WO2024093036A1

WO2024093036A1 - A method to increase the loading of specific nucleic acid molecules in engineered cell exosomes and its application

Info

Publication number: WO2024093036A1
Application number: PCT/CN2023/074243
Authority: WO
Inventors: Wenlin AN; Xian ZHAO; Peifen GAO; Peng Yang; Youxiu ZHONG; Xudong Wang; Xue WU; Jiuheng SHEN
Original assignee: National Vaccine & Serum Institute
Priority date: 2022-11-03
Filing date: 2023-02-02
Publication date: 2024-05-10
Also published as: CN116218904A

Abstract

A method that can improve the loading efficiency of specific nucleic acid molecules in cellular exosomes and its application, which is based on the autonomous docking of multiple tandems of C/D box binding protein L7Ae or its variants to RNA nucleic acid molecules containing C/D box sequences. The purpose-designed loading of RNA nucleic acid molecules into exosomes can be achieved by docking C/D box binding protein L7Ae or/and its variants with fusion proteins (i.e., scaffolding proteins) constructed from exosomal membrane proteins such as CD47.

Description

A method to increase the loading of specific nucleic acid molecules in engineered cell exosomes and its application

Technical Field

The present invention belongs to the field of exosomes as nucleic acid drug delivery carrier systems that can be used for loading nucleic acid drugs in various fields such as vaccines, regenerative medicine, and drug therapy. It specifically relates to a means of preparing engineered exosomes for the enrichment of purpose-designed nucleic acids containing specific sequences into exosomes and their applications.

Background

Exosomes are cell-derived extracellular vesicles with a membrane structure, 30-150 nm in diameter size, produced in multivesicular bodies (MVBs) and secreted into the extracellular fluid by the fusion of MVBs with the cell membrane. Currently, exosomes are considered to be cell-specific secreted extracellular vesicles that are mainly used for intercellular communication and participate in various life processes. They are used as delivery vehicles for nucleic acid drugs because of their high biocompatibility, bioavailability, and ability to cross the blood-brain barrier.

To date, exosomes have been successfully used to deliver small molecules, short RNAs and proteins both in vivo and in vitro. Compared to synthetic materials, exosome delivery systems offer additional advantages such as their endogenous nature, stability, biocompatibility, nanometer size, ability to cross the blood-brain barrier, and compositional designability. Current loading strategies for exosomes include electroporation and transfection reagents, but they suffer from low loading efficiency and compromised drug activity.

Recently, engineering of exosomes has received much attention, and this approach can improve the controllability and loading efficiency of exosome loading to some extent. Nevertheless, the limited vesicle space still affects the loading efficiency. Therefore, how to improve the effective loading rate of exosomes and deliver drug to the target site is a problem that needs to be addressed.

The delivery system is responsible for the intact delivery of small molecule drug components to the target and their release at the right time and under the right environmental conditions. Therefore, the delivery system is essential for nucleic acid drugs (e.g., mRNA) to function. However, delivery vehicles need to be protected by the body's immune system and are susceptible to immune reactions such as allergy. In addition, the delivery system largely determines the conditions and duration of storage of small molecule drugs. Currently, there are very few companies with this technology and there are patent protection barriers, which is one of the issues to be addressed in mRNA vaccine industry.

Traditional nucleic acid drug delivery vehicles include synthetic lipid nanoparticles and viral vectors, among others, currently used in BioNTech/Pfizer and Oxford/AstraZeneca's COVID-19 vaccine, respectively, as well as in many proteins, RNA, and gene therapies. However, the problem is that both approaches have significant limitations, including the areas of the body they can reach, the number of cells within tissues they can reach, and the ability to avoid triggering a harmful immune response.

Exosomes are endogenous lipid nanoparticles which are similar in size and function to synthetic nanoparticles. However, as natural endogenous transport carriers, they have the advantages of low toxicity, non-immunogenicity, long half-life, good permeability, and more ability to cross biological barriers such as the blood-brain barrier (BBB) . Exosomes also play a key role in mediating intercellular communication and regulating immune responses. In addition, it has been shown that exosomes have an innate homing ability due to their homologous surface adhesion proteins, mRNA, DNA and lipid molecules from parental cells. More importantly, the expression of CD47 (a transmembrane protein) on the surface of exosomes facilitates the avoidance of immune clearance by the monocyte macrophage system (MPS) , thus prolonging blood circulation time. A key advantage of exosomes over other delivery methods such as viral vectors and lipid nanoparticles, is that they can accomplish more precise delivery without activating the innate or acquired immune system. As a result, patients do not become immune to the delivery system after the firstadministration, which makes multiple dosing easier.

Current exosome loading strategies mainly include electroporation and transfection reagents, but these methods have some drawbacks, including low loading efficiency (10%-40%) , disruption of exosome structure and activity, and impact on drug activity. Recently, the emergence of engineered exosome methods has improved the controllability of exosome loading and loading efficiency. However, further improvement of loading efficiency within the limited vesicle space of exosomes is still an urgent issue to be addressed.

Content

The purpose of the present invention is to provide a method that can increase the loading efficiency of specific nucleic acid molecules in cellular exosomes and its application. The principle is based on the autonomous docking of L7Ae on C/D box containing nucleic acid molecules and the successful loading of nucleic acids onto fusion proteins (i.e., scaffolding proteins) consisting of exosomal membrane protein CD47 and L7Ae and/or its variants. The present invention establishes an exosome-nucleic acid loading system with high loading capacity based on the exosomal membrane protein fusion protein CD47-L7Ae (n) . Meanwhile, the structure of exosomal membrane protein CD47 and the C/D box binding protein L7Ae were analyzed, and the loading efficiency of this system was successfully improved by structural optimization, and a novel high-load exosome-nucleic acid loading system based on the P4 scaffolding protein (CD47-L7Ae (n) ) has been established.

To solve the technical problems regarding the cargo loading in exosomes, the present invention uses the following embodiments: an exosome-nucleic acid loading system with high loading efficiency, comprising a scaffolding protein expression plasmid for exosome loading nucleic acid, and an expression plasmid for a specific nucleic acid sequence to be loaded. The scaffolding protein expression plasmid for exosome-loaded nucleic acids contains the coding sequence of an exosomal membrane protein, and the coding sequence of at least one C/D boxbinding protein L7Ae or a variant thereof.

The specific nucleic acid sequence expression plasmid has two parts, including the specific nucleic acid molecules to be loaded and the specific sequences C/D box sequence and its equivalent functional derivative sequences that can be directly or indirectly linked to these molecules. These specific nucleic acids sequences are autonomously docked to L7Ae or/and its variants.

Specific nucleic acid molecules to be loaded are RNA, such as mRNA, circRNA and lncRNA.

Preferred scaffolding proteins are exosomal membrane proteins expressed in tandem fusion with multiple C/D box binding proteins L7Ae or/and variants thereof to form a scaffolding protein-L7Ae (n) fusion protein, with “n” being the number of L7Ae and/or its variants. The specific nucleic acid molecules to be loaded can be loaded into exosomes by co-transfection of two plasmids, including the scaffolding protein expression plasmid for exosome loading nucleic acids and the specific nucleic acid sequence expression plasmid to be loaded. The specific sequence is a C/D box sequence or an equivalent functional derivative thereof that specifically recognizes and binds the L7Ae protein and/or its variants.

Said scaffoldingproteins contain exosomal membrane proteins such as CD63, CD47, CD9 and CD81 or variants thereof.

Preferably, said specific nucleic acid sequence expression plasmid to be loaded further comprises interlinked specific nucleic acid molecules and C/D box sequences. In practical pharmaceutical applications, only the specific nucleic acid molecules to be loaded need to be linked to the C/D box sequence without the addition of EGFP or its equivalent analogs (for fluorescent labeling purposes only) .

The exosomal membrane proteins are fused to C/D box binding protein L7Ae (or its variants) by a flexible or rigid linker. When more than one if said C/D box binding protein L7Ae or its variants form a tandem, the exosomal membrane protein is fused to the first C/D box binding protein L7Ae by a flexible linker. In order to reduce mutual interference between C/D box binding proteins and between loaded nucleic acids, the rigid linker is used between the first C/D box binding protein L7Ae and the following L7Ae or its variants, e.g., the first L7Ae is fused to the second L7Ae or its variant via rigid linker, and the second C/D box binding protein L7Ae is fused to the third L7Ae or its variant through a rigid linker, and so on.

Variants of the C/D box binding protein L7Ae refer to the L7Ae variant (i.e., L7Ae_delC21) obtained by removing 21 amino acids (the entire α helix) from the carboxyl terminus of wild-type L7Ae (i.e., L7Ae-WT) , or for other variants that can reduce spatial site resistance, such as truncators or mutants.

Preferably, said flexible linker include, but is not limited to GSSS, GSSSGSSSGS or GGS, and said rigid linker include, but is not limited to PWRPWRP or PWRP, and may also be other flexible or rigid linker. An exosome loading scaffolding protein expression plasmid for nucleic acids when more than one of said bridging protein L7Ae or variant thereof forms a tandem, the flexible junction and/or rigid junction is more than one or only one sequence, and the bridging protein L7Ae or variant thereof is more than one or only one sequence.

Further, said specific nucleic acid molecule to be loaded is an RNA nucleic acid drug molecule or an RNA nucleic acid molecule.

Further, said specific nucleic acid molecule to be loaded is a nucleic acid sequence encoding a vaccine antigen, an antitumor nucleic acid drug, a nucleic acid antibody drug and other nucleic acid molecules encoding various growth factors, antibodies and proteins.

More specifically, said specific nucleic acid molecule to be loaded is a nucleic acid sequence encoding EGF, a nucleic acid sequence encoding insulin, or a nucleic acid molecule of another growth factor.

In one embodiment, the C/D box sequence is shown as SEQ ID NO. 17 or an equivalent derivative sequence thereof.

A second aspect of the present invention is to provide a method that can increase the loading of a specific nucleic acid molecule in an exosome, comprising the following steps.

Constructing a scaffolding protein expression plasmid for exosome loading nucleic acids and a specific nucleic acid sequence expression plasmid for loading nucleic acids; The scaffolding protein expression plasmid for exosome loading nucleic acids contains the coding sequence of an exosomal membrane protein, and the coding sequence of at least one bridging protein L7Ae or a variant thereof; the specific nucleic acid sequence expression plasmid comprises a specific nucleic acid molecule to be loaded and a C/D box sequence directly or indirectly linked to the specific nucleic acid molecule to be loaded.

Exosome-loaded nucleic acids are cotransfected into cells with a scaffolding protein expression plasmid and an expression plasmid for the specific nucleic acid sequence to be loaded, and the exosomal membrane protein is expressed in fusion with the bridging protein L7Ae or a variant thereof to form a fusion protein (i.e. scaffolding protein) , wherein the C/D box docks autonomously with L7Ae or/and a variant thereof, allowing the specific nucleic acid molecule to be loaded into the exosome via the fusion protein, and the exosome is secreted outside the cell while carrying the specific nucleic acid molecule outside the cell.

Enrichment of exosomes containing specific nucleic acid molecules from cell culture supernatants.

Preferably, loading of specific nucleic acid molecules into exosomes is achieved by transient transfection or by constructing a stably transfected cell line; said specific nucleic acid molecules are RNA nucleic acid drugs or RNA nucleic acid molecules.

A third aspect of the present invention is to provide nucleic acid drugs or nucleic acid molecules comprising the aforementioned high loading exosome-nucleic acid loading systems.

Preferably, nucleic acid vaccines, nucleic acid antibody drugs, anti-tumor drugs, nucleic acid molecules for gene therapy or tumor cell therapy, or regenerative medicine drugs comprising the aforementioned high loading exosome-nucleic acid loading systems are provided.

A fourth aspect of the present invention is to provide the use of high loading exosome-nucleic acid loading systems in the preparation of nucleic acid drugs.

Preferably, said use of nucleic acid drugs is in the field of nucleic acid vaccines, antineoplastic, gene therapy, cell therapy or regenerative medicine drugs.

Based on the autonomous docking of L7Ae protein or its variants with nucleic acid drugs containing C/D box sequences, and by fusion expression of L7Ae protein or its variants with exosomal membrane proteins such as CD47, specific nucleic acid drugs can be targeted for loading into exosomes.

This invention discloses a system to increase the loading of a specific nucleic acid in an engineered cell exosome, said method comprising:

1) A nucleic acid molecule, said nucleic acid molecule containing a specific sequence to achieve exosome targeting enrichment.

2) Scaffolding protein, said scaffolding protein is assembled into the exosome during exosome biogenesis.

3) C/D box binding proteins L7Ae or its variants are expressed in fusion with exosomal membrane proteins such as CD47, that can bind specific sequences on nucleic acid molecules to ultimately achieve targeted enrichment of nucleic acid drugs in exosomes.

4) The GSSS flexible linker between the exosomal membrane protein and the first C/D box binding protein fused to the GSSSGSSSGS or the rigid linker PWRPWRP between the second C/D box binding protein and/or following L7Ae variants. Rigid linker PWRPWRP can maintain better spatial structure between multiple C/D box binding proteins and reduce the spatial site resistance between C/D box binding proteins and between loaded nucleic acids. This enhances the loading efficiency and stability of bridging proteins and nucleic acid molecules; said flexible junction GSSSGSSSGS causes the fused L7Ae may swing or fold and bend thereby increasing the spatial site resistance, causing lower nucleic acid loading efficiency and loading capacity.

5) Structural modification of exosomal membrane proteins and C/D box binding protein, said structures through multiple tandem linkages of L7Ae, can enhance the binding efficiency and capacity of L7Ae to specific sequences on nucleic acid molecules, ultimately increasing the exosome-loaded nucleic acid drug loading.

Design nucleic acid drug sequences containing C/D box and construct the corresponding plasmids.

Design fusion scaffolding proteins (i.e., exosomal membrane proteins fused to L7Ae or its variants) such as P1, P2, P3, P4, and construct the corresponding plasmids.

Plasmids are transfected into cells, such as HEK293T (abbreviated as 293T) , HEK293F (abbreviated as 293F) , stem or immune cells or other eukaryotic cells, by transfection reagents or electrotransfection to establish stably transfected cell lines or simply to achieve transient transfection.

When cells transfected with the above plasmids produce exosomes, nucleic acid molecules containing specific sequences are enriched into the exosomes by fusion protein expression plasmids P1, P2, P3 and P4. Exosomes are secreted outside the cell while carrying these nucleic acid molecules outside the cell, and when exosomes carrying target nucleic acid molecules are phagocytosed by recipient cells, the exosome loadings are released from the exosome by the recipient cell and perform their functions.

Enrichment of exosomes from cell supernatants by ultracentrifugation or by molecular sieves.

1) Extract total RNA from exosomes and detect whether the nucleic acid molecules are enriched in exosomes by qPCR.

2) Add the enriched exosomes to the culture supernatant of recipient cells, such as 293T, 293F, stem cells or immune cells or other eukaryotic cells, and detect the expression of mRNA or the regulation of nucleic acids such as miRNA.

Compared to existing nucleic acid exosome loading techniques, the present invention has the advantage that: the loading capacity of targeted loading of nucleic acid drugs in engineered cell exosomes can be increased; nucleic acid drugs of different sequences can be loaded; and the method can be implemented in different cell lines.

Figure description

Figure 1 Detection of the effect of CD47-L7Ae on the loading of C/D box containing GFPmRNA in exosomes by microscopy. 1A. The fluorescence images of exosomes donor cells (293T) co-transfected of plasmid expressing C/D box-GFP with or without scaffolding protein CD47-L7Ae expressing 293T cells; 1B. Expression of GFP in recipient 293T cells incubated with exosomes harvest from the culture media of donor 293T cells in 1A.

Figure 2 Quantitative analysis of loading efficiency of C/D box containing luciferase mRNA via scaffolding protein CD47-L7Ae by luciferase reporter. This result indicates that this reporter gene can be used to screening for scaffolding proteins.

Figure 3 Screening for scaffolding proteins that can efficiently load C/D box containing mRNA in exosomes of donor 293T cells. This result demonstrates that P4 is the most effective scaffolding protein in loading of C/D box containing mRNA in exosome of donor 293T cells.

Figure 4 Microscopy analysis of GFP expression of 293T cells transfected with plasmids p458 and p459, respectively.

Figure 5 Quantitative analysis of C/D box-containing luciferase mRNA loaded in exosomes derive from donor cell transfected with plasmids p458 or p459 in presence or absence of scaffolding proteins P1 or P4, respectively.

Figure 6 The map of plasmid P1.

Figure 7 The map of plasmid P2.

Figure 8 The map of plasmid P3.

Figure 9 The map of plasmid P4.

Specific Implementation

The present invention is described in further detail below using specific embodiments and the accompanying figures, but is not intended to limit the scope of the invention.

The relevant nucleic acid used in the invention is synthesized by Bioengineering (Shanghai) Co., Ltd. P1, P2, P3 and P4 sequences were synthesized by Bioengineering (Shanghai) Co., Ltd. Transfection reagent: Polyethylenimine purchased from sigma; The lipofectamine 3000 was purchased from ThermoFisher. Luciferase Reporter Gene Assay Kit Firefly luciferase reporter gene detection kit was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. The MiniBEST Universal RNA Extraction Kit was purchased from TaKaRa, and the HiScript III 1st Strand cDNA Synthesis Kit was purchased from Novozymes. SYBR Premix Ex Taq ^TM II qPCR kit was purchased from TaKaRa.

The experimental principle of the following embodiment is based on the autonomous docking of protein L7Aeand C/D box containing nucleic acid molecules The invention involves the fusion of exosomal membrane protein to the C/D box binding protein L7Ae, and the binding of nucleic acid molecules harboring C/D box sequence. The specific experimentis carried out by co-transfection the cells with the scaffolding protein expression plasmid containing the C/D box binding protein L7Ae and the expression plasmid containing the specific nucleic acid sequence to be loaded in the C/D box. After successful transfection verification, the exosomes containing purpose-designed nucleic acid molecules is enriched and harvested from supernatant. The supernatant of the enriched exosomes is then added to new recipient cells for cell culture (where the nucleic acid molecules loaded in the exosomes are pre-defined mRNA, circRNA and/or lncRNA carrying C/D box or homologous derived sequences) . The recipient cells are recovered for validation and quantification, and if the nucleic acid loading is successful, then the recipient cells will take up the exosomes from the donor cells and express the exosome-loaded nucleic acid in recipient cells.

Example 1: Screening of scaffolding protein for exosome nucleic acid loading

(1) Screening of the scaffolding protein by GFP reporter

The scaffolding protein expression plasmid expressing exosomal protein fused with C/D box binding protein L7Ae and the C/D box-GFP reporter plasmid were constructed. 293T cells were cultured in24-well plates and the scaffolding protein. The scaffolding protein expression plasmid and GFP reporter plasmid (C/D box-GFP plasmid) were co-transfected, and the supernatant was removed and replaced with medium exosome-free serum to continue culture in incubator at 37℃, 5%CO₂for 24h. The fluorescence image was taken as shown in Figure 1A, proving that the plasmid co-transfection was successful. The supernatant of the medium was enriched and cultured for 34 h. The supernatant was centrifuged at 300×g for 5 min, transferred to a new 1.5 mL tube, centrifuged again at 2000×g for 5 min, and the supernatant was added to a new 24-well plate of 293T recipient cells, and the fluorescence was observed under microscope after 48h. The co-transfection of scaffolding protein CD47-L7Ae expression plasmid with C/D box-GFP plasmid demonstrate a faint green fluorescenceas shown in 1B. No fluorescence was observed in the 293T blank control and C/D box-GFP plasmid transfection groups alone. Also, faint green fluorescence was observed in the co-transfected groups of other scaffolding proteins. The results of this experiment demonstrated that CD47-L7Ae can be used as a scaffolding protein for nucleic acid loading in exosome, but the fluorescence of GFP in this experiment was relatively weak, and only a few cells could be observed to have luminescence, so the fluorescence intensity of the recipient cells was increased by increasing the content of exosomes in the supernatant.

The Luciferase reporter gene system is an experiment that uses luciferin as a substrate to detect the luciferase activity of fireflies. The luciferin substrate is capable of emitting light (wavelength 540-600 nm) in the presence of luciferase, and the light intensity reflects the expression of luciferase.

(2) Screening of scaffolding proteins by luciferase reporter

Plasmid construction was performed by replacement of the GFP portion of the sequence of the C/D box-GFP plasmid with a Luciferase reporter gene. After plasmid construction, the screening experiments for scaffolding proteins were performed as described above again. Prepare 293T cells in 6-well plates for plasmid co-transfection, remove the supernatant and replace with medium containing 10%exosome-free serum to continue cells at 37℃, 5%CO₂ for 24h, collect the supernatant of culture medium and centrifuge at 300×g for 5 min to remove the cell, transfer the supernatant to a new 1.5 mL tube, centrifuge again at 2000×g for 5 min to removed cell debris, and add the supernatant (contains exosomes) to a new 24-well plate of 293T cells. The supernatant was added to 293T recipient cellsin a new 24-well plate, and the cells were recovered at 48 h for luciferase activity assay. The results of the luciferase activity assay showed that the co-transfectionof CD47-L7Ae framework protein plasmid and C/D box-Luc plasmid was higher than that of 293T blank control group and C/D box-Luc plasmid transfection group alone, as shown in Figure 2. The results of this experiment demonstrate that CD47-L7Ae can be used as a scaffolding protein for exosome nucleic acid molecule loading.

Although, the results of this experiment showed that CD47-L7Ae could be used as a scaffoldingprotein for exosome loading, its loading efficiency was not very high. In order to improve the loading efficiency, we performed an in-depth analysis and modification of thestructure of CD47-L7Aestructure.

Example 2: Structural optimization and verification of scaffolding protein CD47-L7Ae (n)

(1) Structure optimization of scaffolding protein CD47-C/D box binding protein L7Ae

In order to enhance the loading efficiency of nucleic acid moleculesin exosomes, the structure of exosomal membrane protein CD47 and C/D box binding protein L7Ae were analyzed and modified. Different linkers of CD47 fused to L7Ae were tested. A GSSS flexible linker and a rigid linker PWRP was designed for the fusion of CD47 and L7Ae or its variant and the structure of the C/D box binding protein L7Ae rigid linker was optimizedto realize a tandem of multiple C/D box binding proteins. Four plasmids, P1, P2, P3 and P4, were designed to express exosomal membrane proteinCD47, GSSS flexible linker and C/D box binding protein L7Ae and/or its variants. In order to reduce the spatial resistant between the two proteins, the rigid linker sequence of PWRPWRP was designed and applied to P4 plasmid. The maps of these four plasmids were shown in Figure 6-9. The following is the amino acid sequence of the scaffolding fusion protein expressed by these plasmids.

Amino acid sequence of P1 scaffolding fusion protein (CD47-GSSS-1×L7Ae-WT sequence, where the italicized part is the GSSS flexible linker sequence and all capital letters are amino acid abbreviations, SEQ ID NO. 1)

Amino acid sequence of P2 scaffolding fusion protein (CD47-GSSS-1×L7Ae-del-C21, where the italicized lettersindicate the GSSS flexible linker, ) (SEQ ID NO. 2) :

P3 scaffolding fusion protein sequence (CD47_GSSSGSSSGS_3×L7Ae-WT sequence, where the italicized letters indicate the flexible linker) (SEQ ID NO. 3) :

The P4 scaffolding fusion protein sequence (CD47-GSSS-2×L7Ae_delC21-1×L7Ae-WT sequence, where the italicized part is the GSSS flexible linker sequence and PWRPWRP rigid linker sequence, all capitalized are amino acid abbreviations, where the first two C/D box binding proteins areL7Ae_delC21. The third C/D box binding protein is L7Ae-WT, CD47 is linked to the first C/D box binding protein via GSSS, the first C/D box binding protein is linked to the second C/D box binding protein via PWRPWRP, and the second C/D box binding protein is linked to the third C/D box binding protein via PWRPWRP, corresponding to SEQ ID NO. 4) :

The P1-P4 plasmid was constructed by inserting the nucleotide sequence encoding the above P1-P4 scaffolding fusion protein into the vector pcDNA3 (+) , where the nucleotide sequence encoding the above P1-P4 scaffolding fusion protein was joined at the 5'end by the nucleotide sequence AAGCTT (restriction site) and at the 3'end by the nucleotide sequence GAATTC (restriction site) .

(2) Screening and validation of scaffolding protein-mediated the loading efficiency of mRNA containing C/D box sequence in exosomes by luciferase reporter gene

After the plasmids (shown in Figure 6-9) were constructed, 293T cells cultured in 6-well plates were co-transfected with P1, P2, P3 and P4 scaffolding protein (CD47-L7Ae protein) and C/D box-Luc expression plasmid, respectively for 6 h. The medium was changed to medium containing 10%exosome-free serum and incubated at 37℃ with 5%CO₂ for 34 hours. The cell medium was collected and centrifuged at 300×g for 5 min, and the supernatant was transferred to a new 1.5 mL tube and centrifuged at 2000×g for another 5 min to collect the supernatant. The supernatant was then added to 293T recipient cells cultured in 24-well plates, and the culture was continued for 48 h. The cells were collected and assayed for luciferase activity. The results of luciferase activity assay showed that the co-transfection groups of newly constructed P1 and P4 plasmids with C/D box-Luc plasmids significantly improved the nucleic acid loading efficiency of exosomes (as shown in Figure 3) . In particular, the P4 group showed an approximately 3-fold increase in loading efficiency compared to the control group. The CD47-L7Ae (i.e., plasmids corresponding to the formation of fusion protein by CD47 directly with a wild-type L7Ae) and C/D box-Luc groups were the control groups, and the 293T group was the blank control group. The results of this experiment demonstrate that the newly constructed P4 can be used as a scaffolding protein (i.e., exosomal membrane protein CD47-L7Ae (n) fusion protein, here “n” is 3) for the loading of specific mRNA molecules containing C/D box into exosomes.

Example 3: Scaffolding protein P4 can enhance the loading efficiency of specific nucleic acid molecules (mRNA-C/D box) in exosomes

Weidentified the scaffolding P4 that could increase the loading efficiency of purpose-designed nucleic acid loading into exosomes by microscopy, here we performed RT-qPCR to confirm P4’s loading efficiency at transcription level. The preparation of the engineered exosomes and their application involved in this embodiment mainly comprises the following steps.

(1) Plasmid design and expression of nucleic acid molecules containing C/D box sequence

Two growth factor expressing plasmids were designed and constructed in PCDNA3+ backbone. One plasmid contains the CDS sequence encoding insulin which fused with EGFP gene with a C/D box cassette after the stop codon of GFP (I01-EGFP-C/D box, p458) . The other is the signal peptide of IL-2fused with Flag-EGF as well as EGFP with a C/D box sequence after the stop codon of GFP (E01-EGFP-C/D box, p459) .

The amino acid sequence of I01-EGFP-C/D box cassette (where letters in bold refers to I01) indicates the amino acid sequence of insulin, the italicized letters showthe amino acid sequence of EGFP (enhanced green fluorescent protein) , and all letters capitalized are amino acid abbreviations. Among them, SEQ ID NO. 5 is the amino acid sequence of the insulin and EGFP fusion protein. In the construction of the plasmid, the insulin-EGFP fusion protein CDS sequence is immediately followed by the C/D box sequence (SEQ ID NO. 17) .

In constructing the corresponding plasmid, the nucleic acid sequence encoding the insulin, the nucleic acid sequence encoding EGFP protein, the stop codon, and the C/D box sequence were sequentially joined. The nucleic acid sequence encoding EGFP protein is followed by the stop codon, and after the stop codon is the C/D box sequence, which is 5'gggcgtgatccgaaaggtgaccc3'(SEQ ID NO. 17) .

The amino acid sequence of E01-EGFP-C/D box (where underlined letters indicates the signal peptide sequence from IL2, bold and italicized sequence DYKDDDDK is Flag tag sequence, letters in bold is E01) , which is the sequence of EGF (epidermal growth factor) , italicized unbolded part is EGFP sequence. The amino acid sequence of EGF and EGFP fusion protein is shown in the SEQ ID NO. 6. In the construction of the plasmid, the EGF-EGFP fusion protein CDS sequence is followed by the C/D box sequence, SEQ ID NO. 17)

For brief description, the amino acid sequences of EGF and EGFP are shown above along with the C/D box nucleic acid sequences.

In constructing the corresponding plasmids, the nucleic acid sequence encoding the IL2 signal peptide, the nucleic acid sequence encoding Flag, the nucleic acid sequence encoding EGF, the nucleic acid sequence encoding EGFP protein, the stop codon, and the C/D box sequence were sequentially joined. The nucleic acid sequence encoding EGFP protein is followed by the stop codon, and after the stop codon is the C/D box sequence, which is 5'gggcgtgatccgaaaggtgaccc3'(SEQ ID NO. 17) .

Among them, the amino acid sequence of CD47 is shown in SEQ ID NO. 18, the amino acid sequence of L7Ae-del-C21 is shown in SEQ ID NO. 19, the amino acid sequence of L7Ae-WT is shown in SEQ ID NO. 20, and the amino acid sequence of EGFP is shown in SEQ ID NO. 21.

The present invention first verified the expression of two plasmids in 293T cells, as shown in Figure 4. After transfecting 293T cells with Lipo3000 reagent for 24 h, we observed the expression of EGFP under fluorescence microscopy. Results from this experiment indicated that this nucleic acid drug sequence could express the corresponding target protein normally.

(2) Validation of scaffolding protein P4-mediated the loading efficiency of mRNA containing C/D box sequence in exosomes by RT-qPCR

To verify the efficiency of scaffolding protein-mediated loading of target nucleic acids in exosomes, we performed a quantitative reverse transcription PCR experiment. The experiment was divided into six groups, P458, P459, P458+P1, P458+P4, P459+P1 and P459+P4. Scaffolding protein expressing plasmids (P1 and P4) were cotransfected with target nucleic acid plasmids to be loaded (P458 and P459) carrying C/D box genes into 293F cells in suspension culture by PEI, respectively. The cell density at the time of transfection was 1×10⁶cells/mL, and two T75-sized culture flasks of cell volume were prepared for transfection in each group.

The cell transfection procedure is as follows, taking group p458+p1 as an example, for the preparation of A solution, 10 μg of plasmid p458 and 10 μg of plasmid p1 (total 20 μg) of plasmid DNA were added to a 1.5 mL sterile centrifuge tube with a pipette, then 375 μL of Opti-MEM was added to the centrifuge tube with a pipette, mixed by gentle blowing, and left to stand at room temperature for 5 min. While preparing A solution, prepare B solution, add 37.5 μL of PEI (final concentration: 1 μg/μL) to 375 μL of Opti-MEM with a pipette, mix gently, and leave for 5 min at room temperature. add B solution to A solution with a 1 mL pipette, mix gently, and leave for 20 min at room temperature. then add the mixed AB solution to the cultured cells for transfection. After 5 h of transfection, the cells were replaced with fresh complete medium at 37℃, 5%CO₂ incubator to continue the cell culture. To increase the content of exosomes in the supernatant, the cells were continued to be cultured for 50 h. The cell suspension was then transferred to a 50 mL centrifuge tube and centrifuged at 3,000 × g for 30 min. The supernatant was transferred to an SEC column and the exosomes in the supernatant were purified using the SEC column.

The steps for quantitative analysis of mRNA in enriched exosomes by qPCR are as follows: Firstly, total mRNA in exosomes is extracted using RNA kits, then mRNA is reverse transcribed into cDNA using reverse transcription kits, and finally, mRNA is relatively quantified by fluorescent quantitative PCR experiments. The specific operation procedure is as follows.

a) Removal of genomic DNA

To remove the genomic DNA from the RNA extract, the following reaction was performed. Table 1 shows the composition of the reaction system. Reaction conditions: 42℃, 2 min; 4℃storage.

Table 1 Genomic DNA Removal System

b) Reverse transcription

To obtain the template for qPCR, the reverse transcription reaction was performed as follows. Table 2 shows the components of the reverse transcription reaction system. The reverse transcription reaction was carried out at 37℃ for 15 min, and kept at 85℃ for 5 s and stored at 4℃. Table 2 Components of the reverse transcription system

c) Quantification of specific mRNA loaded in exosomes by qPCR

In the reaction of qPCR, H-GAPDH was used as the internal reference, and the primer sequence list refers to Table 3 (corresponding to SEQ ID NO. 7-16 in turn) .

Table 3 List of Primer Sequences

Table 4 shows the components of reaction system. The qPCR reaction was performed as the conditions: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 30s (45 cycles) ; and keep at 4℃ for 10min. Table 4. The components of qPCR reaction system

The qPCR results showed that co-transfection of plasmid expressing nucleic acid molecules containing C/D box sequence and the plasmid encoding scaffolding protein P4 could significantly enhance the loading of target protein mRNA carrying C/D box in exosomes, as shown in Figure 5. The groups P458 and P459 are controls and Group 293F is a blank control group.

The present invention achieves increased loading efficiency of specific nucleic acid molecules through the directed design of engineered cells to their engineered cellular exosomes. The present invention discloses the design principle of engineered cells to obtain high loading capacity of nucleic acid molecules of interest containing exosomes. based on multiple tandems of L7Ae protein or/and its variants autonomously docked with nucleic acids to be loaded containing C/D box sequence, and the loading of nucleic acid molecules of interest into exosomes through fusion proteins constructed by C/D box binding protein L7Ae or/and its variants with exosomal membrane proteins such as CD47. This method can effectively improve the ability of exosomes to load specific nucleic acids, and provides an important theoretical and technical basis for drug development using exosomes as nucleic acid drug delivery systems in the direction of nucleic acid vaccines, antitumor drugs, nucleic acid antibody drugs, cell therapy and regenerative medicine. The engineered exosomes produced by the present invention can carry a variety of nucleic acid drugs with high functionality and have versatility in nucleic acid drug delivery.

The above description is not a limitation of the present invention, nor is the present invention limited to the above embodiments. Changes, modifications, additions or replacements made by a person of ordinary skill in the art within the substantial scope of the present invention shall also fall within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

A high-load exosome-nucleic acid loading system characterized by comprising a scaffolding protein expression plasmid for exosome loading of nucleic acids, an expression plasmid for a specific nucleic acid sequence to be loaded.

Scaffolding protein expression plasmids for exosome loading nucleic acids containing the coding sequences for exosomal membrane proteins, and at least one coding sequence for the bridging protein L7Ae or/and variants thereof.

A specific nucleic acid sequence expression plasmid comprising a specific nucleic acid molecule to be loaded and a specific sequence directly or indirectly linked to the specific nucleic acid molecule to be loaded, wherein the specific sequence is a C/D box sequence or a C/D box-derived sequence with equivalent function, said specific sequence being autonomously docked to L7Ae or a variant thereof.
A high loading exosome-nucleic acid loading system according to claim 1, characterized in that said scaffolding protein is: an exosomal membrane protein-L7Ae (n) fusion protein formed by tandem fusion expression of an exosomal membrane protein with a plurality of bridging proteins L7Ae or/and variants thereof, “n” being the number of L7Ae or/and variants thereof; said exosome-loaded nucleic acid is expressed with a scaffolding protein expression plasmid and a specific nucleic acid sequence expression plasmid to be loaded, and the specific nucleic acid molecule to be loaded into the cellular exosome by cotransfection.
A high loading exosome-nucleic acid loading system according to claim 1, characterized in that said scaffolding protein comprises CD47 or other exosomal membrane proteins (i.e., including but not limited to CD47) in tandem with L7Ae or/and variants thereof at its C-terminus.
A high loading exosome-nucleic acid loading system according to claim 2, characterized in that said specific nucleic acid sequence expression plasmid to be loaded further comprises interlinked specific nucleic acid molecules to be loaded and a C/D box sequence or a homofunctional derivative thereof.
A high-load exosome-nucleic acid loading system according to claim 1, characterized in that the exosomal membrane protein is fused to the C/D box binding protein L7Ae or/and its variants by flexible or/and rigid linker; when more than one said the C/D box binding protein L7Ae or/and its variants form a tandem, the adjacent protein L7Ae and its variants are fused to each other by rigid linker.
A high-load exosome-nucleic acid loading system according to claim 1, characterized in that the variant of the C/D box binding protein L7Ae refers to the L7Ae variant obtained by removing 21 amino acids from the carboxyl terminus of wild-type L7Ae, or to any other L7Ae variant that reduces the L7Ae-RNA binding spatial resistance.
A high-load exosome-nucleic acid loading system according to claim 5, characterized in that said flexible linker comprises, but is not limited to, GSSS, GSSSGSSSGS or GGS, and said rigid linker comprises, but is not limited to, PWRPWRP or PWRP; an exosome loading scaffolding protein expression plasmid for nucleic acids when more than one of said bridging proteins L7Ae or/and variants thereof form a tandem, the flexible linker and/or rigid linker being more than one or only one sequence, and the C/D box binding protein L7Ae or variants thereof being more than one or only one sequence.
A high-load exosome-nucleic acid loading system according to claim 2, characterized in that said specific nucleic acid molecule to be loaded is a nucleic acid sequence; the amino acid sequence of the scaffolding protein is shown in SEQ ID NO. 4.
A high-load exosome-nucleic acid loading system according to claim 1, characterized in that said specific nucleic acid molecules to be loaded are nucleic acid sequences encoding vaccine antigens, antitumor nucleic acid drugs, nucleic acid antibody drugs or other nucleic acid molecules encoding various growth factors, antibodies and proteins.
A high loading exosome-nucleic acid loading system according to claim 1, characterized in that said specific nucleic acid molecule to be loaded is a nucleic acid sequence encoding EGF, a nucleic acid sequence encoding insulin, or a nucleic acid molecule of another growth factor.
A high loading exosome-nucleic acid loading system according to claim 2, characterized in that the C/D box sequence is as shown in SEQ ID NO. 17 or is an equivalent functional derivative thereof.
A method for increasing the load of a specific nucleic acid molecule in a cellular exosome, characterized in that it comprises the following steps:

Construction of a scaffolding protein expression plasmid for cellular exosome loading nucleic acids and a specific nucleic acid sequence expression plasmid to be loaded; the scaffolding protein expression plasmid for exosome loading nucleic acids contains the coding sequence of an exosomal membrane protein, and the coding sequence of at least one C/D box binding protein L7Ae or/and a variant thereof; the specific nucleic acid sequence expression plasmid comprises a specific nucleic acid molecule to be loaded and a C/D box sequence directly or indirectly linked to the specific nucleic acid molecule to be loaded.

The scaffolding protein expression plasmid is co-transfected with an expression plasmid for the specific nucleic acid sequence to be loaded into exosome donor cells, which are HEK293T, HEK293F, stem cells or immune cells, and the exosome membrane protein is expressed in fusion with the C/D box binding protein L7Ae or/and its variants to form a fusion protein, which is the scaffolding protein described, wherein the C/D box or a equivalent functional derivative sequence thereof is autonomously docked to L7Ae and variants, thereof such that the specific nucleic acid molecule to be loaded is loaded into the exosome via the fusion protein, and the exosome is secreted outside the cell while carrying the specific nucleic acid sequence molecule outside the cell, thus allowing enrichment of exosomes containing specific nucleic acid molecules from cell supernatants.
The method according to claim 12, characterized in that loading of a specific nucleic acid molecule to be loaded into a cellular exosome is achieved by transient transfection or by constructing a stably transfected cell line; said specific nucleic acid molecule to be loaded being any RNA nucleic acid drug or RNA nucleic acid molecule carrying a C/D box or anequivalent functional derivative sequence thereof.
A nucleic acid drug or nucleic acid molecule comprising the high loading exosome-nucleic acid loading system of any one of claims 1-11, characterized in that said nucleic acid drug or nucleic acid molecule is a nucleic acid vaccine, an antitumor nucleic acid drug, a nucleic acid antibody drug, a nucleic acid molecule for gene therapy or tumor cell therapy, and a regenerative medicine drug.
The use of the high loading exosome-nucleic acid loading system in the preparation of nucleic acid drugs as shown in any one of claims 1-11, characterized in that said nucleic acid drug use is in the field of nucleic acid vaccines, antineoplastic, gene therapy, cell therapy, or regenerative medicine drugs.