WO2024051106A1

WO2024051106A1 - Preparation and use of anti-il4i1 nano antibody

Info

Publication number: WO2024051106A1
Application number: PCT/CN2023/078088
Authority: WO
Inventors: 杜继文; 薛静; 杨燕; 袁亚丰; 许胤辉; 沙思源; 王玉芳; 查长春
Original assignee: 上海百英生物科技股份有限公司
Priority date: 2022-09-09
Filing date: 2023-02-24
Publication date: 2024-03-14
Also published as: CN115785277A; CN115785277B

Abstract

A preparation and use of an anti-IL4i1 nano antibody. The anti-IL4i1 nano antibody has three unique complementarity-determining regions CDR1, CDR2, and CDR3, and nine sequences of the anti-IL4i1 nano antibody are selected in total. Further provided are a coding sequence for coding the nano antibody or a VHH chain thereof, a corresponding expression vector, a host cell capable of expressing the nano antibody, and a production method for the anti-IL4i1 nano antibody.

Description

Preparation and application of an anti-IL4i1 nanobody

Technical field

The invention belongs to the technical field of molecular biology, and specifically relates to the preparation and application of an anti-IL4i1 nanobody.

Background technique

Interleukin-4-inducible gene 1 (IL4I1) is an L-phenylalanine oxidase expressed by antigen-presenting cells. In vitro, IL4I1 inhibits T cell proliferation and cytokine production, promoting The differentiation of CD4+ T cells into regulatory T cells relies in part on their ability to produce H2O2 and consume phenylalanine from the T cell microenvironment. IL4I1 is strongly detected in the tumor bed of most human tumor types, and in some cases, such as certain B-cell lymphomas, it is expressed by the tumor cells themselves. Locally produced IL4I1 promotes tumor growth in mouse models by inhibiting the proliferation and function of anti-tumor CD8+ T cells, changing the balance of immune cells in the tumor microenvironment toward the immunosuppressive population. Furthermore, the location and density of IL4I1 expression in cells correlated with worsening clinical parameters in patients and tended to lead to shorter survival in melanoma patients. The researchers also found that the presence of IL4I1 protein or mRNA was associated with the quality of prognosis in kidney cancer, glioma, colon cancer and breast cancer. These data all suggest that therapeutic strategies aimed at inhibiting IL4I1 expression or reducing its activity in cancer patients may improve immune control in cancer patients. This strategy does not appear to harm the host, as it has been shown that deletion of IL4I1 in KO mice does not appear to cause specific pathology or premature death. Therefore, targeting IL4I1 may be a new tumor immunotherapy strategy. In a study published in the journal Cell, scientists from the German Cancer Research Center (DKFZ) and the Berlin Institute of Health (BIH) discovered that IL4I1 (Interleukin-4-Induced-1), a metabolic enzyme produced in large quantities in tumors, Can promote the spread of tumor cells and suppress the immune system. Their research shows that IL4I1 is a metabolic immune checkpoint, and IL4i1 inhibitors may bring new opportunities for cancer treatment in the future.

Nanobodies are the smallest functional antigen-binding fragments derived from HCAbs in adult camels. They have high stability and high affinity for binding to antigens. They can interact with protein clefts and enzyme active sites, making them act like inhibitors. Therefore, nanobodies can provide new ideas for designing small molecule enzyme inhibitors from peptide mimetic drugs. Since they only have heavy chains, Nanobodies are easier to produce than monoclonal antibodies. Nanobodies' unique properties, such as stability in extreme temperature and pH environments, enable low-cost manufacturing in large quantities.

Therefore, nanobodies have great value in the treatment and diagnosis of diseases, and also have great development prospects in the antibody-targeted diagnosis and treatment of tumors. Compared with conventional four-chain antibody scFv, nanobodies are equivalent to their corresponding scFv in terms of affinity, but have poor performance in solubility, stability, resistance to aggregation, refoldability, expression yield, DNA manipulation, and library construction. and ease of 3-D structure determination beyond scFv.

Phage display technology is a method of displaying polypeptides or proteins on the surface of phages, thereby displaying polypeptides or proteins with desired properties. A technique for in vitro screening of peptides or proteins. By fusing the gene encoding the target protein into the gene for the phage capsid protein, the target protein can be displayed on the surface of the phage, thus linking genotype and phenotype. Subsequently, several rounds of affinity screening (such as biopanning) are performed in vitro to obtain some phage clones. These phage clones are then amplified and more rounds of screening are performed to further obtain the target protein with strong specificity.

Currently, the most widely used single cell analysis technology is high-throughput single-cell RNA sequencing (Single-cell RNA sequencing, scRNA-seq). Automated high-throughput single-cell RNA sequencing technology can provide an unbiased and efficient method for high-throughput detection of single-cell transcriptomes to obtain single-cell transcriptome profiles of the microenvironment. The emergence of droplet-based high-throughput single-cell RNA sequencing technology can increase the number of single-detection cells to tens of thousands, truly realizing high-throughput detection. Therefore, the realization of high-throughput single-cell RNA sequencing technology relies on the application of microfluidic automation technology and high-throughput sequencing technology. The former realizes high-throughput single cell isolation and the latter realizes automated DNA sequencing.

Phage display technology, biopanning, high-throughput sequencing, etc. are all commonly used technologies for nanobody production. Among them, phage display technology requires phage packaging and panning. This technology is all performed in a prokaryotic expression system, and panning requires After at least 3 rounds, it takes a long time, and compared with the eukaryotic expression system, the prokaryotic expression of the antibody still has certain deficiencies in protein modification and folding, which affects the affinity of the antibody to a certain extent. High-throughput sequencing technology data is large in scale and complex in type, including transcriptome, genome, proteome, etc. The reproducibility is not strong, and data storage and visualization are also issues that need to be optimized. Sample contamination is also a major problem that affects the accuracy of sequencing results.

Contents of the invention

The purpose of the present invention is to provide a method that can give full play to the superior properties of Nanobodies, which not only has excellent specific antigen binding ability, but also overcomes the shortcomings of traditional Nanobody screening methods that are time-consuming and cannot be processed and modified by prokaryotic expression. Through microfluidic control The screening method is combined with a high-throughput expression platform to screen anti-IL4i1 antibodies and further provide their application in the preparation of tumor treatment drugs and diagnostic preparations.

To achieve the above objectives, the technical solutions adopted by the present invention are:

An anti-IL4i1 nanobody, the nanobody includes a framework region and a complementarity-determining region; the complementarity-determination region includes CDR1, CDR2, and CDR3, and the amino acid sequence is as follows: the CDR1 sequence of the complementarity-determination region is SEQ ID NO.1, so The complementarity-determining region CDR2 sequence is SEQ ID NO.2, and the complementarity-determining region CDR3 sequence is SEQ ID NO.3; or the complementarity-determining region CDR1 is SEQ ID NO.4, and the complementarity-determining region CDR2 is SEQ ID NO. NO.5, the complementary determining region CDR3 is SEQ ID NO.6; or the complementary determining region CDR1 is SEQ ID NO.7, the complementary determining region CDR2 is SEQ ID NO.8, the complementary determining region CDR3 is SEQ ID NO.9; or the complementarity determining region CDR1 is SEQ ID NO.7, the complementarity determining region CDR2 is SEQ ID NO.10, the complementation determining region CDR3 is SEQ ID NO.11; or the complementarity determining region CDR3 is SEQ ID NO.11; The complementarity determining region CDR1 is SEQ ID NO. 12, and the complementarity determining region CDR2 is SEQ ID NO.13, the complementary determining region CDR3 is SEQ ID NO.14; or the complementary determining region CDR1 is SEQ ID NO.15, the complementary determining region CDR2 is SEQ ID NO.16, the complementary determining region Region CDR3 is SEQ ID NO.17; or the complementarity determining region CDR1 is SEQ ID NO.18, the complementarity determining region CDR2 is SEQ ID NO.19, and the complementarity determining region CDR3 is SEQ ID NO.20; or The complementarity determining region CDR1 is SEQ ID NO.21, the complementarity determining region CDR2 is SEQ ID NO.22, the complementarity determining region CDR3 is SEQ ID NO.23; or the complementarity determining region CDR1 is SEQ ID NO. .24, the complementarity determining region CDR2 is SEQ ID NO.25, and the complementarity determining region CDR3 is SEQ ID NO.26; the specific sequence information is shown in Table 1 below.

Table 1 The specific sequence of the complementarity determining region of IL4i1 Nanobody of the present invention

Preferably, the anti-IL4i1 Nanobody has an amino acid sequence selected from any one of the following: the amino acid sequence corresponding to ANb32-M384-4M-673 is shown in SEQ ID NO. 27; the amino acid sequence corresponding to ANb32-M384-4M-865 The sequence is shown in SEQ ID NO.28; the amino acid sequence corresponding to ANb32-M384-4M-584 is shown in SEQ ID NO.29; the amino acid sequence corresponding to ANb32-M384-4M-769 is shown in SEQ ID NO.30; ANb32- The amino acid sequence corresponding to M384-4M-761 is shown in SEQ ID NO.31; the amino acid sequence corresponding to ANb32-M384-4M-480 is shown in SEQ ID NO.32; the amino acid sequence corresponding to ANb32-M384-4M-577 is shown as SEQ ID NO.33 is shown; the amino acid sequence corresponding to ANb32-M384-4M-665 is shown in SEQ ID NO.34; the amino acid sequence corresponding to ANb32-M384-4M-672 is shown in SEQ ID NO.35.

Preferably, the nucleotide sequences encoding the anti-IL4i1 Nanobody are as follows: the nucleotide sequence corresponding to ANb32-M384-4M-673 is shown in SEQ ID NO. 36; the nucleotide sequence corresponding to ANb32-M384-4M-865 The nucleotide sequence is shown in SEQ ID NO.37; the nucleotide sequence corresponding to ANb32-M384-4M-584 is shown in SEQ ID NO.38; ANb32- The nucleotide sequence corresponding to M384-4M-769 is shown in SEQ ID NO.39; the nucleotide sequence corresponding to ANb32-M384-4M-761 is shown in SEQ ID NO.40; the corresponding nucleotide sequence ANb32-M384-4M-480 The nucleotide sequence of is shown in SEQ ID NO.41; the nucleotide sequence corresponding to ANb32-M384-4M-577 is shown in SEQ ID NO.42; the nucleotide sequence corresponding to ANb32-M384-4M-665 is shown as SEQ ID NO.43 is shown; the nucleotide sequence corresponding to ANb32-M384-4M-672 is shown in SEQ ID NO.44.

The present invention also provides a molecular expression vector, which contains one of the nucleotide sequences of SEQ ID NO. 36 to SEQ ID NO. 44.

The invention also provides a host cell containing the expression vector, and the cell is a eukaryotic cell, preferably a mammalian cell.

The invention also provides a method for preparing the nanobody. The preparation process is as follows:

S1. Based on the protein sequence and gene sequence information of IL4i1, analyze and design the immune antigen, connect the His-tag to its C-terminal, and obtain the modified antigen;

S2. Use the antigen obtained in step S1 to immunize the alpaca, and use droplet microfluidic technology to screen to obtain B cells that can secrete the target antibody;

S3. Use the B cells obtained in step S2 as raw materials, extract RNA, and reverse-transcribe it into cDNA. Obtain the target gene fragment through PCR, then clone the target gene fragment into a eukaryotic expression vector, and transform it into competent cells to construct IL4i1-VHH monoclonal expression library;

S4. Use the IL4i1-VHH monoclonal expression library constructed in step S3 as a template to extract the plasmid, further transfect the cells, and screen positive clones to obtain the result.

Preferably, the eukaryotic expression vector in step S3 is a PcDNA3.4 vector.

The invention also provides an application of the nanobody in preparing drugs for preventing and treating tumors.

The invention also provides an application of the nanobody in preparing a tumor detection reagent.

Compared with the existing technology, the anti-IL4i1 nanobody provided by the present invention has the following advantages:

The amino acid sequence of the anti-IL4i1 nanoparticles provided by the present invention is arranged in the form of framework sequence + CDR1 + framework sequence + CDR2 + framework sequence + CDR3.

(1) The present invention combines the use of cell microfluidic technology to obtain antibody sequences more intuitively, obtain a large number of IL4i1 nanobody genes in a short period of time, realize large-scale production of nanobodies, and is conducive to further development of IL4i1 research utilization;

(2) The present invention uses a high-throughput mammalian cell expression system to express IL4i1 nanobodies, which effectively reduces the development and production costs of IL4i1 antibodies, shortens the antibody expression time, increases throughput, and improves efficiency.

Description of the drawings

Figure 1 shows the ELISA test results;

Figure 2 is a partial diagram of the results of cloning the target fragment;

Figure 3 shows the results of monoclonal ELISA;

Figure 4 shows the positive clone screening results.

Detailed ways

The present invention will be further explained below in conjunction with specific examples. However, it should be noted that the following examples are only used to explain the present invention and cannot be used to limit the present invention. All technical solutions that are the same or similar to the present invention are included in the present invention. within the scope of protection. If no specific techniques or conditions are indicated in this example, the operation shall be carried out in accordance with conventional technical methods in the field and the contents of the instrument instructions; if the manufacturers of the reagents or instruments used are not indicated, they are conventional products that can be purchased commercially.

The present invention first constructs IL4i1 antigen and immunizes alpacas four times to obtain alpaca PBMC cells; secondly, screen and separate PBMC cells through microfluidic technology; capture single cells for RNA, and obtain antibodies through nested PCR. Gene fragments are constructed to construct eukaryotic expression vectors; then high-throughput expression of antibodies is induced through a mammalian cell high-throughput expression system; and finally through ELISA and enzyme activity inhibition detection (using Red Catalase Assay Kit (Red Catalase Assay Kit), and sequencing results were analyzed to obtain antibodies with high sensitivity and enzyme activity inhibition.

Example of an anti-IL4i1 Nanobody

There are 9 kinds of anti-IL4i1 nanobodies, namely ANb32-M384-4M-673, ANb32-M384-4M-865, ANb32-M384-4M-584, ANb32-M384-4M-769, ANb32-M384-4M- 761, ANb32-M384-4M-480, ANb32-M384-4M-577, ANb32-M384-4M-665, ANb32-M384-4M-672.

The preparation process of the anti-IL4i1 nanobody is as follows:

S1. Based on the protein sequence and gene sequence information of IL4i1, analyze and design an antigen that can effectively induce alpacas to produce specific antibodies against human IL4i1, and connect His-tag to its C-terminus to obtain a modified antigen;

S2. Use the mixture of the modified antigen and Freund's adjuvant obtained in step S1 to immunize the alpaca four times, and screen the B cells that can secrete VHH and have binding activity through droplet microfluidic technology;

Alpacas were primed with an emulsified mixture of 200 μg, human IL4i1/His protein and 200 μL Freund's complete adjuvant, and on days 21, 42, and 63, human IL4i1/His protein (i.e., the modified protein obtained in step S1 Antigen) and 200 μL of Freund's incomplete adjuvant were boosted 3 times. One week after each immunization, blood was collected to detect the Anti-IL4i1/His serum titer. One week after the fourth immunization, 50 mL of blood was collected for microfluidic platform testing. Single cell sorting.

The Anti-IL4i1/His serum titer was detected by ELISA. The IL4i1/His protein at a concentration of 2 μg/mL was used to coat the enzyme plate. 100 μL of 2-fold gradient diluted serum was added to each well (the control was pre-immune alpaca serum), 37 Incubate at ℃ for 1.5h, Wash twice, add 1:10000 diluted horseradish peroxidase-labeled Goat anti-Alpaca IgG (H+L) secondary antibody to each well, incubate at 37°C for 1 hour, wash 5 times, add 100 μL TMB substrate, 37 Incubate at ℃ for 10 minutes, stop the reaction with 50 μL of 0.1M H2SO4, and measure OD 450nm. The results are shown in Figure 1. The serum titer detected by ELISA was a dilution value of 2 times that of the blank control at OD450. The antiserum titer after 4 immunizations was 102,400. It can be seen that this antigen can induce alpacas to produce high-titer antiserum specifically against IL4i1 protein.

Sorted cells: One week after the fourth immunization, 50 mL of blood was collected and used on the microfluidic platform to sort functional antibody-secreting cells. Droplet microfluidic technology can package cells and antigens in picolitre-level units. In dispersed oil droplets, the generation speed of thousands of monodispersed droplets per second can be achieved, and each microdroplet obtained from single cells is independent, achieving environmental independence between cells and preventing cross-contamination; in Fluorescently labeled alpaca secondary antibodies are used in the oil droplets to recognize the IL4i1 nanobody. At the same time, if the VHH antibodies secreted by the cells can recognize the fluorescently labeled antigen, a FRET signal can be formed and sorted out. Screening can secrete VHH with binding activity of B cells.

Use the B cells screened in step S2 as a template, use the Trizol method to extract RNA, and use oligo(dT) to reverse it into cDNA. Use primer amplification, molecular cloning and other techniques to obtain the target fragment. The amplification system of the target fragment is as follows: 2, the amplification procedure is shown in Table 3 below. The target fragment cloning results are shown in Figure 2 (partial results); the alpaca VHH gene was cloned into the eukaryotic expression vector pCDNA3.4 and transformed into competent cells Top 10 to obtain a VHH monoclonal expression library. In order to further identify whether the IL4i1-VHH single-clonal expression library was successfully constructed, 10 clones were selected for sequencing from the single-clonal bacteria plate. The sequencing results showed that the positive clone rate and sequence diversity were 100%; the comparison results showed that, Most of the differential sequences are in the CDR binding region. After testing, this construction resulted in an IL4i1-VHH monoclonal expression library.

The sequence information of the upstream primer DFL-(03-16) is as follows:

DFL-03: AGATCTACACATGGCCCAGGTGC

DFL-04: GAGATCTACACATGGCCCAGKTGCAGC

DFL-05: TACACATGGCCGAGGTGCAG

DFL-07: ATCTACACATGGCCCAGTCGCA

DFL-08: CTACACATGGCCCAGCCGCAS

DFL-09: AGATCTACACATGGCCCAGCCGCAS

DFL-10: ATCTACACATGGCCCAGTTG

DFL-11: ATCTACACATGGCCCAGGTGCA

DFL-12: GAGATCTACACATGGCCGAGGTGCAGY

DFL-13:CGAGATCTACACATGGCCGAGGTRS

DFL-14: GATCTACACATGGCCGCGGTA

DFL-15: GATCTACACATGGCCGAGTTGCAAC

DFL-16:CGAGATCTACACATGGCCAGYTKGGTG

The sequence information of downstream primer DFL-06 is: CATACGAGAT ACTAGTTGAGGAGACR

Among them, Y represents C or T base, K represents G or T base, R represents A or G base, and S represents C or G base.

Table 2 Target fragment amplification system

Table 3 Amplification procedure

3.4 Cell transfection and screening:

Transfect the plasmid into mammalian cells HEK-293, add the cell suspension to the corresponding 96-well cell culture plate, approximately 5×104 cells per well, and culture in a 37°C, 5% CO2 cell culture incubator, continuously Culture for 72h.

The cell supernatant after transfection was tested for binding to IL4i1 protein. That is binding ELISA. The specific detection process is as follows: the antigen IL4i1 is coated with 2 μg/mL at 4°C overnight, 100 μL of cell supernatant per well is incubated at 25°C for 1 hour, the secondary antibody is added and incubated at 25°C for 1 hour, and the color development is stopped and the reading is completed. The results of the monoclonal ELISA showed that 377 positive clones were obtained from a total of 961 monoclones in ten 96-well cell plates (as shown in Figure 3, part of the results are shown), and these sequences were sequenced and compared to eliminate repeated sequences. In order to further verify the positive antibodies that bind IL4i1-VHH protein in the library, the cell supernatants were subjected to enzyme activity inhibition experiments. The results showed that 9 of the 377 ELISA positive clones had positive antibodies with better inhibitory activity (as shown in Figure 4 display, partial results are shown).

Finally, it should be noted that the above embodiments are only illustrative of the principles, performance, and efficacy of the present invention, and are not intended to limit the present invention. Anyone familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the invention. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed in the present invention shall still be covered by the claims of the present invention.

Claims

An anti-IL4i1 nanobody, characterized in that the nanobody includes a framework region and a complementarity determining region; the complementarity determining region includes CDR1, CDR2, and CDR3, and the amino acid sequence is as follows: the complementarity determining region CDR1 sequence is SEQ ID NO .1. The CDR2 sequence of the complementary determining region is SEQ ID NO.2, and the CDR3 sequence of the complementary determining region is SEQ ID NO.3; or the CDR1 of the complementary determining region is SEQ ID NO.4, and the complementary determining region CDR1 is SEQ ID NO.4. CDR2 is SEQ ID NO.5, and the complementary determining region CDR3 is SEQ ID NO.6; or the complementary determining region CDR1 is SEQ ID NO.7, and the complementary determining region CDR2 is SEQ ID NO.8, and the complementary determining region CDR2 is SEQ ID NO.8. The complementary determining region CDR3 is SEQ ID NO.9; or the complementary determining region CDR1 is SEQ ID NO.7, the complementary determining region CDR2 is SEQ ID NO.10, and the complementary determining region CDR3 is SEQ ID NO.11 ; Or the complementary determining region CDR1 is SEQ ID NO.12, the complementary determining region CDR2 is SEQ ID NO.13, the complementary determining region CDR3 is SEQ ID NO.14; or the complementary determining region CDR1 is SEQ ID NO.15, the complementary determining region CDR2 is SEQ ID NO.16, the complementary determining region CDR3 is SEQ ID NO.17; or the complementary determining region CDR1 is SEQ ID NO.18, the complementary determining region CDR2 is SEQ ID NO.19, and the complementary determining region CDR3 is SEQ ID NO.20; or the complementary determining region CDR1 is SEQ ID NO.21, and the complementary determining region CDR2 is SEQ ID NO.22, and the complementary determining region CDR2 is SEQ ID NO.22. The complementary determining region CDR3 is SEQ ID NO.23; or the complementary determining region CDR1 is SEQ ID NO.24, the complementary determining region CDR2 is SEQ ID NO.25, and the complementary determining region CDR3 is SEQ ID NO.26 .
The anti-IL4i1 Nanobody as claimed in claim 1, wherein the anti-IL4i1 Nanobody has an amino acid sequence selected from any one of the following: SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29 , SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33, SEQ ID NO.34, SEQ ID NO.35.
The anti-IL4i1 Nanobody as claimed in claim 2, wherein the nucleotide sequence encoding the amino acid sequence of the anti-IL4i1 Nanobody is one of the following sequences: SEQ ID NO.36, SEQ ID NO.37, SEQ ID NO.38, SEQ ID NO.39, SEQ ID NO.40, SEQ ID NO.41, SEQ ID NO.42, SEQ ID NO.43, SEQ ID NO.44.
A molecular expression vector, characterized in that the vector contains one of the nucleotide sequences of SEQ ID NO. 36 to SEQ ID NO. 44 described in claim 3.
A host cell containing the expression vector of claim 4, characterized in that the cell is a eukaryotic cell.
A method for preparing anti-IL4i1 Nanobody according to any one of claims 1 to 5, characterized in that the preparation process is as follows:

S1. Based on the protein sequence and gene sequence information of IL4i1, analyze and design the immune antigen, connect the His-tag to its C-terminal, and obtain the modified antigen;

S2. Use the antigen obtained in step S1 to immunize alpacas, and screen through droplet microfluidic technology to obtain targets that can secrete the target antibody. B cells of the body;

S3. Use the B cells obtained in step S2 as raw materials, extract RNA, and reverse-transcribe it into cDNA. Obtain the target gene fragment through PCR, then clone the target gene fragment into a eukaryotic expression vector, and transform it into competent cells to construct IL4i1-VHH monoclonal expression library;

S4. Use the IL4i1-VHH monoclonal expression library constructed in step S3 as a template to extract the plasmid, further transfect the cells, and screen positive clones to obtain the result.
The preparation method according to claim 6, characterized in that the eukaryotic expression vector in step S3 is a PcDNA3.4 vector.
An application of the anti-IL4i1 nanobody according to claim 1 in the preparation of drugs for the prevention and treatment of tumors.
An application of the anti-IL4i1 nanobody according to claim 1 in the preparation of tumor detection reagents.