WO2024049116A1

WO2024049116A1 - Antiviral composition

Info

Publication number: WO2024049116A1
Application number: PCT/KR2023/012633
Authority: WO
Inventors: 민달희; 신호정
Original assignee: 서울대학교산학협력단
Priority date: 2022-08-30
Filing date: 2023-08-25
Publication date: 2024-03-07

Abstract

The present invention relates to an antiviral composition and a composition for preventing or treating viral infections. Specifically, the compositions may contain one or more of compounds represented by chemical formulas 1 to 7 as an active ingredient, and may inhibit the RdRP activity of RNA viruses.

Description

Antiviral composition

The present invention relates to an antiviral composition.

Over the past 20 years, viral diseases such as Severe Acute Respiratory Syndrome (SARS), Middle East Respiratory Syndrome (MERS), and Zika virus infection have been spreading one after another, and the importance of prevention and management of viral diseases is increasingly highlighted in Korea. Drugs such as chloroquine, Kaletra, and Avigan, which were initially attracting attention as candidates for treating COVID-19, were discontinued because they caused side effects or did not achieve significant results in clinical trials, while Remdesivir, which was clinically conducted by Gilead Sciences, was used to treat COVID-19. 19 It showed clear efficacy in treatment, and clinical results were reported that the mortality rate of critically ill patients was reduced by 62% compared to the non-administered group.

Remdesivir acts as an inhibitor of RNA-dependent RNA Polymerase (RdRP), which is known to play a key role in the self-replication of RNA viruses, and inhibits the proliferation of the COVID-19 virus. It was approved as a treatment by the FDA in August 2020. was approved as However, considering that remdesivir, which is recognized as the first COVID-19 treatment, also has a mortality rate of 7.1% on the 14th day of administration, the development of a more effective COVID-19 treatment is required.

Specifically, RNA viruses, including SARS-CoV-2, which causes COVID-19 infection, proliferate through amplification and reverse transcription of RNA, the genetic material. At this time, enzymes such as helicase, serine protease, and RdRP are key players. Likewise, drugs that directly target the replication mechanism of the virus are called direct-acting antiviral agents (DAAs), and they are known to have superior efficacy and lower side effects than other broad-spectrum antiviral drugs. In the past, enzyme activity analysis methods and library screening have been developed with this in mind, and in particular, screening using proteases has been most actively studied. Based on this, various types of virus treatments have been discovered, but the development of a highly efficient and reliable analysis platform is still insufficient to discover effective treatments targeting helicase and RdRP.

Accordingly, in the present invention, a method for analyzing RNA-dependent RNA polymerase activity using graphene oxide was developed, and an effective antiviral composition was derived through multiple screening of antiviral agents using this method, thereby completing the present invention.

The purpose of the present invention is to provide an antiviral composition.

The purpose of the present invention is to provide a composition for treating viral infections.

1. An antiviral composition comprising a compound represented by any one selected from the group consisting of the following formulas 1 to 7, or a pharmaceutically acceptable salt thereof.

[Formula 1]

(Wherein, n is an integer of 1 to 10, and R ₁ is an alkyl group having 1 to 30 carbon atoms)

[Formula 2]

(wherein n is an integer from 1 to 10)

[Formula 3]

(wherein R ₂ is an alkyl group having 1 to 10 carbon atoms)

[Formula 4]

(In the formula, n is an integer of 1 to 10, and R ₃ is an alkyl group having 1 to 30 carbon atoms.)

[Formula 5]

(Wherein, n is an integer of 1 to 10, and R ₄ is an alkyl group having 1 to 10 carbon atoms)

[Formula 6]

(wherein n is an integer of 1 to 10, and R ₅ is an alkyl group having 1 to 10 carbon atoms) and

[Formula 7]

(wherein n is an integer from 1 to 10).

2. The antiviral composition of 1 above, wherein the compound is represented by any one selected from the group consisting of the following formulas 8 to 14:

[Formula 8]

[Formula 9]

[Formula 10]

[Formula 11]

[Formula 12]

[Formula 13]

and

[Formula 14]

.

3. The antiviral composition of 1 above, wherein the virus is SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2).

4. A pharmaceutical composition for preventing or treating viral infections containing the composition of 1 or 2 above.

5. The pharmaceutical composition for preventing or treating a viral infection according to item 4 above, wherein the viral infection is coronavirus infection-19.

The composition of the present invention has an excellent effect of inhibiting the growth or killing of viruses.

The composition of the present invention effectively inhibits the activity of RdRP, a polymerase of RNA viruses.

Figure 1 schematically illustrates the operating principle of the sensor used in the embodiments of the present application.

Figure 2 shows the results of analyzing a graphene oxide sheet by AFM analysis.

Figure 3 is a schematic diagram of the loop-shaped probe used in the examples herein.

Figure 4 shows the results of confirming dsRNA synthesis in the NTP-treated group using a 6M UREA-PAGE gel.

Figure 5 shows the results of an experiment to determine the concentration of graphene oxide.

Figure 6 shows the results of confirming the quenching effect according to ssRNA (NTP-) and dsRNA (NTP+) and its change over time.

Figure 7 shows the results of measuring the analytical performance of the RdRP activity assay of the examples herein using Z'-factor.

Figures 8a-b show the results of calculating IC50 of selected compounds.

The present invention relates to an antiviral composition comprising a compound selected from the group consisting of the following formulas 1 to 7.

[Formula 1]

[Formula 2]

(wherein n is an integer from 1 to 10)

[Formula 3]

(wherein R ₂ is an alkyl group having 1 to 10 carbon atoms)

[Formula 4]

[Formula 5]

[Formula 6]

[Formula 7]

(wherein n is an integer from 1 to 10)

The alkyl group refers to a straight or branched chain alkyl group containing carbon atoms, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, n-pentyl, n-hexyl or isomers thereof. It can be.

n in the above formula may specifically be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

The carbon number is specifically 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23. , 24, 25, 26, 27, 28, 29 or 30.

Specifically, the compound is

(Fingolimod,FTY720),

(Mitoxantrone),

(Minocycline),

(Docusate sodium),

(Capreomycin sulfate),

(Sisomicin sulfate) or

(Tobramycin).

The virus may be an RNA virus.

Antiviral refers to the activity of killing viruses or inhibiting their growth. Specifically, the composition can prevent or treat diseases caused by RNA virus infection by inhibiting the activity of RdRP (RNA dependent RNA polymerase).

The RdRP is a universal RNA polymerase of RNA viruses. When the activity of RdRP is inhibited, the viral genome cannot be synthesized normally, which can prevent the proliferation of the virus.

As a result, the composition may have an antiviral effect by exhibiting a killing and growth inhibition effect on the target virus.

The RNA virus refers to all viruses that use RNA as genetic material. Specifically, the virus may be SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2).

Or, for example, Amalgaviridae, Birnaviridae, Chrysoviridae, Cystoviridae, Endornaviridae, Hypoviridae, Megabirnaviridae, Partitiviridae, Picobirnaviridae, Reoviridae, Totiviridae, Quadriviridae, Arteri Arteriviridae, Coronaviridae, Mesoniviridae, Roniviridae, Dicistroviridae, Iflaviridae, Marnaviridae ), Picornaviridae, Secoviridae, Alphaflexiviridae, Betaflexiviridae, Gammaflexiviridae, Tymoviridae, Bor Bornnaviridae, Filoviridae, Paramyxoviridae, Rhabdoviridae, Nyamiviridae, Caliciviridae, Flaviviridae (Flaviviridae), Luteoviridae, Togaviridae, Pneumoviridae, Arenaviridae, Deltavirus, or Orthomyxoviridae viruses Including, but not limited to.

The pharmaceutically acceptable salt refers to a salt prepared using a specific compound according to the present invention and a relatively non-toxic acid or base. The salt may be, for example, an acid addition salt or a metal salt.

The composition can be used for disinfection of viruses. For example, it can be used on humans, animals, plants, or objects.

The formulation of the composition may be, for example, liquid, aerosol, foam, gel, powder, cream, etc.

The composition can be prepared according to known methods by adding one or more excipients and additives commonly used in the art.

The composition may further include anionic surfactants, nonionic surfactants, amphoteric surfactants, etc. The anionic surfactant may be alkylbenzene sulfonate, alpha olefin sulfate, sodium or ammonium lauryl ether sulfate, and the nonionic surfactant may be fatty acid amide, alkyl polyglucoside, ethoxylated fatty alcohol, or ethoxylated nonyl phenol. It may be a system, etc., but is not limited thereto. The amphoteric surfactant may be a betaine-based surfactant or amine oxide, and in addition to the surfactant, a diluent such as fragrance, colorant, and water may be optionally added.

The present invention also includes a pharmaceutical composition for preventing or treating viral infections containing the above-described compound or a pharmaceutically acceptable salt thereof.

All matters described regarding the above compounds directly apply to the compounds as active ingredients of the pharmaceutical composition of the present application.

As a result, the compound may prevent or treat the target disease by exhibiting a killing and growth inhibition effect on the target virus.

The RNA virus infection refers to all diseases that can occur in the host due to infection by an RNA virus.

For example, coronavirus disease 19, severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), Zika virus infection, dengue fever, dengue hemorrhagic fever, influenza ( influenza), poliomyelitis anterior acuta, aseptic meningitis, hand-foot-mouth disease, herpes throat (herpangina), acute hemorrhagic conjunctivitis, epidemic pleurisy Pain (epidemic pleurodynia), pericarditis, myocarditis, white diarrhea in infants, rubella, congenital rubella syndrome, yellow fever, Japanese encephalitis, herpes simplex Herpes simplex encephalitis, epidemic parotitis, measles, rabies, Marburg disease, Ebola hemorrhagic fever, hemorrhagic fever with renal syndrome , Hantavirus pulmonary syndrome (HPS), Congo-Crimean hemorrhagic fever, AIDS (Acquired immunodeficiency disease), Adult T-cell leukemia, HTLV-1 associated myelopathy myelopathy), HTLV-1 uveitis, and Lassa fever.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. In the present invention, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not significantly irritate living organisms and does not inhibit the biological activity and properties of the administered ingredient. Pharmaceutically acceptable carriers in the present invention include saline solution, sterilized water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these ingredients may be used in combination. If necessary, other common additives such as antioxidants, buffers, and bacteriostatic agents can be added to formulate an injection suitable for injection into tissues or organs. Additionally, it may be formulated as an isotonic sterile solution, or in some cases, as a dry preparation (particularly a freeze-dried preparation) that can be made into an injectable solution by adding sterile water or physiological saline. Additionally, a target organ-specific antibody or other ligand may be used in combination with the carrier so that it can act specifically on the target organ.

The pharmaceutical composition of the present invention may be provided by mixing with conventionally known substances for preventing or treating viral infections. That is, the pharmaceutical composition of the present invention can be administered in parallel with known substances that have the effect of preventing or treating viral infections.

The composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injectable solutions according to conventional methods. Not limited.

In the present invention, the term “effective amount” refers to the amount necessary to delay or completely promote the onset or progression of a specific disease to be treated.

In the present invention, the composition can be administered in a pharmaceutically effective amount. It is obvious to those skilled in the art that the appropriate total daily usage amount of the pharmaceutical composition can be determined by the treating physician within the scope of sound medical judgment.

For the purposes of the present invention, a specific pharmaceutically effective amount for a particular patient refers to the type and degree of response to be achieved, the specific composition, including whether other agents are used as the case may be, the patient's age, weight, general health, and gender. It is desirable to apply it differently depending on various factors including diet, administration time, administration route and secretion rate of the composition, treatment period, drugs used together or simultaneously with the specific composition, and similar factors well known in the medical field.

In the present invention, the pharmaceutical composition may, if necessary, be accompanied by instructions associated with the packaging in a form directed by a government agency responsible for the manufacture, use and sale of drugs, and the instructions are in the form of the composition or in the form of a human or It indicates approval by a private interest organization for administration to animals, and may be, for example, a label approved by the U.S. Food and Drug Administration for prescription of a drug.

The present invention includes a method of treating viral infections using the composition. Specifically, the method may include administering the composition to an individual in need of treatment, and the individual may be suffering from a viral infection or may be carrying the virus. The subject may be a mammal, including humans.

The method of administration is not limited and may be a method known in the art, and may be administered orally or parenterally.

The present invention includes a method for screening a drug candidate for the treatment of viral infections.

The method includes analyzing the fluorescence intensity of a mixture containing fluorescently labeled single-stranded nucleic acid of the target virus, a protein involved in the polymerization reaction of the viral nucleic acid, a candidate substance for the treatment of viral infections, and graphene oxide. can do.

The method may include first mixing the single-stranded nucleic acid, protein, and candidate material before mixing the graphene oxide, and then, before mixing the graphene oxide, the single-stranded nucleic acid, protein, and candidate material react. You can take enough time to do this.

The time can be appropriately selected by a person skilled in the art depending on conditions such as the type and amount of virus and protein used, temperature, etc., for example, the reaction can be 30 minutes, 1 hour, 2 hours or more. Or it may be 1 hour, 2 hours, or 3 hours or less.

The nucleic acid may be DNA or RNA, and its length is not particularly limited. Specifically, the nucleic acid may be a single-stranded RNA with the 3' end exposed.

The protein may be an enzyme. For example, the enzyme may be an enzyme that amplifies the genome of the target virus or aids proliferation through reverse transcription of RNA. The enzyme may be, for example, a DNA or RNA polymerase.

For example, the enzyme may be a helicase, serine protease, or RdRP, but is not limited thereto.

When RdRP is used as the enzyme, an RNA virus can be used as the target virus. In this case, possible examples and target diseases are the same as described above, so description is omitted.

The method can be performed by a person skilled in the art under appropriate conditions depending on the type of virus and protein for the reaction between the protein and single-stranded nucleic acid.

For example, for the polymerization reaction of nucleic acids by proteins, NTP (nucleoside triphosphate) can be added, or an appropriate auxiliary protein for the protein reaction can be treated together.

The viral nucleic acid may be isolated or contained within the virus.

Analyzing the fluorescence intensity may include comparing the fluorescence intensity with a control group. The fluorescence intensity includes analysis over time.

For example, the control group may be a negative control group that has no effect in treating the viral infection, a positive control group that has a known therapeutic effect in the viral infection, or a control group that has an unknown therapeutic effect in the viral infection.

For example, the negative control may include a substance that has no inhibitory ability on the protein activity, or may be a mixture under conditions in which the protein cannot perform the reaction even if it has an inhibitory ability. For example, it may be a mixture of RdRP enzyme reacted with single-stranded nucleic acid under NTP-free conditions.

When the fluorescence intensity of the mixture containing the candidate substance for the treatment of viral infection is measured in the presence of graphene oxide, if the fluorescence intensity decreases compared to the case of treating the negative control, it can be selected as the virus treatment drug.

Alternatively, if the fluorescence intensity is reduced equally or more significantly compared to the case of treating the positive control, the corresponding candidate material can be selected as a virus treatment agent. Alternatively, a control substance whose effectiveness in treating the viral infection is unknown, that is, a substance whose fluorescence intensity is significantly reduced compared to other candidate substances, can be selected as a treatment agent.

The control group may be one or more. The fluorescence intensity of the control group may be each value obtained from one or a plurality of control groups, or may be the average value, median value, mode, etc. of the values obtained from them.

Since the method is based on fluorescence signals, it is possible to observe and quantify enzyme activity in real time, and thus can effectively screen drug candidates for the treatment of target viruses through high-speed mass screening.

Graphene oxide used in the above method is an economical material that is inexpensive and can be obtained in large quantities, and can be stored stably at room temperature, making it easy to use.

Specifically, the fluorescence of the single-stranded nucleic acid of the fluorescently labeled target virus is quenched by being adsorbed to graphene oxide in the presence of graphene oxide when the protein is inactivated and is not synthesized into a double-stranded nucleic acid and remains in a single-stranded state. The fluorescence intensity of the composition may be weakened.

Therefore, by analyzing the fluorescence intensity, the inhibitory effect of the candidate substance on the protein can be analyzed.

The graphene has a planar single-layer structure in which carbon atoms are filled into a two-dimensional lattice. Graphene has unique electron transfer characteristics, and because of this, graphene oxide can absorb nearby fluorescent dyes through the fluorescence resonance energy transfer (FRET) phenomenon. The fluorescence signal can be quenched.

The adsorption may be due, for example, to the interaction between graphene oxide and the π electrons of the probe, complexation, ion exchange, electrostatic interaction, surface adsorption due to van der Waals attraction, hydrogen bonding, etc., For example, single-stranded nucleic acid can be adsorbed to graphene oxide by pi-pi bonds between the hydrophobic surfaces of graphene oxide.

The fluorescence emission of the fluorescent material may be detected by flow cytometry (FACS), fluorescence reader, qRT-PCR (quantitative real-time PCR), fluorescence microscope, or in vivo imaging device, but is not limited thereto. For example, the fluorescence reader may include, but is not limited to, a fluorescence microplate reader capable of measuring fluorescence ranging from about 230 nm to about 999 nm. For example, the fluorescence reader may include selecting about three organic fluorescent dyes and observing the corresponding fluorescence signals so that the cross-talk phenomenon between the fluorescence signals can be minimized. For example, the flow cytometer includes a device that flows a single cell through a tube and observes the fluorescence signal of the cell. The fluorescence microscope includes, but is not limited to, one capable of observing fluorescence within cells, outside cells, or in samples.

Graphene oxide may be in sheet form or particle form. The sheet may be composed of a single layer or multiple layers. Additionally, the sheet shape may include a flat or curved surface and may exist in various shapes. In one embodiment, the graphene oxide may be in the form of a two-dimensional single layer sheet. Additionally, particle shapes may include various shapes such as spheres, ellipses, rods, and polygons.

Graphene oxide can be nano-sized. The sizes are, for example, 5 to 500 nm, 5 to 200 nm, 5 to 150 nm, 5 to 100 nm, 5 to 50 nm, 10 to 500 nm, 10 to 200 nm, 10 to 150 nm, 10 to 100 nm. , 10 to 50 nm, 20 to 200 nm, 20 to 150 nm, 20 to 100 nm, 20 to 50 nm, 30 to 200 nm, 30 to 150 nm, 30 to 100 nm, 30 to 50 nm, 50 to 200 ㎚ , 50 to 150 nm, 50 to 100 nm, 50 to 80 nm, 60 to 200 nm, 60 to 100 nm, 60, 80 nm, 80 to 200 nm, 80 to 150 nm, 80 to 100 nm, 90 to 20 0 nm , may be 90 to 150 nm or 90 to 100 nm, but is not limited thereto. Particle size is a value calculated by averaging the experimental values obtained by measurement using dynamic light scattering or the sizes seen in atomic force microscopy (AFM) or scanning transmission microscopy (TEM) images. Nanomaterials are said to be spherical or circular. It means the value obtained by assuming.

For a specific example of using nano-sized graphene oxide, the graphene oxide may be conventional graphene oxide made from graphite powder or graphene oxide nanocolloid made from graphite nanofibers.

The graphene oxide may be surface-modified with a water-soluble polymer.

Water-soluble polymer refers to a resin or polymer that can be dissolved in water or dispersed as fine particles in water. The water-soluble polymer may be a natural polymer, a semi-synthetic polymer, or a synthetic polymer. The water-soluble polymer usable in the present invention may have a molecular weight of 1 to 20 kDa, 5 to 15 kDa, or 8 to 12 kDa. As an example, the water-soluble polymer may be 10 kDa.

Water-soluble polymers include chitosan and its derivatives, chitoate, dextran and its derivatives, hyaluronic acid and its derivatives, hyaluronic acid salt, pectin and its derivatives, pectin salt, alginate and its derivatives, alginic acid, agar, galactomannan and its derivatives. May be selected from the group consisting of derivatives, galactomannan salts, xanthan and its derivatives, xanthan salts, beta-cyclodextrin and its derivatives, beta-cyclodextrin salts, polyethylene glycol (PEG), polyethyleneimine (PEI), and combinations thereof. there is. As an example, the water-soluble polymer may be selected from the group consisting of dextran, polyethylene glycol, polyethyleneimine, and combinations thereof.

Water-soluble polymer and graphene oxide may be chemically or physically combined. The chemical bond may include an amide bond, an ester bond, and an ether bond, but is not limited thereto. Additionally, chemical bonding can be achieved through a cross-linking agent. In one embodiment, water-soluble polymers and graphene oxide may be combined through EDC coupling. Additionally, the physical bond may be electrostatic attraction, hydrogen bond, or van der Waals bond, but is not limited thereto. In addition, graphene oxide whose surface has been modified with water-soluble polymers can have improved dispersion ability and stability, and improved biocompatibility.

The fluorescent substances include, for example, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), and oregon green. ), Alex Fluoro, carboxyfluorescein (FAM), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), carboxy-X-rhodamine ( ROX), 6-carboxy-2',4,4',5',7, 7'-hexachlorofluorescein (HEX), Texas Red (sulforhodamine 101 acid chloride), 6-carboxy-2',4, 7',7-tetrachlorofluorescein (TET), tetramethylrhodamine-isothiocyanate (TRITC), carboxytetramethylrhodamine (TAMRA), cyanine dyes, cyadicarbocyanine dyes, and combinations thereof. It may be selected from the group consisting of: The cyanine-based dye may be selected from the group consisting of Cy3, Cy5, Cy5.5, Cy7, and combinations thereof.

The present invention includes a method for determining the protein activity of a virus.

The protein may be an enzyme or may be involved in the polymerization reaction of viral nucleic acid. Specifically, the protein may be RdRP.

The method may include analyzing the fluorescence intensity of a mixture containing fluorescently labeled viral single-stranded nucleic acid, a target protein involved in the polymerization reaction of the viral nucleic acid, and graphene oxide.

The method may include first mixing the single-stranded nucleic acid and the target protein before mixing the graphene oxide, and allowing sufficient time for the single-stranded nucleic acid, protein, and candidate material to react before mixing the graphene oxide. You can.

If the method is to determine protein activity under specific conditions, it can be carried out under those conditions. For example, if you want to determine protein activity in the presence of a specific substance, you can mix the substances together.

If the protein is inactive, the single-stranded nucleic acid is not synthesized into a double-stranded nucleic acid and remains in a single-stranded state, so the fluorescence is quenched by adsorption to graphene oxide in the presence of graphene oxide, and thus the fluorescence intensity of the composition may be weakened. .

Therefore, it can be confirmed whether the protein is active by analyzing the fluorescence intensity.

Detailed descriptions and principles of the method are omitted as they overlap with those described above.

The present invention includes a sensor for screening candidate substances for the treatment of viral infections.

The sensor includes a mixture of a fluorescently labeled single-stranded nucleic acid of a target virus, a protein involved in the polymerization reaction of the viral nucleic acid, and a candidate substance for the treatment of the viral infection; and graphene oxide.

A therapeutic agent for viral infections can be selected by treating the mixture with graphene oxide and analyzing the fluorescence intensity.

When the candidate material can inhibit the activity of a protein, the single-stranded nucleic acid is not synthesized into a double-stranded nucleic acid and remains in a single-stranded state, so the fluorescence is quenched by adsorption on graphene oxide in the presence of graphene oxide, and thus the mixture The fluorescence intensity may weaken.

The sensor can be set to appropriate conditions for the reaction of the protein by a person skilled in the art depending on the type of protein and virus.

For example, the sensor may contain NTP (nucleoside triphosphate) for polymerization of nucleic acids by enzymes.

Detailed descriptions and principles of using the sensor are omitted since they overlap with those described above.

Additionally, the present invention relates to a sensor for determining viral protein activity.

The sensor includes a mixture of a single-stranded nucleic acid of a fluorescently labeled target virus and a target protein involved in a polymerization reaction of the viral nucleic acid; and graphene oxide.

If the protein is inactive, the single-stranded nucleic acid is not synthesized into a double-stranded nucleic acid and remains in a single-stranded state, so the fluorescence is quenched by adsorption to graphene oxide in the presence of graphene oxide, and the fluorescence intensity of the mixture may be weakened. .

Therefore, it is possible to confirm whether the protein is active by treating the mixture with graphene oxide and analyzing the fluorescence intensity.

Hereinafter, the present invention will be described in detail with reference to examples.

실시예Example

1. 산화 그래핀의 제조 및 확인1. Preparation and confirmation of graphene oxide

Graphene oxide is generally synthesized by chemically oxidizing graphite precursors using the modified Hummers' method and exfoliating them through ultrasound. In the process, the ultrasound exposure time and reaction temperature conditions are adjusted to produce uniform graphene oxide of 100 nm or less. was synthesized. 1 g of graphite is reacted with 5 g of potassium permanganate (KMnO ₄ ) in 50 mL of sulfuric acid (H ₂ SO ₄ ) in ice for 2 hours. After removing the ice, react additionally at 40°C for 1 hour. After 1 hour, 50 mL of distilled water was slowly added using a dropping funnel, and an additional 150 mL of distilled water was added and allowed to react for an additional hour. When 10 mL of hydrogen peroxide (H ₂ O ₂ ) is added, the color of the solution changes to yellow and the reaction is completed. Residual acid in the synthesized graphite oxide was removed by washing with 5% HCl and distilled water, and then dried in an oven. Graphene oxide is obtained through repeated ultrasonic pulverization and centrifugation of the synthesized graphite oxide.

In order to confirm the formation of graphene oxide prepared according to the above manufacturing method, the size and thickness information of the graphene oxide sheet were analyzed through atomic force microscopy (AFM)-based analysis of the synthesized graphene oxide. As a result, it was confirmed that graphene oxide with a thickness of approximately 1.1 nm was produced (A-B in Figure 2).

The synthesized graphene oxide was confirmed to show peaks of 3395, 1716, 1225, and 1079 cm ^-1 through infrared spectrum analysis, which correspond to OH relaxation vibration, C=O relaxation vibration, CO (epoxy) vibration, and CO ( Alkoxy) corresponds to vibration. Similarly, through Raman spectrum analysis, it was confirmed that the synthesized dextran-graphene oxide showed strong D band absorption at 1351 cm ^-1 and strong G band absorption at 1589 cm ^-1 (CD in Figure 2).

2. SARS-CoV-2 RdRp의 시험관 수준 활성 분석2. In vitro level activity analysis of SARS-CoV-2 RdRp

First, a single-stranded RNA (ssRNA) sequence to be used as a probe was synthesized by fusing Cy5, a fluorescent substance, to the 5' end. The sequence is UUUUUUUCUACGCGUAGCUUGCUAC (SEQ ID NO: 1), and the 4 bases at the 3' end are complementary to each other to form a loop, and the RdRP protein is designed to generate dsRNA by attaching NTP from the 3' end ( Figure 3 ). RdRP protein (nsp12) and nsp7 and nsp8 proteins, which are accessory proteins required for activity, were obtained using an animal cell expression system and confirmed to be active at the test tube level. In the method, the synthesized ssRNA was first diluted with HEPES buffer containing NaCl, subjected to a denaturation process at 95°C for 5 minutes, and then refolded. The ssRNA prepared in this way was mixed with HEPES buffer containing the same equivalent amount of RdRP protein, auxiliary proteins nsp7 and nsp8 proteins, and KCl, and NTP was added to proceed with the synthesis reaction. The results were compared using a sample without added NTP as a negative control. The concentration of KCl used here is 10 mM, and it has been shown through previous research that RNA synthesis efficiency decreases as the concentration of KCl increases. After the synthesis reaction was completed, the sample was run on a 6M UREA-PAGE gel, and dsRNA synthesis was confirmed only in the NTP-added treatment group ( Figure 4 ).

3. 산화그래핀을 이용한 형광 소광 능력 분석3. Analysis of fluorescence quenching ability using graphene oxide

An experiment was conducted to determine whether the fluorescence of ssRNA labeled with a fluorescent substance is quenched through graphene oxide and the concentration of graphene oxide that can distinguish the difference in the degree of fluorescence quenching between ssRNA and dsRNA. First, ssRNA was mixed with refolding buffer to make it 10 μM, denatured at 95°C for 5 minutes, and then cooled down and refolded. After mixing 2 pmole of refolded ssRNA, RdRp buffer, and RNase inhibitor, pre-heated at 37°C for 5 minutes, then added NTP and reacted for 1 hour. After denaturing at 95°C for 5 minutes to separate the RNA from the protein, it was mixed with 5 ug/ml graphene oxide and the change in fluorescence intensity was measured after 5 minutes at room temperature. Fluorescence values were excitation at 640 nm and emission wavelength was recorded at 660 nm. In the experimental group without NTP, ssRNA was maintained, and when NTP, a substrate, was added, dsRNA was generated by the activity of RdRP. As a result of comparing the degree to which fluorescence was quenched when each sample combined with graphene oxide, graphene oxide When the no addition was set to 100%, it was confirmed that the fluorescence almost disappeared due to graphene oxide in the case of ssRNA (NTP-), and the quenching effect was confirmed to be relatively small in the case of dsRNA (NTP+). (Figure 5). Comparing the fluorescence quenching effect over time, it can be seen that the quenching of dsRNA did not proceed any further even after 30 minutes (Figure 6). As a result of directly comparing the measured fluorescence values, there was a clear difference in fluorescence quenching between ssRNA and dsRNA, so 5 ug/ml graphene oxide was used for drug screening.

4. 산화그래핀을 이용한 RdRp 활성 분석법의 분석능 측정4. Measurement of analytical performance of RdRp activity assay using graphene oxide

In order to evaluate the excellence of the graphene oxide-based viral RdRp activity analysis platform as a screening assay, the Z'-factor, which is widely used as a parameter to evaluate the efficiency and superiority of the screening assay, was measured. The range of the Z'-factor is from 0 to 1, and the closer it is to 1, the more perfect the analysis method is. In general, an analysis method with a Z'-factor of 0.75 or more is said to have high analysis power. First, RdRP protein, buffer, and ssRNA were mixed in each tube, and then 30 samples without NTP and 30 samples with NTP were reacted simultaneously. The results were derived by measuring fluorescence 5 minutes after adding graphene oxide. Relative fluorescence values were calculated by taking the average values of the samples without and with NTP as 0 and 1, respectively, and then plotted on a graph (FIG. 7) . The dotted line on the graph represents ±1σ value. The Z' factor was calculated using Equation 1 below to derive 0.79. A value between 0.5-1 indicates that the experimental method is valid, so it can be considered suitable for performing large screening using this experimental method.

[Equation 1]

5. 저분자 화합물 스크리닝5. Small molecule compound screening

We attempted to screen low-molecular-weight compounds using the above experimental method. Drug screening library was conducted on a total of 17 plates and 1,432 drug reagents. First, all reagents dispensed at a concentration of 1 mM in DMSO were prepared by diluting them to 100 μM using DIW. The reaction mix was prepared by mixing refolded RNA, RdRp protein, RdRp buffer, and RNase inhibitor. First, 2 μl of the prepared drug was dispensed into each PCR tube (final concentration=20 μM), and then 6 μl of the reaction mix was dispensed into each tube and pre-heated at 37°C for 5 minutes. After adding NTP, it was reacted at 37°C for 1 hour and denatured at 95°C for 5 minutes. It was mixed with 5 ug/ml graphene oxide and the change in fluorescence intensity was measured after 5 minutes at room temperature. When the fluorescence value of the NTP- sample was set to 0 and the fluorescence value of the NTP+ sample was set to 1, the relative fluorescence value of the sample treated with each drug was calculated. Among the samples with a relative fluorescence value of 0.7 or less, the drug with a value close to 0.7 was selected. After selection, secondary screening was conducted.

The secondary screening was performed using the same experimental method as the above screening, the difference being that the reagent dispensed in DMSO at a concentration of 1 mM was used directly and a final concentration of 200 μM (final 10% DMSO) was used. Fingolimod (FTY720), Mitoxantrone, Minocycline, Docusate sodium, Capreomycin sulfate, Sisomicin sulfate, and Tobramycin, which were drugs whose fluorescence values were clearly lowered when compared to the positive control, were selected as hit compounds.

6. 선별된 저분자 화합물의 IC50 계산6. IC50 calculation of selected small molecule compounds

Inhibitory concentration 50 (IC50) is a value that determines the biological or biochemical inhibition ability of a specific compound. The IC50 of 7 hit compounds selected through screening was calculated. After preparing each drug at various concentrations, 2 μl of the prepared drug was dispensed into each PCR tube, and then 6 μl of the reaction mix was dispensed into each tube and pre-heated at 37°C for 5 minutes. After adding NTP, it was reacted at 37°C for 1 hour and denatured at 95°C for 5 minutes. It was mixed with 5 ug/ml graphene oxide and the fluorescence intensity was measured at each concentration after 5 minutes at room temperature. As a result, it was confirmed that Fingolimod (FTY720) had an IC50 value of 20.23 uM, Mitoxantrone 5.27 uM, Minocycline 166 uM, Docusate sodium 36.8 uM, Capreomycin sulfate 18.6 uM, Sisomicin sulfate 8.55 uM, and Tobramycin 11.8 uM. .

Claims

An antiviral composition comprising a compound represented by any one selected from the group consisting of the following formulas 1 to 7, or a pharmaceutically acceptable salt thereof:

[Formula 1]

(Wherein, n is an integer of 1 to 10, and R 1 is an alkyl group having 1 to 30 carbon atoms)

[Formula 2]

(wherein n is an integer from 1 to 10)

[Formula 3]

(wherein R 2 is an alkyl group having 1 to 10 carbon atoms)

[Formula 4]

(In the formula, n is an integer of 1 to 10, and R 3 is an alkyl group having 1 to 30 carbon atoms.)

[Formula 5]

(Wherein, n is an integer of 1 to 10, and R 4 is an alkyl group having 1 to 10 carbon atoms)

[Formula 6]

(wherein n is an integer of 1 to 10, and R 5 is an alkyl group having 1 to 10 carbon atoms) and

[Formula 7]

(wherein n is an integer from 1 to 10).
The antiviral composition according to claim 1, wherein the compound is represented by any one selected from the group consisting of the following formulas 8 to 14:

[Formula 8]

[Formula 9]

[Formula 10]

[Formula 11]

[Formula 12]

[Formula 13]

and

[Formula 14]

.
The antiviral composition according to claim 1, wherein the virus is SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2).
A composition for preventing or treating viral infections comprising the composition of claim 1 or 2.
The pharmaceutical composition for preventing or treating a viral infection according to claim 4, wherein the viral infection is coronavirus infection-19.