WO2024097243A1 - Développement d'une souche de levure pour la production d'éthanol - Google Patents

Développement d'une souche de levure pour la production d'éthanol Download PDF

Info

Publication number
WO2024097243A1
WO2024097243A1 PCT/US2023/036514 US2023036514W WO2024097243A1 WO 2024097243 A1 WO2024097243 A1 WO 2024097243A1 US 2023036514 W US2023036514 W US 2023036514W WO 2024097243 A1 WO2024097243 A1 WO 2024097243A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
fermentation
yeast
ethanol
saccharomyces
Prior art date
Application number
PCT/US2023/036514
Other languages
English (en)
Inventor
Maria del Rosario BARBIERI
Zoee Gokhale Perrine
John Henry EVANS, IV
Original Assignee
Ab Mauri Food Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ab Mauri Food Inc. filed Critical Ab Mauri Food Inc.
Publication of WO2024097243A1 publication Critical patent/WO2024097243A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/18—Baker's yeast; Brewer's yeast
    • C12N1/185—Saccharomyces isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12G—WINE; PREPARATION THEREOF; ALCOHOLIC BEVERAGES; PREPARATION OF ALCOHOLIC BEVERAGES NOT PROVIDED FOR IN SUBCLASSES C12C OR C12H
    • C12G3/00—Preparation of other alcoholic beverages
    • C12G3/02—Preparation of other alcoholic beverages by fermentation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C12N1/18—Baker's yeast; Brewer's yeast
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/01—Preparation of mutants without inserting foreign genetic material therein; Screening processes therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C12P7/08—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate
    • C12P7/10—Ethanol, i.e. non-beverage produced as by-product or from waste or cellulosic material substrate substrate containing cellulosic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/85—Saccharomyces
    • C12R2001/865—Saccharomyces cerevisiae
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Definitions

  • This disclosure relates to non-naturally occurring yeast strains and derivatives thereof, as well as compositions comprising the yeast strains for use in ethanol manufacture.
  • the disclosure also relates to processes for producing ethanol from biomass using the yeast strains and compositions.
  • the yeast strains produce higher ethanol and lower glycerol, exhibit higher fructose utilization, and exhibit higher temperature and organic acid tolerances and higher fermentation rates than strains and products currently used in ethanol production processes.
  • Ethanol can be produced from biological organisms using different biochemical pathways inherent to the organism. Ethanol produced from biological organisms is termed bioethanol and is thereby distinguished from ethanol produced by purely chemical methods. Bioethanol is manufactured commercially and can be used as a liquid fuel in internal combustion engines (fuel ethanol), as an ingredient in industrial products (industrial ethanol), or as a component in alcoholic beverages (potable ethanol).
  • Biological organisms such as yeasts produce bioethanol from a variety of biomass, including sucrose, also known as table sugar. Selected yeasts are advantageous for ethanol production from sucrose so that the production processes and profitability can be optimized.
  • biomass that contains sucrose a dimer of the sugars glucose and fructose
  • yeast cells hydrolyze sucrose into glucose and fructose utilizing enzymes located on the outside wall of the cell and both glucose and fructose can be converted to ethanol by the yeast.
  • Glucose is preferred over fructose for yeast such as Saccharomyces cerevisiae and is preferentially used by the cell, leaving high concentrations of fructose outside the cell.
  • Yeast often cannot utilize the fructose remaining outside of the cell and that fructose represents a loss in the potential ethanol made from sucrose by the yeast. High ethanol concentrations exacerbate the limited utilization of fructose by yeast. There is a need for Saccharomyces cerevisiae that can effectively utilize fructose during fermentation.
  • yeast By-product formation by yeast during fermentation (e.g., glycerol) uses sugar as a substrate and thus decreases potential ethanol yield from sugar.
  • Glycerol is an important metabolite with a protective role against several types of stress and is important for maintenance of intracellular redox balance in anaerobic fermentation conditions. Glycerol formation varies considerably among strains of Saccharomyces cerevisiae. It is particularly useful to use yeast for fermentation that exhibit relatively low glycerol production while maintaining good protection against stresses. In particular, yeast that exhibit a high ethanol-to- glycerol ratio to maximize ethanol produced from sugar are needed.
  • yeasts During the fermentation process, yeasts encounter different environments and conditions that limit their ability to produce ethanol, such as presence of inhibitors such as organic acids.
  • Organic acid concentrations during fermentation vary depending on contamination of the fermentation vessel with microbial contaminants which produce organic acids and on contamination of the feedstock.
  • pH decreases during fermentation due to generation of carbon dioxide and carbonic acid the toxicity of organic acids to the yeast increases. At low pH, organic acids become protonated and enter the yeast cell where they then acidify the cell interior. Therefore, yeast that can withstand high organic acid conditions and low pH during fermentation are needed.
  • Yeast in products that are used for commercial production of ethanol require several characteristics including adequate ethanol metabolic yield, adequate ethanol tolerance, acceptable by-product yield, adequate fermentation kinetics, ability to consume fructose, organic acid tolerance, and temperature tolerance during fermentation.
  • Yeast of the genus Saccharomyces exhibit some but not all these characteristics required for commercial production of ethanol.
  • yeast products that comprise Saccharomyces include: Ethanol Red® (Fermentis®), Thermosacc® (Lallemand®), Angel Super Alcohol® (Angel®), 46 EDV (Lallemand®), Superstart® (Lallemand®), DistilaMax® CN (Lallemand®), PE-2 (Fermentec), CAT- 1 (Fermentec), and Fali® M (AB Mauri®).
  • Improvements in the efficiency of ethanol production can be attained by selecting between yeast that display genetic and phenotypic diversity.
  • Phenotypes, or traits, of particular yeast strains can be changed by alterations in the genetic material, or genome, of the yeast strain. Alterations in the genome of yeast can be achieved by several means known in the art.
  • One means by which the genome and phenotype of yeast strain can be altered is by subjecting yeast to directed evolution to generate non-naturally occurring yeast strains. Directed evolution takes advantage of naturally occurring mutations in the yeast genetic material (DNA), or genome, which occur spontaneously in all organisms, including yeast such as Saccharomyces cerevisiae.
  • evolved yeast strains are generated that otherwise would not be found in nature.
  • the genomes of evolved strains are distinct from the original strain before undergoing directed evolution. Distinctions can be uncovered by DNA sequencing of yeast genomes.
  • Naturally occurring mutations in the genome can be augmented by treatment of yeast cells with a mutagen, a chemical or physical agent which causes mutations in DNA.
  • mutagens include, but are not limited to, ultraviolet light, X-rays, and ethyl methanesulfonate.
  • beneficial traits arising from mutations in the yeast genome can be selected for as in directed evolution. Mutagenesis of yeast followed by selection of beneficial traits generate additional diversity in yeast, from which advantageous characteristics for production of ethanol can be derived.
  • the yeast strains resulting from mutagenesis are genomically distinct from the original strain before mutagenesis and are non- naturally occurring yeast strains and would not be found in nature.
  • Genomic and phenotypic diversity in yeast can be further increased by sexual reproduction of yeast, including Saccharomyces cerevisiae.
  • sexual reproduction of yeast a single diploid yeast cell undergoes the process of meiosis and produces genetically distinct haploid spores.
  • Mating haploid spores resulting from a single parental diploid yeast cell, or selfcrossing results in the generation of a diploid progeny that are genetically distinct from the parental cell, the original diploid cell, and would otherwise not be found in nature. More advantageously, haploid spores from different parental cells exhibiting different characteristics can be mated to form genomically distinct progeny.
  • Mating spores from two parents results in progeny with increased genomic diversity. Even more advantageously, spores from 3 or more parental cells can be mated at random in a process known as mass mating. Mass mating generates a number of progeny which are all genomically distinct from the parental strains.
  • sexual reproduction in yeast by self-crossing, directed mating, or mass mating, increases the genomic and phenotypic diversity available and from which advantageous characteristics for production of ethanol can be derived. The yeast strains derived from sexual reproduction would otherwise not be found in nature.
  • microsatellite DNA are genetic loci that comprise of tandem repeats of one to six bases. Some microsatellite DNA loci have a high degree of allelic polymorphism and hence can be used as genetic markers for assessing strain diversity in yeast. PCR assays designed to detect such polymorphisms can provide a means to rapidly discriminate between strains and assess their genotypes.
  • Another more advantageous method for surveying the genetic diversity of yeast strains is through whole genome sequencing which can provide information on single nucleotide polymorphisms and structural variations such as genomic insertions or deletions. Taken together, these approaches can be used for assessing the genetic diversity of yeast strains obtained through directed evolution, mutagenesis, and sexual reproduction.
  • yeast strains and products need to be capable of improving the efficiency of commercial ethanol production by providing a higher conversion of sugar to ethanol, higher temperature tolerance, higher tolerance to fermentation inhibitors, and more rapid fermentation kinetics than yeast strains and products currently in commercial use.
  • the disclosure relates to a non-naturally occurring Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185.
  • the disclosure relates to a non-naturally occurring derivative of a Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y- 68182; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185.
  • the yeast strain or the derivative comprise one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) an increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.
  • the yeast strain or the derivative has at least about 3.3% higher ethanol yield after 48 hours of fermentation relative to Saccharomyces cerevisiae strain Y1027. In another embodiment, the yeast strain or the derivative has at least about 5% higher fructose utilization after 48 hours of fermentation relative to Saccharomyces cerevisiae strain Y1027. In another embodiment, the yeast strain or the derivative has an ethanol to glycerol ratio that is at least about 11% higher than Saccharomyces cerevisiae strain Y1027 after 48 hours of fermentation. In another embodiment, the yeast strain or the derivative has a fermentation rate that is at least about 1.5% higher than Saccharomyces cerevisiae strain Y1027 after 24 hours of fermentation.
  • the yeast strain or the derivative has a higher temperature tolerance during fermentation relative to Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C.
  • the fermentation temperature is 33°C.
  • the fermentation temperature is 38°C.
  • the yeast strain or the derivative has a higher organic acid tolerance when decreasing a fermentation pH from about 4.9 to about 4.0 in the presence of increasing amounts of organic acids in a fermentation medium relative to Saccharomyces cerevisiae strain Y1027.
  • the organic acids in the fermentation medium comprise 0.36 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.9.
  • the organic acids comprise lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.
  • Another aspect of the disclosure provides a method of producing the derivative of a Saccharomyces yeast strain as described herein comprising either: (1) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain is in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain; and (e) screening or selecting for a derivative strain; or (2) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2083, Y2084, Y2086,
  • step (1)(c) comprises screening or selecting spores which exhibit one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or a derivative thereof; and step (1)(e) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or a derivative thereof.
  • step (2)(d) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, or Y2087.
  • Another aspect of the disclosure provides a mutant yeast of a yeast strain as described herein or a derivative as described herein.
  • Another aspect of the disclosure provides a method of producing the mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.
  • the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • EMS ethyl methanesulfonate
  • UV ultraviolet light
  • X-rays methylmethane sulphonate
  • NNG nitrous acid
  • NNG nitrosoguanidine
  • acridine mustard 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethy
  • Another aspect of the disclosure provides a method of producing the mutant yeast as described herein, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.
  • the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • EMS ethyl methanesulfonate
  • UV ultraviolet light
  • X-rays methylmethane sulphonate
  • NNG nitrous acid
  • NNG nitrosoguanidine
  • acridine mustard 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl
  • Another aspect of the disclosure provides an evolved yeast of a yeast strain as described herein or a derivative as described herein.
  • Another aspect of the disclosure provides a method of producing the evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the yeast strain.
  • Another aspect of the disclosure provides a method of producing the evolved yeast as described herein, wherein evolution is induced by applying selective pressure to the derivative.
  • Another aspect of the disclosure provides a genetically modified yeast of a yeast strain as described herein or a derivative of as described herein.
  • a nucleic acid sequence of the genetically modified yeast is changed using gene editing.
  • Another aspect of the disclosure provides a recombinant yeast of a yeast strain as described herein or a derivative as described herein.
  • the recombinant yeast comprises a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, or delete a gene.
  • Another aspect of the disclosure provides a process for producing ethanol from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No.
  • the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.
  • the yeast comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) an increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.
  • the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C.
  • the fermentation temperature is 33°C.
  • the fermentation temperature is 38°C.
  • the yeast has a higher organic acid tolerance in a fermentation medium with decreasing pH from about 4.9 to about 4.0 in the presence of increasing organic acids relative to Saccharomyces cerevisiae strain Y1027.
  • the organic acids in the fermentation medium comprise 0.36 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.9.
  • the organic acids in the fermentation medium comprise 0.9 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.2.
  • the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • the ethanol is produced using a starch.
  • simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.
  • the ethanol is produced using a sugar.
  • batch fermentation or continuous fermentation is used to produce the ethanol.
  • the ethanol is produced using a lignocellulosic sugar.
  • simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.
  • compositions comprising the yeast strain as described herein or the derivative as described herein and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants, and antioxidants.
  • the composition comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) a higher fructose utilization than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) an increased organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces cerevis
  • the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 from 33°C to 38°C. In another embodiment, the temperature is 33°C. In another embodiment, the temperature is 38°C. In another embodiment, the yeast has a higher organic acid tolerance in decreasing pH from about 4.9 to about 4.0 in the presence of increasing organic acids relative to Saccharomyces cerevisiae strain Y1027. In another embodiment, the organic acids comprise 0.36 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.9. In another embodiment, the organic acids comprise 0.9 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.2.
  • the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • the ethanol is produced using a starch.
  • simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.
  • the ethanol is produced using a sugar.
  • batch fermentation or continuous fermentation is used to produce the ethanol.
  • the ethanol is produced using a lignocellulosic sugar.
  • simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.
  • Another aspect of the disclosure provides a method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism, wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y- 68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No.
  • the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.
  • the fermentation product is ethanol.
  • the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or Separate Hydrolysis and Fermentation (SHF) is used to produce the fermentation product.
  • FIGS. 1 A-D are schematics showing processes for making new yeast strains.
  • FIG. 1 A-D are schematics showing processes for making new yeast strains.
  • FIG. 1A is a schematic showing directed mating.
  • FIG. 1B is a schematic showing mass mating.
  • FIG. 1C is a schematic showing directed evolution of yeast strains.
  • FIG. 1D is a schematic showing mutagenesis of yeast strains.
  • FIGS. 2A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 at a fermentation temperature of 33°C in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36 %w/v lactic acid and 0.25 %w/v acetic acid.
  • FIG. 2A is a graph showing ethanol concentration after a 48-hour fermentation
  • FIG. 2B is a graph showing ethanol yield after a 48-hour fermentation
  • FIG. 2C is a graph showing ethanol to glycerol ratio after a 48-hour fermentation
  • FIG. 2D is a graph showing fructose concentration after a 48-hour fermentation.
  • FIG. 2E is a graph showing the rate defined as the mass loss at 24 hours of fermentation.
  • FIGS. 3A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 at a fermentation temperature of 33°C in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90 %w/v lactic acid and 0.25 %w/v acetic acid.
  • FIG. 3A is a graph showing ethanol concentration after a 48-hour fermentation
  • FIG. 3B is a graph showing ethanol yield after a 48-hour fermentation
  • FIG. 3C is a graph showing ethanol to glycerol ratio after a 48-hour fermentation
  • FIG. 3D is a graph showing fructose concentration after a 48-hour fermentation.
  • FIG. 3E is a graph showing the rate defined as the mass loss at 24 hours of fermentation.
  • FIGS. 4A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 at a fermentation temperature of 38°C in standard diluted molasses medium (SDM) at pH 4.9 containing 0.36 %w/v lactic acid and 0.25 %w/v acetic acid.
  • FIG. 4A is a graph showing ethanol concentration after a 48-hour fermentation
  • FIG. 4B is a graph showing ethanol yield after a 48-hour fermentation
  • FIG. 4C is a graph showing ethanol to glycerol ratio after a 48-hour fermentation
  • FIG. 4D is a graph showing fructose concentration after a 48-hour fermentation.
  • FIG. 4E is a graph showing the rate defined as the mass loss at 24 hours of fermentation.
  • FIGS. 5A-E are graphs showing fermentation results from yeast products derived from yeast strains Y1027, Y2083, Y2084, Y2086, and Y2087 at a fermentation temperature of 38°C in acidified diluted molasses medium (ALM) at pH 4.2 containing 0.90 %w/v lactic acid and 0.25 %w/v acetic acid.
  • FIG. 5A is a graph showing ethanol concentration after a 48-hour fermentation
  • FIG. 5B is a graph showing ethanol yield after a 48-hour fermentation
  • FIG. 5C is a graph showing ethanol to glycerol ratio after a 48-hour fermentation
  • FIG. 5D is a graph showing fructose concentration after a 48-hour fermentation.
  • FIG. 5E is a graph showing the rate defined as the mass loss at 24 hours of fermentation.
  • FIG. 6 is an image of a gel generated by the QIAxcel ScreenGel 1 .6.0 software capturing the results from capillary electrophoresis of PCR amplification products of microsatellite DNA for YPL009C and YOR267C loci.
  • the loading order is as follows: 1) Y2083;
  • FIGS. 7A-B are heatmaps that compare nucleotide matches among strains.
  • FIG. 7A is a heatmap of the percentage of identical nucleotide matches for each strain relative to Y1027, for 56 open reading frame (ORF) sequences.
  • FIG. 7B is a heatmap of the percentage of identical nucleotide matches for Y2083 relative to Y2084 for 16 additional ORF sequences.
  • fermenting organisms that comprise defining characteristics that include a higher ethanol yield, higher fructose utilization, higher temperature and inhibitor tolerance, and higher fermentation rate relative to current industry standard yeasts used in yeast products such as Fali® M, under the same fermentation conditions.
  • Saccharomyces yeast strains that have improved properties compared to the yeast strain used in Fali® M.
  • the present disclosure relates to processes for manufacturing yeast products from yeast strains.
  • the present disclosure also relates to improved processes of producing ethanol from different fermentable biomass materials using the fermenting organisms described herein.
  • each intervening number there between with the same degree of precision is explicitly contemplated.
  • the numbers 7 and 8 are contemplated in addition to 6 and 9;
  • the number 6.0, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated; and for the range from 1 to 5, the numbers 2, 3, and 4 are contemplated in addition to 1 and 5.
  • the term “about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • “about” can mean within 3 or more than 3 standard deviations, per the practice in the art.
  • the term “about” can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.
  • biomass refers to any organic matter of plant origin that can become a carbohydrate source after conversion.
  • the biomass may be derived from agricultural or food-processing products and/or coproducts.
  • the biomass may be rich in sucrose or in starch, and is chosen from, or is derived from, for example, sorghum, sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a mixture thereof.
  • combining of DNA between yeast strains refers to combining of all or a part of the genome of the yeast strains.
  • Combining of DNA between yeast strains may be by any method suitable for combining DNA of at least two yeast cells, and may include, for example, mating methods which comprise sporulation of the yeast strains to produce haploid cells and subsequent hybridizing or mating of compatible haploid cells; cytoduction; or cell fusion such as protoplast fusion.
  • a “derivative” is a yeast strain derived from a yeast strain disclosed herein (e.g., Saccharomyces or in the Saccharomyces sensu stricto clade), including through sporulation, hybridization, mutagenesis, recombinant DNA technology, genome editing technology, mating, cell fusion, or cytoduction between yeast strains.
  • the derivative strain may be a direct progeny (i.e., the product of a mating between a strain of the invention and another strain or itself).
  • ethanol yield from glucose is the yield of ethanol that would be achieved from glucose alone or in combination with other fermentable sugars present in the biomass expressed as “glucose equivalents”.
  • the ethanol yield from glucose is represented by the statement: one molecule of glucose yields two molecules of ethanol and two molecules of carbon dioxide.
  • the ethanol yield from glucose is represented by the chemical formula: CeH ⁇ Oe -> 2 C2H5OH + 2 CO2, where CeH ⁇ Oe is the chemical formula for glucose and fructose, C 2 H 5 OH is the chemical formula for ethanol, and CO2 is the chemical formula for carbon dioxide.
  • the ethanol yield from glucose is represented on a mass basis, where 1 .0 gram glucose or fructose yields 0.511 gram ethanol and 0.489 gram carbon dioxide.
  • the highest ethanol yield from glucose or fructose is two molecules of ethanol from one molecule of glucose or fructose.
  • the highest ethanol yield on a mass basis is 0.511 gram ethanol from one gram glucose or fructose.
  • the term “glucose equivalent” or “glucose equivalents” refers to the mass of fermentation molecules other than glucose expressed as the equivalent mass of glucose. For example, 1 .0 gram sucrose is equivalent to 1.053 gram glucose and 1 gram ethanol is equivalent to 1.955 gram glucose.
  • the term “the control” is used interchangeably with “Y1027” or “the Fali® M strain” when discussing yeast strains and “Fali® M” when discussing yeast products.
  • Strain Y1027 is used to manufacture the yeast product Fali® M.
  • Fali® M can be manufactured as an active dried yeast product, as a crumble yeast product, and as a liquid yeast product for use in fermentation of substrates to fuel ethanol, industrial ethanol and to potable ethanol. Fali® M is particularly well-suited for use in fermentation of sucrose, glucose, and fructose liberated from biomass containing those sugars and in fermentation of sugar liberated from starch-containing biomass following liberation of sugars by the action of enzymatic or chemical processes.
  • Fali® M can be used in batch fermentation, continuous fermentation, and simultaneous saccharification fermentations (SSF) of starch substrates. It has a high tolerance to liberated glucose, a moderate ethanol and temperature tolerance, and moderate organic acid tolerance. It rehydrates well in direct pitch applications and can be used in conjunction with glucoamylase and alpha amylase enzyme systems. Fali® M has an optimal performance within a pH range of 4.0 to 5.0 but can ferment well in a pH range of 3.5 to 6.0. Optimal fermentation temperature of Fali® M is dependent on stresses present (e.g., organic acid, ethanol, and pH) but generally ferments well in a temperature range of about 32°C to 34°C. Fali® M is commercially available from AB Mauri®.
  • the term “fermentation medium” refers to the environment in which fermentation, using a fermenting organism, is carried out and which includes the fermentable substrate, that is, a carbohydrate source (e.g., sucrose, glucose, or fructose) that can be metabolized by the fermenting organism into a desired fermentation product, such as ethanol.
  • the fermentation medium may comprise fermentation nutrients for the fermenting organism. Fermentation nutrients are widely used in the art of fermentation and include nitrogen sources (e.g., ammonia, urea), vitamins, minerals, or combinations thereof.
  • “Feed” is a fermentation medium; however, the feed may have a different composition than the fermentation medium.
  • “High-yield ethanol production,” as used herein, means an ethanol production by fermentation wherein the ethanol yield is near theoretical ethanol yield from glucose or other fermentable sugars.
  • high-yield ethanol production requires the ability to utilize fructose.
  • High- yield ethanol production requires limited formation of byproducts, such as glycerol, and yeast growth during fermentation.
  • the terms “improved,” “increased,” “enhanced,” or “greater” as used herein refer to the heightening or bettering of a particular characteristic or trait as compared to other similar organisms, a control, or a wild-type organism. Typically, this is a fermentation-related advantageous trait.
  • inoculum is intended to mean an amount of the microorganism that is added to the main fermenter in order to start the fermentation process. In case of a fermentation process using seed fermenter the inoculum is typically an amount of the preculture corresponding to 5 to 20% of the volume of the main fermenter.
  • isolated means a substance in a form or environment that does not occur in nature.
  • isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in yeast; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • the isolated substance may be an isolated yeast cell, a yeast culture, or a yeast product containing viable yeast (e.g., active dry yeast).
  • An isolated substance may be present in a fermentation broth sample; for example, a yeast may be genetically modified to express a particular polypeptide. The fermentation broth from that yeast will comprise the isolated polypeptide.
  • low pH refers to a pH from about 2.5 to about 4.5. A low pH is preferably less than about 4.5.
  • normal pH refers to a pH from about 4.0 to about 6.0. A normal pH is preferably about 5.0.
  • main fermenter as used herein is used for the final fermenter used in a fermentation process for producing a fermentation product, wherein the intended fermentation product is produced.
  • parental or “parent” strain refers to a yeast strain from which a derivative strain is derived. In some embodiments, a derivative may also be a parent.
  • preculture is understood as a liquid actively growing culture of the microorganism (i.e., yeast) used for inoculating the main fermenter. Actively growing is intended to mean that the culture is in a stage where the microorganism is increasing the number of cells.
  • the preculture is in general used as inoculation material in order to avoid or reduce the lag phase in the main fermenter.
  • cells in a pre-fermenter are typically conditioned. The idea is not to produce yeast biomass, as the carbon in the biomass reduces the carbon going to ethanol.
  • yeast may be added directly to the main fermenter by “direct pitch.”
  • the terms “properties” and “defining characteristics” of the Saccharomyces cerevisiae strains as detailed herein include at least increased ethanol yield compared to the control (i.e., Fali® M or Y1027) under the same process conditions.
  • Other “properties” and “defining characteristics” include, inter alia, increased temperature tolerance, increased fermentation rate, increased organic acid tolerance, increased ethanol production, and decreased glycerol production.
  • a fermenting organism described herein, for example, used in a process described herein may have one or more the above mentioned “properties” and “defining characteristics.”
  • pre-fermenter is intended to mean a fermenter wherein the preculture is formed by fermenting the microorganism until the yeast are activated and conditioned for inoculation into the main fermenter.
  • direct pitch is used.
  • a “substrate” is a molecule that can be directly or indirectly metabolized to ethanol by fermentation by Saccharomyces or any of the yeast or yeast products described herein.
  • wild-type refers to the typical form of an organism or its genetic material, as it normally occurs, as distinguished from a selected organism.
  • yeast product and “composition” are used interchangeably herein and as used herein refers to a composition that includes, among other things, dry yeast, starches and emulsifiers.
  • a yeast product may also be a liquid composition that includes, among other things, cream yeast, glycerol, and xanthan gum.
  • Yeast strains and yeast strain derivatives can be any yeast useful for ethanol production, including, but not limited to, Saccharomyces, ZygoSaccharomyces, Brettanomyces, and Kluyveromyces.
  • the yeast may be a Saccharomyces sp., even more preferably it may be a Saccharomyces cerevisiae.
  • Saccharomyces yeast strains and the derivatives thereof described herein can be readily distinguished from: (a) naturally occurring strains of Saccharomyces’, (b) contaminating strains of Saccharomyces’, and (c) other strains used in the ethanol industry that do not have the ethanol producing capabilities and defining characteristics of the strains described herein.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature range from 20°C to 40°C, preferably a range from 33°C to 38°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C.
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol yield compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein generally result in a statistically significantly higher ethanol yield compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein has at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%,
  • one or more of the yeast strains and the derivatives thereof as described herein have at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0% 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, or 75% higher ethanol yield after 48 hours of fermentation
  • yeast strains and the derivatives thereof as described herein have about 0.1%-75% (i.e. from about 0.1% to about 75%), 0.2%-75%, 0.3%-75%, 0.4%-75%, 0.5%-75%, 0.6%-75%, 0.7%-75%, 0.8%-75%, 0.9%- 75%, 1 %-75%, 2%-75%, 3%-75%, 4%-75%%, 5%-75%, 6%-75%, 7%-75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%- 75%, 55%-75%, 60%-75%, 0.1%-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%- 70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70%%,
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher relative fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature range from 20°C to 40°C, preferably a range from 33°C to 38°C.
  • the one or more of yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C.
  • the inventors have surprisingly found that one or more of the yeast strains described herein result in a statistically significantly higher fructose utilization compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher fructose utilization compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have at least about 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
  • yeast strains and the derivatives thereof as described herein have at most about 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
  • yeast strains and the derivatives thereof as described herein have about 0.5%-55% (i.e.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature range from 20°C to 40°C, preferably a range from 33°C to 38°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C.
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol to glycerol ratio compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher ethanol to glycerol ratio compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have at least about 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
  • yeast strains and the derivatives thereof as described herein have at most about 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
  • yeast strains and the derivatives thereof as described herein have about 1%-90% (i.e.
  • one or more of the yeast strains and the derivatives thereof as described herein have a higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027). In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature from 20°C to 40°C, preferably from 33°C to 38°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C.
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher fermentation rate compared to Y1027 under the same fermentation conditions.
  • the inventors have surprisingly found that the derivatives described herein result in a statistically significantly higher fermentation rate compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) after 24 hours of fermentation.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027 after 24 hours of fermentation.
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) after 24 hours of fermentation.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027 after 24 hours of fermentation.
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate about 0%-450% (i.e. from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%- 450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%- 450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%- 450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%- 450%, 320%-450%, 330%-450%, 340%-450%, 350%-450%,
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher temperature tolerance than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027). Temperature tolerance may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • one or more of the yeast strains and the derivatives thereof as described herein can tolerate a temperature of about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C, and/or about 40°C.
  • the inventors have surprisingly found that the yeast strains and the derivatives thereof described herein have a statistically significantly higher temperature tolerance as compared to Y1027 under the same fermentation conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher tolerance to organic acids at low pH than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027).
  • Organic acid tolerance at low pH may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher tolerance to lactic acid and acetic acid at low pH than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 33°C.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher tolerance to lactic acid and acetic acid at low pH than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at a temperature of 38°C.
  • the inventors have surprisingly found that the yeast strains and the derivatives thereof described herein have a statistically significantly higher organic acid tolerance at low pH as compared to Y1027 under the same fermentation conditions.
  • organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol yield at a low pH with an organic acid compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein generally result in a statistically significantly higher ethanol yield at a low pH with organic acid compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have at least about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31 %, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
  • ethanol yield after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • one or more of the yeast strains and the derivatives thereof as described herein have at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0% 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%,
  • ethanol yield after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • one or more of the yeast strains and the derivatives thereof as described herein have about 0.1%-75% (i.e. from about 0.1% to about 75%), 0.2%-75%, 0.3%-75%, 0.4%-75%, 0.5%-75%, 0.6%-75%, 0.7%-75%, 0.8%-75%, 0.9%- 75%, 1 %-75%, 2%-75%, 3%-75%, 4%-75%%, 5%-75%, 6%-75%, 7%-75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%- 75%, 55%-75%, 60%-75%, 0.1%-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%- 70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70%%, 5%-70%, 6%- 70%, 6%- 70%,
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fructose utilization than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher fructose utilization at a low pH with high organic acid concentrations compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher fructose utilization at a low pH with high organic acid concentrations compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have at least about 0.5%, 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%,
  • one or more of the yeast strains and the derivatives thereof as described herein have at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) ) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0
  • one or more of the yeast strains and the derivatives thereof as described herein have about 0.5%-55% (i.e. from about 0.5% to about 55%), 1 %-55%, 2%-55%, 3%-55%, 4%-55%, 5%-55%, 6%-55%, 7%-55%, 8%-55%, 9%-55%, 10%-55%, 11 %-55%, 12%- 55%, 13%-55%, 14%-55%, 15%-55%, 16%-55%, 17%-55%, 18%-55%, 19%-55%, 20%-55%, 21 %-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%- 55%, 30%-55%, 31%-55%, 32%-55%, 33%-55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%,
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol to glycerol ratio than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher ethanol to glycerol ratio at a low pH with high organic acid concentrations compared to Y1027 under the same fermentation conditions.
  • the inventors have also surprisingly found that the derivatives described herein result in a statistically significantly higher ethanol to glycerol ratio at a low pH with high organic acid concentrations compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have at least about 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
  • ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • one or more of the yeast strains and the derivatives thereof as described herein have at most about 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%,
  • ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • one or more of the yeast strains and the derivatives thereof as described herein have about 1%-90% (i.e. from about 1% to about 90%), 2%-90%, 3%-90%, 4%-90%, 5%-90%, 6%-90%, 7%-90%, 8%-90%, 9%-90%, 10%-90%, 11%-90%, 12%-90%, 13%-90%, 14%-90%, 15%-90%, 16%-90%, 17%-90%, 18%-90%, 19%- 90%, 20%-90%, 21%-90%, 22%-90%, 23%-90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31%-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%- 90%, 37%-90%, 38%-90%, 39%-90%, 40%-90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 40%-90%,
  • ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • Saccharomyces strain Y1027 Saccharomyces strain Y1027
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %w
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher fermentation rate than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast strains used for fermentation e.g., Saccharomyces strain Y1027
  • acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v
  • at lactic acid concentrations from 0.50 %w/v to 1.0 %w
  • the inventors have surprisingly found that the yeast strains described herein result in a statistically significantly higher fermentation rate at a low pH with high organic acid concentrations compared to Y1027 under the same fermentation conditions.
  • the inventors have surprisingly found that the derivatives described herein result in a statistically significantly higher fermentation rate at a low pH with high organic acid concentrations compared to Y1027 under the same conditions.
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) after 24 hours of fermentation at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027) after 24 hours of fermentation at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.
  • one or more of the yeast strains and the derivatives thereof as described herein have a fermentation rate about 0%-450% (i.e. from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%- 450%, 60%-450%, 70%-450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%- 450%, 130%-450%, 140%-450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%- 450%, 200%-450%, 210%-450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%- 450%, 270%-450%, 280%-450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%- 450%, 340%-450%, 350%-450%,
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027).
  • Organic acid tolerance at low pH may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • one or more of the yeast strains and the derivatives thereof as described herein can tolerate organic acid concentrations (e.g., acetic acid and lactic acid) of about 0.1%- 1.5%, 0.2%-1.5%, 0.3%-1.5%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1 .5%, 0.8%-1.5%, 0.9%-1.5%, 1 ,0%-1.5%, 1.1%-1.5%, 1.2%-1.5%, 1.3%-1.5%, 1 ,4%-1.5%, 0.1 %-1.4%, 0.2%- 1.4%, 0.3%-1.4%, 0.4%-1.4%, 0.5%-1.4%, 0.6%-1.4%, 0.7%-1.4%, 0.8%-1.4%, 0.9%-1.4%, 1.0%-1.4%, 1.1%-1.4%, 1.2%-1.4%, 1.3%-1.4%, 0.1%-1.3%, 0.2%-1.3%, 0.4%- 1.3%, 0.5%-1.3%, 0.6%-1.3%, 0.7%-1.4%.8%-1.4%, 0.9%-1.
  • one or more of the yeast strains and the derivatives thereof as described herein have one or more of the defining characteristics described herein. In some embodiments, one or more of the yeast strains and the derivatives thereof as described herein have one or more of the defining characteristics described herein at a temperature from 20°C to 40°C, preferably from 33°C to 38°C, and at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • one or more of the yeast strains and the derivatives thereof as described herein have a statistically significantly higher ethanol yield, a statistically significantly higher fructose utilization, a statistically significant ethanol to glycerol ratio, a statistically significantly higher fermentation rate, a statistically significantly higher temperature tolerance, and a statistically significantly higher organic acid tolerance than typical yeast strains used for fermentation (e.g., Saccharomyces strain Y1027).
  • the yeast strains and the derivatives thereof as described herein may be in any viable form, including crumbled, dry (including active dry and instant), compressed, cream form, yeast culture, etc.
  • the Saccharomyces cerevisiae yeast strain or derivative thereof is dry yeast, such as active dry yeast.
  • the Saccharomyces cerevisiae yeast strain or derivative thereof is a compressed yeast.
  • the Saccharomyces cerevisiae yeast strain or derivative thereof is a cream yeast.
  • Saccharomyces yeast strains designated: Y2083 (deposited under NRRL Patent Deposit Designation No. Y-68182); Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y-68184); Y2087 (deposited under NRRL Patent Deposit Designation No. Y-68185). These yeast strains are referred to herein as “the yeast strains”, “the Saccharomyces yeast strains”, or by their designations (i.e.
  • yeast strains i.e. Y2083, Y2084, Y2086, and Y2087 were produced from one or more different Saccharomyces yeast strains by one or more of the methods as shown in FIG. 1.
  • the yeast strains described herein comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the yeast strain Y1027, the yeast strain used in the product Fali® M.
  • Representative samples of the yeast strains have been deposited under the above-identified accession numbers at the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 University Street, Peoria, IL, USA.
  • Saccharomyces yeast strain selected from the Saccharomyces yeast strains designated: Y2083 (deposited under NRRL Patent Deposit Designation No. Y-68182); Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y- 68184); Y2087 (deposited under NRRL Patent Deposit Designation No. Y-68185).
  • the derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the yeast strain Y1027, the yeast strain used in the product Fali® M.
  • the derivative can be a parental strain and be used to generate other derivatives.
  • the Saccharomyces yeast strains designated Y2083, Y2084, Y2086, and Y2087 may be derived from one or more different Saccharomyces yeast strains by the process shown in FIG.
  • mutant yeast strains and mutant derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the yeast strain Y1027, the yeast strain used in the product Fali® M.
  • the mutant yeast strains and mutant derivatives can be a parental strain and be used to generate other derivatives. An example of mutagenesis is provided in FIG. 1D. In an embodiment, the mutant yeast strains and mutant derivatives as described herein were derived from the method shown in FIG. 1D.
  • the mutant yeast strains and mutant derivatives may be made by contacting any of the yeast strains described herein with a mutagen.
  • the mutagen may be any mutagen known in the art.
  • the mutagen may be ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2-chloroethyl)aminopropylamino]acridine-2 (ICR-170), nitrogen mustard, etc.
  • EMS ethyl methanesulfonate
  • UV ultraviolet light
  • X-rays methylmethane sulphonate
  • NNG nitrous acid
  • NNG nitrosoguanidine
  • acridine mustard 2-methoxy-6-chloro-9[3- (ethyl-2
  • Saccharomyces yeast strains designated Y2083 (deposited under NRRL Patent Deposit Designation No. Y-68182); Y2084 (deposited under NRRL Patent Deposit Designation No. Y-68183); Y2086 (deposited under NRRL Patent Deposit Designation No. Y-68184); Y2087 (deposited under NRRL Patent Deposit Designation No. Y- 68185).
  • the Saccharomyces yeast strains designated Y2083, Y2084, Y2086, and Y2087 may be derived from one or more different Saccharomyces yeast strains by the process shown in FIG.
  • the evolved yeast strains and evolved derivatives comprise one or more defining characteristics including a higher ethanol yield, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates than other yeast strains and typical yeast strains used for fermentation, in particular in comparison to the yeast strain Y1027, the yeast strain used in the product Fali® M.
  • the evolved yeast strains and evolved derivatives can be a parental strain and be used to generate other derivatives. An example of evolution is provided in FIG. 1C.
  • the evolved yeast strains and evolved derivatives as described herein were derived from the method shown in FIG. 1C.
  • the evolved yeast strains and evolved derivatives may be made by applying selective pressure to any of the yeast strains described herein.
  • the selective pressure can be negative (decreases the occurrence of a trait) or positive (increases the proportion of a trait).
  • the selective pressure may be constant or may be intermittent.
  • the selective pressure may be applied by altering the presence of resources (e.g., starches and sugars) and/or altering environmental conditions (e.g., temperature, the presence of organic acids, pH, and length of fermentation). e. Recombinant Yeast and Derivatives
  • An additional embodiment described herein is recombinant yeast strains and recombination derivatives.
  • the recombinant yeast strains and derivatives may be derived from the Saccharomyces cerevisiae yeast strains or derivatives thereof described herein.
  • the recombinant yeast strain may comprise a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, delete a gene, or modify the sequence of a gene.
  • An aspect described herein is a method of making a recombinant of the yeast strain or derivative thereof. The method may comprise introducing a nucleic acid into the Saccharomyces yeast described herein using recombinant DNA technology.
  • the method may comprise changing the nucleic acid sequence of the Saccharomyces yeast or derivatives described herein using gene editing or similar technology.
  • compositions comprising the above-described yeast strains or the derivatives thereof.
  • a composition may comprise at least one of the yeast strains described herein, the derivatives described herein, or a combination thereof, and a naturally occurring and/or a non-naturally occurring component.
  • the composition may comprise one or more components selected from surfactants, emulsifiers, gums, swelling agents, antioxidants, starches, metabolites, and other processing aids.
  • a composition may comprise a dry yeast of any of the yeast strains and/or the derivatives thereof, starches, and emulsifiers.
  • a composition may comprise a cream yeast of any of the yeast strains and/or the derivatives thereof, glycerol, and xanthan gum.
  • an enriched culture of any of the yeast strains described herein is provided wherein enriched is 90%-99% pure.
  • a pure culture of any of the yeast strains described herein is provided wherein pure is 100% pure and thus no additional yeasts present.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable surfactant.
  • the surfactant(s) is/are an anionic surfactant, cationic surfactant, and/or nonionic surfactant.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable emulsifier.
  • the emulsifier is a fatty-acid ester of sorbitan.
  • the emulsifier is selected from the group of sorbitan monostearate (SMS), citric acid esters of monoglycerides or diglycerides, polyglycerolester, and fatty acid esters of propylene glycol.
  • the composition may comprise a Saccharomyces yeast as described herein, and Olindronal SMS, Olindronal SK, or Olindronal SPL including a composition concerned in European Patent No. 1 ,724,336. These products are commercially available from Bussetti, Austria, for active dry yeast.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable gum. In an embodiment the gum is acacia gum, in particular for cream, compressed and dry yeast.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable swelling agent.
  • the swelling agent is methyl cellulose or carboxymethyl cellulose.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable antioxidant.
  • the antioxidant is butylated hydroxyanisole (BHA) and/or butylated hydroxytoluene (BHT), or ascorbic acid (vitamin C), in particular for active dry yeast.
  • the composition may comprise a Saccharomyces yeast as described herein, and any suitable starch.
  • the starch is potato starch, corn starch, or pea starch.
  • composition may comprise a Saccharomyces yeast as described herein, and any suitable yeast protectant.
  • the protectant is glycerol.
  • the composition comprises one or more defining characteristics including a higher ethanol production, higher fructose utilization, higher ethanol to glycerol ratio, higher temperature tolerance, higher organic acid tolerance, and higher fermentation rates than other yeast products and typical yeast products used for fermentation, in particular in comparison to the yeast product Fali® M.
  • the compositions described herein can be readily distinguished from other yeast products used in the ethanol industry that do not have the ethanol producing capabilities and defining characteristics of the compositions described herein.
  • the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature ranging from 20°C to 40°C, preferably ranging from 33°C to 38°C.
  • the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, Distil a Max® CN, PE-2, CAT-1) at a temperature of 33°C.
  • the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C.
  • the compositions as described herein have at least about 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%
  • the compositions as described herein have at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0% 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71 %, 72%, 73%, 74%, or 75% higher ethanol yield after 48 hours of fermentation relative to typical yeast products used for
  • the compositions as described herein have about 0.1 %-75% (i.e. from about 0.1 % to about 75%), 0.2%-75%, 0.3%- 75%, 0.4%-75%, 0.5%-75%, 0.6%-75%, 0.7%-75%, 0.8%-75%, 0.9%-75%, 1 %-75%, 2%-75%, 3%-75%, 4%-75%%, 5%-75%, 6%-75%, 7%-75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%-75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 55%-75%, 60%- 75%, 0.1 %-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%-70%, 0.7%-70%, 0.8%- 70%, 0.9%-70%, 1%-70%, 2%-70%, 3%-70%, 4%-70%%, 5%-70%, 6%-70%, 7%-70%, 0.8%- 70%
  • the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature ranging from 20°C to 40°C, preferably ranging from 33°C to 38°C.
  • the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33°C.
  • the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C.
  • the compositions as described herein have at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41 %, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • Fali® M Ethanol
  • compositions as described herein have at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
  • yeast strains and the derivatives thereof as described herein have about 0.5%-55% (i.e.
  • compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature ranging from 20°C to 40°C, preferably ranging from 33°C to 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • the compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33°C.
  • the compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C.
  • compositions as described herein have at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%,
  • compositions as described herein have at most about 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%,
  • compositions as described herein have about 1 %-90% (i.e.
  • the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature ranging from 20°C to 40°C, preferably ranging from 33°C to 38°C.
  • the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 33°C.
  • the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C.
  • the compositions as described herein have a fermentation rate at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) after 24 hours of fermentation.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV,
  • the compositions as described herein have a fermentation rate at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) after 24 hours of fermentation.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, Distil
  • the compositions as described herein have a fermentation rate about 0%-450% (i.e. from about 0% to about 450%), 1 %-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%- 450%, 80%-450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%- 450%, 150%-450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%- 450%, 220%-450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%- 450%, 290%-450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450%, 350%- 450%, 360%-450%, 370%-
  • compositions as described herein have a higher temperature tolerance than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT- 1). Temperature tolerance may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT- 1.
  • Temperature tolerance may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • the compositions as described herein can tolerate a temperature of about 20°C, about 21 °C, about 22°C, about 23°C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, about 30°C, about 31 °C, about 33°C, about 33°C, about 34°C, about 35°C, about 38°C, about 37°C, about 38°C, about 39°C, and/or about 40°C.
  • the compositions as described herein have a higher organic acid tolerance at low pH than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT- 1).
  • Organic acid tolerance at low pH may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • the compositions as described herein have a higher organic acid tolerance than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • acetic acid concentrations from 0.1 %
  • compositions as described herein have a higher tolerance to lactic acid and acetic acid at low pH than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1) at a temperature of 33°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1
  • compositions as described herein have a higher tolerance to lactic acid and acetic acid at low pH than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at a temperature of 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • organic acids include, but are not limited to, lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, other carboxylic acids, or combinations thereof.
  • the compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • acetic acid concentrations from 0.1 %
  • compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • compositions as described herein have a higher ethanol yield than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • the compositions as described herein have at least about 0.1 %, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51 %, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%
  • compositions as described herein have at most about 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 6.0%, 7.0%, 8.0%, 9.0%, 10.0%, 11.0%, 12.0%, 13.0%, 14.0%, 15.0%, 16.0%, 17.0%, 18.0%, 19.0%, 20.0%, 21.0% 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%,
  • the compositions as described herein have about 0.1%-75% (i.e. from about 0.1% to about 75%), 0.2%-75%, 0.3%-75%, 0.4%-75%, 0.5%-75%, 0.6%-75%, 0.7%-75%, 0.8%-75%, 0.9%-75%, 1%-75%, 2%-75%, 3%-75%, 4%- 75%%, 5%-75%, 6%-75%, 7%-75%, 8%-75%, 9%-75%, 10%-75%, 15%-75%, 20%-75%, 25%- 75%, 30%-75%, 35%-75%, 40%-75%, 45%-75%, 50%-75%, 55%-75%, 60%-75%, 0.1 %-70%, 0.2%-70%, 0.3%-70%, 0.4%-70%, 0.5%-70%, 0.6%-70%, 0.7%-70%, 0.8%-70%, 0.9%-70%, %-70%, 2%-70%, 3%-70%, 4%-70%%, 5%-70%, 6%-70%, 7%-70%, 8%-70%, 0.9%-70%
  • the compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • acetic acid concentrations from 0.1
  • compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • compositions as described herein have a higher fructose utilization than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • the compositions as described herein have at least about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21 %, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at least about 0.5%, 1%,
  • the compositions as described herein have at most about 10%, 11 %, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or 55% higher fructose utilization after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25
  • the compositions as described herein have about 0.5%-55% (i.e. from about 0.5% to about 55%), 1%-55%, 2%-55%, 3%-55%, 4%-55%, 5%-55%, 6%-55%, 7%-55%, 8%-55%, 9%-55%, 10%-55%, 11%-55%, 12%-55%, 13%-55%, 14%-55%, 15%-55%, 16%- 55%, 17%-55%, 18%-55%, 19%-55%, 20%-55%, 21%-55%, 22%-55%, 23%-55%, 24%-55%, 25%-55%, 26%-55%, 27%-55%, 28%-55%, 29%-55%, 30%-55%, 31%-55%, 32%-55%, 33%- 55%, 34%-55%, 35%-55%, 36%-55%, 37%-55%, 38%-55%, 39%-55%, 40%-55%, 41%-55%, 42%-55%, 43%-55%, 44%-55%, 45%-55%, 46%
  • the compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-
  • compositions as described herein have a higher ethanol to glycerol ratio than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1
  • compositions as described herein have at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%,
  • compositions as described herein have at most about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
  • ethanol to glycerol ratio after 48 hours of fermentation relative to typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, Distil a Max® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, Distil a Max® CN, PE-2, CAT-1
  • acetic acid concentrations from 0.1
  • the compositions as described herein have about 1%-90% (i.e. from about 1 % to about 90%), 2%-90%, 3%-90%, 4%-90%, 5%-90%, 6%-90%, 7%-90%, 8%-90%, 9%-90%, 10%-90%, 11%-90%, 12%-90%, 13%-90%, 14%-90%, 15%-90%, 16%-90%, 17%-90%, 18%-90%, 19%-90%, 20%-90%, 21%-90%, 22%-90%, 23%- 90%, 24%-90%, 25%-90%, 26%-90%, 27%-90%, 28%-90%, 29%-90%, 30%-90%, 31 %-90%, 32%-90%, 33%-90%, 34%-90%, 35%-90%, 36%-90%, 37%-90%, 38%-90%, 39%-90%, 40%- 90%, 41%-90%, 42%-90%, 43%-90%, 44%-90%, 45%-90%, 46%-90%, 47%-90%, 40%-
  • the compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • acetic acid concentrations from 0.1 %w
  • compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 33°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • compositions as described herein have a higher fermentation rate than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1 .0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9 and at a temperature of 38°C.
  • typical yeast products used for fermentation e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1
  • the compositions as described herein have a fermentation rate at least about 0%, 1%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) after 24 hours of fermentation at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of
  • the compositions as described herein have a fermentation rate at most about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, 250%, 260%, 270%, 280%, 290%, 300%, 310%, 320%, 330%, 340%, 350%, 360%, 370%, 380%, 390%, 400%, 410%, 420%, 430%, 440%, or 450% higher than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1) after 24 hours of fermentation at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at
  • the compositions as described herein have a fermentation rate about 0%-450% (i.e. from about 0% to about 450%), 1%-450%, 10%-450%, 20%-450%, 30%-450%, 40%-450%, 50%-450%, 60%-450%, 70%-450%, 80%- 450%, 90%-450%, 100%-450%, 110%-450%, 120%-450%, 130%-450%, 140%-450%, 150%- 450%, 160%-450%, 170%-450%, 180%-450%, 190%-450%, 200%-450%, 210%-450%, 220%- 450%, 230%-450%, 240%-450%, 250%-450%, 260%-450%, 270%-450%, 280%-450%, 290%- 450%, 300%-450%, 310%-450%, 320%-450%, 330%-450%, 340%-450%, 350%-450%, 360%- 450%, 370%-450%, 45%
  • the compositions as described herein have one or more of the defining characteristics described herein. In some embodiments, the compositions as described herein have one or more of the defining characteristics described herein at a temperature from 20°C to 40°C, preferably from 33°C to 38°C, and at acetic acid concentrations from 0.1 %w/v to 0.5 %w/v, preferably at an acetic acid concentration of 0.25 %w/v, at lactic acid concentrations from 0.50 %w/v to 1.0 %w/v, preferably from 0.36 %w/v to 0.90 %w/v, and at pH from 3.5 to pH 5.0, preferably from pH 4.2 to pH 4.9.
  • the compositions as described herein have a higher ethanol yield, a higher fructose utilization, a higher ethanol to glycerol ratio, a higher fermentation rate, a higher temperature tolerance, and a higher organic acid tolerance than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE- 2, CAT-1).
  • one or more of the compositions as described herein have a statistically significantly higher organic acid tolerance at low pH than typical yeast products used for fermentation (e.g., Fali® M, Ethanol Red®, Thermosacc®, Angel Super Alcohol®, 46 EDV, SuperstartTM, DistilaMax® CN, PE-2, CAT-1).
  • Organic acid tolerance at low pH may be exhibited by one or more of: increased ethanol yield, increased fructose utilization, higher ethanol to glycerol ratio, and increased fermentation rate.
  • one or more of the yeast strains and the derivatives thereof as described herein can tolerate organic acid concentrations (e.g.
  • acetic acid and lactic acid of about 0.1 %-1.5%, 0.2%-1 .5%, 0.3%- 1.5%, 0.4%-1.5%, 0.5%-1.5%, 0.6%-1.5%, 0.7%-1.5%, 0.8%-1 .5%, 0.9%-1 .5%, 1.0%-1.5%, 1.1 %-1.5%, 1 ,2%-1 .5%, 1.3%-1 .5%, 1.4%-1.5%, 0.1 %-1.4%, 0.2%-1.4%, 0.3%-1.4%, 0.4%- 1.4%, 0.5%-1.4%, 0.6%-1.4%, 0.7%-1.4%, 0.8%-1.4%, 0.9%-1.4%, 1.0%-1.4%, 1.1%-1.4%, 1 ,2%-1.4%, 1 ,3%-1 .4%, 0.1%-1 .3%, 0.2%-1.3%, 0.3%-1.3%, 0.4%-1.3%, 0.5%-1.3%, 0.6%- 1.3%, 0.7%-1.3%, 0.8%-1.3%, 0.9%-1.3%, 1.0%-1.4%, 1.1%-1
  • Described herein are processes for producing ethanol from a substrate by contacting the substrate with a fermenting organism or a composition comprising a fermenting organism.
  • the fermenting organism is selected from the yeast strains described herein and the derivatives thereof. Saccharomyces cerevisiae Y2083, Y2084, Y2086, Y2087, or a fermenting organism having properties that are about the same as those of the yeast strains described herein or a derivative of the yeast strains described herein having the defining characteristics may be used in a process described herein.
  • a fermented product comprising any of the yeasts described herein. Further described herein is a fermented product obtained by the methods described herein.
  • the fermented product can include, but is not limited to, fuel ethanol, industrial ethanol, potable ethanol, bioethanol, fermented foods such as alcoholic beverages, cultured milk and yogurt, wine, beer, cider, tempeh, miso, kimchi, sauerkraut, and fermented sausage.
  • Fermentation is carried out in a fermentation medium.
  • the fermentation medium includes a fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism, such as a biomass.
  • the fermentation medium may comprise nutrients for the fermenting organism(s).
  • Nutrients are widely used in the art of fermentation and include nitrogen sources, vitamins, minerals, or combinations thereof.
  • the strain or derivative, or composition as described herein is incubated with a substrate comprising fermentable sugars from a biomass such as a plant biomass from forests and/or from agricultural or food-processing products and/or coproducts that constitute a considerable source of carbon for the production of molecules of interest.
  • the strain or derivative is incubated with the substrate under conditions that allow fermentation of the fermentable sugars.
  • the fermentable sugars may be glucose, galactose, maltose, fructose, sucrose, mannose, or a combination thereof.
  • the fermentable sugars are glucose, fructose, and sucrose.
  • the source of the fermentable sugar in the substrate may be any source which contains fermentable sugar.
  • the fermentable sugar in the substrate may be, for example, from any one or more of the following sources: hydrolyzed starch, hydrolyzed cellulose, molasses from sugar cane, sugar beet or sweet sorghum, sugar cane juice, agave, sugar beet juice, grape juice, fruit juice, glucose, fructose, hydrolyzed maltodextrins, raw sugar juice, galactose, sucrose, any other forms of fermentable sugars, or combinations thereof.
  • Starch may be obtained from any starch rich crops. Examples of starch rich crops include, but are not limited to, corn, wheat, barley, cassava, sorghum, sweet potato, millet, rice, or any other starch rich crops.
  • the crop is typically crushed and mixed with water and hydrolytic enzyme(s) under conditions which result in hydrolysis of the starch and release of fermentable sugars such as glucose.
  • Typical enzymes for hydrolysis of the starch include a- amylase, amyloglucosidase, pullulanase, [3-amylase, glucoamylase, or mixtures thereof.
  • fermenting organisms such as yeast, including Saccharomyces cerevisiae yeast, require an adequate source of nitrogen for propagation and fermentation.
  • Many sources of nitrogen can be used, and such sources of nitrogen are well known in the art.
  • the nitrogen source may be organic, such as urea or corn mash, or inorganic, such as ammonia or ammonium hydroxide or ammonium salts.
  • the biomass may comprise or originate from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.
  • the substrate is provided in the form of molasses.
  • the substrate is provided in the form of a syrup.
  • the substrate is provided in the form of corn mash or a Synthetic Corn Medium (SCM).
  • the sugar content of the fermentation medium may be adjusted so that it is as high as possible while at the same time ensuring that the sugar is converted to ethanol as rapidly and as completely as possible. It is preferred that the yeast convert all of the sugars of the medium to ethanol, and that the overall yield of conversion of the consumed sugars to ethanol is as high as possible and, consequently, the fewest coproducts such as glycerol are generated during the fermentation.
  • the fermentation is carried out at a temperature which permits fermentation of the fermentable sugars.
  • the temperature at which the fermentation is carried out is from about 25-42°C (i.e. from about 25°C to about 42°C). Suitable temperature ranges include 25-41 °C, 26-40°C, 27-40°C, 28-40°C, 29-40°C, 30-40°C, 25- 39°C, 26-39°C, 27-39°C, 28-39°C, 29-39°C, 30-39°C, 31-39°C, 32-39°C, 33-39°C, 25-
  • molasses and other sugar refinery products as feedstocks is a common practice in the industrial scale production of bioethanol and distilled spirits.
  • the ethanol fermentation process may utilize the sugars obtained at during refining originating at any of the refining steps.
  • the fermentation process is usually a fed-batch fermentation.
  • Yeast can be propagated before fermentation, or the propagation step be omitted by direct pitching active dry yeast product. Fermentation may be carried out at a temperature from about 25°C to about 40°C, such as from about 25°C to about 33°C, about 30°C to about 34°C, or 32°C to about 36°C. For bioethanol applications, temperature is preferable around 33°C.
  • fermentation is ongoing from about 6 hours to about 120 hours, in particular from about 18 hours to about 72 hours, and preferably about 24 hours to about 48 hours.
  • the pH is from about 3.0 to about 6.0, preferably from about 4.0 to about 5.0.
  • SSF Simultaneous Saccharification and Fermentation
  • SSF is widely used in industrial scale fermentation product production processes, especially ethanol production processes.
  • the saccharification step and the fermentation step are carried out simultaneously.
  • a fermenting organism such as yeast, and enzyme(s)
  • SHF hydrolysis and fermentation
  • SSF may be carried out at a temperature from about 25°C to about 40°C, such as from about 28°C to about 35°C, such as from about 30°C to about 34°C, preferably about 33°C.
  • fermentation is ongoing for about 6 hours to about 120 hours, in particular about 24 hours to about 96 hours, and preferably about 48 hours.
  • the pH is from about 3.0-6.0, preferably from about 4.0-5.0.
  • the ethanol may be separated from the spent fermentation medium or beer.
  • the beer may be rectified or distilled to recover/extract the desired fermentation products (i.e. ethanol and higher alcohols).
  • the desired fermentation product i.e. ethanol
  • the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques known in the art.
  • the fermentation product i.e. ethanol
  • the ethanol is not recovered/extracted from the fermentation medium or beer, such as in the production of alcoholic beverages. d. Batch Fermentation
  • Batch fermentation is where fermentation is done in separate batches.
  • a batch fermentation is a process where the fermentation medium is provided in the fermenter from the start, where the fermenter is inoculated with an intended microorganism (i.e. yeast, yeast product) and the fermentation process is running until a predetermined condition has been reached, typically depletion of the substrate in the fermentation medium and the cessation of ethanol production caused by the depletion.
  • an intended microorganism i.e. yeast, yeast product
  • the fermentation process is running until a predetermined condition has been reached, typically depletion of the substrate in the fermentation medium and the cessation of ethanol production caused by the depletion.
  • the products are removed from the fermenter and the fermenter is sterilized before the next fermentation takes place. Then the contents are the end-product (e.g., wine) or can be rectified/distilled (e.g., fuel ethanol and whisky).
  • end-product e.g., wine
  • can be rectified/distilled e.g., fuel
  • a fed-batch process may also be used.
  • a fed-batch process is a fermentation where a part of the fermentation medium is provided from the start of the fermentation process where the inoculum is added, and at a certain time point after the start of the fermentation additional substrate, feed is fed to the fermenter at a rate that may be predetermined or determined by the conditions in the fermenter; until the maximal volume has been reached.
  • the feed may or may not have the same composition as the initial fermentation medium.
  • the contents are the end-product (e.g., wine) or can be rectified/distilled (e.g., fuel ethanol and whisky).
  • Continuous fermentation allows for fermentation to be done over long periods of time without fermenting in separate batches.
  • a continuous fermentation process is a process where new growth medium is continuously fed to the fermenter and ferment is simultaneously removed from the fermenter at the same rate so the volume in the fermenter is constant. Then the contents are the end-product (e.g., wine) or can be rectified/distilled (e.g., fuel ethanol and whisky).
  • the ethanol produced by the yeast and the derivatives thereof as described herein may be fuel ethanol, industrial ethanol, and/or potable ethanol.
  • Fuel ethanol, industrial ethanol, and potable alcohol can be produced from starch-containing biomass, including starch found in cereal grains (e.g., corn, wheat, rice, sorghum/milo, barley, etc.) and from starch in tubers and root vegetables (e.g., potato, cassava, etc.); and from vegetative portions of plants containing the sugars sucrose, glucose, and fructose (e.g., sugar cane, sweet sorghum, sugar beets, agave, etc.); and from the fruits and berries of plants containing sucrose, glucose, and fructose (e.g., grapes, oranges, peaches, cherries, etc.).
  • starch-containing biomass including starch found in cereal grains (e.g., corn, wheat, rice, sorghum/milo, barley, etc.) and from starch
  • Fuel ethanol and industrial ethanol can also be produced from plant biomass containing cellulose and hemicellulose, such as cereal grain crop residues (e.g., wheat and rice straw, corn stover, corn cobs, etc.), from corn fiber, from so-called energy crops such as switchgrass and poplar, from woody material waste including residues from sawmills (e.g., saw dust and wood chips), from residues from pulp and paper manufacture, and from waste paper and cardboard.
  • cereal grain crop residues e.g., wheat and rice straw, corn stover, corn cobs, etc.
  • energy crops such as switchgrass and poplar
  • woody material waste including residues from sawmills (e.g., saw dust and wood chips)
  • Fuel ethanol is manufactured for use in internal combustion engines and may manufactured as anhydrous or hydrous fuel ethanol.
  • Anhydrous fuel ethanol can be mixed with gasoline to form an ethanol/gasoline mixture or with diesel to form an ethanol/diesel mixture.
  • Hydrous fuel ethanol can be used directly as a fuel in internal combustion engines.
  • Industrial ethanol is manufactured for use in a variety of applications including as a solvent in pharmaceuticals, cosmetics, detergents, household cleaners and disinfectants, and coatings and inks; and as a chemical intermediate in manufacture of ethyl acetate, ethyl acrylate, polyethylene, acetic acid, and other organic molecules of industrial importance.
  • a solvent in pharmaceuticals, cosmetics, detergents, household cleaners and disinfectants, and coatings and inks
  • chemical intermediate in manufacture of ethyl acetate, ethyl acrylate, polyethylene, acetic acid, and other organic molecules of industrial importance c. Potable Ethanol
  • Potable ethanol is manufactured for human consumption and includes the ethanol found in wine, beer, cider, sake, mead, kombucha, and distilled spirits including whisky, bourbon, cachaga, Chinese white liquor, baijiu, and others.
  • the methods may include providing a first yeast strain that is selected from Saccharomyces strains Y2083, Y2084, Y2086, and Y2087 and a second yeast strain that is any yeast strain, such as a yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain.
  • the second strain may also be any of the yeast strains described herein.
  • the methods may further include inducing sporulation of the first yeast strain and the second yeast strain.
  • the methods may also include screening and selecting spores from the first yeast strain and spores from the second yeast strain.
  • the method may include hybridizing a selected spore of the first yeast strain with a selected spore of the second yeast strain, and screening or selecting for a derivative strain.
  • the method may include screening or selecting for spores which exhibit one or more defining characteristics of the Saccharomyces strains as described herein.
  • the method may further include screening or selecting a hybrid which exhibits one or more defining characteristics of the Saccharomyces strains as described herein.
  • An example of directed mating is provided in FIG. 1A. Therefore, the parents (i.e. donors of the “a” and “alpha” haploids) that generate a hybrid are known.
  • the yeast strains and derivatives thereof as described herein are made from a process as shown in FIGS. 1 A-D.
  • the Saccharomyces yeast strains designated Y2083, Y2084, Y2086, and Y2087 are derived from one or more different Saccharomyces yeast strains by a process shown in FIGS. 1A-D, for example by the process shown in FIG. 1A, so that one or more of Y2083, Y2084, Y2086, or Y2087 is a product of directed mating.
  • Methods of directed mating are known in the art and are described in U.S. Patent No. 10,308,963 and U.S. Patent No. 10,106,823, which are incorporated herein by reference.
  • the methods may include providing a first yeast strain that is selected from Saccharomyces strains Y2083, Y2084, Y2086, and Y2087 and one or more additional yeast strains that are any yeast strain, such as a yeast strain in the Saccharomyces sensu stricto clade, such as a Saccharomyces cerevisiae strain.
  • the one or more additional yeast strains may also be any of the yeast strains described herein.
  • the methods may further include inducing sporulation of the first yeast strain and the one or more additional yeast strains.
  • the methods may also include mixing all of the spores to allow for hybridization of the spores and screening or selecting for a derivative strain.
  • the method may include screening or selecting a hybrid which exhibits one or more defining characteristics of the Saccharomyces strains as described herein. An example of mass mating is provided in FIG. 1B. Therefore, the parents (i.e. donors of the “a” and “alpha” haploids) that generate a hybrid are unknown.
  • the yeast strains and derivatives thereof as described herein are derived from a process as shown in FIGS. 1 A-D.
  • Saccharomyces yeast strains designated Y2083, Y2084, Y2086, and Y2087 are derived from one or more different Saccharomyces yeast strains by a process shown in FIGS. 1A-D, for example by the process shown in FIG. 1 B, so that one or more of Y2083, Y2084, Y2086, or Y2087 is a product of mass mating. 7. Examples
  • DM Diluted sugarcane Molasses medium
  • Blackstrap molasses (79°Brix, United States Standards for Grades of Sugarcane Molasses, USDA, 1956) are generally used in industrial bioethanol production.
  • DM is prepared by dilution of commercial blackstrap molasses and adjusted to reflect the chemical composition of sugar cane molasses used at manufacturing scale in terms of sugar and nutrient availability.
  • DM reflects a mid-gravity model sugar cane molasses at 22-25% fermentable sugars, which should yield 7-11 %w/v final ethanol. Molasses quality and composition is variable depending on geography and refinery practices.
  • This medium is used to monitor the performance of the yeast during a batch fermentation process, in which the fermentable sugars are added at once before the fermentation starts.
  • SDM Standard DM
  • 1 kg of SDM medium was made by adding 1 L water to 615 g molasses and 1.6 g urea.
  • the medium was autoclaved for 20 minutes 120°C and allowed to cool down to room temperature. pH was adjusted to 4.87 with hydrochloric acid and/or potassium hydroxide while mixing at 24-25°C.
  • virginiamycin was added to 1.0 ppm and penicillin G was added to 100 ppm.
  • the broth was adjusted to 22-25 %w/v fermentable sugars with water.
  • the resulting medium contains 0.36 %w/v lactic acid and 0.25 %w/v acetic acid.
  • a representative sample of the solution was collected for measurement of specific gravity and for HPLC analysis.
  • ALM high organic Acid DM
  • Yeast product rehydration Yeast dry product was resuspended in 0.9% sodium chloride (0.07 g/g) and allowed to hydrate at room temperature for 30 minutes before inoculation.
  • Ethanol yield The ratio of ethanol glucose equivalents present at the end of the fermentation to the total end of fermentation glucose equivalents was used to determine ethanol yield. The relative difference in ethanol yield was determined as the difference between the percent ratio of ethanol yield over the mean ethanol yield for Y1027 minus one hundred percent.
  • Ethanol to Glycerol ratio The net glycerol produced during the fermentation was determined as the difference between the total glycerol at the end of the fermentation and the initial glycerol present in the medium.
  • the ethanol to glycerol ratio (ethanol: glycerol) was determined as the ratio of ethanol to net glycerol.
  • the relative percent change in ethanol: glycerol with respect to Y1027 was determined as the difference between the percent ratio of ethanol: glycerol over the mean of ethanol: glycerol for Y1027 minus one hundred percent.
  • Fructose utilization The concentration of residual fructose at the end of the fermentation was used as an indicator of fructose utilization capacity, e.g., lower residual fructose indicates higher fructose utilization.
  • the relative percent change in fructose utilization with respect to Y1027 was determined as the difference between the percent ratio of residual fructose over the mean of residual fructose for Y1027 minus one hundred percent.
  • Fermentation rate The amount of CO2 in grams produced during ethanol fermentation is proportional to the amount of ethanol in grams produced during the same reaction. Therefore, mass loss in grams can be used to evaluate the progress of the fermentation reaction without breaking the anaerobic seal. The mass loss in grams at 24 hours of fermentation was used as an indication of midpoint fermentation rate. The relative change in fermentation rate of a given strain with respect to Y1027 was determined as the difference between the percent ratio of fermentation rate for that strain over the mean fermentation rate for Y1027 minus one hundred percent.
  • Genetic diversity can be generated in a yeast population by artificially introducing mutations.
  • Artificial mutagenesis can be obtained by exposure to radiation energy (e.g., ultraviolet radiation), chemical mutagens (e.g., ethyl methanesulfonate, EMS), or a combination of both.
  • radiation energy e.g., ultraviolet radiation
  • chemical mutagens e.g., ethyl methanesulfonate, EMS
  • the next paragraph shows the use of artificial mutagenesis to produce a genetically diverse population starting from Y1027.
  • a fresh colony of Y1027 was inoculated int 50 mL YPS medium (1 %w/v yeast extract, 2% w/v bactopeptone, 2 %w/v sucrose) and incubated at 33°C for 24 hours with agitation at 250 rpm.
  • the culture was diluted to 2.2 x 10 8 cells/mL.
  • Cells were exposed to UV radiation from 0 to 4 kJ/cm 2 and 3 %w/v EMS from 90 to 240 minutes. Cultures were washed in phosphate buffered saline buffer, pH 7.4 and stored at 4°C. Aliquots of the culture before and after treatment were plated in YPS agar plates and the ratio of colonies relative to the untreated culture was used to determine the survival rate (TABLE 1).
  • a pool of mutants derived from Y1027 was inoculated into 1 % w/v Yeast Extract, 2% w/v bactopeptone, 10.8 %w/v fermentable sugars (2.8% glucose, 8 % fructose), 9.6 %w/v ethanol, 1.2 %w/v lactic acid, pH 3.8 and incubated at 38°C for 24 h. Surviving cells were plated on YPS agar plates and incubated at 32°C to obtain isolated colonies.
  • Directed evolution applies selective pressure to a genetically diverse population to gain advantages in fitness that are otherwise difficult to obtain through traditional breeding and selection.
  • Directed evolution can be performed under continuous culture conditions as described here, as serial culture batch or fed-batch passages, or as a combination of both. Selection conditions can be applied simultaneously, in series, or in alternating patterns to improve specific traits throughout the course of the strain development.
  • Protocol modification steps throughout the execution of the directed evolution experiment.
  • someone skilled in the art may adjust the feeding rate of specific nutrients.
  • a genetically diverse population may be produced through naturally occurring mutations and/or by artificial mutagenesis (e.g., chemical mutagenesis).
  • a genetically diverse population may be also produced by breeding genetically different strains as described in the previous example.
  • directed evolution was performed by continuously culturing an acid tolerant strain as the starter strain in sugarcane molasses medium at 37°C -38°C for 100 days. Cells were maintained in suspension by continuous agitation at 150 rpm. The culture was continuously fed with Standard Diluted Molasses Medium (SDM). Fermentable sugars concentration was maintained at 4-6 %w/v and ethanol at 3.6-7.7 %w/v throughout the experiment. The initial organic acid concentration of 0.326 ⁇ 0.015 %w/v acetic acid and 0.5-0.6 %w/v lactic acid. The initial pH was adjusted to 4.8- 4.9.
  • SDM Standard Diluted Molasses Medium
  • the feed media was acidified to pH 4.4 with hydrochloric acid and the lactic acid concentration in the feed was increased to 1 %w/v reaching 0.77% w/v and pH 4.4 at the end of the directed evolution in the culture vessel. Growth was stimulated by the addition of Tween-80 (420 mg/L) and ergosterol (10 mg/L).
  • meiotic yeast spores can be induced following methods well known in the art (e.g., as described in “Methods in Yeast Genetics, A Cold Spring Harbor Laboratory Course Manual, 2000 Edition” de D. Burke, D. Dawson et T. Stearns, Cold Spring Harbor Laboratory Press (ISBN 0-87969-588-9)). Formation of meiotic yeast spores was facilitated by resuspending a fresh yeast culture grown in acetate medium (1 %w/v yeast extract, 2 %w/v bactopeptone, 2% w/v potassium acetate) into sporulation media and incubating for 5 days at 30°C with agitation at 250 rpm.
  • spore suspensions were treated with an equal volume of ethyl ether, incubated for two hours at room temperature (e.g., 25°C) and washed in sterile sporulation media to remove vegetative cells. Spore suspensions were stored at 4°C until use.
  • Breeding occurs when physical contact between two haploid cells or germinating meiotic spores from opposite mating types (MAT alpha and MATa) results in cell fusion and the formation of a diploid cell.
  • Direct mating is the result of manually induced breeding by which the person skilled in the art facilitates the physical contact between the two cells.
  • the use of a micromanipulator e.g., Singer model number 1377 A3 can be used to facilitate the placing of the two cells into physical contact.
  • two individual stable haploid cells of opposite mating types are physically contacted.
  • an individual MATalpha haploid cell was obtained from the progeny of a Y1027 mutant.
  • the MATalpha haploid cell was physically contacted with an individual MATa haploid cell descending from a hybrid strain.
  • the pair was placed together on a YPS agar plate with the help of a micromanipulator and incubated at 32°C until growth was observed.
  • a random meiotic spore from a first strain with desirable characteristics was physically dissected and separated from the other meiotic spores in the same ascus and placed on a YPS agar plate with the help of a micromanipulator.
  • a random meiotic spore from a second strain with desirable characteristics was dissected in the same way and physically placed next to the first spore to allow for physical contact on the YPS agar plate.
  • the spore pair was allowed to germinate and fuse by incubation at 32°C until growth was observed.
  • hybrid diploid progeny was obtained by physically contacting individual spores from an acid tolerant mutant strain and a high fructose utilizing strain Fermichamp.
  • one zymolyase-treated random spore from a first strain with desirable characteristics was physically contacted with an individual cell from a stable haploid strain showing desirable characteristics on a YPS agar plate with the help of a micromanipulator and incubated at 32°C until growth was observed.
  • random spores from an intermediate hybrid were contacted with individual MATalpha haploid cells derived from the CAT-1 strain to generate new hybrid strains.
  • the haploid cell suspension may be obtained from one or more stable haploid population provided that both mating types are present.
  • the haploid cell suspension can be obtained by treating a spore suspension with zymolyase to digest the ascus wall and facilitate mechanical separation of the meiotic spores.
  • the zymolyase-treated spore suspension is diluted into a sucrose or glucose containing medium to facilitate spore germination into haploid cells.
  • the suspension is mixed and allowed to settle for a short period of time to encourage cell fusion events.
  • ethyl ether treated meiotic spores from at least two different strains with desirable characteristics were treated with 5 units/mL zymolyase for 30 minutes, mixed and resuspended in 10 mL YPS broth (1% yeast extract, 1% peptone, 2% sucrose). The mix was incubated for 1 .5 hours without agitation to allow germinating individual spores to randomly contact each other. The mixture was further incubated at 33°C for an additional 18-20 hours with gentle agitation at 70 rpm.
  • a combination of breeding and directed evolution was used to improve tolerance to multiple stresses as well as to improve fermentation rate. Tolerance to multiple stresses was performed by applying several rounds of mass mating and selection to a population of intermediate strains obtained by breeding and selection for improved acid and temperature tolerance in sugarcane molasses medium. A portion of the strains was initially inoculated into a continuous culture in SDM medium at 33°C. A second portion of the strains was initially subjected to selection in YP (1% yeast extract, 2% bactopeptone) for tolerance to different concentrations of organic acids and ethanol, at various levels of temperature from 36°C to 40°C and pH. Isolates passing each selection criteria were combined for sporulation and mass mating.
  • YP 1% yeast extract, 2% bactopeptone
  • Saccharomyces yeast strains as described herein, and representative samples of the strains having been deposited under NRRL Patent Deposit Designation No. Y-68182 (Y2083), NRRL Patent Deposit Designation No. Y-68183 (Y2084) , NRRL Patent Deposit Designation No. Y-68184 (Y2086), and NRRL Patent Deposit Designation No. Y-68185 (Y2087) were observed to possess the following characteristics, based on experiments conducted at 33°C or 38°C, at a normal pH without organic acids or at a low pH with addition of organic acids. Y1027 is shown for comparison and was analyzed under similar conditions.
  • yeast strains as described herein comprise increased ethanol yield, increased fructose utilization, increased ethanol to glycerol ratio, and increased initial fermentation rate as compared to a control.
  • the advantageous fermentation characteristics of the yeast strains and their corresponding products as described herein are provided in the following examples.
  • Active dry yeast products derived from the yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 33°C and pH 4.2 in ALM initially containing 22.5-24.5 %w/v fermentable sugars, 0.9 %w/v lactic acid and 0.25 %w/v acetic acid (TABLE 3 and FIGS. 3A-E).
  • the control (Y1027) is shown for comparison.
  • Active dry yeast products derived from the yeast strains as described herein were evaluated for ethanol production, fructose utilization, glycerol production, and fermentation rate at 38°C and pH 4.9 in SDM initially containing 22.5-24.5 %w/v fermentable sugars, 0.36 %w/v lactic acid and 0.25 %w/v acetic acid (TABLE 4 and FIGS. 4A-E). The control (Y1027) is shown for comparison.
  • Genotype comparison employing PCR amplification of microsatellite loci was carried out to verify that strains Y2083, Y2084, Y2086, and Y2087 (NRRL Patent Deposit Designation No. Y-68182, Y-68183, Y-68184, and Y-68185, respectively) have unique genotypes and can be differentiated from other strains isolated from commercial yeast products used in bioethanol production (TABLE 7).
  • microsatellite DNA amplification products were generated through multiplex PCR of the YPL009C and YOR267C loci.
  • the primers used were YPL009C_F1 : GGTTTTGGATTTTTATGGAAAG (SEQ ID NO: 1), YPL009C_R1: TTTCGTGCTATCGTTTGAATC (SEQ ID NO: 2), YOR267C_F1 : CGATGCTAATGGTGACTCTAAC (SEQ ID NO: 3), and YOR267C_R1: CTGTTGACTCGATTTATTATCG (SEQ ID NO: 4).
  • Each primer was used at 0.4 pM concentration.
  • PCR amplification was performed using a Mastercycler Nexus Gradient Instrument (Eppendorf) with the following thermocycling conditions: an initial denaturation step at 94°C for 2 minutes, followed by 35 cycles of 94°C for 30 seconds, 53.5°C for 20 seconds and 68°C for 30 seconds, followed by a final extension step at 68°C for 5 minutes.
  • Eppendorf Mastercycler Nexus Gradient Instrument
  • PCR products were analyzed by capillary electrophoresis using the QIAxcel Advanced Instrument (Qiagen) using the following run settings: Rise Time: 0.3 sec; Applied Injection Time: 20 sec; Applied Separation Time: 425 sec; Method Injection Time: 10 sec; Method Separation Time: 420 sec; Method Injection Voltage: 5.0 kV; and Method Separation Voltage: 5.0 kV. Fragment sizes were compared against a reference marker table generated using the QX DNA Size Marker 100 bp - 2.5 kb (Qiagen Catalog Number: 929559) prepared in 1x PCR buffer to a final concentration of 20 ng/pl. The alignment marker used was QX Alignment Marker 15 bp/5 kb (Qiagen Catalog Number: 929524).
  • strains Y2083, Y2084, Y2086, and Y2087 are novel yeast strains which can be differentiated from prior art strains based on their microsatellite DNA patterns (FIG. 6).
  • sequence comparison results are displayed as a heatmap which shows the percentage of identical nucleotide matches for each strain relative to Y1027, for 56 ORF sequences (FIG. 7A).
  • the intensity legend accompanying the heatmap corresponds to the percentage of identical matches generated through blastn analysis using Y1027 ORF sequence as the query sequence. Shaded rectangles represent percent identities less than 100% compared to the Y1027 sequence and hence indicate sequence variations.
  • strains Y2083, Y2084, Y2086, and Y2087 each have unique shading patterns which, along with the microsatellite PCR results, show that the strains claimed in the present invention are novel and have a unique genotype.
  • a non-naturally occurring Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185.
  • a non-naturally occurring derivative of a Saccharomyces yeast strain selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185.
  • Clause 4 The yeast strain or the derivative of any one of clauses 1 to 3, wherein the yeast strain or the derivative has at least about 3.3% higher ethanol yield after 48 hours of fermentation relative to Saccharomyces cerevisiae strain Y1027.
  • Clause 13 The yeast strain or derivative of any one of clauses 3 to 11 , wherein the organic acids comprise lactic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, or a combination thereof.
  • a method of producing the derivative of a Saccharomyces yeast strain of any one of clauses 2-13 comprising either: (1) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2083, Y2084, Y2086, Y2087, and derivatives thereof; and (ii) a second yeast strain, wherein the second yeast strain is in the Saccharomyces sensu stricto clade; (b) inducing sporulation of the first yeast strain and the second yeast strain; (c) screening and selecting spores from the first yeast strain and spores from the second yeast strain; (d) hybridizing the selected spores of the first yeast strain with the selected spores of the second yeast strain; and (e) screening or selecting for a derivative strain; or (2) (a) providing: (i) a first yeast strain, wherein the first yeast strain is selected from Saccharomyces strains Y2083, Y2084, Y2086,
  • step (1)(c) comprises screening or selecting spores which exhibit one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or a derivative thereof; and step (1 )(e) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, Y2087, or a derivative thereof.
  • step (2)(d) comprises screening or selecting a hybrid which exhibits one or more defining characteristics of Saccharomyces strains Y2083, Y2084, Y2086, or Y2087.
  • Clause 17 A mutant yeast of a yeast strain of clause 1 or a derivative of clause 2.
  • Clause 18 A method of producing the mutant yeast of clause 17, wherein the mutant yeast is mutated by contacting the yeast strain with a mutagen.
  • Clause 19 The method of clause 18, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • EMS ethyl methanesulfonate
  • UV ultraviolet light
  • MMS methylmethane sulphonate
  • NNG nitrous acid
  • NNG nitrosoguanidine
  • acridine mustard 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • Clause 20 A method of producing the mutant yeast of clause 17, wherein the mutant yeast is mutated by contacting the derivative with a mutagen.
  • Clause 21 The method of clause 20, wherein the mutagen is ethyl methanesulfonate (EMS), ultraviolet light (UV), X-rays, methylmethane sulphonate (MMS), nitrous acid, nitrosoguanidine (NNG), acridine mustard, 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • EMS ethyl methanesulfonate
  • UV ultraviolet light
  • MMS methylmethane sulphonate
  • NNG nitrous acid
  • NNG nitrosoguanidine
  • acridine mustard 2-methoxy-6-chloro-9[3- (ethyl-2- chloroethyl)aminopropylamino]acridine-2 (ICR-170), or nitrogen mustard.
  • Clause 23 A method of producing the evolved yeast of clause 22, wherein evolution is induced by applying selective pressure to the yeast strain.
  • Clause 24 A method of producing the evolved yeast of clause 22, wherein evolution is induced by applying selective pressure to the derivative.
  • Clause 26 The genetically modified yeast of clause 25, wherein a nucleic acid sequence of the genetically modified yeast is changed using gene editing.
  • Clause 27 A recombinant yeast of a yeast strain of clause 1 or a derivative of clause 2.
  • Clause 28 The recombinant yeast of clause 27, wherein the recombinant yeast comprises a modification to suppress expression of a gene, enhance expression of a gene, introduce a gene, or delete a gene.
  • a process for producing ethanol from a substrate by contacting the substrate with a fermenting organism wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof.
  • Clause 30 The process of clause 29, wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.
  • yeast comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces strain Y1027; (c) a higher fructose utilization than Saccharomyces strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio than Saccharomyces strain Y1027 under the same fermentation conditions; (e) an increased organic acid tolerance compared to Saccharomyces strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces strain Y1027 under the same fermentation conditions.
  • Clause 32 The process of any one of clauses 29 to 31 , wherein the yeast has a higher temperature tolerance during fermentation than Saccharomyces cerevisiae strain Y1027 at fermentation temperatures ranging from 33°C to 38°C.
  • Clause 34 The process of clause 32, wherein the fermentation temperature is 38°C.
  • Clause 35 The process of any of any one of clauses 29 to 34, wherein the yeast has a higher organic acid tolerance in a fermentation medium with decreasing pH from about 4.9 to about 4.0 in the presence of increasing organic acids relative to Saccharomyces cerevisiae strain Y1027.
  • Clause 36 The process of clause 35, wherein the organic acids in the fermentation medium comprise 0.36 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.9.
  • Clause 37 The process of clause 35, wherein the organic acids in the fermentation medium comprise 0.9 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.2.
  • Clause 38 The process of any one of clauses 29 to 37, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • Clause 39 The process of any one of clauses 29 to 37, wherein the ethanol is produced using a starch.
  • Clause 40 The process of clause 39, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.
  • SSF simultaneous saccharification and fermentation
  • Clause 41 The process of any one of clauses 29 to 37, wherein the ethanol is produced using a sugar.
  • Clause 42 The process of clause 41 , wherein batch fermentation or continuous fermentation is used to produce the ethanol.
  • Clause 43 The process of any one of clauses 29 to 37, wherein the ethanol is produced using a lignocellulosic sugar.
  • Clause 44 The process of clause 43, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.
  • SSF simultaneous saccharification and fermentation
  • SHF Separate Hydrolysis and Fermentation
  • Clause 45 A composition comprising the yeast strain of clause 1 or the derivative of clause 2 and one or more components selected from surfactants, emulsifiers, gums, swelling agents, protectants, and antioxidants. [000239] Clause 46.
  • composition of clause 45 wherein the composition comprises one or more defining characteristics selected from: (a) a higher ethanol yield than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (b) an increased temperature tolerance compared to Saccharomyces cerevisiae strain Y1027; (c) a higher fructose utilization than Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (d) a higher ethanol to glycerol ratio compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; (e) an increased organic acid tolerance compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions; and (f) an increased fermentation rate compared to Saccharomyces cerevisiae strain Y1027 under the same fermentation conditions.
  • Clause 47 The composition of clause 45 or clause 46, wherein the yeast has a higher temperature tolerance than Saccharomyces cerevisiae strain Y1027 from 33°C to 38°C.
  • Clause 48 The composition of any one of clauses 45-47, wherein the temperature is 33°C.
  • Clause 49 The composition of any one of clauses 45-47, wherein the temperature is 38°C.
  • Clause 50 The composition of any one of clauses 45-49, wherein the yeast has a higher organic acid tolerance in decreasing pH from about 4.9 to about 4.0 in the presence of increasing organic acids relative to Saccharomyces cerevisiae strain Y1027.
  • Clause 51 The composition of any one of clauses 45-50, wherein the organic acids comprise 0.36 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.9.
  • Clause 52 The composition of any one of clauses 45-50, wherein the organic acids comprise 0.9 %w/v lactic acid and 0.25 %w/v acetic acid, and pH is 4.2.
  • Clause 53 A process for producing ethanol from a biomass by contacting the biomass with the composition of clause 45.
  • Clause 54 The process of clause 53, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • Clause 55 The process of clause 53, wherein the ethanol is produced using a starch.
  • Clause 56 The process of clause 53, wherein simultaneous saccharification and fermentation (SSF) or continuous fermentation is used to produce the ethanol.
  • SSF simultaneous saccharification and fermentation
  • Clause 58 The process of clause 53, wherein batch fermentation or continuous fermentation is used to produce the ethanol.
  • Clause 60 The process of clause 53, wherein simultaneous saccharification and fermentation (SSF) or Separate Hydrolysis and Fermentation (SHF) is used to produce the ethanol.
  • SSF simultaneous saccharification and fermentation
  • SHF Separate Hydrolysis and Fermentation
  • a method of producing a fermentation product from a substrate by contacting the substrate with a fermenting organism wherein the fermenting organism is selected from: (a) Saccharomyces strain Y2083, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68182, or a derivative thereof; (b) Saccharomyces strain Y2084, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68183, or a derivative thereof; (c) Saccharomyces strain Y2086, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68184, or a derivative thereof; (d) Saccharomyces strain Y2087, a representative sample of the strain having been deposited under NRRL Patent Deposit Designation No. Y-68185, or a derivative thereof.
  • Clause 62 The method of clause 61 , wherein the substrate comprises or originates from sugar cane, sugar beet, sweet sorghum, agave, corn, wheat, rice, barley, rye, sorghum, triticale, potato, sweet potato, cassava, or a combination thereof.
  • Clause 64 The method of clause 63, wherein the ethanol is used for fuel ethanol, industrial ethanol, potable ethanol, or a combination thereof.
  • Clause 65 The method of clause 61 , wherein batch fermentation, continuous fermentation, simultaneous saccharification and fermentation (SSF), or Separate Hydrolysis and Fermentation (SHF) is used to produce the fermentation product.
  • SSF simultaneous saccharification and fermentation
  • SHF Separate Hydrolysis and Fermentation
  • the deposit will be maintained at the NRRL depository under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure for a term of at least thirty years and at least five years after the most recent request for the furnishing of a sample of the deposit was received by the depository. Applicants have satisfied all the requirements of 37 C.F.R. ⁇ 1.801-1.809, including providing an indication of the viability of the sample. Additional deposits will be made at the NRRL as needed to ensure availability, subject to the conditions described herein. Applicants impose no restrictions on the availability of the deposited material from the NRRL after the issuance of a patent from this application. Applicants have no authority to wave any restrictions imposed by law on the transfer of biological material or its transportation in worldwide commerce. Applicants do not waive any of their rights granted under any patents issuing from this application in any country.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne des souches de levure et des dérivés de celles-ci, ainsi que des compositions comprenant les souches de levure destinées à être utilisées dans la fabrication d'éthanol. L'invention concerne également des procédés de production d'éthanol à partir de biomasse à l'aide des souches de levure et des compositions. En particulier, les souches de levure produisent du glycérol inférieur et de l'éthanol supérieur, et ont une tolérance à la température supérieure et un taux de fermentation supérieur à celui des souches et des produits actuellement utilisés dans des procédés de production d'éthanol.
PCT/US2023/036514 2022-10-31 2023-10-31 Développement d'une souche de levure pour la production d'éthanol WO2024097243A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263421115P 2022-10-31 2022-10-31
US63/421,115 2022-10-31

Publications (1)

Publication Number Publication Date
WO2024097243A1 true WO2024097243A1 (fr) 2024-05-10

Family

ID=90931378

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/036514 WO2024097243A1 (fr) 2022-10-31 2023-10-31 Développement d'une souche de levure pour la production d'éthanol

Country Status (1)

Country Link
WO (1) WO2024097243A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015099727A1 (fr) * 2013-12-26 2015-07-02 Hill's Pet Nutrition, Inc. Levure hautement nutritive
WO2022216622A1 (fr) * 2021-04-05 2022-10-13 Ab Mauri Développement d'une souche de levure pour la production d'éthanol

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015099727A1 (fr) * 2013-12-26 2015-07-02 Hill's Pet Nutrition, Inc. Levure hautement nutritive
US20160326484A1 (en) * 2013-12-26 2016-11-10 Hill's Pet Nutrition, Inc. High nutrient yeast
WO2022216622A1 (fr) * 2021-04-05 2022-10-13 Ab Mauri Développement d'une souche de levure pour la production d'éthanol

Similar Documents

Publication Publication Date Title
EP1766007B1 (fr) Souches de saccharomyces non recombinantes croissant sur du xylose
Brooks Ethanol production potential of local yeast strains isolated from ripe banana peels
US20120309069A1 (en) Yeast for Fermentation
US8980617B2 (en) Yeast strains for improved ethanol production
Morais et al. Production of ethanol and xylanolytic enzymes by yeasts inhabiting rotting wood isolated in sugarcane bagasse hydrolysate
EP0066396A1 (fr) Fermentation directe de d-xylose en éthanol par une levure mutée capable de fermenter le xylose
TWI450963B (zh) 具高木醣消耗率之分離酵母菌株及使用該菌株製造酒精之方法
US20100291649A1 (en) Control of contaminant yeast in fermentation processes
US20240182930A1 (en) Yeast strain development for ethanol production
KR101230638B1 (ko) 내열성 및 에탄올 생산성이 우수한 클루이베로마이세스 마르샤너스 균주
WO2024097243A1 (fr) Développement d'une souche de levure pour la production d'éthanol
US9127323B2 (en) Isolated yeast strain having high xylose consumption rate and process for production of ethanol using the strain
US8609382B1 (en) Scheffersomyces stipitis strain for increased ethanol production and uses thereof
WO2022201197A1 (fr) Souche de levure mutante pour la production d'alcool et son procédé de production
Ozioko et al. Isolation and Characterization of Local Yeast Strains from Fermented African Breadfruits for Use in Pentose Sugars Fermentation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23886649

Country of ref document: EP

Kind code of ref document: A1