA binding site comprises a sequence having a region of complementarity to the nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

66. The isolated nucleic acid of any one of claims 60 to 65, wherein the AAV ITRs are AAV2 ITRs.

67. A recombinant adeno-associated virus (rAAV) comprising:

(i) the isolated nucleic acid of any one of claims 60 to 66; and

(ii) at least one AAV capsid protein.

68. The rAAV of claim 67, wherein the at least one AAV capsid protein is of a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or a variant thereof.

69. The rAAV of claim 67 or 68, wherein the at least one AAV capsid protein is an AAV9 capsid protein.

70. A composition comprising: (i) the rAAV of any one of claims 57 to 59; and

(ii) the rAAV of any one of claims 67 to 69.

71. The composition of claim 70 further comprising a nucleic acid sequence encoding a PITCH gRNA.

72. A system comprising:

(i) the isolated nucleic acid of any one of claims 1-10,

(ii) a nucleic acid sequence encoding a single guide RNA (sgRNA) targeting a COL1A2 gene; and

(iii) a nucleic acid sequence encoding a CRISPR/Cas protein, optionally wherein the nucleic acid further comprises adeno-associated virus (AAV) inverted terminal repeats (ITRs).

73. The system of claim 72, wherein the sgRNA comprises a region of complementarity with a mutant COL1A2 gene.

74. The system of claim 73, wherein the mutant COL1A2 gene comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence.

75. The system of any one of claims 72 to 74, wherein the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 30 or 31.

76. The system of any one of claims 72 to 75, wherein the CRISPR/Cas protein is a Staphylococcus aureus Cas9 protein (saCas9).

77. The system of any one of claims 72 to 76, wherein the AAV ITRs are AAV2 ITRs.

78. A method for inducing collagen production in a subject, the method comprising administering to the subject the isolated nucleic acid of any one of claims 1 to 10, 14 to 25, 29- 46, 50 to 56, or 60 to 66.

79. A method for inducing collagen production in a subject, the method comprising administering to the subject the rAAV of any one of claims 11 to 13, 26 to 28, 47 to 49, 57 to 59, or 67 to 69.

80. A method for inducing collagen production in a subject, the method comprising administering to the subject the composition of claim 70 or 71; or the system of any one of claims 72 to 77.

81. A method for treating a disease associated with a mutation of the COL1A1 or COL1A2 gene, the method comprising administering to a subject in need thereof an isolated nucleic acid, rAAV, composition, or system as described in any preceding claim.

82. The method of claim 81, wherein the disease is selected from osteogenesis imperfecta (OI), arthrochalasia type Ehlers-Danlos syndrome (aEDS), cardiac-valvular type Ehlers-Danlos syndrome (cvEDS), Caffey disease.

83. A method for treating osteogenesis imperfecta (OI) in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid, rAAV, composition, or system as described in any preceding claim.

84. The method of any one of claims 78 to 83, wherein the subject is a mammal, optionally a human.

85. The method of any one of claims 78 to 84, wherein the subject has one or more mutations in a COL1A2 gene.

86. The method of claim 85, wherein the one or more mutations comprises a AG deletion at position 3978 or 3983 of a wild-type COL1A2 sequence.

87. The method of any one of claims 78 to 86, wherein the administration comprises injection, optionally intravenous injection, intramuscular injection, or injection into a joint of the subject.

88. The method of any one of claims 78 to 87, wherein the administration comprises implantation of a tissue or graft comprising an isolated nucleic acid, rAAV, or composition of any preceding claim.