WO2024089663A1

WO2024089663A1 - Modified cellular by-product, methods and uses thereof

Info

Publication number: WO2024089663A1
Application number: PCT/IB2023/060856
Authority: WO
Inventors: António David RUFINO RAMOS; Kevin COSTA LEANDRO; Rui Jorge GONÇALVES PEREIRA NOBRE; Luís Fernando MORGADO PEREIRA DE ALMEIDA
Original assignee: Universidade De Coimbra
Priority date: 2022-10-27
Filing date: 2023-10-27
Publication date: 2024-05-02

Abstract

The present disclosure relates to a method and a composition for the treatment/prevention of neurodegenerative diseases, in particular Machado-Joseph disease (MJD)/ Spinocerebellar Ataxia type-3 (SCA3) by utilizing extracellular vesicles (EVs) to deliver silencing sequences, such as small interfering RNAs (siRNAs) or microRNAs (miRNAs). In the present disclosure it was found that ExoMotifs would promote the packaging of engineered miRNA-based silencing sequences into EVs to be used as therapeutic vehicles to the brain to treat MJD/SCA3 upon daily intranasal administration. it was found that miRNA-based silencing sequences, associated with the ExoMotif GGAGGAG and the ribonucleoprotein A2B1 (hnRNPA2B1), retained the capacity to silence mutant ATXN3 (mutATXN3) and were 2.5-fold enriched into EVs. Furthermore, the bioengineered EVs containing the neuronal targeting peptide RVG on the surface significantly decreased mutATXN3 mRNA and protein levels in primary cerebellar neurons from MJD YAC 84.2 and in a novel dual luciferase MJD reporter animal model, upon daily intranasal administration. Altogether these findings indicate that bioengineered EVs carrying miRNA-based silencing sequences can be used as a promising delivery vehicle for brain therapy.

Description

D E S C R I P T I O N MODIFIED CELLULAR BY-PRODUCT, METHODS AND USES THEREOF TECHNICAL F IELD [0001] The present disclosure relates to a method and a composition for the treatment/prevention of neurodegenerative diseases, in particular Machado-Joseph disease (MJD)/ Spinocerebellar Ataxia type-3 (SCA3) by utilizing nanoparticles of modified cellular by-products, in particular extracellular vesicles (EVs), to deliver silencing sequences, such as small interfering RNAs (siRNAs), or microRNAs (miRNAs), either natural or artificial miRNAs. BACKGROUND [0002] Machado–Joseph disease (MJD) or Spinocerebellar Ataxia Type 3 (SCA3), is the most common autosomal dominantly inherited ataxia worldwide. MJD is a polyglutamine (polyQ) disease characterized by a mutation in chromosome 14q32.1 that leads to an over-repetition of the trinucleotide CAG in the ATXN3 gene (Kawaguchi et al., 1994)(Takiyama et al., 1993)(Sequeiros et al., 1994). It is transcribed into a mutant mRNA and translated to a mutant Ataxin-3 (mutATXN3) protein with an expanded polyQ tract. MutATXN3 protein is associated with gain of toxicity that leads to severe neuronal dysfunction over the disease course. Neurodegeneration occurs primarily in the cerebellum, pons, substantia nigra and in the striatum, resulting in progressive neuronal loss (T Klockgether et al., 1998)(Evers & Toonen, 2014). Clinical symptoms have an adult onset and include gait and limb ataxia, ocular impairments, dystonia, dysarthria, along with a progressive impairment of motor coordination (Schöls et al., 2004)(Maruyama et al., 1995). MJD is an extremely debilitating disorder with no disease-modifying treatments available to cure it or delay its progression. [0003] Previous works have shown promising results in alleviating MJD in animal models upon direct intracranial injection of lentiviral vectors (LVs) encoding engineered short-hairpin RNAs (shRNAs), miRNAs, and artificial miRNAs targeting mutATXN3 mRNA (Nóbrega et al., 2013, 2014, 2019)(Alves S. et al., 2008, 2010)(Nobre et al., 2021) (Alves, Régulier, et al., 2008)(Martier et al., 2019)(Moore et al., 2017). These experiments showed that in vivo viral delivery of silencing sequences is able to downregulate the mutATXN3 mRNA and protein levels, ameliorating MJD phenotypical features. Nevertheless, direct intracranial injection of viral vectors into the brain parenchyma is an extremely invasive procedure, resulting in a circumscribed tissue transduction to some millimetres around the injection site (Parr-Brownlie et al., 2015). Additionally, insertional mutagenesis and immunogenicity associated with lentivirus delivery may lead to efficacy and safety concerns for clinical use (Thomas Klockgether et al., 2019)). [0004] EVs are a heterogenous group of membrane vesicles with a lipid bilayer, secreted by all cell types as a way of communicating at close and long distances, and typically categorized by size and biogenesis process in exosomes, microvesicles, and apoptotic bodies (van Niel et al., 2022)(Théry et al., 2018)(Rufino-Ramos et 93 al., 2017). Recently, some studies have described exomeres (H. Zhang et al. 2018; Q. Zhang et al. 2019) and supermeres (Q. Zhang et al. 2021) as two distinct types of non- membranous extracellular nanoparticles with less than 50 nm playing biological functions. (Clancy, Boomgarden, and D’Souza-Schorey 2021). EVs mediate the functional transfer of lipids, luminal and membrane proteins, and nucleic acids among cells, both in physiological and pathological conditions and, thus, playing a major role in intercellular communication (Mahjoum et al., 2021)(Pegtel et al., 2014) (O’Brien et al., 2020). Their cargo usually reflects the state of their donor cell and can be exploited both as biomarkers for diagnostic or prognostic of disease, as well as a platform to deliver targeted therapies (Rufino-Ramos et al., 2017). [0005] EVs were found to carry DNA fragments, mRNAs, and particularly small RNAs due to their small size (O’Brien et al., 2020). Among the small RNAs, it has been described that EVs are enriched in miRNAs (Pegtel et al., 2014) (O’Brien et al., 2020), small non-coding RNAs with around 21 nucleotides in size that mediate post-transcriptional gene regulation of their mRNA targets, controlling translation or causing mRNA degradation (Bartel, 2009)(Carmona et al., 2017). Intriguingly, EVs carry specific subsets of miRNAs, suggesting a selective and active packaging of miRNAs during EVs biogenesis. The sorting mechanism on which specific miRNAs get highly enriched into EVs is thought to be a multifactorial process depending on the presence of short sorting motifs that drive miRNAs into EVs. These sequences are called ExoMotifs, as is the case of GGAG (SEQ ID No. 6), CCCU (SEQ ID No. 2), GGCU (SEQ ID No.3), and CGGGAG (SEQ ID No. 4) sequences (Villarroya-Beltri et al., 2013)(Santangelo et al., 2016)(Garcia- Martin et al., 2022). On the opposite direction, other sequences called CellMotifs restrain miRNAs in cells preventing their packaging into EVs (Garcia-Martin et al., 2022; Villarroya-Beltri et al., 2013). [0006] The packaging process into EVs seems to be cell type-specific since different proteins were described to promote the incorporation of miRNAs into EVs in different cell types, such as Heterogeneous Nuclear ribonucleoprotein A2B1 (hnRNPA2B1) in EVs derived from T-lymphocytes (Villarroya-Beltri et al., 2013), and synaptotagmin-binding cytoplasmic RNA-interacting protein (SYNCRIP) in hepatocytes-derived EVs (Santangelo et al., 2016). Recently, the study of the miRNA profile of five metabolic cell lines have suggested Alyref and Fus as RNA-binding proteins that efficiently load miRNAs into EVs (Garcia-Martin et al., 2022). Post-translational modifications of RNA-binding proteins were also described as a packaging trigger, acting as facilitators of the miRNA-protein binding (Villarroya-Beltri et al., 2013). Moreover, miRNA secondary and tertiary structures influence their packaging into EVs, and can be stabilized by RNA binding proteins, such as Y-box protein 1 (Shurtleff et al., 2016)(Shurtleff et al., 2017). [0007] Typically, silencing sequences are incorporated into EVs by electroporation (Kamerkar et al., 2017)(Alvarez-Erviti et al., 2011). However, it was described that this process compromises EVs integrity and leads to aggregation of siRNAs on EVs surface, thus reducing the therapeutic efficiency of siRNA- loaded EVs in delivering their cargo to recipient cells (Kooijmans et al., 2013). [0008] Nevertheless, using EVs for in vivo therapeutic approaches remains extremely challenging due to the lack of organ-specific targeting efficiency. In this regard, several studies have demonstrated good targeting efficiency levels in specific organs and distinct disease contexts, such as when targeting oncogenic Kras in pancreatic cancer (Kamerkar et al., 2017), increasing dystrophin protein in muscles (Gao et al., 2018), and targeting the brain upon expression of the rabies virus glycoprotein (RVG) on EVs surface (Alvarez-Erviti et al., 2011; Dar et al., 2021; Gao et al., 2018). Targeting the brain in a minimal/non-invasive way remains very demanding when considering gene therapy, primarily due to the difficulty in finding a suitable vehicle to carry the genetic material to the brain without targeting peripheral organs, such as the liver. In fact, intravenous administration has allowed the delivery of EVs to the brain upon modulation of their surface with brain targeting peptides (El-Andaloussi et al., 2012)(Kojima et al., 2018)(Dar et al., 2021). Similarly, intra- cerebrospinal fluid (intra-CSF) injections also demonstrated great potential for brain targeting, since EVs are able to diffuse from CSF to the brain (Patel et al., 2022). Other non-invasive way to direct EVs to the brain is through the intranasal route that allows EVs to bypass the blood-brain barrier (BBB), after traversing the olfactory bulb (Losurdo et al., 2020)(Perets et al., 2019). [0009] Document WO2020144611 discloses an engineered miRNA-based silencing sequence targeting mutATXN3 mRNA. However, this document is silent on the incorporation of said mRNA into EV for efficient delivery into the brain. [0010] These facts are disclosed in order to illustrate the technical problem addressed by the present disclosure. GENERAL DESCRIPTION [0011] The present disclosure relates to a method and composition for the treatment/prevention of neurodegenerative diseases, in particular Machado-Joseph disease (MJD)/ Spinocerebellar Ataxia type-3 (SCA3) by utilizing nanoparticles of modified cellular by-products, in particular extracellular vesicles (EVs), to deliver silencing sequences, such as small interfering RNAs (siRNAs) or microRNAs (miRNAs), either natural or artificial miRNAs. [0012] The present disclosure relates to the use of ExoMotifs (SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 or SEQ ID No.6) to promote the packaging into EVs (extracellular vesicles) of an engineered miRNA-based silencing sequence targeting mutATXN3 mRNA. [0013] In an embodiment, the engineered miRNAs were loaded into EVs in order to silence mutATXN3 mRNA for the treatment of MJD/SCA3. Additionally, to specifically target neurons and enable BBB (blood brain barrier) crossing, the RVG (rabies virus glycoprotein) peptide was inserted on EVs surface. [0014] In another embodiment, a packaging cell line stably producing RVG-EVs loaded with silencing sequences was generated. [0015] In an embodiment, the disclosed engineered EVs were shown to efficiently downregulate mutATXN3 mRNA in primary cerebellar cultures of MJD YAC84.2 pups and in a new dual luminescent MJD mouse model, upon daily intranasal administrations of EVs. The obtained results show that the disclosed system can be used on brain delivery of therapeutics and therapy. [0016] The present disclosure relates to a cellular by-product nanoparticle comprising a miRNA sequence comprising a mirSilencer sequence and an ExoMotif sequence; wherein the mirSilencer is a miRNA-based silencing sequence targeting mutATXN3 mRNA; wherein the ExoMotif sequence comprises at least a sequence 90% identical to the sequences of the following list: SEQ ID No 1: GGCG; SEQ ID No 2: CCCU, SEQ ID No 3: GGCU, SEQ ID No 4: CGGGAG, SEQ ID No 5: GGAGGAG, SEQ ID No. 6 GGAG or mixtures thereof. Preferably, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical or identical [0017] In an embodiment for better results, the ExoMotif sequence comprises at least a sequence 90% identical to the sequences of the following list: SEQ ID No 2: CCCU, SEQ ID No 3: GGCU, SEQ ID No 4: CGGGAG, SEQ ID No 5: GGAGGAG, SEQ ID No. 6 GGAG or mixtures thereof. Preferably, 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical or identical. [0018] In an embodiment, the mirSilencer is a miRNA-based silencing sequence targeting mutATXN3 mRNA. [0019] In an embodiment, the miRNA-based silencing sequence targeting mutATXN3 mRNA sequence is disclosed on document WO2020144611 these sequences are herein incorporated by reference (SEQ ID No 38-66). [0020] In an embodiment, the miRNA sequence comprises a sequence for a heterogeneous ribonucleoprotein, preferably A2/B1 RNA-binding protein. [0021] In an embodiment, the extracellular vesicle comprises at its surface a neurotropic protein moiety, in particular a glycoprotein surface moiety. [0022] In an embodiment, said glycoprotein is a rabies virus glycoprotein surface moiety, in particular wherein the surface moiety is tethered to Platelet-Derived Growth Factor Receptor. [0023] In an embodiment, the miRNA sequence comprising a mirSilencer sequence and an ExoMotif sequence is selected from the following list: SEQ ID No 19, SEQ ID No 20, SEQ ID No 21, SEQ ID No 22, SEQ ID No 23, SEQ ID No 24. [0024] In an embodiment, the ExoMotif and the mirSilencer are embedded in miRNA sequence selected from: miR-155 (SEQ ID No 10), mir-575 (SEQ ID No 11), mir125a-3p (SEQ ID No 12), mir-198 (SEQ ID No 13), mir-451 (SEQ ID No 14), mir-601 (SEQ ID No 15), mir-887 (SEQ ID No 16), preferably miR- 155 (SEQ ID No 10), miR-451 (SEQ ID No 14) or miR-601 (SEQ ID No 15), more preferably miR-155 (SEQ ID No 10). [0025] In an embodiment, the disclosed cellular by-product nanoparticle may be use in medicine or veterinary. Preferably, for use in the treatment of any condition susceptible of being improved or prevented by reducing mutATXN3 mRNA levels. More preferably, for use in the therapy, treatment, or prevention of neurodegenerative diseases, preferably CAG trinucleotide-repeat neurodegenerative disease; even more preferably, the CAG trinucleotide-repeat neurodegenerative disease is Machado- Joseph disease/Spinocerebellar Ataxia type 3 (MJD/SCA3). [0026] In an embodiment, the nanoparticle is an extracellular vesicle, extracellular-like vesicle, exomer, or supermere. [0027] In an embodiment, the extracellular vesicle is an exosome or microvesicle. [0028] In an embodiment, the size of the nanoparticle ranges from 50 to 110 nm. [0029] Another aspect of the present disclosure relates to a vector comprising a miRNA sequence comprising a mirSilencer sequence as described in the present disclosure and an ExoMotif sequence as described in the present disclosure. [0030] Another aspect of the present disclosure relates to a cell line for obtaining the nanoparticle comprising the vector described in the present disclosure. [0031] Pharmaceutical composition comprising the nanoparticle disclosed in the present disclosure for use in medicine or veterinary, preferably for use in the treatment of any condition susceptible of being improved or prevented by reducing mutATXN3 mRNA levels; more preferably, for use in the therapy, treatment, or prevention of neurodegenerative diseases, preferably CAG trinucleotide-repeat neurodegenerative disease. Even more preferably, wherein the CAG trinucleotide-repeat neurodegenerative disease is Machado-Joseph disease/Spinocerebellar Ataxia type 3 (MJD/SCA3). [0032] The nanoparticle, in particular the extracellular vesicle, or the pharmaceutical composition described in the present application for use in therapy, treatment, or prevention of a neurodegenerative disease in a patient. [0033] The nanoparticle, in particular the extracellular vesicle, or the pharmaceutical composition described in the present application for the manufacture of a medicament of a neurodegenerative disease. [0034] A method for treating or preventing a neurodegenerative disease in a subject wherein the method comprises administering the nanoparticle, in particular the extracellular vesicle, or the pharmaceutical composition described in in the present application to the subject. [0035] An aspect of the present disclosure relates to an immortal mammalian cell line that was genetically engineered to secrete or release extracellular vesicles, and/or extracellular-like vesicles, and/or exomeres, and/or supermeres (together named cellular by-products) to at least comprise, present, and/or express silencing nucleic acid molecules and/or precursors thereof, surface moieties for cell-specific tropism, and proteins involved in nucleic acid sorting for the said extracellular vesicles, and/or extracellular-like vesicles, and/or exomeres, and/or supermeres. [0036] Another aspect of the present disclosure relates to the extracellular vesicle, and/or extracellular-like vesicle, and/or exomere, and/or supermere (together named cellular by-products) that was genetically engineered to at least comprise, present, and/or express silencing nucleic acid molecules and/or precursors thereof, surface moieties for cell-specific tropism, and proteins involved in nucleic acid sorting for the said extracellular vesicle, and/or extracellular-like vesicle, and/or exomere, and/or supermere. [0037] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the miR-155 scaffold (SEQ ID No 10). [0038] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-575 scaffold (SEQ ID No 11). [0039] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir125a-3p scaffold (SEQ ID No 12). [0040] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-198 scaffold (SEQ ID No 13). [0041] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-451 scaffold (SEQ ID No 14). [0042] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-601 scaffold (SEQ ID No 15). [0043] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-887 scaffold (SEQ ID No 16). [0044] In an embodiment, the silencing nucleic acid molecules and/or precursors are embedded in the mir-181a scaffold (SEQ ID No 17). [0045] In an embodiment, the silencing nucleic acid molecules and/or precursors contain a nucleic acid packaging sequence that increases the enrichment of the said nucleic acid molecules and/or precursors in the cellular byproducts, preferentially but not limited to the following nucleic acid packaging sequence wherein n varies from 1 to 2: (GGA)nG, or wherein n varies from 1 to 2: G(GAG)n. [0046] Another aspect of the present disclosure relates to an immortal mammalian cell line and/or cellular by-products which comprise a surface moiety which is the rabies virus glycoprotein (RVG). [0047] In an embodiment, the protein involved in the nucleic acid sorting is the heterogeneous nuclear Ribonucleoprotein A2/B1 (hnRNPA2B1). [0048] In an embodiment, the surface moiety is tethered to the enriched component Platelet-Derived Growth Factor Receptor (PDGRF). [0049] In an embodiment, the immortal mammalian cell line may be used in the treatment or prevention of a neurodegenerative disease or in the treatment or prevention of cytotoxic effects of said neurodegenerative disease. [0050] In an embodiment, the neurodegenerative disease is a CAG trinucleotide-repeat disease, preferably CAG trinucleotide-repeat disease is the Machado-Joseph disease/Spinocerebellar Ataxia type 3 (MJD/SCA3). [0051] In an embodiment, the sequences are specific for the mutant ataxin-3 mRNA. BRIEF DESCRIPTION OF THE DRAWINGS [0052] The following figures provide preferred embodiments for illustrating the disclosure and should not be seen as limiting the scope of invention. [0053] Figure 1: Endogenous miRNAs with ExoMotifs are extensively loaded into EVs. A. EVs isolation through differential ultracentrifugation (dUC). Conditioned media was centrifuged 300g for 10 minutes to eliminate cells in suspension, followed by a centrifugation at 2000g for 10 minutes to discard cell debris. Supernatant was then centrifuged at 16500g for 1h to remove large vesicles, filtered through 0.22µm and ultracentrifuged at 100000g for 2 hours to pellet EVs. The pellet was then washed in cold 1xPBS and centrifuged at 100 000g for 2 hours to remove free protein and protein aggregates. B. Characterization of HEK293T-derived EVs protein markers. Western blotting of equimolar amounts of protein from cells and their derived EVs show the presence of the EV positive markers Lamp-2 (110kDa), Alix (100kDa), HSC70 (70kDa) and Flotilin-1 (48kDa) and the absence of the negative marker Calnexin (100kDa). C. Characterization of EVs by nanoparticle tracking analysis (NTA). NTA shows a prominent peak at 110 ± 3.9 nm, corresponding to the typical EVs size range. In the inset, characterization of EVs population by transmission electron microscopy (TEM). TEM shows the cupped-shaped morphology of EVs. Scale bar is 1µm (open field image). D. Particles produced per cell; E. Levels of endogenous miRNA content in SH-SY5Y cells (black bars) and derived EVs (gray bars). miR-451 (SEQ ID No 14) and miR-601 (SEQ ID No 15) are enriched in EVs comparing to their cells. miR-575 (SEQ ID No 11), miR-125a-3p (SEQ ID No 12), miR-198 (SEQ ID No 13), miR-887 (SEQ ID No 16) and miR-181a (SEQ ID No 17) are restrained in cells comparing to EVs. F. KUM10 miRNA sorting profile between cells and their derived EVs. miR-575 (SEQ ID No 11), miR-451 (SEQ ID No 14), and miR-601 (SEQ ID No 15) are enriched in EVs comparing to their cells. miR-125a-3p (SEQ ID No 12) and miR-181a (SEQ ID No 17) are restrained in cells comparing to EVs. miR-198 (SEQ ID No 13) is not detected in cells or EVs. G. HEK293T miRNA sorting profile between cells and their derived EVs. miR-575 (SEQ ID No 11), miR451 (SEQ ID No 14), miR-198 (SEQ ID No 13), miR-601 (SEQ ID No 15) and miR-887 (SEQ ID No 16) are enriched in EVs comparing to their cells. miR- 125a-3p (SEQ ID No 12) and miR-181a (SEQ ID No 17) are restrained in cells comparing to EVs. Data is presented as means ± SEM throughout four independent experiments (N=4). Data was normalized against U6 (SHSY5Y) and SNO202 (KUM10 and HEK293T) housekeeping RNAs. Data was compared with Multiple unpaired t-tests. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001 and N.D. – Non Determined. [0054] Figure 2: ExoMotif and hnRNPA2B1 association with miRNA mutATXN3 silencer drives its packaging into EVs and reduce mutATXN3 mRNA levels. A. Schematic representation of the experimental setup. The ExoMotif GGAGGAG (SEQ ID No 5) was associated with miRNA mutATXN3 silencer (mirSilencer). The silencing efficacy of mirSilencers with and without ExoMotif were assessed by plasmid transfection. B. Levels of mutATXN3 protein in Neuro2A cells. mirSilencer plasmids (with and without ExoMotif) were transfected in Neuro2A cells encoding mutATXN3. Both plasmids led to a significant silencing of mutATXN3 protein level relative to mir-Neg (miRNA encoding a scramble sequence that does not bind to mutATXN3 mRNA). C. ATXN3 protein levels upon plasmid transfection. D. Lentiviral vectors (LV) were used to generate stable cell lines encoding both mirSilencers. miRsilencer levels in cells and their derived EVs were assessed by RT-PCR. E. MirSilencer enrichment in EVs. Stable cell lines encoding mirSilencer with and without ExoMotif were used to compare the mirSilencer levels between progenitor cells and their derived EVs. mirSilencer associated with the ExoMotif and hnRNPA2B1 sequence is 2.5-fold significantly enriched in EVs when compared to their progenitor cells. A relative qPCR quantification was performed and RNU1A1 was used as endogenous control. Results are expressed as mean ± SEM of arbitrary units (N=4). Data was compared performing one-way ANOVA followed by Sidak's multiple comparisons test (F=4.336). F. MutATXN3 mRNA levels upon EVs incubation. EVs carrying mirSilencer with and without ExoMotif were incubated in Neuro2A cells encoding mutATXN3 mRNA. After 48h, mutATXN3 mRNA levels were significantly decreased in cells incubated with EVs carrying mirSilencer with ExoMotif (N=4). One-sample t-test. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001 and ns – non significant. [0055] Figure 3: RVG peptide expression on the surface of EVs promotes internalization into neurons. A. Schematic representation of EVs expressing CD63-Nanoluc and PDGFR-RVG followed by their incubation in distinct cell lines. B. RVG-EVs are internalized by multiple cell lines. EVs expressing PDGFR- RVG on their surface internalize 6x more into Neuro2A cells and 5x more in Bend3 cells when compared to CD63-Nanoluc EVs without RVG. C. Internalization profile of RVG-EVs in Neuro2A and Bend3 cells at 2h, 6h, 12h, 18h, 24h and 36h incubation time-points. CD63-Nanoluc EVs without RVG expression were used as controls. Neuro2A cells internalize more EVs at early time-points (6h), while Bend3 cells showed a stable internalization profile over 36h. Data is expressed as mean ± SEM. D. RVG-EVs internalize more into neuronal cells. Neuro2A cells showed an increase in the bioluminescence uptake signal, when compared with Bend3 cells upon 6 hours of incubation. The data was compared by Unpaired T-test. E. Dose-response of RVG-EVs. Internalization of RVG-EVs is proportional to the amount of EVs incubated. Higher dose of EVs (6.0X10⁸ particles) leads to higher internalization (37873 RLU), when compared to the lower dose of EVs (1.5X10⁸ particles) that corresponds to 9230 RLU in cells upon 6h of incubation. The data is compared by ordinary one-way ANOVA followed by Tukey's multiple comparisons test (F=7364.0). F. Schematic representation of incubation of CD63-GFP EVs expressing PDGFR-RVG on their surface in primary rat cortical neurons. G. Internalization of RVG-EVs by primary rat cortical neurons. Confocal images showing EVs (green) being internalized in neurons (red, β3-tubulin). The analysis was performed using laser confocal microscopy equipped with Plan-Apochromat 40×/1.40 Oil DIC M27 (420782-9900) (scale bar 5μm). Percentage of primary neurons internalizing CD63-GFP EVs. CD63-GFP EVs expressing PDFGR-RVG on their surface internalize a high number of primary neurons when compared control (CD63-GFP EVs) at 4- and 12-hours incubation period. The data is compared by one- way ANOVA followed by Sidak's multiple comparisons test (F=8.840). Statistical significance: *p < 0.05 and ****p < 0.0001. [0056] Figure 4: Engineered EVs significantly reduce mutATXN3 mRNA in vitro A. Representation of the packaging cell line overexpressing PDGFR-RVG, hnRNPA2B1 and mirSilencer to produce therapeutic EVs. Lentivirus encoding PDGFR-RVG and hnRNPA2B1 were used to generate a stable cell line (Scale bar 20µm). The same cells were then split to overexpress mirSilencer with and without ExoMotif and mirScramble. Conditioned media were collected to isolate therapeutic EVs by dUC and incubated with various cell models to evaluate in vitro efficacy. B. Incubation of therapeutic EVs in Dual Luciferase reporter cells: Neuro2A cells overexpressing a dual luciferase construct encoding Firefly Luciferase (FLuc) associated with mutATXN3 under control of PGK promoter and Renilla Luciferase (Rluc) under control of CMV promoter. C. Luminescence of FLuc mutATXN3 upon EVs incubation: therapeutic EVs carrying mirSilencer with ExoMotif significantly reduce luciferase activity by 34% comparing to the control condition (EVs carrying mirScramble), while EVs with mirSilencer without ExoMotif do not significantly silence Fluc-mutATXN3 mRNA. Results are expressed in arbitrary units and mean ± SEM (N=5). One- sample t-test, column means significantly different than a hypothetical value of 1. D. Dose dependent effect of therapeutic EVs: therapeutic EVs carrying the mirSilencer showed a dose dependent effect on reducing Fluc-mutATXN3 luciferase activity. Results are expressed as mean ± SEM of arbitrary units (N=3). Data was compared by one-way ANOVA followed by Tukey's multiple comparisons test (F=21.01). E. Establishment of cerebellar cultures from MJD YAC84.2 pups (P6-P7). Immunostaining at day 15 of primary cerebellar cultures showed positive staining for the neuronal marker MAP2, ATXN31H9, and deep cerebellar marker PCP4 under microscopy analysis (scale bar 10μm). F. Therapeutic EVs downregulate endogenous mutATXN3 mRNA in cerebellar cultures. The first dose of EVs was incubated at day 10 and the second dose at day 12. At day 14, cells were collected and mRNA was analyzed. A significant downregulation of endogenous mutATXN3 of approximately 49% was observed upon incubation with EVs containing the mirSilencer with ExoMotif. EVs carrying mirSilencer without ExoMotif, showed a non-significant tendency to downregulate the levels of mutATXN3 mRNA (approximately 29%). Results are expressed as mean ± SEM of arbitrary units (N=3/6). Data was compared by ordinary one-way ANOVA followed by Tukey's multiple comparisons test (F=4.75). Statistical significance: ns – non significant, *p < 0.05 and **p < 0.01. [0057] Figure 5: Delivery of mirSilencer to the brain significantly decreases mutATXN3 mRNA in Dual Luminescent MJD mouse model A. Generation of a Dual Luminescent MJD mouse model upon intracerebellar injection of LV encoding Dual luciferase reporter (FL/RL) associated with mutATXN3. B. Co-injection in the cerebellum of LV encoding the dual luciferase MJD reporter and the mirSilencer with ExoMotif or mirScramble. In vivo bioluminescence assessment showed a significant decrease of Fluc- mutATXN3 luminescence by 59% in the mirSilencer condition relative to control (mirScramble). Results are expressed in mean ± SEM of arbitrary units (N=3/4). Data was compared performing unpaired t-test, *p < 0.05. C. Schematic representation of daily intranasal administration of EVs. D. Therapeutic EVs carrying mirSilencer with ExoMotif or mirScramble were daily administered intranasally for 1 month in a dose of 2x10⁹ EVs/animal/day. Evaluation of mirSilencer distribution throughout the brain upon intranasal administration showed the highest fold change of mirSilencer in the olfactory bulb, followed by the brainstem, cerebellum and the remaining brain. E1. Schematic representation of cerebellum processing for RNA and Bioluminescence. E2. Levels of mutATXN3 mRNA in the cerebellum homogenates were significantly reduced when mirSilencer with ExoMotif EVs (blue bar) were administered comparing to the scramble condition. E3. Dual luciferase assay in cerebellar homogenates showed a significant decrease of mutATXN3-luciferase activity in the EVs carrying mirSilencer with ExoMotif condition (red bar) compared to scramble EVs. Results are expressed in mean ± SEM of arbitrary units (N=6/8). Statistical significance: *p < 0.05 and 1093 **p < 0.01. [0058] Figure 6: mirSilencer expression levels in cells and EVs. A. Cell lines encoding mirSilencer with or without the ExoMotif were used to compare the mirSilencer levels between progenitor cells and their derived EVs. Overexpression of hnRNPA2B1 seems to not affect the relative amount of miRNAs in cells. Overexpression of hnRNPA2B1 showed a tendency for the cells to produce EVs enriched with mirSilencer containing the ExoMotif when compared to mirSilencer in the absence of ExoMotif. A relative qPCR quantification was performed and RNU1A1 was used as endogenous control. Results are expressed as mean ± SEM of arbitrary units (N=4). Data was compared by one-way ANOVA followed by Sidak's multiple comparisons test (F=4.336). [0059] Figure 7: Generation of a stable cell line encoding hnRNPA2B1 and PDGFR-RVG. A. Cell sorting of double positive cells encoding for hnRNPA2B1 and PDGFR-RVG. HEK293T cells were transduced with lentiviral vectors encoding PDGFR-RVG and mCherry fluorescent protein and hnRNPA2B1 fused with turboGFP fluorescent protein. Double positive cells were sorted by flow cytometry and cultured to generate a stable cell line co-expressing both proteins. [0060] Figure 8: Dual luciferase reporter system to monitor mutATXN3 mRNA levels. A. Co- transfection with miRNAs and dual luciferase reporter Fluc-mutATXN3. Plasmids encoding mirScramble and mirSilencer with and without ExoMotif were evaluated in terms of silencing efficacy 48h after transfection in HEK 293T cells. Both mirSilencers were shown to significantly silence Fluc-mutATXN3 in more than 60%. Results are expressed as mean ± SEM of arbitrary units (N=3). Data compared by one- way ANOVA followed by Dunnett's multiple comparisons test (F=61.83). B. Therapeutic EVs incubated with primary neurons transduced with dual luciferase reporter. Both therapeutic EVs were shown to have efficacy above 60% at downregulating Fluc-mutATXN3. Results are expressed in arbitrary units and mean ± SEM (N=4). Data compared by one-way ANOVA followed by Dunnett's multiple comparisons test (F=8.254). Statistical significance: *p < 0.05, ***p < 0.001 and ns – non significant. [0061] Figure 9: Intranasal administration of EVs co-expressing CD63-GFP and PDGFR-RVG reach the cerebellum. PBS (control animals) or EVs co-expressing CD63-GFP and PDGFR-RVG (treated animals) were administered twice a day for 2 weeks to wild-type C57BL/6 mice. Animals were sacrificed and brains processed for immunohistochemical staining against GFP (red). Yellow dots represent co- localization of endogenous GFP (from CD63-GFP expressing EVs) and anti-GFP in the lobule 5 of cerebellum. Images were acquired with Zeiss Axio Imager Z2 microscope (Carl Zeiss Microimaging), equipped with a High-Resolution Monochromatic Camera and with Plan-Apochromat 20X/0.8 M27 objective. [0062] Figure 10: Generation of a dual luciferase MJD reporter mouse. A. LV encoding the dual luciferase construct Fluc-mutATXN3 were intracranially injected into mice striatum. FLuc bioluminescence was observed 10 minutes after intraperitoneal injection of Luciferin, while RLuc was observed 30 seconds after intravenous injection of ViviRen (a coelenterazine analog). [0063] Figure 11: In vivo monitorization using bioluminescence. A. Monitorization of EVs treatment efficacy in vivo overtime upon bioluminescence evaluation. Bioluminescence evaluation in vivo allowed to monitor the EVs treatment efficacy through intranasal administration. Three different time-points were considered. Timepoint 0 was performed before the treatment, while time-point 1 was performed 15 days later and time-point 2 performed 30 days after the beginning of the treatment. Results are expressed in arbitrary units and mean ± SEM (N=6/8). DETAILED DESCRIPTION [0064] Machado–Joseph disease (MJD)/Spinocerebellar Ataxia Type 3 (SCA3) is the most common autosomal dominantly inherited ataxia worldwide. It is caused by an over repetition of the trinucleotide CAG within the ATXN3 gene which confers toxic properties to the ataxin-3 (ATXN3) mRNA and protein. Despite no disease modifying treatment is available up to date, RNA interference technology has shown promising therapeutic outcomes but still lacks an efficient non-invasive delivery method to the brain. Extracellular vesicles (EVs) are cell-derived lipid membranes emerging as a promising delivery strategy due to their capacity to deliver small nucleic acids, such as miRNAs. miRNAs were found to be enriched into EVs due to specific signal motifs designated as ExoMotifs. [0065] The present disclosure relates to a method and a composition for the treatment/prevention of neurodegenerative diseases, in particular Machado-Joseph disease (MJD)/ Spinocerebellar Ataxia type-3 (SCA3) by utilizing nanoparticles of cellular by-products, in particular extracellular vesicles (EVs), to deliver silencing sequences, such as small interfering RNAs (siRNAs) or microRNAs (miRNAs). [0066] In the present disclosure it was found that ExoMotifs would promote the packaging of engineered miRNA-based silencing sequences into EVs to be used as therapeutic vehicles to the brain to treat MJD/SCA3 upon daily intranasal administration. It was found that miRNA-based silencing sequences, associated with the ExoMotif GGAGGAG (SEQ ID No 5) and the ribonucleoprotein A2B1 (hnRNPA2B1), retained the capacity to silence mutant ATXN3 (mutATXN3) and were 2.5-fold enriched into EVs. Furthermore, the bioengineered EVs herein disclosed containing the neuronal targeting peptide RVG on the surface significantly decreased mutATXN3 mRNA and protein levels in primary cerebellar neurons from MJD YAC 84.2 and in a novel dual luciferase MJD reporter animal model, upon daily intranasal administration. Altogether these findings indicate that the bioengineered EVs carrying miRNA-based silencing sequences can be used as a delivery vehicle for brain therapy. [0067] In an embodiment, all animal experimental protocols were approved by the European Union Directive 86/609/EEC for the care and use of laboratory animals. The present disclosure is part of a research project which was approved by the Center for Neuroscience and Cell Biology ethics committee (ORBEA_66_2015_/22062015 and ORBEA_289_) and the Portuguese Authority responsible for the regulation of animal experimentation, Direcção Geral da Agricultura e Veterinária (DGAV 0421/000/000/2015). Researchers received adequate training (Federation of European Laboratory Animal Science Associations (FELASA)-certified course) and certification from Portuguese authorities (Direcção Geral de Alimentação e Veterinária) to perform the experiments. MJD YAC84.2 and C57BL/6 mice (Charles River Laboratories) were maintained with unlimited access to water and food under a 12- hour light/dark cycle. Male and female mice ranging from 8-10 weeks in age were randomly assigned to experimental groups. [0068] In an embodiment, lentiviral production and titer assessment was performed. Lentiviral vectors encoding mirSilencer, mirScramble, hnRNPA2B1 (such as SEQ ID No. 67 protein) and PDGFR-RVG plasmids were produced in human embryonic kidney 293 (HEK293T) cell line, as previously described in (Carmona et al., 2017)(de Almeida et al., 2001). As an alternative, the described vectors can be produced in KUM10 cells, an osteoblast cell line from mouse C57/B6 bone marrow. Briefly, cells were seeded and 24h later transfected with a four-plasmid system. Six hours after transfection, cells were washed with PBS and incubated in new culture media. Lentiviral vector isolation was performed 48h- 72h later upon ultracentrifugation at 70 000g followed by pellet re-suspension in 1% PBS/BSA. Viral particle was evaluated by assessing HIV-1 p24 antigen levels by ELISA 2.0 (Retro Tek, 0801002), in accordance with the manufacturer’s instructions. Concentrated viral stocks were stored at −80 °C until use. [0069] In an embodiment, stereotaxic injection into the mouse brain was performed. C57BL/6J mice with 4-5 weeks of age were anesthetized through intraperitoneal injection (IP) of a mixture of ketamine (75mg/kg, Nimatek, Dechra) and medetomidine (0.75mg/kg, DOMTOR®, Esteve). Mice were stereotaxically injected into the striatum with the following coordinates relative to Bregma: anteroposterior: 0.6 mm, lateral: +1.8 mm, ventral: 3.3 mm and tooth bar: 0 mm, with concentrated lentiviral vectors in a final volume of 2μl/injection containing 400 ng of p24 antigen. For cerebellar injections (Lobule V), Bregma and Lambda were aligned and the following coordinates were used relative to Lambda: anteroposterior: -2.4 mm, lateral: 0 mm, ventral: -2.9 mm, and tooth bar: 0 mm. Lentiviral vectors were injected in a final volume of 4μl/injection containing 600 ng of p24 antigen. The infusion was performed at an injection rate of 0.25 mL/min using a 10 mL Hamilton syringe, 5 min after the infusion was completed, the needle was retracted 0.3 mm and allowed to remain in place for an additional 3 min prior to its complete removal (Carmona et al., 2017). The skin was closed using a 6-0 Prolene® suture (Ethicon, Johnson and Johnson, Brussels, Belgium). [0070] In an embodiment, in vivo bioluminescence analysis was performed. Stable lentiviral transduction in the cerebellum was monitored by assessing FLuc bioluminescence periodically, using IVIS Lumina XR equipment upon injection of D-Luciferin (PerkinElmer). For each determination, mice were IP injected with D-Luciferin (100 mg/kg) and anesthetized with 2.5% isoflurane in 100% oxygen. Bioluminescence images were acquired 10-20 minutes after D-Luciferin injection. To evaluate RLuc expression, IV injection of ViviRen (coelenterazine substrate modified for in vivo analysis) was administered and the signal collected 30 s after injection. Analysis was performed using Living Image software (version 4.10, Xenogen) and quantification of the bioluminescent signal was obtained from a region of interest (ROI) drawn around the cranium. Values are expressed as average radiance relative to control. [0071] In an embodiment, mouse tissue preparation for Immunofluorescence was performed. Mice were sacrificed under lethal administration of Ketamine and Xylazine, followed by intracardiac perfusion with PBS and fixation with 4% paraformaldehyde (PFA)/PBS (Sigma). Brains were post-fixed in 4% PFA/PBS for 48h at 4°C, followed by incubation in 30% sucrose/PBS for 48h at 4°C. Brains were then frozen at -80°C and sliced in cryostat (Leica CM3050S, Leica Microsystems at -20°C). Sagittal sections of 35-μm were collected in a serial mode in PBS/Azide (0.05 μM) for further free-floating immunofluorescence. [0072] In an embodiment, immunofluorescence was performed. Free-floating immunofluorescence was initiated by incubating the selected brain sections 1 h in blocking and permeabilizing solution, 0.1% Triton X-100/10% normal goat serum (NGS) in PBS, at room temperature (RT). Sections were incubated overnight at 4°C with rabbit polyclonal anti-GFP antibody (1:1000, Thermo Fisher Scientific). Sections were washed in PBS and incubated for 2h at RT with the corresponding secondary antibody Alexa Fluor 564 (1:200, Invitrogen). Sections were washed with PBS and incubated with DAPI (1:5 000; Sigma), washed and mounted with mounting medium (Dako) on gelatin-coated slides. [0073] In an embodiment, mouse cerebellar primary culture was performed. Primary cultures of MJD YAC84.2 pups (P6-P7) cerebellar neurons were prepared from (P6-P7) post-natal pups. Cerebella were dissected and dissociated with trypsin (0.01%, Sigma, T0303) 15 min (inversion each 5 minutes) at 37°C and DNase (0.045 mg/mL, Sigma, D5025) in Mg²⁺ free Krebs buffer (120 mM NaCl, 5 mM KCl, 1.2 mM KH2PO4, 13 mM glucose, 15 mM 4-(2-hydroxyethyl)pipera- zine-1-ethanesulfonic acid (HEPES), 0.3% BSA, pH 7.4). Cerebella were then washed with Krebs buffer (with Mg²⁺) containing trypsin inhibitor (0.3 mg/mL, Sigma, T9128) to stop trypsin activity. Cells were dissociated in this solution and centrifuged. Pellet was resuspended first with a pipet tip, followed by a syringe with a needle of 21G, then filtered through a strainer of 40µm and resuspended in Basal Medium Eagle supplemented with 25 mM KCl, 30 mM glucose, 26 mM NaHCO₃, 1% penicillin– streptomycin (100 U/ml, 100 mg/ml) and 10% fetal bovine. Cells were plated on 48 or 24-well plates coated with poly-D-lysine.24-48h after the isolation, cytosine arabinoside 10μM final concentration was added to cultures. Cultures were maintained up to 15 days in a humid incubator (5% CO2/ 95% air at 37°C). [0074] In an embodiment, immunocytochemistry was performed. Cell cultures were washed and fixed with 4% PFA/PBS. After permeabilization and blocking in PBS/0.1% Triton X-100/3%BSA, cells were incubated with primary antibodies overnight at 4°C. The following primary antibodies were used diluted in blocking solution: mouse anti-β3 tubulin clone 38F4 (1:500; Life Technologies), mouse anti-MAP2 (1:250, M1406, Sigma), quail anti-ATXN3 antibody (1:1000, HBT018-100, HenBiotech), rabbit polyclonal anti-PCP4 (C15) (1:200 Santa Cruz) and rabbit polyclonal anti-GFP antibody (1:1000, Thermo Fisher Scientific). Cells were washed with PBS and incubated for 2 hr at RT with the secondary antibodies Alexa Fluor 488, 564 and 647 (anti-rabbit, anti-mouse, 1:200 Invitrogen and anti-chicken 1:250 Life Technologies). Cells were washed with PBS and incubated with DAPI (1:5 000; Sigma), washed and mounted in mounting medium (Dako) on gelatin-coated slides. Cells were visualized in a Zeiss Axio Imager Z2 and Zeiss LSM 510 Meta confocal microscope (Carl Zeiss MicroImaging), equipped with EC Plan-Neofluar 40x/1.30 Oil DIC M27 (420462-9900) and Plan-Apochromat 63x/1.40 Oil DIC M27 (420782- 9900) objectives and ZEN Image software. [0075] In an embodiment, cell line culture and transduction was performed. HEK293T, bEnd3, KUM10 and Neuro2A cells were maintained in standard DMEM (Sigma) supplemented with 10% fetal bovine serum (Life Technologies), 1% penicillin/streptomycin (Gibco) and grown at 37 °C and 5% CO2. SH-SY5Y were maintained in DMEM-F12 (Sigma) supplemented with 10% fetal bovine serum (Life Technologies), 1% penicillin/streptomycin (Gibco) and grown at 37 °C and 5% CO₂. Cells were plated and transduced 24h after plating with lentiviral vectors encoding each construct (400 ng of p24 per 200000 cells). 24h later, the medium was replaced with regular medium and cells were cultured and expanded in their standard conditions. Fluorescence and genomic DNA analysis was used to monitor stable cell line generation. [0076] In an embodiment, isolation of extracellular vesicles (EVs) by Differential Ultracentrifugation was performed. For EVs isolation, cells were cultured in depleted fetal bovine serum (dFBS) (previously centrifuged at 100000g for 18 hours, 4°C). Medium was collected from cells at 80% confluency after 48- 72h and centrifuged at 300g for 10 minutes, followed by a 2 000g centrifugation for 10 minutes to remove cells and death cells. Medium was then centrifuged at 16 500g for 1 hour in thinwall polyallomer tubes (Beckman Coulter), SW28Ti rotor (Beckman Coulter) in Centrifuge Optima XE-100 to remove cellular debris. [0077] Supernatant was then filtered with a 0.22µm sterile syringe filter (Merck Millipore) to remove particles larger than 220 nm from the media. Supernatant was placed into new thinwall polyallomer tubes (Beckman Coulter) to pellet EVs at 100000g for 2 hours. The pellet was then washed abundantly with particles depleted PBS (dPBS) at 100000g for 2 hours to eliminate contaminating proteins. Pellet was resuspended to a final volume between 50 to 100 µL. [0078] In an embodiment, Western Blotting was performed. Total protein from cells and EVs was extracted using RIPA buffer (50 mM Tris-base; 150 mM NaCl; 5 mM EGTA; 1% Triton X-100; 0.5% sodium deoxycholate; 0.1% SDS) containing cOmplete Mini proteinase inhibitor (Roche) and supplemented with 0.2 mM PMSF (phenylmethylsulphonyl fluoride), 1 mM DTT (dithiothreitol), 1 mM Sodium Orthovanadate and 5 mM Sodium Fluoride. Protein concentration was determined by Bradford assay according to manufacture instructions (Bio-Rad Laboratories). Protein samples were denatured (95 °C for 10 min) with 6× sample buffer containing: 0.375 M Tris pH 6.8 (Sigma-Aldrich), 12% SDS (Sigma- Aldrich), 60% glycerol (Sigma-Aldrich), 0.6 M DTT (Sigma-Aldrich) and 0.06% bromophenol blue (Sigma- Aldrich). Samples were resolved by electrophoresis on 10 or 12% SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (GE Healthcare). Total protein labelling was performed using No Stain Labeling Reagent (Invitrogen) according to manufacturer’s protocol. Membranes were blocked by incubation in 5% non-fat milk powder in 0.1% Tween 20 in Tris buffered saline (TBS-T) and incubated overnight at 4°C with primary antibodies: ALIX (BD Biosciences, 611620, 1:1000), calnexin (Santa Cruz, sc-11397, 1:1000), CD63 (DSHB, AB528158, 1:500), Flotillin-1 (BD Biosciences, 610820, 1:1000), HSC70 (GeneTex, GTX101144, 1:1000), Lamp-2 (Santa Cruz, sc18822, 1:1000), TSG101 (BD Biosciences BD612696, 1:1000). Membranes were then washed 3 times in TBS-T for 10 min each and incubated with an alkaline phosphatase-linked secondary goat anti-mouse/anti-rabbit antibody (1:10 000; Thermo Scientific Pierce) at RT for 1h. Bands were visualized with Enhanced Chemifluorescence substrate (ECF) (GE Healthcare) in the chemifluorescence imaging (ChemiDoc Imaging System, Bio-Rad). Analysis was carried out based on the optical density of scanned membranes in ImageLab version 5.2.1; Bio-Rad. [0079] In an embodiment, RNA Extraction, cDNA synthesis and RT-PCR were performed. [0080] In an embodiment, total RNA was isolated with miRCURY RNA isolation kit (Exiqon), Total RNA Purification Plus Kit (Norgen) and Total RNA isolation Kit (Macherey-Nagel) according to manufacturer’s instructions. RNA was quantified using a NanoDrop 2000 Spectrophotometer (Thermo Scientific) and stored at -80°C. [0081] In an embodiment, specific cDNAs for miRNA quantification were synthetized using a TaqMan MicroRNA Reverse Transcription Kit combined with specific TaqMan MicroRNA Assays (Applied Biosystems) for each miRNA according to manufacturer’s instructions. qPCR was performed using TaqMan Universal PCR Master Mix II, with UNG (Applied Biosystems) in a StepOnePlus Real-Time PCR System (Applied Biosystems). [0082] In an embodiment, cDNA synthesis for mRNA quantification was performed with iScript cDNA Synthesis Kit (Bio-Rad) from 0.5-1 μg of total RNA. Real-time quantitative PCR was performed with the Sso Advanced SYBR Green Supermix Kit (Bio-Rad) using the StepOnePlus Real-Time PCR System (Applied Biosystems). Reactions were performed in duplicated or triplicated. The amplification rate for each target was evaluated from the cycle threshold (Ct) numbers obtained with cDNA dilutions. Differences between control and experimental samples were calculated using the 2^-∆∆Ct method. TaqMan Probes for miRNAs: miR-575 (ID001617), miR-451 (ID001141), miR-198 (ID002273), miR-601 (ID001558), miR- 887 (ID002374), miR-125a-3p (ID002199) and mir-181a-5p (ID000480), U6 snRNA (ID001973), snoRNA202 (ID:001232). Exiqon primers RNU5G (hsa,mmu, rno), RNU1A1 (hsa, mmu, rno), mirScramble: ID: 715657-1 and mirSilencer: ID: 715661-1 and ID: 715653-1. [0083] In an embodiment, the following primers were used: FlucFwd CTCACTGAGACTACATCAGC (SEQ ID No 30) and FlucRev TCCAGATCCACAACCTTCGC (SEQ ID No 31); RLucFwd GGAATTATAATGCTTATCTACGTGC (SEQ ID No 32) and RlucRev CTTGCGAAAAATGAAGACCTTTTAC (SEQ ID No 33); hATXN3 Fwd: TCCAACAGATGCATCGACCA (SEQ ID No 26) and hATXN3 Rev ACATTCGTTC CAGGTCTGTT (SEQ ID No 27); mGAPDH Fwd: TGGAGAAACCTGCCAAGTATGA (SEQ ID No 34) and mGAPDH Rev: GTCCTCAGTGTAGCCCAAG (SEQ ID No 35); hGAPDH Fwd: TGTTCGACAGTCAGCCGCATCTTC (SEQ ID No 36) and hGAPDH Rev: CAGAGTTAAAAGCAGCCCTGGTGAC (SEQ ID No 37). [0084] In an embodiment, dual luciferase reporter assay was performed. The dual luciferase reporter constructs with Firefly Luciferase associated with mutATXN3 (FLuc-mutATXN3) and Renilla Luciferease (RLuc) was used to evaluate target engagement of artificial miRNA. Cells were washed with PBS and frozen at −80°C or directly processed. Cell processing was performed according to the manufacturer’s instructions (Dual-Luciferase Reporter Assay System). Briefly, cells were lysed with Passive lysed buffer (PLB) and 20 μL loaded in white 96-well culture plates (Lumitrac 200) and opaque 96-well plate (Corning). [0085] In an embodiment, firefly luminescence activity was measured on Synergy H1 Hybrid Multi- Mode Reader (BioTek) and FLUOstar Omega Microplate Reader (BMG LABTECH) after automatic injection of 100 μL of Luciferase Assay Buffer II (LARII). Renilla luminescence activity was used as a normalization control and was measured after automatic injection of 100 μL of Stop & Glo Reagent. Integration times were 10 s for firefly luciferase signal capture and 5 s for renilla luciferase signal capture. Each sample was loaded in duplicate and at least 2 reads were performed. [0086] In an embodiment, Transmission electron microscopy (TEM) was performed. EVs isolated by dUC were fixed with 2% PFA/PBS and allowed to absorb on Formvar-carbon coated grids (TAAB Laboratories) for 5min. The excess liquid was blotted off the film surface using a filter paper (Whatman). Then, the grids were contrasted with uranyl acetate 2% and after 1min, the excess stain was blotted off and the sample air dried. Observations were carried out using a Tecnai G2 Spirit BioTwin electron microscope (FEI) at 100 kV. [0087] In an embodiment, Nanoparticle Tracking Analysis (NTA) was performed. Number of EVs diluted in PBS was assayed using Nanoparticle Tracking Analysis Version 2.2 Build 0375 instrument (NanoSight NS300 instrument, Malvern Instruments). Particles were measured for 30 s and the number of particles (30–800 nm) was determined using NTA Software 2.2. Samples were diluted 1:1000 in PBS prior to analysis. The following photographic conditions were used: frames processed (1498 of 1498 or 1499 of 1499); frames per second (24.97 or 24.98 f/s); calibration (190 nm/pixel); and detection threshold (6 or 7 multi). Number of particles per frame was within the recommended range of 20–100 particles/frame for NanoSight NS300. [0088] In an embodiment, it was shown that endogenous miRNAs are extensively loaded into EVs due to the presence of ExoMotifs. [0089] In an embodiment, to evaluate whether miRNAs previously described as containing ExoMotifs (Villarroya-Beltri et al., 2013) were preferentially enriched into EVs, it was tested their intrinsic loading efficacy in three different cell lines: HEK293T, KUM10, and SH-SY5Y. For that purpose, a differential ultracentrifugation (dUC) protocol was optimized (Figure 1A) for EVs isolation. Briefly, conditioned media was collected from cells at 80% confluence and increasing ultracentrifugation forces were sequentially applied to remove cells in suspension, cell debris, and large vesicles. The supernatant was then filtered through a 0.22µm syringe filter and ultracentrifuged at 100000g for 2 hours to pellet EVs. The pellet was then washed in cold PBS at 100000g for 2 hours to remove co-pelleted free protein and protein aggregates. EVs were characterized by western blotting to identify typical EVs markers according to MISEV2018 guidelines (Théry et al., 2018). The obtained EVs population was shown to be enriched for Lamp-2, Alix, HSC70, and Flotilin-1, whereas the Golgi marker Calnexin was absent (Figure 1B). EVs size distribution was evaluated by performing nanoparticle tracking analysis (NTA) (Figure 1C), which indicated that EVs presented a typical size mode of 110nm. Moreover, transmission electron microscopy (TEM) (Figure 1C, inset) allowed to validate particle size, the sample purity (no protein aggregates) and to confirm the typical cup-shaped morphology of EVs. The isolated EVs were then evaluated concerning specific miRNAs abundance. For that, it was selected a set of miRNAs previously described as containing an ExoMotif: miR-575 (SEQ ID No 11), miR-451 (SEQ ID No 14), miR-198 (SEQ ID No 13), miR-601 (SEQ ID No 15), miR-887 (SEQ ID No 16), and miR-125a-3p (SEQ ID No 12) (Villarroya-Beltri et al., 2013). As control, it was selected miR-181a (SEQ ID No 17) which was described as being restrained in cells due to the presence of a CellMotif (Villarroya-Beltri et al., 2013). [0090] In an embodiment, miRNA levels were compared between parental cells and their derived EVs. From the set of evaluated miRNAs, EVs obtained from SH-SY5Y cells were significantly enriched in miR- 451 and miR-601, while miR-575, miR-125a-3p, miR-198, miR-887, and miR-181a were more abundant in the producer SH-SY5Y cells (Figure 1E). In KUM10 cells, three miRNAs were found to be significantly enriched into EVs, namely miR-575, miR-451, and miR-601. Despite showing the same tendency, miR- 887 did not reach statistical significance. miR-125a-3p and miR-181a were found to be restrained in cells comparing to EVs. miR-198 was not detected neither in cells nor in EVs (Figure 1F). In HEK293T cells, four miRNAs were found to be significantly enriched into EVs comparing to their origin cells, namely miR-575, miR-451, miR-601, and miR-887, while miR-198 did not reach statistical significance. In contrast, miR-125a-3p and miR-181a were more abundant in cells comparing to EVs (Figure 1G). Interestingly, miR-451 was found to be significantly enriched in EVs derived from all the three cell lines with at least more than 1000-fold increase comparing to their parental cells. Moreover, among the different cell lines, HEK293T cells exhibited more ExoMotif-containing miRNAs packaged into EVs from the set of miRNAs analysed. [0091] Overall, it was found that ExoMotif signals drive miRNAs into EVs with different loading efficiencies depending on the cell line and the considered miRNA. [0092] In an embodiment, it was shown that the GGAGGAG ExoMotif (SEQ ID No. 5) and hnRNPA2B1 ribonucleoprotein increase EVs loading efficiency of mutATXN3 miRNA-based silencer. [0093] In an embodiment, to investigate whether the ExoMotif sequence GGAGGAG (SEQ ID No. 5), that is present in the set of miRNAs above described, would promote the packaging of the artificial miRNA embedded in a miR-155 scaffold into EVs, two constructs encoding a mirSilencer targeting mutant Ataxin-3 (constructs described in WO/2020/144611 - WO’611 – SEQ ID No.38 to SEQ ID No 66) were generated. One construct encoding a mirSilencer and the referred ExoMotif, and other, just encoding the mirSilencer (without the ExoMotif) (Figure 2A1). In a preferred embodiment, the resulting constructs with Exomotif comprise a sequence at least 90% identical to a sequence of the following list: SEQ ID No 19, SEQ ID No 20, SEQ ID No 21, SEQ ID No 22, SEQ ID No 23, or SEQ ID No 24; and the construct without Exomotif comprises a sequence at least 90% identical to SEQ ID No 18. First, it was evaluated whether the association of the GGAGGAG ExoMotif (SEQ ID No 5) would impact the silencing activity of the mirSilencer by transfecting Neuro2A cells stably expressing mutATXN3 with the described plasmids (Figure 2B). A significant reduction of 45% in mutATXN3 protein levels was confirmed by western blotting for both mirSilencer sequences (with and without the ExoMotif) when compared to the control condition (mirScramble), suggesting that the ExoMotif incorporation does not affect the silencing efficiency of the mirSilencer. [0094] In an embodiment, stable cell lines were generated using lentiviral vectors (LVs) encoding the mirSilencer either with or without the ExoMotif (Figure 2D), from HEK293T cells; as an alternative, the stable cell lines can be generates from KUM10 cells, an osteoblast cell line from mouse C57/B6 bone marrow. Moreover, an additional condition overexpressing the hnRNPA2B1 protein (such as SEQ ID No 67) was added, aiming at promoting further enrichment of mirSilencer in EVs. mirSilencer levels in EVs were evaluated by RT-qPCR and, remarkably, the mirSilencer showed to be 2.5-fold enriched in EVs, when compared to progenitor cells in the condition comprising both the ExoMotif and hnRNPA2B1 (Figure 2C). Having these findings into account, it was evaluated whether the enrichment of mirSilencer into EVs would enhance silencing of mutATXN3 mRNA in Neuro2A cells. For that it was incubated the enriched EVs with cells for 48h (Figure F). In fact, EVs carrying the mirSilencer associated with the ExoMotif were able to significantly downregulate mutATXN3 mRNA in 18.5%, while no statistically significant downregulation was observed with EVs carrying the mirSilencer without the ExoMotif (Figure 2E). [0095] Overall, the co-expression of mirSilencer in association with the ExoMotif and the hnRNPA2B1 protein allowed increased packaging of mirSilencer sequences into EVs, enabling functional silencing of mutATXN3 mRNA in vitro. [0096] In an embodiment, it was shown that EVs internalization in neurons is promoted by incorporation of the PDGFR transmembrane protein fused with the rabies virus glycoprotein (RVG). [0097] It was demonstrated that the solution of present disclosure is able to improve the packaging of mirSilencer into EVs, enabling its functional delivery to cells. However, promoting gene silencing in the target neurons also depends on the subsequent step of EVs internalization which could be further optimized. Several authors (Conceição et al., 2016) and other authors (Dar et al., 2021; El-Andaloussi et al., 2012; Hung & Leonard, 2015)(György et al., 2014) previously showed that peptides derived from rabies virus glycoprotein (RVG) can be displayed on the surface of particles to enhance neuronal targeting (Kumar et al., 2007). In fact, it has been described RVG confers neuronal targeting capacity due to the binding to acetylcholine receptors (AChR) in neurons (Kumar et al., 2007). Therefore, in the present disclosure it was taking advantage of a CD63-NanoLuc reporter cell line to generate EVs decorated with RVG peptide on their surface that can be used to evaluate internalization efficiency by bioluminescence imaging. The RVG peptide fused with the platelet-derived growth factor receptor (PDGFR), a transmembrane protein that allow the anchoring of proteins on the surface of EVs through its fusion with a ligand of interest (György et al., 2014). The vesicles were incubated with bEnd.3 (endothelial cells from mouse brain tissue) or Neuro2A cells for 12h. As a control, CD63-NanoLuc vesicles not displaying RVG on their surface were used (Figure 3A). [0098] For every cell line, it was found that the internalization was five to six times significantly higher for EVs expressing PDGFR-RVG when compared to the control condition (without the RVG targeting moiety) (Figure 3B), suggesting that the RVG peptide allows a more efficient internalization both in neuronal and non- neuronal cells. Then, to investigate the internalization profile of the engineered vesicles overtime, it was incubated vesicles for 2h, 6h, 12h, 18h, 24h and 36h in bEnd.3 and Neuro2A cells. Neuro2A cells internalized significantly more EVs than bEnd.3 cells in all the defined time points. Neuro2A cells showed a peak of internalization corresponding to approximately 10000 RLU after 6h of incubation, while bEnd.3 showed 2000 RLU at the same time point (Figure 3C), suggesting that PDGFR- RVG EVs are more efficiently internalized by Neuro2A cells. After 6h of incubation, PDGFR-RVG EVs mediated 4 times more luminescence in Neuro2A cells (∆RLU=8000) when compared to bEnd.3 cells (∆RLU=2000), indicating that an increased number of vesicles were internalized (Figure 3D). To further understand whether the internalization is dependent on the number of RVG-containing vesicles, RVG- EVs were incubated with two different doses of vesicles: 1.5X10⁸ particles and 6.0X10⁸ particles, respectively. The higher dose led to almost 4 times more luminescence in Neuro2A cells, suggesting that the internalization of RVG-EVs is proportional to the dose of incubated EVs (Figure 3E). [0099] In an embodiment, additional experiment was performed to evaluate internalization of EVs in primary neurons. For that purpose, fluorescent EVs expressing CD63-GFP were used as a sensor for internalization. EVs exhibiting CD63-GFP and PDGFR-RVG on the surface were incubated with primary cortical rat neurons, and CD63-GFP EVs without PDGFR-RVG were used as control (Figure 3F). Laser confocal microscopy images displayed CD63-GFP EVs being internalized by β3-tubulin positive neurons. Interestingly, CD63-GFP EVs expressing PDFGR-RVG on their surface were internalized in roughly 63% of neurons comparing to 37% in the control condition, at 4 hours post-incubation (Figure 3G). After 12 hours of incubation, 82% of neurons displayed GFP expression comparing to 57% GFP-positive neurons when PDGFR-RVG was absent from EVs (control), suggesting PDFGR-RVG expression promotes internalization of EVs in primary neurons. [00100] In an embodiment, it was shown that engineered EVs significantly reduce mutATXN3 mRNA in vitro. [00101] In an embodiment, taking into consideration the enhanced delivery of RVG-EVs payload to neuronal cells, it was generated a packaging cell line encoding PDGFR-RVG (co-expressing mCherry) and hnRNPA2B1 (co-expressing turboGFP) (Figure 4A). A stable expression of both transgenes was achieved after lentiviral transduction, followed by FACS sorting for double positive cells co-expressing mCherry and turboGFP (Figure 7A). Afterwards, cells were then split to separately overexpress each miRNA conditions (mirScramble, mirSilencer, and mirSilencer with ExoMotif). The engineered vesicles continuously produced by this packaging cell lines were used to exploit the therapeutic potential and further in vitro applications (Figure 4A). A dual luciferase reporter system encoding Firefly Luciferase (FLuc) associated with mutATXN3 and Renilla Luciferase (RLuc) under control of PGK and CMV promoters, respectively, was used to monitor the levels of mutATXN3 mRNA (Figure 8A). Engineered EVs were incubated in Neuro2A cells overexpressing the dual luciferase construct (Figure 4B). After 48h of incubation, luminescence levels of FLuc-mutATXN3 were significantly decreased in 34% when incubated with EVs carrying mirSilencer with the ExoMotif comparing to control (EVs carrying mirScramble), while EVs with mirSilencer without ExoMotif did not significantly silence FLuc-mutATXN3 mRNA. Moreover, a dose-dependent effect on reducing FLuc-mutATXN3 luminescence activity was observed upon EVs incubation. Therapeutic EVs carrying the mirSilencer with the ExoMotif downregulated mutATXN3 mRNA levels from 57% to 72% upon doubling the dose of incubated EVs, compared to control EVs carrying the mirScramble (Figure 4D). [00102] In an embodiment, therapeutic efficacy was then evaluated in cerebellar cultures from an MJD transgenic mouse model, hemizygous MJD YAC84.2 pups (P6-P7), which express the full human mutant ATXN3 gene (Cemal et al., 2002). Primary cerebellar cultures showed a positive staining for the microtubule-associated protein 2 (MAP2) and for the cerebellar neurons marker Purkinje cell protein 4 (PCP4), as well as for ATXN3, by microscopy analysis (Figure 4E). To evaluate the therapeutic potential of the engineered EVs in this model, primary cerebellar MJD YAC84.2 cells were incubated with two doses of EVs, added at day 10 and 12 of culture. A significant decrease of mutATXN3 of approximately 49% was observed upon incubation with EVs containing the mirSilencer with ExoMotif (Figure 4F). EVs carrying mirSilencer without ExoMotif showed a tendency to downregulate the levels of mutATXN3 mRNA of approximately 29% relative to control condition. [00103] Overall, these results suggest that engineered EVs carrying the mirSilencer with the ExoMotif and expressing RVG peptide are functionally active at downregulating the levels of mutATXN3 mRNA in Neuro2A cells and in MJD murine cerebellar neurons. [00104] In an embodiment, it was shown that delivery of mirSilencer to the brain significantly decreases mutATXN3 mRNA in a Dual Luciferase MJD mouse model. [00105] Besides the results of the disclosed therapeutic EVs at efficiently downregulating mutATXN3 mRNA in neurons in vitro, the potential of this platform was also tested for in vivo purposes. For that aim, a novel dual luciferase MJD mouse model was developed upon intracerebellar stereotaxic injection of LVs encoding FLuc associated with mutATXN3 and RLuc (Figure 5A). This model allows double luminescence readout, where FLuc emits light 10 minutes after IP injection of luciferin, which directly correlates with the mutATXN3 levels, and RLuc emits light 30 seconds after IV injection of ViviRen (coelenterazine analog) (Figure 9A). The suitability of this animal model to monitor the mutATXN3 mRNA levels in vivo was evaluated upon co-injection of LV encoding the dual luciferase MJD reporter system and either the mirSilencer with ExoMotif or mirScramble in the cerebellum. In vivo bioluminescence showed a significant and robust 59% reduction of FLuc-mutATXN3 luminescence levels in the mirSilencer condition relative to mirScramble (Figure 5B). [00106] In an embodiment, to explore a non-invasive route of administration, it was evaluated whether RVG-EVs would reach the cerebellum of wild-type mice upon intranasal administration. CD63-GFP EVs expressing PDGFR-RVG were intranasally administered twice a day for 2 weeks (Figure 9). Interestingly, it was observed GFP fluorescence in the cerebellum suggesting EVs reach this brain region (Figure 9). [00107] In an embodiment, to further investigate whether RVG-EVs containing mirSilencer with ExoMotif administered through intranasal route would reach the cerebellum and knock down mutant ataxin-3 in a dual luminescent MJD mouse model, a dose of 2x109 of therapeutic EVs was administered in each animal daily for 1 month. mirSilencer distribution throughout the brain showed the highest fold change in the olfactory bulb, followed by brainstem, cerebellum and the remaining brain regions, suggesting mirSilencer-containing EVs can reach the major regions affected in MJD, namely the brainstem and cerebellum (Figure 5C). Unexpectedly, the treatment monitoring after 15 and 30 days did not demonstrate significant differences between conditions in living animals possibly due to technical limitations (such as skull, skin and fur interference) (Figure 10B). Animals were sacrificed after 30 days from the beginning of administrations and cerebellum homogenates were split for RNA processing and bioluminescence analysis (Figure 5D). Interestingly, mutATXN3 mRNA levels were significantly downregulated by 38% when mirSilencer with ExoMotif EVs were administered compared to scramble EVs (Figure 5D). These findings were also corroborated at the protein level by a dual luciferase assay in cerebellum homogenates that showed a significant downregulation of 24% in the luciferase activity in the condition respecting to EVs carrying mirSilencer with ExoMotif when compared to scramble EVs condition (Figure 5E). [00108] As all the above points have demonstrated, these results showed that long-term administration of engineered EVs via the intranasal route in a MJD mouse model: a) deliver the mirSilencer with ExoMotif to the cerebellum, and b) downregulate mutATXN3 mRNA thus turning to be a promising therapeutic approach to alleviate MJD in vivo. [00109] The present disclosure demonstrates that a miRNA-based silencing sequence targeting mutATXN3 mRNA embedded in a miR-155 scaffold is: a) packaged into EVs; b) significantly enriched upon association with the ExoMotif GGAGGAG and the hnRNPA2B1 protein; c) more efficiently delivered to neuronal cells when the corresponding EVs are decorated with the RVG peptide on their surface. Engineering EV-packaging cells with modified miRNA-based silencing sequences, hnRNPA2B1, and the RVG peptide enabled production of EVs with the capacity of efficiently silence mutant ataxin-3 in cell lines and primary cultures of cerebellar neurons of a MJD transgenic mouse model. Finally, a daily non- invasive intranasal administration of these therapeutic EVs into a dual luminescent MJD mouse model enabled their efficient delivery into the most affected brain regions, and significantly silenced mutATXN3 expression, suggesting that the disclosed extracellular vesicle stands as a promising therapeutic strategy for MJD. [00110] Many efforts have been made to develop RNA interference (RNAi) strategies to ameliorate the neuropathology and rescue the disease phenotype in MJD animal models (Evers & Toonen, 2014; Moore et al., 2019; Rodríguez-Lebrón et al., 2013)(Alves, Hassig, et al., 2008; Nobre et al., 2021; Nóbrega et al., 2014). RNAi is a naturally occurring mechanism that involves sequence specific downregulation of mRNA, by simply destroying it or avoiding its translation into protein (Sui et al., 2002). The vast majority of RNAi technologies used to downregulate mutATXN3 mRNA are based on the delivery of shRNAs or siRNAs through intracranial injection (Nóbrega et al., 2013, 2014, 2019)(Alves S. et al., 2008, 2010)(Nobre et al., 2021) (Martier et al., 2019)(Moore et al., 2017). However, intracranial injections are an extremely invasive procedure with safety issues and limited distribution across the different diseased brain regions. Less invasive administration routes have therefore been exploited to deliver silencing sequences to the brain with success in the context of MJD (Conceição et al., 2016). Nevertheless, the use of cell-derived lipid membranes, such as EVs, as a delivery vehicle for RNAi has still been poorly explored (Arora et al., 2021; dos Santos Rodrigues et al., 2020) (Alvarez-Erviti et al., 2011). In fact, so far only two studies explored the therapeutic potential of EVs in MJD animal models using either native MSC-derived EVs (You et al., 2020) or miR-6780-5p-enriched EVs-derived from butylidenephthalide pre- conditioned human olfactory ensheathing cells (Chen et al., n.d.), both with promising results at alleviating motor behavior phenotypes. Nevertheless, the use of engineered EVs as a vehicle to deliver artificial miRNA-based silencers to downregulate mutATXN3 mRNA in MJD mouse models had not been previously investigated. [00111] In the present disclosure three different cell lines (HEK293T, KUM10, and SH-SY5Y) were analyzed regarding miRNAs incorporation into secreted EVs, with two miRNAs being identified as highly enriched into EVs from all cell lines: miR-451 and miR-601. Remarkably, miR-451 is at least 1000-fold enriched in EVs when compared to their progenitor cells, suggesting miR-451 as an efficient scaffold candidate to incorporate silencing sequences. Indeed, this strategy was shown to be efficient in loading SOD1 siRNAs into EVs, reducing the therapeutic dose of siRNAs, and consequently the toxicity in SOD1 G93A mice (Reshke et al., n.d.). A distinct analysis performed intracranial injection in Huntington and SCA3 disease models by directly infusing AAV5 encoding miR-451 scaffold with silencing sequences targeting huntingtin (miHTT) and ataxin-3 (miATXN3) in non-human primates (NHP) (Sogorb-gonzalez et al., 2021). In this case, miR-451 scaffold packaging properties into EVs allowed a suitable pharmacokinetic evaluation of long-term expression of the artificial miRNA in EVs secreted in CSF for up to 2 years (Sogorb-gonzalez et al., 2021). Nevertheless, high packaging efficiency into EVs may not necessarily correlate with high therapeutic efficiency respecting mRNA downregulation in target cells, due to the possibility of redirection for EVs secretion upon cell internalization, without reaching the target mRNA (O’Brien et al., 2022). [00112] The loading of small RNAs in EVs depends on multiple factors: a) presence of ExoMotif sequences, such as GGAG, CCCU, GGCU, UGGA, and CGGGAG sequences (Villarroya-Beltri et al., 2013)(Santangelo et al., 2016)(Garcia-Martin et al., 2022)(Temoche-Diaz et al., 2019); b) presence of RNA-binding proteins, such as hnRNPA2B1, SYNCRIP, Y-box protein 1, HuR, Lupus La protein, Alyref, and Fus (Villarroya-Beltri et al., 2013)(Santangelo et al., 2016)(Garcia-Martin et al., 2022)(Temoche-Diaz et al., 2019) (Shurtleff et al., 2016)(Shurtleff et al., 2017)(Li et al., 2019); c) secondary structure of miRNAs (Shurtleff et al., 2016)(Shurtleff et al., 2017), and d) cell type-specific mechanisms (Villarroya-Beltri et al., 2013)(Santangelo et al., 2016)(Garcia-Martin et al., 2022)(Temoche-Diaz et al., 2019) (Shurtleff et al., 2016)(Shurtleff et al., 2017). Previous work used a miRNA-based silencing sequence targeting mutATXN3 mRNA based in an miR-155 scaffold (WO/2020/144611) that has been described in previous studies to be naturally enriched into EVs (Asadirad et al., 2022; Song et al., 2022; Vaillancourt et al., 2021). [00113] In an embodiment to further increase the packaging efficiency of the miRNA-based silencing sequence targeting mutATXN3 mRNA based in an miR-155 by an endogenous loading mechanism, it was associated the ExoMotif GGAGGAG and an hnRNPA2B sequence, mediating a 2.5-fold enrichment when compared to the control condition. However, EV-based delivery of miRNA with the ExoMotif promoted a modest improvement of the downregulation of mutATXN3 mRNA when compared to the condition without ExoMotif, suggesting that packaging of miRNA into EVs may not be the only influencing factor, and highlights the involvement of other mechanisms to increase the efficiency of miRNAs delivery through EVs. [00114] It was then hypothesized that a limiting step for therapeutic delivery and efficacy of our EV- miRNA strategy would relate to their internalization process into recipient cells. It was observed limited internalization rates of EVs into Neuro2A cells, encouraging us to further decorate their surface with the PDGFR-RVG fusion protein. The RVG peptide was described to target neurons through a specific ligand- receptor mediated transcytosis mechanism, relying on the binding to the AchR which is expressed in neurons. Many studies used RVG targeting properties to reach the brain, either by directly associating siRNA with RVG (Kumar et al., 2007; Zadran et al., 2013), by decorating liposomes to enable brain targeting (Conceição et al., 2016)(Pulford et al., 2010)(Arora et al., 2021; dos Santos Rodrigues et al., 2020) or by expressing them on EVs for the same purpose (Alvarez-Erviti et al., 2011)(Gao et al., 2018)(Kojima et al., 2018)(Dar et al., 2021)(Zhang et al., 2021). LAMP2B is the transmembrane domain typically used to express RVG peptide on the surface of EVs (El-Andaloussi et al., 2012). Instead, it was used the PDGFR transmembrane domain to associate with RVG peptide, an extremely efficient system already used to deliver EV-AAV to the brain (György et al., 2014). Indeed, as expected, RVG improved EVs internalization, which was more efficient in Neuro2A cells than in other non-neuronal cells lines, with a prominent peak of internalization at 6h. Even so, it was found that RVG-EVs incubation with a non-neuronal cell line (bEnd.3) promoted more internalization comparing to their respective controls (not expressing RVG on the surface), suggesting that other internalization mechanisms may also occur in the presence of RVG. Overall, RVG-EVs showed an improved internalization profile in all tested cell lines, suggesting that the use of RVG may improve delivery of therapeutic cargo, particularly to neuronal cells. Indeed, RVG-EVs in association with the ExoMotif and hnRNPA2B1 achieved around 30% and 50% downregulation of mutATXN3 in a dual luciferase reporter cell line and in primary cerebellar cultures, respectively, in comparison with a 20% downregulation of mutATXN3 mRNA when using EVs without RVG. Taken together with previous findings, it was hypothesize that the major limiting step for the downregulation ofmutATXN3 mRNA is the limited internalization of EVs in recipient cells. Therefore, future studies should address the internalization of EVs by exploring their native properties from different cell sources or by modifying their surface with other fusogenic entities. [00115] The RVG peptide is typically expressed on the surface of nanoparticles to target the brain upon intravenous (IV) administration (Alvarez-Erviti et al., 2011; Dar et al., 2021; Gao et al., 2018; Hung & Leonard, 2015)(dos Santos Rodrigues et al., 2020; Kim et al., 2010). Despite the success of this strategy, some concerns regarding the efficiency upon IV injection have been raising due to the high liver retention (Maguire et al., 2012). Additionally, the AchR is also expressed on macrophages (Kim et al., 2010) which may increase the engulfment of RVG-EVs by resident macrophages in liver (György et al., 2014). An alternative non-invasive route is intranasal administration which bypasses the BBB and results in less systemic adverse effects. This route is being increasingly used for brain delivery of small molecules (Thorne et al., 2004) (Gonçalves et al., 2019; Serralheiro et al., 2014) (Pinkham et al., 2019), mesenchymal stem cells (Perets et al., 2019), olfactory ensheathing cells (Carvalho et al., 2019)(Carvalho & Tannous, 2019), and EVs (Perets et al., 2019)(Betzer et al., 2017)(Zhuang et al., 2011) (Losurdo et al., 2020). A comparison between IV and IN administrations of EVs to reach the mouse brain was performed using neuroimaging with gold nanoparticles-labelled EVs. These in vivo results suggested IN administration was more effective than IV injection (Betzer et al., 2017). Indeed, intranasal administration of MSC-derived EVs was previously shown to be neuroprotective and immunomodulatory in 3xTg animal model of Alzheimer’s disease (AD). Curiously, this administration route was chosen to detriment of IV or intra-CSF single administration, due to the additional advantage of feasible multiple administrations through a non-invasive procedure (Losurdo et al., 2020). [00116] There are two main mechanisms described for the delivery of therapeutics from nasal cavity to the brain: a) one involving trigeminal nerve, also known as intraneuronal pathway, that requires axonal transport of the therapeutics throughout several days; b) the extraneuronal pathway involving the extracellular bulk flow along perineural and perivascular channels, and biofluids (such as CSF) directly to brain parenchyma, constituting a faster process (Zhuang et al., 2011)(Gabathuler, 2009)(Thorne et al., 2004)(Bicker et al., 2020). The trigeminal nerve connects the olfactory bulb to the brainstem (Bathla & Hegde, 2013) and it was shown to express AchR (Alimohammadi & Silver, 2000; Liu et al., 1998), being a probable target for the RVG nanoparticles (Chung et al., 2020). RVG-EVs were successfully through the intranasal route to different brain regions, after performing repeated daily administrations for 1 month. Indeed, it could detect the presence of EVs in the cerebellum and brainstem, regions linked to the olfactory bulb by the trigeminal nerve. It was hypothesized that this effect may be enhanced by the RVG peptide which facilitates EVs internalization by AchR-expressing cells in trigeminal nerves. However, a recent study pointed out limitations in brain distribution of EVs through IN route, suggesting its reconsideration for use in larger mammals, such as Macaca nemestrina or humans (Castell et al., 2021). [00117] Remarkably, it was saw a significant downregulation in mutATXN3 mRNA within the cerebellum, one of the primary regions affected in MJD, suggesting that a daily administration of EVs can be a useful strategy to deliver silencing sequences to the brain upon intranasal administration. These findings corroborate a previous study that shows IN delivery of neuropeptide Y (NPY) to be effective at mitigating MJD motor impairment phenotype and the neuropathology in a MJD transgenic mouse model with severe cerebellar atrophy (Duarte-Neves et al., 2021). [00118] Besides the conventional MJD mouse models used in pre-clinical studies for motor and neuropathology evaluation, here it is reported the development of a novel dual luminescent mouse model with tremendous advantages to evaluate in vivo target engagement : a) it expresses FLuc associated with mutATXN3 gene that emits light 10 minutes after IP injection of luciferin, while RLuc emits light 30 seconds after IV injection of ViviRen (analog of coelenterazine used for in vivo studies) working as a housekeeping control; b) it allows therapy monitorization and dose adjustment in living mice without need of sacrifice; c) it can be applied to a specific brain region through intracranial injection and, d) it can be applied in other genetic-based diseases. It should mention that the lesion caused by the intracranial injection in the brain parenchyma may compromise the BBB integrity and increases EVs recruitment to the injected site, as described before by (Zhuang et al., 2011). [00119] In the present disclosure, it was engineered EVs to pack an miRNA-based silencing sequences with high efficiency and increased their internalization properties by decorating EVs surface with the RVG peptide. The use of the ExoMotif associated with the artificial miRNA, together with the expression of hnRNPA2B1 and PDGFR-RVG proteins, allowed to generate therapeutic EVs with capacity to efficiently downregulate mutATXN3 species in different cellular models. Additionally, it was demonstrated that EVs carrying silencing sequences can reach the cerebellum and ameliorate MJD through a significant downregulation of mutATXN3, constituting a promising therapeutic strategy for this and other neurodegenerative disorders. [00120] Figure 1 shows endogenous miRNAs with ExoMotifs are extensively loaded into EVs. Figure 1A. EVs isolation through differential ultracentrifugation (dUC). Conditioned media was centrifuged 300g for 10 minutes to eliminate cells in suspension, followed by a centrifugation at 2000g for 10 minutes to discard cell debris. Supernatant was then centrifuged at 16500g for 1h to remove large vesicles, filtered through 0.22µm and ultracentrifuged at 100000g for 2 hours to pellet EVs. The pellet was then washed in cold 1xPBS and centrifuged at 100000g for 2 hours to remove free protein and protein aggregates. Figure 1B Characterization of HEK293T-derived EVs protein markers. Western blotting of equimolar amounts of protein from cells and their derived EVs show the presence of the EV positive markers Lamp- 2 (110kDa), Alix (100kDa), HSC70 (70kDa) and Flotilin-1 (48kDa) and the absence of the negative marker Calnexin (100kDa). Figure 1C Characterization of EVs by nanoparticle tracking analysis (NTA). NTA shows a prominent peak at 110 ± 3.9 nm, corresponding to the typical EVs size range. Figure 1D Characterization of EVs population by transmission electron microscopy (TEM). TEM shows the cupped- shaped morphology of EVs. Scale bar is 1µm (open field image). Figure 1E Levels of endogenous miRNA content in SH-SY5Y cells (black bars) and derived EVs (blue bars). miR-451 and miR-601 are enriched in EVs comparing to their cells. miR-575, miR-125a-3p, miR-198, miR-887 and miR-181a are restrained in cells comparing to EVs. Figure 1F KUM10 miRNA sorting profile between cells and their derived EVs. miR-575, miR-451, and miR-601 are enriched in EVs comparing to their cells. miR-125a-3p and miR-181a are restrained in cells comparing to EVs. miR-198 is not detected in cells or EVs. Figure 1H HEK293T miRNA sorting profile between cells and their derived EVs. miR-575, miR451, miR-198, miR-601 and miR- 887 are enriched in EVs comparing to their cells. miR-125a-3p and miR-181a are restrained in cells comparing to EVs. Data is presented as means ± SEM throughout four independent experiments (N=4). Data was normalized against U6 (SHSY5Y) and SNO202 (KUM10 and HEK293T) housekeeping RNAs. Data was compared with Multiple unpaired t-tests. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001 and N.D. – Non Determined. [00121] Figure 2 shows ExoMotif and hnRNPA2B1 association with miRNA mutATXN3 silencer drives its packaging into EVs and reduce mutATXN3 mRNA levels. Figure 2Ais a schematic representation of the experimental setup. The ExoMotif GGAGGAG was associated with miRNA mutATXN3 silencer (mirSilencer). The silencing efficacy of mirSilencers with and without ExoMotif were assessed by plasmid transfection. Figure 2B Levels of mutATXN3 protein in Neuro2A cells. mirSilencer plasmids (with and without ExoMotif) were transfected in Neuro2A cells encoding mutATXN3. Both plasmids led to a significant silencing of mutATXN3 protein level relative to mir-Neg (miRNA encoding a scramble sequence that does not bind to mutATXN3 mRNA). Figure 2C Lentiviral vectors (LV) were used to generate stable cell lines encoding both mirSilencers. miRsilencer levels in cells and their derived EVs were assessed by RT-PCR. Figure 2D MirSilencer enrichment in EVs. Stable cell lines encoding mirSilencer with and without ExoMotif were used to compare the mirSilencer levels between progenitor cells and their derived EVs. mirSilencer associated with the ExoMotif and hnRNPA2B1 sequence is 2.5-fold significantly enriched in EVs when compared to their progenitor cells. A relative qPCR quantification was performed and RNU1A1 was used as endogenous control. Results are expressed as mean ± SEM of arbitrary units (N=4). Data was compared performing one-way ANOVA followed by Sidak's multiple comparisons test (F=4.336). Figure 2E MutATXN3 mRNA levels upon EVs incubation. EVs carrying mirSilencer with and without ExoMotif were incubated in Neuro2A cells encoding mutATXN3 mRNA. After 48h, mutATXN3 mRNA levels were significantly decreased in cells incubated with EVs carrying mirSilencer with ExoMotif (N=4). One-sample t-test. Statistical significance: *p < 0.05, **p < 0.01, ***p < 0.001 and ns – non significant [00122] Figure 3 shows RVG peptide expression on the surface of EVs promotes internalization into neurons. Figure 3A Schematic representation of EVs expressing CD63-Nanoluc and PDGFR-RVG followed by their incubation in distinct cell lines. Figure 3B RVG-EVs are internalized by multiple cell lines. EVs expressing PDGFR-RVG on their surface internalize 6x more into Neuro2A cells and 5x more in Bend3 cells when compared to CD63-Nanoluc EVs without RVG. Figure 3C Internalization profile of RVG-EVs in Neuro2A (red) and Bend3 (pink) cells at 2h, 6h, 12h, 18h, 24h and 36h incubation time-points. CD63- Nanoluc EVs without RVG expression were used as controls (black lines). Neuro2A cells internalize more EVs at early time-points (6h), while Bend3 cells showed a stable internalization profile over 36h. Data is expressed as mean ± SEM. Figure 3D RVG-EVs internalize more into neuronal cells. Neuro2A cells showed an increase in the bioluminescence uptake signal, when compared with Bend3 cells upon 6 hours of incubation. The data was compared by Unpaired T-test. Figure 3E Dose-response of RVG-EVs. Internalization of RVG-EVs is proportional to the amount of EVs incubated. Higher dose of EVs 6.0X108 particles) leads to higher internalization (37873 RLU), when compared to the lower dose of EVs (1.5X108 particles) that corresponds to 9230 RLU in cells upon 6h of incubation. The data is compared by ordinary one-way ANOVA followed by Tukey's multiple comparisons test (F=7364.0). F. Schematic representation of incubation of CD63-GFP EVs expressing PDGFR-RVG on their surface in primary rat cortical neurons. G. Internalization of RVG-EVs by primary rat cortical neurons. Confocal images showing EVs (green) being internalized in neurons (red, β3-tubulin). The analysis was performed using laser confocal microscopy equipped with Plan-Apochromat 40×/1.40 Oil DIC M27 (420782-9900) (scale bar 5μm). Percentage of primary neurons internalizing CD63-GFP EVs. CD63-GFP EVs expressing PDFGR-RVG on their surface internalize a high number of primary neurons when compared control (CD63-GFP EVs) at 4- and 12-hours incubation period. The data is compared by one-way ANOVA followed by Sidak's multiple comparisons test (F=8.840). Statistical significance: *p < 0.05 and ****p < 0.0001. [00123] Figure 4 shows engineered EVs significantly reduce mutATXN3 mRNA in vitro. Figure 4A Representation of the packaging cell line overexpressing PDGFR-RVG, hnRNPA2B1 and mirSilencer to produce therapeutic EVs. Lentivirus encoding PDGFR-RVG and hnRNPA2B1 were used to generate a stable cell line (Scale bar 20µm). The same cells were then split to overexpress mirSilencer with and without ExoMotif and mirScramble. Conditioned media were collected to isolate therapeutic EVs by dUC and incubated with various cell models to evaluate in vitro efficacy. Figure 4B Incubation of therapeutic EVs in Dual Luciferase reporter cells: Neuro2A cells overexpressing a dual luciferase construct encoding Firefly Luciferase (FLuc) associated with mutATXN3 under control of PGK promoter and Renilla Luciferase (Rluc) under control of CMV promoter. Figure 4C Luminescence of FLuc mutATXN3 upon EVs incubation: therapeutic EVs carrying mirSilencer with ExoMotif significantly reduce luciferase activity by 34% comparing to the control condition (EVs carrying mirScramble), while EVs with mirSilencer without ExoMotif do not significantly silence Fluc-mutATXN3 mRNA. Results are expressed in arbitrary units and mean ± SEM (N=5). One-sample t-test, column means significantly different than a hypothetical value of 1. Figure 4D Dose dependent effect of therapeutic EVs: therapeutic EVs carrying the mirSilencer showed a dose dependent effect on reducing Fluc-mutATXN3 luciferase activity. Results are expressed as mean ± SEM of arbitrary units (N=3). Data was compared by one-way ANOVA followed by Tukey's multiple comparisons test (F=21.01). Figure 4E Establishment of cerebellar cultures from MJD YAC84.2 pups (P6- P7). Immunostaining at day 15 of primary cerebellar cultures showed positive staining for the neuronal marker MAP2, ATXN3 1H9, and deep cerebellar marker PCP4 under microscopy analysis (scale bar 10μm). Figure 4F Therapeutic EVs downregulate endogenous mutATXN3 mRNA in cerebellar cultures. The first dose of EVs was incubated at day 10 and the second dose at day 12. At day 14, cells were collected and mRNA was analyzed. A significant downregulation of endogenous mutATXN3 of approximately 49% was observed upon incubation with EVs containing the mirSilencer with ExoMotif. EVs carrying mirSilencer without ExoMotif, showed a non-significant tendency to downregulate the levels of mutATXN3 mRNA (approximately 29%). Results are expressed as mean ± SEM of arbitrary units (N=3/6). Data was compared by ordinary one-way ANOVA followed by Tukey's multiple comparisons test (F=4.75). Statistical significance: ns – non significant, *p < 0.05 and **p < 0.01. [00124] Figure 5 shows delivery of mirSilencer to the brain significantly decreases mutATXN3 mRNA in Dual Luminescent MJD mouse model. Figure 5A Generation of a Dual Luminescent MJD mouse model upon intracerebellar injection of LV encoding Dual luciferase reporter (FL/RL) associated with mutATXN3. Figure 5B Co-injection in the cerebellum of LV encoding the dual luciferase MJD reporter and the mirSilencer with ExoMotif or mirScramble. In vivo bioluminescence assessment showed a significant decrease of Fluc-mutATXN3 luminescence by 59% in the mirSilencer condition relative to control (mirScramble). Results are expressed in mean ± SEM of arbitrary units (N=3/4). Data was compared performing unpaired t-test, *p < 0.05. Figure 5C Schematic representation of daily intranasal administration of EVs. Figure 5D Therapeutic EVs carrying mirSilencer with ExoMotif or mirScramble were daily administered intranasally for 1 month in a dose of 2x10^9 EVs/animal/day. Evaluation of mirSilencer distribution throughout the brain upon intranasal administration showed the highest fold change of mirSilencer in the olfactory bulb, followed by the brainstem, cerebellum and the remaining brain. Figure 5E1 Schematic representation of cerebellum processing for RNA and Bioluminescence. Figure 5E2 Levels of mutATXN3 mRNA in the cerebellum homogenates were significantly reduced when mirSilencer with ExoMotif EVs (blue bar) were administered comparing to the scramble condition. Figure 5E3 Dual luciferase assay in cerebellar homogenates showed a significant decrease of mutATXN3- luciferase activity in the EVs carrying mirSilencer with ExoMotif condition (red bar) compared to scramble EVs. Results are expressed in mean ± SEM of arbitrary units (N=6/8). Statistical significance: *p < 0.05 and **p < 0.01. [00125] Figure 6 shows mirSilencer expression levels in cells and EVs. Figure 6A Cell lines encoding mirSilencer with or without the ExoMotif were used to compare the mirSilencer levels between progenitor cells and their derived EVs. Overexpression of hnRNPA2B1 seems to not affect the relative amount of miRNAs in cells. Overexpression of hnRNPA2B1 showed a tendency for the cells to produce EVs enriched with mirSilencer containing the ExoMotif when compared to mirSilencer in the absence of ExoMotif. A relative qPCR quantification was performed and RNU1A1 was used as endogenous control. Results are expressed as mean ± SEM of arbitrary units (N=4). Data was compared by one-way ANOVA followed by Sidak's multiple comparisons test (F=4.336) [00126] Figure 7 shows generation of a stable cell line encoding hnRNPA2B1 and PDGFR-RVG. Figure 7A Cell sorting of double positive cells encoding for hnRNPA2B1 and PDGFR-RVG. HEK293T cells were transduced with lentiviral vectors encoding PDGFR-RVG and mCherry fluorescent protein and hnRNPA2B1 fused with turboGFP fluorescent protein. Double positive cells were sorted by flow cytometry and cultured to generate a stable cell line co-expressing both proteins. [00127] Figure 8 shows dual luciferase reporter system to monitor mutATXN3 mRNA levels. Figure 8A Co-transfection with miRNAs and dual luciferase reporter Fluc-mutATXN3. Plasmids encoding mirScramble and mirSilencer with and without ExoMotif were evaluated in terms of silencing efficacy 48h after transfection in HEK 293T cells. Both mirSilencers were shown to significantly silence Fluc- mutATXN3 in more than 60%. Results are expressed as mean ± SEM of arbitrary units (N=3). Data compared by one-way ANOVA followed by Dunnett's multiple comparisons test (F=61.83). Figure 8B Therapeutic EVs incubated with primary neurons transduced with dual luciferase reporter. Both therapeutic EVs were shown to have efficacy above 60% at downregulating Fluc-mutATXN3. Results are expressed in arbitrary units and mean ± SEM (N=4). Data compared by one-way ANOVA followed by Dunnett's multiple comparisons test (F=8.254). Statistical significance: *p < 0.05, ***p < 0.001 and ns – non significant. [00128] Figure 9 shows intranasal administration of EVs co-expressing CD63-GFP and PDGFR-RVG reach the cerebellum. PBS (control animals) or EVs co-expressing CD63-GFP and PDGFR-RVG (treated animals) were administered twice a day for 2 weeks to wild-type C57BL/6 mice. Animals were sacrificed and brains processed for immunohistochemical staining against GFP (red). Yellow dots represent co- localization of endogenous GFP (from CD63-GFP expressing EVs) and anti-GFP in the lobule 5 of cerebellum. Images were acquired with Zeiss Axio Imager Z2 microscope (Carl Zeiss Microimaging), equipped with a High-Resolution Monochromatic Camera and with Plan-Apochromat 20X/0.8 M27 objective. [00129] Figure 10 shows generation of a dual luciferase MJD reporter mouse. Figure 10A shows LV encoding the dual luciferase construct Fluc-mutATXN3 were intracranially injected into mice striatum. FLuc bioluminescence was observed 10 minutes after intraperitoneal injection of Luciferin, while RLuc was observed 30 seconds after intravenous injection of ViviRen (a coelenterazine analog). [00130] Figure 11: shows in vivo monitorization using bioluminescence. Figure 11A shows monitorization of EVs treatment efficacy in vivo overtime upon bioluminescence evaluation. Bioluminescence evaluation in vivo allowed to monitor the EVs treatment efficacy through intranasal administration. Three different time-points were considered. Time point 0 was performed before the treatment, while time-point 1 was performed 15 days later and time-point 2 performed 30 days after the beginning of the treatment. Results are expressed in arbitrary units and mean ± SEM (N=6/8). [00131] The present disclosure was funded by the European Regional Development Fund through the Regional Operational Program Center 2020, Competitiveness Factors Operational Program (COMPETE 2020) and National Funds through Foundation for Science and Technology (FCT): BrainHealth2020 projects (CENTRO-01–0145-FEDER-000008), ViraVector (CENTRO-01–0145-FEDER-022095), CortaCAGs (PTDC/NEU-NMC/0084/2014|POCI-01–0145-FEDER-016719), SpreadSilencing (POCI-01–0145-FEDER- 029716), POCI-01-0145-FEDER-022122, CancelStem (POCI-01–0145-FEDER-016390), UID/4950/2020, UID/NEU/04539/2019, as well as SynSpread, ESMI and ModelPolyQ under the EU Joint Program— Neurodegenerative Disease Research (JPND), the last two co-funded by the European Union H2020 program, GA No.643417; by the Association Française contre les Myopathies-Téléthon no. 21163, by National Ataxia Foundation (USA), the American Portuguese Biomedical Research Fund (APBRF—no grant number) and the Richard Chin and Lily Lock Machado-Joseph Disease Research Fund (no grant number). D.R.R. was supported by SFRH/BD/132618/2017 and FLAD 2021/CON001/CAN008; K.L. was supported by SFRH/BD/09513/2020. [00132] Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the global (over the whole the sequence) alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (NCBI). Global percentages of similarity and identity may also be determined using one of the methods available in the MatGAT software package (Campanella et al., BMC Bioinformatics.2003 Jul 10; 4:29. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences). Minor manual editing may be performed to optimise alignment between conserved motifs, as would be apparent to a person skilled in the art. The sequence identity values, which are indicated in the present subject matter as a percentage were determined over the entire amino acid sequence, using BLAST with the default parameters. [00133] The disclosure should not be seen in any way restricted to the embodiments described and a person with ordinary skill in the art will foresee many possibilities to modifications thereof. [00134] The above described embodiments are combinable. SEQUENCE LIST SEQ Name Molecule type Qualifier Organism sequence

No 4 construct SEQ ID Exomotif 5 RNA Other RNA synthetic ggaggag No 5 construct GG AC au caa ug CC GG aua CC ugg AU ccc a UA GA ca CA ga UG cu CT gc agc CT AA CT

No 19 construct GTATGCTGtgataggtcccgctgctgctgc GGAGTTTTGGCCACTGACTGACgca gcagccgggacctatcaCAGGACACAAG AA CT gc gc AG TC CT gc gc AA GA CT gc TG CA AT CT gc agc AC TG CT gc gc AA GA ’ 3’; GC-

No 33 construct CTTGCGAAAAATGAAGACCTTTTAC- 3’; SEQ ID mGAPDH Fwrd RNA Other RNA synthetic 5’-TGGAGAAACCTGCCAAGTATGA- ’ ’; C- GA 3’ 3’ ’ 3’ – 3’ ’ 3’ 3’ – 3’ ’ 3’ 3’ –

SEQ ID WO’611_seq_19 Target RNA Other RNA Homo accuggaacgaguguuagaagca No 56 sequence at exon 8 sapiens (rs1048755) (G) ’ ’ 3’ ’ 3’ 3’ – 3’ ’ g – ’ cau RN GF GR LF IEI RK CC uc Cu

REFERENCES 1) Alimohammadi, H., & Silver, W. L. (2000). Evidence for Nicotinic Acetylcholine Receptors on Nasal Trigeminal Nerve Endings of the Rat. Chemical Senses, 25(1), 61–66. https://doi.org/10.1093/chemse/25.1.61 2) Alvarez-Erviti, L., Seow, Y., Yin, H., Betts, C., Lakhal, S., & Wood, M. J. A. (2011). Delivery of siRNA to the mouse brain by systemic injection of targeted exosomes. Nature Biotechnology, 29(4), 341–345. https://doi.org/10.1038/nbt.1807 3) Alves, S., Hassig, R., Almeida, P. De, Lima, M. C. P. De, & De, N. (2010). Silencing ataxin-3 mitigates degeneration in a rat model of Machado – Joseph disease^: no role for.19(12), 2380–2394. https://doi.org/10.1093/hmg/ddq111 4) Alves, S., Hassig, R., Brouillet, E., Lima, M. C. P. De, & Hantraye, P. (2008). Allele-Specific RNA Silencing of Mutant Ataxin-3 Mediates Neuroprotection in a Rat Model of Machado- Joseph Disease. 3(10). https://doi.org/10.1371/journal.pone.0003341 5) Alves, S., Régulier, E., Nascimento-Ferreira, I., Hassig, R., Dufour, N., Koeppen, A., Carvalho, A. L., Simões, S., De Lima, M. C. P., Brouillet, E., Gould, V. C., Déglon, N., & De Almeida, L. P. (2008). Striatal and nigral pathology in a lentiviral rat model of Machado-Joseph disease. Human Molecular Genetics, 17(14), 2071–2083. https://doi.org/10.1093/hmg/ddn106 ) Arora, S., Layek, B., & Singh, J. (2021). Design and Validation of Liposomal ApoE2 Gene Delivery System to Evade Blood–Brain Barrier for Effective Treatment of Alzheimer’s Disease. Molecular Pharmaceutics, 18(2), 714–725. https://doi.org/10.1021/acs.molpharmaceut.0c00461 ) Asadirad, A., Baghaei, K., Hashemi, S. M., Dehnavi, S., Ghanbarian, H., Mortaz, E., Anissian, A., Asadzadeh Aghdaei, H., & Amani, D. (2022). Dendritic cell immunotherapy with miR-155 enriched tumor-derived exosome suppressed cancer growth and induced antitumor immune responses in murine model of colorectal cancer induced by CT26 cell line. International Immunopharmacology, 104, 108493. https://doi.org/10.1016/j.intimp.2021.108493 ) Bartel, D. P. (2009). MicroRNAs: Target Recognition and Regulatory Functions. Cell, 136(2), 215–233. https://doi.org/https://doi.org/10.1016/j.cell.2009.01.002 ) Bathla, G., & Hegde, A. N. (2013). The trigeminal nerve: An illustrated review of its imaging anatomy and pathology. Clinical Radiology, 68(2), 203–213. https://doi.org/https://doi.org/10.1016/j.crad.2012.05.019 0) Betzer, O., Perets, N., Angel, A., Motiei, M., Sadan, T., Yadid, G., Offen, D., & Popovtzer, R. (2017). In Vivo Neuroimaging of Exosomes Using Gold Nanoparticles. ACS Nano, 11(11), 10883–10893. https://doi.org/10.1021/acsnano.7b04495 1) Bicker, J., Fortuna, A., Alves, G., & Falcão, A. (2020). Nose-to-brain delivery of natural compounds for the treatment of central nervous system disorders. Current Pharmaceutical Design, 26(5), 594–619. 2) Carmona, V., Cunha-Santos, J., Onofre, I., Simões, A. T., Vijayakumar, U., Davidson, B. L., & Pereira de Almeida, L. (2017). Unravelling Endogenous MicroRNA System Dysfunction as a New Pathophysiological Mechanism in Machado- Joseph Disease. Molecular Therapy, 25(4), 1038–1055. https://doi.org/https://doi.org/10.1016/j.ymthe.2017.01.0213) Carvalho, L. A., & Tannous, B. A. (2019). Olfactory ensheathing cells travel their natural nasal pathway to deliver therapeutics to brain tumors. Oncotarget, 10(43), 4351–4353. https://doi.org/10.18632/oncotarget.27043 4) Carvalho, L. A., Teng, J., Fleming, R. L., Tabet, E. I., Zinter, M., De Melo Reis, R. A., & Tannous, B. A. (2019). Olfactory ensheathing cells: A trojan horse for glioma gene therapy. Journal of the National Cancer Institute, 111(3), 283–291. https://doi.org/10.1093/jnci/djy138 5) Castell, N., Stover, M., Guerrero-martin, S., & Richardson, R. (2021). Pharmacokinetics and biodistribution of extracellular vesicles administered intravenously and intranasally to Macaca nemestrina. 6) Cemal, C. K., Carroll, C. J., Lawrence, L., Lowrie, M. B., Ruddle, P., Al-Mahdawi, S., King, R. H. M., Pook, M. A., Huxley, C., & Chamberlain, S. (2002). YAC transgenic mice carrying pathological alleles of the MJD1 locus exhibit a mild and slowly progressive cerebellar deficit. Human Molecular Genetics, 11(9), 1075–1094. https://doi.org/10.1093/hmg/11.9.1075 7) Chen, Y., Lin, Y., Chen, P., & Chen, P. (n.d.). miR-6780-5p-Enriched Exosomes Derived From Butylidenephthalide-Pre- Conditioned Human Olfactory Ensheathing Cells Via Autophagy Improve Motor Coordination and Balance in a SCA3 / MJD Mouse Model. 8) Chung, E. P., Cotter, J. D., Prakapenka, A. V., Cook, R. L., Diperna, D. M., & Sirianni, R. W. (2020). Targeting small molecule delivery to the brain and spinal cord via intranasal administration of rabies virus glycoprotein (RVG29)- modified PLGA nanoparticles. Pharmaceutics, 12(2), 1–16. https://doi.org/10.3390/pharmaceutics12020093 ) Conceição, M., Costa, P., Conceiç, M., Hirai, H., Pereira, L., & Almeida, D. (2016). Biomaterials Intravenous administration of brain-targeted stable nucleic acid lipid particles alleviates Machado-Joseph disease neurological phenotype.82, 124–137. https://doi.org/10.1016/j.biomaterials.2015.12.021 ) Dar, G. H., Mendes, C. C., Kuan, W. L., Speciale, A. A., Conceição, M., Görgens, A., Uliyakina, I., Lobo, M.J., Lim, W. F., EL Andaloussi, S., Mäger, I., Roberts, T. C., Barker, R. A., Goberdhan, D. C. I., Wilson, C., & Wood, M. J. A. (2021). GAPDH controls extracellular vesicle biogenesis and enhances the therapeutic potential of EV mediated siRNA delivery to the brain. Nature Communications, 12(1). https://doi.org/10.1038/s41467-021-27056-3 ) de Almeida, L. P., Zala, D., Aebischer, P., & Déglon, N. (2001). Neuroprotective effect of a CNTF-expressing lentiviral vector in the quinolinic acid rat model of Huntington’s disease. Neurobiology of Disease, 8(3), 433–446. https://doi.org/10.1006/nbdi.2001.0388 ) dos Santos Rodrigues, B., Arora, S., Kanekiyo, T., & Singh, J. (2020). Efficient neuronal targeting and transfection using RVG and transferrin-conjugated liposomes. Brain Research, 1734, 146738. ) Duarte-Neves, J., Cavadas, C., & Pereira de Almeida, L. (2021). Neuropeptide Y (NPY) intranasal delivery alleviates Machado–Joseph disease. Scientific Reports, 11(1), 1–9. https://doi.org/10.1038/s41598-021-82339-5 ) El-Andaloussi, S., Lee, Y., Lakhal-Littleton, S., Li, J., Seow, Y., Gardiner, C., Alvarez-Erviti, L., Sargent, I. L., & Wood, M. J. A. (2012). Exosome-mediated delivery of siRNA in vitro and in vivo. Nature Protocols, 7(12), 2112–2126. https://doi.org/10.1038/nprot.2012.131 ) Evers, M. M., & Toonen, L. J. A. (2014). Ataxin-3 Protein and RNA Toxicity in Spinocerebellar Ataxia Type 3^: Current Insights and Emerging Therapeutic Strategies.1513–1531. https://doi.org/10.1007/s12035-013-8596-2 ) Gabathuler, R. (2009). Blood-brain barrier transport of drugs for the treatment of brain diseases. CNS & Neurological Disorders Drug Targets, 8(3), 195–204. https://doi.org/10.2174/187152709788680652 ) Gao, X., Ran, N., Dong, X., Zuo, B., Yang, R., Zhou, Q., Moulton, H. M., Seow, Y., & Yin, H. (2018). Anchor peptide captures , targets , and loads exosomes of diverse origins for diagnostics and therapy.0195(June). ) Garcia-Martin, R., Wang, G., Brandão, B. B., Zanotto, T. M., Shah, S., Kumar Patel, S., Schilling, B., & Kahn, C. R. (2022). MicroRNA sequence codes for small extracellular vesicle release and cellular retention. Nature, 601(7893), 446–451. https://doi.org/10.1038/s41586-021-04234-3 ) Gonçalves, J., Bicker, J., Gouveia, F., Liberal, J., Oliveira, R. C., Alves, G., Falcão, A., & Fortuna, A. (2019). Nose-to-brain delivery of levetiracetam after intranasal administration to mice. International Journal of Pharmaceutics, 564, 329– 339. ) György, B., Fitzpatrick, Z., Crommentuijn, M. H. W., Mu, D., & Maguire, C. A. (2014). Naturally enveloped AAV vectors for shielding neutralizing antibodies and robust gene delivery invivo. Biomaterials, 35(26), 7598–7609. https://doi.org/10.1016/j.biomaterials.2014.05.032 ) Hung, M. E., & Leonard, J. N. (2015). Stabilization of exosome-targeting peptides via engineered glycosylation. Journal of Biological Chemistry, 290(13), 8166–8172. https://doi.org/10.1074/jbc.M114.621383 ) Kamerkar, S., Lebleu, V. S., Sugimoto, H., Yang, S., Carolina, F., Melo, S. A., Lee, J. J., & Kalluri, R. (2017). HHS Public Access.546(7659), 498–503. https://doi.org/10.1038/nature22341.Exosomes ) Kawaguchi, Y., Okamoto, T., Taniwaki, M., Aizawa, M., Inoue, M., Katayama, S., Kawakami, H., Nakamura, S., Nishimura, M., & Akiguchi, I. (1994). CAG expansions in a novel gene for Machado-Joseph disease at chromosome 14q32.1. Nature Genetics, 8(3), 221–228. https://doi.org/10.1038/ng1194-221 ) Kim, S. S., Ye, C., Kumar, P., Chiu, I., Subramanya, S., Wu, H., Shankar, P., & Manjunath, N. (2010). Targeted delivery of sirna to macrophages for anti-inflammatory treatment. Molecular Therapy, 18(5), 795 993–1001. https://doi.org/10.1038/mt.2010.27 ) Klockgether, T, Skalej, M., Wedekind, D., Luft, A. R., Welte, D., Schulz, J. B., Abele, M., Bürk, K., Laccone, F., Brice, A., & Dichgans, J. (1998). Autosomal dominant cerebellar ataxia type I. MRI-based volumetry of posterior fossa structures and basal ganglia in spinocerebellar ataxia types 1, 2 and 3. Brain^: A Journal of Neurology, 121 ( Pt 9, 1687–1693. https://doi.org/10.1093/brain/121.9.1687 ) Klockgether, Thomas, Mariotti, C., & Paulson, H. L. (2019). Spinocerebellar ataxia. Nature Reviews Disease Primers, 0123456789, 1–21. https://doi.org/10.1038/s41572-019-0074-3 ) Kojima, R., Bojar, D., Rizzi, G., Hamri, G. C. El, El-Baba, M. D., Saxena, P., Ausländer, S., Tan, K. R., & Fussenegger, M. (2018). Designer exosomes produced by implanted cells intracerebrally deliver therapeutic cargo for Parkinson’s disease treatment. Nature Communications, 9(1). https://doi.org/10.1038/s41467-018-03733-8 ) Kooijmans, S. A. A., Stremersch, S., Braeckmans, K., Smedt, S. C. De, Hendrix, A., Wood, M. J. A., Schiffelers, R. M., Raemdonck, K., & Vader, P. (2013). Electroporation-induced siRNA precipitation obscures the ef fi ciency of siRNA loading into extracellular vesicles. Journal of Controlled Release, 172(1), 229–238. https://doi.org/10.1016/j.jconrel.2013.08.014 ) Kumar, P., Wu, H., McBride, J. L., Jung, K.-E., Hee Kim, M., Davidson, B. L., Kyung Lee, S., Shankar, P., & Manjunath, N. (2007). Transvascular delivery of small interfering RNA to the central nervous system. Nature, 448(7149), 39–43. https://doi.org/10.1038/nature05901 ) Li, Z., Zhou, X., Wei, M., Gao, X., Zhao, L., Shi, R., Sun, W., Duan, Y., Yang, G., & Yuan, L. (2019). In Vitro and in Vivo RNA Inhibition by CD9-HuR Functionalized Exosomes Encapsulated with miRNA or CRISPR/dCas9. Nano Letters, 19(1), 19–28. https://doi.org/10.1021/acs.nanolett.8b02689 ) Liu, L., Chang, G.-Q., Jiao, Y. Q., & Simon, S. A. (1998). Neuronal nicotinic acetylcholine receptors in rat trigeminal ganglia. Brain Research, 809(2), 238–245. https://doi.org/https://doi.org/10.1016/S0006-8188993(98)00862-2) Losurdo, M., Pedrazzoli, M., Agostino, C. D., Elia, C. A., Massenzio, F., Lonati, E., Mauri, M., Rizzi, L., Molteni, L., Bresciani, E., Dander, E., Amico, G. D., Bulbarelli, A., Torsello, A., Coco, S., & Buffelli, M. (2020). Intranasal delivery of mesenchymal stem cell-derived extracellular vesicles exerts immunomodulatory and neuroprotective effects in a 3xTg model of Alzheimer ’ s disease. April, 1–17. https://doi.org/10.1002/sctm.19-0327 ) Maguire, C. A., Balaj, L., Sivaraman, S., Crommentuijn, M. H. W., Ericsson, M., Mincheva-Nilsson, L., Baranov, V., Gianni, D., Tannous, B. A., Sena-Esteves, M., Breakefield, X. O., & Skog, J. (2012). Microvesicle-associated AAV vector as a novel gene delivery system. Molecular Therapy^: The Journal of the American Society of Gene Therapy, 20(5), 960–971. https://doi.org/10.1038/mt.2011.303 ) Mahjoum, S., Rufino-ramos, D., & Broekman, M. L. D. (2021). Living Proof of Activity of Extracellular Vesicles in the Central Nervous System. ) Martier, R., Sogorb-Gonzalez, M., Stricker-Shaver, J., Hübener-Schmid, J., Keskin, S., Klima, J., Toonen, L. J., Juhas, S., Juhasova, J., Ellederova, Z., Motlik, J., Haas, E., van Deventer, S., Konstantinova, P., Nguyen, H. P., & Evers, M. M. (2019). Development of an AAV-Based MicroRNA Gene Therapy to Treat Machado-Joseph Disease. Molecular Therapy - Methods and Clinical Development, 15(December), 343–358. https://doi.org/10.1016/j.omtm.2019.10.008 ) Maruyama, H., Nakamura, S., Matsuyama, Z., Sakai, T., Doyu, M., Sobue, G., Seto, M., Tsujihata, M., Oh-i, T., & Nishio, T. (1995). Molecular features of the CAG repeats and clinical manifestation of Machado- Joseph disease. Human Molecular Genetics, 4(5), 807–812. https://doi.org/10.1093/hmg/4.5.807 ) Moore, L. R., Keller, L., Bushart, D. D., Delatorre, R. G., Li, D., Mcloughlin, H. S., Costa, C., Shakkottai, V. ) 839 G., Smith, G. D., & Paulson, H. L. (2019). Antisense oligonucleotide therapy rescues aggresome formation in a novel spinocerebellar ataxia type 3 human embryonic stem cell line. Stem Cell Research, 39(July), 101504. https://doi.org/10.1016/j.scr.2019.101504 ) Moore, L. R., Rajpal, G., Dillingham, I. T., Qutob, M., Blumenstein, K. G., Gattis, D., Hung, G., Kordasiewicz, H. B., Paulson, H. L., & McLoughlin, H. S. (2017). Evaluation of Antisense Oligonucleotides Targeting ATXN3 in SCA3 Mouse Models. Molecular Therapy. Nucleic Acids, 7, 200–210. https://doi.org/10.1016/j.omtn.2017.04.005 ) Nobre, R. J., Duarte, S. P., Nobre, R. J., Lobo, D. D., Henriques, C., Silva, A. C., Lopes, M. M., Mariet, F., Schwarz, L. K., Baatje, M. S., Ferreira, V., Valle, A., & Almeida, L. P. De. (2021). MiRNA-Mediated Knockdown of ATXN3 Alleviates. 00(00), 1–12. https://doi.org/10.1089/nat.2021.0020 ) Nóbrega, C., Codêsso, J. M., Mendonça, L., & Pereira de Almeida, L. (2019). RNA Interference Therapy for Machado- Joseph Disease: Long-Term Safety Profile of Lentiviral Vectors Encoding Short Hairpin RNAs Targeting Mutant Ataxin- 3. Human Gene Therapy, 30(7), 841–854. https://doi.org/10.1089/hum.2018.157 ) Nóbrega, C., Nascimento-Ferreira, I., Onofre, I., Albuquerque, D., Déglon, N., & de Almeida, L. P. (2014). RNA interference mitigates motor and neuropathological deficits in a cerebellar mouse model of Machado-Joseph disease. PloS One, 9(8), e100086. https://doi.org/10.1371/journal.pone.0100086 ) Nóbrega, C., Nascimento-Ferreira, I., Onofre, I., Albuquerque, D., Hirai, H., Déglon, N., & de Almeida, L. P. (2013). Silencing mutant ataxin-3 rescues motor deficits and neuropathology in Machado-Joseph disease transgenic mice. PloS One, 8(1), e52396. https://doi.org/10.1371/journal.pone.0052396 ) O’Brien, K., Breyne, K., Ughetto, S., Laurent, L. C., & Breakefield, X. O. (2020). RNA delivery by extracellular vesicles in mammalian cells and its applications. Nature Reviews Molecular Cell Biology, 21(10), 585–606. https://doi.org/10.1038/s41580-020-0251-y ) O’Brien, K., Ughetto, S., Mahjoum, S., Nair, A. V., & Breakefield, X. O. (2022). Uptake, functionality, and re-release of extracellular vesicle-encapsulated cargo. Cell Reports, 39(2), 110651. https://doi.org/10.1016/j.celrep.2022.110651) Parr-Brownlie, L. C., Bosch-Bouju, C., Schoderboeck, L., Sizemore, R. J., Abraham, W. C., & Hughes, S. M. (2015). Lentiviral vectors as tools to understand central nervous system biology in mammalian model organisms. Frontiers in Molecular Neuroscience, 8(MAY), 1–12. https://doi.org/10.3389/fnmol.2015.00014 ) Patel, S., Schmidt, K. F., Farhoud, M., Zi, T., Chul, S., Dooley, K., Kentala, D., Dobson, H., Economides, K., & Williams, D. E. (2022). In vivo tracking of [ 89 Zr ] Zr-labeled engineered extracellular vesicles by PET reveals organ-specific biodistribution based upon the route of administration. Nuclear Medicine and Biology, 112–113(June), 20–30. https://doi.org/10.1016/j.nucmedbio.2022.06.004 ) Pegtel, D. M., Peferoen, L., & Amor, S. (2014). Extracellular vesicles as modulators of cell-to-cell communication in the healthy and diseased brain. Philosophical Transactions of the Royal Society B: Biological Sciences, 369(1652), 20130516. https://doi.org/10.1098/rstb.2013.0516 ) Perets, N., Betzer, O., Shapira, R., Brenstein, S., Angel, A., Sadan, T., Ashery, U., Popovtzer, R., & Offen, D. (2019). Golden Exosomes Selectively Target Brain Pathologies in Neurodegenerative and Neurodevelopmental Disorders. Nano Letters, 19(6), 3422–3431. https://doi.org/10.1021/acs.nanolett.8b04148 ) Pinkham, K., Park, D. J., Hashemiaghdam, A., Kirov, A. B., Adam, I., Rosiak, K., da Hora, C. C., Teng, J., Cheah, P. S., Carvalho, L., Ganguli-Indra, G., Kelly, A., Indra, A. K., & Badr, C. E. (2019). Stearoyl CoA Desaturase Is Essential for Regulation of Endoplasmic Reticulum Homeostasis and Tumor Growth in Glioblastoma Cancer Stem Cells. Stem Cell Reports, 12(4), 712–727. https://doi.org/10.1016/j.stemcr.2019.02.012 ) Pulford, B., Reim, N., Bell, A., Veatch, J., Forster, G., Bender, H., Meyerett, C., Hafeman, S., Michel, B., Johnson, T., Wyckoff, A. C., Miele, G., Julius, C., Kranich, J., Schenkel, A., Dow, S., & Zabel, M. D. (2010). Liposome-siRNA-Peptide Complexes Cross the Blood-Brain Barrier and Significantly Decrease PrPC on Neuronal Cells and PrPRES in Infected Cell Cultures. PLOS ONE, 5(6), e11085. https://doi.org/10.1371/journal.pone.0011085 ) Reshke, R., Taylor, J. A., Savard, A., Guo, H., Rhym, L. H., Kowalski, P. S., Trung, M. T., Campbell, C., Little, W., & Anderson, D. G. (n.d.). RNA by packaging it in extracellular vesicles via a pre-microRNA backbone. Nature Biomedical Engineering. https://doi.org/10.1038/s41551-019-0502-4 ) Rodríguez-Lebrón, E., Costa, M. do C., Luna-Cancalon, K., Peron, T. M., Fischer, S., Boudreau, R. L., Davidson, B. L., & Paulson, H. L. (2013). Silencing mutant ATXN3 expression resolves molecular phenotypes in SCA3 transgenic mice. Molecular Therapy^: The Journal of the American Society of Gene Therapy, 21(10), 1909–1918. https://doi.org/10.1038/mt.2013.152 ) Rufino-Ramos, D., Albuquerque, P. R., Carmona, V., Perfeito, R., Nobre, R. J., & Pereira de Almeida, L. (2017). Extracellular vesicles: Novel promising delivery systems for therapy of brain diseases. Journal of Controlled Release, 262(June), 247–258. https://doi.org/10.1016/j.jconrel.2017.07.001 ) Santangelo, L., Giurato, G., Cicchini, C., Alonzi, T., Weisz, A., Tripodi, M., Santangelo, L., Giurato, G., Cicchini, C., Montaldo, C., Mancone, C., & Tarallo, R. (2016). The RNA-Binding Protein SYNCRIP Is a Component of the Hepatocyte Exosomal Machinery Controlling MicroRNA Sorting Article The RNA-Binding Protein SYNCRIP Is a Component of the Hepatocyte Exosomal Machinery Controlling MicroRNA Sorting. CellReports, 17(3), 799–808. https://doi.org/10.1016/j.celrep.2016.09.031 ) Schöls, L., Bauer, P., Schmidt, T., Schulte, T., & Riess, O. (2004). Autosomal dominant cerebellar ataxias: clinical features, genetics, and pathogenesis. The Lancet Neurology, 3(5), 291–304. https://doi.org/10.1016/S1474- 4422(04)00737-9 ) Sequeiros, J., Silveira, I., Maciel, P., Coutinho, P., Manaia, A., Gaspar, C., Burlet, P., Loureiro, L., Guimarães, J., & Tanaka, H. (1994). Genetic linkage studies of Machado-Joseph disease with chromosome 14q STRPs in 16 Portuguese- Azorean kindreds. Genomics, 21(3), 645–648. https://doi.org/10.1006/geno.1994.1327 ) Serralheiro, A., Alves, G., Fortuna, A., & Falcão, A. (2014). Intranasal administration of carbamazepine to mice: a direct delivery pathway for brain targeting. European Journal of Pharmaceutical Sciences, 60, 32–39. ) Shurtleff, M. J., Temoche-Diaz, M. M., Karfilis, K. V, Ri, S., & Schekman, R. (2016). Y-box protein 1 is required to sort microRNAs into exosomes in cells and in a cell-free reaction. ELife, 5, e19276. https://doi.org/10.7554/eLife.19276) Shurtleff, M. J., Yao, J., Qin, Y., Nottingham, R. M., & Temoche-diaz, M. M. (2017). Broad role for YBX1 in defining the small noncoding RNA composition of exosomes.8987–8995. https://doi.org/10.1073/pnas.1712108114 ) Sogorb-gonzalez, M., Vendrell-tornero, C., Snapper, J., Stam, A., Keskin, S., Miniarikova, J., Spronck, E. A., Haan, M. De, Nieuwland, R., Konstantinova, P., Deventer, S. J. Van, Evers, M. M., & Valle, A. (2021). B RAIN AIN COMMUNICATIONS Secreted therapeutics^: monitoring durability of microRNA-based gene therapies in the central nervous system.1–16. https://doi.org/10.1093/braincomms/fcab054 ) Song, L., Luan, B., Xu, Q., Shi, R., & Wang, X. (2022). microRNA-155-3p delivered by M2 macrophages- derived exosomes enhances the progression of medulloblastoma through regulation of WDR82. Journal of Translational Medicine, 20(1), 13. https://doi.org/10.1186/s12967-021-03156-y ) Sui, G., Soohoo, C., Affar, E. B., Gay, F., Shi, Y., Forrester, W. C., & Shi, Y. (2002). A DNA vector-based RNAi technology to suppress gene expression in mammalian cells. Proceedings of the National Academy of Sciences, 99(8), 5515–5520.) Takiyama, Y., Nishizawa, M., Tanaka, H., Kawashima, S., Sakamoto, H., Karube, Y., Shimazaki, H., Soutome, M., Endo, K., Ohta, S., Kagawa, Y., Kanazawa, I., Mizuno, Y., Yoshida, M., Yuasa, T., Horikawa, Y., Oyanagi, K., Nagai, H., Kondo, T., … Tsuji, S. (1993). The gene for Machado–Joseph disease maps to human chromosome 14q. Nature Genetics, 4(3), 300–304. https://doi.org/10.1038/ng0793-300 ) Temoche-Diaz, M. M., Shurtleff, M. J., Nottingham, R. M., Yao, J., Fadadu, R. P., Lambowitz, A. M., & Schekman, R. (2019). Distinct mechanisms of microrna sorting into cancer cell-derived extracellular vesicle subtypes. ELife, 8, 1–34. https://doi.org/10.7554/eLife.47544 ) Théry, C., Witwer, K. W., Aikawa, E., Alcaraz, M. J., Anderson, J. D., Andriantsitohaina, R., Antoniou, A., Arab, T., Archer, F., Atkin-Smith, G. K., Ayre, D. C., Bach, J. M., Bachurski, D., Baharvand, H., Balaj, L., Baldacchino, S., Bauer, N. N., Baxter, A. A., Bebawy, M., … Zuba-Surma, E. K. (2018). Minimal information for studies of extracellular vesicles 2018 (MISEV2018): a position statement of the International Society for Extracellular Vesicles and update of the MISEV2014 guidelines. Journal of Extracellular Vesicles, 7(1). https://doi.org/10.1080/20013078.2018.1535750) Thorne, R. G., Pronk, G. J., Padmanabhan, V., & Frey, W. H. (2004). Delivery of insulin-like growth factor-I to the rat brain and spinal cord along olfactory and trigeminal pathways following intranasal administration. Neuroscience, 127(2), 481–496. https://doi.org/10.1016/j.neuroscience.2004.05.029 ) Tomatis, F., Lino, M. M., Sim, S., Vivien, D., Sobrino, T., & Ferreira, L. (2021). Engineered extracellular vesicles as brain therapeutics.338(August), 472–485. https://doi.org/10.1016/j.jconrel.2021.08.037 ) Vaillancourt, M., Hubert, A., Subra, C., Boucher, J., Bazié, W. W., Vitry, J., Berrazouane, S., Routy, J.-P., Trottier, S., Tremblay, C., Jenabian, M.-A., Benmoussa, A., Provost, P., Tessier, P. A., & Gilbert, C. (2021). Velocity Gradient Separation Reveals a New Extracellular Vesicle Population Enriched in miR-155 and Mitochondrial DNA. Pathogens (Basel, Switzerland), 10(5). https://doi.org/10.3390/pathogens10050526 ) van Niel, G., Carter, D. R. F., Clayton, A., Lambert, D. W., Raposo, G., & Vader, P. (2022). Challenges and directions in studying cell–cell communication by extracellular vesicles. Nature Reviews Molecular Cell Biology, 23(5), 369–382. https://doi.org/10.1038/s41580-022-00460-3 ) Villarroya-Beltri, C., Gutiérrez-Vázquez, C., Sánchez-Cabo, F., Pérez-Hernández, D., Vázquez, J., Martin-Cofreces, N., Martinez-Herrera, D. J., Pascual-Montano, A., Mittelbrunn, M., & Sánchez-Madrid, F. (2013). Sumoylated hnRNPA2B1 controls the sorting of miRNAs into exosomes through binding to specific motifs. Nature Communications, 4(1), 2980. https://doi.org/10.1038/ncomms3980 ) You, H. J., Fang, S. Bin, Wu, T. T., Zhang, H., Feng, Y. K., Li, X. J., Yang, H. H., Li, G., Li, X. H., Wu, C., Fu, Q. L., & Pei, Z. (2020). Mesenchymal stem cell-derived exosomes improve motor function and attenuate neuropathology in a mouse model of Machado-Joseph disease. Stem Cell Research and Therapy, 11(1), 1–11. https://doi.org/10.1186/s13287- 020-01727-2 ) Zadran, S., Akopian, G., Zadran, H., Walsh, J., & Baudry, M. (2013). RVG-Mediated Calpain2 Gene Silencing in the Brain Impairs Learning and Memory. NeuroMolecular Medicine, 15(1), 74–81. https://doi.org/10.1007/s12017-012-8196-8) Zhang, L., Wu, T., Shan, Y., Li, G., Ni, X., Chen, X., Hu, X., Lin, L., Li, Y., Guan, Y., Gao, J., Chen, D., Zhang, Y., Pei, Z., & Chen, X. (2021). Therapeutic reversal of Huntington’s disease by in vivo self-assembled siRNAs. Brain, 144(11), 3421– 3435. https://doi.org/10.1093/brain/awab354 ) Zhuang, X., Xiang, X., Grizzle, W., Sun, D., Zhang, S., Axtell, R. C., Ju, S., Mu, J., Zhang, L., Steinman, L., Miller, D., & Zhang, H. G. (2011). Treatment of brain inflammatory diseases by delivering exosome encapsulated anti-inflammatory drugs from the nasal region to the brain. Molecular Therapy, 19(10), 976 1769–1779. https://doi.org/10.1038/mt.2011.164

Claims

C L A I M S 1. Cellular by-product nanoparticle comprising a miRNA sequence comprising a mirSilencer sequence and an ExoMotif sequence; wherein the mirSilencer is a miRNA-based silencing sequence targeting mutATXN3 mRNA; wherein the ExoMotif sequence comprises at least a sequence 90% identical to the sequences of the following list: SEQ ID No 1; SEQ ID No 2, SEQ ID No 3, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or mixtures thereof.

2. The nanoparticle according to the previous claim wherein the ExoMotif sequence comprises at least a sequence 95% identical to the sequences of the following list: SEQ ID No 1; SEQ ID No 2, SEQ ID No 3, SEQ ID No 4, SEQ ID No 5, SEQ ID No 6 or mixtures thereof; preferably 91% identical, 92% identical, 93% identical, 94% identical, 95% identical, 96% identical, 97% identical, 98% identical, 99% identical or identical.

3. The nanoparticle according to the previous claim, wherein the mirSilencer is a miRNA-based silencing sequence targeting mutATXN3 mRNA.

4. The nanoparticle according to any of the previous claims, wherein the miRNA sequence comprises a sequence for a heterogeneous ribonucleoprotein, preferably A2/B1 RNA-binding protein.

5. The nanoparticle according to any of the previous claims, wherein the extracellular vesicle comprises at its surface a neurotropic protein moiety, in particular a glycoprotein surface moiety.

6. The nanoparticle according to any of the previous claims, wherein said glycoprotein is a rabies virus glycoprotein surface moiety, in particular wherein the surface moiety is tethered to Platelet- Derived Growth Factor Receptor.

7. The nanoparticle according to any of the previous claims, wherein the miRNA sequence comprising a mirSilencer sequence and an ExoMotif sequence is selected from the following list: SEQ ID No 19, SEQ ID No 20, SEQ ID No 21, SEQ ID No 22, SEQ ID No 23, SEQ ID No 24.

8. The nanoparticle according to any of the previous claims, wherein the ExoMotif and the mirSilencer are embedded in an miRNA sequence selected from: miR-155 (SEQ ID No 10), mir-575 (SEQ ID No 11), mir125a-3p (SEQ ID No 12), mir-198 (SEQ ID No 13), mir-451 (SEQ ID No 14), mir-601 (SEQ ID No 15), mir-887 (SEQ ID No 16), preferably miR-155 (SEQ ID No 10), miR-451 (SEQ ID No 14) or miR- 601 (SEQ ID No 15), more preferably miR-155 (SEQ ID No 10).

9. The nanoparticle according to any of the previous claims, for use in medicine or veterinary.

10. The nanoparticle according to any of the previous claims, for use in the treatment of any condition susceptible of being improved or prevented by reducing mutATXN3 mRNA levels.

11. The nanoparticle according to any of the previous claims, for use in the therapy, treatment, or prevention of neurodegenerative diseases, preferably CAG trinucleotide-repeat neurodegenerative disease.

12. The nanoparticle according to the previous claim, wherein the CAG trinucleotide-repeat neurodegenerative disease is Machado-Joseph disease/Spinocerebellar Ataxia type 3 (MJD/SCA3).

13. The nanoparticle according to any of the previous claims wherein the nanoparticle is an extracellular vesicle, extracellular-like vesicle, exomer, or supermere.

14. The nanoparticle according to the previous claim wherein the extracellular vesicle is an exosome or microvesicle.

15. The nanoparticle according to any of the previous claims wherein the size of the nanoparticle ranges from 50 to 110 nm.

16. A vector comprising a miRNA sequence comprising a mirSilencer sequence as described in any of the previous claims and an ExoMotif sequence as described in any of the previous claims.

17. A cell line for obtaining the nanoparticle according to any of the previous claims 1-15 comprising the vector described in the previous claim.

18. Pharmaceutical composition comprising the nanoaprticle according to any of the previous claims 1- 15 for use in medicine or veterinary.

19. Pharmaceutical composition according to the previous claim, for use in the treatment of any condition susceptible of being improved or prevented by reducing mutATXN3 mRNA levels.

20. Pharmaceutical composition according to any of the previous claims 18-19, for use in the therapy, treatment, or prevention of neurodegenerative diseases, preferably CAG trinucleotide-repeat neurodegenerative disease.

21. Pharmaceutical composition according to any of the previous claims 18-20, wherein the CAG trinucleotide-repeat neurodegenerative disease is Machado-Joseph disease/Spinocerebellar Ataxia type 3 (MJD/SCA3).

22. The nanoparticle or the pharmaceutical composition described in any of the previous claims for use in therapy, treatment, or prevention of a neurodegenerative disease in a patient.

23. The nanoparticle or the pharmaceutical composition described in any of the previous claims for the manufacture of a medicament of a neurodegenerative disease.

24. A method for treating or preventing a neurodegenerative disease in a subject wherein the method comprises administering the nanoparticle or the pharmaceutical composition described in any of the previous claims to the subject.