WO2024090815A1 - Production of human papillomavirus virus-like particles from plant - Google Patents

Production of human papillomavirus virus-like particles from plant Download PDF

Info

Publication number
WO2024090815A1
WO2024090815A1 PCT/KR2023/014783 KR2023014783W WO2024090815A1 WO 2024090815 A1 WO2024090815 A1 WO 2024090815A1 KR 2023014783 W KR2023014783 W KR 2023014783W WO 2024090815 A1 WO2024090815 A1 WO 2024090815A1
Authority
WO
WIPO (PCT)
Prior art keywords
hpv16
protein
recombinant protein
plant
dna construct
Prior art date
Application number
PCT/KR2023/014783
Other languages
French (fr)
Korean (ko)
Inventor
황인환
탕가라스 무타밀세르반
이동욱
곽주원
Original Assignee
포항공과대학교 산학협력단
주식회사 셀루메드
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 포항공과대학교 산학협력단, 주식회사 셀루메드 filed Critical 포항공과대학교 산학협력단
Publication of WO2024090815A1 publication Critical patent/WO2024090815A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14—Extraction; Separation; Purification
    • C07K1/16—Extraction; Separation; Purification by chromatography
    • C07K1/22—Affinity chromatography or related techniques based upon selective absorption processes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)

Definitions

  • the present invention relates to a technology for producing human papilloma virus-like particles from plants. More specifically, the present invention relates to a technology for producing human papilloma virus-like particles from plants, by controlling the amino acid length of the chloroplast transit peptide, placing SUMO protein at its N-terminus, and then fusing it with the HPV L1 protein. This relates to technology for effectively producing human papilloma virus-like particles in chloroplasts.
  • HPV L1 protein the main capsid protein
  • HPV L1 protein can be used as a vaccine.
  • HPV L1 protein can be manufactured as a virus-like particle (VLP) without genomic DNA, which is almost identical to a natural virus and provides immunity. It is known to induce a response (Chabeda et al. 2018).
  • HPV L1 VLPs were recently successfully produced using yeast and insect expression systems and commercialized as vaccines called Gardasil and Cervarix (Jorma Paavonen et al. 2007; Keith S Reisinger et al. 2007). Its efficacy in preventing cervical cancer has been proven.
  • recombinant proteins accumulate in various organelles such as the endoplasmic reticulum, vacuole, oil-body, extracellular space, and chloroplast. can do.
  • the optimal cell organelle may be different depending on the type of recombinant protein of interest and its structural characteristics. Therefore, by screening various cell organelles according to the recombinant protein and selecting the optimal organelle, the recombinant protein is effectively accumulated. Production yield can be increased.
  • the structure formation of the desired recombinant protein may vary depending on the cell organelle, so it is particularly important to select the optimal cell organelle suitable for the desired recombinant protein.
  • chloroplasts exist in large numbers in plant cells, and occupy the second largest intracellular space in plant cells after the vacuole, making them very advantageous for accumulating and storing recombinant proteins.
  • Several research groups have already successfully moved the HPV16 L1 protein to chloroplasts and assembled it into VLPs and capsomers, and when this was injected into mice as a vaccine, it was confirmed that neutralizing antibodies were induced (J Maclean et al. 2007; Fernandez-San Millan A et al. 2008; Paulina N Naupu et al.
  • a chloroplast transit peptide In order to move a recombinant protein to the chloroplast, a chloroplast transit peptide can be fused to the recombinant protein.
  • the chloroplast transit peptide is a chloroplast transit signal that functions at the N-terminus of the protein, and is transmitted through the endoplasmic reticulum, nucleus, and peroxisomes. It has the characteristic of being relatively long compared to the movement signal of proteins that move to peroxisomes.
  • HPV16 L1d22 recombinant protein was expressed in plants by fusing 59 amino acid residues from the N-terminus of the RbcS-derived transit peptide to the (HPV16 L1d22) protein of HPV16 L1 with 22 amino acid residues deleted at the C-terminus.
  • a VLP formed by the HPV16 L1d22 recombinant protein has been produced in the chloroplast.
  • the HPV16 L1d22 recombinant protein was moved to the chloroplast, the N-terminus of the transit peptide was degraded, but the five amino acid residues at the C-terminus of the transit peptide were still retained by the recombinant protein. It was confirmed to be fused to a protein. (Maryam Zahin et al. PLoS One. 2016; 11(8): e0160995.)
  • the present invention has made diligent efforts to develop an HPV16 L1 protein production system that can solve the above technical problems.
  • the amino acid length of the chloroplast transit peptide is adjusted, a SUMO protein is placed at the N-terminus, and the HPV16 L1 protein is fused.
  • the HPV16 L1 protein can be effectively transported to the chloroplast of the plant, while the transit peptide is completely removed, and at the same time, the same protein as the original HPV16 L1 protein without the C-terminal amino acid deletion can be effectively produced, and the protein efficiently forms VLP.
  • the present invention was completed by confirming.
  • the purpose of the present invention is to provide a system that can efficiently produce human papilloma virus-like particles from plants.
  • the present invention provides a first DNA construct containing nucleotides encoding a fusion protein comprising (i) a chloroplast transfer peptide, (ii) a SUMO protein, and (iii) an HPV16 L1 protein. do.
  • the first DNA construct includes 5'UTR; and/or may be characterized as additionally comprising a UBQ10 intron nucleotide sequence.
  • the first DNA construct may further include a nucleotide sequence encoding the P19 protein.
  • the (i) chloroplast transfer peptide may be characterized as comprising the 1st to 60th amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 3.
  • the present invention also provides the first DNA construct; and a second DNA construct comprising a sequence encoding a SUMO protease.
  • the present invention also provides the first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
  • the plant cells include Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, rice, It may be characterized as being derived from a plant selected from the group consisting of barley, wheat, rye, corn, sugar cane, oats and onions.
  • the present invention also provides a method for producing HPV16 L1 recombinant protein in plant cells comprising the following steps:
  • step (b) may be characterized in that the total soluble protein extract obtained by disrupting the cultured plant cells is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
  • the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl).
  • step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
  • the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles.
  • the present invention also provides the first DNA construct or the first DNA construct.
  • the transgenic plants include Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, and rice. , barley, wheat, rye, corn, sugar cane, oats and onions.
  • the present invention also provides a method of producing HPV16 L1 recombinant protein in a transgenic plant comprising the following steps:
  • step (b) may be characterized in that the total soluble protein extract obtained by crushing the tissue isolated from the plant is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
  • the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl).
  • step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
  • the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles.
  • the present invention also provides an HPV16 vaccine composition comprising the HPV16 L1 recombinant protein produced by the above method.
  • the HPV L1 recombinant protein production system effectively transfers the HPV16 L1 recombinant protein to the chloroplasts of plants, and at the same time, the chloroplast transfer peptide fused for movement to the chloroplasts can be completely removed after movement to the chloroplasts, and the HPV16 L1 recombinant protein can be completely removed. It has the advantage of being manufactured in the form of virus-like particles that induce an immune response almost identical to a natural virus when administered in the body while improving the expression level in plant cells.
  • Figure 1 shows N-terminal fragments of various lengths (54, 60, 70, and 79 amino acid residues) were synthesized with green fluorescent protein (GFP) to confirm the efficiency of migration into chloroplasts depending on the length of the N-terminal region of the Arabidopsis RbcS gene. ), constructing a recombinant gene to be fused to the N-terminus, introducing it into Arabidopsis protoplasts, and confirming the efficiency of transfer to chloroplasts. The processed form and precursor form of the GFP-fusion protein were detected using an anti-mouse-GFP antibody.
  • GFP green fluorescent protein
  • Figure 2 shows various recombinant DNA constructs designed to express the HPV16 L1 recombinant protein according to the present invention in plants.
  • Figure 3 shows that N. benthamiana leaf tissue was transformed with an expression vector containing the recombinant DNA construct constructed in Figure 2 using the Agrobacterium-mediated infiltration method, and 19 ⁇ g of total soluble protein from the leaf tissue extract was infiltrated with SDS/ This is the result of development by PAGE and Western blotting using CBB staining or anti-HPV16 L1 antibody.
  • Figure 4 shows the total soluble protein extract obtained from the leaf tissue of N. benthamiana expressing the HPV16 L1 recombinant protein using heparin affinity chromatography using heparin affinity resin to obtain HPV16 L1 without contamination of the host protein.
  • the HPV16 L1 protein was allowed to bind to the heparin affinity resin while changing the NaCl concentration of the total water-soluble protein extract, and then the protein bound to the heparin affinity resin was released at a concentration of 0.8 M NaCl.
  • the results were confirmed by CBB (coomassie brilliant blue) staining (left) or Western blotting using anti-HPV16 L1 antibody (right) after development by SDS-PAGE.
  • Figure 5 shows (A) the absorbance of each fraction purified from HPV16 L1 protein by additional size exclusion chromatography after heparin affinity chromatography and (B) development by SDS/PAGE using anti-HPV16 L1 antibody. This is the result of Western blotting.
  • Figure 6 shows the isolation and purification of VLPs of HPV16 L1 recombinant protein from N. benthamiana transgenic plants according to an embodiment of the present invention, negative staining thereof, and observation with a transmission electron microscope at magnifications of (A) 150,000 and (B) 250,000. It is a result.
  • Figure 7 shows a plate coated with (A) purified HPV16 L1 recombinant protein VLP derived from a transgenic plant or (B) purified and disassembled HPV16 L1 recombinant protein derived from a transgenic plant, followed by PBS, PBS (vehicle, control).
  • A purified HPV16 L1 recombinant protein VLP derived from a transgenic plant
  • B purified and disassembled HPV16 L1 recombinant protein derived from a transgenic plant
  • the length of the chloroplast transfer peptide is adjusted to more than 60 amino acids, a SUMO protein is placed at the N-terminus, the HPV16 L1 protein is fused, and the SUMO protein is subjected to protein hydrolysis using bdSENP1, a SUMO-specific protease.
  • proteolytic cleavage the HPV16 L1 protein was effectively moved to the chloroplast of the plant and at the same time, the HPV16 L1 protein with the transit peptide completely removed was effectively produced.
  • a translational enhancing sequence was placed in the 5' UTR, and a recombinant gene construct was constructed including the UBQ10 intron in its 5' upstream region. .
  • the present invention provides a first DNA construct comprising nucleotides encoding a fusion protein comprising (i) a chloroplast transit peptide, (ii) a SUMO protein, and (iii) an HPV16 L1 protein. It's about trucks.
  • the first DNA construct may be a DNA construct for producing HPV16 L1 recombinant protein in plants, and the HPV16 L1 recombinant protein may be represented by the amino acid sequence of SEQ ID NO: 1. It can be done as, but is not limited to this.
  • the chloroplast transfer peptide may be characterized as comprising the 1st to 60th amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 3, but is not limited thereto.
  • the chloroplast transfer peptide is 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 from the N-terminus of the amino acid sequence shown in SEQ ID NO: 3. It may be characterized as containing 75, 76, 77, 78, 79 or 80 amino acids.
  • the chloroplast transfer peptide is characterized in that it contains at least 70, more preferably at least 80 amino acids from the N-terminus of the amino acid sequence shown in SEQ ID NO: 3 in order to further enhance the efficiency of movement into chloroplasts. It can be done, but it is not limited to this.
  • the SUMO protein may be characterized as being represented by the amino acid sequence of SEQ ID NO: 5, but is not limited thereto, and a person skilled in the art will be able to cleave the SUMO domain derived from various organisms and the same. It will be obvious that it can be used by appropriately changing it to a SUMO protease that can be used.
  • the first DNA construct includes 5'UTR; and/or may be characterized as additionally comprising a UBQ10 intron nucleotide sequence.
  • the 5' UTR sequence may be characterized as being represented by the nucleotide sequence of SEQ ID NO: 14, but is not limited thereto.
  • the UBQ10 intron nucleotide sequence may be characterized as being represented by the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.
  • the first DNA construct may further include a nucleotide sequence encoding the P19 protein.
  • the P19 protein may be characterized as being represented by the amino acid residue of SEQ ID NO: 10, but is not limited thereto.
  • the present invention provides, in order to completely remove the chloroplast transfer peptide after the HPV16 L1 recombinant protein moves to the chloroplast, the first DNA construct; and a second DNA construct comprising a sequence encoding a SUMO protease.
  • the SUMO protease may be characterized as represented by the amino acid sequence of SEQ ID NO: 8, but is not limited thereto.
  • the present invention provides the first DNA construct; the second DNA construct; and a third DNA construct comprising a nucleotide sequence encoding a P19 protein.
  • the gene used in the present invention can be modified in various ways in the coding region within the range that does not change the amino acid sequence of the protein expressed from the coding region, and can be modified in a variety of ways without affecting the expression of the gene in parts other than the coding region. Modification or modification may be made, and such modified genes are also included within the scope of the present invention.
  • the present invention also includes polynucleotides having substantially the same base sequence as the gene and fragments of the gene.
  • substantially identical polynucleotide refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of sequence homology.
  • the fragment of the gene also refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of the length of the fragment.
  • amino acid sequence of the protein that is the expression product of the gene of the present invention can be obtained from various biological resources such as microorganisms to the extent that it does not affect the titer and activity of the enzyme, and proteins obtained from other biological resources can also be obtained. included within the scope of the present invention.
  • the present invention also includes polypeptides and fragments of the polypeptides having substantially the same amino acid sequence as the protein.
  • substantially identical polypeptide refers to a protein having the same function as that used in the present invention, regardless of amino acid sequence homology.
  • the fragment of the polypeptide also refers to a protein having the same function as that used in the present invention, regardless of the length of the fragment.
  • the protein used in the present invention may have some amino acids substituted, and the amino acid substitutions in the present application may be non-conserved substitutions.
  • Such non-conservative substitutions include, for example, replacing an amino acid residue with a particular side chain size or a particular property (e.g., hydrophilicity) with an amino acid residue with a different side chain size or a different property (e.g., hydrophobicity).
  • it may involve altering amino acid residues of the target protein or polypeptide.
  • the amino acid substitutions may also be conserved substitutions.
  • conserved substitutions include, for example, replacing an amino acid residue with a particular side chain size or particular characteristic (e.g., hydrophilicity) with an amino acid residue with the same or similar side chain size or the same or similar characteristic (e.g., still hydrophilic). It may include altering amino acid residues of the target protein or polypeptide in a conserved manner, such as: These conserved substitutions generally do not significantly affect the structure or function of the produced protein.
  • an amino acid sequence variant that is a mutation of a fusion protein, a fragment thereof, or a variant thereof in which one or more amino acids are substituted may include conserved amino acid substitutions that do not significantly change the structure or function of the protein.
  • a group of amino acids with non-polar side chains alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine.
  • a group of uncharged amino acids with polar side chains glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • a group of negatively charged amino acids with polar side chains aspartic acid and glutamic acid.
  • a group of positively charged basic amino acids lysine, arginine, and histidine.
  • a group of amino acids with phenyl phenylalanine, tryptophan and tyrosine.
  • Proteins, polypeptides and/or amino acid sequences encompassed by the present invention may also be understood to include at least the following range: variants or homologues having the same or similar function as the protein or polypeptide.
  • the variant may be a protein or polypeptide produced by substitution, deletion or addition of one or more amino acids compared to the amino acid sequence of the protein and/or the polypeptide.
  • such functional variants include substitutions, deletions and/or insertions of at least one amino acid, e.g. 1-30, 1-20 or 1-10, alternatively e.g. 1, 2, 3, 4. , or it may include a protein or polypeptide having an amino acid change by substitution, deletion and/or insertion of 5 amino acids.
  • the functional variant may substantially retain the biological properties of the protein or polypeptide prior to the change (eg, substitution, deletion, or addition).
  • the functional variant may retain at least 60%, 70%, 80%, 90%, or 100% of the biological activity of the protein or polypeptide prior to the change.
  • the homologue is at least about 80% (e.g., at least about 85%, about 90%, about 91%, about 92%, about 93%) the amino acid sequence of the protein and/or polypeptide. %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) may be a protein or polypeptide having sequence homology.
  • the homology generally refers to similarity, significance, or association between two or more sequences. “Percent of sequence homology” refers to identical nucleic acid bases (e.g. A, T, C, G, I) or identical amino acid residues (e.g. Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) are calculated by comparing two aligned sequences in a comparison window to determine the number of positions present.
  • Perfect of sequence homology refers to identical nucleic acid bases (e.g. A, T, C, G, I) or identical amino acid residues (e.g. Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) are calculated by comparing two aligned sequences in a
  • the number of matching positions can be divided by the total number of positions to give the number of matching positions in the comparison window (i.e., window size), and the result is multiplied by 100 to give the percentage of sequence homology.
  • Alignments to determine percent sequence homology can be performed in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.
  • BLAST BLAST-2
  • ALIGN ALIGN
  • Megalign DNASTAR
  • One skilled in the art can determine appropriate parameters for sequence alignment, including any algorithms necessary to achieve maximal alignment within the full-length sequences being compared or within the target sequence region.
  • the homology can also be determined by the following methods: FASTA and BLAST.
  • the FASTA algorithm is described, for example, in W. R. Pearson and D. J.
  • the present invention provides a first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
  • the present invention provides a first DNA construct or a recombinant vector containing the first DNA construct; A second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct; and a third DNA construct containing a nucleotide sequence encoding the P19 protein or a recombinant vector containing the third DNA construct.
  • the plant cells can be used to produce HPV16 L1 recombinant protein, and the plant cells can produce HPV16 L1 recombinant protein in the form of VLP.
  • the plant cells include Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, rice, It may be characterized as being derived from a plant selected from the group consisting of barley, wheat, rye, corn, sugar cane, oats and onions, but is not limited thereto.
  • vector refers to a DNA preparation containing a DNA sequence operably linked to a suitable control sequence capable of expressing the DNA in a suitable host.
  • Vectors can be plasmids, phage particles, or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vector, “plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors.
  • a typical plasmid vector that can be used for this purpose is (a) an origin of replication that allows efficient replication to contain several to hundreds of plasmid vectors per host cell, and (b) a selection site for host cells transformed with the plasmid vector. It has a structure that includes (c) an antibiotic resistance gene that allows the DNA fragment to be inserted, and (c) a restriction enzyme cut site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cut site does not exist, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method. After ligation, the vector must be transformed into an appropriate host cell. Transformation can be easily achieved using the calcium chloride method or electroporation (Neumann, et al., EMBO J., 1:841, 1982).
  • the vector used to overexpress the gene according to the present invention may be an expression vector known in the art.
  • a binary vector commonly used for plant transformation was used.
  • the gene in order to increase the expression level of a transgene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences.
  • the expression control sequence and the corresponding gene are contained in one recombinant vector that also contains a bacterial selection marker and a replication origin.
  • the recombinant vector preferably further contains an expression marker useful in plant cells. Plants or plant cells transformed by the above-described recombinant vector constitute another aspect of the present invention.
  • transformation refers to introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or through completion of chromosomal integration. Meanwhile, “transfection” means introducing DNA into a host cell so that it can replicate within the host cell.
  • a preferred example of the recombinant vector of the present invention is the Ti-plasmid vector, which can transfer a part of itself, the so-called T-region, into plant cells when present in a suitable host such as Agrobacterium tumefaciens .
  • Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced with the hybrid DNA properly inserted into the plant's genome.
  • a particularly preferred form of Ti-plasmid vectors are the so-called binary vectors as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.
  • viral vectors such as those that may be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, geminiviruses, etc.
  • double-stranded plant viruses e.g., CaMV
  • single-stranded viruses e.g., geminiviruses, etc.
  • non-intact plant virus vectors e.g., SV2, SV2, SV2, SV2, etc.
  • the use of such vectors can be particularly advantageous when it is difficult to properly transform plant hosts.
  • the expression vector will preferably include one or more selectable markers.
  • the marker is a nucleic acid sequence that has characteristics that can be generally selected by chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. There is a resistance gene, but it is not limited to this.
  • the promoter may be CaMV 35S, double enhancer CaMV, MacT, CsVMV, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto.
  • the term "promoter” refers to the region of DNA upstream from a structural gene and refers to the DNA molecule to which RNA polymerase binds to initiate transcription.
  • a “plant promoter” is a promoter capable of initiating transcription in plant cells.
  • a “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be accomplished at various stages and by various tissues. Therefore, constitutive promoters do not limit selection possibilities.
  • common terminators can be used, examples of which include nopaline synthase (NOS), rice ⁇ -amylase RAmy1 A terminator, HSP18.2 terminator, and intro removal terminator of tobacco (Nicotiana tabacum) extensin. , protease inhibitor II terminator, RD19B terminator, phaseoline terminator, terminator of Octopine gene of Agrobacterium tumefaciens, rrnB1/B2 terminator of E. coli, etc., but are limited to these. That is not the case. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.
  • the plant cells may be characterized as plant cells derived from dicot plants or monocot plants, but are not limited thereto.
  • the dicotyledonous plant is selected from the group consisting of soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot and celery. It may be characterized, but is not limited to this.
  • the monocot plant may be selected from the group consisting of rice, barley, wheat, rye, corn, sugarcane, oats, and onions, but is not limited thereto.
  • the plant cells may be derived from Nicotiana benthamiana , Nicotiana tabacum , or Arabidopsis thaliana .
  • the present invention provides a method for producing HPV16 L1 recombinant protein in plant cells comprising the following steps:
  • step (b) may be characterized in that the total soluble protein extract obtained by disrupting the cultured plant cells is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein, but is limited to this. It doesn't work.
  • the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl), but is limited thereto. It doesn't work.
  • the final concentration of the total soluble protein extract is 0.33M to 0.65M sodium chloride (NaCl), for example , may be characterized as containing 0.50 to 0.65 M of sodium chloride (NaCl), but is not limited thereto.
  • step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography, but is not limited to this.
  • the extraction step of heparin affinity chromatography may be characterized as extraction with a buffer containing 0.7 to 0.9, preferably 0.75 to 0.85 M, for example, about 0.8 M of sodium chloride, but is not limited thereto.
  • the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles, but is not limited thereto.
  • the present invention relates to a recombinant vector containing the first DNA construct.
  • the present invention relates to a recombinant vector containing the second DNA construct.
  • the present invention relates to a kit comprising a recombinant vector containing the first DNA construct and a recombinant vector containing the second DNA construct.
  • the kit may further include instructions explaining in detail how to transform plants using the recombinant vector, and various reagents for transformation in plants, such as Agrobacterium-mediated transformation. Known reagents for may additionally be included.
  • the present invention provides the first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
  • the present invention provides the first DNA construct or a recombinant vector containing the first DNA construct; The second DNA construct or a recombinant vector containing the second DNA construct; and a third DNA construct containing a nucleotide sequence encoding the P19 protein or a recombinant vector containing the third DNA construct.
  • the transgenic plants include Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, and rice. , barley, wheat, rye, corn, sugar cane, oats and onions, but is not limited thereto.
  • the transgenic plant may be a dicotyledonous plant or a monocotyledonous plant, but is not limited thereto.
  • the dicotyledonous plant is selected from the group consisting of soybeans, tobacco, eggplants, peppers, potatoes, tomatoes, Chinese cabbages, radishes, cabbage, lettuce, peaches, pears, strawberries, watermelons, melons, cucumbers, carrots, and celery. It can be done as, but is not limited to this.
  • the monocot plant may be selected from the group consisting of rice, barley, wheat, rye, corn, sugarcane, oats, and onions, but is not limited thereto.
  • the transgenic plant may be Nicotiana benthamiana , Nicotiana tabacum , or Arabidopsis thaliana .
  • the present invention relates to a method of producing HPV16 L1 recombinant protein in a transgenic plant comprising the following steps:
  • step (b) may be characterized in that the total soluble protein extract obtained by crushing the tissue isolated from the plant is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein. It is not limited.
  • the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl), but is limited thereto. It doesn't work.
  • step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography, but is not limited to this.
  • the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles, but is not limited thereto.
  • the gene encoding the HPV16 L1 recombinant protein can be transiently expressed or stably transformed in a transformed plant or plant cell through a vector.
  • the gene encoding the HPV16 L1 recombinant protein is transiently expressed in the transformed plant or plant cell
  • the gene encoding the target protein is introduced into the genome of the transformed plant or plant cell and exists as a chromosomal factor, thereby stably transforming the plant. It can be.
  • inserting a gene targeting the target protein into the plant genome chromosome will have the same effect.
  • the introduction of a vector containing the gene encoding the HPV16 L1 recombinant protein or the chromosomal insertion of the gene encoding the target protein is carried out by inserting the vector containing the gene encoding the target protein into a population of plant cells. It can be performed by adding Agrobacterium containing and co-culturing.
  • the co-culture may be performed under dark conditions.
  • the co-culture involves cultivating a culture of Agrobacterium containing plant cells and a vector containing a gene encoding the HPV16 L1 recombinant protein while stirring, and may further include a stationary culture step. there is.
  • the gene encoding the HPV16 L1 recombinant protein can be transiently expressed or stably transformed in plant cells through a vector.
  • the stationary culture is a method of culturing in a state in which the container is left standing without stirring the culture medium, and herein, it can be used interchangeably with immersion without agitation.
  • the stationary culture may be included in the form of a single or intermittent culture.
  • a single stationary culture for example, the culture of plant cells and Agrobacterium may be co-cultured with stirring, and after stationary culture, the culture may be stirred again.
  • intermittent stationary culture the culture form of co-culturing the culture of plant cells and Agrobacterium with stirring, stationary culturing, and then co-culturing with stirring again may be repeated several to dozens of times.
  • the culture is performed by co-culturing the plant cells and a culture of Agrobacterium containing a vector containing a gene encoding the target protein with agitation for 1 minute to 48 hours, and then for 1 minute to 96 hours. After political culture, it may be characterized as agitated culture for 1 to 10 days.
  • the OD600 of Agrobacterium added for co-culture may be 0.00001 to 2.0.
  • OD 600 of Agrobacterium is too low, there is a problem that the transformation infection rate for temporary expression is low, and if it is too high, there is a problem that the survival rate of host cells drastically decreases. Therefore, it is preferable to co-cultivate by adding Agrobacterium having an OD 600 in the above-defined range.
  • Agrobacterium commonly used for plant transformation can be used, and for example , Agrobacterium tumefaciens or Agrobacterium rhizogenes can be used.
  • Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily require a regeneration and/or tissue culture period. Transformation of plant species is now common for plant species including both monocots as well as dicots.
  • any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle bombardment of various plant elements (DNA or RNA-coated), invasion of plants or characterization of mature pollen or spores. It can be appropriately selected from Agrobacterium tumefaciens-mediated gene transfer by conversion, infection by (non-complete) virus, etc. A preferred method according to the invention involves Agrobacterium mediated DNA transfer.
  • the present invention relates to an HPV16 vaccine composition
  • an HPV16 vaccine composition comprising the HPV16 L1 recombinant protein produced by the above method from the plant cell or the transgenic plant.
  • the vaccine composition may be characterized as a cervical cancer vaccine composition, but is not limited thereto.
  • the vaccine composition may contain 0.1 to 99.9% (v/v) of the HPV16 L1 recombinant protein, but is not limited thereto.
  • the vaccine composition may further include a carrier for delivering the protein.
  • the HPV16 L1 recombinant protein may be characterized as being self-assembled into virus-like particles, but is not limited thereto.
  • the vaccine composition may be used in a form containing the virus-like particles or a concentrate thereof, in the form of the plant cells themselves or in the form of a dry powder of the plant cells, or in the form of a dry powder of the transgenic plant. Additionally, the vaccine composition can be used together with other foods or food ingredients and can be used appropriately according to conventional methods.
  • the vaccine composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., and sterile injectable solutions according to conventional methods.
  • oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc.
  • sterile injectable solutions according to conventional methods.
  • commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be used together.
  • the present invention relates to a method for producing a vaccine, further comprising formulating a vaccine using the HPV16 L1 recombinant protein produced by the above method.
  • the present invention relates to a method for producing a vaccine using the HPV16 L1 recombinant protein produced by the above method. It relates to the use of the composition comprising it as a vaccine.
  • the present invention relates to the use of the HPV16 L1 recombinant protein for vaccine production.
  • RbcS transit peptides of various lengths were prepared using Arabidopsis RbcS cDNA as a template using the primer pairs PF-1/PR-2, PF1/PR-3, or PF-1/PR-4 shown in Table 1. PCR amplified, and these were cut using restriction enzymes XbaI and .
  • the above-prepared expression vector was introduced into protoplasts isolated from Arabidopsis leaves using a PEG-mediated transformation method. Using the same volume of 40% PEG (polyethylene glycol)-3350 solution (Sigma), 0.5M mannitol, and 100mM CaCl 2 , 5 ⁇ g of the cloned plasmid was introduced into 2 x 10 6 protoplast cells and incubated for 15 minutes. Protoplasts were washed twice with 2 times the volume of W5 solution (154mM NaCl, 125mM CaCl 2 , 5mM KCl, 5mM glucose, and 1.5mM Mes-KOH, pH 5.6) and 1mL of culture medium and reproduced in 1mL of culture medium. After turbidity, the cells were cultured overnight at 28°C in light conditions (green protoplasts) and dark conditions (sulfurized protoplasts). Plates used for protoplast culture were pre-coated with 5% FBS.
  • the GFP protein fused with a transit peptide with 54 amino acid residues did not move to chloroplasts at all, but most of the GFP proteins fused with a transit peptide with 60 amino acid residues moved to chloroplasts. Only some of the fusion proteins failed to move to the chloroplast and remained in precursor form. Meanwhile, the GFP protein fused with the transit peptide, which has 70 and 79 amino acid residues, respectively, moved to the chloroplast, and only the processed form was confirmed.
  • chloroplast transit peptides with more than 70 amino acid residues completely transport the fusion protein to chloroplasts. I knew I could do it.
  • the HPV16 L1 recombinant protein By constructing a DNA construct to express a chloroplast transit peptide fused to the HPV16 L1 protein and introducing it into plants, the HPV16 L1 recombinant protein can be accumulated and produced in the chloroplast (Maryam Zahin et al. PLoS One. 2016; 11(8) ): e0160995). However, during the process of moving the HPV16 L1 recombinant protein to the chloroplast, the chloroplast transit peptide is cut off, but some amino acid residues at the C-terminus of the chloroplast transit peptide are still fused to the HPV16 L1 recombinant protein (Maryam Zahin et al. PLoS One. 2016;11(8):e0160995.)
  • the present invention attempted to use bdSENP1, a SUMO domain and SUMO-specific protease.
  • the MacT promoter was amplified by PCR using the PF-5/PR-6 primer pair using the nucleotide sequence of SEQ ID NO. 12 (chemical synthesis, Bioneer, Korea) as a template, cut with PstI and XbaI restriction enzymes, and then digested with the same restriction enzymes. It was ligated into the pCBM3-bdSUMO-hIL6 binary vector (Islam Md. R. et al., Plant Biotechnol. J. (2018), 10.1111/pbi.13040).
  • HPV16-L1 gene amplified to have SpeI and XhoI restriction enzymes at both ends was cut with SpeI and pMacT:BiP:CBM3:bdSUMO:HPV16-L1 was constructed by ligating the vector.
  • RD29B terminator was PCR amplified using SEQ ID NO: 13 (Chemical Synthesis, Bioneer, Korea) as a template using the PF-14/PR15 primer pair, cut with restriction enzymes pMacT19-SR-16 was constructed by cutting the vector with the same restriction enzyme and ligating it to the 3' end of the HPV16-L1 gene. .
  • the MacT-UBQ10 intron fusion DNA fragment was PF using Arabidopsis gDNA and the MacT promoter as templates, respectively. Fusion amplification was performed by performing overlap PCR using primer pairs -5/PR-7 and PF-8/PR-9, and then cleaved using restriction enzymes Pst1 and After removing the MacT promoter with restriction enzymes Pst1 and
  • the P19 gene was chemically synthesized (Bioneer, Daejeon, Korea), PCR amplified using the PF-10/PR-11 primer pair as a template, and digested with XbaI and XhoI restriction enzymes. Afterwards, the pCAMPIA1300 vector (addgene) was cut with XbaI and XhoI restriction enzymes and inserted between the 35S promoter and Nos-terminator. Since P38 generates virus-like particles and interferes with the isolation and purification of HPV16 L1 to be produced through the present invention, P19, a gene silencing suppressor that does not have this interference effect, was used.
  • RbcSN80 a DNA fragment (RbcSN80) encoding amino acids 1-80 (i.e., transit peptide) of the N-terminal region of Arabidopsis RbcS (i.e., transit peptide) of Arabidopsis RbcS was used to target and express the SUMO-specific protease BdSENP1 in chloroplasts using PF12/PR18 primers as above.
  • BdSENP1 was amplified using the pair, and BdSENP1 was amplified using pRSET-bdSENP1 (Islam Md. R. et al., Plant Biotechnol. J.
  • the recombinant protein expression vector constructed in Example 2 was introduced into N. benthamiana leaves using the Agrobacterium-mediated transformation method, a method known in the art.
  • transfections were (i) expressing pMacT19-SR-16 alone, (ii) co-expressing pMacT19-SR-16 and pP19, (iii) co-expressing pMacT19-SR-16, pP19, and pBdSENP1:HA, (iv)
  • Six experimental groups were conducted: (v) pMacIN19-SR-16 alone expression, (v) pMacIN19-SR-16 and pP19 co-expression, (vi) pMacIN19-SR-16, pP19, and pBdSENP1:HA co-expression, and the same amount was used as the mock control group.
  • the empty vector was transformed.
  • N. benthamiana leaf tissue was lysed with cell lysate (50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton X-100), mixed with sample loading buffer, and heated for 10 minutes. The residue was removed by centrifugation at 14,000 rpm, and the supernatant, that is, total soluble protein, was obtained. Afterwards, a sample equivalent to 18 ⁇ g of protein was quantified, electrophoresed on a 10% SDS-PAGE gel, and stained with Coomassie brillent blue (CBB) staining solution (CBB, 0.1%; methanol, 50%; glacial acetic acid, 10%) for 20 minutes. dyed.
  • CBB Coomassie brillent blue
  • the expression level of HPV16 L1 recombinant protein was significantly increased when pP19 was co-expressed compared to pMacT19-SR-16 alone, and the intron of UBQ10 was inserted into the 5' upstream region and 5' before the start codon. 'It was confirmed that the expression level could be further increased when HPV16 L1 recombinant protein including UTR was expressed.
  • HPV16 L1 recombinant protein expression vector when the HPV16 L1 recombinant protein expression vector is co-expressed with bdSENP1, a cleaved form HPV16 L1 recombinant protein of about 55 kD without residual amino acid residues derived from the transit peptide is produced, whereas when bdSENP1 is not co-expressed, HPV16 L1 recombinant protein is produced.
  • a non-cleaved form of the HPV16 L1 recombinant protein was identified in which an amino acid residue derived from a transit peptide was fused to the L1 protein.
  • Example 3 it was confirmed that the cleaved form of HPV16 L1 recombinant protein, in which amino acids derived from the transit peptide were completely cleaved, could be produced by high expression.
  • a method for recovering the highly expressed HPV16 L1 recombinant protein present in the cell was described. We wanted to improve efficiency.
  • N. benthamiana leaf tissue was lysed with cell lysate (50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton was obtained. This was filtered through a triple-folded gauge cloth, and the filtered homogenate was treated with 2mM phytate (Sigma-Aldrich) and 2mM CaCl 2 and then centrifuged at 14,000 rpm for 30 minutes to remove precipitates and secure the supernatant.
  • cell lysate 50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton was obtained. This was filtered through a triple-folded gauge cloth, and the filtered homogenate was treated with 2mM phytate (Sigma-Aldrich) and 2mM CaCl 2 and then centrifuged at 14,000 rpm for 30 minutes to remove precipitates and secure the supernatant.
  • HPV16 L1 recombinant protein was analyzed by SDS-PAGE and Western blotting in the same manner as in Example 3. .
  • HPV16 L1 recombinant protein was confirmed in fractions 8 to 10 constituting the first peak, and these fractions had a molecular weight of 670 kD, which was much larger than the molecular weight of 55 kD, which was the molecular weight of HPV16 L1 recombinant protein. It was confirmed that the HPV16 L1 recombinant protein forms a complex rather than a single molecule, and it was expected that the HPV16 L1 recombinant protein forms a VLP.
  • the HPV16 L1 recombinant protein isolated and purified in Example 4 was absorbed onto a carbon-coated grid (Electron Microscopy Sciences, USA) and negatively stained with 2% phosphotungstic acid (pH 6.8). After staining, it was observed using a transmission electron microscope (Phillips CM-12) at final magnifications of 150,000 and 250,000.
  • the concentration of isolated and purified HPV16 L1 recombinant protein was determined using Bio-Rad Bradford protein assay reagent (Bio-Rad Laboratories, USA) containing bovine serum albumin (BSA; Pierce, USA).
  • mice (6-8 weeks old, Hyochang Science) were raised under specific pathogen-free conditions with controlled humidity, temperature, and photoperiod (12:12). Mice were fed autoclaved food (NIH 31, 6% fat, Lab Diet 5K52, Purina Mills, St. Louis, MO) and acidified water (pH 2.8-3.2) ad libitum.
  • mice were immunized to collect hyperimmune sera with plant HPV16 L1 recombinant protein VLPs. Specifically, 10 ⁇ g of isolated and purified HPV16 L1 recombinant protein VLP or PBS (control group) was injected subcutaneously twice at 2-week intervals without additional adjuvants. Blood was collected on the 42nd day after the first immunization injection, and the production of antibodies was confirmed using ELISA.
  • the plates were washed three times with PBS-T and incubated with alkaline phosphatase-conjugated goat anti-mouse gG(H+L) (Sigma, USA) diluted 1:5000 in 1% PBSA for 1 h at 37°C. reacted. Unbound secondary antibodies were removed by washing, and bound antibodies were stained with alkaline phosphatase chromogenic substrate (Sigma, USA) and absorbance was measured at 405 nm.
  • the OD 450 of the mouse serum immunized with the HPV16 L1 recombinant protein VLP on the plate coated with the HPV L1 recombinant protein VLP was confirmed to be 2.5, and the disassembled HPV L1 recombinant protein coated plate was confirmed to have an OD 450 of 2.5.
  • the mouse serum immunized with HPV16 L1 recombinant protein VLP on the plate had an OD 450 of 1.4, and the mouse serum immunized with PBS itself or PBS did not have a significant OD 450 , indicating that the plant-derived HPV16 L1 produced in the present invention had an OD 450 of 1.4. It was confirmed that the recombinant protein VLP can produce antibodies that specifically bind to both the HPV16 L1 protein VLP and the HPV16 L1 protein that does not form a VLP structure in vivo.
  • SEQ ID NO: 1 HPV16 L1 amino acid sequence
  • SEQ ID NO: 2 HPV16 L1 nucleotide sequence
  • SEQ ID NO: 4 RbcSN80 nucleotide sequence
  • SEQ ID NO: 6 bdSUMO nucleotide sequence
  • SEQ ID NO: 8 bdSENP1 amino acid sequence
  • SEQ ID NO: 9 bdSENP1 nucleotide sequence
  • SEQ ID NO: 12 MacT promoter sequence
  • SEQ ID NO: 15 HA base sequence
  • SEQ ID NO: 16 HA amino acid sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Plant Pathology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a technology for producing human papillomavirus virus-like particles from a plant and, more specifically, to a technology for effectively producing human papillomavirus virus-like particles in a plant chloroplast by adjusting the length of amino acids of a chloroplast transfer peptide, and locating a SUMO protein at the N-terminus thereof, followed by fusion with an HPV L1 protein. A system for producing an HPV L1 recombinant protein, according to the present invention, effectively moves an HPV L1 recombinant protein to a plant chloroplast and at the same time, enables complete removal of a chloroplast transfer peptide that has been fused for movement to the chloroplast, after movement to the chloroplast, and has the advantages of improving the expression level of the HPV L1 recombinant protein in plant cells and enabling the production of the HPV L1 recombinant protein in the form of virus-like particles that induce an immune response almost identical to that of natural viruses, when administered in vivo.

Description

식물로부터 인유두종 바이러스 유사 입자의 생산 Production of human papilloma virus-like particles from plants
본 발명은 식물로부터 인유두종 바이러스 유사 입자를 생산하는 기술에 관한 것으로, 더 상세하게는 엽록체 전이 펩타이드의 아미노산 길이를 조절하고, 그 N-말단에 SUMO 단백질을 위치시킨 후 HPV L1 단백질을 융합시킴으로써 식물의 엽록체에서 인유두종 바이러스 유사 입자를 효과적으로 생산하는 기술에 관한 것이다.The present invention relates to a technology for producing human papilloma virus-like particles from plants. More specifically, the present invention relates to a technology for producing human papilloma virus-like particles from plants, by controlling the amino acid length of the chloroplast transit peptide, placing SUMO protein at its N-terminus, and then fusing it with the HPV L1 protein. This relates to technology for effectively producing human papilloma virus-like particles in chloroplasts.
인간유두종 바이러스(human papilloma virus, HPV)에 의해 발생하는 자궁경부암은 효과적인 백신으로 예방이 가능하다고 알려져 있다. 대표적으로는 주요 캡시드 단백질인 HPV L1 단백질을 백신으로 이용할 수 있는데, HPV L1 단백질은 게놈 DNA가 없는 바이러스 유사 입자(VLP)로 제조할 수 있으며, 이는 자연적 바이러스(natural virus)와 거의 동일한 형태로 면역반응을 유도한다는 것이 알려져 있다 (Chabeda et al. 2018).It is known that cervical cancer caused by human papilloma virus (HPV) can be prevented with an effective vaccine. Representatively, HPV L1 protein, the main capsid protein, can be used as a vaccine. HPV L1 protein can be manufactured as a virus-like particle (VLP) without genomic DNA, which is almost identical to a natural virus and provides immunity. It is known to induce a response (Chabeda et al. 2018).
이에, 다양한 세포에서 HPV L1 재조합 단백질을 발현시키고 이를 VLP로 제조하여 백신으로 개발하고자 하는 시도가 있어 왔다. 예컨대, 최근 효모 및 곤충 발현 시스템을 이용하여 HPV L1 VLP를 성공적으로 생산하고, 이를 Gardasil 및 Cervarix라는 백신으로 상용화하였으며 (Jorma Paavonen et al. 2007; Keith S Reisinger et al. 2007), 상기 백신은 자궁경부암을 예방하는 효능이 입증되었다. Accordingly, there have been attempts to develop a vaccine by expressing HPV L1 recombinant protein in various cells and manufacturing it into VLP. For example, HPV L1 VLPs were recently successfully produced using yeast and insect expression systems and commercialized as vaccines called Gardasil and Cervarix (Jorma Paavonen et al. 2007; Keith S Reisinger et al. 2007). Its efficacy in preventing cervical cancer has been proven.
그러나 VLP를 생산하기 위해서는 복잡한 공정이 요구되어 상기 백신을 생산하는데 값비싼 비용이 요구되고, 따라서 극빈국과 개발도상국에서는 이들 백신을 광범위하게 사용하는데 한계가 있어 왔다. 이에, 이러한 생산 비용 문제를 해결하기 위해서는 경제적인 HPV L1 VLP의 생산 시스템이 필요한 실정이다.However, complex processes are required to produce VLPs, making the vaccines expensive to produce, and therefore there have been limitations in the widespread use of these vaccines in extremely poor and developing countries. Accordingly, in order to solve this production cost problem, an economical HPV L1 VLP production system is needed.
바이오 의약품용 재조합 단백질을 생산하기 위한 다양한 발현 시스템 중 최근 식물을 이용한 발현 시스템이 각광받고 있는데, 식물 세포에서 재조합 단백질은 소포체, 액포, 오일-바디, 세포외 공간, 엽록체 등 다양한 세포 소기관에 축적되도록 할 수 있다. 그러나, 목적하는 재조합 단백질의 종류와 그 구조적 특성에 따라 최적의 세포 소기관은 다를 수 있어, 재조합 단백질에 따라 다양한 세포 소기관을 스크리닝하고 최적의 세포 소기관을 선별하여 재조합 단백질이 효과적으로 축적되도록 함으로써 재조합 단백질의 생산 수율을 높일 수 있다. 특히, VLP를 유도할 때에는 목적하는 재조합 단백질의 구조체 형성이 세포 소기관에 따라 달라질 수 있으므로, 목적하는 재조합 단백질에 적합한 최적의 세포 소기관을 선별하는 것이 특히 중요하다. Among various expression systems for producing recombinant proteins for biopharmaceuticals, expression systems using plants have recently been in the spotlight. In plant cells, recombinant proteins accumulate in various organelles such as the endoplasmic reticulum, vacuole, oil-body, extracellular space, and chloroplast. can do. However, the optimal cell organelle may be different depending on the type of recombinant protein of interest and its structural characteristics. Therefore, by screening various cell organelles according to the recombinant protein and selecting the optimal organelle, the recombinant protein is effectively accumulated. Production yield can be increased. In particular, when inducing a VLP, the structure formation of the desired recombinant protein may vary depending on the cell organelle, so it is particularly important to select the optimal cell organelle suitable for the desired recombinant protein.
다양한 세포 소기관 중 엽록체는 식물 세포에 많은 수로 존재하며, 식물 세포에서 액포 다음으로 넓은 세포 내 공간을 차지하고 있어 재조합 단백질이 축적되고 저장되는데 매우 유리하다. 이미 여러 연구 그룹이 HPV16 L1 단백질을 성공적으로 엽록체로 이동시켜 VLP 및 캡소머로 조립하였으며, 이를 백신으로 마우스에 주입한 결과 중화 항체가 유도되는 것을 확인하였다(J Maclean et al. 2007; Fernandez-San Millan A et al. 2008; Pineo CB et al. 2013; Paulina N Naupu et al. 2020). Among various cellular organelles, chloroplasts exist in large numbers in plant cells, and occupy the second largest intracellular space in plant cells after the vacuole, making them very advantageous for accumulating and storing recombinant proteins. Several research groups have already successfully moved the HPV16 L1 protein to chloroplasts and assembled it into VLPs and capsomers, and when this was injected into mice as a vaccine, it was confirmed that neutralizing antibodies were induced (J Maclean et al. 2007; Fernandez-San Millan A et al. 2008; Paulina N Naupu et al.
재조합 단백질을 엽록체로 이동시키기 위해서는 엽록체 전이 펩타이드를 재조합 단백질에 융합시킬 수 있는데, 엽록체 전이 펩타이드(chloroplast transit peptide)는 단백질의 N-말단에서 기능하는 엽록체로의 이동 신호로, 소포체, 핵, 퍼옥시좀(peroxisome) 등으로 이동하는 단백질들이 가지는 이동 신호에 비해 상대적으로 길이가 긴 특징을 가진다. 재조합 단백질의 N-말단에 엽록체 전이 펩타이드를 융합시키면 재조합 단백질은 엽록체로 이동된 후, 상기 전이 펩타이드의 N-말단은 절단되어 분해된다. 구체적으로, 앞선 연구에서는 RbcS 유래 전이 펩타이드의 N-말단으로부터 59개 아미노산 잔기를 C-말단에 22 아미노산 잔기가 결실된 HPV16 L1의 (HPV16 L1d22) 단백질에 융합함으로써 식물에서 HPV16 L1d22 재조합 단백질을 발현시키고 엽록체에서 HPV16 L1d22 재조합 단백질이 형성하는 VLP를 생산한 바 있으나, 상기 HPV16 L1d22 재조합 단백질은 엽록체에 이동된 후, 전이 펩타이드의 N-말단이 분해되었지만, 여전히 전이 펩타이드 C-말단 5개의 아미노산 잔기는 재조합 단백질에 융합되어 있는 것으로 확인되었다. (Maryam Zahin et al. PLoS One. 2016; 11(8): e0160995.) In order to move a recombinant protein to the chloroplast, a chloroplast transit peptide can be fused to the recombinant protein. The chloroplast transit peptide is a chloroplast transit signal that functions at the N-terminus of the protein, and is transmitted through the endoplasmic reticulum, nucleus, and peroxisomes. It has the characteristic of being relatively long compared to the movement signal of proteins that move to peroxisomes. When a chloroplast transit peptide is fused to the N-terminus of a recombinant protein, the recombinant protein is moved to the chloroplast, and then the N-terminus of the transit peptide is cleaved and degraded. Specifically, in a previous study, HPV16 L1d22 recombinant protein was expressed in plants by fusing 59 amino acid residues from the N-terminus of the RbcS-derived transit peptide to the (HPV16 L1d22) protein of HPV16 L1 with 22 amino acid residues deleted at the C-terminus. A VLP formed by the HPV16 L1d22 recombinant protein has been produced in the chloroplast. However, after the HPV16 L1d22 recombinant protein was moved to the chloroplast, the N-terminus of the transit peptide was degraded, but the five amino acid residues at the C-terminus of the transit peptide were still retained by the recombinant protein. It was confirmed to be fused to a protein. (Maryam Zahin et al. PLoS One. 2016; 11(8): e0160995.)
이와 같이 HPV L1 재조합 단백질에 전이 펩타이드 유래의 아미노산 잔기가 융합되어 잔존하는 경우, 상기 HPV16 L1 단백질을 자궁경부암 백신으로 인체에 주입시 의도치 않은 면역 반응을 유도할 수 있는 문제점이 있다. In this way, if amino acid residues derived from the transit peptide remain fused to the HPV L1 recombinant protein, there is a problem that an unintended immune response may be induced when the HPV16 L1 protein is injected into the human body as a cervical cancer vaccine.
한편, 엽록체 전이 펩타이드가 융합되는 재조합 단백질을 엽록체로 효율적으로 이동시키기 위해서는 엽록체로 이동하여 절단되는 부위에서 확장되는 추가 서열을 필요로 한다. 그러나, 절단되는 부위에서 확장되는 추가 서열은 앞서 설명한 바와 같이 엽록체 전이 펩타이드가 절단되어 분해되더라도 엽록체 전이 펩타이드 일부 아미노산 잔기가 재조합 단백질에 융합되어 잔존하게 된다. 따라서, HPV L1 재조합 단백질을 엽록체로 효율적으로 이동시키면서도, 엽록체로 이동된 후 전이 펩타이드가 완전히 제거된 HPV L1 단백질 생산 시스템을 개발할 필요성이 요구되었다.Meanwhile, in order to efficiently move the recombinant protein to which the chloroplast transfer peptide is fused to the chloroplast, an additional sequence extending from the site where it moves to the chloroplast and is cleaved is required. However, as described above, the additional sequence extending from the cleavage site causes some amino acid residues of the chloroplast transit peptide to remain fused to the recombinant protein even if the chloroplast transit peptide is cleaved and degraded. Therefore, there was a need to develop an HPV L1 protein production system that efficiently moves HPV L1 recombinant protein to chloroplasts while completely removing the transit peptide after being transported to chloroplasts.
이에 본 발명에서는 상기 기술적 과제를 해결할 수 있는 HPV16 L1 단백질 생산 시스템을 개발하고자 예의 노력한 결과, 엽록체 전이 펩타이드의 아미노산 길이를 조절하고, 그 N-말단에 SUMO 단백질을 위치시킨 후 HPV16 L1 단백질을 융합시키는 경우, HPV16 L1 단백질을 식물의 엽록체로 효과적으로 이동시키는 동시에 전이 펩타이드가 완전히 제거됨과 동시에 C-말단의 아미노산 결손이 없는 원래의 HPV16 L1 단백질과 동일한 단백질 효과적으로 생산할 수 있으며 상기 단백질은 효율적으로 VLP를 형성함을 확인함으로써 본 발명을 완성하였다. Accordingly, the present invention has made diligent efforts to develop an HPV16 L1 protein production system that can solve the above technical problems. As a result, the amino acid length of the chloroplast transit peptide is adjusted, a SUMO protein is placed at the N-terminus, and the HPV16 L1 protein is fused. In this case, the HPV16 L1 protein can be effectively transported to the chloroplast of the plant, while the transit peptide is completely removed, and at the same time, the same protein as the original HPV16 L1 protein without the C-terminal amino acid deletion can be effectively produced, and the protein efficiently forms VLP. The present invention was completed by confirming.
본 발명은 식물로부터 인유두종 바이러스 유사 입자를 효율적으로 생산할 수 있는 시스템을 제공하는 것을 목적으로 한다. The purpose of the present invention is to provide a system that can efficiently produce human papilloma virus-like particles from plants.
상기 목적을 달성하기 위하여, 본 발명은 (i) 엽록체 전이 펩타이드, (ii) SUMO 단백질, 및 (iii) HPV16 L1 단백질을 포함하는 융합단백질을 암호화하는 뉴클레오티드를 포함하는 제1 DNA 컨스트럭트를 제공한다.In order to achieve the above object, the present invention provides a first DNA construct containing nucleotides encoding a fusion protein comprising (i) a chloroplast transfer peptide, (ii) a SUMO protein, and (iii) an HPV16 L1 protein. do.
본 발명에 있어서, 상기 제1 DNA 컨스트럭트는 5' UTR; 및/또는 UBQ10 intron 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 할 수 있다.In the present invention, the first DNA construct includes 5'UTR; and/or may be characterized as additionally comprising a UBQ10 intron nucleotide sequence.
본 발명에 있어서, 상기 제1 DNA 컨스트럭트는 P19 단백질을 암호화하는 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 할 수 있다. In the present invention, the first DNA construct may further include a nucleotide sequence encoding the P19 protein.
본 발명에 있어서, 상기 (i) 엽록체 전이 펩타이드는 서열번호 3으로 표시되는 아미노산 서열의 N-말단으로부터 1 내지 60번째 아미노산을 포함하는 것을 특징으로 할 수 있다. In the present invention, the (i) chloroplast transfer peptide may be characterized as comprising the 1st to 60th amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 3.
본 발명은 또한, 상기 제1 DNA 컨스트럭트; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트를 포함하는, DNA 컨스트럭트 쌍을 제공한다. The present invention also provides the first DNA construct; and a second DNA construct comprising a sequence encoding a SUMO protease.
본 발명은 또한, 상기 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 식물세포를 제공한다.The present invention also provides the first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
본 발명에 있어서, 상기 식물세포는 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 식물로부터 유래된 것을 특징으로 할 수 있다. In the present invention, the plant cells include Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, rice, It may be characterized as being derived from a plant selected from the group consisting of barley, wheat, rye, corn, sugar cane, oats and onions.
본 발명은 또한, 다음 단계를 포함하는 식물세포에서 HPV16 L1 재조합 단백질을 생산하는 방법을 제공한다:The present invention also provides a method for producing HPV16 L1 recombinant protein in plant cells comprising the following steps:
(a) 상기 식물세포를 배양하는 단계; 및(a) culturing the plant cells; and
(b) 상기 배양된 식물세포를 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by disrupting the cultured plant cells.
본 발명에 있어서, 상기 (b) 단계는 상기 배양된 식물세포를 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있다.In the present invention, step (b) may be characterized in that the total soluble protein extract obtained by disrupting the cultured plant cells is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
본 발명에 있어서, 상기 (b) 단계의 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 할 수 있다. In the present invention, the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl).
본 발명에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있다. In the present invention, step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
본 발명에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 할 수 있다.본 발명은 또한, 상기 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 형질전환 식물을 제공한다.In the present invention, the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles. The present invention also provides the first DNA construct or the first DNA construct. Recombinant vector containing a DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct. It provides a transgenic plant into which is introduced.
본 발명에 있어서, 상기 형질전환 식물은 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있다.In the present invention, the transgenic plants include Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, and rice. , barley, wheat, rye, corn, sugar cane, oats and onions.
본 발명은 또한, 다음 단계를 포함하는 형질전환 식물에서 HPV16 L1 재조합 단백질을 생산하는 방법을 제공한다:The present invention also provides a method of producing HPV16 L1 recombinant protein in a transgenic plant comprising the following steps:
(a) 상기 형질전환 식물을 생장시키는 단계; 및(a) growing the transgenic plant; and
(b) 상기 식물로부터 분리된 조직을 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by crushing the tissue isolated from the plant.
본 발명에 있어서, 상기 (b) 단계는 상기 식물로부터 분리된 조직을 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있다.In the present invention, step (b) may be characterized in that the total soluble protein extract obtained by crushing the tissue isolated from the plant is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
본 발명에 있어서, 상기 (b) 단계의 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 할 수 있다. In the present invention, the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl).
본 발명에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있다. In the present invention, step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
본 발명에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 할 수 있다.In the present invention, the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles.
본 발명은 또한, 상기 방법에 의해 생산된 HPV16 L1 재조합 단백질을 포함하는 HPV16 백신 조성물을 제공한다. The present invention also provides an HPV16 vaccine composition comprising the HPV16 L1 recombinant protein produced by the above method.
본 발명에 따른 HPV L1 재조합 단백질 생산 시스템은 HPV16 L1 재조합 단백질을 식물의 엽록체로 효과적으로 이동시키는 동시에 엽록체로의 이동을 위해 융합되어 있던 엽록체 전이 펩타이드가 엽록체 이동 후 완전히 제거될 수 있으며, HPV16 L1 재조합 단백질의 식물 세포 내 발현량을 향상시키면서도 체내 투여시 자연적 바이러스와 거의 동일하게 면역반응을 유도하는 바이러스 유사 입자 형태로 제조할 수 있다는 장점을 갖는다.The HPV L1 recombinant protein production system according to the present invention effectively transfers the HPV16 L1 recombinant protein to the chloroplasts of plants, and at the same time, the chloroplast transfer peptide fused for movement to the chloroplasts can be completely removed after movement to the chloroplasts, and the HPV16 L1 recombinant protein can be completely removed. It has the advantage of being manufactured in the form of virus-like particles that induce an immune response almost identical to a natural virus when administered in the body while improving the expression level in plant cells.
도 1은 애기장대의 RbcS 유전자의 N-말단 부위의 길이에 따른 엽록체로의 이동 효율을 확인하고자 다양한 길이 (54, 60, 70 및 79개의 아미노산 잔기)의 N-말단 단편을 green fluorescent protein (GFP)의 N-말단에 융합되도록 재조합 유전자를 구축하고 이를 애기장대의 원형질체에 도입하여 엽록체로의 이동 효율을 확인한 결과이다. 항-마우스-GFP 항체을 이용하여 GFP-융합 단백질의 processed form(가공된 형태) 및 precursor form(전구체 형태)을 검출하였다. Figure 1 shows N-terminal fragments of various lengths (54, 60, 70, and 79 amino acid residues) were synthesized with green fluorescent protein (GFP) to confirm the efficiency of migration into chloroplasts depending on the length of the N-terminal region of the Arabidopsis RbcS gene. ), constructing a recombinant gene to be fused to the N-terminus, introducing it into Arabidopsis protoplasts, and confirming the efficiency of transfer to chloroplasts. The processed form and precursor form of the GFP-fusion protein were detected using an anti-mouse-GFP antibody.
도 2는 본 발명에 따른 HPV16 L1 재조합 단백질을 식물에서 발현시키기 위해 제작된 다양한 재조합 DNA 컨스트럭트를 나타낸다. Figure 2 shows various recombinant DNA constructs designed to express the HPV16 L1 recombinant protein according to the present invention in plants.
도 3은 아그로박테리움-매개 침투 방법으로 N. benthamiana 잎 조직에 도 2에서 제작된 재조합 DNA 컨스트럭트를 포함하는 발현 벡터를 형질전환하고, 잎 조직 추출물로부터 19㎍의 총 가용성 단백질을 SDS/PAGE로 전개한 후, CBB 염색 또는 항-HPV16 L1 항체를 이용하여 웨스턴 블랏팅을 한 결과이다.Figure 3 shows that N. benthamiana leaf tissue was transformed with an expression vector containing the recombinant DNA construct constructed in Figure 2 using the Agrobacterium-mediated infiltration method, and 19 μg of total soluble protein from the leaf tissue extract was infiltrated with SDS/ This is the result of development by PAGE and Western blotting using CBB staining or anti-HPV16 L1 antibody.
도 4는 헤파린 친화성 크로마토그래피를 이용하여 HPV16 L1 재조합 단백질을 발현하는 N. benthamiana의 잎 조직으로부터 확보한 총 수용성 단백질 추출물로부터 헤파린 친화성 레진(affinity resin)을 이용하여 숙주 단백질의 오염 없이 HPV16 L1 단백질을 분리 정제하기 위한 조건을 확인하기 위해서 총 수용성 단백질 추출물의 NaCl 농도를 변화시키면서 HPV16 L1 단백질이 헤파린 친화성 레진에 결합하도록 한 후 헤파린 친화성 레진에 결합된 단백질을 0.8 M NaCl 농도로 유리하여 SDS-PAGE로 전개한 후 CBB (coomassie brilliant blue) 염색 (왼쪽) 또는 항 HPV16 L1 항체를 이용한 웨스턴 블랏팅 (오른쪽)으로 확인한 결과이다. M, 단백질 크기 스탠다드; lane 1, 총단백질 추출물; lane 2, 총단백질 추출물을 2mM Phytate and 2mM CaCl2을 처리한 후 확보한 단백질 추출물; lane 3-6, 각각 0.33M, 0.4M, 0.5M 및 0.65M NaCl 농도로 처리한 추출물의 비결합 단백질 분획; Lane 7-10, 각각 0.33M, 0.4M, 0.5M, 0.65M로 처리한 후 0.8M NaCl로 유리한 HPV16 L1 단백질 분획. Figure 4 shows the total soluble protein extract obtained from the leaf tissue of N. benthamiana expressing the HPV16 L1 recombinant protein using heparin affinity chromatography using heparin affinity resin to obtain HPV16 L1 without contamination of the host protein. To confirm the conditions for separating and purifying the protein, the HPV16 L1 protein was allowed to bind to the heparin affinity resin while changing the NaCl concentration of the total water-soluble protein extract, and then the protein bound to the heparin affinity resin was released at a concentration of 0.8 M NaCl. The results were confirmed by CBB (coomassie brilliant blue) staining (left) or Western blotting using anti-HPV16 L1 antibody (right) after development by SDS-PAGE. M, protein size standard; lane 1, total protein extract; lane 2, protein extract obtained after treating the total protein extract with 2mM Phytate and 2mM CaCl 2 ; Lanes 3-6, unbound protein fraction of extracts treated with NaCl concentrations of 0.33M, 0.4M, 0.5M, and 0.65M, respectively; Lanes 7–10, HPV16 L1 protein fraction favored with 0.8 M NaCl after treatment with 0.33 M, 0.4 M, 0.5 M, and 0.65 M, respectively.
도 5는 헤파린 친화성 크로마토그래피 이후 크기 배제 크로마토그래피를 추가로 진행하여 HPV16 L1 단백질을 정제한 각 분획에 따른 (A) 흡광도 및 (B) SDS/PAGE로 전개한 후 항-HPV16 L1 항체를 이용하여 웨스턴 블랏팅한 결과이다. Figure 5 shows (A) the absorbance of each fraction purified from HPV16 L1 protein by additional size exclusion chromatography after heparin affinity chromatography and (B) development by SDS/PAGE using anti-HPV16 L1 antibody. This is the result of Western blotting.
도 6은 본 발명의 일 실시예에 따른 N. benthamiana 형질전환 식물체에서 HPV16 L1 재조합 단백질의 VLP를 분리 정제한 후 이를 음성 염색하여 (A) 150,000 및 (B) 250,000의 배율에서 투과 전자현미경으로 관찰한 결과이다. Figure 6 shows the isolation and purification of VLPs of HPV16 L1 recombinant protein from N. benthamiana transgenic plants according to an embodiment of the present invention, negative staining thereof, and observation with a transmission electron microscope at magnifications of (A) 150,000 and (B) 250,000. It is a result.
도 7은 (A) 형질전환 식물체 유래 정제된 HPV16 L1 재조합 단백질 VLP 또는 (B) 형질전환 식물체 유래 정제 후 해체된(disassembled) HPV16 L1 재조합 단백질로 플레이트를 코팅하고, PBS, PBS(vehicle, 대조군)를 마우스에 2회 피하주사 후 분리된 혈청, 10㎍의 형질전환 식물체 유래 정제된 HPV16 L1 재조합 단백질 VLP를 마우스에 2회 피하주사 후 분리된 혈청으로 ELISA 분석한 결과이다. Figure 7 shows a plate coated with (A) purified HPV16 L1 recombinant protein VLP derived from a transgenic plant or (B) purified and disassembled HPV16 L1 recombinant protein derived from a transgenic plant, followed by PBS, PBS (vehicle, control). This is the result of ELISA analysis using serum isolated after two subcutaneous injections into mice, and 10 μg of purified HPV16 L1 recombinant protein VLP derived from transgenic plants.
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.
본 발명에서는 HPV16 L1 단백질을 식물 (N. benthamiana) 잎세포의 엽록체에서 발현하여 HPV16 L1 단백질 VLP를 생산하기 위한 기술을 개발하였다. 선행 연구에서는 식물에서 HPV16 L1d22 단백질을 N. benthamiana에서 발현시키고 엽록체에 축적 및 저장시키고자 RbcS 단백질의 N-말단 59개의 아미노산으로 구성된 전이 펩타이드를 사용한 결과, 전이 펩타이드 유래 잔기가 HPV16 L1d22 단백질에 융합되어 남아 있는 형태로 VLP를 형성하는 것을 확인하였다. 이 경우, 전이 펩타이드 유래 잔기는 체내 주입하는 경우 에피토프로 작용할 가능성이 있다. 한편, HPV16 L1 단백질에 융합되어 남아 있는 전이 펩타이드 유래 잔기를 제외한 전이 펩타이드를 이용하는 경우, HPV16 L1 단백질의 엽록체로의 이동 효율이 낮아지는 문제점이 있다. In the present invention, we developed a technology to produce HPV16 L1 protein VLP by expressing HPV16 L1 protein in the chloroplast of plant ( N. benthamiana ) leaf cells. In a previous study, a transit peptide consisting of the N-terminal 59 amino acids of the RbcS protein was used to express the HPV16 L1d22 protein in N. benthamiana and to accumulate and store it in the chloroplast. As a result, the transition peptide-derived residue was fused to the HPV16 L1d22 protein. It was confirmed that VLP was formed in the remaining form. In this case, the transition peptide-derived residue has the potential to act as an epitope when injected into the body. On the other hand, when using a transit peptide excluding residues derived from the transit peptide remaining fused to the HPV16 L1 protein, there is a problem in that the transfer efficiency of the HPV16 L1 protein to the chloroplast is lowered.
이에, 본 발명에서는 엽록체 전이 펩타이드의 아미노산 길이를 60개 이상으로 조절하고, 그 N-말단에 SUMO 단백질을 위치시킨 후 HPV16 L1 단백질을 융합시키고 SUMO 단백질을 SUMO 특이적 프로테아제인 bdSENP1을 이용하여 단백질 가수분해 절단(proteolytic cleavage)함으로써 HPV16 L1 단백질을 식물의 엽록체로 효과적으로 이동시키는 동시에 전이 펩타이드가 완전히 제거된 HPV16 L1 단백질 효과적으로 생산하도록 하였다. 또한, HPV16 L1 유전자 발현을 증진시키고자 5' UTR에 번역 강화 서열(translational enhancing sequence)이 위치하도록 하였으며, 이의 5' 업스트림 부위(upstream region)에 UBQ10 인트론을 포함하여 재조합 유전자 컨스트럭트를 구축하였다. Accordingly, in the present invention, the length of the chloroplast transfer peptide is adjusted to more than 60 amino acids, a SUMO protein is placed at the N-terminus, the HPV16 L1 protein is fused, and the SUMO protein is subjected to protein hydrolysis using bdSENP1, a SUMO-specific protease. By proteolytic cleavage, the HPV16 L1 protein was effectively moved to the chloroplast of the plant and at the same time, the HPV16 L1 protein with the transit peptide completely removed was effectively produced. In addition, to enhance HPV16 L1 gene expression, a translational enhancing sequence was placed in the 5' UTR, and a recombinant gene construct was constructed including the UBQ10 intron in its 5' upstream region. .
따라서, 본 발명은 일 관점에서, (i) 엽록체 전이 펩타이드(Chloroplast transit peptide), (ii) SUMO 단백질, 및 (iii) HPV16 L1 단백질을 포함하는 융합단백질을 암호화하는 뉴클레오티드를 포함하는 제1 DNA 컨스트럭트에 관한 것이다.Therefore, in one aspect, the present invention provides a first DNA construct comprising nucleotides encoding a fusion protein comprising (i) a chloroplast transit peptide, (ii) a SUMO protein, and (iii) an HPV16 L1 protein. It's about trucks.
본 발명에 있어서, 상기 제1 DNA 컨스트럭트는 HPV16 L1 재조합 단백질을 식물에서 생산하기 위한 DNA 컨스트럭트인 것을 특징으로 할 수 있으며, 상기 HPV16 L1 재조합 단백질은 서열번호 1의 아미노산 서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the first DNA construct may be a DNA construct for producing HPV16 L1 recombinant protein in plants, and the HPV16 L1 recombinant protein may be represented by the amino acid sequence of SEQ ID NO: 1. It can be done as, but is not limited to this.
본 발명에 있어서, 엽록체 전이 펩타이드는 서열번호 3으로 표시되는 아미노산 서열의 N-말단으로부터 1 내지 60번째 아미노산을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the chloroplast transfer peptide may be characterized as comprising the 1st to 60th amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 3, but is not limited thereto.
예컨대, 상기 엽록체 전이 펩타이드는 서열번호 3으로 표시되는 아미노산 서열의 N-말단으로부터 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 또는 80개의 아미노산을 포함하는 것을 특징으로 할 수 있다.For example, the chloroplast transfer peptide is 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74 from the N-terminus of the amino acid sequence shown in SEQ ID NO: 3. It may be characterized as containing 75, 76, 77, 78, 79 or 80 amino acids.
바람직하게는 상기 엽록체 전이 펩타이드는 엽록체로의 이동 효율을 추가로 강화시키고자 서열번호 3으로 표시되는 아미노산 서열의 N-말단으로부터 70개 이상, 더 바람직하게는 80개 이상의 아미노산을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. Preferably, the chloroplast transfer peptide is characterized in that it contains at least 70, more preferably at least 80 amino acids from the N-terminus of the amino acid sequence shown in SEQ ID NO: 3 in order to further enhance the efficiency of movement into chloroplasts. It can be done, but it is not limited to this.
본 발명에 있어서, 상기 SUMO 단백질은 서열번호 5의 아미노산 서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않으며, 본 기술분야의 통상의 기술자가 다양한 생물로부터 유래된 SUMO 도메인과 이를 절단할 수 있는 SUMO protease로 적절히 변경하여 사용할 수 있음은 자명할 것이다. In the present invention, the SUMO protein may be characterized as being represented by the amino acid sequence of SEQ ID NO: 5, but is not limited thereto, and a person skilled in the art will be able to cleave the SUMO domain derived from various organisms and the same. It will be obvious that it can be used by appropriately changing it to a SUMO protease that can be used.
본 발명에 있어서, 상기 제1 DNA 컨스트럭트는 5' UTR; 및/또는 UBQ10 인트론 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 할 수 있다.In the present invention, the first DNA construct includes 5'UTR; and/or may be characterized as additionally comprising a UBQ10 intron nucleotide sequence.
본 발명에 있어서, 상기 5' UTR 서열은 서열번호 14의 뉴클레오티드 서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the 5' UTR sequence may be characterized as being represented by the nucleotide sequence of SEQ ID NO: 14, but is not limited thereto.
본 발명에 있어서, 상기 UBQ10 인트론 뉴클레오티드 서열은 서열번호 7의 뉴클레오티드 서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the UBQ10 intron nucleotide sequence may be characterized as being represented by the nucleotide sequence of SEQ ID NO: 7, but is not limited thereto.
본 발명에 있어서, 상기 제1 DNA 컨스트럭트는 P19 단백질을 암호화하는 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 할 수 있다. In the present invention, the first DNA construct may further include a nucleotide sequence encoding the P19 protein.
본 발명에 있어서, 상기 P19 단백질은 서열번호 10의 아미노산 잔기로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the P19 protein may be characterized as being represented by the amino acid residue of SEQ ID NO: 10, but is not limited thereto.
본 발명은 다른 관점에서, 상기 HPV16 L1 재조합 단백질이 엽록체로 이동 후 엽록체 전이 펩타이드를 완전히 제거하기 위하여, 상기 제1 DNA 컨스트럭트; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트를 포함하는, DNA 컨스트럭트 쌍을 제공한다. From another aspect, the present invention provides, in order to completely remove the chloroplast transfer peptide after the HPV16 L1 recombinant protein moves to the chloroplast, the first DNA construct; and a second DNA construct comprising a sequence encoding a SUMO protease.
본 발명에 있어서, 상기 SUMO protease는 서열번호 8의 아미노산 서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the SUMO protease may be characterized as represented by the amino acid sequence of SEQ ID NO: 8, but is not limited thereto.
본 발명은 또 다른 관점에서, 상기 제1 DNA 컨스트럭트; 상기 제2 DNA 컨스트럭트; 및 P19 단백질을 암호화하는 뉴클레오티드 서열을 포함하는 제3 DNA 컨스트럭트를 포함하는, DNA 컨스트럭트(constructs)를 제공한다. From another aspect, the present invention provides the first DNA construct; the second DNA construct; and a third DNA construct comprising a nucleotide sequence encoding a P19 protein.
본 발명에서 사용되는 유전자는 코딩 영역으로부터 발현되는 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고 코딩 영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있으며, 그러한 변형 유전자 역시 본 발명의 범위에 포함된다.The gene used in the present invention can be modified in various ways in the coding region within the range that does not change the amino acid sequence of the protein expressed from the coding region, and can be modified in a variety of ways without affecting the expression of the gene in parts other than the coding region. Modification or modification may be made, and such modified genes are also included within the scope of the present invention.
따라서, 본 발명은 상기 유전자와 실질적으로 동일한 염기서열을 갖는 폴리뉴클레오티드 및 상기 유전자의 단편을 역시 포함한다. 실질적으로 동일한 폴리뉴클레오티드란 서열의 상동성과는 무관하게, 본 발명에서 사용된 것과 동일한 기능을 가지는 효소를 코딩하는 유전자를 의미한다. 상기 유전자의 단편 또한 단편의 길이와는 무관하게, 본 발명에서 사용된 것과 동일한 기능을 가지는 효소를 코딩하는 유전자를 의미한다.Accordingly, the present invention also includes polynucleotides having substantially the same base sequence as the gene and fragments of the gene. Substantially identical polynucleotide refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of sequence homology. The fragment of the gene also refers to a gene encoding an enzyme having the same function as that used in the present invention, regardless of the length of the fragment.
또한, 본 발명의 유전자의 발현산물인 단백질의 아미노산 서열이 해당 효소의 역가 및 활성에 영향을 미치지 않는 범위 내에서 다양한 미생물 등 생물자원들로부터 확보될 수 있으며, 그러한 다른 생물자원으로부터 확보한 단백질 역시 본 발명의 범위에 포함된다.In addition, the amino acid sequence of the protein that is the expression product of the gene of the present invention can be obtained from various biological resources such as microorganisms to the extent that it does not affect the titer and activity of the enzyme, and proteins obtained from other biological resources can also be obtained. included within the scope of the present invention.
따라서, 본 발명은 상기 단백질과 실질적으로 동일한 아미노산서열을 갖는 폴리펩타이드 및 상기 폴리펩타이드의 단편을 역시 포함한다. 실질적으로 동일한 폴리펩타이드란 아미노산 서열의 상동성과는 무관하게, 본 발명에서 사용된 것과 동일한 기능을 가지는 단백질을 의미한다. 상기 폴리펩타이드의 단편 또한 단편의 길이와는 무관하게, 본 발명에서 사용된 것과 동일한 기능을 가지는 단백질을 의미한다.Accordingly, the present invention also includes polypeptides and fragments of the polypeptides having substantially the same amino acid sequence as the protein. Substantially identical polypeptide refers to a protein having the same function as that used in the present invention, regardless of amino acid sequence homology. The fragment of the polypeptide also refers to a protein having the same function as that used in the present invention, regardless of the length of the fragment.
본 발명에서 사용되는 단백질은 그 일부 아미노산이 치환될 수 있는데, 본 출원의 아미노산 치환은 비 보존 치환(non-conserved substitutions)일 수 있다. 상기 비 보존 치환은, 예를 들어, 특정 측쇄 크기 또는 특정 특성 (예를 들어, 친수성)을 갖는 아미노산 잔기를 상이한 측쇄 크기 또는 상이한 특성 (예를 들어, 소수성)을 갖는 아미노산 잔기로 대체하는 것과 같은 비 보존 방식으로, 표적 단백질 또는 폴리펩티드의 아미노산 잔기를 변경하는 것을 포함할 수 있다. The protein used in the present invention may have some amino acids substituted, and the amino acid substitutions in the present application may be non-conserved substitutions. Such non-conservative substitutions include, for example, replacing an amino acid residue with a particular side chain size or a particular property (e.g., hydrophilicity) with an amino acid residue with a different side chain size or a different property (e.g., hydrophobicity). In a non-conservative manner, it may involve altering amino acid residues of the target protein or polypeptide.
상기 아미노산 치환은 또한 보존된 치환(conserved substitutions)일 수 있다. 상기 보존된 치환은, 예를 들어, 특정 측쇄 크기 또는 특정 특징 (예를 들어, 친수성)을 갖는 아미노산 잔기를 동일하거나 유사한 측쇄 크기 또는 동일하거나 유사한 특성 (예: 여전히 친수성)을 갖는 아미노산 잔기로 대체하는 것과 같이, 보존된 방식으로 표적 단백질 또는 폴리펩티드의 아미노산 잔기를 변경하는 것을 포함할 수 있다. 이러한 보존된 치환은 일반적으로 생산된 단백질의 구조 또는 기능에 큰 영향을 미치지 않는다. 본 출원에서, 융합 단백질의 돌연변이인 아미노산 서열 변이체, 이의 단편, 또는 하나 이상의 아미노산이 치환된 이의 변이체는 단백질의 구조 또는 기능을 현저하게 변화시키지 않는 보존된 아미노산 치환을 포함할 수 있다.The amino acid substitutions may also be conserved substitutions. Such conserved substitutions include, for example, replacing an amino acid residue with a particular side chain size or particular characteristic (e.g., hydrophilicity) with an amino acid residue with the same or similar side chain size or the same or similar characteristic (e.g., still hydrophilic). It may include altering amino acid residues of the target protein or polypeptide in a conserved manner, such as: These conserved substitutions generally do not significantly affect the structure or function of the produced protein. In the present application, an amino acid sequence variant that is a mutation of a fusion protein, a fragment thereof, or a variant thereof in which one or more amino acids are substituted may include conserved amino acid substitutions that do not significantly change the structure or function of the protein.
예를 들어, 다음 그룹 각각에서 아미노산 간의 상호 치환(mutual substitutions)은 본 출원에서 보존적 치환으로 간주될 수 있다:For example, mutual substitutions between amino acids in each of the following groups may be considered conservative substitutions in this application:
비극성 측쇄를 갖는 아미노산 그룹: 알라닌, 발린, 류신, 이소류신, 프롤린, 페닐알라닌, 트립토판 및 메티오닌.A group of amino acids with non-polar side chains: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan and methionine.
극성 측쇄를 갖는 비하전 아미노산 그룹: 글리신, 세린, 트레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민.A group of uncharged amino acids with polar side chains: glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
극성 측쇄를 갖는 음전하 아미노산 그룹: 아스파르트산 및 글루탐산.A group of negatively charged amino acids with polar side chains: aspartic acid and glutamic acid.
양전하를 띤 염기성 아미노산 그룹: 라이신, 아르기닌 및 히스티딘.A group of positively charged basic amino acids: lysine, arginine, and histidine.
페닐을 갖는 아미노산 그룹: 페닐알라닌, 트립토판 및 티로신.A group of amino acids with phenyl: phenylalanine, tryptophan and tyrosine.
본 발명에 포함된 단백질, 폴리펩티드 및/또는 아미노산 서열은 또한 적어도 다음 범위를 포함하는 것으로 이해될 수 있다: 상기 단백질 또는 폴리펩티드와 동일하거나 유사한 기능을 갖는 변이체 또는 상동체(homologues).Proteins, polypeptides and/or amino acid sequences encompassed by the present invention may also be understood to include at least the following range: variants or homologues having the same or similar function as the protein or polypeptide.
본 발명에서, 상기 변이체는 상기 단백질 및/또는 상기 폴리펩티드의 아미노산 서열과 비교하여 하나 이상의 아미노산의 치환, 결실 또는 첨가에 의해 생성된 단백질 또는 폴리펩티드 일 수 있다. 예를 들어, 상기 기능적 변이체는 적어도 1 개의 아미노산의 치환, 결실 및/또는 삽입, 예를 들어 1-30, 1-20 또는 1-10, 대안적으로, 예를 들어 1, 2, 3, 4, 또는 5 아미노산의 치환, 결실 및/또는 삽입에 의한 아미노산 변화를 갖는 단백질 또는 폴리펩티드를 포함할 수 있다. 상기 기능적 변이체는 변화 (예를 들어, 치환, 결실 또는 첨가) 전에 상기 단백질 또는 상기 폴리펩티드의 생물학적 특성을 실질적으로 보유할 수 있다. 예를 들어, 상기 기능적 변이체는 변경 전에 상기 단백질 또는 상기 폴리펩티드의 생물학적 활성의 60 %, 70 %, 80 %, 90 % 또는 100 % 이상을 보유할 수 있다.In the present invention, the variant may be a protein or polypeptide produced by substitution, deletion or addition of one or more amino acids compared to the amino acid sequence of the protein and/or the polypeptide. For example, such functional variants include substitutions, deletions and/or insertions of at least one amino acid, e.g. 1-30, 1-20 or 1-10, alternatively e.g. 1, 2, 3, 4. , or it may include a protein or polypeptide having an amino acid change by substitution, deletion and/or insertion of 5 amino acids. The functional variant may substantially retain the biological properties of the protein or polypeptide prior to the change (eg, substitution, deletion, or addition). For example, the functional variant may retain at least 60%, 70%, 80%, 90%, or 100% of the biological activity of the protein or polypeptide prior to the change.
본 발명에서, 상기 상동체(homologue)는 상기 단백질 및/또는 상기 폴리펩티드의 아미노산 서열과 적어도 약 80 % (예를 들어, 적어도 약 85 %, 약 90 %, 약 91 %, 약 92 %, 약 93 %, 약 94 %, 약 95 %, 약 96 %, 약 97 %, 약 98 %, 약 99 % 이상) 서열 상동성을 갖는 단백질 또는 폴리펩티드 일 수 있다. In the present invention, the homologue is at least about 80% (e.g., at least about 85%, about 90%, about 91%, about 92%, about 93%) the amino acid sequence of the protein and/or polypeptide. %, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more) may be a protein or polypeptide having sequence homology.
본 발명에서, 상기 상동성은 일반적으로 둘 이상의 서열 간의 유사성(similarity), 유의성(analogousness) 또는 연관성(association)을 지칭한다. "서열 상동성 백분율(percent of sequence homology)"은 동일한 핵산 염기 (예: A, T, C, G, I) 또는 동일한 아미노산 잔기 (예 : Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys 및 Met)가 존재하는 위치의 수를 결정하는 비교 창에서 정렬된 두 서열을 비교하는 방식에 의해 계산될 수 있으며, 비교 창(즉, 윈도우 사이즈)의 일치하는 위치의 수를 제공하기 위하여 일치하는 위치의 수를 총 위치 수로 나누고, 결과에 100을 곱하여 서열 상동성의 백분율을 제공한다. 서열 상동성의 백분율을 결정하기 위한 정렬은 예를 들어 BLAST, BLAST-2, ALIGN 또는 Megalign (DNASTAR) 소프트웨어와 같은 공개적으로 이용 가능한 컴퓨터 소프트웨어를 사용하여 당업계에 알려진 다양한 방식으로 수행될 수 있다. 당업자는 비교되는 전장 서열 내에서 또는 표적 서열 영역 내에서 최대 정렬을 달성하는 데 필요한 임의의 알고리즘을 포함하여 서열 정렬을 위한 적절한 파라미터를 결정할 수 있다. 상기 상동성은 또한 다음 방법에 의해 결정될 수 있다: FASTA 및 BLAST. FASTA 알고리즘은 예를 들어 W. R. Pearson and D. J. Lipman's "Improved Tool for Biological Sequence Comparison", Proc. Natl. Acad. Sci., 85: 2444-2448, 1988; 및 D, J. Lipman and W. R. Pearson's "Fast and Sensitive Protein Similarity Search", Science, 227:1435-1441, 1989에 개시되어 있고, BLAST 알고리즘에 대한 설명은 S. Altschul, W. Gish, W. Miller, E. W. Myers and D. Lipman, "A Basic Local Alignment Search Tool", Journal of Molecular Biology, 215: 403-410, 1990를 참조하길 바란다.In the present invention, the homology generally refers to similarity, significance, or association between two or more sequences. “Percent of sequence homology” refers to identical nucleic acid bases (e.g. A, T, C, G, I) or identical amino acid residues (e.g. Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) are calculated by comparing two aligned sequences in a comparison window to determine the number of positions present. The number of matching positions can be divided by the total number of positions to give the number of matching positions in the comparison window (i.e., window size), and the result is multiplied by 100 to give the percentage of sequence homology. Alignments to determine percent sequence homology can be performed in a variety of ways known in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. One skilled in the art can determine appropriate parameters for sequence alignment, including any algorithms necessary to achieve maximal alignment within the full-length sequences being compared or within the target sequence region. The homology can also be determined by the following methods: FASTA and BLAST. The FASTA algorithm is described, for example, in W. R. Pearson and D. J. Lipman's "Improved Tool for Biological Sequence Comparison", Proc. Natl. Acad. Sci., 85: 2444-2448, 1988; and D, J. Lipman and W. R. Pearson's "Fast and Sensitive Protein Similarity Search", Science, 227:1435-1441, 1989, and a description of the BLAST algorithm is provided by S. Altschul, W. Gish, W. Miller, See E. W. Myers and D. Lipman, "A Basic Local Alignment Search Tool", Journal of Molecular Biology, 215: 403-410, 1990.
본 발명은 또 다른 관점에서, 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 식물세포를 제공한다. From another aspect, the present invention provides a first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
본 발명은 또 다른 관점에서, 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 P19 단백질을 암호화하는 뉴클레오티드 서열을 포함하는 제3 DNA 컨스트럭트 또는 상기 제3 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 식물세포를 제공한다. From another aspect, the present invention provides a first DNA construct or a recombinant vector containing the first DNA construct; A second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct; and a third DNA construct containing a nucleotide sequence encoding the P19 protein or a recombinant vector containing the third DNA construct.
본 발명에 있어서, 상기 식물세포는 HPV16 L1 재조합 단백질을 생산하기 위한 용도로 사용될 수 있으며, 상기 식물세포는 HPV16 L1 재조합 단백질을 VLP 형태로 생산할 수 있다.In the present invention, the plant cells can be used to produce HPV16 L1 recombinant protein, and the plant cells can produce HPV16 L1 recombinant protein in the form of VLP.
본 발명에 있어서, 상기 식물세포는 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 식물로부터 유래된 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the plant cells include Arabidopsis thaliana, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, rice, It may be characterized as being derived from a plant selected from the group consisting of barley, wheat, rye, corn, sugar cane, oats and onions, but is not limited thereto.
본 발명에서, "벡터(vector)"는 적합한 숙주 내에서 DNA를 발현시킬 수 있는 적합한 조절 서열에 작동 가능하게 연결된 DNA 서열을 함유하는 DNA 제조물을 의미한다. 벡터는 플라스미드, 파지 입자 또는 간단하게 잠재적 게놈 삽입물일 수 있다. 적당한 숙주로 형질전환되면, 벡터는 숙주 게놈과 무관하게 복제하고 기능할 수 있거나, 또는 일부 경우에 게놈 그 자체에 통합될 수 있다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호 교환적으로 사용된다. 본 발명의 목적상, 플라스미드 벡터를 이용하는 것이 바람직하다. 이러한 목적에 사용될 수 있는 전형적인 플라스미드 벡터는 (a) 숙주세포당 수 개에서 수백 개의 플라스미드 벡터를 포함하도록 복제가 효율적으로 이루어지도록 하는 복제 개시점, (b) 플라스미드 벡터로 형질전환된 숙주세포가 선발될 수 있도록 하는 항생제 내성 유전자 및 (c) 외래 DNA 절편이 삽입될 수 있는 제한효소 절단부위를 포함하는 구조를 지니고 있다. 적절한 제한효소 절단부위가 존재하지 않을지라도, 통상의 방법에 따른 합성 올리고뉴클레오타이드 어댑터(oligonucleotide adaptor) 또는 링커(linker)를 사용하면 벡터와 외래 DNA를 용이하게 라이게이션(ligation)할 수 있다. 라이게이션 후에, 벡터는 적절한 숙주세포로 형질전환 되어야 한다. 형질전환은 칼슘 클로라이드 방법 또는 전기천공법(electroporation) (Neumann, et al., EMBO J., 1:841, 1982) 등을 사용해서 용이하게 달성될 수 있다.As used herein, “vector” refers to a DNA preparation containing a DNA sequence operably linked to a suitable control sequence capable of expressing the DNA in a suitable host. Vectors can be plasmids, phage particles, or simply potential genomic inserts. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are currently the most commonly used form of vector, “plasmid” and “vector” are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. A typical plasmid vector that can be used for this purpose is (a) an origin of replication that allows efficient replication to contain several to hundreds of plasmid vectors per host cell, and (b) a selection site for host cells transformed with the plasmid vector. It has a structure that includes (c) an antibiotic resistance gene that allows the DNA fragment to be inserted, and (c) a restriction enzyme cut site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cut site does not exist, the vector and foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method. After ligation, the vector must be transformed into an appropriate host cell. Transformation can be easily achieved using the calcium chloride method or electroporation (Neumann, et al., EMBO J., 1:841, 1982).
본 발명에 따른 유전자의 과발현을 위하여 사용되는 벡터는 당업계에 공지된 발현 벡터가 사용될 수 있다. 본 발명에서는 통상적으로 식물체의 형질전환에 사용되는 binary vector가 사용되었다.The vector used to overexpress the gene according to the present invention may be an expression vector known in the art. In the present invention, a binary vector commonly used for plant transformation was used.
당업계에 주지된 바와 같이, 숙주세포에서 형질전환 유전자의 발현 수준을 높이기 위해서는, 해당 유전자가 전사 및 해독 발현 조절 서열에 작동 가능하도록 연결되어야만 한다. 바람직하게는 발현 조절서열 및 해당 유전자는 세균 선택 마커 및 복제 개시점(replication origin)을 같이 포함하고 있는 하나의 재조합 벡터 내에 포함되게 된다. 재조합 벡터는 식물세포 내에서 유용한 발현 마커를 더 포함하는 것이 바람직하다. 상술한 재조합 벡터에 의해 형질전환된 식물 또는 식물세포는 본 발명의 또 다른 측면을 구성한다. 본원 명세서에 사용된 용어 "형질전환(transformation)"은 DNA를 숙주로 도입하여 DNA가 염색체 외 인자로서 또는 염색체 통합완성에 의해 복제 가능하게 되는 것을 의미한다. 한편, "형질감염(transfection)"은 DNA를 숙주 세포에 도입하여 숙주 세포 내에서 복제 가능하게 되는 것을 의미한다.As is well known in the art, in order to increase the expression level of a transgene in a host cell, the gene must be operably linked to transcriptional and translational expression control sequences. Preferably, the expression control sequence and the corresponding gene are contained in one recombinant vector that also contains a bacterial selection marker and a replication origin. The recombinant vector preferably further contains an expression marker useful in plant cells. Plants or plant cells transformed by the above-described recombinant vector constitute another aspect of the present invention. As used herein, the term “transformation” refers to introducing DNA into a host so that the DNA can be replicated as an extrachromosomal factor or through completion of chromosomal integration. Meanwhile, “transfection” means introducing DNA into a host cell so that it can replicate within the host cell.
물론 모든 벡터가 본 발명의 시스템 내에서 DNA 서열을 발현하는데 모두 동등하게 기능을 발휘하지는 않는다는 것을 이해하여야만 한다. 그러나, 당업자라면 과도한 실험적 부담 없이 본 발명의 범위를 벗어나지 않는 채로 여러 벡터 및 발현 조절 서열 중에서 적절한 선택을 할 수 있다. 벡터의 복제수, 복제 수를 조절할 수 있는 능력 및 당해 벡터에 의해 코딩되는 다른 단백질, 예를 들어 항생제 마커의 발현 또한 고려되어야만 한다.Of course, it should be understood that not all vectors are equally functional in expressing DNA sequences within the system of the present invention. However, those skilled in the art can make an appropriate selection among various vectors and expression control sequences without excessive experimental burden and without departing from the scope of the present invention. The copy number of the vector, the ability to control copy number and the expression of other proteins encoded by the vector, such as antibiotic markers, should also be considered.
본 발명의 재조합 벡터의 바람직한 예는 아그로박테리움 투머파시엔스(Agrobacterium tumefaciens)와 같은 적당한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.A preferred example of the recombinant vector of the present invention is the Ti-plasmid vector, which can transfer a part of itself, the so-called T-region, into plant cells when present in a suitable host such as Agrobacterium tumefaciens . Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells or protoplasts from which new plants can be produced with the hybrid DNA properly inserted into the plant's genome. there is. A particularly preferred form of Ti-plasmid vectors are the so-called binary vectors as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host include viral vectors, such as those that may be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, geminiviruses, etc. For example, it may be selected from non-intact plant virus vectors. The use of such vectors can be particularly advantageous when it is difficult to properly transform plant hosts.
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 글리포세이트(glyphosate) 또는 포스피노트리신(phosphinothricin)과 같은 제초제 저항성 유전자, 카나마이신(Kanamycin), G418, 블레오마이신(Bleomycin), 하이그로마이신(hygromycin), 클로람페니콜(chloramphenicol)과 같은 항생제 내성 유전자가 있으나, 이에 한정되는 것은 아니다.The expression vector will preferably include one or more selectable markers. The marker is a nucleic acid sequence that has characteristics that can be generally selected by chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol. There is a resistance gene, but it is not limited to this.
본 발명의 식물 발현 벡터에서, 프로모터는 CaMV 35S, double enhancer CaMV, MacT, CsVMV, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.In the plant expression vector of the present invention, the promoter may be CaMV 35S, double enhancer CaMV, MacT, CsVMV, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter" refers to the region of DNA upstream from a structural gene and refers to the DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in plant cells. A “constitutive promoter” is a promoter that is active under most environmental conditions and developmental states or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be accomplished at various stages and by various tissues. Therefore, constitutive promoters do not limit selection possibilities.
본 발명의 재조합 벡터에서, 통상의 터미네이터를 사용할 수 있으며, 그 예로는 노팔린 신타아제(NOS), 벼 α-아밀라아제 RAmy1 A 터미네이터, HSP18.2 터미네이터, 담배 (Nicotiana tabacum) 익스텐신의 인트로 제거 터미네이터, protease 인히비터 II 터미네이터, RD19B 터미네이터, 파세올린(phaseoline) 터미네이터, 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)의 옥토파인(Octopine) 유전자의 터미네이터, 대장균의 rrnB1/B2 터미네이터 등이 있으나, 이에 한정되는 것은 아니다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알려져 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.In the recombinant vector of the present invention, common terminators can be used, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, HSP18.2 terminator, and intro removal terminator of tobacco (Nicotiana tabacum) extensin. , protease inhibitor II terminator, RD19B terminator, phaseoline terminator, terminator of Octopine gene of Agrobacterium tumefaciens, rrnB1/B2 terminator of E. coli, etc., but are limited to these. That is not the case. Regarding the necessity of terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly preferred in the context of the present invention.
본 발명에 있어서, 상기 식물세포는 쌍자엽 식물 또는 단자엽 식물로부터 유래된 식물세포인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the plant cells may be characterized as plant cells derived from dicot plants or monocot plants, but are not limited thereto.
본 발명에 있어서, 상기 쌍자엽 식물은 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근 및 샐러리로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the dicotyledonous plant is selected from the group consisting of soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot and celery. It may be characterized, but is not limited to this.
또한, 본 발명에 있어서, 상기 단자엽 식물은 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. Additionally, in the present invention, the monocot plant may be selected from the group consisting of rice, barley, wheat, rye, corn, sugarcane, oats, and onions, but is not limited thereto.
일부 양태로서, 상기 식물세포는 Nicotiana benthamiana, Nicotiana tabacum 또는 Arabidopsis thaliana로부터 유래된 것을 특징으로 할 수 있다. In some embodiments, the plant cells may be derived from Nicotiana benthamiana , Nicotiana tabacum , or Arabidopsis thaliana .
한편, 본 발명에서는 상기 식물세포를 이용하여 효과적으로 HPV16 L1 재조합 단백질 생산하는 방법을 개발하였다.Meanwhile, in the present invention, a method for effectively producing HPV16 L1 recombinant protein using the plant cells was developed.
따라서, 본 발명은 또 다른 관점에서, 다음 단계를 포함하는 식물세포에서 HPV16 L1 재조합 단백질을 생산하는 방법을 제공한다:Accordingly, from another aspect, the present invention provides a method for producing HPV16 L1 recombinant protein in plant cells comprising the following steps:
(a) 상기 식물세포를 배양하는 단계; 및(a) culturing the plant cells; and
(b) 상기 배양된 식물세포를 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by disrupting the cultured plant cells.
본 발명에 있어서, 상기 (b) 단계는 상기 배양된 식물세포를 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, step (b) may be characterized in that the total soluble protein extract obtained by disrupting the cultured plant cells is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein, but is limited to this. It doesn't work.
본 발명에 있어서, 상기 (b) 단계의 상기 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl), but is limited thereto. It doesn't work.
예컨대, 본 발명에 있어서, HPV16 L1 재조합 단백질의 순수 분리 정제 목적의 헤파린 친화성 크로마토그래피를 수행하기 위한, 상기 총 가용성 단백질 추출물의 최종 농도로서 0.33M 내지 0.65M의 염화나트륨(NaCl), 예를 들어, 0.50 내지 0.65M의 염화나트륨(NaCl)을 포함하는 것을 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. For example, in the present invention, for performing heparin affinity chromatography for the purpose of pure separation and purification of HPV16 L1 recombinant protein, the final concentration of the total soluble protein extract is 0.33M to 0.65M sodium chloride (NaCl), for example , may be characterized as containing 0.50 to 0.65 M of sodium chloride (NaCl), but is not limited thereto.
본 발명에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography, but is not limited to this.
또한, 헤파린 친화성 크로마토그래피의 추출 단계에서는 0.7 내지 0.9, 바람직하게는 0.75 내지 0.85M, 예컨대, 약 0.8M의 염화나트륨을 포함하는 버퍼로 추출하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. Additionally, the extraction step of heparin affinity chromatography may be characterized as extraction with a buffer containing 0.7 to 0.9, preferably 0.75 to 0.85 M, for example, about 0.8 M of sodium chloride, but is not limited thereto.
본 발명에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles, but is not limited thereto.
또 다른 관점에서 본 발명은 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터에 관한 것이다. From another perspective, the present invention relates to a recombinant vector containing the first DNA construct.
또 다른 관점에서, 본 발명은 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터에 관한 것이다.In another aspect, the present invention relates to a recombinant vector containing the second DNA construct.
또 다른 관점에서, 본 발명은 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터와 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터를 포함하는 키트에 관한 것이다. From another perspective, the present invention relates to a kit comprising a recombinant vector containing the first DNA construct and a recombinant vector containing the second DNA construct.
본 발명에서, 상기 키트는 상기 재조합 벡터를 이용하여 식물을 형질전환하는 방법을 상세히 설명하는 지침서를 추가로 포함할 수 있으며, 식물에 형질전환하기 위한 다양한 시약, 예컨대, 아그로박테리움-매개 형질전환을 위한 공지의 시약을 추가로 포함할 수 있다. In the present invention, the kit may further include instructions explaining in detail how to transform plants using the recombinant vector, and various reagents for transformation in plants, such as Agrobacterium-mediated transformation. Known reagents for may additionally be included.
또 다른 관점에서, 본 발명은 상기 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 형질전환 식물에 관한 것이다.From another perspective, the present invention provides the first DNA construct or a recombinant vector containing the first DNA construct; and a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct.
또 다른 관점에서, 본 발명은 상기 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 상기 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터; 및 P19 단백질을 암호화하는 뉴클레오티드 서열을 포함하는 제3 DNA 컨스트럭트 또는 상기 제3 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 형질전환 식물에 관한 것이다.From another perspective, the present invention provides the first DNA construct or a recombinant vector containing the first DNA construct; The second DNA construct or a recombinant vector containing the second DNA construct; and a third DNA construct containing a nucleotide sequence encoding the P19 protein or a recombinant vector containing the third DNA construct.
본 발명에 있어서, 상기 형질전환 식물은 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the transgenic plants include Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, and rice. , barley, wheat, rye, corn, sugar cane, oats and onions, but is not limited thereto.
본 발명에 있어서, 상기 형질전환 식물은 쌍자엽 식물 또는 단자엽 식물인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, the transgenic plant may be a dicotyledonous plant or a monocotyledonous plant, but is not limited thereto.
예컨대, 상기 쌍자엽 식물은 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 및 샐러리로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.For example, the dicotyledonous plant is selected from the group consisting of soybeans, tobacco, eggplants, peppers, potatoes, tomatoes, Chinese cabbages, radishes, cabbage, lettuce, peaches, pears, strawberries, watermelons, melons, cucumbers, carrots, and celery. It can be done as, but is not limited to this.
또한, 상기 단자엽 식물은 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. Additionally, the monocot plant may be selected from the group consisting of rice, barley, wheat, rye, corn, sugarcane, oats, and onions, but is not limited thereto.
일부 양태로서, 상기 형질전환 식물은 Nicotiana benthamiana, Nicotiana tabacum 또는 Arabidopsis thaliana 인 것을 특징으로 할 수 있다. In some embodiments, the transgenic plant may be Nicotiana benthamiana , Nicotiana tabacum , or Arabidopsis thaliana .
또 다른 관점에서, 본 발명은 다음 단계를 포함하는 형질전환 식물에서 HPV16 L1 재조합 단백질을 생산하는 방법에 관한 것이다:In another aspect, the present invention relates to a method of producing HPV16 L1 recombinant protein in a transgenic plant comprising the following steps:
(a) 상기 형질전환 식물을 생장시키는 단계; 및(a) growing the transgenic plant; and
(b) 상기 식물로부터 분리된 조직을 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by crushing the tissue isolated from the plant.
본 발명에 있어서, 상기 (b) 단계는 상기 식물로부터 분리된 조직을 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the present invention, step (b) may be characterized in that the total soluble protein extract obtained by crushing the tissue isolated from the plant is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein. It is not limited.
본 발명에 있어서, 상기 (b) 단계의 상기 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) may be characterized as containing 0.3M to 0.8M sodium chloride (NaCl), but is limited thereto. It doesn't work.
본 발명에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, step (b) may be characterized in that the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography, but is not limited to this.
본 발명에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the HPV16 L1 recombinant protein may be produced by self-assembling into virus-like particles, but is not limited thereto.
본 발명에서, HPV16 L1 재조합 단백질을 코딩하는 유전자는 벡터를 통해 형질전환 식물 또는 식물세포에서 일시적으로 발현 (transient Expression)되거나, 안정적 형질전환 (stable transformation)될 수 있다.In the present invention, the gene encoding the HPV16 L1 recombinant protein can be transiently expressed or stably transformed in a transformed plant or plant cell through a vector.
HPV16 L1 재조합 단백질을 코딩하는 유전자가 형질전환 식물 또는 식물세포에서 일시적 발현되는 것 이외에도, 목적 단백질을 코딩하는 유전자는 상기 형질전환 식물 또는 식물세포 게놈에 도입되어 염색체상 인자로서 존재함으로써 안정적으로 형질전환될 수 있다. 본 발명이 속하는 기술분야의 당업자에게 있어 상기 목적 단백질을 타겟으로 하는 유전자를 식물 게놈 염색체에 삽입하여서 동일한 효과를 가질 것은 자명하다 할 것이다.In addition to the fact that the gene encoding the HPV16 L1 recombinant protein is transiently expressed in the transformed plant or plant cell, the gene encoding the target protein is introduced into the genome of the transformed plant or plant cell and exists as a chromosomal factor, thereby stably transforming the plant. It can be. For those skilled in the art to which the present invention pertains, it will be obvious that inserting a gene targeting the target protein into the plant genome chromosome will have the same effect.
본 발명에 있어서, HPV16 L1 재조합 단백질을 코딩하는 유전자를 함유하는 벡터의 도입 또는 목적 단백질을 코딩하는 유전자의 염색체 삽입은, 식물 세포들의 집단 (population)에, 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 함유하는 아그로박테리움을 첨가하여 공동배양시킴으로써 수행될 수 있다.In the present invention, the introduction of a vector containing the gene encoding the HPV16 L1 recombinant protein or the chromosomal insertion of the gene encoding the target protein is carried out by inserting the vector containing the gene encoding the target protein into a population of plant cells. It can be performed by adding Agrobacterium containing and co-culturing.
하나의 실시예에서, 상기 공동배양은 암조건에서 수행되는 것을 특징으로 할 수 있다. 상기 공동배양은 식물 세포와 상기 HPV16 L1 재조합 단백질을 코딩하는 유전자를 포함하는 벡터를 포함하는 아그로박테리움의 배양물을 교반하며 배양하는 것으로, 이후 정치배양 (stationary culture) 단계를 추가로 포함할 수 있다.In one embodiment, the co-culture may be performed under dark conditions. The co-culture involves cultivating a culture of Agrobacterium containing plant cells and a vector containing a gene encoding the HPV16 L1 recombinant protein while stirring, and may further include a stationary culture step. there is.
이와 같이, HPV16 L1 재조합 단백질을 코딩하는 유전자는 벡터를 통해 식물 세포 중에서 일시적으로 발현 (transient Expression)되거나, 안정적 형질전환 (stable transformation)될 수 있다.In this way, the gene encoding the HPV16 L1 recombinant protein can be transiently expressed or stably transformed in plant cells through a vector.
상기 정치배양은 배양 배지를 교반하지 않고 용기를 정치한 상태에서 배양하는 방법으로, 본원에서는 교반없이 침적하는 것과 혼용하여 사용될 수 있다.The stationary culture is a method of culturing in a state in which the container is left standing without stirring the culture medium, and herein, it can be used interchangeably with immersion without agitation.
상기 정치배양은 단 회 또는 간헐적 배양 형태로 포함될 수 있다. 단회의 정치배양이 포함되는 경우, 예를 들어 식물 세포와 아그로박테리움의 배양물을 교반하며 공동배양하고, 정치배양한 후 다시 교반배양하는 것을 특징으로 할 수 있다. 간헐적 정치 배양이 포함되는 경우, 식물 세포와 아그로박테리움의 배양물을 교반하며 공동배양 하고, 정치배양한 후 다시 교반하며 공동배양하는 배양 형태가 수 내지 수십 회 반복될 수 있다.The stationary culture may be included in the form of a single or intermittent culture. In the case where a single stationary culture is included, for example, the culture of plant cells and Agrobacterium may be co-cultured with stirring, and after stationary culture, the culture may be stirred again. When intermittent stationary culture is included, the culture form of co-culturing the culture of plant cells and Agrobacterium with stirring, stationary culturing, and then co-culturing with stirring again may be repeated several to dozens of times.
이때, 상세하게는 상기 배양은 상기 식물세포와 상기 목적 단백질을 코딩하는 유전자를 포함하는 벡터를 함유하는 아그로박테리움의 배양물을 1분 내지 48시간 교반하며 공동배양한 다음, 1분 내지 96시간 정치배양한 후 다시 1 내지 10일간 교반배양하는 것을 특징으로 할 수 있다. 공동배양을 위해 첨가되는 아그로박테리움의 OD600는 0.00001 내지 2.0일 수 있다.At this time, in detail, the culture is performed by co-culturing the plant cells and a culture of Agrobacterium containing a vector containing a gene encoding the target protein with agitation for 1 minute to 48 hours, and then for 1 minute to 96 hours. After political culture, it may be characterized as agitated culture for 1 to 10 days. The OD600 of Agrobacterium added for co-culture may be 0.00001 to 2.0.
아그로박테리움의 OD600가 너무 낮으면, 일시적 발현을 위한 형질전환 감염률이 낮아지는 문제가 있고, 너무 높으면 숙주세포의 생존률이 급격하게 감소하는 문제가 있다. 따라서, 상기 정의된 범위의 OD600를 가지는 아그로박테리움을 첨가하여 공동배양하는 것이 바람직하다.If the OD 600 of Agrobacterium is too low, there is a problem that the transformation infection rate for temporary expression is low, and if it is too high, there is a problem that the survival rate of host cells drastically decreases. Therefore, it is preferable to co-cultivate by adding Agrobacterium having an OD 600 in the above-defined range.
이 때, 아그로박테리움은 통상적으로 식물 형질전환을 위하여 사용되는 아그로박테리움을 사용할 수 있으며, 예시적으로 Agrobacterium tumefaciens 또는 Agrobacterium rhizogenes를 사용할 수 있다.At this time, Agrobacterium commonly used for plant transformation can be used, and for example , Agrobacterium tumefaciens or Agrobacterium rhizogenes can be used.
식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법, 원형질체의 전기천공법, 식물 요소로의 현미주사법, 각종 식물 요소의(DNA 또는 RNA-코팅된) 입자 충격법, 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 투머파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다.Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily require a regeneration and/or tissue culture period. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts, electroporation of protoplasts, microinjection into plant elements, particle bombardment of various plant elements (DNA or RNA-coated), invasion of plants or characterization of mature pollen or spores. It can be appropriately selected from Agrobacterium tumefaciens-mediated gene transfer by conversion, infection by (non-complete) virus, etc. A preferred method according to the invention involves Agrobacterium mediated DNA transfer.
또 다른 관점에서, 본 발명은 상기 식물세포 또는 상기 형질전환 식물로부터 상기 방법에 의해 생산된 HPV16 L1 재조합 단백질을 포함하는 HPV16 백신 조성물에 관한 것이다. In another aspect, the present invention relates to an HPV16 vaccine composition comprising the HPV16 L1 recombinant protein produced by the above method from the plant cell or the transgenic plant.
본 발명에 있어서, 상기 백신 조성물은 자궁경부암 백신 조성물인 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다.In the present invention, the vaccine composition may be characterized as a cervical cancer vaccine composition, but is not limited thereto.
상기 백신 조성물은 상기 HPV16 L1 재조합 단백질을 0.1 내지 99.9%(v/v)로 포함할 수 있으나, 이에 한정되지는 않는다. 본 발명에 있어서, 상기 백신 조성물은 상기 단백질 전달을 위한 담체를 추가로 포함할 수 있다. The vaccine composition may contain 0.1 to 99.9% (v/v) of the HPV16 L1 recombinant protein, but is not limited thereto. In the present invention, the vaccine composition may further include a carrier for delivering the protein.
상기 백신 조성물에서 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 포함되는 것을 특징으로 할 수 있으나, 이에 한정되지는 않는다. In the vaccine composition, the HPV16 L1 recombinant protein may be characterized as being self-assembled into virus-like particles, but is not limited thereto.
본 발명에 있어서, 상기 백신 조성물은 상기 바이러스-유사입자 또는 이의 농축액을 포함하는 형태이거나, 상기 식물세포 자체 또는 식물세포의 건조 분말 형태 또는 상기 형질전환 식물의 건조 분말 형태로 사용될 수 있다. 또한, 상기 백신 조성물은 다른 식품 또는 식품 성분과 함께 사용할 수 있으며 통상적인 방법에 따라 적절하게 사용될 수 있다. In the present invention, the vaccine composition may be used in a form containing the virus-like particles or a concentrate thereof, in the form of the plant cells themselves or in the form of a dry powder of the plant cells, or in the form of a dry powder of the transgenic plant. Additionally, the vaccine composition can be used together with other foods or food ingredients and can be used appropriately according to conventional methods.
상기 백신 조성물은 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형 및 멸균 주사용액의 형태로 제형화하여 사용할 수 있다. 제제화할 경우에는 통상적으로 사용되는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제가 함께 사용될 수 있다.The vaccine composition can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., and sterile injectable solutions according to conventional methods. When formulating, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants may be used together.
또 다른 관점에서, 본 발명은 상기 방법에 의해 생산된 HPV16 L1 재조합 단백질을 백신 제형화하는 단계를 추가로 포함하는 백신 제조방법에 관한 것이다.또 다른 관점에서, 본 발명은 상기 HPV16 L1 재조합 단백질을 포함하는 조성물의 백신으로서의 용도에 관한 것이다.From another perspective, the present invention relates to a method for producing a vaccine, further comprising formulating a vaccine using the HPV16 L1 recombinant protein produced by the above method. From another perspective, the present invention relates to a method for producing a vaccine using the HPV16 L1 recombinant protein produced by the above method. It relates to the use of the composition comprising it as a vaccine.
또 다른 관점에서, 본 발명은 상기 HPV16 L1 재조합 단백질의 백신 제조를 위한 용도에 관한 것이다. In another aspect, the present invention relates to the use of the HPV16 L1 recombinant protein for vaccine production.
실시예Example
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.
실시예 1. RbcS 유래 trainsit peptide 길이에 따른 표적화 효율 검증Example 1. Verification of targeting efficiency according to the length of RbcS-derived trainsit peptide
다양한 길이의 RbcS transit peptide는 표 1에 표시된 PF-1/PR-2, PF1/PR-3, 또는 PF-1/PR-4 프라이머쌍을 이용하여 Arabidopsis의 RbcS cDNA를 주형으로 PCR 증폭하였으며, 이들은 제한효소 XbaI 및 XhoI를 이용하여 자른 후 XbaI과 Sal1 제한 효소로 자른 p326-GFP 벡터 (Jin, J.B et al., Plant Cell(2001), 13, 1511-1526)에 라이게이션하였다. RbcS transit peptides of various lengths were prepared using Arabidopsis RbcS cDNA as a template using the primer pairs PF-1/PR-2, PF1/PR-3, or PF-1/PR-4 shown in Table 1. PCR amplified, and these were cut using restriction enzymes XbaI and .
상기 제조된 발현벡터를 애기장대 잎에서 분리한 원형질체에 PEG-매개성 형질전환 방법으로 도입하였다. 동일한 부피의 40% PEG(polyethylene glycol)-3350 용액(Sigma), 0.5M 만니톨 및 100mM CaCl2을 사용하여 상기 클로닝된 플라스미드 5 μg을 2 x 106개의 원형질체 세포에 도입하고 15분 동안 배양한 후 원형질체를 W5 용액 (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM glucose, and 1.5 mM Mes-KOH, pH 5.6)의 2배 용량과 1mL의 배양액으로 2회 세척하고 1mL의 배양액에 재현탁한 후, 28℃의 명조건(녹화 원형질체) 및 암조건(황화 원형질체)에서 밤새도록 배양하였다. 원형질체 배양에 사용된 플레이트는 5% FBS로 미리 코팅하였다. The above-prepared expression vector was introduced into protoplasts isolated from Arabidopsis leaves using a PEG-mediated transformation method. Using the same volume of 40% PEG (polyethylene glycol)-3350 solution (Sigma), 0.5M mannitol, and 100mM CaCl 2 , 5 μg of the cloned plasmid was introduced into 2 x 10 6 protoplast cells and incubated for 15 minutes. Protoplasts were washed twice with 2 times the volume of W5 solution (154mM NaCl, 125mM CaCl 2 , 5mM KCl, 5mM glucose, and 1.5mM Mes-KOH, pH 5.6) and 1mL of culture medium and reproduced in 1mL of culture medium. After turbidity, the cells were cultured overnight at 28°C in light conditions (green protoplasts) and dark conditions (sulfurized protoplasts). Plates used for protoplast culture were pre-coated with 5% FBS.
형질전환체를 제조한 후, 24시간 배양하고 원형질체를 수집, 용해하여 정량하고 이로부터 발현되는 RbcS 융합 단백질의 양을 웨스턴 블랏팅(Western blotting) 분석 방법으로 비교하였다. 구체적으로, 세포 용해액으로부터 단백질 30㎍을 SDS 시료 버퍼와 혼합하여 가열하였고, 10% SDS-PAGE 겔에 전기영동하였다. 분리된 단백질을 PVDF 막에 이동시키고, 5% 스킴 밀크(skim milk)로 블로킹하였다. 이후 생쥐 유래의 anti-GFP 단일 항체 (1 : 1000 희석; Clontech Laboratories)와 함께 반응시켰고, HRP(horseradish peroxidase)가 결합된 2차 항체와 반응시켰다. 이후 ECL 용액을 제조사의 지침에 따라 처리하였다.After preparing the transformants, they were cultured for 24 hours, and the protoplasts were collected, lysed, quantified, and the amount of RbcS fusion protein expressed therefrom was compared using Western blotting analysis. Specifically, 30 μg of protein from the cell lysate was mixed with SDS sample buffer, heated, and electrophoresed on a 10% SDS-PAGE gel. The separated proteins were transferred to a PVDF membrane and blocked with 5% skim milk. Afterwards, it was reacted with a mouse-derived anti-GFP single antibody (1:1000 dilution; Clontech Laboratories), and then reacted with a HRP (horseradish peroxidase)-conjugated secondary antibody. The ECL solution was then processed according to the manufacturer's instructions.
그 결과, 도 1에서와 같이 54개의 아미노산 잔기를 갖는 transit peptide와 융합된 GFP 단백질은 전혀 엽록체로 이동하지 못하였으나, 60개 아미노산 잔기를 갖는 transit peptide와 융합된 GFP 단백질은 대부분 엽록체로 이동하고, 일부의 융합 단백질만이 엽록체로 이동하지 못한 채 precursor form으로 남아 있었다. 한편, 각각 70개 및 79개 아미노산 잔기를 갖는 transit peptide와 융합된 GFP 단백질은 모두 엽록체로 이동하여 processed form만이 확인되었다. As a result, as shown in Figure 1, the GFP protein fused with a transit peptide with 54 amino acid residues did not move to chloroplasts at all, but most of the GFP proteins fused with a transit peptide with 60 amino acid residues moved to chloroplasts. Only some of the fusion proteins failed to move to the chloroplast and remained in precursor form. Meanwhile, the GFP protein fused with the transit peptide, which has 70 and 79 amino acid residues, respectively, moved to the chloroplast, and only the processed form was confirmed.
이와 같은 결과로부터, 재조합 단백질의 엽록체로의 효과적인 이동을 위하여 엽록체 transit peptide의 N-말단으로부터 적어도 60개 아미노산이 필요하고, 특히 70개 이상의 아미노산 잔기를 갖는 엽록체 transit peptide는 융합단백질을 완전히 엽록체로 이동시킬 수 있음을 알 수 있었다. From these results, at least 60 amino acids from the N-terminus of the chloroplast transit peptide are required for effective movement of the recombinant protein into chloroplasts, and in particular, chloroplast transit peptides with more than 70 amino acid residues completely transport the fusion protein to chloroplasts. I knew I could do it.
실시예 2. HPV16 L1 재조합 단백질 발현 벡터의 구축Example 2. Construction of HPV16 L1 recombinant protein expression vector
HPV16 L1 단백질에 엽록체 transit peptide가 융합되어 발현되도록 DNA 컨스트럭트를 제작하여 식물에 도입하면, HPV16 L1 재조합 단백질을 엽록체에 축적시켜 생산할 수 있다(Maryam Zahin et al. PLoS One. 2016; 11(8): e0160995). 그러나 HPV16 L1 재조합 단백질이 엽록체로 이동하는 과정에서 엽록체 transit peptide가 잘려 나가지만 엽록체 transit peptide C-말단의 일부 아미노산 잔기는 여전히 HPV16 L1 재조합 단백질에 융합되어 있는 것으로 나타났다 (Maryam Zahin et al. PLoS One. 2016; 11(8): e0160995.)By constructing a DNA construct to express a chloroplast transit peptide fused to the HPV16 L1 protein and introducing it into plants, the HPV16 L1 recombinant protein can be accumulated and produced in the chloroplast (Maryam Zahin et al. PLoS One. 2016; 11(8) ): e0160995). However, during the process of moving the HPV16 L1 recombinant protein to the chloroplast, the chloroplast transit peptide is cut off, but some amino acid residues at the C-terminus of the chloroplast transit peptide are still fused to the HPV16 L1 recombinant protein (Maryam Zahin et al. PLoS One. 2016;11(8):e0160995.)
이처럼 HPV16 L1 재조합 단백질의 N-말단에 엽록체 transit peptide 유래 일부 아미노산 잔기가 남아 있으면, HPV16 L1 재조합 단백질의 VLP 형성에 영향을 미칠 뿐만 아니라, 이는 HPV16 L1과 무관한 면역반응을 유도하는 에피토프로 작용할 수 있다. 따라서, 식물에서 HPV16 L1 재조합 단백질을 생산하기 위해서는 HPV16 L1 재조합 단백질이 엽록체로 이동하는 효율을 극대화하는 동시에, 외인성(exogenenous) 아미노산 잔기 없는 정확한(authentic) HPV16 L1 재조합 단백질을 생산할 수 있는 시스템을 개발할 필요가 있었다. In this way, if some amino acid residues derived from the chloroplast transit peptide remain at the N-terminus of the HPV16 L1 recombinant protein, it not only affects the VLP formation of the HPV16 L1 recombinant protein, but can also act as an epitope that induces an immune response unrelated to HPV16 L1. there is. Therefore, in order to produce HPV16 L1 recombinant protein in plants, it is necessary to develop a system that can maximize the efficiency of HPV16 L1 recombinant protein movement into chloroplasts and at the same time produce authentic HPV16 L1 recombinant protein without exogenenous amino acid residues. There was.
이를 위하여, 본 발명에서는 SUMO domain과 SUMO-specific protease인 bdSENP1을 이용하고자 하였다. For this purpose, the present invention attempted to use bdSENP1, a SUMO domain and SUMO-specific protease.
2-1. pMacT19-SR-16 벡터2-1. pMacT19-SR-16 Vector
먼저 MacT promoter는 서열번호 12의 뉴클레오티드 서열(화학적 합성, 바이오니아, 한국)을 주형으로 하여 PF-5/PR-6 프라이머 쌍으로 PCR을 증폭하고 PstI 과 XbaI 제한효소로 절단한 후, 이를 동일한 제한효소로 절단한 pCBM3-bdSUMO-hIL6 binary 벡터 (Islam Md. R. et al., Plant Biotechnol. J. (2018), 10.1111/pbi.13040)에 라이게이션하였다. First, the MacT promoter was amplified by PCR using the PF-5/PR-6 primer pair using the nucleotide sequence of SEQ ID NO. 12 (chemical synthesis, Bioneer, Korea) as a template, cut with PstI and XbaI restriction enzymes, and then digested with the same restriction enzymes. It was ligated into the pCBM3-bdSUMO-hIL6 binary vector (Islam Md. R. et al., Plant Biotechnol. J. (2018), 10.1111/pbi.13040).
이후, 양 말단에 SpeI 및 XhoI 제한효소를 가지도록 증폭된 HPV16-L1 유전자(중앙대 김진홍 교수 제공)를 SpeI 및 XhoI 제한효소로 절단한 후, SpeI 및 XhoI 제한효소로 절단한 상기 MacT 프로모터가 도입된 벡터에 라이게이션 하여 pMacT:BiP:CBM3:bdSUMO:HPV16-L1을 구축하였다.Afterwards, the HPV16-L1 gene amplified to have SpeI and XhoI restriction enzymes at both ends (provided by Professor Jinhong Kim of Chung-Ang University) was cut with SpeI and pMacT:BiP:CBM3:bdSUMO:HPV16-L1 was constructed by ligating the vector.
HPV16 L1을 엽록체로 표적화하기 위하여 BiP:CBM3 domain을 RbcS transit peptide로 치환하고자 하였다. 이를 위하여 루비스코 복합체(rubisco complex)의 작은 서브유닛인 RbcS (RbcS, accession number, AY065101)의 transit peptide를 사용하고자 하였으며, 이 RbcS transit peptide는 Arabidopsis의 RbcS cDNA를 주형으로 PF-12/PR-13 프라이머쌍으로 PCR 증폭하고 XbaI 및 XmaI 제한효소로 절단한 후, 상기 pMacT:BiP:CBM3:bdSUMO:HPV16-L1 벡터를 동일한 제한 효소로 절단한 후 라이게이션하므로써 BiP:CBM3를 RbcS transit peptide로 치환한 pMacT:RbcS:bdSUMO:HPV16-L1를 구축하였다. 이때 RbcS transit peptide의 증폭에 사용된 PF12 primer에 M17 5' UTR 서열이 포함되도록 프라이머를 디자인하였다. To target HPV16 L1 to chloroplasts, we attempted to replace the BiP:CBM3 domain with the RbcS transit peptide. For this purpose, we attempted to use the transit peptide of RbcS (RbcS, accession number, AY065101), a small subunit of the rubisco complex, and this RbcS transit peptide was prepared using the RbcS cDNA of Arabidopsis as a template. After PCR amplification with the PF-12/PR-13 primer pair and digestion with XbaI and pMacT:RbcS:bdSUMO:HPV16-L1 was constructed by substituting RbcS transit peptide. At this time, primers were designed to include the M17 5' UTR sequence in the PF12 primer used for amplification of the RbcS transit peptide.
마지막으로 RD29B 터미네이터는 서열 번호 13(화학적 합성, 바이오니아, 한국)을 주형으로 하여 PF-14/PR15 프라이머 쌍으로 PCR 증폭하고 제한효소 XhoI과 EcoR1로 절단한 후, pMacT:RbcS:bdSUMO:HPV16-L1 벡터를 동일한 제한효소로 절단하고 HPV16-L1 유전자 3' 말단에 위치하도록 라이게이션함으로써 pMacT19-SR-16를 구축하였다. .Finally, the RD29B terminator was PCR amplified using SEQ ID NO: 13 (Chemical Synthesis, Bioneer, Korea) as a template using the PF-14/PR15 primer pair, cut with restriction enzymes pMacT19-SR-16 was constructed by cutting the vector with the same restriction enzyme and ligating it to the 3' end of the HPV16-L1 gene. .
2-2. pMacIN19-SR16 벡터2-2. pMacIN19-SR16 Vector
한편, HPV16 L1 재조합 유전자 컨스트럭트의 5' 업스트림 부위(upstream region)에 Arabidopsis UBQ10의 인트론(intron)을 삽입하기 위하여, MacT-UBQ10 인트론 융합 DNA 단편을 Arabidopsis의 gDNA 및 MacT promoter를 주형으로 각각 PF-5/PR-7 및 PF-8/PR-9 프라이머 쌍을 이용하여 오버랩(overlap) PCR을 수행하여 융합 증폭한 후 제한효소 Pst1과 XbaI을 이용하여 절단하고, 상기 pMacT19-SR-16 벡터에서 MacT 프로모터를 제한효소 Pst1과 XbaI로 제거한 후, 제거된 위치에 MACT-UBQ10의 인트론(intron) 융합 단편을 삽입하여 pMacIN19-SR16 벡터를 구축하였다. Meanwhile, in order to insert the Arabidopsis UBQ10 intron into the 5' upstream region of the HPV16 L1 recombinant gene construct, the MacT-UBQ10 intron fusion DNA fragment was PF using Arabidopsis gDNA and the MacT promoter as templates, respectively. Fusion amplification was performed by performing overlap PCR using primer pairs -5/PR-7 and PF-8/PR-9, and then cleaved using restriction enzymes Pst1 and After removing the MacT promoter with restriction enzymes Pst1 and
2-3. pP19 벡터2-3. pP19 vector
gene silencing suppressor 유전자인 P19을 발현시키기 위하여 P19 유전자는 화학적으로 합성하였으며 (바이오니아, 대전, 대한민국), 이를 주형으로 PF-10/PR-11 프라이머 쌍으로 PCR 증폭하고, XbaI 및 XhoI 제한효소로 절단한 후, pCAMPIA1300 벡터(addgene)를 XbaI 및 XhoI 제한효소로 절단하고 35S 프로모터와 Nos-터미네이터 사이에 위치하도록 삽입하였다. P38은 바이러스 유사 입자를 생성하여, 본 발명을 통해 생산하고자 하는 HPV16 L1의 분리 정제를 방해하기 때문에, 이러한 방해작용을 하지 않는 gene silencing suppressor인 P19를 사용하였다. In order to express P19, a gene silencing suppressor gene, the P19 gene was chemically synthesized (Bioneer, Daejeon, Korea), PCR amplified using the PF-10/PR-11 primer pair as a template, and digested with XbaI and XhoI restriction enzymes. Afterwards, the pCAMPIA1300 vector (addgene) was cut with XbaI and XhoI restriction enzymes and inserted between the 35S promoter and Nos-terminator. Since P38 generates virus-like particles and interferes with the isolation and purification of HPV16 L1 to be produced through the present invention, P19, a gene silencing suppressor that does not have this interference effect, was used.
2-4. pBdSENP1:HA 벡터2-4. pBdSENP1:HA vector
마지막으로, SUMO-specific protease인 BdSENP1가 엽록체에 표적화되어 발현되도록 애기장대 RbcS의 N-말단 부위 1-80 아미노산(즉, transit peptide)을 암호화하는 DNA 단편 (RbcSN80)을 상기와 같이 PF12/PR18 프라이머 쌍을 이용하여 증폭하고, BdSENP1는 pRSET-bdSENP1 (Islam Md. R. et al., Plant Biotechnol. J. (2018), 10.1111/pbi.13040)을 주형으로 PF16/PR17 프라이머 쌍을 이용하여 BdESNP1:HA 형태로 증폭하고 이를 각각 XbaI 및 BamH1 또는 BamH1 및 XhoI으로 절단하고, 35S promoter와 Nos-terminator가 있는 pCAMBIA1300 벡터 (addgene)를 XbaI과 Xho1으로 절단한 후 삽입하여 pBdSENP1:HA 발현 벡터를 구축하였다. 이때 PR17 primer에 HA 서열을 포함하도록 프라이머를 디자인하였다. Finally, a DNA fragment (RbcSN80) encoding amino acids 1-80 (i.e., transit peptide) of the N-terminal region of Arabidopsis RbcS (i.e., transit peptide) of Arabidopsis RbcS was used to target and express the SUMO-specific protease BdSENP1 in chloroplasts using PF12/PR18 primers as above. BdSENP1 was amplified using the pair, and BdSENP1 was amplified using pRSET-bdSENP1 (Islam Md. R. et al., Plant Biotechnol. J. (2018), 10.1111/pbi.13040) as a template using the PF16/PR17 primer pair: It was amplified in HA form and cleaved with XbaI and BamH1 or BamH1 and At this time, the primer was designed to include the HA sequence in the PR17 primer.
클로닝에 사용된 프라이머 서열은 표 1과 같다.The primer sequences used for cloning are listed in Table 1.
PrimerPrimer Sequence 5'-3'Sequence 5'-3'
PF-1PF-1 35S-Seq: TTTCAGAAAGAATGCTAACC35S-Seq: TTTCAGAAAGAATGCTAACC
PR-2 PR-2 XhoI-RbcS_54-R: CCG CTCGAG gttaactcttccgccgttXhoI-RbcS_54-R: CCG CTCGAG gttaactcttccgccgtt
PR-3PR-3 XhoI-RbcS_60-R: CCG CTCGAG aggccacacctgcatgcaXhoI-RbcS_60-R: CCG CTCGAG aggccacacctgcatgca
PR-4PR-4 XhoI-RbcS_70-R: CCG CTCGAG gagagtctcaaacttcttcXhoI-RbcS_70-R: CCG CTCGAG gagagtctcaaacttcttc
PF-5PF-5 PstI-MacT-F: GGG ctgcagagagatctcctttgccccPstI-MacT-F: GGG ctgcagagagatctcctttgcccc
PR-6PR-6 XbaI-MacT-R: GGG tctagaaacgatttggtgtatcgXbaI-MacT-R: GGG tctagaaacgatttggtgtatcg
PR-7PR-7 Intr-MacT-overlapping-R: aaggaacacagaaatttaccttgaacgatttggtgtatcgIntr-MacT-overlapping-R: aaggaacacagaaatttaccttgaacgatttggtgtatcg
PF-8PF-8 MacT-Intr-overlapping-F: cgatacaccaaatcgttcaaggtaaatttctgtgttccttMacT-Intr-overlapping-F: cgatacaccaaatcgttcaaggtaaatttctgtgttcctt
PR-9PR-9 XbaI-Intr-R:GGG tctagaatctgttaatcagaaaaactcagattaatcgacaaattcgatcgcacaaactagaaactaacacca gaactagatagXBAI-INTR-R: GGG TCTAGAATCTTAATCAGATCAGATTAATCGACACACACACACACACACTACACTACACTACACAGAGATAGAG
PF-10PF-10 XbaI-P19: GGG tctagaatggaacgagctatacaaggaaacXbaI-P19: GGG tctagaatggaacgagctatacaaggaaac
PR-11PR-11 XhoI-P19: GGG ctcgagttactcgctttctttttcgaaXhoI-P19: GGG ctcgagttactcgctttctttttcgaa
PF-12PF-12 XbaI-M17UTR-RbcS-F: GGG tctagaggcgtgtgtgtgtgttaaagaatggcttcctctatgctctctXbaI-M17UTR-RbcS-F: GGG tctagaggcgtgtgtgtgtgttaaagaatggcttcctctatgctctct
PR-13PR-13 XmaI-RbcS-R: GGG cccggggggaatcggtaaggtcaggXmaI-RbcS-R: GGG cccggggggaatcggtaaggtcagg
PF-14PF-14 XhoI-Rd29B-F: GGG ctcgagaattttactcaaaatXhoI-Rd29B-F: GGG ctcgagaattttactcaaaat
PR-15PR-15 EcoRI- Rd29B-R: GGG aattcatttttgtttgaactEcoRI- Rd29B-R: GGG aattcatttttgtttgaact
PF-16PF-16 BamHI-BdSENP1-F: GGG ggatccccattcgttccgcttaccBamHI-BdSENP1-F: GGG ggatccccattcgttccgcttacc
PR-17PR-17 RBdSENP1-HA-XhoI: GGG ctcgagctatgcataatctggaacatcatatgggtatccagccttcaaatcaagtatRBdSENP1-HA-XhoI: GGG ctcgagctatgcataatctggaacatcatatgggtatccagccttcaaatcaagtat
PR-18PR-18 BamHI-RbcS-R: GGGGGATCCCTGGGAATCGGTAAGGTCAGGBamHI-RbcS-R: GGGGGATCCCTGGGAATCGGTAAGGTCAGG
실시예 3. 형질전환 식물체의 제작 및 HPV16 L1 발현량 비교 Example 3. Construction of transgenic plants and comparison of HPV16 L1 expression level
실시예 2에서 구축된 재조합 단백질 발현 벡터를 당해 분야에 공지된 방법으인 아그로박테리움-매개 형질전환 방법을 이용하여 N. benthamiana 잎에 도입하였다. The recombinant protein expression vector constructed in Example 2 was introduced into N. benthamiana leaves using the Agrobacterium-mediated transformation method, a method known in the art.
구체적으로, 형질전환은 (i) pMacT19-SR-16 단독 발현, (ii) pMacT19-SR-16와 pP19 공동 발현, (iii) pMacT19-SR-16, pP19, pBdSENP1:HA 공동 발현, (iv) pMacIN19-SR-16 단독 발현, (v) pMacIN19-SR-16와 pP19 공동 발현, (vi) pMacIN19-SR-16, pP19, pBdSENP1:HA 공동 발현의 6 가지 실험군으로 진행하였고, Mock 대조군으로는 동량의 빈 벡터(empty vector)를 형질전환하였다. Specifically, transfections were (i) expressing pMacT19-SR-16 alone, (ii) co-expressing pMacT19-SR-16 and pP19, (iii) co-expressing pMacT19-SR-16, pP19, and pBdSENP1:HA, (iv) Six experimental groups were conducted: (v) pMacIN19-SR-16 alone expression, (v) pMacIN19-SR-16 and pP19 co-expression, (vi) pMacIN19-SR-16, pP19, and pBdSENP1:HA co-expression, and the same amount was used as the mock control group. The empty vector was transformed.
형질전환 후 5일째 N. benthamiana 잎 조직을 세포 용해액(50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton X-100)으로 용해시키고, 시료 로딩 버퍼와 혼합하여 10분간 가열한 후, 14,000 rpm에서 원심분리하여 잔여물을 제거하고 상등액, 즉, 총 가용성 단백질(total soluble protein)을 수득하였다. 이후, 단백질 18 μg에 해당하는 시료를 정량하여 10% SDS-PAGE 겔에 전기영동하고, Coomassie brillent blue (CBB) 염색 용액 (CBB, 0.1%; 메탄올, 50%; 빙초산, 10%)으로 20분 염색하였다. 염색 후, 40% 메탄올, 10% 빙초산을 포함한 세척 용액으로 탈색하였으며, 염색된 단백질은 LAS3000 이미징 시스템(Fuji, 일본)를 이용하여 발현 수준을 비교하였다. 또한, 웨스턴 블랏팅을 위해, 10% SDS-PAGE 겔에서 분리된 단백질을 PVDF 막에 이동시키고, 5% 스킴 밀크(skim milk)로 블로킹하였다. 이후 rabbit anti-HPV16 L1 항체(1:10000 희석, 중앙대 김홍진 교수, 실험실 제작) 와 함께 반응시켰고, 고추냉이 퍼옥시데이즈(HRP, horseradish peroxidase)가 결합된 2차 항체와 반응시켰다. 이후 ECL 용액을 제조사의 방법대로 처리하였다.Five days after transformation , N. benthamiana leaf tissue was lysed with cell lysate (50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton X-100), mixed with sample loading buffer, and heated for 10 minutes. The residue was removed by centrifugation at 14,000 rpm, and the supernatant, that is, total soluble protein, was obtained. Afterwards, a sample equivalent to 18 μg of protein was quantified, electrophoresed on a 10% SDS-PAGE gel, and stained with Coomassie brillent blue (CBB) staining solution (CBB, 0.1%; methanol, 50%; glacial acetic acid, 10%) for 20 minutes. dyed. After staining, it was destained with a washing solution containing 40% methanol and 10% glacial acetic acid, and the expression levels of the stained proteins were compared using the LAS3000 imaging system (Fuji, Japan). Additionally, for Western blotting, proteins separated in a 10% SDS-PAGE gel were transferred to a PVDF membrane and blocked with 5% skim milk. Afterwards, it was reacted with rabbit anti-HPV16 L1 antibody (1:10000 dilution, produced by Professor Kim Hong-jin, Chung-Ang University, laboratory), and was reacted with a secondary antibody conjugated with horseradish peroxidase (HRP, horseradish peroxidase). Afterwards, the ECL solution was treated according to the manufacturer's method.
그 결과, 도 3에서와 같이 pMacT19-SR-16 단독 발현과 비교하여 pP19이 공동 발현된 경우 HPV16 L1 재조합 단백질의 발현량이 현저히 증가하였으며, 5' 업스트림 부위에 UBQ10의 인트론을 삽입하고 개시 코돈 앞에 5'UTR을 포함하여 HPV16 L1 재조합 단백질을 발현시킨 경우 발현량을 추가로 증가시킬 수 있음을 확인하였다. 한편, HPV16 L1 재조합 단백질 발현 벡터를 bdSENP1와 공동 발현시킨 경우, transit peptide로부터 유래된 잔여 아미노산 잔기 없는 약 55 kD의 cleaved form HPV16 L1 재조합 단백질이 생성되는 반면, bdSENP1을 공동 발현시키지 않은 경우에는, HPV16 L1 단백질에 transit peptide로부터 유래된 아미노산 잔기가 융합되어 있는 non-cleaved form의 HPV16 L1 재조합 단백질이 확인되었다. As a result, as shown in Figure 3, the expression level of HPV16 L1 recombinant protein was significantly increased when pP19 was co-expressed compared to pMacT19-SR-16 alone, and the intron of UBQ10 was inserted into the 5' upstream region and 5' before the start codon. 'It was confirmed that the expression level could be further increased when HPV16 L1 recombinant protein including UTR was expressed. On the other hand, when the HPV16 L1 recombinant protein expression vector is co-expressed with bdSENP1, a cleaved form HPV16 L1 recombinant protein of about 55 kD without residual amino acid residues derived from the transit peptide is produced, whereas when bdSENP1 is not co-expressed, HPV16 L1 recombinant protein is produced. A non-cleaved form of the HPV16 L1 recombinant protein was identified in which an amino acid residue derived from a transit peptide was fused to the L1 protein.
실시예 4. HPV16 L1 분리 및 정제Example 4. HPV16 L1 isolation and purification
실시예 3에서는 transit peptide로부터 유래된 아미노산이 완전히 절단된 cleaved form의 HPV16 L1 재조합 단백질이 고발현되어 생산될 수 있음을 확인하였으며, 이하에서는 이렇게 고발현되어 세포 내에 존재하는 HPV16 L1 재조합 단백질을 회수하는 효율을 향상시키고자 하였다. In Example 3, it was confirmed that the cleaved form of HPV16 L1 recombinant protein, in which amino acids derived from the transit peptide were completely cleaved, could be produced by high expression. Hereinafter, a method for recovering the highly expressed HPV16 L1 recombinant protein present in the cell was described. We wanted to improve efficiency.
이를 위하여, 실시예 3 형질전환 식물체에서 형질전환 4일 후 N. benthamiana 잎 조직을 세포 용해액(50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton X-100)으로 용해시키고 총 가용성 단백질을 수득하였다. 이를 3중 접힌 게이지 천을 통과시켜 여과시키고, 여과된 균질액을 2mM phytate (Sigma-Aldrich) 및 2mM CaCl2로 처리한 후, 14,000 rpm으로 30분간 원심분리하여 침전물을 제거하고 상등액을 확보하였다. For this purpose, 4 days after transformation in the transgenic plants of Example 3 , N. benthamiana leaf tissue was lysed with cell lysate (50mM Tris-HCl, pH7.2, 200mM NaCl, 0.1% Triton was obtained. This was filtered through a triple-folded gauge cloth, and the filtered homogenate was treated with 2mM phytate (Sigma-Aldrich) and 2mM CaCl 2 and then centrifuged at 14,000 rpm for 30 minutes to remove precipitates and secure the supernatant.
각각 0.33M, 0.4M, 0.5M, 또는 0.65M의 NaCl 농도를 갖도록 상등액에 NaCl을 추가한 후, 이 단백질 추출액들을 헤파린 친화성 수지(POROS™HE Heparin Affinity Resin, Cat. No. 4333410) 12.5mg으로 채워진 컬럼을 통과 시켜서 HPV16 L1 재조합 단백질이 헤파린 친화성 수지에 결합하도록 유도하였다. 이어서, 상기 컬럼을 300mM NaCl이 포함된 PBS (20mL)로 여러 번 세척하고, 0.8M NaCl이 포함된 PBS를 이용하여 헤파린 친화성 수지에 결합된 HPV16 L1 재조합 단백질을 1ml씩 10개 분획으로 유리시켰다. 이후, 유리된 각 분획을 실시예 3과 동일한 방식으로 SDS/PAGE 후 Coomassie brillent blue 염색 또는 항-HPV16 L1 항체로 웨스턴 블랏팅 분석하였다. After adding NaCl to the supernatant to have a NaCl concentration of 0.33M, 0.4M, 0.5M, or 0.65M, respectively, these protein extracts were incubated with 12.5 mg of heparin affinity resin (POROS™HE Heparin Affinity Resin, Cat. No. 4333410). The HPV16 L1 recombinant protein was induced to bind to the heparin affinity resin by passing through a column filled with . Subsequently, the column was washed several times with PBS (20 mL) containing 300mM NaCl, and the HPV16 L1 recombinant protein bound to the heparin affinity resin was liberated into 10 fractions of 1 ml each using PBS containing 0.8M NaCl. . Thereafter, each free fraction was subjected to SDS/PAGE in the same manner as in Example 3, followed by Coomassie Brillent Blue staining or Western blotting analysis with anti-HPV16 L1 antibody.
그 결과, 도 4에서와 같이 총 가용성 단백질 추출물을 최종 0.5M 또는 0.65M의 NaCl 농도로 조정하였을 때, 헤파린 수지에 비특이적 결합을 감소시키고, 0.8M NaCl을 포함하는 PBS를 이용하여 유리(elution)시켰을 때, 다른 단백질의 오염(contamination)을 방지하고 높은 함량의 HPV16 L1 재조합 단백질을 분리해 낼 수 있었다. As a result, as shown in Figure 4, when the total soluble protein extract was adjusted to a final NaCl concentration of 0.5M or 0.65M, non-specific binding to the heparin resin was reduced and elution was performed using PBS containing 0.8M NaCl. When this was done, contamination of other proteins was prevented and a high content of HPV16 L1 recombinant protein was isolated.
이후, HPV16 L1 재조합 단백질을 더 순수하게 정제하기 위해서 크기 배제 크로마토그래피를 수행하였다. 헤파린 친화성 수지로 정제된 분획을 취합하여 Superdex 컬럼(Hitrap, GE Healthcare Life Sciences, USA)에 로딩하고 PBS, pH 7.2, 0.01% Tween 20를 이동상으로 전개시켰다. 분획을 컬럼에서 0.5mL/min로 1ml 분획씩 4시간 동안 수집하고, 280 nm에서의 흡광도는 분광광도계로 측정하였고 HPV16 L1 재조합 단백질은 실시예 3과 동일한 방식으로 SDS-PAGE와 웨스턴 블랏팅 분석하였다.Afterwards, size exclusion chromatography was performed to further purify the HPV16 L1 recombinant protein. Fractions purified with heparin affinity resin were collected, loaded on a Superdex column (Hitrap, GE Healthcare Life Sciences, USA), and developed with PBS, pH 7.2, 0.01% Tween 20 as a mobile phase. Fractions were collected on the column at 0.5 mL/min in 1 ml fractions for 4 hours, the absorbance at 280 nm was measured with a spectrophotometer, and HPV16 L1 recombinant protein was analyzed by SDS-PAGE and Western blotting in the same manner as in Example 3. .
그 결과, 도 5에서와 같이 HPV16 L1 재조합 단백질이 첫 번째 피크를 구성하는 8 내지 10번 분획에서 확인되었으며, 이들 분획은 HPV16 L1 재조합 단백질의 분자량인 55 kD 보다 대단히 큰 분자량을 갖는 670 kD의 크기로 확인되어, HPV16 L1 재조합 단백질이 단분자 형태가 아닌 복합체를 이루고 있으며, HPV16 L1 재조합 단백질이 VLP를 형성하고 있을 것으로 예상하였다. As a result, as shown in Figure 5, HPV16 L1 recombinant protein was confirmed in fractions 8 to 10 constituting the first peak, and these fractions had a molecular weight of 670 kD, which was much larger than the molecular weight of 55 kD, which was the molecular weight of HPV16 L1 recombinant protein. It was confirmed that the HPV16 L1 recombinant protein forms a complex rather than a single molecule, and it was expected that the HPV16 L1 recombinant protein forms a VLP.
실시예 5. VLP 형성 확인Example 5. Confirmation of VLP formation
HPV16 L1 재조합 단백질이 VLP를 형성하는지 확인하고자 실시예 4에서 분리 정제된 HPV16 L1 재조합 단백질을 탄소 코팅 그리드(Electron Microscopy Sciences, USA)에 흡수시키고 2% 인텅스텐산(pH 6.8)으로 음성 염색(negatively staining)한 후, 투과 전자 현미경(Phillips CM-12)에 의해 150,000 및 250,000의 최종 배율에서 관찰하였다. To confirm whether the HPV16 L1 recombinant protein forms a VLP, the HPV16 L1 recombinant protein isolated and purified in Example 4 was absorbed onto a carbon-coated grid (Electron Microscopy Sciences, USA) and negatively stained with 2% phosphotungstic acid (pH 6.8). After staining, it was observed using a transmission electron microscope (Phillips CM-12) at final magnifications of 150,000 and 250,000.
그 결과, 도 6에서와 같이 HPV16 L1 재조합 단백질이 VLP를 형성하는 것을 확인하였다. As a result, it was confirmed that HPV16 L1 recombinant protein formed VLP, as shown in Figure 6.
실시예 6. HPV16 L1 재조합 단백질 VLP의 면역 반응 확인Example 6. Confirmation of immune response to HPV16 L1 recombinant protein VLP
분리 정제된 HPV16 L1 재조합 단백질의 농도는 소 혈청 알부민(BSA; Pierce, USA)이 포함된 Bio-Rad Bradford 단백질 분석 시약(Bio-Rad Laboratories, USA)을 사용하여 결정되었다. The concentration of isolated and purified HPV16 L1 recombinant protein was determined using Bio-Rad Bradford protein assay reagent (Bio-Rad Laboratories, USA) containing bovine serum albumin (BSA; Pierce, USA).
BALB/c 마우스(6-8 주령, 효창 사이언스)는 습도, 온도 및 광주기(12:12)가 제어된 특정 병원균이 없는 조건에서 사육하였다. 마우스는 고압 멸균 식품(NIH 31, 6% 지방, Lab Diet 5K52, Purina Mills, St. Louis, MO) 및 산성화된 물(pH 2.8-3.2)을 자유급이하도록 하였다. BALB/c mice (6-8 weeks old, Hyochang Science) were raised under specific pathogen-free conditions with controlled humidity, temperature, and photoperiod (12:12). Mice were fed autoclaved food (NIH 31, 6% fat, Lab Diet 5K52, Purina Mills, St. Louis, MO) and acidified water (pH 2.8-3.2) ad libitum.
식물 HPV16 L1 재조합 단백질 VLP의 과면역 혈청을 수집하기 위해 BALB/c 마우스를 면역화하였다. 구체적으로, 10㎍의 분리 정제된 HPV16 L1 재조합 단백질 VLP 또는 PBS(대조군)는 추가적인 보조제 없이 2주 간격으로 2차례 피하주사하였다. 첫번째 면역 주사 후 42일째 되는 날에 혈액을 채취하여 항체의 생성 여부를 ELISA를 이용하여 확인하였다.BALB/c mice were immunized to collect hyperimmune sera with plant HPV16 L1 recombinant protein VLPs. Specifically, 10 μg of isolated and purified HPV16 L1 recombinant protein VLP or PBS (control group) was injected subcutaneously twice at 2-week intervals without additional adjuvants. Blood was collected on the 42nd day after the first immunization injection, and the production of antibodies was confirmed using ELISA.
96웰 ELISA 플레이트(Immunolon 2; Dynatech)를 4℃에서 웰당 형질전환 식물체 유래 정제된 HPV L1 재조합 단백질 VLP 400ng을 1X DPBS에 재현탁시키거나, 형질전환 식물체 유래 정제된 HPV L1 재조합 단백질 VLP을 0.2M NaHCO3 로 4℃에서 12 시간 처리하여 해체된(disassembled) HPV L1 재조합 단백질 400ng을 1X DPBS에 재현탁 시킨 후, 플레이트에 밤새 코팅하였다. 플레이트를 세척 완충액(PBS-T)으로 3회 세척하고 37℃에서 1시간 동안 1XPBS 중 5% BSA(PBSA)로 블로킹하였다. 세척 완충액으로 3회 세척한 후, 코팅된 플레이트를 1% PBSA에 1:4000으로 희석한 수집된 마우스 혈청과 37℃에서 1시간 동안 반응시켰다. 그 후, 플레이트를 PBS-T로 3회 세척하고, 1% PBSA에 1:5000으로 희석한 알칼리성 포스파타제-접합 염소 항-마우스 gG(H+L)(Sigma, USA)와 37℃에서 1시간 동안 반응시켰다. 결합되지 않은 2차 항체는 세척하여 제거하고 결합된 항체는 알칼리성 포스파타제 발색 기질(Sigma, USA)로 염색하고 405 nm에서 흡광도를 측정하였다.In a 96-well ELISA plate (Immunolon 2; Dynatech), 400 ng of purified HPV L1 recombinant protein VLPs from transgenic plants were resuspended in 1 400ng of HPV L1 recombinant protein disassembled by treatment with NaHCO 3 at 4°C for 12 hours was resuspended in 1X DPBS and coated on a plate overnight. Plates were washed three times with wash buffer (PBS-T) and blocked with 5% BSA in 1XPBS (PBSA) for 1 hour at 37°C. After washing three times with washing buffer, the coated plate was reacted with collected mouse serum diluted 1:4000 in 1% PBSA at 37°C for 1 hour. Afterwards, the plates were washed three times with PBS-T and incubated with alkaline phosphatase-conjugated goat anti-mouse gG(H+L) (Sigma, USA) diluted 1:5000 in 1% PBSA for 1 h at 37°C. reacted. Unbound secondary antibodies were removed by washing, and bound antibodies were stained with alkaline phosphatase chromogenic substrate (Sigma, USA) and absorbance was measured at 405 nm.
그 결과, 도 7에서와 같이 HPV L1 재조합 단백질 VLP가 코팅된 플레이트에 대한 HPV16 L1 재조합 단백질 VLP로 면역화시킨 마우스 혈청은 OD450이 2.5로 확인되었고, 해체된(disassembled) HPV L1 재조합 단백질이 코팅된 플레이트에 대한 HPV16 L1 재조합 단백질 VLP로 면역화시킨 마우스 혈청은 OD450이 1.4로 확인되었으며, PBS 자체 또는 PBS로 면역화시킨 마우스 혈청은 의미 있는 OD450이 확인되지 않아, 본 발명에서 제조된 식물 유래 HPV16 L1 재조합 단백질 VLP는 생체 내에서 HPV16 L1 단백질 VLP와 VLP 구조를 형성하지 않는 HPV16 L1 단백질 모두에 대해 특이적으로 결합하는 항체를 생산할 수 있음을 확인하였다. As a result, as shown in Figure 7, the OD 450 of the mouse serum immunized with the HPV16 L1 recombinant protein VLP on the plate coated with the HPV L1 recombinant protein VLP was confirmed to be 2.5, and the disassembled HPV L1 recombinant protein coated plate was confirmed to have an OD 450 of 2.5. The mouse serum immunized with HPV16 L1 recombinant protein VLP on the plate had an OD 450 of 1.4, and the mouse serum immunized with PBS itself or PBS did not have a significant OD 450 , indicating that the plant-derived HPV16 L1 produced in the present invention had an OD 450 of 1.4. It was confirmed that the recombinant protein VLP can produce antibodies that specifically bind to both the HPV16 L1 protein VLP and the HPV16 L1 protein that does not form a VLP structure in vivo.
실시예 7. 서열정보Example 7. Sequence information
서열번호 1: HPV16 L1 아미노산 서열SEQ ID NO: 1: HPV16 L1 amino acid sequence
Figure PCTKR2023014783-appb-img-000001
Figure PCTKR2023014783-appb-img-000001
서열번호 2: HPV16 L1 뉴클레오티드 서열SEQ ID NO: 2: HPV16 L1 nucleotide sequence
Figure PCTKR2023014783-appb-img-000002
Figure PCTKR2023014783-appb-img-000002
서열번호 3: RbcSN80 아미노산 서열SEQ ID NO: 3: RbcSN80 amino acid sequence
Figure PCTKR2023014783-appb-img-000003
Figure PCTKR2023014783-appb-img-000003
서열번호 4: RbcSN80 뉴클레오티드 서열 SEQ ID NO: 4: RbcSN80 nucleotide sequence
Figure PCTKR2023014783-appb-img-000004
Figure PCTKR2023014783-appb-img-000004
서열번호 5: bdSUMO 아미노산 서열SEQ ID NO: 5: bdSUMO amino acid sequence
Figure PCTKR2023014783-appb-img-000005
Figure PCTKR2023014783-appb-img-000005
서열번호 6: bdSUMO 뉴클레오티드 서열SEQ ID NO: 6: bdSUMO nucleotide sequence
Figure PCTKR2023014783-appb-img-000006
Figure PCTKR2023014783-appb-img-000006
서열번호 7: UBQ10 Intron SequenceSEQ ID NO: 7: UBQ10 Intron Sequence
Figure PCTKR2023014783-appb-img-000007
Figure PCTKR2023014783-appb-img-000007
서열번호 8: bdSENP1 아미노산 서열SEQ ID NO: 8: bdSENP1 amino acid sequence
Figure PCTKR2023014783-appb-img-000008
Figure PCTKR2023014783-appb-img-000008
서열번호 9: bdSENP1 뉴클레오티드 서열SEQ ID NO: 9: bdSENP1 nucleotide sequence
Figure PCTKR2023014783-appb-img-000009
Figure PCTKR2023014783-appb-img-000009
서열번호 10: P19 아미노산 서열SEQ ID NO: 10: P19 amino acid sequence
Figure PCTKR2023014783-appb-img-000010
Figure PCTKR2023014783-appb-img-000010
서열번호 11: P19 뉴클레오티드 서열SEQ ID NO: 11: P19 nucleotide sequence
Figure PCTKR2023014783-appb-img-000011
Figure PCTKR2023014783-appb-img-000011
서열번호 12: MacT 프로모터 서열SEQ ID NO: 12: MacT promoter sequence
Figure PCTKR2023014783-appb-img-000012
Figure PCTKR2023014783-appb-img-000012
서열번호 13: RD29B 종결자 서열SEQ ID NO: 13: RD29B terminator sequence
Figure PCTKR2023014783-appb-img-000013
Figure PCTKR2023014783-appb-img-000013
서열 번호 14: M17 5' UTRSEQ ID NO: 14: M17 5'UTR
Figure PCTKR2023014783-appb-img-000014
Figure PCTKR2023014783-appb-img-000014
서열번호 15:SEQ ID NO: 15: HA 염기 서열 HA base sequence
Figure PCTKR2023014783-appb-img-000015
Figure PCTKR2023014783-appb-img-000015
서열번호 16: HA 아미노산 서열 SEQ ID NO: 16: HA amino acid sequence
Figure PCTKR2023014783-appb-img-000016
Figure PCTKR2023014783-appb-img-000016
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred embodiments and do not limit the scope of the present invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (20)

  1. (i) 엽록체 전이 펩타이드(Chloroplast transit peptide), (ii) SUMO 단백질, 및 (iii) HPV16 L1 단백질을 포함하는 융합단백질을 암호화하는 뉴클레오티드를 포함하는 제1 DNA 컨스트럭트.A first DNA construct comprising nucleotides encoding a fusion protein comprising (i) a chloroplast transit peptide, (ii) a SUMO protein, and (iii) an HPV16 L1 protein.
  2. 제1항에 있어서, 5' UTR; 및/또는 UBQ10 intron 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 하는, 제1 DNA 컨스트럭트.5'UTR; And/or the first DNA construct, characterized in that it further comprises a UBQ10 intron nucleotide sequence.
  3. 제1항에 있어서, P19 단백질을 암호화하는 뉴클레오티드 서열을 추가로 포함하는 것을 특징으로 하는, 제1 DNA 컨스트럭트.2. The first DNA construct according to claim 1, further comprising a nucleotide sequence encoding the P19 protein.
  4. 제1항에 있어서, 상기 (i) 엽록체 전이 펩타이드는 서열번호 3으로 표시되는 아미노산 서열의 N-말단으로부터 1 내지 60번째 아미노산을 포함하는 것을 특징으로 하는, 제1 DNA 컨스트럭트.The first DNA construct according to claim 1, wherein the (i) chloroplast transfer peptide comprises the 1st to 60th amino acids from the N-terminus of the amino acid sequence represented by SEQ ID NO: 3.
  5. 제1항 내지 제4항 중 어느 한 항의 제1 DNA 컨스트럭트; 및The first DNA construct of any one of claims 1 to 4; and
    SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트를 포함하는, DNA 컨스트럭트 쌍. A pair of DNA constructs, comprising a second DNA construct comprising a sequence encoding a SUMO protease.
  6. 제1항 내지 제4항 중 어느 한 항의 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및The first DNA construct of any one of claims 1 to 4 or a recombinant vector comprising the first DNA construct; and
    SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 식물세포.A plant cell into which a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct is introduced.
  7. 제6항에 있어서, 상기 식물세포는 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 식물로부터 유래된 것을 특징으로 하는, 식물세포.The method of claim 6, wherein the plant cells include Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, and rice. , a plant cell, characterized in that it is derived from a plant selected from the group consisting of barley, wheat, rye, corn, sugar cane, oats and onions.
  8. 다음 단계를 포함하는 식물세포에서 HPV16 L1 재조합 단백질을 생산하는 방법:Method for producing HPV16 L1 recombinant protein in plant cells comprising the following steps:
    (a) 제6항의 식물세포를 배양하는 단계; 및(a) culturing the plant cells of paragraph 6; and
    (b) 상기 배양된 식물세포를 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by disrupting the cultured plant cells.
  9. 제8항에 있어서, According to clause 8,
    상기 (b) 단계는 상기 배양된 식물세포를 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 하는, 방법.In step (b), the total soluble protein extract obtained by disrupting the cultured plant cells is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
  10. 제9항에 있어서, According to clause 9,
    상기 (b) 단계의 상기 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 하는, 방법.The method wherein the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) contains 0.3M to 0.8M sodium chloride (NaCl).
  11. 제9항에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 하는, 방법.The method of claim 9, wherein in step (b), the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
  12. 제8항에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 하는 방법.The method of claim 8, wherein the HPV16 L1 recombinant protein is produced by self-assembling into virus-like particles.
  13. 제1항 내지 제4항 중 어느 한 항의 제1 DNA 컨스트럭트 또는 상기 제1 DNA 컨스트럭트를 포함하는 재조합 벡터; 및The first DNA construct of any one of claims 1 to 4 or a recombinant vector comprising the first DNA construct; and
    SUMO protease를 암호화하는 서열을 포함하는 제2 DNA 컨스트럭트 또는 상기 제2 DNA 컨스트럭트를 포함하는 재조합 벡터;가 도입되어 있는 형질전환 식물.A transgenic plant into which a second DNA construct containing a sequence encoding SUMO protease or a recombinant vector containing the second DNA construct is introduced.
  14. 제13항에 있어서, 상기 형질전환 식물은 애기장대, 대두, 담배, 가지, 고추, 감자, 토마토, 배추, 무, 양배추, 상추, 복숭아, 배, 딸기, 수박, 참외, 오이, 당근, 샐러리, 벼, 보리, 밀, 호밀, 옥수수, 사탕수수, 귀리 및 양파로 구성된 군으로부터 선택되는 것을 특징으로 하는, 형질전환 식물.The method of claim 13, wherein the transgenic plant is Arabidopsis, soybean, tobacco, eggplant, pepper, potato, tomato, Chinese cabbage, radish, cabbage, lettuce, peach, pear, strawberry, watermelon, melon, cucumber, carrot, celery, A transgenic plant, characterized in that it is selected from the group consisting of rice, barley, wheat, rye, corn, sugarcane, oats and onions.
  15. 다음 단계를 포함하는 형질전환 식물에서 HPV16 L1 재조합 단백질을 생산하는 방법:Method for producing HPV16 L1 recombinant protein in transgenic plants comprising the following steps:
    (a) 제13항의 형질전환 식물을 생장시키는 단계; 및(a) growing the transgenic plant of item 13; and
    (b) 상기 식물로부터 분리된 조직을 파쇄하여 HPV16 L1 재조합 단백질을 회수하는 단계.(b) Collecting HPV16 L1 recombinant protein by crushing the tissue isolated from the plant.
  16. 제15항에 있어서, According to clause 15,
    상기 (b) 단계는 상기 식물로부터 분리된 조직을 파쇄하여 수득된 총 가용성 단백질 추출물을 헤파린 친화성 크로마토그래피로 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 하는, 방법.The step (b) is characterized in that the total soluble protein extract obtained by crushing the tissue isolated from the plant is purified by heparin affinity chromatography to recover the HPV16 L1 recombinant protein.
  17. 제16항에 있어서, According to clause 16,
    상기 (b) 단계의 상기 총 가용성 단백질 추출물을 포함하는 헤파린 친화성 크로마토그래피용 로딩 버퍼는 0.3M 내지 0.8M의 염화나트륨(NaCl)을 포함하는 것을 특징으로 하는, 방법.The method wherein the loading buffer for heparin affinity chromatography containing the total soluble protein extract in step (b) contains 0.3M to 0.8M sodium chloride (NaCl).
  18. 제16항에 있어서, 상기 (b)단계는 헤파린 친화성 크로마토그래피로 정제 후 크기 배제 크로마토그래피로 추가 정제하여 HPV16 L1 재조합 단백질을 회수하는 것을 특징으로 하는, 방법.The method of claim 16, wherein in step (b), the HPV16 L1 recombinant protein is recovered by purifying it by heparin affinity chromatography and then further purifying it by size exclusion chromatography.
  19. 제15항에 있어서, 상기 HPV16 L1 재조합 단백질은 바이러스-유사 입자로 자가-조립(self-assemble)되어 생산되는 것을 특징으로 하는 방법The method of claim 15, wherein the HPV16 L1 recombinant protein is produced by self-assembling into virus-like particles.
  20. 제15항의 방법에 의해 생산된 HPV16 L1 재조합 단백질을 포함하는 HPV16 백신 조성물. An HPV16 vaccine composition comprising the HPV16 L1 recombinant protein produced by the method of claim 15.
PCT/KR2023/014783 2022-10-26 2023-09-26 Production of human papillomavirus virus-like particles from plant WO2024090815A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20220139262 2022-10-26
KR10-2022-0139262 2022-10-26

Publications (1)

Publication Number Publication Date
WO2024090815A1 true WO2024090815A1 (en) 2024-05-02

Family

ID=90831115

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/014783 WO2024090815A1 (en) 2022-10-26 2023-09-26 Production of human papillomavirus virus-like particles from plant

Country Status (1)

Country Link
WO (1) WO2024090815A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011077371A1 (en) * 2009-12-22 2011-06-30 University Of Cape Town Method for enhancing the expression of hpv l1
CN105296521A (en) * 2015-12-07 2016-02-03 郑州大学 Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
KR20190030263A (en) * 2017-09-13 2019-03-22 주식회사 바이오컴 Recombinant vector for separating and purifying target protein in plant

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011077371A1 (en) * 2009-12-22 2011-06-30 University Of Cape Town Method for enhancing the expression of hpv l1
CN105296521A (en) * 2015-12-07 2016-02-03 郑州大学 Recombinant plasmid capable of expressing soluble human papilloma virus 16 subtype L1 protein and expression method thereof
KR20190030263A (en) * 2017-09-13 2019-03-22 주식회사 바이오컴 Recombinant vector for separating and purifying target protein in plant

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ALAN B. ROSE: "The effect of intron location on intron-mediated enhancement of gene expression in Arabidopsis", THE PLANT JOURNAL, BLACKWELL SCIENCE, vol. 40, no. 5, 1 December 2004 (2004-12-01), pages 744 - 751, XP055029911, ISSN: 09607412, DOI: 10.1111/j.1365-313X.2004.02247.x *
DATABASE Protein 26 July 2016 (2016-07-26), ANONYMOUS: "unnamed protein product, partial [synthetic construct]", XP093165544, retrieved from NCBI Database accession no. CAA48415.1 *
MARYAM ZAHIN: "Scalable Production of HPV16 L1 Protein and VLPs from Tobacco Leaves", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, US, vol. 11, no. 8, 12 August 2016 (2016-08-12), US , pages e0160995, XP093165541, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0160995 *
THANGARASU MUTHAMILSELVAN: "Assembly of Human Papillomavirus 16 L1 Protein in Nicotiana benthamiana Chloroplasts into Highly Immunogenic Virus-Like Particles", JOURNAL OF PLANT BIOLOGY, BOTANICAL SOCIETY OF KOREA, SEOUL, KR, vol. 66, no. 4, 6 April 2023 (2023-04-06), KR , pages 331 - 340, XP093165543, ISSN: 1226-9239, DOI: 10.1007/s12374-023-09393-6 *

Similar Documents

Publication Publication Date Title
CA2595328C (en) Production of hetero-oligomeric proteins in plants
Sun et al. Improved expression and purification of recombinant human serum albumin from transgenic tobacco suspension culture
WO2005063990A2 (en) Wuschel (wus) gene homologs
WO2004003207A1 (en) Production of peptides and proteins by accumulation in plant endoplasmic reticulum-derived protein bodies
WO2011025242A2 (en) Dna fragment for improving translation efficiency, and recombinant vector containing same
US20110055976A1 (en) Method Of Protease Production In Plants
Arokiaraj et al. Expression of human serum albumin in transgenic Hevea brasiliensis
US8076141B2 (en) Nucleotide sequences encoding RAMOSA3 and sister of RAMOSA3 and methods of use for same
WO2018220595A1 (en) Co-expression of human chaperone proteins in plants for increased expression of heterologous polypeptides
WO2021187750A1 (en) Method for mass production of target protein in plant
WO2024090815A1 (en) Production of human papillomavirus virus-like particles from plant
KR101085791B1 (en) Flower and fruit specific expression promoter from Solanum lycopersicum HR7 gene and uses thereof
Maas et al. Expression of intron modified NPT II genes in monocotyledonous and dicotyledonous plant cells
AU781793B2 (en) Scorpion toxins from buthotus judaicus
US7172901B2 (en) Scorpion toxins
WO2023085582A1 (en) Effect of gb1 domain fusion on upregulation of recombinant protein expression in plant
US20040117874A1 (en) Methods for accumulating translocated proteins
WO2021101351A2 (en) Antibody produced using afucosylated tobacco and use thereof
WO2016036195A1 (en) Method for simultaneously increasing photosynthesis efficiency and drought and salt damage resistance of plants
WO2012093764A1 (en) Composition containing gene encoding abc transporter proteins for increasing size of plant seed and content of fat stored within seed
WO2023229330A1 (en) Pentameric toxin protein-based target protein fusion pentamer producing platform using viral nucleocapsid
US7250296B2 (en) Nucleotide sequences of 2S albumin gene and its promoter from grape and uses thereof
WO2021246740A1 (en) Recombinant expression vector for producing encapsulin-based vaccine, and preparation method therefor
WO2010093174A2 (en) Solanum lycopersicum histidinedecarboxylase gene-derived fruit-specific expression promoter and uses thereof
JP2022124384A (en) Recombinant bone morphogenetic protein 4 expressed in plant cells and production methods thereof