WO2024083171A1 - Composé lipidique et composition de nanoparticules lipidiques - Google Patents

Composé lipidique et composition de nanoparticules lipidiques Download PDF

Info

Publication number
WO2024083171A1
WO2024083171A1 PCT/CN2023/125314 CN2023125314W WO2024083171A1 WO 2024083171 A1 WO2024083171 A1 WO 2024083171A1 CN 2023125314 W CN2023125314 W CN 2023125314W WO 2024083171 A1 WO2024083171 A1 WO 2024083171A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
alkenyl
alkynyl
nucleic acid
lipid
Prior art date
Application number
PCT/CN2023/125314
Other languages
English (en)
Chinese (zh)
Inventor
王秀莲
英博
Original Assignee
苏州艾博生物科技有限公司
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 苏州艾博生物科技有限公司 filed Critical 苏州艾博生物科技有限公司
Publication of WO2024083171A1 publication Critical patent/WO2024083171A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/16—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms
    • C07C233/17—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • C07C233/18—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to a hydrogen atom or to a carbon atom of an acyclic saturated carbon skeleton

Definitions

  • the present invention generally relates to a lipid compound that can be used to combine with other lipid components (e.g., neutral lipids, cholesterol and polymer-conjugated lipids) to form lipid nanoparticles for delivering therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked (LNA), peptide nucleic acid (PNA) and morpholino oligonucleotides) intracellularly and extracellularly for therapeutic or preventive purposes including vaccination.
  • therapeutic agents e.g., nucleic acid molecules, including nucleic acid mimetics such as locked (LNA), peptide nucleic acid (PNA) and morpholino oligonucleotides
  • nucleic acids have the potential to revolutionize vaccination, gene therapy, protein replacement therapy, and other genetic disease therapies. Since the first clinical studies of therapeutic nucleic acids began in the 2000s, significant progress has been made through the design of nucleic acid molecules and improvements in their delivery methods. However, nucleic acid therapeutics still face several challenges, including low cell permeability and high sensitivity to degradation of certain nucleic acid molecules (including RNA). Therefore, there is a need to develop new nucleic acid molecules and related methods and compositions to facilitate their delivery outside or inside cells for therapeutic and/or preventive purposes.
  • lipid compounds are provided herein, including pharmaceutically acceptable salts or stereoisomers thereof, which can be used alone, or with other lipid components such as neutral lipids, charged lipids, steroids (including, for example, all sterols) and/or their analogs, and/or with polymer-conjugated lipids, and/or polymers in combination, to form lipid nanoparticles for delivery of therapeutic agents (e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino ring oligonucleotides).
  • therapeutic agents e.g., nucleic acid molecules, including nucleic acid mimetics such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino ring oligonucleotides).
  • lipid nanoparticles are used to deliver nucleic acids, such as antisense and/or messenger RNA. It also provides methods for treating various diseases or conditions (such as diseases or conditions caused by infectious entities and/or protein deficiencies) using such lipid nanoparticles.
  • L1 , L2 , L3 , R1 , R2 , R3 , R4 , R5 , R6 and m are as defined herein or elsewhere.
  • the invention provides a nanoparticle composition comprising a compound provided herein and a therapeutic or prophylactic agent.
  • the therapeutic or prophylactic agent comprises at least one mRNA encoding an antigen or a fragment or epitope thereof.
  • Fig. 1 is a graph of fluorescence intensity in mice
  • FIG2 is an organ distribution diagram of compound 3
  • FIG3 is a graph showing the Luc expression of compound 3 after intramuscular injection
  • FIG4 is a graph showing the IgG antibody titers of compounds 3, 11, and 17;
  • FIG. 5 is a graph showing the RSV-A neutralizing antibody titer of compound 3.
  • lipid refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by generally having poor solubility in water but being soluble in many non-polar organic substances. Although lipids generally have poor solubility in water, certain classes of lipids (e.g., lipids modified with polar groups such as DMG-PEG2000) have limited water solubility and can be dissolved in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids.
  • biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids.
  • Lipids can generally be divided into at least three categories: (1) “simple lipids”, including fats and oils as well as waxes; (2) “compound lipids”, including phospholipids and glycolipids (such as DMPE-PEG2000); (3) “derivatized lipids”, such as steroids, etc.
  • lipids also include lipid-like compounds.
  • lipid nanoparticle refers to a particle with a nanometer scale (nm) (e.g., 1nm to 1,000nm) comprising one or more types of lipid molecules.
  • LNP provided herein may further include at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules).
  • LNP comprises a non-lipid payload molecule partially or completely encapsulated inside a lipid shell.
  • the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein)
  • the lipid component of the LNP comprises at least one cationic lipid.
  • cationic lipids can interact with negatively charged payload molecules and promote the incorporation and/or encapsulation of payloads into LNPs during LNP formation.
  • other lipids that can form a part of LNP include, but are not limited to, neutral lipids and charged lipids, such as steroids, polymer-conjugated lipids and various zwitterionic lipids.
  • LNP according to the present invention comprises one or more lipids of formula (I) (and its subformula) as described herein.
  • cationic lipid refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or a lipid that is capable of being positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., its intended use environment). Therefore, the term “cationic” covers the range of “permanent cations" and “cationizable”.
  • the positive charge in the cationic lipid is derived from the presence of a quaternary nitrogen atom.
  • the cationic lipid includes a zwitterionic lipid that is positively charged in the environment in which it is intended to be administered (e.g., at physiological pH). Positively charged.
  • the cationic lipid is a lipid of one or more Formula (I) (and subformulae thereof) described herein.
  • polymer-conjugated lipid refers to a molecule that comprises both a lipid portion and a polymer portion.
  • An example of a polymer-conjugated lipid is a pegylated lipid (PEG-lipid), wherein the polymer portion comprises polyethylene glycol.
  • neutral lipid encompasses any lipid molecule that exists in an uncharged form or a neutral zwitterionic form at a selected pH.
  • the selected useful pH value or range corresponds to the pH conditions of the environment in which the lipid is intended to be used, such as physiological pH.
  • neutral lipids that can be used in conjunction with the disclosure herein include, but are not limited to, phosphatidylcholines, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), phosphatidylethanolamines such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-(((2,3-bis(oleoyloxy)propyl))dimethylammoniumphosphate)ethylhydrogen (DOCP), sphingomye
  • DOPE 1,
  • charged lipid encompasses any lipid molecule that exists in a positively or negatively charged form in a selected pH value or range.
  • the selected pH value or range corresponds to the pH conditions of the intended use environment of the lipid, such as physiological pH.
  • the charged lipid that can be used in conjunction with the disclosure herein includes but is not limited to phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyl trimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyl dimethylaminopropane, ethylphosphocholine, dimethylaminoethane aminoformyl sterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) sodium salt (DOPG-Na) and 1,2-dioleoyl-sn-glycero-3-phospho-sodium salt (DOPA)
  • DOPA 1,2-
  • alkyl refers to a straight or branched hydrocarbon chain radical consisting only of saturated carbon and hydrogen atoms.
  • the alkyl group has, for example, 1 to 24 carbon atoms (C 1 -C 24 alkyl), 4 to 20 carbon atoms (C 4 -C 20 alkyl), 10 to 20 carbon atoms (C 10 -C 20 alkyl), 6 to 16 carbon atoms (C 6 -C 16 alkyl), six to nine carbon atoms (C 6 -C 9 alkyl), one to fifteen carbon atoms (C 1 -C 15 alkyl), one to twelve carbon atoms (C 1 -C 12 alkyl), one to eight carbon atoms (C 1 -C 8 alkyl), or one to six carbon atoms (C 1 -C 6 alkyl), and is attached to the rest of the molecule by a single bond.
  • alkyl groups include, but are not limited to, methyl, ethyl, propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc. Unless otherwise specified, alkyl groups are optionally substituted.
  • alkenyl refers to a straight or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. As understood by those of ordinary skill in the art, the term “alkenyl” also includes groups with “cis” and “trans” configurations, or "E” and “Z” configurations.
  • the alkenyl group has, for example, 2 to 24 carbon atoms ( C2 - C24 alkenyl), 4 to 20 carbon atoms ( C4 - C20 alkenyl), 6 to 16 carbon atoms ( C6 - C16 alkenyl), six to nine carbon atoms ( C6 - C9 alkenyl), two to fifteen carbon atoms ( C2 - C15 alkenyl), two to twelve carbon atoms ( C2 - C12 alkenyl), two to eight carbon atoms ( C2 - C8 alkenyl) or 2 to 6 carbon atoms ( C2 - C6 alkenyl), and is connected to the rest of the molecule by a single bond.
  • alkenyl groups include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. Unless otherwise specified, alkenyl groups are optionally substituted.
  • alkynyl refers to a straight or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds.
  • the alkynyl group has, for example, 2 to 24 carbon atoms ( C2 - C24 alkynyl), 4 to 20 carbon atoms ( C4 - C20 alkynyl), 6 to 16 carbon atoms ( C6 - C16 alkynyl), six to nine carbon atoms ( C6 - C9 alkynyl), two to fifteen carbon atoms ( C2 - C15 alkynyl), two to twelve carbon atoms ( C2 - C12 alkynyl), two to eight carbon atoms ( C2 - C8 alkynyl) or two to six carbon atoms ( C2 - C6 alkynyl), and is connected to the rest of the molecule by a single bond. Examples of alkynyl
  • alkylene or “alkylene chain” refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a group consisting only of saturated carbon and hydrogen.
  • the alkylene group has, for example, 1 to 24 carbon atoms (C 1 -C 24 alkylene), 1 to 15 carbon atoms (C 1 -C 15 alkylene), 1 to 12 carbon atoms (C 1 -C 12 alkylene), 1 to 8 carbon atoms (C 1 -C 8 alkylene), 1 to 6 carbon atoms (C 1 -C 6 alkylene), 2 to 4 carbon atoms (C 2 -C 4 alkylene), 1 to 2 carbon atoms (C 1 -C 2 alkylene).
  • alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butene, etc.
  • the alkylene chain is connected to the rest of the molecule by a single bond and is connected to the free radical group by a single bond.
  • the connection of the alkylene chain to the rest of the molecule and to the free radical group can be through one carbon or any two carbons in the chain. Unless otherwise stated, alkylene chains are optionally substituted.
  • alkenylene refers to a straight or branched divalent hydrocarbon chain that connects the remainder of a molecule to a radical group consisting only of carbon and hydrogen, the radical group comprising one or more carbon-carbon double bonds.
  • alkenylene has, for example, 2 to 24 carbon atoms ( C2 - C24 alkenylene), 2 to 15 carbon atoms ( C2 - C15 alkenylene), 2 to 12 carbon atoms ( C2 - C12 alkenylene), 2 to 8 carbon atoms ( C2 - C8 alkenylene), 2 to 6 carbon atoms ( C2 - C6 alkenylene) or 2 to 4 carbon atoms ( C2 - C4 alkenylene).
  • alkenylene include, but are not limited to, vinylene, propenylene, n-butenyl, etc.
  • Alkenylene is connected to the remainder of the molecule by a single bond or double bond, and is connected to the radical group by a single bond or double bond.
  • the connection of alkenylene to the remainder of the molecule and to the radical group can be through one carbon or any two carbons in the chain. Unless otherwise specified, an alkenylene group is optionally substituted.
  • cycloalkyl refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting only of carbon and hydrogen atoms and being saturated. Cycloalkyl can include condensed rings or bridged ring systems. In one embodiment, cycloalkyl has, for example, 3 to 15 ring carbon atoms (C 3 -C 15 cycloalkyl), 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkyl) or 3 to 8 ring carbon atoms (C 3 -C 8 cycloalkyl). Cycloalkyl is connected to the rest of the molecule by a single bond.
  • Examples of monocyclic cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.
  • Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decahydroalkyl, 7,7-dimethyl-bicyclo [2.2.1] heptyl, etc. Unless otherwise indicated, cycloalkyl is optionally substituted.
  • cycloalkylene is a divalent cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.
  • cycloalkenyl refers to a non-aromatic monocyclic or polycyclic hydrocarbon group consisting only of carbon and hydrogen atoms and including one or more carbon-carbon double bonds.
  • the cycloalkenyl group may include a condensed ring or a bridged ring system.
  • the cycloalkenyl group has, for example, 3 to 15 ring carbon atoms ( C3 - C15 cycloalkenyl), 3 to 10 ring carbon atoms ( C3 - C10 cycloalkenyl) or 3 to 8 ring carbon atoms ( C3 - C8 cycloalkenyl).
  • the cycloalkenyl group is connected to the remainder of the molecule by a single bond.
  • the example of a monocyclic cycloalkenyl group includes but is not limited to cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl etc. Unless otherwise indicated, the cycloalkenyl group is optionally substituted.
  • cycloalkenylene is a divalent cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.
  • heterocyclyl refers to a non-aromatic monocyclic or polycyclic moiety containing one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus and sulfur.
  • the heterocyclyl can be attached to the main structure at any heteroatom or carbon atom.
  • the heterocyclyl can be a monocyclic, bicyclic, tricyclic, tetracyclic or other polycyclic system, wherein the polycyclic system can be a fused ring, a bridged ring or a spirocyclic system.
  • the heterocyclic polycyclic system can include one or more heteroatoms in one or more rings.
  • the heterocyclyl can be saturated or partially unsaturated. Saturated heterocycloalkyl can be referred to as “heterocycloalkyl". If the heterocyclyl contains at least one double bond, the partially unsaturated heterocycloalkyl can be referred to as “heterocycloalkenyl”; if the heterocyclyl contains at least one triple bond, it can be referred to as "heterocycloalkynyl".
  • the heterocyclyl has, for example, 3 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 18 ring atoms (4 to 18-membered heterocyclyl), 5 to 18 ring atoms (5 to 18-membered heterocyclyl), 4 to 8 ring atoms (4 to 8-membered heterocyclyl) or 5 to 8 ring atoms (5 to 8-membered heterocyclyl).
  • a numerical range such as "3 to 18" refers to each integer in the given range.
  • heterocyclyl means that the heterocyclyl can be composed of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, up to 18 ring atoms, etc.
  • heterocyclic groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinylpyrrolyl, isothiazolyl, furanyl, furanyl, furanyl, piperidinyl, quinolyl and isoquinolyl. Unless otherwise specified, heterocyclic groups are optionally substituted.
  • heterocyclylene is a divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.
  • aryl refers to a monocyclic aromatic group and/or a polycyclic monovalent aromatic group comprising at least one aromatic hydrocarbon ring.
  • the aryl group has 6 to 18 ring carbon atoms (C6-C18 aryl), 6 to 14 ring carbon atoms (C6-C14 aryl) or 6 to 10 ring carbon atoms (C6-C10 aryl).
  • aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthracenyl, phenanthrenyl, pyrenyl, biphenyl and terphenyl.
  • aryl also refers to a bicyclic, tricyclic or other polycyclic hydrocarbon ring, wherein at least one ring is aromatic, and the other rings may be saturated, partially unsaturated or aromatic, such as dihydronaphthyl, indenyl, indanyl or tetrahydronaphthyl (tetrahydronaphthyl). Unless otherwise indicated, aryl is optionally substituted.
  • arylene is a divalent aromatic group. Unless otherwise specified, an arylene group is optionally substituted.
  • heteroaryl refers to a monocyclic aromatic group and/or polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more independently selected from O, S and N, one to three or one to four heteroatoms. Heteroatoms in heteroaryl can be connected to the main structure at any carbon atom. In certain embodiments, heteroaryl has 5 to 20, 5 to 15 or 5 to 10 ring atoms.
  • heteroaryl also refers to bicyclic, tricyclic or other polycyclic rings, wherein at least one ring is aromatic, and the other rings can be saturated, partially unsaturated or aromatic, wherein at least one aromatic ring contains one or more monocyclic heteroaryl examples, including but not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyrazinyl, pyrimidinyl, pyridazinyl and triazinyl.
  • bicyclic heteroaryl groups include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothiophenyl, quinolyl, tetrahydroisoquinolyl, isoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, oxynaphthyl, furapyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolyl.
  • heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl and xanthinyl. Unless otherwise specified, heteroaryl groups are optionally substituted.
  • heteroarylene is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.
  • the substituent is C 1 -C 12 alkyl. In other embodiments, the substituent is cycloalkyl. In other embodiments, the substituent is a halogen group, such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is hydroxy. In other embodiments, the substituent is alkoxy (-OR'). In other embodiments, the substituent is carboxyl. In other embodiments, the substituent is amino (-NR'R').
  • the term “optional” or “optionally” means that the subsequently described event or circumstances may or may not occur, and that the description includes instances where the event or circumstances occur and instances where the event or circumstances do not occur.
  • “optionally substituted alkyl” means that the alkyl group may or may not be substituted, and that the description includes substituted alkyl groups and unsubstituted alkyl groups.
  • Prodrug refers to a compound that can be converted into a biologically active compound under physiological conditions or by solvolysis. Therefore, the term “prodrug” refers to a metabolic precursor of a pharmaceutically acceptable biologically active compound. When administered to a subject in need, the prodrug may be inactive, but is converted into the biologically active compound of the present invention in vivo. The prodrug is generally rapidly converted in vivo to the parent biologically active compound of the present invention, for example, by hydrolysis in the blood.
  • Prodrug compounds generally provide advantages of solubility, tissue compatibility or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in Higuchi, T., et al., A.C.S. Symposium Series, Vol. 14, and Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
  • prodrug is also meant to include any carriers that are covalently bonded, and when such prodrugs are administered to mammalian subjects, they release the active compounds of the present invention in vivo.
  • Prodrugs of the compounds of the present invention can be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved into the parent compounds of the present invention by conventional manipulation or in vivo.
  • Prodrugs include compounds of the present invention wherein a hydroxyl, amino or thiol group is bonded to any of the following groups, and when the prodrugs of the compounds of the present invention are administered to mammalian subjects, the groups are cleaved to form free hydroxyls, free aminos or free thiol groups, respectively.
  • prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of amide derivatives of alcohol or amine functional groups in the compounds provided herein, and the like.
  • the term “pharmaceutically acceptable salt” includes acid addition salts and base addition salts.
  • Examples of “pharmaceutically acceptable acid addition salts” include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, decanoic acid, caproic acid, Caprylic acid, carbonic acid, cinnamic acid, citric acid, cycloamic acid, dodecyl sulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactonic acid, gentisic acid, gluconic acid, glucuronic acid
  • salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, and the like.
  • the inorganic salt is an ammonium salt, a sodium salt, a potassium salt, a calcium salt, and a magnesium salt.
  • Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines and basic ion exchange resins such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, dealcoholization, 2-dimethylaminoethanol, 2-diethylaminoethanol, lysine, arginine, histidine, caffeine, procaine, hydraziniline, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like.
  • the organic base is isopropylamine, diethylamine, ethanolamine, tri
  • Compounds provided herein may contain one or more asymmetric centers, and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R)- or (S)-, or as (D)- or (L)- in terms of absolute stereochemistry for amino acids. Unless otherwise indicated, compounds provided herein are intended to include all of these possible isomers, as well as their racemic and optically pure forms.
  • Optically active (+) and (-), (R)- and (S)- or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization.
  • the term “isomer” refers to different compounds having the same molecular formula.
  • “Stereoisomers” are isomers that differ only in the way their atoms are arranged in space.
  • “Atropisomers” are stereoisomers that are hindered in the rotation of atoms about single bonds.
  • “Enantiomers” are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any ratio may be referred to as a “racemic” mixture.
  • “Diastereomers” are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.
  • Stepoisomers may also include E and Z isomers or mixtures thereof, and cis and trans isomers or mixtures thereof.
  • the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.
  • Tautomers refer to isomeric forms of a compound that are in equilibrium with each other. The difference in concentration of the isomeric forms will depend on the environment in which the compound is located, and may depend on whether the compound is a solid or in an organic or aqueous solution.
  • the compounds described herein may contain an unnatural portion of an atomic isotope at one or more atoms.
  • the compound may be radiolabeled with a radioactive isotope, such as tritium-3 ( 3 H), iodine-125 ( 125 I), sulfur-35 ( 35 S) or carbon-14 ( 14 C), or may be isotopically enriched with deuterium ( 2 H), carbon-13 ( 13 C) or nitrogen-15 ( 15 N).
  • a radioactive isotope such as tritium-3 ( 3 H), iodine-125 ( 125 I), sulfur-35 ( 35 S) or carbon-14 ( 14 C), or may be isotopically enriched with deuterium ( 2 H), carbon-13 ( 13 C) or nitrogen-15 ( 15 N).
  • isotope means a radioactive isotope.
  • Radiolabeled and isotopically enriched compounds are isotopically enriched compounds.
  • isotopically enriched refers to an atom having an isotopic composition different from the natural isotopic composition of the atom.
  • isotopically enriched can also refer to a compound containing at least one atom whose isotopic composition is different from the natural isotopic composition of the atom.
  • isotopic composition refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, such as cancer therapeutics, research reagents (such as binding assay reagents), and diagnostic agents (such as in vivo imaging agents).
  • isotopes of the compounds described herein are provided, for example, the isotopes are enriched in deuterium, carbon-13 and/or nitrogen-15.
  • deuterated refers to a compound in which at least one hydrogen (H) is replaced by deuterium (represented by D or 2H ), that is, the compound is enriched in deuterium at at least one position.
  • the term "pharmaceutically acceptable carrier, diluent or excipient” includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye/colorant, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier approved by the U.S. Food and Drug Administration for use in humans or livestock.
  • composition is intended to encompass a product containing specified ingredients (eg, mRNA molecules), optionally in specified amounts.
  • polynucleotide or “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides of any length, including, for example, DNA and RNA.
  • Nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and/or analogs thereof, or may be any substrate incorporated into a polymer by DNA polymerase or RNA polymerase or by a synthetic reaction.
  • Polynucleotides may contain modified nucleotides, such as methylated nucleotides and analogs thereof.
  • Nucleic acids may be in single-stranded or double-stranded form.
  • nucleic acid also includes nucleic acid mimetics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino oligonucleotides.
  • LNA locked nucleic acids
  • PNA peptide nucleic acids
  • oligonucleotide refers to a short synthetic polynucleotide, which is generally but not necessarily less than about 200 nucleotides in length.
  • the terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides.
  • the left end of any single-stranded polynucleotide sequence disclosed herein is the 5' end; the left direction of a double-stranded polynucleotide sequence is referred to as the 5' direction.
  • the direction of addition of nascent RNA transcripts from 5' to 3' is called the transcription direction; the sequence region on the DNA chain with the same sequence as the RNA transcript located from 5' to the 5' end of the RNA transcript is called the "upstream sequence"; the sequence region on the DNA chain with the same sequence as the RNA transcript located from 3' to the 3' end is called the "downstream sequence".
  • isolated nucleic acid refers to nucleic acid, for example, it can be RNA, DNA or mixed nucleic acid, which is basically separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases) by nature, including native sequences. "Isolated” nucleic acid molecules are nucleic acid molecules separated from other nucleic acid molecules in natural sources. In addition, when produced by recombinant technology, "isolated" nucleic acid molecules (such as mRNA molecules) can be substantially free of other cell materials or culture media, or can be substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, one or more nucleic acid molecules encoding antigens described herein are separated or purified.
  • the term includes nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs synthesized by heterologous systems.
  • Substantially pure molecules can include isolated forms of molecules.
  • encoding nucleic acid or its grammatical equivalents includes: (a) a nucleic acid molecule that, when in its natural state or manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA that can be translated into a peptide and/or polypeptide, and (b) the mRNA molecule itself.
  • the antisense strand is the complementary sequence of the nucleic acid molecule, and the coding sequence can be inferred therefrom.
  • coding region refers to the portion of the coding nucleic acid sequence that can be translated into a peptide or polypeptide.
  • UTR untranslated region
  • mRNA refers to a messenger RNA molecule comprising one or more open reading frames (ORFs), which can be translated by a cell or organism to produce one or more peptides or protein products.
  • ORFs open reading frames
  • the region comprising one or more ORFs is referred to as the coding region of the mRNA molecule.
  • the mRNA molecule also comprises one or more untranslated regions (UTRs).
  • mRNA is a monocistronic mRNA comprising only one ORF.
  • monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen).
  • mRNA is a polycistronic mRNA comprising two or more ORFs.
  • polycistronic mRNA encodes two or more peptides or proteins that are identical or different from each other.
  • each peptide or protein encoded by polycistronic mRNA comprises at least one epitope of a selected antigen.
  • different peptides or proteins encoded by polycistronic mRNA each comprise at least one epitope of a different antigen.
  • at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 epitopes of an antigen.
  • nucleobase encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.
  • the term "functional nucleotide analogue” refers to a modified form of a canonical nucleotide A, G, C, U or T, which (a) retains the base pairing properties of the corresponding canonical nucleotide, and (b) comprises at least one chemical modification of any combination of (i) to (iii) of (i) a nucleobase, (ii) a sugar group, (iii) a phosphate group or (iv) a corresponding natural nucleotide.
  • base pairs not only cover standard Watson-Crick A-T, A-U or C-G base pairs, but also include base pairs formed between canonical nucleotides and functional nucleotide analogs or between a pair of functional nucleotide analogs, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows the formation of hydrogen bonds between the modified nucleobase and the standard nucleobase or between two complementary modified nucleobase structures.
  • a functional analogue of guanosine (G) retains the ability to base pair with a functional analogue of cytosine (C) or cytosine.
  • nucleic acid molecules comprising functional nucleotide analogs can have at least one modified nucleobase, sugar group or internucleoside bond. Exemplary chemical modifications to the nucleobase, sugar group or internucleoside bond of nucleic acid molecules are provided herein.
  • TEE translation enhancing element
  • translation enhancer refers to a region in a nucleic acid molecule whose function is to promote the translation of a coding sequence of a nucleic acid into a protein or peptide product, for example, by cap-dependent or cap-independent translation.
  • TEEs are typically located in the UTR region of a nucleic acid molecule (such as mRNA) and can enhance the translation level of a coding sequence located upstream or downstream.
  • a TEE in the 5'-UTR of a nucleic acid molecule can be located between the promoter and the start codon of the nucleic acid molecule.
  • TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8): 747–750; Chappell et al. PNAS June 29, 2004 101(26) 9590-9594). It is known that certain TEEs are conserved among multiple species (Pánek et al. Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625–7634).
  • stem-loop sequence refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions to form at least one double helix and a non-complementary loop, the resulting loop structure being called a stem-loop structure, a hairpin or a hairpin loop, which is also a secondary structure present in many RNA molecules.
  • peptide refers to a polymer containing 2-50 amino acid residues linked by one or more covalent peptide bonds.
  • the term is applicable to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).
  • polypeptide and protein are used interchangeably herein and refer to polymers having more than fifty amino acid residues linked by covalent peptide bonds. That is, the description of polypeptides is equally applicable to the description of proteins, and vice versa.
  • the term is applicable to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs).
  • the term encompasses amino acid chains of any length, including full-length proteins (e.g., antigens).
  • the term "antigen" refers to a substance that can be recognized by the subject's immune system (including the adaptive immune system) and can produce an immune response (including an antigen-specific immune response) in the subject's body in contact with the antigen.
  • the antigen is a protein associated with a diseased cell (e.g., a cell infected by a pathogen or a neoplastic cell) (e.g., a tumor-associated antigen (TAA)).
  • TAA tumor-associated antigen
  • fragment refers to a peptide or polypeptide that contains less than the full-length amino acid sequence. Such fragments can come from truncation of the N-terminus, truncation of the C-terminus and/or deletion of residues within the amino acid sequence. Fragments can be produced by alternative RNA splicing or in vivo proteases.
  • a fragment refers to a polypeptide comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 consecutive amino acid residues.
  • a fragment refers to a polypeptide
  • Epitope is a site on the surface of an antigen molecule to which a specific antibody molecule binds, for example, a local area on the surface of an antigen that can bind to one or more antigen binding regions of an antibody, has antigenic or immunogenic activity in animals such as mammals (e.g., humans), and can induce an immune response.
  • An epitope with immunogenic activity is a part of a polypeptide that triggers an antibody response in an animal.
  • An epitope with antigenic activity is a part of a polypeptide that an antibody binds to, as determined by any method known in the art, including, for example, by immunoassay. Antigenic epitopes do not necessarily have to be immunogenic.
  • Epitopes are usually composed of a collection of chemically active surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics, as well as specific charge characteristics.
  • Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed by continuous sequences of amino acids in proteins. Conformational epitopes are formed by discontinuous amino acids in a protein sequence, but they bind together when the protein is folded into its three-dimensional structure. When the three-dimensional structure of a protein is in an altered configuration, such as after activation or binding of another protein or ligand, an induced epitope is formed.
  • an epitope is a three-dimensional surface feature of a polypeptide.
  • an epitope is a linear feature of a polypeptide.
  • an antigen has several or many different epitopes and can react with many different antibodies.
  • the term "gene vaccine” refers to a therapeutic or preventive composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (such as an infectious disease or a neoplastic disease). Peptides or proteins are encoded by administering a vaccine (vaccination) to a subject, thereby inducing an immune response to the target disease in the subject.
  • the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and/or immune cells that can activate and proliferate for the specific elimination of diseased cells expressing the antigen.
  • the immune response also includes an innate immune response.
  • the vaccine can be administered to the subject before or after the onset of clinical symptoms of the target disease.
  • vaccination of healthy or asymptomatic subjects makes the vaccinated subject immune or less sensitive to the target disease process.
  • vaccination of subjects with disease symptoms can improve the disease condition of the vaccinated subject or treat the disease.
  • innate immune response and "innate immunity” are well known in the art and refer to non-specific defense mechanisms initiated by the human immune system upon recognition of pathogen-associated molecules, which involve different forms of cellular activity, including cytokine production and cell death in various pathways.
  • the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production), activation of the NF ⁇ B pathway, increased proliferation, maturation, differentiation and/or survival of immune cells, and in some cases induced apoptosis.
  • the activation of innate immunity can be detected using methods known in the art, such as by measuring the activation of (NF)- ⁇ B.
  • the adaptive immune response includes a cellular response triggered and/or enhanced by a vaccine composition (such as a genetic composition described herein).
  • the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response.
  • the vaccine composition allows the production of an antigen in an immunized subject after administration, which antigen is a target of an antigen-specific adaptive immune response.
  • the activation of an adaptive immune response can be detected using methods known in the art, such as by monitoring the production of antigen-specific antibodies or monitoring the level of antigen-specific cell-mediated cytotoxicity.
  • antibody is intended to include polypeptide products secreted by effector B cells, which are composed of two pairs of identical polypeptide chains, wherein each pair of polypeptide chains has a heavy chain (about 50-70 kDa) and a light chain (about 25 kDa), the N-terminal portion of each chain contains a variable region of about 100 to about 130 or more amino acids, and the C-terminal portion of each chain includes a constant region, which can bind to a specific molecular antigen.
  • Immunoglobulins are not just antibodies. For example, see Antibody Engineering (Borrebaeck ed., 2d ed. 1995) and Kuby, Immunology (3d ed. 1997).
  • the specific molecular antigen includes a polypeptide, a fragment or an epitope thereof, which can bind to the antibodies described herein.
  • Antibodies also include, but are not limited to, synthetic antibodies, antibodies produced by recombination, camelized antibodies, intracelluar antibodies, anti-Id antibodies and functional fragments of these antibodies.
  • the functional fragment of an antibody refers to a functional polypeptide fragment separated from the heavy chain or light chain of the aforementioned antibody that can retain a part or all of the binding activity.
  • ⁇ -chain antibodies including monospecific, bispecific, etc.
  • Fab fragments F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-stabilized antibodies (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies and mini antibodies.
  • the antibodies described herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen binding domains or molecules containing antigen binding sites (such as one or more CDRs of an antibody).
  • antigen binding domains or molecules containing antigen binding sites such as one or more CDRs of an antibody.
  • the antibodies provided by the present invention can be any type of immunoglobulin molecule (such as IgG, IgE, IgM, IgD and IgA, etc.) or any subclass (such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2, etc.).
  • administering refers to the act of delivering an in vitro substance (such as a lipid nanoparticle composition described herein) to a patient, for example, by mucosal, intramuscular/subcutaneous injection, intravenous injection, or other physical means known in the art.
  • an in vitro substance such as a lipid nanoparticle composition described herein
  • the administration of the substance is usually performed after the onset of the disease, disorder, condition, or symptom thereof.
  • the administration of the substance is usually performed before the onset of the disease, disorder, condition, or symptom.
  • Chronic administration refers to administration in a continuous mode (e.g., over a period of time such as days, weeks, months or years) as opposed to an acute mode of administration to maintain the initial therapeutic effect (activity) over an extended period of time.
  • Intermittent administration is not continuous but rather periodic, without interruption of treatment.
  • target delivery refers to the process of promoting the delivery of agents (e.g., therapeutic payload molecules in lipid nanoparticle compositions described herein) to reach specific organs, tissues, cells and/or intracellular compartments (referred to as target locations), making the target location more than any other organ, tissue, cell or intracellular compartment (referred to as non-target location) delivered.
  • agents e.g., therapeutic payload molecules in lipid nanoparticle compositions described herein
  • target locations specific organs, tissues, cells and/or intracellular compartments
  • non-target location intracellular compartments
  • targeted delivery can be detected by methods known in the art, such as by comparing the concentration of the agent delivered in the target cell population after systemic administration with the concentration of the agent delivered in the non-target cell population. In certain embodiments, compared to non-target locations, targeted delivery results in a concentration at least 2 times higher at the target location.
  • an "effective amount” is generally an amount sufficient to reduce the severity and/or frequency of symptoms, eliminate symptoms and/or underlying causes, prevent the occurrence of symptoms and/or their causes, and/or improve or remedy damage.
  • Diseases caused by or associated with a disease, disorder or condition include infection and tumor formation, etc.
  • an effective amount is a therapeutically effective amount or a prophylactically effective amount.
  • the term "therapeutically effective amount” refers to an amount of an agent (such as a vaccine composition) sufficient to reduce and/or improve the severity and/or duration of symptoms associated with a given disease, disorder or condition (such as an infectious disease caused by a viral infection, or a neoplastic disease of cancer, etc.).
  • the "therapeutically effective amount” of a substance/molecule/agent of the present disclosure may vary according to factors such as the disease state, age, sex, and weight of the individual, as well as the ability of the substance/molecule/agent to elicit a desired response in the individual.
  • a therapeutically effective amount includes an amount in which any toxic or deleterious effects of the substance/molecule/agent are offset by the beneficial effects of the treatment.
  • the term "therapeutically effective amount” refers to an amount of a lipid nanoparticle composition or a therapeutic or preventive agent (such as a therapeutic mRNA) contained therein that is effective in "treating" a disease, disorder, or condition in a subject or mammal.
  • a “prophylactic effective amount” is an amount that will have the expected prophylactic effect when administered to a subject, for example, the amount of a pharmaceutical composition that prevents, delays or reduces the likelihood of onset (or recurrence) of a disease, disorder, and related symptoms (such as infectious diseases caused by viral infection or neoplastic diseases such as cancer). Conditions or related symptoms.
  • a prophylactic dose is used in a subject before or at an earlier stage of a disease, disorder, or condition, the prophylactic effective amount may be less than the therapeutic effective amount.
  • a complete therapeutic or prophylactic effect does not necessarily occur by administering one dose, but may only occur after a series of doses are administered. Therefore, a therapeutic or prophylactic effective amount may be administered in one or more administrations.
  • prevent refers to reducing the likelihood of developing a disease, disorder, condition or associated symptoms, such as an infectious disease, such as infection by a virus, or a neoplastic disease, such as cancer.
  • management refers to the beneficial effects that a subject obtains from a treatment (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease.
  • a treatment e.g., a prophylactic or therapeutic agent
  • one or more therapies are administered to a subject to "manage" one or more symptoms of an infectious or neoplastic disease, thereby preventing the progression or worsening of the disease.
  • prophylactic agent refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and/or symptoms associated therewith in a subject.
  • therapeutic agent refers to any drug useful in treating, preventing or alleviating a disease, disorder or condition, including any drug useful in treating, preventing or alleviating one or more symptoms of a disease, disorder or condition and associated symptoms.
  • the term “therapy” refers to any regimen, method and/or agent that can be used to prevent, manage, treat and/or improve a disease, disorder or condition.
  • the term “therapy” refers to biological therapy, supportive therapy and/or other therapies known to those skilled in the art, such as medical personnel, that can be used to prevent, control, treat and/or improve a known disease, disorder or condition.
  • a “prophylactically effective serum titer” is a serum titer of antibodies in a subject (eg, a human) that fully or partially inhibits the development, recurrence, onset or spread of a disease, disorder or condition and symptoms associated therewith.
  • a "therapeutically effective serum titer” is a serum titer of antibodies in a subject (eg, a human) that reduces the severity, duration, and/or symptoms associated with a disease, disorder, or condition.
  • serum titer refers to the average serum titer from a subject from multiple samples (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000 or more subjects.
  • side effect encompasses unwanted and/or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent).
  • Adverse effects are not necessarily unfavorable.
  • Adverse effects of a therapy may be harmful, uncomfortable, or risky.
  • Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, hair loss, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, chills, tiredness, digestive problems, and allergic reactions.
  • Other undesirable effects experienced by patients are known in the art and are described in Physician’s Desk Reference (68th ed. 2014).
  • the subject is a mammal, such as a non-primate (such as a cow, pig, horse, cat, dog, rat, etc.) or a primate (such as a monkey and a human).
  • a mammal such as a non-primate (such as a cow, pig, horse, cat, dog, rat, etc.) or a primate (such as a monkey and a human).
  • the subject is a human.
  • the subject is a mammal (such as a human) suffering from an infectious disease or a neoplastic disease.
  • the subject is a mammal (such as a human) at risk of developing an infectious disease or a neoplastic disease.
  • detectable probe refers to a composition that provides a detectable signal.
  • the term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal through its activity.
  • detectable agent refers to a substance that can be used to determine the presence of a desired molecule in a sample or subject, such as an antigen encoded by an mRNA molecule as described herein.
  • a detectable agent can be a substance that can be visualized, or a substance that can be determined and/or measured (such as by quantification).
  • substantially all is meant at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
  • the term “about” or “approximately” refers to an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” refers to within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” refers to within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.
  • L1 is selected from C1 , C2 , C3 , C4, C5 , C6 , C7, C8 , C9 , C10 , C11 or C12 alkylene, or C2 , C3 , C4 , C5 , C6 , C7 , C8 , C9 , C10 , C11 or C12 alkenylene or alkynylene, wherein one or more methylene groups are optionally independently replaced by -O-, -S-, -S(O)-, -S(O) 2- , -C(O)-, -C(S)-, or -NR a - instead;
  • L 2 is selected from C 1 , C 2 , C 3 , C 4 , C 5 or C 6 alkylene, or C 2 , C 3 , C 4 , C 5 or C 6 alkenylene or alkynylene, wherein one or more methylene groups are optionally independently replaced by C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 or C 10 cycloalkylene, phenylene or naphthylene;
  • L3 is selected from C1 , C2 , C3 , C4, C5 , C6 , C7, C8 , C9 , C10 , C11 or C12 alkylene, or C2 , C3 , C4 , C5 , C6 , C7 , C8 , C9 , C10 , C11 or C12 alkenylene or alkynylene, wherein one or more methylene groups are optionally independently replaced by -O-, -S-, -S(O)-, -S(O) 2- , -C(O)-, -C(S)-, or -NR a - instead;
  • R 1 is selected from alkyl, alkenyl or alkynyl optionally substituted by cycloalkyl or phenyl, or cycloalkyl or phenyl optionally substituted by halogen, alkyl, alkenyl or alkynyl, the alkyl is C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 or C 10 alkyl, the alkenyl or alkynyl is C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 or C 10 alkenyl or alkynyl, the cycloalkyl is C 3 , C 4 , C 5 , C 6 , C 7 , C 8 , C 9 or C 10 cycloalkyl, the phenyl is optionally substituted by one or more (C 1 -C 6 ) alkyl;
  • R2 is selected from alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl or heteroaryl; the alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl or heteroaryl is optionally substituted independently by hydroxy, hydroxy( C1 - C6 )alkyl, mercapto, amino, halogen, cyano, aryl, heteroaryl, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl or Rb -X-; optionally, two substituents on the same carbon atom of the alkyl, alkenyl or alkynyl together with the carbon atom form a cycloalkyl; the alkyl is C1 , C2 , C3 , C4 , C5 , C6 , C7 , C8, C9 or C10 alkyl
  • R3 is selected from H, C4 , C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17, C18, C19, C20, C21, C22, C23 or C24 alkyl , alkenyl or alkynyl , wherein one or more methylene groups are optionally independently -O-, -S-, -S(O)-, -S(O) 2 -, -C(O)-, -C(S)-, or -NR a - instead;
  • R4 is selected from H, C4 , C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17, C18, C19, C20, C21, C22, C23 or C24 alkyl , alkenyl or alkynyl , wherein one or more methylene groups are optionally independently replaced by -O-, -S-, -S(O)-, -S(O) 2- , -C(O)-, -C(S)-, or -NR a - instead;
  • R 3 and R 4 are not H at the same time
  • R5 is selected from C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17 , C18 , C19 or C20 alkyl, alkenyl or alkynyl ;
  • R6 is selected from C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17 , C18 , C19 or C20 alkyl, alkenyl or alkynyl ;
  • X is selected from O, S or N(R c );
  • Ra is selected from H, ( C1 - C6 ) alkyl, ( C2 - C6 ) alkenyl, ( C2 - C6 ) alkynyl, ( C3 - C10 ) cycloalkyl, hydroxyl or mercapto;
  • Rb is selected from H, ( C1 - C6 )alkyl, ( C2 - C6 )alkenyl, ( C2 - C6 )alkynyl, wherein the ( C1 - C6 )alkyl, ( C2 - C6 )alkenyl or ( C2 - C6 )alkynyl is optionally substituted with hydroxy, thiol, amino, halogen, cyano, aryl , heteroaryl or (C3-C10)cycloalkyl; ( C3 - C10 )cycloalkyl, aryl or heteroaryl optionally substituted with ( C1 - C6 )alkyl, ( C2 - C6 )alkenyl, ( C2 -C6)alkynyl, hydroxy, thiol, amino, halogen, cyano, aryl, heteroaryl or ( C3 - C10 )cycloalkyl; ( C4 - C10
  • R c is selected from H, (C 1 -C 6 )alkyl, (C 2 -C 6 )alkenyl, (C 2 -C 6 )alkynyl, wherein the (C 1 -C 6 )alkyl, (C 2 -C 6 )alkenyl or (C 2 -C 6 )alkynyl is optionally substituted with hydroxy, thiol, amino, halogen, cyano, aryl, heteroaryl or (C 3 -C 10 )cycloalkyl; (C 3 -C 10 )cycloalkyl, aryl or heteroaryl optionally substituted with (C 1 -C 6 )alkyl, (C 2 -C 6 )alkenyl, (C 2 -C 6 )alkynyl, hydroxy, thiol, amino, halogen, cyano, aryl, heteroaryl or (C 3 -C 10 )cycloalkyl; (C 4
  • n is independently selected at each occurrence from 0, 1, 2, 3, 4, 5 or 6,
  • alkyl, alkenyl, alkynyl, alkylene, alkenylene, alkynylene, cycloalkyl, cycloalkylene, cycloalkenyl, aryl, heteroaryl, phenyl, phenylene, naphthylene or amino group is optionally substituted independently by one or more substituents; preferably, the substituents are selected from (C 1 -C 6 ) alkyl, (C 2 -C 6 ) alkenyl, (C 2 -C 6 ) alkynyl, (C 3 -C 10 ) cycloalkyl, (C 3 -C 10 ) cycloalkenyl, hydroxyl, thiol, amino, halogen, cyano, heterocyclyl, aryl or heteroaryl.
  • L1 is selected from L1a - OL1a , L1a - SL1a , L1a -S(O) -L1a , L1a -S(O) 2 - L1a , L1a -C(O) -L1a , L1a-C(S) -L1a , L1a - NRa - L1a , L1a- OC(O)-L1a, L1a - C (O) -OL1a , L1a -NRa -C (O) -L1a , L1a -C(O)-NRa - L1a , L 1a -SC(O)-L 1a or L 1a -OC(S)-L 1a , L 1a at each occurrence is independently selected from a chemical bond, C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8
  • L2 is selected from C2 alkylene, or C3 , C4 , C5 , C6 , C7 , C8 , C9 or C10 alkylene. Cycloalkyl, phenylene or naphthylene.
  • L3a is selected from L3a - OL3a , L3a - SL3a , L3a -S(O) -L3a , L3a -S(O) 2 - L3a , L3a -C(O) -L3a , L3a-C(S) -L3a , L3a - NR3- L3a , L3a- OC(O)-L3a, L3a - C (O) -OL3a , L3a - NR3 - C(O) -L3a , L3a -C(O)-NR3 - L3a , L 3a -SC(O)-L 3a or L 3a -OC(S)-L 3a , L 3a at each occurrence is independently selected from a chemical bond, C 1 , C 2 , C 3 , C 4 , C 5 , C 6 , C 7 , C 8
  • R 3 is selected from the group consisting of H, R 3a -OR 3b , R 3a -SR 3b , R 3a -S(O)-R 3b , R 3a -S(O) 2 -R 3b , R 3a -C(O)-R 3b , R 3a -C(S)-R 3b , R 3a -NR a -R 3b , R 3a -OC(O)-R 3b , R 3a -C(O)-OR 3b , R 3a -NR a -C(O)-R 3b , R 3a -C(O)-NR a -R 3b , R 3a -SC(O)-R 3b or R 3a -OC(S)-R 3b , R 3a is selected from C 4 , C 5 , C 6 , C 7 , C 8, C 9 , C 10 , C 11 , C 12 , C 13 , R 3
  • R 4 is selected from the group consisting of H, R 4a -OR 4b , R 4a -SR 4b , R 4a -S(O)-R 4b , R 4a -S(O) 2 -R 4b , R 4a -C(O)-R 4b , R 4a -C(S)-R 4b , R 4a -NR a -R 4b , R 4a -OC(O)-R 4b , R 4a -C(O)-OR 4b , R 4a -NR a -C(O)-R 4b , R 4a -C(O)-NR a -R 4b , R 4a -SC(O)-R 4b or R 4a -OC(S)-R 4b , R 4a is selected from C 4 , C 5 , C 6 , C 7 , C 8, C 9 , C 10 , C 11 , C 12 , C 13
  • the aryl group is phenyl
  • the heteroaryl group is selected from pyridyl, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyrazinyl, pyrimidinyl, pyridazinyl or triazinyl, and/or the heterocyclic group is selected from (C 3 -C 10 ) monocyclic cycloalkyl containing one or two heteroatoms selected from oxygen, nitrogen or sulfur.
  • the alkyl, alkenyl, alkynyl, alkylene, alkenylene or alkynylene group is linear or branched, and the cycloalkyl, cycloalkylene, cycloalkenyl group is monocyclic.
  • R 3 and R 4 are the same.
  • R5 is selected from C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17 , C18 , C19 or C20 alkenyl ;
  • R6 is selected from C5 , C6 , C7 , C8, C9 , C10 , C11 , C12 , C13 , C14 , C15 , C16 , C17 , C18 , C19 or C20 alkyl .
  • R 2 is an alkyl or cycloalkyl group substituted with a hydroxy group.
  • the compound is selected from:
  • R H or (C 1 -C 6 )alkyl
  • any embodiment of the compound provided herein as described above, and any specific substituent and/or variable of the compound provided herein as described above can be independently combined with other embodiments and/or substituents and/or various variables of the compound to form an embodiment that is not specifically set forth.
  • substituents and/or variables for any particular group or variable, it should be understood that each individual substituent and/or variable can be deleted from a specific embodiment and/or claim, and the remaining substituent and/or variable list will be considered to be within the scope of the embodiment provided herein.
  • nanoparticle compositions comprising a lipid compound described herein.
  • the nanoparticle composition comprises a compound according to formula (I) (and subformulae thereof) described herein.
  • the maximum size of the nanoparticle composition provided herein is 1 ⁇ m or shorter (e.g., ⁇ 1 ⁇ m, ⁇ 900nm, ⁇ 800nm, ⁇ 700nm, ⁇ 600nm, ⁇ 500nm, ⁇ 400nm, ⁇ 300nm, ⁇ 200nm, ⁇ 175nm, ⁇ 150nm, ⁇ 125nm, ⁇ 100nm, ⁇ 75nm, ⁇ 50nm or shorter), when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy or other methods.
  • the lipid nanoparticles provided herein have at least one dimension in the range of about 40 to about 200nm. In one embodiment, at least one dimension is in the range of about 40 to about 100nm.
  • Nanoparticle compositions that can be used in conjunction with the present invention include lipid nanoparticles (LNP), nanolipoprotein particles, liposomes, lipid vesicles and lipid complexes, etc.
  • the nanoparticle composition comprises a vesicle of one or more lipid bilayers.
  • the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments.
  • the lipid bilayers can be functionalized and/or cross-linked to each other.
  • the lipid bilayer can include one or more ligands, proteins or channels.
  • the properties of a nanoparticle composition can depend on its components.
  • a nanoparticle composition comprising cholesterol as a structural lipid can have different properties than a nanoparticle composition comprising a different structural lipid.
  • the properties of a nanoparticle composition can depend on the absolute or relative amounts of its components.
  • a nanoparticle composition comprising a higher mole fraction of phospholipids can have different properties than a nanoparticle composition comprising a lower mole fraction of phospholipids.
  • the properties can also vary depending on the method and conditions of preparation of the nanoparticle composition.
  • Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (transmission electron microscopy or scanning electron microscopy, etc.) can be used to detect the morphology and size distribution of nanoparticle compositions. Dynamic light scattering or potentiometric methods (e.g., potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, and Worcestershire, UK) can also be used to measure multiple characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.
  • microscopy transmission electron microscopy or scanning electron microscopy, etc.
  • Dynamic light scattering or potentiometric methods e.g., potentiometric titration
  • Dynamic light scattering can also be used to determine particle size.
  • Instruments such as the Zetasizer Nano
  • the average size of the nanoparticle composition can be between 10s nm and 100s nm.
  • the average size can be between about 40 nm and about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm.
  • the average size of the nanoparticle composition can be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 70nm 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm.
  • the average size of the nanoparticle composition can be about 70nm to about 100nm. In some embodiments, the average size can be about 80nm. In other embodiments, the average size can be about 100nm.
  • the composition of the nanoparticles can be relatively uniform.
  • the polydispersity index can be used to indicate the uniformity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition.
  • a small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution.
  • the nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25.
  • the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
  • Encapsulation efficiency represents the amount of the therapeutic and/or prophylactic agent encapsulated or combined with the nanoparticle composition after preparation, relative to the amount initially provided. High encapsulation efficiency (e.g., close to 100%) is desired. Encapsulation efficiency can be measured by comparing the amount of the therapeutic and/or prophylactic agent comprising the nanoparticle composition before decomposing the nanoparticle composition with one or more organic solvents or detergents and after decomposition in solution. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA) in solution.
  • RNA free therapeutic and/or prophylactic agent
  • the encapsulation efficiency of the therapeutic and/or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
  • the zeta potential of a nanoparticle composition can be used to indicate the electromotive force of the composition.
  • the zeta potential can describe the surface charge of a nanoparticle composition. It is generally desirable for a nanoparticle composition to have a relatively low positive or negative charge, because higher charged materials may interact adversely with cells, tissues, and other elements of the human body.
  • the zeta potential of a nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about -10 mV.
  • the RNA of self-replication can be prepared in liposomes.
  • the RNA of self-replication can be prepared in liposomes as described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety.
  • liposomes may include lipids that are conducive to the delivery pKa value of mRNA.
  • liposomes may have a substantially neutral surface charge at physiological pH, and therefore can be effectively used for immunization (see, for example, the liposomes described in International Publication No. WO20120067378, which is incorporated herein by reference in its entirety).
  • the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to formula (I) (and subformulae thereof) as described herein.
  • the nanoparticle composition may include a lipid component comprising one of the compounds provided herein.
  • the nanoparticle composition may also include one or more other lipid or non-lipid components as described below.
  • the nanoparticle compositions provided herein include, in addition to the lipids according to formula (I) (and subformulae thereof), one or more charged or ionizable lipids. It is contemplated that certain charged or zwitterionic lipid components of the nanoparticle compositions are similar to lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles.
  • Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the invention include, but are not limited to, 3-(docosylamino)-N1,N1,4-triacontyl-1-piperazineethylamine (KL10), N1-[2-(docosylamino)ethyl]-N1,N4,N4-triacontyl-1,4-piperazinedienamide (KL22), 14,25-tricosyl-15,18,21,24-tetraazaoctaconane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptaconitol ester (heptaconitol ester), tatriaconta)-6,9,28,31-t
  • Additional exemplary charged or ionizable lipids that form part of the nanoparticle compositions of the present invention include those described in Sabnis et al. “A Novel Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates”, Molecular Therapy Vol. 26 No 6, 2018, the entire contents of which are incorporated herein by reference.
  • suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[ (3-aminopropyl)amino]-4-[bis(3-amino-propyl)amino
  • Cationic lipids with charged head groups at physiological pH such as primary amines (e.g., DODAG N', N'-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC), bis-guanidinium trisaminoethylamine-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)) are also suitable.
  • primary amines e.g., DODAG N', N'-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide
  • guanidinium head groups e.g., bis-guanidinium-spermidine-cholesterol
  • Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl).
  • DODAPen-Cl a enantiomer or racemic form, and includes various salt forms (e.g., chlorides or sulfates) of the above cationic lipids.
  • the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate).
  • DOTAP-Cl N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride
  • DOTAP-sulfate N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate
  • the cationic lipid is an ionizable cationic lipid, such as (for example) dioctadecyl dimethyl ammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); heptathriacontane-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butyrate (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and morpholino cholesterol (Mo-CHOL).
  • the lipid nanoparticle includes a combination of two or more cationic lipid, such as (
  • the charged or ionizable lipid that can form part of the present nanoparticle composition is a lipid comprising a cyclic amine group.
  • Additional cationic lipids suitable for use in the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330 and WO2015011633, the entire contents of which are incorporated herein by reference in their entirety.
  • the lipid component of nanoparticle composition may include one or more polymer-conjugated lipids (polymer conjugated lipids), such as PEGylated lipids (PEG lipids). It is contemplated that the polymer conjugated lipid component in the nanoparticle composition can improve colloidal stability and/or reduce the protein absorption of nanoparticles.
  • polymer conjugated lipids such as PEGylated lipids (PEG lipids). It is contemplated that the polymer conjugated lipid component in the nanoparticle composition can improve colloidal stability and/or reduce the protein absorption of nanoparticles.
  • Exemplary cationic lipids that can be used in conjunction with the present disclosure include but are not limited to PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and mixtures thereof.
  • PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000 or Chol-PEG2000.
  • the polymer-conjugated lipid is a pegylated lipid.
  • pegylated diacylglycerol PEG-DAG
  • PEG-DMG 1-(monomethoxy-polyethylene glycol)-2,3-dimyristyl glycerol
  • PEG-PE pegylated phosphatidylethanolamine
  • PEG succinic diacylglycerol PEG-S-DAG
  • the polymer-conjugated lipid is present at a molar concentration of 1.0 to 2.5%. In one embodiment, the polymer-conjugated lipid is present at a molar concentration of about 1.7%. In one embodiment, the polymer-conjugated lipid is present at a molar concentration of about 1.5%.
  • the molar ratio of cationic lipid to polymer-conjugated lipid is about 35:1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 100:1 to about 20:1.
  • the PEGylated lipid has the formula:
  • R 12 and R 13 are each independently a linear or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds;
  • the average value of w is between 30 and 60.
  • R 12 and R 13 are each independently a linear saturated alkyl chain containing 12 to 16 carbon atoms.
  • w is in the range of 42 to 55 on average, for example, w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55 on average. In a specific embodiment, the average w is about 49.
  • the PEGylated lipid has the formula:
  • the average value of w is about 49.
  • the lipid component of the nanoparticle composition may include one or more structural lipids. It is contemplated that the structural lipids can stabilize the amphipathic structure of the nanoparticles, such as, but not limited to, the lipid bilayer structure of the nanoparticles. Exemplary structural lipids that can be used in conjunction with the present disclosure include, but are not limited to, cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (e.g., prednisolone, dexamethasone, prednisone and hydrocortisone) or a combination thereof.
  • corticosteroids e.g., prednisolone, dexamethasone, prednisone and hydrocortisone
  • the lipid nanoparticles provided herein include a steroid or a steroid analog.
  • the steroid or steroid analog is cholesterol.
  • the molar concentration range of the presence of the steroid is 39-49%, 40-46%, 40-44%, 40-42%, 42-44% or 44-46%.
  • the steroid is present at a molar concentration of 40, 41, 42, 43, 44, 45 or 46%.
  • the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is about 5:1 to 1:1. In one embodiment, the steroid is present at a molar concentration of 32-40% of the steroid.
  • the lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. It is contemplated that the phospholipids may assemble into one or more lipid bilayer structures.
  • Exemplary phospholipids that may form part of the present nanoparticle composition include, but are not limited to, 1,2-distearoyl-sn- Glycerol-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-heneicosanoyl-sn-glycerophosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycer
  • exemplary neutral lipids include dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1 carboxylate (DOPE-mal), dipalmitoylphosphatidylphosphatidylethanolamine (DPPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE) and 1,2-divaleryl-sn-glycero-3-phosphoethanolamine (transDOPE).
  • DPPG dipalmitoylphosphatidylglycerol
  • POPE palmitoyloleoyl-phosphatidylethanolamine
  • POPE palmitoylole
  • the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
  • DSPC 1,2-distearoyl-sn-glycero-3-phosphocholine
  • the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA) or phosphatidylglycerol (PG).
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PS phosphatidylserine
  • PA phosphatidic acid
  • PG phosphatidylglycerol
  • Additional phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017/112865, the entire contents of which are incorporated herein by reference in their entirety.
  • Nanoparticle compositions as described herein may further comprise one or more therapeutic and/or prophylactic agents. These therapeutic and/or prophylactic agents are sometimes referred to as “therapeutic payloads” or “payloads” in the present disclosure. In some embodiments, nanoparticles may be used as delivery vehicles to administer therapeutic payloads in vivo or in vitro.
  • the nanoparticle composition comprises a small molecule compound (e.g., a small molecule drug) as a therapeutic payload, for example, antineoplastic agents (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g., actinomycin D, vincristine, vinblastine, cytarabine, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs such as methotrexate, purine and pyrimidine analogs), anti-infective agents, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol and labetalol), antihyper
  • the therapeutic payload comprises a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, and/or another therapeutic and/or prophylactic agent.
  • Cytotoxins or cytotoxic agents include any Any substance that may be harmful to cells.
  • Examples include, but are not limited to, paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthraquinone, ketomethoate, 1-nortestosterone, oryzalin, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoid, maytansinol, rachetomycin (CC-1065) and its analogs or homologues.
  • Radioactive ions include, but are not limited to, iodine (such as iodine 125 or iodine 131), strontium 89, phosphorus, palladium, cesium, iridium, phosphate, cobalt, yttrium 90, samarium 153 and praseodymium.
  • the therapeutic payload of the present nanoparticle compositions can include, but are not limited to, therapeutic and/or prophylactic agents such as antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil, dacarbazine), alkylating agents (e.g., mechlorethamine, chlorambucil, racletin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., Dactinomycin (formerly actinomycin), bleomycin,
  • the nanoparticle composition comprises biomolecules such as peptides and polypeptides as therapeutic payloads.
  • the biomolecules forming part of the nanoparticle composition can be of natural or synthetic origin.
  • the therapeutic payload of the nanoparticle composition may include, but is not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), factor VIR, luteinizing hormone releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, cholera vaccine, and peptides and polypeptides.
  • the nanoparticle composition comprises one or more nucleic acid molecules (such as DNA or RNA molecules) as a therapeutic payload.
  • nucleic acid molecules such as DNA or RNA molecules
  • Exemplary forms of nucleic acid molecules that can be included in the present nanoparticle composition as a therapeutic payload include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), and hybrid forms thereof, RNAi inducers, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like.
  • the therapeutic payload comprises RNA.
  • RNA molecules that can be included in the nanoparticle composition of the present invention as a therapeutic payload include, but are not limited to, short isomers, agonists (agomir), antagonists (antagomir), antisense molecules, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA) and other forms of RNA molecules known in the art.
  • the RNA is mRNA.
  • the nanoparticle composition comprises siRNA molecules as therapeutic payloads.
  • the siRNA molecules can selectively interfere with and downregulate the expression of target genes.
  • the siRNA payload can selectively silence genes associated with specific diseases, disorders or conditions.
  • the siRNA molecule comprises a sequence complementary to the mRNA sequence encoding the target protein product.
  • the siRNA molecule is an immunomodulatory siRNA.
  • the nanoparticle composition comprises a shRNA molecule or a vector encoding a shRNA molecule as a therapeutic payload.
  • the therapeutic payload produces shRNA inside the target cell after being administered to the target cell. Constructs and mechanisms associated with shRNA are known in the art.
  • nanoparticle compositions include mRNA molecules as therapeutic payloads.
  • the mRNA molecules encode target polypeptides, including any naturally or non-naturally occurring or modified polypeptides.
  • the polypeptides encoded by the mRNA can have any size and can have any secondary structure or activity.
  • the polypeptides encoded by the mRNA payload when expressed in cells, can have a therapeutic effect.
  • the nucleic acid molecules of the present disclosure include mRNA molecules.
  • the nucleic acid molecules include at least one coding region (such as an open reading frame (ORF)) encoding a peptide or polypeptide of interest.
  • the nucleic acid molecules further include at least one untranslated region (UTR).
  • the untranslated region (UTR) is located upstream (5' end) of the coding region, referred to herein as 5'-UTR.
  • the untranslated region (UTR) is located downstream (3' end) of the coding region, referred to herein as 3'-UTR.
  • the nucleic acid molecules include 5'-UTR and 3'-UTR simultaneously. In some embodiments, 5'-UTR includes a 5'-cap structure. In some embodiments, the nucleic acid molecules include a Kozak sequence (e.g., in 5'-UTR). In some embodiments, the nucleic acid molecules include a poly-A region (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecules include a polyadenylic acid signal (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecules include a conserved region (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecules include a secondary structure.
  • the secondary structure is a stem loop.
  • the nucleic acid molecule comprises a stem loop sequence (e.g., in a 5'-UTR and/or a 3'-UTR).
  • the nucleic acid molecule comprises one or more intron regions that can be excised during splicing.
  • the nucleic acid molecule comprises one or more regions selected from a 5'-UTR and a coding region.
  • the nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR.
  • the nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region, and a 3'-UTR.
  • nucleic acid molecules of the present disclosure include at least one coding region.
  • the coding region is an open reading frame (ORF) encoding a single peptide or protein.
  • the coding region includes at least two ORFs, each ORF encoding a peptide or protein.
  • the coding region includes more than one ORF, the peptides and/or proteins encoded by the ORFs may be identical or different from each other.
  • a plurality of ORFs in the coding region are separated by non-coding sequences.
  • the non-coding sequence separating two ORFs includes an internal ribosome entry site (IRES).
  • an internal ribosome entry site can serve as a unique ribosome binding site, or as one of multiple ribosome binding sites of mRNA.
  • An mRNA molecule containing more than one functional ribosome binding site can encode several peptides or polypeptides (such as polycistronic mRNA) independently translated by ribosomes. Therefore, in some embodiments, nucleic acid molecules (such as mRNA) of the present disclosure include one or more internal ribosome entry sites (IRES).
  • IRES sequences that can be used in conjunction with the present disclosure include, but are not limited to, sequences from microtumor viruses (such as FMDV), pest viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), hand, foot and mouth virus (FMDV), hepatitis C virus (HCV), classical swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV) or paralysis virus (CrPV).
  • microtumor viruses such as FMDV
  • CFFV pest viruses
  • PV polioviruses
  • ECMV encephalomyocarditis viruses
  • HCV hepatitis C virus
  • CSFV classical swine fever virus
  • MLV murine leukemia virus
  • SIV simian immunodeficiency virus
  • CrPV paralysis virus
  • the nucleic acid molecules of the present invention encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins.
  • the peptides and proteins encoded by the nucleic acid molecules can be the same or different.
  • the nucleic acid molecules of the present disclosure encode dipeptides (such as carnosine and anserine).
  • the nucleic acid molecules encode tripeptides.
  • the nucleic acid molecules encode tetrapeptides.
  • the nucleic acid molecules encode pentapeptides.
  • the nucleic acid molecules encode hexapeptides.
  • the nucleic acid molecules encode heptapeptides.
  • the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 150 amino acids.
  • the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.
  • the length of the nucleic acid molecules of the present disclosure is at least about 30 nucleotides (nt). In some embodiments, the length of the nucleic acid molecules is at least about 35nt. In some embodiments, the length of the nucleic acid molecules is at least about 40nt. In some embodiments, the length of the nucleic acid molecules is at least about 45nt. In some embodiments, the length of the nucleic acid molecules is at least about 50nt. In some embodiments, the length of the nucleic acid molecules is at least about 55nt. In some embodiments, the length of the nucleic acid molecules is at least about 60nt. In some embodiments, the length of the nucleic acid molecules is at least about 65nt.
  • the length of the nucleic acid molecules is at least about 70nt. In some embodiments, the length of the nucleic acid molecules is at least about 75nt. In some embodiments, the length of the nucleic acid molecules is at least about 80nt. In some embodiments, the length of the nucleic acid molecules is at least about 85nt. In some embodiments, the length of the nucleic acid molecules is at least about 90nt. In some embodiments, the length of the nucleic acid molecules is at least about 95nt. In some embodiments, the length of the nucleic acid molecules is at least about 100nt. In some embodiments, the length of the nucleic acid molecules is at least about 120nt.
  • the length of the nucleic acid molecules is at least about 140nt. In some embodiments, the length of the nucleic acid molecule is at least about 160nt. In some embodiments, the length of the nucleic acid molecule is at least about 180nt. In some embodiments, the length of the nucleic acid molecule is at least about 200nt. In some embodiments, the length of the nucleic acid molecule is at least about 250nt. In some embodiments, the length of the nucleic acid molecule is at least about 300nt. In some embodiments, the length of the nucleic acid molecule is at least about 400nt. In some embodiments, the length of the nucleic acid molecule is at least about 500nt.
  • the length of the nucleic acid molecule is at least about 600nt. In some embodiments, the length of the nucleic acid molecule is at least about 700nt. In some embodiments, the length of the nucleic acid molecule is at least about 800nt. In some embodiments, the length of the nucleic acid molecule is at least about 900nt. In some embodiments, the length of the nucleic acid molecule is at least about 1000nt. In some embodiments, the length of the nucleic acid molecule is at least about 1100nt. In some embodiments, the length of the nucleic acid molecule is at least about 1200nt. In some embodiments, the length of the nucleic acid molecule is at least about 1300nt.
  • the length of the nucleic acid molecule is at least about 1400nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900nt. In some embodiments, the length of the nucleic acid molecule is at least about 2000nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500nt.
  • the length of the nucleic acid molecule is at least about 3000nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000nt.
  • the therapeutic payload comprises a vaccine composition as described herein (e.g., a genetic vaccine).
  • the therapeutic payload comprises a compound capable of eliciting immunity to one or more target conditions or diseases.
  • the target symptoms are associated with, for example, coronavirus (e.g., 2019-nCoV), influenza, measles,
  • coronavirus e.g., 2019-nCoV
  • influenza e.g., influenza
  • measles e.g., influenza
  • the invention relates to pathogens such as human papillomavirus (HPV), rabies, meningitis, pertussis, tetanus, plague, hepatitis and tuberculosis or infections caused by them.
  • the therapeutic payload comprises a nucleic acid sequence (such as mRNA) encoding a pathogenic protein characteristic of the pathogen or an antigenic fragment or epitope thereof.
  • a nucleic acid sequence such as mRNA
  • the encoded pathogenic protein or its antigenic fragment or epitope is expressed, thereby inducing immunity against the pathogen in the subject.
  • the target disorder is associated with or caused by the neoplastic growth of cells, such as cancer.
  • the therapeutic payload comprises a nucleic acid sequence (such as mRNA) encoding a tumor-associated antigen (TAA) or an antigenic fragment or epitope thereof characteristic of cancer.
  • TAA tumor-associated antigen
  • the vaccine after being administered to a vaccinated subject, expresses the encoded TAA (or its antigenic fragment or epitope), thereby inducing immunity against tumor cells expressing the TAA in the subject.
  • the 5'-cap structure of the polynucleotide participates in nuclear export and improves the stability of the polynucleotide, and binds to the mRNA cap binding protein (CBP) in the cell that is responsible for the stability of the polynucleotide.
  • CBP mRNA cap binding protein
  • the binding of CBP to the poly-A binding protein forms a mature circular mRNA, thereby obtaining translation ability.
  • the 5'-cap structure further assists in the removal of the 5'-end intron during the mRNA splicing process. Therefore, in some embodiments, the nucleic acid molecule of the present disclosure comprises a 5'-cap.
  • Nucleic acid molecules may be 5'-capped by the cell's endogenous transcriptional machinery, thereby generating a 5'-ppp-5'-triphosphate bond between the guanine cap terminal residue and the 5'-transcribed sense nucleotide of the polynucleotide. This 5'-guanylate cap is then methylated to generate an N7-methyl-guanylate residue.
  • the ribose sugars of the terminal and/or pre-terminal transcribed nucleotides at the 5' end of the polynucleotide may also be optionally 2'-O-methylated.
  • 5'-decapping by hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.
  • the nucleic acid molecules of the present disclosure comprise one or more alterations of a native 5'-cap structure produced by an endogenous process. Modifications to the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and can improve the translation efficiency of the polynucleotide.
  • Exemplary changes to the native 5'-Cap structure include creating a non-hydrolyzable cap structure, thereby preventing decapping and increasing the half-life of the polynucleotide.
  • modified nucleotides can be used during the capping reaction.
  • Vaccinium capping enzyme from New England Biolabs can be used with ⁇ -thioguanosine nucleotides to generate a phosphorothioate bond in the 5'-ppp-5' according to the manufacturer's instructions.
  • Other modified guanosine nucleotides such as ⁇ -methylphosphonate and selenophosphate nucleotides, can also be used.
  • exemplary alterations of the native 5'-Cap structure include modifications at the 2'- and/or 3'-positions of the capping guanosine triphosphate (GTP), replacement of the sugar ring oxygen (oxygen participating in the carbon ring) with a methylene moiety (CH2), modifications of the triphosphate bridge portion of the cap structure, or modifications of the nucleobase (G) portion.
  • GTP capping guanosine triphosphate
  • CH2 methylene moiety
  • modifications of the triphosphate bridge portion of the cap structure modifications of the nucleobase (G) portion.
  • exemplary changes to the natural 5'-cap structure include, but are not limited to, 2'-O-methylation of the 5'-end of the polynucleotide and/or the 5'-terminal nucleic acid on the 2'-hydroxyl of the ribose, which can generate multiple different 5'-cap structures of polynucleotides (e.g., mRNA molecules).
  • Additional exemplary 5'-cap structures that can be used in conjunction with the present disclosure also include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of which are incorporated herein by reference.
  • the 5'-cap may include a cap analog.
  • Cap analogs also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, are chemically different from the natural (i.e., endogenous, wild-type or physiological) 5'-cap structure while retaining the function of the cap.
  • Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and/or attached to a polynucleotide.
  • the reverse reverse cap analog (ARCA) cap comprises two guanosines linked by a 5'-5'-triphosphate group, wherein one of the guanosines comprises an N7-methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G-3'mppp-G, which can be equivalently referred to as 3'O-Me-m7G(5')ppp(5')G).
  • the 3'-O atom of the other unchanged guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA).
  • N7- and 3'-O-methylated guanosines provide the terminal portion of the capped polynucleotide (e.g., mRNA).
  • mCAP is similar to ARCA but has a 2'-O-methyl group on guanosine (ie, N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm -ppp-G).
  • the cap analog can be a dinucleotide cap analog.
  • the dinucleotide cap analog can be modified with a borate phosphate group or a phosphoselenate group at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Pat. No.: 8,519,110, the entire contents of which are incorporated herein by reference.
  • the cap analog can be a N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and/or described herein.
  • Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (e.g., see Kore et al.
  • the cap analog useful for the nucleic acid molecules of the present disclosure is a 4-chloro/bromophenoxyethyl analog.
  • the cap analog may include a guanosine analog.
  • Available guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido.
  • cap analogs allow simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped.
  • This structural difference of cap analogs from the natural 5'-cap structure of polynucleotides generated from the cell's endogenous transcription machinery may result in reduced translational capacity and reduced cellular stability.
  • the nucleic acid molecules of the present disclosure may also be capped after transcription using enzymes to produce a more realistic 5'-cap structure.
  • more realistic refers to features that closely reflect or mimic endogenous or wild-type features in structure or function. That is, compared to synthetic or analogs of the prior art, "more realistic" features represent better endogenous, wild-type, natural or physiological cell functions and/or structures, or their performance is better than the corresponding endogenous, wild-type natural type, natural or physiological features in one or more aspects.
  • Non-limiting examples of more realistic 5'-cap structures used in conjunction with nucleic acid molecules of the present disclosure are those with enhanced binding of cap-binding proteins, increased half-life, and reduced sensitivity to 5'.
  • ⁇ -endonuclease reduces 5'-decapping.
  • a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can generate a canonical 5'-5'-triphosphate bond between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide.
  • the cap guanine contains an N7-methylation, while the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl group.
  • Cap1 This structure is referred to as a Cap1 structure.
  • this cap results in higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines.
  • Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p(Cap 0), 7mG(5')ppp(5')NlmpNp(Cap 1), 7mG(5')-ppp(5')NlmpN2mp(Cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up(Cap 4).
  • nucleic acid molecules of the present disclosure can be capped after transcription and because the process is more efficient, nearly 100% of the nucleic acid molecules can be capped.
  • the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs).
  • the UTR is located upstream of the coding region of the nucleic acid molecule, referred to as the 5'-UTR.
  • the UTR is located downstream of the coding region of the nucleic acid molecule, referred to as the 3'-UTR.
  • the sequence of the UTR may be homologous or heterologous to the sequence of the coding region in the nucleic acid molecule.
  • the nucleic acid molecule may include multiple UTRs, which may have the same or different sequences and/or genetic origins. According to the present disclosure, any part of the UTR in the nucleic acid molecule (including the absence thereof) may be codon optimized, and one or more different structural or chemical modifications may be independently included, before and/or after codon optimization.
  • nucleic acid molecules (such as mRNA) of the present disclosure comprise UTRs and coding regions that are homologous to each other. In other embodiments, nucleic acid molecules (such as mRNA) of the present disclosure comprise UTRs and coding regions that are heterologous to each other.
  • nucleic acid molecules comprising UTRs and detectable probe coding sequences can be administered in vitro (e.g., in cell or tissue culture) or in vivo (e.g., to a subject). And the effects of UTR sequences (such as regulation of expression levels, cellular localization of the encoded product, or half-life of the encoded product) can be detected using methods known in the art.
  • the UTR of the nucleic acid molecule (such as mRNA) of the present disclosure comprises at least one translation enhancer element (TEE), which acts to increase the polypeptide or protein yield produced from the nucleic acid molecule.
  • TEE translation enhancer element
  • the TEE is located in the 5'-UTR of the nucleic acid molecule.
  • the TEE is located at the 3'-UTR of the nucleic acid molecule.
  • at least two TEEs are located at the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively.
  • the nucleic acid molecule (such as mRNA) of the present disclosure may comprise one or more copies of a TEE sequence or comprise more than one different TEE sequence.
  • the different TEE sequences in the nucleic acid molecule may be homologous or heterologous to each other.
  • the TEE can be an internal ribosome entry site (IRES), HCV-IRES or an IRES element.
  • IRES internal ribosome entry site
  • Additional internal ribosome entry sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No.
  • TEEs can be those described in Supplementary Tables 1 and 2 of Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8): 747–750, the contents of which are incorporated herein by reference in their entirety.
  • Additional exemplary TEEs that can be used in conjunction with the present disclosure include, but are not limited to, those disclosed in U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009/0226470, U.S. Patent Publication No. 2013/0177581, U.S. Patent Publication No. 2007/0048776, U.S. Patent Publication No. 2011/0124100, U.S. Patent Publication No.
  • the nucleic acid molecules (such as mRNA) of the present disclosure comprise at least one UTR comprising at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25
  • the TEE sequence in the UTR of the nucleic acid molecule is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of the nucleic acid molecule have different sequences.
  • a plurality of different TEE sequences are arranged in the UTR region of the nucleic acid molecule in one or more repetitive patterns.
  • the repetitive pattern can be, for example, ABABAB, ABABBAABBAABB, ABCABCABC, etc., wherein in these exemplary patterns, each capital letter (A, B or C) represents a different TEE sequence.
  • at least two TEE sequences are continuous with each other in the UTR of the nucleic acid molecule (ie, there is no spacer sequence between them). In other embodiments, at least two TEE sequences are separated by a spacer sequence.
  • the UTR can comprise a TEE sequence-spacer sequence module that is repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times.
  • the UTR can be a 5'-UTR, a 3'-UTR, or both a 5'-UTR and a 3'-UTR of a nucleic acid molecule.
  • the UTR of the nucleic acid molecule (such as mRNA) of the present disclosure comprises at least one translation inhibition element, the function of which is to reduce the amount of the polypeptide or protein produced from the nucleic acid molecule.
  • the UTR of the nucleic acid molecule comprises one or more miR sequences or fragments thereof (such as miR seed sequences) recognized by one or more microRNAs.
  • the UTR of the nucleic acid molecule comprises one or more stem-loop structures that downregulate the translation activity of the nucleic acid molecule. Other mechanisms for inhibiting the translation activity associated with the nucleic acid molecule are known in the art. In any embodiment described in this paragraph, the UTR can be the 5'-UTR, 3'-UTR, or both the 5'-UTR and 3'-UTR of the nucleic acid molecule.
  • poly-A adenosine nucleotides
  • mRNA messenger RNA
  • Poly-A polymerase then adds chains of adenosine nucleotides to the RNA. This process is called polyadenylation, and a poly-A region of 100 to 250 residues in length is added. It is contemplated that the poly-A region can confer a variety of advantages to the nucleic acid molecules of the present invention.
  • nucleic acid molecules (such as mRNA) of the present disclosure comprise polyadenylation signals.
  • nucleic acid molecules (such as mRNA) of the present disclosure comprise one or more polyadenylation (poly-A) regions.
  • the poly-A region is entirely composed of adenine nucleotides or functional analogs thereof.
  • the nucleic acid molecule comprises at least one poly-A region at its 3' end.
  • the nucleic acid molecule comprises at least one poly-A region at its 5' end.
  • the nucleic acid molecule comprises at least one poly-A region at its 5' end and at least one poly-A region at its 3' end.
  • the poly-A region can have varying lengths.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 30 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 35 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 40 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 45 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 50 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 55 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 60 nucleotides. In some embodiments, The length of the poly-A region of the nucleic acid molecule of the disclosure is at least 65 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 70 nucleotides.
  • the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 75 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 80 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 85 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 90 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 95 nucleotides.
  • the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 100 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 110 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecule of the disclosure is at least 120 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 130 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 140 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 150 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 160 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 170 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 180 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 190 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 200 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 225 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 250 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 275 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 300 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 350 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 450 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 600 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 700 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 800 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 900 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1000 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1100 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1200 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1300 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1600 nucleotides.
  • the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1700 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1800 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1900 nucleotides. In some embodiments, the nucleic acids of the present disclosure In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2250 nucleotides in length.
  • the poly-A region of the nucleic acid molecules of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 3000 nucleotides in length.
  • the length of the poly-A region in the nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof (e.g., the length of the coding region or the length of the open reading frame).
  • the poly-A region accounts for about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule containing the poly-A region.
  • RNA binding proteins can bind to the poly-A region located at the 3' end of the mRNA molecule.
  • These poly-A binding proteins PABPs
  • PABPs poly-A binding proteins
  • the nucleic acid molecules (such as mRNA) of the present disclosure include at least one binding site for a poly-A binding protein (PABP).
  • PABP poly-A binding protein
  • the nucleic acid molecules are conjugated or complexed with PABP before being loaded into a delivery vehicle (e.g., lipid nanoparticle).
  • nucleic acid molecules (such as mRNA) of the present disclosure comprise poly-A-G tetramers.
  • G tetramers are cyclic hydrogen-bonded arrays of four guanosine nucleotides that can be formed by G-rich sequences in DNA and RNA.
  • the G tetramers are bound to the ends of the poly-A region.
  • the stability, protein production, and other parameters of the resulting polynucleotides (such as mRNA) can be measured, including half-life at different time points. Studies have shown that the protein yield produced by the polyA-G tetramer structure is at least equal to 75% of the protein yield produced by the poly-A region of 120 nucleotides alone.
  • the nucleic acid molecules (such as mRNA) of the present disclosure may include a poly-A region and may be stabilized by adding a 3' stabilizing region.
  • the 3' stabilizing region that can be used to stabilize nucleic acid molecules (such as mRNA) includes a poly-A or poly-A-G tetramer structure, which is described in International Patent Publication No. WO2013/103659, which is incorporated herein by reference in its entirety.
  • 3' stabilizing regions that can be used in conjunction with the nucleic acid molecules of the present disclosure include chain terminating nucleosides, such as, but not limited to, 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides or O-methyl nucleosides, 3'-deoxynucleosides, 2',3'-dideoxynucleosides 3'-O-methyl nucleosides, 3'-O-ethyl nucleosides,
  • the stem-loop structure can guide RNA folding, protect the structural stability of nucleic acid molecules (such as mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions.
  • nucleic acid molecules such as mRNA
  • TEE sequences will change the shape of the stem-loop region, which may increase and/or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).
  • the nucleic acid molecules described herein may adopt a stem-loop structure, such as but not limited to a histone stem-loop.
  • the stem-loop structure is formed by a stem-loop sequence of about 25 or about 26 nucleotides in length, which may be but not limited to those described in International Patent Publication No. WO2013/103659, which is incorporated herein by reference in its entirety.
  • Other examples of stem-loop sequences include those described in International Patent Publication No. WO2012/019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. Incorporated herein.
  • the stem-loop sequence comprises TEE as described herein. In some embodiments, the stem-loop sequence comprises a miR sequence as described herein. In a specific embodiment, the stem-loop sequence may include a miR-122 seed sequence. In a specific embodiment, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).
  • the nucleic acid molecules (such as mRNA) of the present disclosure include a stem-loop sequence located upstream (5' end) of the nucleic acid molecule coding region. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecules (such as mRNA) of the present disclosure include a stem-loop sequence located downstream (3' end) of the nucleic acid molecule coding region. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may include more than one stem-loop sequence. In some embodiments, the nucleic acid molecule includes at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.
  • the nucleic acid molecule comprising the stem-loop structure further comprises a stabilization region.
  • the stabilization region comprises at least one chain termination nucleoside, which acts to slow down degradation and thus increases the half-life of the nucleic acid molecule.
  • Exemplary chain termination nucleoside that can be used in conjunction with the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymidine, 2', 3'-dideoxynucleoside, 2', 3'-dideoxyadenosine, 2', 3'-dideoxyuridine, 2', 3'-dideoxycytosine, 2', 3'-dideoxyguanosine, 2', 3'-dideoxythymidine, 2'-deoxynucleoside or O-methyl nucleoside, 3'-deoxynucleoside, 2', 3'-dideoxynucleoside 3'-O-methyl nucleoside, 3'-O-ethyl nucleoside, 3'-arabinoside, other alternative nucleoside described herein or known in the art.
  • the stem-loop structure can be stabilized by altering the 3' region of the polynucleotide, which alterations can prevent and/or inhibit the addition of oligio(U) (International Patent Publication No. WO2013/103659, which is incorporated herein by reference in its entirety).
  • the nucleic acid molecules of the present disclosure include at least one stem-loop sequence and a poly-A region or a polyadenylation signal.
  • Non-limiting examples of polynucleotide sequences including at least one stem-loop sequence and a poly-A region or a polyadenylation signal are included in International Patent Publication No. WO2013/120497, International Patent Publication No. WO2013/120629, International Patent Publication No. WO2013/120500, International Patent No. WO2013/120627, International Patent No. WO2013/120498, International Patent Publication No. WO2013/120626, International Patent Publication No. WO2013/120499 and International Patent Publication No. WO2013/120628, the entire contents of which are incorporated herein by reference in their entirety.
  • a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a pathogen antigen or a fragment thereof, as described in International Patent Publication No. WO2013/120499 and International Patent Publication No. WO2013/120628, the contents of which are incorporated herein by reference in their entirety.
  • a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a therapeutic protein, as described in International Patent Publication No. WO2013/120497 and International Patent Publication No. WO2013/120629, the contents of which are incorporated herein by reference in their entirety.
  • a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a tumor antigen or a fragment thereof, as described in International Patent Publication No. WO2013/120500 and International Patent Publication No. WO2013/120627, the contents of which are incorporated herein by reference in their entirety.
  • a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, as described in International Patent Publication No. WO2013/120498 and International Patent Publication No. WO2013/120626, the contents of which are incorporated herein by reference in their entirety.
  • a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, as described in International Patent Publication No. WO2013/120498 and International Patent Publication No. WO2013/120626, the contents of which are incorporated herein by reference in their entirety.
  • the payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein.
  • the functional nucleotide analog comprises at least one chemical modification to a nucleobase, a sugar group and/or a phosphate group. Therefore, the payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to a nucleobase, a sugar group and/or a nucleoside bond. Exemplary chemical modifications to a nucleobase, a sugar group or a nucleoside bond of a nucleic acid molecule are provided herein.
  • nucleotides in the payload nucleic acid molecule can range from 0% to 100% as functional nucleotide analogs as described herein.
  • the functional nucleotide analogs can be present at any position of the nucleic acid molecule, including the 5'-end, the 3'-end and/or one or more internal positions.
  • a single nucleic acid molecule can contain different sugar modifications, different core base modifications and/or different types of nucleoside bonds (such as backbone structures).
  • 0% to 100% of all nucleotides of one type can be functional nucleotide analogs as described herein.
  • nucleic acid molecule can contain different sugar modifications, different core base modifications and/or different types of nucleoside bonds (such as backbone structures).
  • the functional nucleotide analogs include non-standard nucleobases.
  • standard nucleobases e.g., adenine, guanine, uracil, thymine and cytosine
  • Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including but not limited to alkyl, aryl, halogen, oxo, hydroxyl, alkoxy and/or thio substitutions; one or more fused rings or ring openings, oxidation and/or reduction.
  • the non-standard nucleobase is a modified uracil.
  • exemplary nucleobases and nucleosides having modified uracils include pseudouridine ( ⁇ ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (S 2 U), 4-thio-uracil (S 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromouracil), 3-methyluracil (m 3 U), 5-methoxyuracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (c
  • Um 1-thio-uracil, deoxythymidine, 5-(2-carbonylmethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thiouracil, 5-carbamoyl-2-thiouracil, 5-cyanomethyluracil, 5-methoxy-2-thiouracil and 5-3-(1-E-propyleneamino)uracil.
  • the non-standard nucleobase is a modified cytosine.
  • exemplary nucleobases and nucleosides with modified cytosine include 5-azacytosine, 6-azacytosine, pseudoisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolocytosine, pyrrolopseudoisocytidine, 2-thiocytosine nucleoside (s2C), 2-thio-5-methylcytosine nucleoside, 4-thio-pseudo Isocytidine, 4-thio-1-methyl-pseu
  • the non-standard nucleobase is a modified adenine.
  • exemplary nucleobases and nucleosides having a substituted adenine include 2-aminopurine, 2,6-diaminopurine, 2-amino-6-halopurine (e.g., 2-amino-6-chloropurine), 6-halopurine (e.g., 6-chloropurine), 2-amino-6-methylpurine, 8-azidoadenine, 7-deazaadenine, 7-deaza-8-azaadenine, 7-deaza-2-aminopurine, 7-deaza-8-nitrogen-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-nitrogen-2,6 -diaminopurine, 1-methyladenine (m1A), 2-methyladenine (m2A), N6-methyladenine (m6A), 2-methylthio-N6-methyla
  • the non-standard nucleobase is a modified guanine.
  • exemplary nucleobases and nucleosides with modified guanine include inosine (I), 1-methylinosine (m1I), inosine (imG), methylinosine (mimG), 4-demethylinosine (imG-14), isotyrosine (imG2), wybutosine (yW), peroxotyrosine (o2yW), hydroxytyrosine (OHyW), undermodified hydroxytyrosine (OHyW*), 7-deazaguanine, quercetin ( Q), epoxyquinone (oQ), galactosylquinone (galQ), mannosylquinone, 7-cyano-7-deazaguanine (preQO), 7-aminomethyl-7-deazaguanine (preQ1), archaeoalkaloids (G+), 7-deaza8-azaguanine, 6-thioguanine
  • the non-standard nucleobase of the functional nucleotide analog can be independently a purine, a pyrimidine, a purine or a pyrimidine analog.
  • the non-standard nucleobase can be a modified adenine, cytosine, guanine, uracil or hypoxanthine.
  • the non-standard nucleobase can also include, for example, naturally occurring and synthetic derivatives of the base, including pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g.
  • the functional nucleotide analogs include non-standard sugar groups.
  • the non-standard sugar group can be a 5-carbon or 6-carbon sugar (e.g., pentose, ribose, arabinose, xylose, glucose, galactose or its deoxy derivatives) with one or more substituents, and the substituents can be halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido groups, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, etc.
  • RNA molecules typically contain a ribose group, which is a five-membered ring with an oxygen.
  • exemplary non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or an alkylene group such as methylene or ethylene); addition of double bonds (e.g., replacement of ribose with a cyclopentenyl or cyclohexenyl group); ring closure of ribose (e.g., to form a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring with additional carbon atoms or heteroatoms, such as anhydrohexitol, arabitol, mannitol, cyclohexyl, cyclohexenyl, and morpholino (also with a phosphoramidate backbone)
  • the sugar group comprises one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose.
  • the nucleic acid molecule may include nucleotides containing, for example, arabinose or L-ribose as sugars.
  • the nucleic acid molecule includes at least one nucleoside wherein the sugar is L-ribose, 2'-O-methyl ribose, 2'-fluororibose, arabinose, hexitol, LNA or PNA.
  • the payload nucleic acid molecules of the present disclosure may comprise one or more modified nucleoside bonds (eg, phosphate backbones).
  • the phosphate groups of the backbone may be altered by replacing one or more oxygen atoms with different substituents.
  • functional nucleotide analogs may include another nucleoside bond to replace the unchanged phosphate moiety.
  • the example of the phosphate group of substitution includes but is not limited to phosphorothioate, phosphite selenate, boric acid phosphate, boric acid phosphate, phosphonate hydrogen, phosphoramidate, phosphorodiamino ester, alkyl or aryl phosphonate and phosphotriester.
  • Two non-connected oxygens of phosphorodithioate are all replaced by sulfur. It is also possible to connect the phosphate bond of change by replacing oxygen with nitrogen (phosphoramidate of bridge), sulfur (phosphorothioate of bridge) and carbon (methylene phosphonate of bridge).
  • nucleosides and nucleotides include borane moieties (BH 3 ), sulfur (thio), methyl, ethyl and/or methoxy groups in place of one or more non-bridging oxygens.
  • two non-bridging oxygens at the same position can be substituted with sulfur (thio) and methoxy groups.
  • the stability of RNA and DNA is enhanced (e.g., against exonucleases and endonucleases) with non-natural thiophosphate backbone linkages by substitution of one or more oxygen atoms at the position of the phosphate moiety (such as ⁇ -phosphorothioate).
  • Phosphorothioate DNA and RNA have enhanced nuclease resistance and therefore have a longer half-life in the cellular environment.
  • nucleoside bonds for use in accordance with the present disclosure include nucleoside bonds that do not contain a phosphorus atom.
  • nucleic acid molecules such as mRNA
  • compositions, formulations and/or methods related thereto that can be used in conjunction with the present disclosure are further included in WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/0047 43, WO2005/016376, WO2006/024518, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO2011026641, WO2011/144358, WO2012019780, WO2012013326, WO20 12089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO20131436
  • the nanoparticle compositions described herein may include at least one lipid component and one or more other components, such as therapeutic and/or prophylactic agents.
  • the nanoparticle compositions may be designed for one or more specific applications or targets.
  • the elements of the nanoparticle compositions may be selected based on a specific application or target and/or based on the efficacy, toxicity, cost, ease of use, availability or other characteristics of one or more elements.
  • a specific formulation of the nanoparticle composition may be selected for a specific application or target based on the efficacy and toxicity of a specific combination of elements.
  • the lipid component of the nanoparticle composition may include lipids of formula (I) (and its subformulae) as described herein, phospholipids (e.g., unsaturated lipids such as DOPE or DSPC, etc.), PEG lipids, and structural lipids.
  • phospholipids e.g., unsaturated lipids such as DOPE or DSPC, etc.
  • PEG lipids e.g., PEG lipids
  • structural lipids e.g., structural lipids.
  • the elements of the lipid component may be provided in specific ratios.
  • a nanoparticle composition comprising a cationic or ionizable lipid compound, a therapeutic agent and one or more excipients provided herein.
  • a cationic or ionizable lipid compound comprises a compound of formula (I) (and its subformula) as described herein, and optionally one or more other ionizable lipid compounds.
  • one or more excipients are selected from neutral lipids, steroids and polymer-conjugated lipids.
  • the therapeutic agent is encapsulated in or associated with a lipid nanoparticle.
  • the present invention provides a nanoparticle composition (lipid nanoparticle) comprising:
  • molar percentage refers to the molar percentage of a component relative to the total moles of all lipid components in the LNP (ie, the total moles of cationic lipids, neutral lipids, steroids, and polymer-conjugated lipids).
  • lipid nanoparticles account for 41 to 49 mole percent, 41 to 48 mole percent, 42 to 48 mole percent, 43 to 48 mole percent, 44 to 48 mole percent, 45 to 48 mole percent, and the content of cationic lipid is 46-48 mole percent, or 47.2-47.8 mole percent. In one embodiment, lipid nanoparticles account for about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mole percent of cationic lipid.
  • the neutral lipid is present at a concentration of 5 to 15 mole percent, 7 to 13 mole percent, or 9 to 11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
  • the steroid is present in a concentration range of 39-49 mole percent, 40-46 mole percent, 40-44 mole percent, 40-42 mole percent, 42-44 mole percent or 44-46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45 or 46 mole percent. In one embodiment, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the steroid is cholesterol.
  • the ratio of therapeutic agent to lipid in the LNP (i.e., N/P, N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) is 2:1 to 2.30:1, such as 3:1 to 22:1.
  • N/P is 6:1 to 20:1 or 2:1 to 12:1.
  • Exemplary N/P ranges include about 3:1, about 6:1, about 12:1, and about 22:1.
  • lipid nanoparticle comprising:
  • the mole percentage is determined based on the total moles of lipid present in the lipid nanoparticles.
  • the cationic lipid can be any of a variety of lipids with a net positive charge at a selected pH (such as physiological pH). Exemplary cationic lipids are described below.
  • the pKa of the cationic lipid is greater than 6.25. In one embodiment, the pKa of the cationic lipid is greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65 or greater than 6.7.
  • the lipid nanoparticles comprise 40 to 45 mole percent of the cationic lipids. In one embodiment, the lipid nanoparticles comprise 45 to 50 mole percent of the cationic lipids.
  • the molar ratio of cationic lipid to neutral lipid is about 2: 1 to about 8: 1. In one embodiment, the neutral lipid accounts for 5 to 10 mole percent of the lipid in the lipid nanoparticle.
  • Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).
  • DOPG dioleoylphosphatidylglycerol
  • DPPG dipalmitoylphosphatidylglycerol
  • DSPG 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol)
  • the lipid nanoparticles contain 1 to 10 mol% of anionic lipids. In one embodiment, the lipid nanoparticles contain 1 to 5 mol% of anionic lipids. In one embodiment, the lipid nanoparticles contain 1 to 9 mol%, 1 to 8 mol%, 1 to 7 mol% or 1 to 6 mol% of anionic lipids. In one embodiment, the molar ratio of anionic lipids to neutral lipids is 1:1 to 1:10.
  • the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is about 5:1 to 1:1. In one embodiment, the lipid nanoparticles contain 32 to 40 mol% of the steroid.
  • the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids is 5 to 15 molar percentages. In one embodiment, the sum of the molar percentage of neutral lipids and the molar percentage of anionic lipids is 7 to 12 molar percentages.
  • the molar ratio of anionic lipid to neutral lipid is 1:1 to 1: 10. In one embodiment, the sum of the molar percentages of neutral lipid and steroid is 35 to 45 mole percent.
  • the lipid nanoparticle comprises:
  • the lipid nanoparticles contain 1.0 to 2.5 mole percent of the polymer-conjugated lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mole percent.
  • the neutral lipid is present at a concentration of 5 to 15 mole percent, 7 to 13 mole percent, or 9 to 11 mole percent. In one embodiment, the neutral lipid is present at a concentration of about 9.5, 10, or 10.5 mole percent. In one embodiment, the molar ratio of cationic lipid to neutral lipid is about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0, or about 4.7:1.0 to 4.8:1.0.
  • the steroid is cholesterol. In some embodiments, the steroid is present in a concentration range of 39 to 49 mole percent, 40 to 46 mole percent, 40 to 44 mole percent, 40 to 42 mole percent, 42 to 44 mole percent or 44 to 46 mole percent. In one embodiment, the steroid is present at a concentration of 40, 41, 42, 43, 44, 45 or 46 mole percent. In certain embodiments, the molar ratio of cationic lipid to steroid is 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2.
  • the molar ratio of cationic lipid to steroid is from 5:1 to 1:1.
  • the lipid nanoparticle contains 1.0 to 2.5 mole percent of polymer-conjugated lipids. In one embodiment, the polymer-conjugated lipids are present at a concentration of about 1.5 mole percent.
  • the molar ratio of cationic lipid to polymer-conjugated lipid is about 100:1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to polymer-conjugated lipid is about 35:1 to about 25:1.
  • the average diameter of the lipid nanoparticles is from 50 nm to 100 nm, or from 60 nm to 85 nm.
  • the composition comprises cationic lipids, DSPC, cholesterol and PEG-lipids provided herein and mRNA.
  • the molar ratio of cationic lipids, DSPC, cholesterol and PEG-lipids provided herein is about 50:10:38.5:1.5.
  • Nanoparticle compositions can be designed for one or more specific applications or goals.
  • nanoparticle compositions can be designed to deliver therapeutic and/or prophylactic agents (e.g., RNA) to specific cells, tissues, organs, or systems thereof, etc. in a mammal.
  • therapeutic and/or prophylactic agents e.g., RNA
  • the physicochemical properties of nanoparticle compositions can be altered to increase selectivity for specific body targets.
  • the particle size can be adjusted based on the fenestration size of different organs.
  • the therapeutic and/or prophylactic agents contained in the nanoparticle compositions can also be selected based on the desired one or more delivery targets.
  • therapeutic and/or prophylactic agents can be selected for specific indications, conditions, diseases or disorders and/or delivered to specific cells, tissues, organs or systems, etc.
  • nanoparticle compositions may include mRNA encoding a polypeptide that can be translated into a target polypeptide in a cell. Such compositions can be specifically designed for delivery to specific organs. In certain embodiments, the composition can be designed to be specifically delivered to the liver of a mammal.
  • the amount of therapeutic and/or prophylactic agent in a nanoparticle composition can depend on the size, composition, desired target, and/or other properties of the nanoparticle composition and the properties of the therapeutic and/or prophylactic agent.
  • the amount of RNA that can be used in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA.
  • the relative amounts of the therapeutic and/or prophylactic agent and other elements can also be adjusted.
  • the wt/wt ratio of the lipid component to the therapeutic and/or prophylactic agent in the nanoparticle composition can be about 5:1 to about 60:1, such as 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1.
  • the wt/wt ratio of the lipid component to the therapeutic and/or prophylactic agent can be about 10:1 to about 40:1. In certain embodiments, the weight/weight ratio is about 20:1.
  • the amount of the therapeutic and/or prophylactic agent in the nanoparticle composition can be measured by absorption spectroscopy (e.g., UV-visible spectroscopy).
  • the nanoparticle composition comprises one or more RNAs, and the one or more RNAs, lipids, and amounts thereof may be selected to provide a specific N:P ratio.
  • the N:P ratio of a composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected.
  • RNAs, lipids, and amounts thereof may be selected so that the N:P ratio is about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1.
  • the N:P ratio may be about 2:1 to about 8:1.
  • the N:P ratio is about 5:1 to about 8:1.
  • the N:P ratio may be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1.
  • the N:P ratio may be about 5.67:1.
  • the physical properties of a nanoparticle composition can depend on its components.
  • a nanoparticle composition comprising cholesterol as a structural lipid can have different properties than a nanoparticle composition comprising a different structural lipid.
  • the properties of a nanoparticle composition can depend on the absolute or relative amounts of its components.
  • a nanoparticle composition comprising a higher mole fraction of phospholipids has different properties than a nanoparticle composition comprising a lower mole fraction of phospholipids.
  • the properties can also vary depending on the method and conditions of preparation of the nanoparticle composition.
  • Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (such as a transmission electron microscope or a scanning electron microscope) can be used to examine the morphology and size distribution of the nanoparticle composition. Dynamic light scattering or potentiometric methods (such as potentiometric titration) can be used to measure the zeta potential. Dynamic light scattering can also be used to determine particle size. The Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple characteristics of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.
  • microscopy such as a transmission electron microscope or a scanning electron microscope
  • Dynamic light scattering or potentiometric methods such as potentiometric titration
  • Dynamic light scattering can also be used to determine particle size.
  • the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK
  • the average size of the nanoparticle composition can be between 10 nm and 100 nm.
  • the average size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm.
  • the average size of the nanoparticle composition can be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 70nm 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm.
  • the average size of the nanoparticle composition can be about 70nm to about 100nm. In some embodiments, the average size can be about 80nm. In other embodiments, the average size can be about 100nm.
  • the nanoparticle composition can be relatively uniform.
  • the polydispersity index can be used to indicate the uniformity of the nanoparticle composition, for example, the particle size distribution of the nanoparticle composition.
  • a small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution.
  • the nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.06, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.30, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.40, 0.41, 0.42, 0.43, 0.44, 0.45 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25.
  • the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.
  • the zeta potential of a nanoparticle composition can be used to indicate the electromotive force of the composition.
  • the zeta potential can characterize the surface charge of a nanoparticle composition. It is generally desirable to have a relatively low positively or negatively charged nanoparticle composition because more highly charged materials can interact adversely with cells, tissues, and other elements of the human body.
  • the zeta potential of a nanoparticle composition can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 ...
  • mV to about +5mV about -10mV to about 0mV, about -10mV to about -5mV, about -5mV to about +20mV, about -5mV to about +15mV, about -5mV to about +10mV, about -5mV to about +5mV, about -5mV to about 0mV, about 0mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about 0mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about +5mV to about +20mV, about 0mV to about +15mV, about 0mV to about +10mV, about 0mV to about +5mV, about +5mV to about +20mV, about +5mV
  • the encapsulation efficiency of the therapeutic and/or prophylactic agent describes the amount of the therapeutic and/or prophylactic agent encapsulated or associated with the nanoparticle composition after preparation relative to the initial amount provided. It is desirable that the encapsulation efficiency is high (e.g., close to 100%).
  • the encapsulation efficiency can be measured, for example, by comparing the amount of the therapeutic and/or prophylactic agent before and after treatment in a solution containing the nanoparticle composition with one or more organic solvents or detergents to decompose the nanoparticle composition. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agents (e.g., RNA) in the solution.
  • the encapsulation efficiency of the therapeutic and/or prophylactic agent can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
  • the nanoparticle composition may optionally include one or more coatings.
  • the nanoparticle composition may be formulated into a capsule, film, or tablet having a coating.
  • the capsule, film, or tablet of the composition described herein may have any useful size, tensile strength, hardness, or density.
  • nanoparticle compositions can be formulated as part or all of a pharmaceutical composition.
  • a pharmaceutical composition may include one or more nanoparticle compositions.
  • a pharmaceutical composition may include one or more nanoparticle compositions, and one or more different therapeutic agents and/or prophylactic agents.
  • the pharmaceutical composition may further contain one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein.
  • General guidelines for the preparation and production of pharmaceutical compositions and formulations are described in, for example, Remington’s The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006, etc.
  • excipients and auxiliary ingredients can be used in any pharmaceutical composition unless they are incompatible with one or more components of the nanoparticle composition. If the excipients or auxiliary ingredients are incompatible with the components of the nanoparticle composition, their combination may result in adverse biological or harmful effects.
  • one or more excipients or adjuvants may comprise greater than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition.
  • typically one or more excipients or adjuvants may comprise 50%, 60%, 70%, 80%, 90% or more of the pharmaceutical composition.
  • the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure.
  • the excipient is approved for human and veterinary use.
  • the excipient is approved by the U.S. Food and Drug Administration.
  • the excipient is of pharmaceutical grade.
  • the excipient complies with the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and/or the International Pharmacopoeia.
  • the relative amount of one or more pharmaceutically acceptable excipients and/or any other ingredients may be adjusted depending on their characteristics, size, and other related conditions, and further depending on the administration object and administration route of the composition.
  • the pharmaceutical composition may contain 0.1% to 100% (wt/wt) of one or more nanoparticle compositions.
  • the nanoparticle compositions and/or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and transportation. For example, at a temperature of 4°C or lower, between about -150°C and 0°C or at a temperature of about -80°C to about -20°C, such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or -150°C.
  • compositions containing compounds of formula (I) and subformulas thereof in solution form are refrigerated for storage or transportation under conditions such as about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C or -80°C.
  • the present disclosure also relates to methods for improving the stability of nanoparticle compositions and/or pharmaceutical compositions containing compounds of formula (I) (and subformulas thereof).
  • nanoparticle compositions and/or pharmaceutical compositions By storing the nanoparticle compositions and/or pharmaceutical compositions at 4°C or lower, such as between about -150°C and about 0°C or between about -80°C and about -20°C, such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C.
  • 4°C or lower such as between about -150°C and about 0°C or between about -80°C and about -20°C, such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -
  • the nanoparticle compositions and/or pharmaceutical compositions disclosed herein are stable at 4°C or lower (such as between about 4°C and -20°C) for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least one month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months.
  • the formulation is stable for at least 4 weeks at about 4°C.
  • the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of Tris, acetate (e.g., acetic acid), citrate (e.g., sodium citrate), saline, PBS, and sucrose.
  • a pharmaceutically acceptable carrier selected from one or more of Tris, acetate (e.g., acetic acid), citrate (e.g., sodium citrate), saline, PBS, and sucrose.
  • the pH value of the pharmaceutical composition of the present disclosure is between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8 or 7 and 7.8).
  • the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and has a pH of about 7.5-8, which is suitable for storage or transportation at about -20°C.
  • the pharmaceutical composition of the present disclosure comprises a nanoparticle composition disclosed herein and PBS, and has a pH of about 7-7.8, which is suitable for storage or transportation at a temperature such as about 4°C or lower.
  • stable and “stability” refer to the resistance of the nanoparticle composition or pharmaceutical composition disclosed herein to chemical or physical changes (such as degradation, particle size change, aggregation change) under given manufacturing, preparation, transportation, storage and/or use conditions (such as applied stress (shear force, freeze/thaw stress, etc.)).
  • Nanoparticle compositions and/or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including providing beneficial therapeutic effects by delivering therapeutic and/or prophylactic agents to specific cells, tissues, organs, or systems thereof, such as the renal system, of the patient or subject.
  • the description of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions herein is primarily directed to compositions suitable for administration to humans, it will be appreciated by those skilled in the art that such compositions are generally suitable for administration to any other mammal. It is well known that modifications to compositions suitable for administration to humans are made in order to make the compositions suitable for administration to various animals, and veterinary pharmacists of ordinary skill can design and/or perform such modifications only through ordinary experiments.
  • Subjects to whom the composition is intended to be administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and rats.
  • compositions comprising one or more nanoparticle compositions can be prepared by any method known or later developed in the field of pharmacology. Generally, such preparation methods include combining the active ingredient with an excipient and/or one or more other auxiliary ingredients, and if necessary, the product can also be divided into single or mixed forms and/or packaged into the desired multiple dosage units.
  • compositions according to the present disclosure can be prepared, packaged, and/or sold in bulk as a single unit dose and/or as multiple single unit doses.
  • a "unit dose” is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition).
  • the amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and/or a convenient fraction of the dose, such as half or one-third of the dose.
  • the pharmaceutical composition can be prepared into various forms suitable for various routes and methods of administration.
  • the pharmaceutical composition can be prepared into liquid dosage forms (such as emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable dosage forms, solid dosage forms (such as capsules, tablets, pills, powders and granules), dosage forms for topical and/or transdermal administration (such as ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.
  • liquid dosage forms such as emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs
  • injectable dosage forms such as capsules, tablets, pills, powders and granules
  • dosage forms for topical and/or transdermal administration such as ointments, pastes, creams, lotions, gels, powders, solutions, sprays, in
  • Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and/or elixirs.
  • the liquid dosage form may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (particularly cottonseed, peanut, corn, germ, olive oil, castor and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan and mixtures thereof.
  • inert diluents commonly used in the art, such as water or other solvents, so
  • the oral composition may contain other therapeutic and/or preventive agents, such as wetting agents, emulsifying and suspending agents, sweeteners, flavoring agents and/or flavoring agents and other preparations.
  • the composition is mixed with a solubilizing agent such as CremophorTM, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrin polymers, and/or combinations thereof.
  • Injectable preparations can be prepared according to known techniques using suitable dispersants, wetting agents and/or suspending agents, such as aqueous or oily suspensions that can be sterile injected.
  • Aseptic injection preparations can be sterile injection solutions, suspensions and/or emulsions in nontoxic parenteral acceptable diluents and/or solvents, such as solutions in 1,3-butanediol.
  • Available acceptable vehicles and solvents include water, American Ringer's solution and isotonic sodium chloride solution.
  • Sterile fixed oils are generally used as solvents or suspension media. For this reason, any gentle fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used to prepare injections.
  • the injectable formulations can be sterilized by filtration through a bacteria-retaining filter and/or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • the present invention discloses methods for delivering therapeutic and/or prophylactic agents to mammalian cells or organs, producing target polypeptides in mammalian cells, and treating diseases or disorders in mammals by contacting mammalian cells with nanoparticle compositions containing therapeutic and/or prophylactic agents and/or administering to the mammal.
  • HPLC purifications were performed on a Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, typically using water containing 0.1% TFA as solvent A and acetonitrile as solvent B.
  • DAD diode array detector
  • LCMS analysis was performed on a Shimadzu (LC-MS2020) system. Chromatography was performed on a SunFire C18, typically using water with 0.1% formic acid as solvent A and acetonitrile with 0.1% formic acid as solvent B.
  • Example 11 Preparation and characterization of lipid nanoparticles
  • the ethanol lipid solution is mixed with the mRNA aqueous solution at a volume ratio of 1:3 using a microfluidic device at a flow rate of 9-30 mL/min, and the weight ratio of total lipid to mRNA is about 10:1 to 30:1 to prepare LNP.
  • PBS is used for dialysis instead of ethanol, thereby removing ethanol.
  • the lipid nanoparticles are filtered through a 0.2 ⁇ m sterile filter.
  • the size of the liposomal nanoparticles was determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern UK) in 173° backscatter detection mode.
  • the encapsulation efficiency of the lipid nanoparticles was determined using the Quant-it Ribogreen RNA quantification kit (Thermo Fisher Scientific, UK) according to the manufacturer’s instructions.
  • LNP formulations As reported in the literature, the apparent pKa of LNP formulations is correlated with the delivery efficiency of LNPs to nucleic acids in vivo.
  • the apparent pKa of each formulation was determined using a 2-(p-tolyl)-6-naphthalenesulfonic acid (TNS)-based fluorescence assay.
  • LNP formulations containing cationic lipids/DSPC/cholesterol/DMG-PEG (50/10/38.5/1.5 mol%) were prepared as described above.
  • TNS was made into a 300uM stock solution in distilled water.
  • the LNP formulation was diluted to 0.1mg/ml total lipid in 3mL of a buffer solution containing 50mM sodium citrate, 50mM sodium phosphate, 50mM sodium borate, and 30mM sodium chloride, with a pH of 3 to 9.
  • TNS solution was added to a final concentration of 0.1mg/ml, and after vortex mixing, the fluorescence intensity was measured at room temperature in a Molecular Devices Spectramax iD3 spectrometer using excitation wavelengths of 325nm and 435nm. A sigmoidal best-fit analysis was performed on the fluorescence data, and the pKa values were measured at the pH values that gave half of the maximum fluorescence intensity.
  • the compounds of the invention have the desired size (nm), polydispersity index (PDI), apparent pKa.
  • the lipid nanoparticles containing luciferase mRNA encapsulated by compound 3 in the above table were administered at a dose of 0.25 mg/kg to 6-8 week old female Balb/c mice (Zhejiang Weitong Lihua Experimental Animal Co., Ltd.) for 6 hours, and the total fluorescence intensity in the mice was tested (Figure 1). The results showed that the tested compounds all had good in vivo fluorescence expression.
  • the organ distribution expression of compound 3 showed ( Figure 2) that LNP 3 had strong fluorescence intensity not only in the liver, but also in the spleen.
  • the lipid nanoparticles encapsulating luciferase mRNA in Example 11 were intravenously injected into 6-8 week old female Balb/c mice (Zhejiang Weitong Lihua Experimental Animal Co., Ltd.) at a dose of 0.25 mg/kg, and the spleen fluorescence expression in the mice was tested 6 hours after the single administration (Table 2). Whether compared with MC3 or compared with compound AS, the introduction of tail containing sphingosine increased the spleen fluorescence expression to varying degrees.
  • the lipid nanoparticles of luciferase mRNA encapsulated by compound 3 were administered intramuscularly at a dose of 0.05ug/mouse to female Balb/c mice aged 6-8 weeks (Zhejiang Weitong Lihua Experimental Animal Co., Ltd.), and the fluorescence expression in the test mice was tested after 6 hours, 24 hours, and 48 hours of single administration.
  • SM102 was used as a positive control under the same conditions. As can be seen from Figure 3, the fluorescence expression was the highest in the time of 6h to 48h, and then gradually decreased, but no matter which time point, the fluorescent protein expression of compound 3 was higher than that of SM102.
  • the mRNA of SARS-CoV-2S RBD protein was prepared by T7 in vitro transcription method. According to the preparation method of Example 11, compounds 3, 11 and 17 were used for nanoparticle encapsulation, and the obtained three LNP preparations were used for BALB/c mouse immunization test. The specific operation was as follows: 6-8 week old BALB/c mice, female, 5 mice per group, were inoculated with LNP preparations by intramuscular injection on Day 0 and Day 14, respectively, with an injection volume of 50 ⁇ L and an injection dose of 0.5 ug/mouse. Serum was taken 21 days after the first immunization for detection and calculation of IgG antibody titer (Figure 4). Figure 4 shows that the IgG antibody titers of compounds 3, 11, and 17 are significantly higher than SM102.
  • RSV protein mRNA was prepared by T7 in vitro transcription method, and nanoparticle encapsulation was performed with ionizable compound 3 according to the preparation method of Example 11.
  • the obtained LNP preparation was used for BALB/c mouse immunization test.
  • the specific operation was as follows: 6-8 week old BALB/c mice, female, 5 mice per group, were inoculated with LNP preparation by intramuscular injection on Day 0 and Day 14, respectively, with an injection volume of 50 ⁇ L and an injection dose of 0.5 ug/mouse. Serum was collected 21 days after the first immunization for The neutralizing antibody titer of RSV-A was detected (Figure 5).
  • Figure 5 shows that the RSV-A neutralizing antibody titer of compound 3 is higher than that of SM102.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne un composé lipidique et une composition de nanoparticules lipidiques. La présente invention concerne en particulier un composé lipidique, qui peut être utilisé en combinaison avec d'autres composants lipidiques tels que des lipides neutres, du cholestérol et des lipides conjugués à un polymère pour former des nanoparticules lipidiques, de façon à administrer un agent thérapeutique, tel qu'une molécule d'acide nucléique, à des fins thérapeutiques ou prophylactiques. L'invention concerne en outre une composition de nanoparticules lipidiques comprenant le composé lipidique.
PCT/CN2023/125314 2022-10-20 2023-10-19 Composé lipidique et composition de nanoparticules lipidiques WO2024083171A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CNPCT/CN2022/126391 2022-10-20
CN2022126391 2022-10-20

Publications (1)

Publication Number Publication Date
WO2024083171A1 true WO2024083171A1 (fr) 2024-04-25

Family

ID=90736984

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2023/125314 WO2024083171A1 (fr) 2022-10-20 2023-10-19 Composé lipidique et composition de nanoparticules lipidiques

Country Status (1)

Country Link
WO (1) WO2024083171A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998003204A1 (fr) * 1996-07-23 1998-01-29 Oregon Health Sciences University Conjugues lipidiques polaires covalents associes a des composes biologiquement actifs utilisables dans les onguents
US20100305333A1 (en) * 2007-05-09 2010-12-02 Biolab Ltd. Lipid conjugated cyclic carbonate derivatives, their synthesis, and uses
WO2016125163A1 (fr) * 2015-02-04 2016-08-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Assemblages lipidiques et leurs utilisations et quelques lipides de modulation de ph et électrostatique destinés à être utilisés dans lesdits assemblages
CN114206463A (zh) * 2020-06-30 2022-03-18 苏州艾博生物科技有限公司 脂质化合物和脂质纳米颗粒组合物

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998003204A1 (fr) * 1996-07-23 1998-01-29 Oregon Health Sciences University Conjugues lipidiques polaires covalents associes a des composes biologiquement actifs utilisables dans les onguents
US20100305333A1 (en) * 2007-05-09 2010-12-02 Biolab Ltd. Lipid conjugated cyclic carbonate derivatives, their synthesis, and uses
WO2016125163A1 (fr) * 2015-02-04 2016-08-11 Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd. Assemblages lipidiques et leurs utilisations et quelques lipides de modulation de ph et électrostatique destinés à être utilisés dans lesdits assemblages
CN114206463A (zh) * 2020-06-30 2022-03-18 苏州艾博生物科技有限公司 脂质化合物和脂质纳米颗粒组合物

Similar Documents

Publication Publication Date Title
CN114206827B (zh) 脂质纳米颗粒组合物
CN114391008B (zh) 脂质化合物和脂质纳米颗粒组合物
CN114206463B (zh) 脂质化合物和脂质纳米颗粒组合物
CN116615472A (zh) 聚合物缀合的脂质化合物和脂质纳米颗粒组合物
WO2024022263A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
CN116323627A (zh) 脂质化合物和脂质纳米颗粒组合物
WO2023116804A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
US11964052B2 (en) Lipid compounds and lipid nanoparticle compositions
TW202330457A (zh) 脂質化合物和脂質奈米顆粒組合物
CN118043306A (zh) 脂质化合物和脂质纳米颗粒组合物
TW202329986A (zh) 脂質化合物及脂質奈米顆粒組合物
WO2024083171A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
WO2024083172A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
WO2024109798A1 (fr) Composé lipidique et composition de nanoparticules lipidiques
CA3241492A1 (fr) Compose lipidique et composition de nanoparticules lipidiques
CN117069785A (zh) 脂质化合物和脂质纳米颗粒组合物
KR20240090186A (ko) 지질 화합물 및 지질 나노 입자 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23879158

Country of ref document: EP

Kind code of ref document: A1