WO2024096125A1

WO2024096125A1 - Method for designing or producing bacterial preparation containing microorganism having desired pharmacological efficacy

Info

Publication number: WO2024096125A1
Application number: PCT/JP2023/039720
Authority: WO
Inventors: 亮奥村; 清和岩田; 華歩倉本; 翔子宮崎; 新太郎吉良; 仁志光延; 南部由美子西田
Original assignee: 株式会社バイオパレット
Priority date: 2022-11-04
Filing date: 2023-11-02
Publication date: 2024-05-10

Abstract

The present disclosure provides a technique for efficiently designing or producing a bacterial preparation utilizing a bacterium capable of exhibiting a desired trait or a desired efficacy. More specifically, the present disclosure provides a method for designing or producing a bacterial preparation containing a microorganism having a desired pharmacological efficacy in a subject, the method comprising: a step of selecting or screening for at least one gene associated with the pharmacological efficacy; a step of modifying the gene; a step of selecting a microorganism in which the expression level of the gene is altered and/or a microorganism in which the function of a protein produced by the gene is modified; a step of confirming whether or not the selected microorganism has the desired pharmacological efficacy and then selecting a microorganism having the pharmacological efficacy; and an optional step of producing a mass containing the microorganism having the desired pharmacological efficacy if necessary.

Description

Methods for designing or producing bacterial formulations containing microorganisms with desired therapeutic effects

The present disclosure relates to methods for designing or producing bacterial formulations that contain microorganisms that have a desired therapeutic effect in a subject.

In recent years, attempts have been made to develop pharmaceutical preparations consisting of single or multiple bacteria for the treatment and prevention of a wide range of diseases, including various infectious diseases, ulcerative colitis, and cancer, and numerous bacterial species have been tested. Such bacterial preparations can be made not only using wild-type bacteria, but also by modifying the genes of wild-type bacteria to give them the desired traits, and then using bacteria carrying the modified genes to make bacterial preparations. Therefore, there is a demand for efficient design and production methods for bacterial preparations that use bacteria that have the desired traits or effects.

In today's field of biological products, from antibody preparations to gene therapy, we do not simply use what nature has provided us with, but rather constantly use gene modification technology to improve therapeutic efficacy and safety, leading to the development of more powerful and more specific biological products. Similarly, it is difficult for microbiome therapeutic products to combine the desired efficacy and safety simply by utilizing wild-type bacteria that exist in nature, and so there is a need to develop base-edited LBP preparations that utilize optimal base editing technology.

Thus, the present disclosure provides:
(Item 1)
1. A method for designing or producing a bacterial formulation comprising a microorganism having a desired therapeutic effect in a subject, comprising:
selecting or screening at least one gene associated with said therapeutic effect;
modifying the gene;
selecting a microorganism in which the expression level of the gene and/or the function of the protein produced by the gene is modified;
A step of confirming whether the selected microorganism has the desired medicinal effect and selecting a microorganism having the medicinal effect;
and optionally generating a population comprising said microorganism having said desired therapeutic effect.
(Item 2)
The method according to item 1, wherein the selection or screening of the gene comprises screening using a database and/or a genome library.
(Item 3)
The method according to any one of items 1 to 2, wherein the modification comprises genome editing.
(Item 4)
4. The method according to any one of items 1 to 3, wherein the modification comprises a point mutation in the gene.
(Item 5)
5. The method according to any one of items 1 to 4, wherein the modification comprises a mutation that generates a stop codon.
(Item 5a)
The method according to any one of items 1 to 5, wherein the modification comprises genome editing without cleavage of the target nucleic acid molecule.
(Item 6)
6. The method according to any one of items 1 to 5, wherein the modification comprises at least two mutations in the at least one gene.
(Item 7)
The method according to any one of items 1 to 6, wherein the selection of a microorganism having a medicinal effect comprises use of a drug gene resistance system, use of an essential gene (auxotrophic marker), use of a gene encoding an enzyme that catalyzes a color reaction, or use of temperature tolerance.
(Item 8)
The method according to any one of items 1 to 7, wherein the confirmation of the desired drug effect includes utilization of a drug gene resistance system, an enzyme activity based on the drug effect, a survival activity based on the drug effect, and/or a fixability of the microorganism in the subject.
(Item 9)
14. The method according to any one of items 1 to 13, wherein the genes include genes associated with at least one disease or function selected from the group consisting of inflammatory bowel disease, Parkinson's disease, cancer immunity, dental caries, and periodontal disease.
(Item 10)
15. The method according to any one of items 1 to 14, wherein the microorganism comprises Escherichia coli.

It is contemplated that one or more of the features described above may be provided in combinations other than those explicitly stated. Further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary.

Furthermore, the features and notable actions and effects of the present disclosure other than those described above will become clear to those skilled in the art by referring to the following description of the embodiments of the invention and the drawings.

　With the present disclosure, by utilizing microorganisms that have been modified in a specific manner, it is possible to design or produce bacterial preparations that contain microorganisms that have a desired medicinal effect in a subject, and this also makes it possible to efficiently produce bacterial preparations for various diseases.

In addition, by designing the efficacy of a drug, it is possible to adjust the strength of the drug's efficacy (and its duration in the body), which not only improves the therapeutic effect but also makes it easier to predict the drug's efficacy in humans. If the strength of the drug's efficacy can be clearly improved, it will also have the effect of making it easier to set the endpoints of clinical trials.

Furthermore, if the strength of the drug's efficacy can be stabilized by improving its efficacy and suppressing the emergence of revertant mutants, it will be possible to reduce variation between production lots and make it easier to set biomarkers during clinical trials.

FIG. 1-1 is a graph showing the results of a growth test of base-edited E. coli obtained by a method according to one embodiment of the present disclosure. FIG. 1-2 is a graph showing the results of a Congo Red staining experiment of CsgA in base-edited E. coli obtained by a method according to one embodiment of the present disclosure. 1-3 show the results of Western blotting of CsgA in base-edited E. coli obtained by a method according to one embodiment of the present disclosure. 1-4 are transmission electron microscope images of base-edited E. coli obtained by a method according to one embodiment of the present disclosure. 1-5 show the results of a Congo Red staining test of CsgA oligomers and a CsgA-CsgB intercellular complementation test for base-edited E. coli obtained by a method according to one embodiment of the present disclosure. Figures 1-6 show the results of inhibiting CsgA oligomerization in base-edited E. coli obtained by a method according to one embodiment of the present disclosure. Figures 1-7 show the results of inhibiting CsgA oligomerization in base-edited E. coli obtained by a method according to one embodiment of the present disclosure. Figures 1-8 show the results of inhibiting CsgA oligomerization in base-edited E. coli by using a sigma factor gene group, a catabolite repressor gene group, and a two-component regulatory system gene group in one embodiment of the present disclosure. Figure 2-1 shows the genome editing sites of a microorganism obtained by a method in one embodiment of the present disclosure, its growth curve, and fimH binding strength. Figure 2-2 is a graph showing the results of a mannose bead binding test for the genome-edited strains BP3019, BP3021, and BP3026 obtained by a method according to one embodiment of the present disclosure. Figure 2-3 is a graph showing the results of a mannose bead binding test for the BP3019, BP3021, and BP3026 strains, which are genome-edited strains according to one embodiment of the present disclosure, compared to Sibofimloc in one embodiment of the present disclosure. Figures 2-4 are graphs showing the results of adhesion and invasion tests of genome-edited strains obtained by a method according to an embodiment of the present disclosure against T84 cells. Figure 2-5 is a graph showing the DAI score when the BP3026 strain, a genome-edited strain obtained by a method according to one embodiment of the present disclosure, was administered to mice. Figure 2-6 is a graph showing the measurement results of intestinal length when the BP3026 strain, a genome-edited strain obtained by a method according to one embodiment of the present disclosure, was administered to mice. FIG. 2-7 is a graph showing the results of an intestinal microbiota analysis according to one embodiment of the present disclosure. Figure 2-8 is a graph showing the results of a mannose bead binding test using a genome-edited strain of a two-component regulatory system gene group in one embodiment of the present disclosure. FIG. 3-1 shows the results of genome editing sites in a microorganism obtained by a method according to one embodiment of the present disclosure and its TLR5 activation ability. FIG. 3-2 shows the results of genome editing sites in a microorganism obtained by a method according to one embodiment of the present disclosure and its TLR5 activation ability. FIG. 3-3 is a photograph of electrophoresis confirming the expression of Flagellin in a microorganism obtained by the method according to one embodiment of the present disclosure. FIG. 4-1 is a graph showing the results of evaluating the biofilm formation of microorganisms obtained by a method according to one embodiment of the present disclosure.

The present disclosure will be described below while showing the best mode. Throughout this specification, singular expressions should be understood to include the concept of the plural, unless otherwise specified. Thus, singular articles (e.g., in the case of English, "a," "an," "the," etc.) should be understood to include the concept of the plural, unless otherwise specified. In addition, terms used in this specification should be understood to be used in the sense commonly used in the field, unless otherwise specified. Thus, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. In the case of conflict, the present specification (including definitions) will take precedence.

The following provides definitions of terms specifically used in this specification and/or provides an explanation of basic technical content as appropriate.

In this specification, "about" means ±10% of the numerical value that follows.

In this specification, "microorganisms" refers to minute living organisms, including prokaryotes such as bacteria and actinomycetes, eukaryotes such as yeast and mold, lower algae, fungi, viruses, and even individual, separate cells of multicellular organisms such as animals and plants. Microorganisms also include natural microorganisms, as well as those cultured and artificially propagated, mutated microorganisms, and microorganisms artificially modified by transformation or other techniques.

In this specification, "modification" of a gene means that a nucleotide (e.g., dC) on a DNA strand is converted to another nucleotide (e.g., dT, dA, or dG) or deleted, or that a nucleotide or nucleotide sequence is inserted or added between certain nucleotides on a DNA strand. In this specification, "modification" includes the substitution or deletion of one or more nucleotides at a targeted site of double-stranded DNA, or the insertion or addition of one or more nucleotides at a targeted site of double-stranded DNA. Here, the double-stranded DNA to be modified is not particularly limited, but is preferably genomic DNA. In addition, the "targeted site" of double-stranded DNA means all or a part of the "target nucleotide sequence" that the nucleic acid sequence recognition module specifically recognizes and binds to, or the vicinity of the target nucleotide sequence (either one or both of the 5' upstream and 3' downstream), and the range can be appropriately adjusted between one base and several hundred bases in length depending on the purpose.

In this specification, "gene" is interpreted in the broadest sense and refers to a character string of nucleic acid or a sequence of a substance that carries it (e.g., nucleotides such as DNA or RNA), and preferably refers to a sequence or a substance that contains a sequence that exerts some function, and includes, for example, those that code for proteins, as well as adjacent transcriptional regulatory regions such as promoters and enhancers that control the timing and amount of transcription of the transcript as a transcription factor binding site, and adjacent transcriptional regulatory regions such as promoters and enhancers that control the timing and amount of transcription of the transcript as a transcription factor binding site.

In this specification, the term "bacterial preparation" refers to a powder or liquid preparation containing a group of useful microorganisms, which is expected to exert a medicinal effect alone or in combination with other substances. Examples of the form of the bacterial preparation include, but are not limited to, oral capsules, tablets (for oral use), enema preparations, gargling liquids, and skin smears (ointments). Furthermore, the bacterial preparation may contain one or more types of microorganisms.

In this specification, "pharmaceutical effect" is interpreted in the broadest sense and refers to any biological effect brought about on a subject. A medicinal effect can be recognized as a change in some biological phenomenon or phenomenon caused by a biological effect in a subject. Typically, this includes, but is not limited to, improvement of a disease state and maintenance or improvement of health status through biological components such as probiotics.

As used herein, the term "gene associated with drug efficacy" refers to a gene that has some direct or indirect effect on drug efficacy. A gene associated with drug efficacy may be, for example, a gene associated with a disease, or a gene associated with a function that maintains health, such as immune function. Examples of genes associated with drug efficacy include the following genes:
(1) Causative gene of a disease → a biosynthetic gene for a substance toxic to the host (treatment method: a strain of bacteria that has been knocked out and rendered non-functional is administered into the body to replace the toxic bacteria);
(2) Biosynthetic genes of substances that contribute to treatment or are beneficial to health → enzyme genes derived from bacteria that can treat diseases or alleviate symptoms (treatment method: improving the expression level or enzyme activity of the gene);
(3) Genes that degrade disease-causing or toxic substances: Enzyme genes derived from bacteria that can decompose or neutralize substances that are toxic to the host (treatment method: improve the expression level or enzyme activity of the gene); and (4) Genes that improve the host's immunity by improving immune activity or vaccine effect: Antimicrobial drugs (single or combined agents) and cancer immunotherapy (single or combined agents) are envisioned (treatment method: improve the expression level or enzyme activity of the gene).

In this specification, "design," when referring to, for example, a target microorganism or bacterial preparation, means to newly design it or provide a blueprint for it.

In this specification, "function of a protein" refers not only to the main function of the protein, but also to any function exerted by the protein.

In this specification, "modifying" the function of a gene refers to the act of directly or indirectly changing the function of the original gene before modification.

Preferred Embodiments
Preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can make appropriate modifications within the scope of the present disclosure in consideration of the description in this specification. In addition, the following embodiments of the present disclosure can be used alone or in combination.

In one aspect of the present disclosure, there is provided a method for designing or producing a bacterial preparation containing a microorganism having a desired medicinal effect in a subject, the method comprising the steps of selecting or screening at least one gene associated with the medicinal effect, modifying the gene, selecting a microorganism in which the expression level of the gene is modified and/or the function of a protein produced by the gene is modified, confirming whether the selected microorganism has the desired medicinal effect, selecting a microorganism having the medicinal effect, and, if necessary, generating a population containing the microorganism having the desired medicinal effect. The method of the present disclosure is useful as a design technique for a bacterial preparation with a desired effect.

Regarding the use of modified microorganisms as bacterial preparations, a notice was issued in 2020 on the handling of pharmaceutical-related organisms obtained using genome editing technology. This notice requires that even if it is determined that the organism is not subject to the Cartagena Protocol (i.e., even if the final organism does not contain nucleic acids processed outside the cell), if it is determined that there is a risk of an impact on biodiversity, necessary measures must be taken to prevent the impact on biodiversity. The impact on biodiversity refers to the assessment of whether the target organism has an advantage over competing organisms when it is discharged from the body, or the presence or absence of wild animals and plants that may be affected. Identifying and notifying such risks in advance may be required to start clinical trials. For this reason, in order for microbial preparations using genome editing technology to be used not only in clinical trials but also in actual clinical practice, it is considered most realistic to be able to clearly indicate information on non-proliferation after discharge from the body (survival conditions, survival time, etc.).

In one embodiment, the step of selecting or screening at least one gene associated with a medicinal effect can be carried out as follows. The step of selecting at least one gene associated with a medicinal effect can be carried out, for example, by using a genomic library to compare clones that have each gene with clones that do not have the gene to select clones that have the desired medicinal effect.

In the case of microbiome drug discovery, the target gene for the target disease and the bacteria are often genes whose correspondence between the two has been validated, and can be selected from database information such as literature, academic societies, and patents. Therefore, in one embodiment, based on the above information sources, at least one gene related to drug efficacy can be selected or screened using a so-called "reverse translational research" method that searches for drug discovery targets starting from large-scale human clinical findings. When screening from a genome library, it is necessary to efficiently verify the relationship with the disease by determining whether the hit target gene has been validated in human clinical trials.

The process of selecting or screening at least one gene related to drug efficacy includes, for example, searching for drug efficacy-related genes in silico using a database based on information from literature, academic societies, patents, etc.

In one embodiment, the step of modifying a gene can be carried out by any method. Representative methods include classical mutation methods such as ultraviolet light, conventional molecular biology techniques, and genome editing techniques, and so-called non-cutting genome editing (genome editing that does not involve cutting the target nucleic acid molecule) can be preferably used.

In one embodiment of the present disclosure, the modification in the method of the present disclosure may include point mutations in the target gene, as well as the insertion of a gene related to drug efficacy.

In one embodiment, the step of selecting microorganisms with altered gene expression levels and/or altered functions of proteins produced by the genes can be achieved by any test method related to the function or by testing microorganisms with the function. Such techniques include measurement of the amount of target gene transcription (RNA amount), analysis of protein expression levels (including specific staining of target proteins), measurement of transcription activity such as reporter assays, migration tests, examination of growth curves (aerobic, anaerobic), and/or morphological observations under an electron microscope.

In one embodiment, the step of determining whether the selected microorganism has the desired efficacy and selecting the microorganism having the efficacy can be performed by any method capable of directly or indirectly measuring efficacy. Such techniques can include measurement of enzyme activity, adhesion tests to human or animal cells and tissues, analysis of bacterial interactions (e.g., biofilms), and/or behavior, biological response evaluation, or efficacy evaluation after administration to animals (wild type or disease model).

In one embodiment, the step of generating a population containing the microorganism having the desired therapeutic effect can use any method that can grow and/or culture the microorganism.

In one embodiment, the selection of microorganisms with medicinal properties can be performed by using a drug gene resistance system, an essential gene (auxotrophic marker), a gene that encodes an enzyme that catalyzes a color reaction (e.g., the lacZ gene), or a temperature tolerance method.

In one embodiment, confirmation of the desired pharmacological effect of the microorganism obtained by the method of the present disclosure can include the use of a drug gene resistance system, an enzyme activity based on the pharmacological effect, a survival activity based on the pharmacological effect, a migration activity of the microorganism, a fixability of the microorganism in the subject, a cell adhesion activity of the microorganism, an adhesion activity of the microorganism to a mucin layer, a fixation activity of the microorganism in an animal tissue, etc.

In one embodiment, the conditions for generating a population containing a microorganism having a desired therapeutic effect are not particularly limited as long as the microorganism can grow and/or amplify. When producing a bacterial formulation, for example, by comparing the growth curve under aerobic and/or anaerobic conditions with that of a wild-type strain (parent strain), it is possible to avoid clones that are difficult to mass-cultivate, which is an issue in formulation.

In one embodiment, the at least one gene related to medicinal efficacy can be selected based on examples of "disease-bacteria" combinations that contribute to the treatment of a disease by modifying the function of a bacterium presumed to be the cause of the disease. For example, the at least one gene related to medicinal efficacy can include a gene related to at least one disease or function selected from the group consisting of inflammatory bowel disease, Parkinson's disease, cancer immunity, dental caries, and periodontal disease.

In one embodiment, the at least one gene related to the medicinal effect can include, for example, a gene related to at least one disease or function selected from the group consisting of various cancers (in combination with immune checkpoint inhibitors), digestive diseases (inflammatory bowel diseases (irritable bowel syndrome, Crohn's disease, etc.)), neurodegenerative diseases (Parkinson's disease, etc.), psychiatric diseases, autoimmune diseases, infectious diseases, metabolic diseases, respiratory diseases, liver diseases, cardiovascular diseases, oral diseases, skin diseases, and vaginitis.

In one embodiment, the method of the present disclosure can design or produce a bacterial preparation containing a microorganism having a desired medicinal effect for use in the treatment or prevention of tumors. Examples of tumor treatment or prevention include radiotherapy, molecular targeted drugs, and cancer immunotherapy using immune checkpoint inhibitors. It is known that activation of Toll-Like Receptor 5 (TLR5) is involved in immune responses and anti-tumor functions. In one embodiment, the method of the present disclosure can design or produce a bacterial preparation containing a microorganism that regulates or improves the activation ability of TLR5 in a host by modifying at least one gene related to the activation ability of TLR5.

The microorganisms obtained by the method disclosed herein are useful as a microbiome drug discovery technology that enhances the effectiveness of cancer immunotherapy using immune checkpoint inhibitors.

In one embodiment, the disclosed method can design or produce a bacterial preparation containing a microorganism having a desired medicinal effect for use in the treatment or prevention of an inflammatory disease. The inflammatory disease may be any disease that exhibits inflammatory symptoms, such as inflammatory bowel disease, lymphoproliferative disease, autoimmune disease, and autoinflammatory disease. Inflammatory bowel disease includes two diseases, Crohn's disease (CD) and ulcerative colitis (UC). Both of these diseases are known to cause accumulation of inflammatory macrophages. In one embodiment, the disclosed method can design or produce a bacterial preparation containing a microorganism that reduces the accumulation of inflammatory macrophages in a host by modifying at least one gene associated with the reduction of inflammatory macrophage accumulation.

The microorganisms obtained by the method of the present disclosure can suppress inflammation, reduce the accumulation of inflammatory macrophages, and/or reduce the accumulation of inflammatory cytokines in a host. Thus, the microorganisms obtained by the method of the present disclosure are useful as bacterial therapeutic preparations in the treatment of inflammatory diseases such as inflammatory bowel disease (IBD), including Crohn's disease (CD) and ulcerative colitis (UC), celiac disease, primary sclerosing cholangitis, cystitis, and pyelonephritis.

In one embodiment, the disclosed method can design or produce a bacterial preparation containing a microorganism with a desired medicinal effect for use in the treatment or prevention of brain diseases. Examples of brain diseases include Parkinson's disease (PD), multiple system atrophy (MSA), and dementia with Lewy bodies, all of which are known to have a common accumulation of intracellular aggregates composed mainly of toxic oligomers of α-synuclein. In one embodiment, by modifying at least one gene related to the inhibition of α-synuclein aggregation, the disclosed method can design or produce a bacterial preparation containing a microorganism that inhibits α-synuclein aggregation in a host.

The microorganism obtained by the method disclosed herein inhibits α-synuclein aggregation in the host and is useful as a bacterial therapeutic agent for Parkinson's disease (PD), multiple system atrophy (MSA), or dementia with Lewy bodies (DLB), etc.

In one embodiment, in the method of the present disclosure, the modification of at least one gene in the microorganism can be performed using standard molecular biology techniques. In one embodiment, the modification can include a point mutation in the gene, and a method for site-specifically and precisely modifying the target double-stranded polynucleotide can be, for example, a method of contacting the target double-stranded polynucleotide with a Cas protein and a guide RNA, or a method of contacting the target double-stranded polynucleotide with a complex of a Cas protein and a nucleic acid base conversion enzyme and a guide RNA. In such a method, the Cas9 protein forms a complex with the guide RNA and binds to the target double-stranded polynucleotide. Here, the Cas9 protein modifies the base sequence in the target polynucleotide by not cleaving the target double-stranded polynucleotide or by cleaving only one strand, i.e., without causing a double-stranded cleavage. In one embodiment, the modification is preferably performed in single-base units.

In one embodiment, the specific and precise modification of the single base unit (single base editing) is preferably performed using a nucleic acid base conversion enzyme in the complex. Examples of the nucleic acid base conversion enzyme include deaminases. Examples of deaminases that can be used include cytosine deaminase, cytidine deaminase, adenosine deaminase, and the like. In addition to the nucleic acid base conversion enzyme, the complex in one embodiment may contain an Indel formation inhibitor such as uracil DNA glycosylase inhibitor (UGI) to inhibit Indel formation.

In one embodiment, the specific and precise modification of the single base unit (single base editing) can also be achieved by using a method using a complex of a nucleic acid sequence recognition module and DNA glycosylase. When a complex of a nucleic acid sequence recognition module and DNA glycosylase is expressed from an expression vector or RNA molecule introduced into a cell, the nucleic acid sequence recognition module specifically recognizes and binds to a target nucleotide sequence in a double-stranded DNA of interest (e.g., genomic DNA), and the action of the DNA glycosylase linked to the nucleic acid sequence recognition module causes an abasic reaction in the sense or antisense strand of the targeted site (which can be appropriately adjusted within a range of several hundred bases including all or part of the target nucleotide sequence or their vicinity), resulting in an abasic site (AP site) in one strand of the double-stranded DNA. Then, the base excision repair (BER) system in the cell is activated, and first, an AP endonuclease recognizes the AP site and cuts the phosphate bond of one strand of DNA, and an exonuclease removes the abasic nucleotide. Next, a DNA polymerase inserts a new nucleotide using the opposite strand DNA as a template, and finally, a DNA ligase repairs the splice. When a repair error occurs at any stage of this BER, various mutations are introduced. As mentioned above, by using a mutant AP endonuclease that has lost its enzymatic activity but retains the ability to bind to AP sites, the BER mechanism in the cell is inhibited, and the frequency of repair errors, and therefore the efficiency of mutation introduction, can be improved.

The CRISPR-Cas system recognizes the sequence of a double-stranded DNA of interest using a guide RNA complementary to the target nucleotide sequence, and therefore any sequence can be targeted simply by synthesizing an oligo-RNA and/or oligo-DNA capable of specifically hybridizing with the target nucleotide sequence. Moreover, at the targeted site, the double-stranded DNA is unwound to generate a single-stranded region and an adjacent region having a loosened double-stranded DNA structure, so that a nucleic acid base conversion enzyme or DNA glycosylase can be efficiently acted on the targeted site specifically without combining a factor that changes the structure of the double-stranded DNA. Therefore, in a more preferred embodiment of the present disclosure, a CRISPR-Cas system that does not have at least one DNA cleavage ability of Cas (CRISPR-mutant Cas) or a CRISPR-Cas system that does not have both DNA cleavage abilities of Cas (CRISPR-mutant Cas) can be preferably used as the nucleic acid sequence recognition module.

The nucleic acid sequence recognition module of the present disclosure using CRISPR-mutant Cas is provided as a complex of an RNA molecule consisting of a guide RNA complementary to a target nucleotide sequence and a tracrRNA required for recruiting the mutant Cas protein, and the mutant Cas protein.

In one embodiment, the modification can be performed in any environment, in vivo or in vitro. In one embodiment, the modification can also be performed outside the body, i.e., ex vivo or in vitro.

In one embodiment of the present disclosure, the modification of at least one gene in the microorganism used in the method of the present disclosure can include a mutation that generates a stop codon by the method described above.

In one embodiment of the present disclosure, the modification of at least one gene in the microorganism used in the method of the present disclosure can include at least 2, 3, 4, 5, 6, 7, or 8 mutations in a gene.

In one embodiment of the present disclosure, modification of at least one gene in a microorganism used in the method of the present disclosure is preferably performed by base editing, preferably single base editing.

In one embodiment of the present disclosure, the modification of at least one gene in the microorganism used in the method of the present disclosure can include at least one mutation in each of at least two types of genes. In another embodiment, the modification of at least one gene in the microorganism used in the method of the present disclosure can include at least two mutations in each of at least two types of genes.

In one embodiment, microorganisms that can be used in the methods of the present disclosure include, for example, members of the phyla of Escherichia coli, Lactococcus lactis, Bacteroidetes, Firmicutes, Actinobacteria, Proteobacteria, Fusobacteria, or Verrucomicrobia, as well as members of the phyla of Bacteroides, Alistipes, Faecalis bacterium, Parabacteroides, Prevotella, and the like. Prevotella, Roseburia, Ruminococcus, Clostridium, Oscillibacter, Gemmiger, Barnesiella, Dialister, Parasutterella ), Phascolarctobacterium, Propionibacterium, Sutterella, Blautia, Paraprevotella, Coprococcus, Odoribacter, Spiropla Spiroplasma, Anaerostipes, Ackermansia, Lactobacillus, Streptococcus, Bifidobacterium, Ackermansia, Megasphaera aera), Eubacterium, Bariatricus, Erysipelatoclostridium, Pediococcus, Enterococcus, Pseudoflavonifractor, Lachnospira Family Lachnospiraceae, Family Erysipelotrichaceae, Family Oscillospiraceae, Family Faecalicatena, Enterococcus casseliflavus, Enterococcus gallinarum, Enterococcus faecalis, Enterococcus hirae, Enterococcus mundtii, Lactiplantibacillus plantarum, Lactobacillus gasseri, Ackermansia muciniphila, Faecalibacterium prausnitzii, Bifidobacterium spp. , Bifidobacterium animalis, Bifidobacterium breve, Streptococcus cristatus, Streptococcus gordonii, Streptococcus mutans, Streptococcus salivarius, Staphylococcus aureus, Staphylococcus epidermidis, Porphyromonas gingivalis, Clostridium acetobutylicum, Clostridium butyricum, Clostridium sporogenes, Clostridium cocleatum, Clostridium saccharogumia, Clostridium spiroforme, Clostridium innocuum, Clostridium ramosum, Clostridium hathewayi, Clostridium saccharolyticum, Clostridium sindens, Clostridium sp. , Clostridium bolteae, Clostridium indolis, Clostridium lavalense, Clostridium asparagiforme, Clostridium symbiosum, Clostridiales bacterium, Fusobacterium nucleatum, Blautia hydrogenotrophic a, Blautia stercoris, Blautia wexlerae, Blautia producta, Blautia coccoides, Blautia hansenii, Blautia faecis, Blautia glucea, Blautia luti, Blautia schinkii, Megasphaera massiliensis, Megasp haera elsdenii, Megasphaera cerevisiae, Megasphaera indica, Megasphaera paucivorans, Megasphaera sueciensis, Megasphaera micronuciformis, Megasphaera hexanoica, Eubacterium contortum, Eubacter Eubacterium fissicatena, Eubacterium limosum, Eubacterium rectale, Eubacterium aerofaciens, Eubacterium callanderi, Eubacterium eligens, Eubacterium hallii, Bariatricus massiliensis, Anaerostipes ha drus, Anaerostipes butyraticus, Anaerostipes rhamnosivorans, Anaerostipes caccae, Anaerotruncus colihominis, Faecalicatena fissicatena, Faecalicatena contorta, Erysipelatoclostridium ramosum , Parabacteroides distasonis, Parabacteroides merdae, Parabacteroides goldsteinii, Parabacteroides johnsonii, Pediococcus acidilactici, Pediococcus cellicola, Pediococcus claussenii, Pediococcus us damnosus, Pediococcus ethanolidurans, Pediococcus inopinatus, Pediococcus parvulus, Pediococcus pentosaceus, Pediococcus stilesii, Roseburia hominis, Roseburia intestinalis, Roseburia faecii s, Roseburia massiliensis, Roseburia ceicola, Roseburia inulinivorans, Bacteroides coprocola, Bacteroides thetaiotaomicron, Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides sp. , Pseudoflavonifractor capillosus, Lachnospiraceae bacterium, Lachnospiraceae sp. , Erysipelotrichaceae bacterium, Ruminococcus sp., Oscillospiraceae bacterium, Oscillibacter valericigenes, and Lactobacillus reuteri.

In one embodiment, the microorganisms that can be used in the methods of the present disclosure can inhabit the gut, oral cavity, and/or skin of a subject, for example, from a genus that constitutes at least about 0.1%, at least about 0.5%, at least about 1%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, or at least about 40% of the total culturable microorganisms in the subject's feces. The microorganisms in the subject's gut or feces can be analyzed by any technique known in the art, including 16S ribosomal sequencing. For example, Bacteroides is the most naturally abundant genus in the human gut, and exemplary Bacteroides species include B. acidifaciens, B. amylophilus, B. asaccharolyticus, B. spp. ... B. barnesiaes, B. bivius, B. buccae, B. buccalis, B. caccae, B. caecicola, B. caecigallinarum, B. capillosus, B. capillus, B. cellulosilyticus, B. cellulosolvens, B. chinchilla, B. clarus, B. B. coagulans, B. coprocola, B. coprophilus, B. coprosuis, B. corporis, B. denticola, B. disiens, B. distasonis, B. dorei, B. eggerthii, B. endodontalis, B. faecichinchillae, B. faecis, B. cephalosporin ... B. finegoldii, B. fluxus, B. forsythus, B. fragilis, B. furcosus, B. galacturonicus, B. gallinaceum, B. gallinarum, B. gingivalis, B. goldsteinii, B. gracilis, B. graminisolvens, B. helcogenes, B. B. heparinolyticus, B. hypermegas, B. intermedius, B. intestinalis, B. johnsonii, B. levvi, B. loescheii, B. luti, B. macacae, B. massiliensis, B. melaninogenicus, B. merdae, B. microfusus, B. B. multiacidus, B. nodosus, B. nordii, B. ochraceus, B. oleiciplenus, B. oralis, B. oris, B. aurorum, B. ovatus, B. paurosaccharolyticus, B. pectinophilus, B. pentosaceus, B. plebeius, B. B. pneumosintes, B. polypragmatus, B. praeactus, B. propionicifaciens, B. putredinis, B. pyogenes, B. reticulothermitis, B. rodentium, B. ruminicola, B. salanitronis, B. salivosus, B. saliersiae, B. B. sartorii, B. sediment, B. splanchnicus, B. stercoris, B. stercoris, B. succinogenes, B. suis, B. tectus, B. termitidis, B. thetaiotaomicron, B. ureformis, B. uniformis, B. ureolyticus, B. veroralis, B. Examples of bacteria that may be present include B. vulgatus, B. xylanisolvens, B. xylanolyticus, and B. zoogleofonnans. Examples of bacteria that may be present in the oral cavity include Streptococcus gordonii, Streptococcus mutans, and Streptococcus salivarius, and examples of bacteria that may be present in the skin include Staphylococcus aureus and Staphylococcus epidermidis.

In one embodiment, the microorganisms obtained by the methods of the present disclosure are capable of stably colonizing the human intestine, oral cavity, and/or skin. The microorganisms obtained by the methods of the present disclosure are capable of colonizing the intestine of a subject with increased abundance, stability, or ease of initial colonization in the intestine, for example, as compared to the same or similar microorganisms that have not been modified.

In one embodiment, the microorganism obtained by the method of the present disclosure may further include a gene related to a therapeutic agent. Such a gene related to a therapeutic agent may be one that the microorganism originally possesses, or a gene that exerts a desired effect may be introduced as is or with a partial modification. In one embodiment, the gene related to a therapeutic agent may be a type 1 fimbrin D-mannose specific adhesin (fimH) or the like. In one embodiment, the microorganism obtained by the method of the present disclosure may further include a gene related to a diagnostic agent. Such a gene related to a diagnostic agent may be one that the microorganism originally possesses, or a gene that exerts a desired effect may be introduced as is or with a partial modification. In one embodiment, the gene related to a diagnostic agent may be a bacterial actin-like cytoskeleton protein (cell shape-determining protein (mreB)) or the like. In one embodiment, the microorganism obtained by the method of the present disclosure may further include a gene related to a colonization property. Such a gene related to a colonization property may be one that the microorganism originally possesses, or a gene that exerts a desired effect may be introduced as is or with a partial modification. In one embodiment, the gene associated with fixation can be the DNA-binding transcriptional activator flhD.

In one embodiment, the transgene can inhibit functional expression of the target protein by the effect of a stop codon introduced as a result of single base editing. When a microorganism contains genes or nucleic acids encoding multiple proteins, it is contemplated that open reading frames encoding two or more of the proteins can be present, for example, in a single operon.

In one embodiment of the present disclosure, the microorganism obtained by the method of the present disclosure can be used as a therapeutic preparation, and such a therapeutic preparation can contain, for example, a therapeutically effective amount of the microorganism of the present disclosure, for example, at least about 0.01%, about 0.05%, about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.5%, about It may contain 2.0%, about 3.0%, about 4.0%, about 5.0%, about 6.0%, about 7.0%, about 8.0%, about 9.0%, about 10.0%, about 11.0%, about 12.0%, about 13.0%, about 14.0%, about 15.0%, about 16.0%, about 17.0%, about 18.0%, about 19.0%, about 20.0%, about 25.0%, about 30.0%, about 35.0%, about 40.0%, about 45.0%, about 50.0% or more.

In one embodiment of the present disclosure, the microorganisms obtained by the method of the present disclosure can be used to perform microbial replacement by administering base-edited microorganisms created by ex vivo editing into a patient's body, and can respond to the treatment of various diseases.

In another aspect, a system and/or an apparatus for implementing the method of the present disclosure is provided.

(General Technology)
The molecular biological techniques, biochemical techniques, and microbiological techniques used herein are well known and commonly used in the art, and may be selected from those described in, for example, Sambrook J. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F. M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F. M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, M. A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F. M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F. M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M. A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F. M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; Sninsky, J. J. et al. (1999). These are described in, for example, PCR Applications: Protocols for Functional Genomics, Academic Press, Special Edition of Experimental Medicine, "Gene Introduction & Expression Analysis Experimental Methods," Yodosha, 1997, the relevant portions of which (possibly in their entirety) are incorporated herein by reference.

For DNA synthesis technology and nucleic acid chemistry to create artificially synthesized genes, gene synthesis and fragment synthesis services such as GeneArt, GenScript, Integrated DNA Technologies (IDT) can be used, and other references include, for example, Gait, M. J. (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, M. J. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R. L. et al. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G. M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G. T. (1996). Bioconjugate Techniques, Academic Press, etc., the relevant portions of which are incorporated herein by reference.

In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when it is specified that "within the range" of "two values," the range includes the two values themselves.
All references cited herein, including scientific literature, patents, patent applications, and the like, are hereby incorporated by reference in their entirety to the same extent as if each was specifically set forth.

The present disclosure has been described above by showing preferred embodiments for ease of understanding. Below, the present disclosure will be described based on examples, but the above description and the following examples are provided for illustrative purposes only and are not provided for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims.

Example 1: Drug for treating Parkinson's disease
(Example 1-1: Inhibition of CsgA oligomerization by modification of the curli pilus operon gene cluster)
In this example, a base-edited strain was created by inserting a single stop codon into each of the csgA, csgE, and csgG genes using the E. coli ATCC47076 strain. The guide RNA was selected from the most N-terminal of the possible design positions. Specifically, a stop codon was introduced into the 72nd amino acid of 151 amino acids for csgA, the 45th amino acid of 129 amino acids for csgE, and the second amino acid from the N-terminus of 277 amino acids for csgG. All base-edited strains showed no problems with in vitro growth under aerobic conditions (Figure 1-1). A triple-edited strain of csgA-csgE-csgG was created by the following method. A base-editing vector carrying dual guide RNAs of csgE and csgG was constructed, and a double base-edited strain of csgE and csgG was created. Then, a csgA guide RNA vector was introduced into the csgE-csgG double base-edited strain to produce a csgA-csgE-csgG triple base-edited strain. It was confirmed that there were no problems with in vitro proliferation at each stage of production (Figure 1-1).

For comparison purposes, a csgA-deficient strain, a csgB-deficient strain, and a csgDEFG operon-deficient strain were created using homologous recombination technology. After confirming that the introduced plasmid vector had been removed from all of the base-edited strains created, the following in vitro evaluation was performed.

<CsgA staining experiment with Congo red (fluorescence intensity)>
Congo red, an amyloid staining reagent, was used to quantitatively evaluate E. coli curli fimbriae. E. coli ATCC47076 wild-type strain, the base-edited strain, and the homologous recombinant strain were cultured overnight in LB liquid medium, smeared on YESCA agar medium, which is a medium for curli fimbria formation, and then statically cultured at 26 ° C. for 48 hours. EGCG, a CsgA oligomerization inhibitor compound, was mixed at the time of preparation of the YESCA agar medium to a final concentration of 10, 50, 100, and 500 μg / mL, and the E. coli wild-type strain was smeared and cultured under the same conditions as above.

After 48 hours of culture, the cells were harvested and suspended in PBS, and the turbidity was measured at OD600 (nm). The turbidity of all the cell suspensions was adjusted to OD600 = 5, and the supernatant was removed after centrifugation.
The collected cells were suspended in 1 mL of PBS containing 15 μg/mL Congo Red and allowed to stand at room temperature for 10 minutes. After centrifuging again to remove the supernatant, the cells were resuspended in a small amount of PBS to elute Congo Red. Quantification of E. coli curli fimbriae was performed at an excitation wavelength of 470 nm and a fluorescence wavelength of 620 nm.

The amount of curli fimbriae formed by the wild-type E. coli strain is shown as a relative value (average value + standard error, n = 3) for each strain (Figure 1-2), with the amount of curli fimbriae formed by the wild-type E. coli strain taken as 100. The value for the csgA homologous recombination-deficient strain was set as the detection limit of this example, and is shown by the dotted line.

EGCG, which is known to have inhibitory effects on the formation of curli fimbriae, inhibited the formation of curli fimbriae in a concentration-dependent manner. In addition, it was confirmed that the csgA-csgE-csgG triple base-edited strain inhibited the formation of curli fimbriae as strongly as or more strongly than the csgA homologous recombination-deficient strain.

<CsgA Western blotting>
CsgA was detected using a commercially available anti-CsgA antibody. The cells were cultured on YESCA agar medium at 26 ° C for 48 hours, and the cells were collected. The bacterial solution prepared to a turbidity of OD600 = 1 was divided into two, one of which was subjected to protein quantification, and the other was prepared as a suspension with formic acid added for use as a sample for Western blotting. In order to completely dry the formic acid, the tube was heated at 37 ° C for 3 hours with the lid open, and then left at room temperature overnight with the lid open. After adding SDS buffer to this sample and suspending it, 2 μg of protein per well was applied to a 15% gel from Cosmo Bio Co., Ltd., and SDS-PAGE was performed. Transblot Turbo and Transblot Turbo Transfer Pack PVDF membranes (both BioRad) were used for transfer. For fixation and antibody reaction, iBind Flex Western System (Invitrogen) was used. The primary antibody was CSGA Antibody (CUSABIO) diluted 1/1,000, and the secondary antibody was Anti-rabbit IgG, HRP-linked Antibody (Cell Signaling) diluted 1/2,000. ECL Prime Western Blotting Detection Reagents (Cytiva) were used as the chemiluminescent detection reagent. The results of Western blotting are shown in Figure 1-3.

The detection band for CsgA is indicated by a black arrow. EGCG inhibited CsgA protein expression in a concentration-dependent manner (left side of Figure 1-3), and a correlation was confirmed with the quantitative results of CsgA by Congo red staining shown in Figure 1-2. On the other hand, no clear expression of CsgA protein was observed in either the homologous recombination-deficient strain or the base-edited strain (right side of Figure 1-3).

<Observation of E. coli using a transmission electron microscope>
To form curli, E. coli was cultured on YESCA agar medium for 48 hours at 26° C. Bacteria collected from the agar medium were stained with uranyl acetate and then observed under a transmission electron microscope using the negative staining method (FIG. 1-4).

(result)
Pili were observed in the wild-type E. coli strain but not in the csgA base-edited strain.

<Congo Red staining test for CsgA oligomers (agar culture)>
The color change of the grown bacteria on the agar medium containing Congo Red was observed. The wild-type strain of E. coli ATCC47076, the base-edited strain, and the homologous recombinant strain were cultured overnight in LB liquid medium, and the turbidity was adjusted to OD600 = 3. The bacterial solution was spotted on a YESCA agar medium containing a final concentration of 10 μg / mL of Congo Red and a final concentration of 10 μg / mL of Coomassie Brilliant Blue, 5 μL, and then statically cultured at 26 ° C. for 48 hours, and further incubated at 4 ° C. for 72 hours to observe the amount of CsgA oligomer formation (Figure 1-5). In addition, the csgA homologous recombination-deficient strain (CsgB donor) or the csgB homologous recombination-deficient strain (CsgA donor) was mixed with each test strain in equal amounts, and a CsgA-CsgB bacterial cell complementation test was performed under the same conditions as above, and the amount of CsgA oligomer formation was observed (Figure 1-5).

(result)
The wild-type E. coli strain formed a deep red colony indicating the formation of CsgA oligomers. In addition, when the csgA homologous recombination-deficient strain and the csgB homologous recombination-deficient strain were cultured alone, the formation of CsgA oligomers was inhibited and white colonies were formed. However, when the csgA homologous recombination-deficient strain and the csgB homologous recombination-deficient strain were cultured after mixing in equal amounts, a deep red colony was formed, indicating that CsgA oligomers were formed by mutual complementation of CsgA and CsgB.

When the csgA base-edited strain was used alone, it produced light red colonies, likely due to partial formation of the beta-sheet structure of CsgA as expected. On the other hand, when it was mixed with a csgB homologous recombination-deficient strain, it produced dark red colonies, indicating oligomerization of CsgA.

As a result of the instability of the intracellular structure of the CsgA monomer, the csgE base-edited strain formed white colonies when mixed in equal amounts with a csgA homologous recombination-deficient strain (CsgB donor), but when mixed in equal amounts with a csgB homologous recombination-deficient strain (CsgA donor), it formed light red colonies indicating the formation of a small amount of CsgA oligomers.

The csgG base-edited strain (which maintained expression of CsgA monomers within the bacteria) and the triple base-edited strain of csgA-csgE-csgG formed white colonies, indicating that no CsgA oligomers were formed outside the bacteria in any combination.

These results demonstrate that, compared to a csgA single deletion strain, the csgA-csgE-csgG triple base-edited E. coli strongly inhibits the formation of CsgA oligomers as a result of a CsgA-CsgB cell-cell complementation test by co-culture.

EGCG inhibited the expression of CsgA oligomers in a concentration-dependent manner, but even at concentrations higher than the clinically anticipated concentration, it was not possible to achieve 100% inhibition (Figure 1-2). In contrast, in vitro testing confirmed that the triple base-edited E. coli produced in this patent inhibited the formation of CsgA oligomers 100%, and that this complete inhibition of CsgA oligomer formation was not affected by CsgA or CsgB produced by other E. coli strains, and that the inhibition continued.

These results demonstrate that the triple base-edited E. coli produced in this disclosure inhibits the formation of CsgA oligomers more strongly than EGCG, which inhibits CsgA oligomer formation.

(Example 1-2: Inhibition of CsgA oligomer formation by other base-edited strains)
Inhibition of CsgA oligomerization by mutants and multiple mutants of the curli pilus operon genes was evaluated in the same manner as in Example 1-1.

The results are shown in Figures 1-6 and 1-7. These results confirm that the base-edited E. coli produced in this disclosure inhibits the formation of CsgA oligomers.

(Example 1-3: Inhibition of CsgA oligomerization by genome-edited strains of sigma factor genes, catabolite repressor genes, and two-component regulatory system genes)
In the same manner as in Example 1, the inhibition of oligomer formation of CsgA by mutants and multiple mutants of the sigma factor gene group, the catabolite repressor gene group, and the two-component control gene group was evaluated.

The results are shown in Figure 1-8. When the Congo Red Binding Assay was performed on the disrupted strains, the fluorescence intensity of BP4087-P (rpoS-), BP4091-P (ompR-), and BP4093-P (ompR-) was approximately half that of the wild type.

Example 2: Inflammatory Bowel Disease
(Example 2-1: Modification of fim fimbrial operon genes)
Genome-edited strains were prepared by modifying the target gene and its editing site as shown in FIG. 2-1. The parent strain of each genome-edited strain was ATCC25922 or ATCC700926 as shown in FIG. 1. FIG. 2-1 shows the Growth Curve of each genome-edited strain, as well as the results of the mannose bead binding test and the hemagglutination test described below. The target genes to be edited were fimA, fimC, fimD, fimH, papG, papD, and csgA, each used alone or in combination. The gRNA for each target gene was designed mainly to introduce a stop codon to the 5' end side, which induces a complete loss of protein function, and to induce amino acid substitutions in the active site, etc., predicted from the protein structure prediction.

As shown in Figure 2-1, many of the modified strains showed good growth curves, confirming that modifying the target gene had no effect on survival.

(Example 2-2: Effect of genome-edited strain on fimH binding ability)
Using the genome-edited strain prepared in Example 2-1, the fimH binding ability of mutant strains of the fim pilus operon gene group and the fimbrial-related gene group, as well as multiple mutant strains, was evaluated. In this example, a hemagglutination test was performed to evaluate the expression level of functional E. coli FimH.

<Hemagglutination test>
The hemagglutination test was carried out as follows.
This test utilizes the property that E. coli FimH specifically binds to glycoproteins mainly composed of mannose expressed on the surface of guinea pig-derived red blood cells. The E. coli used in the test was inoculated into 2 mL of LB medium and cultured at 37°C for 24 hours. The E. coli was further diluted 100-fold with LB medium and cultured at 37°C for an additional 24 hours. After a total of 48 hours of culture, 1 mL of the culture solution was collected, centrifuged at 9700×g for 1 minute at room temperature to collect the cells, the supernatant was removed, and the cells were resuspended in PBS to a turbidity of 2.0 OD or 10.0 OD. The resulting E. coli solution was dispensed into a 96-well U-bottom plate to prepare a 2-fold dilution series. The guinea pig red blood cell solution was adjusted to a final concentration of 10% (w/v), and then guinea pig red blood cells (containing mannose as necessary) were dispensed so that each well had a uniform final concentration of 1%. A solution of E. coli at any concentration was contacted with 1% (w/v) guinea pig red blood cells, and then the wells were left to stand at 4° C. for 4 hours, after which a photograph was taken from above the 96-well plate. The dilution rate of the bacterial solution was determined from the well in which an agglutination reaction was observed and which had the lowest turbidity of the bacterial solution, and this was expressed as a numerical value as the natural logarithm of 2.

The results are shown in Figure 2-1. As can be seen from these results, hemagglutination was reduced in strains that were singly deficient in either fimC or fimH, indicating that the expression level of E. coli type I fimbriae or the functional expression level of E. coli FimH is reduced in the genome-edited strain disclosed herein. Furthermore, the FimC-FimH double-deficient strain constructed to completely eliminate FimH function had reduced hemagglutination compared to other base-edited strains, and was able to suppress the expression level of functional E. coli FimH.

(Example 2-3: Mannose bead binding test)
Using the genome-edited strain prepared in Example 2-1, the fimH binding ability of mutant strains of the fim pilus operon gene group and the fimbrial-related gene group, as well as multiple mutant strains, was evaluated. In this example, a mannose bead binding test was performed.

Mannose bead binding test
The mannose bead binding test was carried out as follows.
This test utilizes the property that E. coli FimH specifically binds to mannose fixed to the surface of agarose beads. This test system is more stable than the biological sample guinea pig red blood cells, and is expected to realize more accurate quantitative evaluation. The E. coli used in the test was inoculated into 2 mL of LB medium and cultured at 37 ° C for 24 hours. The E. coli was further diluted 100 times with LB medium and cultured at 37 ° C for an additional 24 or 48 hours. After a total of 48 or 72 hours of culture, 1 mL of the culture solution was collected, centrifuged at 9700 × g for 1 minute at room temperature to collect the bacteria, the supernatant was removed, and the mixture was resuspended in PBS to a turbidity of 1.0 OD. The prepared bacterial solution was mixed with mannose beads (final concentration 10 mg / mL) and incubated at 4 ° C for 4 hours with gentle stirring. In order to remove non-specific adsorption of E. coli to the mannose beads, the mannose beads were washed three times with PBS, and then E. coli was disrupted using a bead cell disrupter. After purifying and extracting the genomic DNA of E. coli, quantitative PCR was carried out using a primer set (Fw: catgccgcgtgtatgaagaa (SEQ ID NO: 37), Rv: cgggtaacgtcaatgagcaaa (SEQ ID NO: 38)) that anneals to the 16S rRNA region of E. coli in order to quantify the number of E. coli that were specifically bound to mannose. For the calibration curve, a dilution series was used in which the genomic DNA of E. coli wild-type strain was used as a template, the DNA fragments amplified with the above primer set were purified, and the concentrations were measured.

The results are shown in Figure 2-1. As can be seen from these results, the fimC or fimH single-deficient strains had reduced binding to mannose beads, indicating that the binding strength of fimH was further reduced. Furthermore, the FimC-FimH double-deficient strain constructed to completely eliminate FimH function had reduced binding to mannose beads compared to other base-edited strains, indicating that the binding strength of fimH was further reduced. Furthermore, unlike small molecule and nucleic acid drugs, the base-edited strains disclosed herein, including the FimC-FimH double-deficient strain, are expected to have a permanent inhibitory effect due to base editing. Furthermore, the FimC-FimH double-deficient strain will be the first IBD treatment that targets FimC.

Figure 2-2 shows the results of mannose bead binding tests for the wild-type strains ATCC700926, BP3019, BP3021, and BP3026. To confirm that the bacteria bind specifically to mannose, tests were also conducted for the wild-type strain ATCC700926 in the presence of mannose beads as well as mannose that was not bound to beads. The mannose concentrations were 0, 0.5, 5, and 50 mM, respectively.

As a control, Figures 2-3 show the results when Sibofimloc (EB8018, TAK018, jointly developed with Enterome, France, and Takeda Pharmaceutical), a small molecule FimH inhibitor that inhibits adhesion of AIEC to the intestinal epithelium, was used. The Sibofimloc concentrations were 0, 0.1, 1, and 10 μM.

As can be seen from these results, all base-edited strains showed reduced mannose bead binding and reduced binding strength via fimH. Furthermore, compared to Sibofimloc, which is known to inhibit adhesion of AIEC to the intestinal epithelium, the base-edited strains of the present disclosure showed reduced mannose bead binding and reduced binding strength via fimH.

(Example 2-4: Adhesion and invasion test for T84 cells)
Human colon cancer cell line T84 cells (CCL-248, ATCC) have intestinal epithelial cell-like properties and are used to evaluate the adhesion and invasion of intestinal bacteria to intestinal epithelial cells. For the culture of T84 cells, 10% FBS-containing D-MEM / Ham's F-12 medium (048-29785, Fujifilm Wako Pure Chemical Industries, Ltd.) was used. T84 cells were seeded on a 24-well plate at 8 x 10 ⁵ cells/well and cultured overnight in a CO ₂ incubator (37°C, 5% CO ₂ ). E. coli was added to each T84 cell at 100 CFU, and co-cultured at 37°C for 2 hours in a CO ₂ incubator. Thereafter, Triton was added to the well to a final concentration of 0.1% to detach the T84 cells, and the bacteria were collected to obtain total E. coli. In addition, the well was washed five times with 1 mL of phosphate-buffered saline to remove non-adherent bacteria, and then Triton was added to the well to a final concentration of 0.1%, T84 cells were detached, and the bacteria were collected to obtain adherent E. coli. To collect invasive E. coli, the well was washed twice with 1 mL of phosphate-buffered saline, and then gentamicin was added to 100 μg/mL and cultured at 37 ° C. for 2 hours in a CO ₂ incubator. Triton was added to the well to a final concentration of 0.1%, T84 cells were detached, and the bacteria were collected. The collected bacteria were smeared on LB plates, cultured overnight at 37 ° C. in an incubator, and the number of colonies was measured. The number of adherent bacteria or the number of invasive E. coli was calculated as a percentage by dividing the number of adherent E. coli or invasive E. coli by the total E. coli.
As a result, BP3026 reduced the number of attached and invaded E. coli compared to the wild-type strain (FIG. 2-4).

(Example 5: Drug efficacy test in in vivo DSS colitis model)
Next, using the genome-edited strain prepared in Example 1, a drug efficacy test was conducted in an in vivo DSS colitis model.

<Drug efficacy test in in vivo DSS colitis model>
The efficacy test in an in vivo DSS colitis model was carried out as follows.
Eight-week-old C57BL/6J mice (male, Jackson Laboratory Japan Co., Ltd.) were allowed to drink 3% dextran sulfate sodium (hereinafter referred to as DSS, Fujifilm Wako Pure Chemical Industries, Ltd.) aqueous solution ad libitum from the start of the test (Day 0) to the end of the test (Day 7) to induce enteritis in the mice. Tap water was given to the untreated group instead of the 3% DSS aqueous solution. The ATCC700926 strain was used as the wild-type E. coli strain, and the BP3026 strain (fimC: W49*, Q87* and fimH: Q83*, R84*) that was base-edited based on the ATCC700926 strain was used as the genome-edited strain. A bacterial suspension of 10 9 CFU (Colony Forming Unit) per mouse was orally administered once a day for 7 days. As a positive control, salazosulfapyridine (hereinafter referred to as SASP), a commercially available IBD treatment drug, was orally administered at 100 mg/kg, equivalent to the human dose, once a day for 7 days. Pharmacological evaluation was performed by observing the DAI (Disease Activity Index) score over time and measuring the length of the colon excised on Day 7. The DAI score is a score given to the diarrhea and bloody stool condition on a scale of 0 to 3, and the diarrhea score, bloody stool score, and the sum of both scores are the score of the individual, with the lower the score value, the more the symptoms induced by DSS are alleviated. The measurement of the colon length utilizes the property that the colon length of mice with intestinal inflammation generally shortens, and when DSS-induced intestinal inflammation is suppressed, the shortening of the colon length is suppressed, so that the closer the colon length is to that of untreated mice, the more effective the treatment is.

The results of the DAI score and the measurement results of the colon length are shown in Figure 2-5 and Figure 2-6, respectively. As can be seen from these results, the FimC-FimH double-deficient strain (BP3026), constructed to completely eliminate FimH function, reduced the DAI score and alleviated the symptoms induced by DSS. Furthermore, in the double-deficient strain (BP3026), the colon length was closer to that of untreated mice compared to the parent strain (ATCC700926), confirming the inhibitory effect on intestinal inflammation.

<Intestinal flora analysis>
The intestinal microbiota analysis was performed as follows.
On Day 7 of the efficacy test of the DSS colitis model, feces from each mouse were collected and stored at -80°C until DNA extraction. Mouse feces were freeze-dried using a VD-250R Freeze Dryer (TAITEC), and then crushed for 2 minutes at 1,500 rpm with a Multi-Beads Shocker (Yasui Kikai). Lysis Solution F (Nippon Gene) was added to the crushed mouse feces and allowed to stand at 65°C for 10 minutes. Then, the mixture was centrifuged at 12,000 x g for 2 minutes, and the supernatant was separated. DNA was purified from the separated solution using a Lab-Aid824s DNA Extraction kit (ZEESAN). The purified DNA was subjected to concentration measurement using LX (Bio Tek) and QuantiFluor dsDNA System (Promega). After preparing a library from the purified DNA using 2-step tailed PCR method, the library concentration was measured using Synergy H 1 (Bio Tek) and QuantiFluor dsDNA System. The quality of the library was confirmed using Fragment Analyzer and dsDNA 915 Reagent Kit (Advanced Analytical Technologies). Sequencing was performed under the condition of 2 x 300 bp using MiSeq system and MiSeq Reagent Kit v 3 (Illumina). Only the read sequences whose beginnings of the read sequences obtained using the fastx_barcode_splitter tool of FASTX Toolkit (ver. 0.0.14) completely matched the primer sequences used were extracted. The primer sequences were deleted from the extracted reads using fastx_trimer of FASTX Toolkit. Then, sequences with a quality value of less than 20 were removed using sickle (ver. 1.33), and sequences with a length of 130 bases or less and their paired sequences were discarded. The reads were combined using the paired-end read combination script FLASH (ver. 1.2.11). After removing chimeric sequences and noise sequences using the dada 2 plug-in of Qiime 2 (ver. 2022.8), the representative sequences and ASV table were output. Using the feature classifier plug-in, the representative sequences obtained were compared with the 97% OTU of Greengene (ver. 13_8) to perform phylogenetic estimation. The proportion of each bacterium in mouse feces was calculated for each family.

As a result, in both the group administered the wild-type E. coli strain and the group administered the genome-edited bacteria, the presence of Enterobacteriaceae, which is expected to contain the administered E. coli, was confirmed, and no significant changes were observed in the overall bacterial flora (Figure 2-7).

(Example 6: Effect of base-edited strains of two-component regulatory gene clusters on fimH binding ability)
The fimH binding strength of genome-edited strains of the two-component regulatory system gene group was evaluated (mannose bead binding test).

The results are shown in Figure 2-8. We created rcsB and qseC knockout strains and performed an in vitro mannose bead binding test. The binding was suppressed to the same extent as in a strain in which the fim operon was knocked out by homologous recombination (ΔfimB-H).

Example 3: Cancer immunotherapy
(Example 3-1: Measurement of TLR5 activation ability of genome-edited strains)
The TLR5 activation ability of each strain was measured using genome-edited strains prepared by modifying the target genes and their editing sites as shown in Figures 3-1 and 3-2. The target genes to be edited were fliC, fliD, flgE, fliF, flgK, flgM, flgN, fliT, and sigD, each of which was used alone. The gRNA for each target gene was designed mainly to introduce a stop codon at the 5' end, which induces a complete loss of protein function, and to induce amino acid substitutions in the active site, etc., predicted from the protein structure.

After genome editing of the above genes in the enterococcus E. casseliflavus ATCC700327 strain, a stable strain was established and its TLR5 activation ability was measured.

<Measurement of TLR5 activation ability>
The TLR5 activation ability was measured as follows.
The strains to be evaluated were cultured overnight (12-18 hours) at 37°C in Brain Heart infusion medium, washed with Opti-MEM medium, and the turbidity (660 nm) was measured. The turbidity was adjusted to 1.0 with Opti-MEM medium, and then a bacterial solution was prepared by diluting ¹⁰⁴ times with Opti-MEM. The following three types of plasmids were introduced into human embryonic kidney cells HEK293T to construct cells for evaluating TLR5 activation ability.

The three types of plasmids are a plasmid that forcibly expresses human TLR5, a plasmid that places the NanoLuc (registered trademark) gene under the control of an activation-responsive sequence to evaluate the activation ability of TLR5, and a plasmid that constitutively expresses the firefly luciferase gene that functions as an internal standard. The three types of plasmids were introduced into HEK293T cells, and after 16 to 20 hours, the diluted bacterial solution prepared above was added in an amount of 1/10 of the medium in which the plasmid-introduced cells grew, and the cells were co-cultured at 37°C for 4 hours. The TLR5 activation ability was measured using the activity of NanoLuc as an index using Promega's Nano-Glo (registered trademark) Dual-Luciferase (registered trademark) Reporter Assay System. Following the recommended protocol, the activity of firefly luciferase, which is the internal standard, was measured, and then the activity of NanoLuc, which reflects TLR5 activation, was measured. NanoLuc activity was standardized with firefly luciferase activity to evaluate the TLR5 activation ability of each strain.

The results are shown in Figures 3-1 and 3-2. As shown in these figures, the TLR5 activation ability of the genome-edited enterococcus strain constructed to enhance Flagellin expression and/or secretion was improved compared to that of the wild-type strain.

(Example 3-2: Confirmation of Flagellin expression)
The target strain was inoculated into 20 mL of MTM medium (1% w/v Bacto Peptone, 0.5% w/v NaCl, 0.3% w/v Beet extract) and cultured overnight (16-24 hours) at 37°C with shaking. The culture was heat-treated at 60°C for 20 minutes. The culture was centrifuged at 2,900×g for 10 minutes, and the supernatant was filtered through a 0.22 μm filter. 15 mL of the filtrate was concentrated to 1 mL using Amicon-15 (MWCO 10k, Millipore). 450 μL of the concentrated solution was diluted with Protein G PLUS-Agarose.
(Santa Cruz) was added at 20 μL, and the mixture was mixed by inversion at 4 ° C for 1 hour. After centrifugation, 430 μL of the supernatant was collected and used as the pre-treated sample. 1 μg of Recombinant Mouse TLR5 Fc Chimera Protein (R & D systems) was mixed with 20 μL of Protein G PLUS-Agarose to form a complex, which was then added to the pre-treated sample and mixed by inversion at 4 ° C for 1 to 3 hours. The agarose beads were precipitated by centrifugation at 1,000 × g for 2 minutes, the supernatant was removed, and the beads were suspended in 500 μL PBS. After repeating this centrifugation and suspension procedure three times in total, the agarose beads were suspended in 45 μL of 1× Laemmli dye and heat-treated at 95° C. for 5 minutes to elute the bound protein from the beads. After centrifugation at 1,000×g for 2 minutes, the supernatant was collected and used as a TLR5-binding protein sample.

15 μL of sample was applied to a 10% TGX gel (Bio-Rad). Electrophoresis was performed for 45 to 60 minutes at a constant current of 30 mA/gel. The gel was stained with Coomassie staining solution, and washed and destained with Milli-Q water.

As a result, Flagellin-derived bands were detected in the wild-type strain and the flgN-, fliD-, and flgK-edited strains, but no Flagellin bands were detected in the fliC- and fliF-edited strains (Figure 3-3).

(Example 3-3: Other Genetic Modifications)
By rendering mprA, a transcription factor, dysfunctional by base editing as in Example 1, the master regulatory factor of the flagellum-related gene group is activated, which is expected to result in increased expression of flagellin and enhanced activation ability of TLR5.

(Example 3-4: Evaluation of the antitumor effect of Enterococcus alone or in combination with immune checkpoint inhibitors using a tumor-bearing mouse model)
A tumor-bearing mouse model was created using a mouse colon cancer cell line, and the E. casseriflavus wild-type strain or its genome-edited strain was administered alone or in combination with an anti-PD-1 antibody (anti-mouse PD-1 [CD279], clone: RMP1-14, Bio X Cell) which is an immune checkpoint inhibitor, to evaluate the antitumor effect.

Mouse colon cancer cell line MC38 (Cat. No. ENH204-FP, Kerafast) is a C57BL/6J mouse (6 weeks old, female, Jackson Laboratory Japan Co., Ltd.), and CT26 (Cat. No. CRL-2638, ATCC) is a BALB/c mouse (6 weeks old, female, Jackson Laboratory Japan Co., Ltd.), and 100 ^μL of each cell suspended in physiological saline is subcutaneously transplanted into the right flank of each mouse. One week after transplantation, the tumor diameter of the mouse is measured, and the estimated tumor volume (long diameter x short diameter x short diameter / 2) is calculated. Based on the estimated tumor volume, the group is divided and designated as Day 0. On Days 0, 2, 4, 7, 9, 11, 14, 16, 18, 21, 23, and 25, E. The E. casseriflavus wild-type strain and its genome-edited strain are prepared in phosphate-buffered saline to give 10 ⁹ CFU/100 μL, and 100 μL per individual is forcibly administered orally. The anti-PD-1 antibody is administered into the tail vein at 5 mg/kg per individual on days 0, 3, 7, 10, and 14. Under the above administration conditions of the bacterial solution and anti-PD-1 antibody, the E. casseriflavus wild-type strain or its genome-edited strain alone, or in combination with the anti-PD-1 antibody, is administered. The estimated tumor volume and body weight of the mice are measured twice a week from day 0.

Tumor growth is expected to be suppressed in the group administered the genome-edited strain alone and in the group administered the genome-edited strain in combination with an anti-PD-1 antibody.

(Examples 3-5: Cancer Treatment)
A strain with enhanced TLR5 activation ability is orally administered to a cancer patient (regardless of the type of cancer) in the form of a tablet or capsule, and the strain is allowed to exist transiently or ideally become established in the intestine of the patient, stimulating the host's immune cells and enhancing the immune response to cancer cells. By using ICI in combination, it is possible to inhibit the suppressive effect of cancer cells on immune cells, and it is expected that the reactivity of activated immune cells to cancer cells will be enhanced.

When used in combination with ICI, the timing of administration of the strain can be either simultaneous administration or administration of the strain prior to ICI. Depending on the degree to which the strain adheres to the patient's body, the strain may be administered multiple times. Even in patients who have a low response to cancer immunotherapy using ICI alone, it is expected that the response of ICI will be increased by combining it with the strain.

(Example 4: Measurement of biofilm formation by Streptococcus mutans)
(Experimental Procedure)
- Pre-culture The strain was inoculated onto a brain heart infusion (BHI) agar medium and cultured overnight at 37° C. The colony after culture was inoculated into 1 mL of a BHI liquid medium and cultured statically overnight at 37° C.

- Main culture of bacterial solution The preculture solution was inoculated into 2 mL of BHI liquid medium to give an OD ₆₀₀ of 0.1, and then cultured at 37°C until the OD ₆₀₀ reached 0.3 to 0.9. The bacterial solution was adjusted to give an OD ₆₀₀ of 0.005 in 5% sucrose-containing BHI liquid medium, and 200 μL of the prepared bacterial solution was added to each well of a 96-well plate, followed by culture at 37°C for 24 hours in an anaerobic jar containing a decarbonizing agent.

Evaluation of biofilm formation by crystal violet staining The supernatant of the bacterial solution cultured in a 96-well plate was removed, and 200 μL of phosphate-buffered saline (PBS) solution was added to each well and washed. Washing was performed once more. Then, 200 μL of 0.01% crystal violet solution was added, and the well was left to stand at room temperature for 20 minutes under light-shielded conditions. The crystal violet solution was removed, and 200 μL of PBS solution was added and washed. Washing was performed once more.

After adding 200 μL of ethanol to each well, the plate was left to stand at room temperature for 30 minutes in the dark to elute the staining solution. ABS ₅₉₀ in 100 μL of the eluted solution was measured.

The results are shown in Table 1 below and in FIG.

(Note)
As described above, the present disclosure has been illustrated using preferred embodiments of the present disclosure, but it is understood that the scope of the present disclosure should be interpreted only by the scope of the claims. It is understood that the patents, patent applications and other documents cited in this specification should be incorporated by reference to this specification in the same manner as if the contents themselves were specifically described in this specification. This application claims priority to Japanese Patent Application No. 2022-177706 filed on November 4, 2022 at the Japan Patent Office, the contents of which are incorporated by reference in their entirety in this application.

The disclosed method makes it possible to design or produce bacterial preparations containing microorganisms that have a desired medicinal effect in a subject, and also makes it possible to efficiently produce bacterial preparations for various diseases, which is expected to have a wide range of applications in the medical field.

SEQ ID NO:1: Nucleic acid sequence of csgA from Escherichia coli SEQ ID NO:2: Amino acid sequence of csgA from Escherichia coli SEQ ID NO:3: Nucleic acid sequence of csgB from Escherichia coli SEQ ID NO:4: Amino acid sequence of csgB from Escherichia coli SEQ ID NO:5: Nucleic acid sequence of csgC from Escherichia coli SEQ ID NO:6: Amino acid sequence of csgC from Escherichia coli SEQ ID NO:7: Nucleic acid sequence of csgD from Escherichia coli SEQ ID NO:8: Amino acid sequence of csgD from Escherichia coli SEQ ID NO:9: Nucleic acid sequence of csgE from Escherichia coli SEQ ID NO:10: Amino acid sequence of csgE from Escherichia coli SEQ ID NO:11: Nucleic acid sequence of csgF from Escherichia coli SEQ ID NO:12: Amino acid sequence of csgF from Escherichia coli SEQ ID NO:13: Nucleic acid sequence of csgG from Escherichia coli SEQ ID NO:14: Amino acid sequence of csgG from Escherichia coli SEQ ID NO:15: SEQ ID NO:16: Amino acid sequence of rpoS from Escherichia coli SEQ ID NO:17: Nucleic acid sequence of crp from Escherichia coli SEQ ID NO:18: Amino acid sequence of crp from Escherichia coli SEQ ID NO:19: Nucleic acid sequence of ompR from Escherichia coli SEQ ID NO:20: Amino acid sequence of ompR from Escherichia coli SEQ ID NO:21: Nucleic acid sequence of fimA from Escherichia coli SEQ ID NO:22: Amino acid sequence of fimA from Escherichia coli SEQ ID NO:23: Nucleic acid sequence of fimC from Escherichia coli SEQ ID NO:24: Amino acid sequence of fimC from Escherichia coli SEQ ID NO:25: Nucleic acid sequence of fimD from Escherichia coli SEQ ID NO:26: Amino acid sequence of fimD from Escherichia coli SEQ ID NO:27: Nucleic acid sequence of rcsB from Escherichia coli SEQ ID NO:28: Amino acid sequence of rcsB from Escherichia coli SEQ ID NO:29: SEQ ID NO:30: Escherichia coli qseC amino acid sequence SEQ ID NO:31: Escherichia coli papD nucleic acid sequence SEQ ID NO:32: Escherichia coli papD amino acid sequence SEQ ID NO:33: Escherichia coli papG nucleic acid sequence SEQ ID NO:34: Escherichia coli papG amino acid sequence SEQ ID NO:35: Escherichia coli csgA nucleic acid sequence SEQ ID NO:36: Escherichia coli csgA amino acid sequence SEQ ID NO:37: Forward primer annealing to the 16S rRNA region of E. coli used in the mannose binding test SEQ ID NO:38: Escherichia coli 16S rRNA region used in the mannose binding test Reverse primer annealing to the rRNA region SEQ ID NO: 39: Nucleic acid sequence of fliC(hag) of E_casseliflavus SEQ ID NO: 40: Nucleic acid sequence of fliD of E_casseliflavus SEQ ID NO: 41: Nucleic acid sequence of flgE of E_casseliflavus SEQ ID NO: 42: Nucleic acid sequence of fliF of E_casseliflavus SEQ ID NO: 43: Nucleic acid sequence of flgK of E_casseliflavus SEQ ID NO: 44: Nucleic acid sequence of flgM of E_casseliflavus SEQ ID NO: 45: Nucleic acid sequence of flgN of E_casseliflavus SEQ ID NO: 46: Nucleic acid sequence of fliT of E_casseliflavus SEQ ID NO: 47: Nucleic acid sequence of sigD of E_casseliflavus

Claims

1. A method for designing or producing a bacterial formulation comprising a microorganism having a desired therapeutic effect in a subject, comprising:
selecting or screening at least one gene associated with said therapeutic effect;
modifying the gene;
selecting a microorganism in which the expression level of the gene and/or the function of the protein produced by the gene is modified;
A step of confirming whether the selected microorganism has the desired medicinal effect and selecting a microorganism having the medicinal effect;
and optionally generating a population comprising said microorganism having said desired therapeutic effect.
The method of claim 1, wherein the selection or screening of the gene includes screening using a database and/or a genomic library.
The method of claim 1 or 2, wherein the modification includes genome editing.
The method according to any one of claims 1 to 3, wherein the modification comprises a point mutation in the gene.
The method according to any one of claims 1 to 4, wherein the modification includes a mutation that generates a stop codon.
The method according to any one of claims 1 to 5, wherein the modification includes at least two mutations in the at least one gene.
The method according to any one of claims 1 to 6, wherein the selection of the microorganism having the medicinal effect includes the use of a drug gene resistance system, an essential gene (auxotrophic marker), a gene encoding an enzyme that catalyzes a color reaction, and temperature tolerance.
The method according to any one of claims 1 to 7, wherein the confirmation of the desired drug effect includes the use of a drug gene resistance system, an enzyme activity based on the drug effect, a survival activity based on the drug effect, and/or the fixability of the microorganism in the subject.
The method according to any one of claims 1 to 8, wherein the gene includes a gene associated with at least one disease or function selected from the group consisting of inflammatory bowel disease, Parkinson's disease, cancer immunity, dental caries, and periodontal disease.
The method according to any one of claims 1 to 9, wherein the microorganism comprises Escherichia coli.