WO2024047552A1 - Systèmes et procédés d'édition ciblée de génome dans des plantes - Google Patents

Systèmes et procédés d'édition ciblée de génome dans des plantes Download PDF

Info

Publication number
WO2024047552A1
WO2024047552A1 PCT/IB2023/058570 IB2023058570W WO2024047552A1 WO 2024047552 A1 WO2024047552 A1 WO 2024047552A1 IB 2023058570 W IB2023058570 W IB 2023058570W WO 2024047552 A1 WO2024047552 A1 WO 2024047552A1
Authority
WO
WIPO (PCT)
Prior art keywords
tnpb
nucleotide sequence
guide rna
protein
fusion protein
Prior art date
Application number
PCT/IB2023/058570
Other languages
English (en)
Inventor
Kutubuddin A. MOLLA
Mirza J. BAIG
Subhasis Karmakar
Original Assignee
Indian Council Of Agricultural Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Indian Council Of Agricultural Research filed Critical Indian Council Of Agricultural Research
Publication of WO2024047552A1 publication Critical patent/WO2024047552A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2497—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing N- glycosyl compounds (3.2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention belongs to the field of plant biotechnology in general and plant genetic engineering in particular. Specifically, the invention relates to systems and methods for targeted genome editing and gene regulation in plants using hypercompact RNA- guided DNA nuclease. BACKGROUND OF THE INVENTION [0002]
  • the background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.
  • Genetic variation is the key to agricultural crop improvement. The generation of genetic variation through spontaneous mutation is an extremely slow process.
  • Cas9 and Cas12a are the two most popular RNA-guided DNA sequence-specific nucleases (SSNs) (Wang and Doudna, 2023). Cas9 and Cas12a are usually 1100-1500 amino acids long (Koonin et al., 2022).
  • nucleotide deaminase, activator, repressor, methylase/demethylase, and sometimes reporter proteins are fused with Cas9/Cas12a, which further increases the size of the construct and protein.
  • the large size of these proteins is a limiting factor in many applications. The Large size also hinders the effective delivery of editing reagents inside cells.
  • Viral vector- mediated genome editing is an emerging field. Since nucleic acid cargo capacity is limited in viral vectors, packing large-size SSNs like Cas9 or Cas12a is difficult (Davis et al., 2022).
  • RNA-guided DNA nucleases can increase the versatility of applications more specifically for plant genome editing.
  • OBJECTS OF THE INVENTION It is an object of the present disclosure to provide compact and smaller RNA- guided DNA nucleases.
  • TnpB transposon-associated transposase B
  • the present disclosure pertains to systems for targeted genome editing and gene regulation in plants involving hypercompact RNA-guided DNA nucleases, base editor, activator, repressor, and epigenome editor constructs.
  • the present disclosure provides hypercompact plant genome editing systems comprising ‘transposon-associated transposase B’ (TnpB) from bacteria, archaea, and eukaryotes.
  • TnpB transposon-associated transposase B
  • the present disclosure provides an RNA-guided sequence-specific nuclease [‘transposon-associated transposase B’ (TnpB)] for genome editing in plants.
  • TnpB RNA-guided sequence-specific nuclease
  • a system for plant genome editing including generating random indels and precise base substitution, comprising at least a ‘transposon-associated transposase B’ (TnpB) protein and a guide RNA [right-end transposon element-derived RNA (reRNA) plus guide sequence].
  • TnpB transposon-associated transposase B
  • reRNA right-end transposon element-derived RNA
  • the present disclosure provides a system comprising one of the entities selected from an expression construct comprising a nucleotide sequence encoding TnpB and a guide RNA; an expression construct comprising a nucleotide sequence encoding TnpB, and an expression construct comprising a nucleotide sequence encoding a guide RNA; a base editing fusion protein comprising a nuclease-deficient TnpB protein and a deaminase protein domain; an expression construct comprising a nucleotide sequence encoding base editing fusion protein comprising a nuclease-deficient TnpB protein, a deaminase protein domain, and a guide RNA; and an expression construct comprising a nucleotide sequence encoding base editing fusion protein comprising a nuclease-deficient TnpB protein, a deaminase protein domain, and a uracil DNA glycosylase inhibitor and a guide RNA;
  • the present disclosure provides a system for targeted genome editing in plants, said system comprising any one of: a TnpB protein, and a guide RNA [right-end transposon element-derived RNA (reRNA) plus guide sequence]; an expression construct comprising a nucleotide sequence encoding a TnpB protein, and a guide RNA; a TnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a TnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding TnpB protein and a nucleotide sequence encoding guide RNA, wherein, the guide RNA can target said TnpB protein to the target sequence in the plant genome to modify nucleotide sequence, to generate indels, or to induce genetic variations
  • the target sequence is located immediately 3’ of a TAM site in the genome of the plant cell, and wherein the TAM site comprises TTGAT, TTTAA, TTTR, CCAT, TTTAT, TTAG, TTAC, TGAT, TTAT, CTAC, TGAC, or TTAA.
  • the present disclosure provides a system for performing base editing of a target sequence in a plant genome, said system comprising any one of: a base editing fusion protein, and a guide RNA (reRNA plus guide sequence); an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and a guide RNA; a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding base editing fusion protein and a nucleotide sequence encoding guide RNA, wherein, said base editing fusion protein comprises nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB) and
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the present disclosure provides a system to activate the expression of target genes.
  • the system comprises a nuclease-deficient TnpB and TV (6XTAL+2XVP64) activator, and a guide RNA.
  • the present disclosure provides a system for activating the expression of a target nucleic acid in a plant genome, said system comprising any one of: an activator fusion protein, and a guide RNA; an expression construct comprising a nucleotide sequence encoding an activator fusion protein, and a guide RNA; an activator fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding an activator fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding activator fusion protein and a nucleotide sequence encoding guide RNA, wherein said activator fusion protein is a nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB) and a transcription activation
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the present disclosure provides a system for programmable transcriptional repression.
  • the system comprises a nuclease-deficient TnpB; a nuclease- deficient TnpB and KRAB domain; a nuclease-deficient TnpB and KRAB and transcription repression domain (TRD) of Methyl-CpG binding protein 2 (MeCP2).
  • the present disclosure provides a system for repressing expression of a target nucleic acid in a plant genome, comprising any one of: a repressor fusion protein, and a guide RNA; a nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB), and a guide RNA; an expression construct comprising a nucleotide sequence encoding a repressor fusion protein or a dTnpB protein, and a guide RNA; a repressor fusion protein or a dTnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a repressor fusion protein or dTnpB, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the present disclosure provides plasmid vectors for plant genome editing comprising (i) a polynucleotide encoding the TnpB protein; (ii) a polynucleotide encoding base editing fusion protein; (iii) a polynucleotide encoding the activator fusion protein; or (iv) a polynucleotide encoding the repressor fusion protein.
  • the present disclosure provides a method for targeted genome editing in plants comprising the steps of: a. providing the plasmid vector as disclosed herein; b. providing a plant protoplast or calli tissue or other explants; c. transforming the plant protoplast or calli tissue or other explants with the plasmid vector or ribonucleoprotein complex (RNP) to obtain transformed plant cells; d. isolating and identifying the transformed plant cells; e. extracting the genomic DNA from transformed plant cells, followed by determining the genome editing status by Sanger sequencing or Next generation sequencing to identify genome-edited plant cells; and f. regenerating the genome-edited plants using plant growth media.
  • a. providing the plasmid vector as disclosed herein comprising the steps of: a. providing the plasmid vector as disclosed herein; b. providing a plant protoplast or calli tissue or other explants; c. transforming the plant protoplast or calli tissue or other explants with the plasmid vector or rib
  • FIG. 1A shows a schematic description of TnpB-guided genome editing.
  • the guide RNA reRNA+ guide sequence
  • the 20 bp guide sequence at 3'-end of guide RNA is paired with one strand of a targeted DNA.
  • a TAM motif (5’-TTGAT-3’) is necessary for targeting DNA. While TTGAT is for IsDra2TnpB, TnpBs from other species have distinct TAM compatibility.
  • FIG. 1B shows a schematic of catalytically inactive TnpB or nuclease-deficient TnpB or dead TnpB (dTnpB) fused with an effector protein.
  • dTnpB can bind target DNA but cannot make a DSB.
  • dTnpB can be made by installing either D191A, E278A or D361A mutation in TnpB peptide sequence.
  • dTnpB can be fused with effector protein/s to do multiple novel functions.
  • the effector proteins could be reporter proteins, deaminases, methylases/demethylases, transcription activator domains, transcription repressor domains, and the like.
  • Figure 2A and Figure 2B shows schematic diagrams of different versions of constructs used for genome editing in rice and Arabidopsis, respectively.
  • Figure 3A shows schematic diagrams of versions of dTnpB-adenine base editors (dTnpB-ABEs). dTnpB fused with adenosine deaminase (for example, ABE8e here) for A to G base editing.
  • Figure 3B shows schematic diagrams of versions of dTnpB-cytosine base editors (dTnpB-CBEs). dTnpB fused with cytidine deaminase (for example, PmCDA and A3A here) for C to T base editing.
  • Figure 3C shows schematic diagrams of constructs for transcriptional regulations. dTnpB-Act construct can be used for transcriptional activation, while dTnpB-Rep1/Rep2 can be used for transcriptional repression.
  • Figure 4 shows a diagram of the components of pk-TnpB1 vector. A.
  • Oryza sativa Ubiquitin promoter (OsUbi) as Pol II promoter and Oryza sativa U3 snoRNA promoter (OsU3) as Pol III promoter were used to control the transcription of Transposon associated nuclease B (TnpB) and the guide RNA (reRNA+guide sequence), respectively.
  • Pol II and Pol III terminators are used to control the expression of the TnpB nuclease.
  • TnpB encodes rice codon optimized transposon associated nuclease, including bipartite nuclear localization signal (NLS).
  • B. Guide cloning site and schematic promoter sequences for pk-TnpB1 are shown at the bottom.
  • the designed guide sequence can be inserted into BsaI sites in the pk- TnpB1 vector.
  • OsU3 promoter is followed by right-end transposon element-derived RNA (reRNA), cloning site for guide, followed by Hepatitis delta virus ribozyme (HDV ribozyme) and Pol III terminator.
  • reRNA right-end transposon element-derived RNA
  • HDV ribozyme Hepatitis delta virus ribozyme
  • Pol III terminator Pol III terminator.
  • Figure 5 shows a diagram of components of pkb-TnpB1 vector, a binary vector for Agrobacterium-mediated transformation.
  • A. OsUbi as Pol II promoter and OsU3 as Pol III promoter were used to control the transcription of TnpB and the guide RNA (reRNA+guide sequence), respectively.
  • Hygromycin resistant gene was used as a plant selectable marker.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • B. Guide cloning site and schematic promoter sequences for pkb- TnpB1 are shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pkb-TnpB1 vector.
  • OsU3 promoter is followed by right-end transposon element- derived RNA (reRNA), cloning site for guide, followed by Hepatitis delta virus ribozyme (HDV ribozyme) and Pol III terminator.
  • reRNA right-end transposon element- derived RNA
  • HDV ribozyme Hepatitis delta virus ribozyme
  • Figure 6 shows a diagram of components of pk-TnpB2 vector.
  • Pol II terminator, NOS was used to terminate transcription of both TnpB nuclease and the guide RNA.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • HH hammerhead ribozyme
  • HDV ribozymes are used to remove 5’- and 3’-end heterogeneity, respectively, of RNA transcripts.
  • FIG. 7 shows a diagram of components of pkb-TnpB2 vector, a binary vector for Agrobacterium-mediated transformation.
  • OsUbi as Pol II promoter
  • ZmUbi Zea mays Ubiquitin promoter
  • NOS Pol II terminator
  • Hygromycin resistant gene was used as a plant selectable marker.
  • Expression cassettes for TnpB, guide RNA, and hygromycin-resistant genes were placed within the T-DNA right and left border for Agrobacterium-mediated transformation.
  • TnpB encodes rice codon- optimized transposon-associated nuclease, including bipartite NLS.
  • B Guide cloning site and schematic promoter sequences for pkb-TnpB2 are shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pkb-TnpB2 vector. ZmUbi promoter is followed by hammerhead ribozyme (HH), reRNA, cloning site for guide, HDV ribozyme, and Pol II terminator. The hammerhead ribozymes and HDV ribozymes are used to remove 5’- and 3’-end heterogeneity, respectively, of RNA transcripts.
  • HH hammerhead ribozyme
  • HDV ribozymes are used to remove 5’- and 3’-end heterogeneity, respectively, of RNA transcripts.
  • FIG. 8 shows a diagram of the components of pk-TnpB3 vector.
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter were used to control the transcription of TnpB and the guide RNA (reRNA+guide sequence), respectively.
  • a tRNAgly was fused at upstream of reRNA for better transcription.
  • tRNA is cleaved by cellular RNase P and RNase Z.
  • Pol II and Pol III terminators are used to terminate transcription of TnpB nuclease and guide RNA, respectively.
  • TnpB encodes rice codon- optimized transposon-associated nuclease, including bipartite NLS.
  • FIG. 1 shows a diagram of the components of the pk-TnpB4 vector.
  • OsUbi as Pol II promoter and 35S-CmYLCV-U6 composite promoter (hereafter CMP) were used to control the transcription of TnpB and the guide RNA, respectively.
  • NOS terminator was used to terminate transcription of TnpB and a PolyT-NOST was used to terminate transcription of the guide RNA.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • B. Guide cloning site and promoter sequences for pk-TnpB3 are shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk- TnpB4 vector.
  • CMP is followed by HH ribozyme, reRNA, cloning site for guide, HDV ribozyme, and PolyT-NOST terminator.
  • Figure 10 shows a diagram of components of pk-TnpB multiplexing vector (hereafter pk-TnpBM) for simultaneously editing more than one target locus.
  • pk-TnpBM pk-TnpB multiplexing vector
  • A. OsUbi as Pol II promoter and OsU3 as Pol III promoter were used to control the transcription of TnpB and the guide RNAs, respectively. Pol II and Pol III terminators are used to control the expression of the TnpB and the guide RNAs, respectively.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • tRNA-gRNA cassette was assembled through golden gate cloning and fused with existing pk-TnpB1 vector background to make it a pk-TnpBM vector.
  • Two guide cloning sites and promoter sequences for pk-TnpBM are shown at the bottom. More than two guides can also be cloned following the same method.
  • OsU3 promoter is followed by pre- tRNAgly (tRNA), reRNA, guide 1 sequence, tRNA, reRNA, guide 2 sequence, HDV ribozyme, and Pol III terminator.
  • FIG 11 shows a diagram of components of pk-TnpB-D1 vector for genome editing in Arabidopsis (as a model dicot).
  • Pol II and Pol III terminators were used to terminate the expression of TnpB and guide RNA, respectively.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • B. Guide cloning site for pk-TnpB- D1 is shown at the bottom.
  • FIG. 12 shows a diagram of components of pk-TnpB-D2 vector for genome editing in Arabidopsis (as a model dicot).
  • eCaMV Enhanced CaMV35S promoter
  • Arabidopsis thaliana U6-26 (AtU6-26) promoter as Pol III promoter were used to control the transcription of TnpB and guide RNA, respectively.
  • TnpB encodes rice codon-optimized transposon-associated nuclease, including bipartite NLS.
  • B. Guide cloning site for pk-TnpB-D2 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk-TnpB-D2 vector. AtU6-26 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 13 shows a diagram of components of the vector for A to G base editing (hereafter pk-dTnpB-ABEv1).
  • Evolved adenine base editor 8e can be fused to the C terminus of rice codon optimized nuclease deficient TnpB (dTnpB) with a linker.
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter were used to control the transcription of dTnpB and guide RNA, respectively.
  • Pol II and Pol III terminators can be used to control the expression of dTnpB.
  • B. Guide cloning site for pk-dTnpB-ABEv1 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk- dTnpB-ABEv1 vector.
  • FIG. 14 shows a diagram of components of the vector for A to G base editing (hereafter pk-dTnpB-ABEv2).
  • A. Evolved adenine base editor 8e (ABE8e/TadA8e) can be fused to the N terminus of rice codon optimized nuclease-deficient TnpB (dTnpB) with a linker.
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter were used to control the transcription of dTnpB and guide RNA, respectively.
  • Pol II and Pol III terminators can be used to control the expression of dTnpB.
  • B. Guide cloning site for pk-dTnpB-ABEv2 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk- dTnpB-ABEv2 vector. OsU3 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 15 shows a diagram of components of the vector for C to T base editing (hereafter pk-dTnpB-CBEv2).
  • Petromyzon marinus CDA1 can be fused to the N terminus of rice codon optimized nuclease deficient TnpB (dTnpB) with a linker.
  • Uracil DNA glycosylase inhibitor Uracil DNA glycosylase inhibitor (UGI can be fused to the C-terminus).
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter can be used to control the transcription of dTnpB and guide RNA, respectively.
  • B. Guide cloning site for pk-dTnpB-CBEv2 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk-dTnpB-CBEv2 vector.
  • OsU3 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 16 shows a diagram of components of pk-dTnpB-Act vector for activating gene expression.
  • A. Fusion of TV [6X Transcription Activator Like (6XTAL) Domain and 2X Viral protein 64 (2XVP64)] to the C terminus of dTnpB can generate a transcription activator.
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter can be used to control the transcription of dTnpB-TV and the guide RNA, respectively.
  • dTnpB encodes rice codon- optimized nuclease deficient TnpB (dTnpB), including bipartite NLS.
  • B Guide cloning site for pk-dTnpB-Act is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk-dTnpB-Act vector. OsU3 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 17 shows a diagram of components of pk-dTnpB-Rep1 vector for repressing gene expression.
  • Fusion of Krüppel associated box (KRAB) domain to the C terminus of dTnpB can generate a transcription repressor.
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter can be used to control the transcription of dTnpB-KRAB and guide RNA, respectively.
  • dTnpB encodes rice codon-optimized nuclease-deficient TnpB (dTnpB), including bipartite NLS.
  • B. Guide cloning site for pk-dTnpB-Rep1 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk-dTnpB-Rep1 vector.
  • OsU3 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 18 shows a diagram of components of pk-dTnpB-Rep2 vector for repressing gene expression.
  • KRAB Krüppel associated box
  • TRD transcription repression domain
  • Methyl-CpG binding protein 2 Methyl-CpG binding protein 2
  • OsUbi as Pol II promoter and OsU3 as Pol III promoter can be used to control the transcription of dTnpB-KRAB-MeCP2 and guide RNA, respectively.
  • dTnpB encodes rice codon-optimized nuclease-deficient TnpB (dTnpB), including bipartite NLS.
  • B Guide cloning site for pk-dTnpB-Rep2 is shown at the bottom. The designed guide sequence can be inserted into BsaI sites in the pk-dTnpB-Rep2 vector. OsU3 promoter is followed by reRNA, cloning site for guide sequence, HDV ribozyme, and Pol III terminator.
  • Figure 19 shows evidence of editing different loci of the rice genome with pk- TnpB1 vector.
  • OsHMBPP Three target loci (OsHMBPP, OsSla4-g2, and OsPi21) sequences showing the presence of restriction endonuclease recognition sites at the expected cleavage site (highlighted) of TnpB. Cleavage and indel generation would destroy the restriction sites.
  • B Agarose gel image of PCR-RE showing undigested PCR bands marked with ‘+’, which indicates the destruction of restriction sites.
  • C-E Comparison of Sanger sequence data from the undigested bands (M) with wild type (WT) sequences of respective locus, revealing deletion of nucleotides.
  • Figure 20 shows the editing efficiencies of the pk-TnpB1 vector and types of editing in rice protoplast for six different loci as revealed by next-generation sequencing (NGS) analysis.
  • Figure 21 shows the editing efficiencies of the pk-TnpB2 vector and types of editing in rice protoplast for three different loci as revealed by next-generation sequencing (NGS) analysis.
  • Figure 22 shows the editing efficiencies of the pk-TnpB3 vector and types of editing in rice protoplast for three different loci as revealed by next-generation sequencing (NGS) analysis.
  • Figure 23 shows the editing efficiencies of the pk-TnpB4 vector and types of editing in rice protoplast for three different loci as revealed by next-generation sequencing (NGS) analysis.
  • C Insertion percentage.
  • D-F Types of deletion generated in different loci.
  • Figure 24 shows the editing efficiencies of the pk-TnpBM vector and types of editing in rice protoplast for two different loci (OsBSRK and OsWAXY) targeted simultaneously.
  • Next-generation sequencing (NGS) data is presented here.
  • Figure 25 shows the editing efficiencies of the pk-TnpB1 vector for genomic sites with non-specific TAM (TCGAT) and deletion types in rice protoplast for two different loci (OsHMBPP and OsPDS).
  • Next-generation sequencing (NGS) data is presented here.
  • Figure 25 shows the editing efficiencies of the pk
  • Figure 26 shows the editing efficiencies of the pk-TnpB-D1 vector and types of editing in Arabidopsis protoplast for three different loci (AtABP, AtdTMPK and AtGAT), as revealed by Next-generation sequencing (NGS).
  • Figure 27 shows the editing efficiencies of the pk-TnpB-D2 vector and types of editing in Arabidopsis protoplast for three different loci (AtABP, AtdTMPK and AtGAT), as revealed by Next-generation sequencing (NGS).
  • Figure 28 shows the expression of GFP in rice and Arabidopsis protoplast.
  • FIG. 29 shows targeted mutations of OsHMBPP and OsSla4-g2 induced by TnpB detected in stable transgenic rice plants.
  • the upper panel shows sla4-g2 mutants (#22- 4, #22-7, #22-10, #22-16) exhibiting albino phenotype, while wild-type (WT) control plants are green. Plants are from the T1 generation grown from seeds of T0 mutant.
  • the lower panel shows albino hmbpp mutants at T1 generation. Homozygous mutation at both OsSLA4 and OsHMBPP genes causes albino phenotype.
  • Figure 30 shows chromatograms obtained from Sanger sequencing, showing 53 bp deletion for sla4-g2 mutant and 23 bp deletion for hmbpp mutant.
  • Figure 31 shows a schematic representation of methods to perform genome editing using TnpB vectors in accordance with exemplary embodiments of the present disclosure, in rice as a model monocot plant and Arabidopsis as a model dicot plant. DETAILED DESCRIPTION OF THE INVENTION [00057] The following is a detailed description of the embodiments of the present disclosure. The embodiments are in such detail as to clearly communicate the disclosure.
  • the numbers expressing quantities of ingredients, properties such as concentration, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable.
  • the present disclosure provides hypercompact plant genome editing systems comprising ‘transposon-associated transposase B’ (TnpB) protein from bacteria, archaea and eukaryotes.
  • TnpB transposon-associated transposase B
  • the present disclosure provides an RNA-guided sequence-specific nuclease for genome editing in plants, wherein the sequence-specific nuclease is ‘transposon- associated transposase B’ (TnpB) protein.
  • the present disclosure provides a system comprising one of the entities selected from a TnpB protein, and a guide RNA; an expression construct comprising a nucleotide sequence encoding TnpB and a guide RNA; an expression construct comprising a nucleotide sequence encoding TnpB, and an expression construct comprising a nucleotide sequence encoding a guide RNA; a base editing fusion protein comprising a nuclease-deficient TnpB protein and nucleoside deaminase; an expression construct comprising a nucleotide sequence encoding base editing fusion protein comprising a nuclease-deficient TnpB protein and a deaminase protein domain, and a guide RNA; an expression construct comprising a nucleotide sequence encoding base editing fusion protein comprising a nuclease-deficient TnpB protein, a deaminase protein domain or DNA
  • the present disclosure provides a system for targeted genome editing in plants, said system comprising any one of: a TnpB protein, and a guide RNA (right-end transposon element-derived RNA (reRNA) plus guide sequence); an expression construct comprising a nucleotide sequence encoding a TnpB protein, and a guide RNA; a TnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a TnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding TnpB protein and a nucleotide sequence encoding guide RNA, wherein, the guide RNA can target said TnpB protein to the target sequence in the plant genome to modify nucleotide sequence, to generate indels, or to induce genetic variations [
  • reRNA right-
  • TnpB proteins in accordance with the present disclosure can be targeted to different Transposon-associated motifs (TAMs) in the genome selected from but not limited to TTGAT, TTTAA, TTTR, CCAT, TTTAT, TTAG, TTAC, TGAT, TTAT, CTAC, TGAC, and TTAA (Xiang et al., 2023).
  • TAMs Transposon-associated motifs
  • the different species from which the orthologous TnpB may be used can be selected from but not limiting to Deinococcus radiodurans ISDra2 Enterococcus faecium ISEfa4, Aeromonas species ISAs26, Clostridium perfringens ISCpe2, Mycobacterium mazei ISMma22, Bacillus cereus ISBce3, Aeromonas media ISAeme8, Thermobifida fusca ISTfu1, Campylobacter coli ISCco1, Synechococcus sp. ISSoc3, Thermosynechococcus elongatus ISTel2, Nostoc sp.
  • ISNsp3 Clostridium botulinum ISCbt1, Escherichia coli ISEc26, Salmonella enterica ISSen6, Halorhodospira halochloris ISHahl1, Klebsiella pneumoniae ISKpn69, Deinococcus geothermalis ISDge10, Acinetobacter baumannii ISAba30, Raoultella ornithinolytica ISRor9.
  • Table 1 provides a list of TnpBs with their respective TAMs.
  • TAM C Ectothiorhodospirac Halorhodospira ISHahl1 CTAC SEQ ID NO: 29
  • Nucleotide sequences of TnpBs, constructs, and different components for modifying plant genomes and regulating gene expression are given in Sequence IDs 1- 44.
  • Peptide sequences of TnpBs, constructs, and different components for modifying plant genomes and regulating gene expression are given in Sequence IDs 45-84.
  • polynucleotide sequence encoding TnpB polypeptide is codon-optimized for expression in plant cells. Codon optimized polynucleotide sequences encoding different protein domains and polypeptides, and polypeptide sequences disclosed here are given in table 2.
  • RNAs are expressed through promoters selected from polymerase III or polymerase II promoters.
  • the nucleotide sequence encoding said TnpB protein and/or a nucleotide sequence encoding said guide RNA are operably linked to an expression regulatory element for the plant.
  • Said expression regulatory element is (i) a promoter selected from the group consisting of a rice Ubi promoter, a maize Ubi promoter, an enhanced CaMV35S promoter, an Arabidopsis Ubi 10 promoter, a rice U3 promoter, an Arabidopsis U6-26 promoter, a 35S-CmYLCV-U6 composite promoter; (ii) a self-cleaving RNA sequence selected from the group consisting of tRNAGly, HH ribozyme, and HDV ribozyme.
  • the TnpB protein further comprises a nuclear localization sequence (NLS) encoding an amino acid sequence of SEQ ID NO: 45 or 46.
  • Figures 1(A)-1(B) are schematic descriptions of TnpB-mediated genome editing and transcription modulation. reRNA and guide sequence together form guide RNA or omega RNA (Nety et al., 2023). Guide RNA forms a complex with TnpB protein and guides TnpB to the target locus to bind and cleave. Guide sequence binds with the target locus through base pair complementarity. This binding determines the targetability of TnpB.
  • TAM motif for example, TTGAT for ISDra2 TnpB
  • TnpB After binding to the target based on guide sequence complementarity, TnpB would cleave both strands of DNA.
  • the cellular repair pathway often generates indels causing frameshift mutation.
  • Mutation can be installed in TnpB coding sequence to make it nuclease deficient TnpB (dTnpB).
  • dTnpB can be fused with various effectors to execute novel functions at target locus.
  • the applicability of TnpB mediated system is expanded for gene transcription activation and repression by dead TnpB alone or fusing with some activator or repressor domains.
  • the present disclosure provides a system for performing base editing of a target sequence in a plant genome, said system comprising any one of: a base editing fusion protein, and a guide RNA (reRNA plus guide sequence); an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and a guide RNA; a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a base editing fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding base editing fusion protein and a nucleotide sequence encoding guide RNA, wherein, said base editing fusion protein comprises nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB)
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the deaminase is an adenine deaminase comprising an amino acid sequence selected from SEQ ID NOs: 48-51 or a cytidine deaminase comprising an amino acid sequence selected from SEQ ID NOs: 52-55.
  • the DNA glycosylase domain is an alkyladenine DNA glycosylase (AAG) or N-methylpurine DNA glycosylase (MPG) comprising an amino acid sequence set forth in SEQ ID NO: 56 or 58, respectively.
  • AAG alkyladenine DNA glycosylase
  • MPG N-methylpurine DNA glycosylase
  • the deaminase domain or DNA glycosylase domain is fused to the N - terminal of said dTnpB domain, or fused to the C - terminal of said dTnpB domain.
  • the deaminase domain or DNA glycosylase domain and said dTnpB domain is fused through a linker comprising a sequence of SEQ ID NO: 47.
  • the base editing fusion protein further comprises (i) a uracil DNA glycosylase inhibitor (UGI) comprising a sequence of SEQ ID NO: 57; and (ii) a nuclear localization sequence (NLS) comprising a sequence of SEQ ID NO: 45 or 46.
  • UMI uracil DNA glycosylase inhibitor
  • NLS nuclear localization sequence
  • the present disclosure provides a system for activating the expression of a target nucleic acid in a plant genome, said system comprising any one of: an activator fusion protein, and a guide RNA; an expression construct comprising a nucleotide sequence encoding an activator fusion protein, and a guide RNA; an activator fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding an activator fusion protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a nucleotide sequence encoding activator fusion protein and a nucleotide sequence encoding guide RNA, wherein said activator fusion protein is a nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB) and a transcription activation
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the transcription activation domain is a TV activator comprising six copies of the transcription activator like domain (6X TAL) and two copies of VP64 (2X VP64).
  • the present disclosure provides a system for repressing expression of a target nucleic acid in a plant genome, comprising any one of: a repressor fusion protein, and a guide RNA; a nuclease-deficient TnpB/catalytically dead TnpB/dead TnpB domain (dTnpB), and a guide RNA; an expression construct comprising a nucleotide sequence encoding a repressor fusion protein or a dTnpB protein, and a guide RNA; a repressor fusion protein or a dTnpB protein, and an expression construct comprising a nucleotide sequence encoding a guide RNA; an expression construct comprising a nucleotide sequence encoding a repressor fusion protein or dTnpB, and an expression construct comprising a nucleotide sequence encoding a guide RNA; and an expression construct comprising a
  • said dTnpB comprises amino acid substitutions of D191A, E278A, or D361A relative to the wild-type TnpB protein as set forth in SEQ ID NO: 63, 64, and 65, respectively.
  • the transcription repression domain is a Kruppel-associated box (KRAB) domain or a fusion of KRAB with the transcription repression domain of MeCP2 (KRAB-MeCP2) of SEQ ID NOs: 59 and 61, respectively.
  • the present disclosure provides plasmid vectors for plant genome editing comprising (i) a polynucleotide encoding the TnpB protein (ii) a polynucleotide encoding base editing fusion protein; (iii) a polynucleotide encoding the activator fusion protein; or (iv) a polynucleotide encoding the repressor fusion protein.
  • Figure 2(A) and 2(B) are different versions of TnpB-vectors for genome editing in rice and Arabidopsis.
  • Figure 3(A) depicts two different versions of the Adenine base editor and 3 (B) is a schematic of four different versions of the cytosine base editor, while 3 (C) shows gene activator and repressor constructs.
  • Figure 4(A)-18(B) are schematic diagrams of different vectors and guide sequence cloning sites. Vectors are for targeted genome editing, base editing, and transcription regulation. Table 3 provides a list of vectors and their sequence IDs.
  • Table 3 Different vectors and their sequence ID Name of the vectors Seq ID NO p O p Z p O p C p T r p N p N p T p ( t p (N ucleoplasmin)- UGI- NOS T- OsU3- reRNA- guide- HDV ribozyme- terminator] p 6 t p L t p L r [00095] All primer sequences used for constructing different vectors and cloning guide sequences are given in Table 4- 5.
  • Table 4 List of primers used for making different TnpB constructs P n 5 5 5 - r 5 1 5 5 5 5 A 5 ( 5 - a g o p- p - v2 584-F2 TAGGTCTCCtgtgTCCGGCGGCAGTAG 5 5 5 6 - 6 6 6 C F 6 C R 6 A 7 A 6 6 6 6 7 7 7 p
  • Table 5 List of primers used for cloning different guides Primer name Primer sequence Purpose 3 O 3 O 3 O 3 O 3 2 3 1 3 2 3 1 3 2 3 3 3 3 1 3 2 6 6 6 6 6 6 6 6 6 g gg 662-Oligo1 tcaaGTTGTCGAGCAAGGGGATGT Cloning of OsHMBPP e 6 6 e 6 6 6 6 6 6 6 6 6 9 9 9 9 9 9 9 9 9 9 9 [00096]
  • the present disclosure provides a method for targeted genome editing in plants comprising the steps of: a.
  • plasmid vector as disclosed herein; b. providing a plant protoplast or calli tissue or other explants; c. transforming the plant protoplast or calli tissue or other explants with the plasmid vector or ribonucleoprotein complex (RNP) to obtain transformed plant cells; d. isolating and identifying the transformed plant cells; e. extracting the genomic DNA from transformed plant cells, followed by determining the genome editing status by Sanger sequencing or Next generation sequencing to identify genome-edited plant cells; and f. regenerating the genome-edited plants using plant growth media.
  • RNP ribonucleoprotein complex
  • the transformation in step c) is effected by a method selected from the group consisting of PEG-mediated or electroporation- mediated protoplast transfection; or biolistic, agrobacterium-mediated, nanoparticle- mediated, pollen tube approach, ovary injection approach, and virus-mediated transformation methods.
  • the method further comprising the steps of: culturing the plant cell to produce plants under conditions in which the TnpB polypeptide is expressed through transformation and cleaves the nucleotide sequence at the target site to produce genetic variation or a modified nucleotide sequence; and selecting plants with the said modified nucleotide sequence.
  • the method effects insertion of heterologous DNA into the plant genome, deletion of a nucleotide sequence from the plant genome, or changes of at least one nucleotide in the plant genome.
  • Figure 19-30 are experimental data provided as exemplary evidence of genome editing in Rice, a model monocot, and Arabidopsis, a model dicot. Table 6 provides a list of genes in rice and Arabidopsis with their IDs that were targeted by TnpB.
  • Figure 31 relates to a schematic representation of methods to perform genome editing in plants using TnpB vectors in accordance with exemplary embodiments of the present disclosure, wherein the left panel represents method performed for editing in monocot and dicot protoplast and the right panel represents method performed in calli tissue or other explants and for regenerating stable genome edited plants. [000102] All primer sequences used for screening and sequencing of target loci are given in Table 7- 8.
  • Table 7 List of primers used for screening of mutants P 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 610-AtGATase-Sc- TGCACCCGCCATGGATGTACTT Screening of mutants for F 6 R 6 F 6 R 6 6 7 ) 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7
  • Table 8 List of primers used for deep amplicon sequencing (NGS) P 5 5 5 F 5 R 592-OsSLA4-g1- ACACTCTTTCCCTACACGACGCTCTTCCGATC Deep F TCAAGTGTGGGGCATTGGAAA sequencing for 5 R 5 5 5 5 5 6 6 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6 G 6
  • the OsUbi promoter may be replaced with eCaMV35S, AtUbi10, or other suitable dicot-specific Pol II promoters for improving editing efficiency in dicot plants.
  • the method of the present disclosure comprises transformation to plant protoplast or calli tissue or other explants with vectors of the present disclosure with cloned guide RNAs targeted to specific DNA loci; genomic DNA extraction from the transformed cells and determination of precise editing by Sanger sequencing or next generation sequencing; and regenerating genome-edited plants using suitable media.
  • the TnpB reagents may be delivered to cells through PEG-mediated/electroporation-mediated protoplast transfection with DNA/RNA/RNP. In some embodiments, the TnpB reagents may also be transferred to cells through biolistic, Agrobacterium-mediated, nanoparticle-mediated, and virus-mediated methods. [000107] In certain embodiments, the TnpB vector may be removed by genetic cross or segregation upon identification of successful editing, to generate non-transgenic genome- modified plants. [000108] In certain embodiments, the Rice and Arabidopsis are used in exemplary embodiments as model monocot and dicot plants, respectively.
  • the TnpB systems in accordance with the present disclosure can be used to remove marker genes from transgenic plants.
  • the TnpB system in accordance with the present disclosure can be used for a multitude of applications, including but not limited to, promoter editing for creating a continuum of trait variation, gene editing, splice site editing, UTR editing, developing crop disease and pest resistance, increasing grain number and size, enhancing yield, altering nutritional qualities, enhancing abiotic stress tolerance, developing herbicide-tolerance, removing antinutrients, enhancing shelf-life, induction of haploidy, clonal propagation of hybrids, and crop improvement.
  • TnpB system can be used to knock-in gene or other DNA sequences at a desired genomic location by creating DSB and supplying additional donor templates, relying on cellular homology-directed repair (HDR). 2.
  • the TnpB system can be used to develop versatile base editing tools, including but not limited to Adenine base editor, cytosine base editor, C-to-G base editor, A-to- Y base editor (where Y represents C or T), and dual base editor.
  • the TnpB system can be used to develop epigenome editors for modifying DNA methylation status. 4.
  • the TnpB system can be used to develop live cell DNA imaging tools. 5.
  • the TnpB system can be used to develop DNA diagnostic tools by utilizing its collateral cleavage activity. 6.
  • the TnpB system can be combined with other RNA-guided nucleases for additional and synergistic functions. 7.
  • Active TnpB and dead TnpB systems can be combined for simultaneously performing genome editing and gene regulation.
  • 8. dTnpB system can be used for prime editing by fusing with reverse transcriptase and using an orthogonal nickase.
  • the inventors cloned the reRNA component with 3’ dual Bsa1 recognition sites and HDV ribozyme under the OsU3 promoter ( Figure 4B).
  • the Bsa1 site allows cloning of 20 bp guide sequence of choice.
  • the construct is abbreviated as pk-TnpB1 ( Figure 4A).
  • TnpB cleavage is dependent on the presence of transposon-associated motif (TAM) 5’ to the target sequence.
  • TAM transposon-associated motif
  • the TAM sequence is 5’-TTGAT-3’.
  • TnpB cleaves targets at 15-21 bp from TAM, generating staggered patterns.
  • the inventors have designed guide RNAs for six different genomic loci (OsSLA4-g1, OsSLA4-g2, OsHMBPP, OsPi21, OsCAF2, and OsCKX2) in rice in such a way that some of them contain a restriction enzyme (RE) recognition sequence at the expected cleavage site (Figure 19A).
  • PCR products were amplified from protoplast transfected with the vectors containing guides and cloned in pGEMT vector.
  • Pol-III promoter (OsU3) was used to express guide RNAs in pk-TnpB1.
  • the inventors replaced the pol-III promoter and pol-III terminator with a Pol-II promoter (ZmUbi) and Pol-II terminator (Nos) for expressing guide RNA.
  • the inventors named the new vector as pk-TnpB2 ( Figure 6A-B).
  • the inventors transfected pk-TnpB2 to rice protoplast to target three loci, OsHMBPP, OsPi21, and OsSla4g2.
  • NGS analysis revealed very high editing efficiency at OsHMBPP (70%) and OsPi21 (70.5%) ( Figure 21A-B).
  • pk- TnpB2 Like pk-TnpB1, pk- TnpB2 also generated mutations dominated by deletions of variable lengths ( Figure 21C-G). [000119] A previous study showed that the fusion of tRNA upstream of guide RNA can increase transcription (Xie et al., 2015). tRNA gene sequence contains internal promoter elements, BoxA and BoxB, which recruit RNA Polymerase III complexes. The inventors have fused a tRNAgly sequence upstream of reRNA sequence in the pk-TnpB1 vector background to generate pk-TnpB3 vector ( Figure 8A-B).
  • a composite promoter which harbors the CaMV35S enhancer, CmYLCV promoter, and shortened U6-26 promoter, was used.
  • the inventors used the composite promoter to express guide RNA and generated a new vector pk-TnpB4 (Figure 9A-B).
  • the inventors observed the highest 7.5% editing efficiency in the case of OsSLA4-g2 locus ( Figure 23A). For all three loci, deletion dominated the mutation spectrum ( Figure 23B-F).
  • a major advantage of RNA-guided nucleases is their flexibility in multiplexing, i.e.
  • the inventors constructed a multiplex vector to edit OsBSRK1 and OsWAXY loci simultaneously ( Figure 10A).
  • Figure 10B The inventors assembled two guide RNA components in a polycistronic tRNA-guide RNA gene ( Figure 10B).
  • the tRNAs used here are cleaved by endogenous RNaseP and RNaseZ. Cleavage of tRNA releases individual guide RNA.
  • the inventors have observed editing at both the loci with more than 1% Indel generating efficiency ( Figure 24A- E).
  • the inventors have checked the specificity of TnpB by targeting genetic locus with non-targeting PAM.
  • the inventors have designed three guides to target AtABP, AtdTMPK, and AtGAT genes.
  • the inventors have constructed a vector, pk-TnpB-D1 for expression in Dicot.
  • the TnpB was expressed under the Pol-II promoter AtUbi10, while the guide RNA was expressed with the Pol-III promoter, AtU6-26 ( Figure 11A-B).
  • the editing efficiency across three loci ranged from 0.16% to 0.42% ( Figure 26A). Similar to rice, the mutations generated in Arabidopsis were mostly deletions (Figure 26B-F).
  • the inventors have replaced the AtUbi10 promoter with an enhanced CaMV35S (eCaMV35S) promoter to express TnpB.
  • the vector is abbreviated as pk-TnpB-D2 ( Figure 12A-B).
  • the eCaMV35S promoter was found to be superior to AtUbi10 in Arabidopsis ( Figure 28B).
  • the vector pk-TnpB-D2 performed better than pk-TnpB-D1.
  • the inventors have observed significantly enhanced editing efficiency across all three loci, AtABP, AtdTMK, and AtGAT, tested.
  • Editing efficiency ranged from 0.19% to 2.16% with predominantly deletions ( Figure 27A-F).
  • the inventors changed the amino acid aspartic acid to alanine at 191 position (D191A) in the TnpB polypeptide sequence through site-directed mutagenesis to develop nuclease-deficient TnpB or deactivated TnpB (dTnpB).
  • dTnpB nuclease-deficient TnpB or deactivated TnpB
  • Inventors targeted five rice genetic loci in OsPAO5, OsSSIIIa, and OsPDS genes with dTnpB and observed no trace of editing, indicating the deactivation of TnpB with D191A mutation.
  • the protoplast transfection efficiency of the plasmid vectors was determined by performing transfection with a plasmid harbouring GFP expression cassette. Rice protoplast was transfected with high efficiency (as high as 66%) as determined by FACS analysis ( Figure 28A and 28C). Arabidopsis protoplast was transfected with 40% efficiency ( Figure 28B). [000127] Then, the inventors generated stable rice mutants with TnpB binary vectors. The inventors constructed pkb-TnpB1 ( Figure 5A-B) and pkb-TnpB2 ( Figure 7A-B) for Agrobacterium-mediated rice calli transformation.
  • TnpB offers solutions to above stated limitations and multiple advantages over other nucleases for genome editing and gene regulation. 2. Hypercompact nature of TnpB allows high efficiency delivery in a variety of contexts for genome engineering applications. 3. TnpB generates mostly large deletions that are suitable for effective knockout of target genes. 4.
  • TnpBs described here offer expanding genome targetability since they can be targeted to genomic loci that were inaccessible by other nucleases. TnpBs can be targeted to sequences located immediately 3’ of a TAM site in the genome of the plant cell. Different orthologous TnpB proteins are specific to different TAMs, including TTGAT, TTTAA, TTTR, CCAT, TTTAT, TTAG, TTAC, TGAT, TTAT, CTAC, TGAC, or TTAA.
  • Transposon-associated TnpB is a Nature, 599(7886), 692–696. Li, J., Chen, L., Liang, J., Xu, R., Jiang, Y., Li, Y., Ding, J., Li, M., Qin, R., & Wei, P. (2022). Development of a highly efficient prime editor 2 system in plants.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des systèmes et des procédés d'édition ciblée de génome dans des plantes à l'aide de nucléases d'ADN guidées par ARN hypercompactes et de constructions d'éditeurs de bases. La présente invention concerne des systèmes et des procédés de régulation ciblée de gènes dans des plantes à l'aide d'une protéine de fusion d'activateur et d'une protéine de fusion de répresseur. La présente invention concerne des nucléases d'ADN guidées par ARN compactes et miniatures. La présente invention concerne un système d'édition du génome des plantes, y compris la génération d'indels aléatoires et la substitution précise de bases, comprenant au moins une protéine 'transposase B associée à un transposon' (TnpB) et un ARN guide. Le système comprenant l'une des entités choisies parmi une construction d'expression comprenant une séquence nucléotidique codant pour TnpB et un ARN guide ; une construction d'expression comprenant une séquence nucléotidique codant pour TnpB, et une construction d'expression comprenant une séquence nucléotidique codant pour un ARN guide ; une protéine de fusion d'édition de bases comprenant un domaine de protéine TnpB et de désaminase déficient en nucléase ; une construction d'expression comprenant une séquence nucléotidique codant pour une protéine de fusion d'édition de bases ci-décrite comprenant une protéine TnpB déficiente en nucléase et un domaine de protéine désaminase et un ARN guide.
PCT/IB2023/058570 2022-08-31 2023-08-30 Systèmes et procédés d'édition ciblée de génome dans des plantes WO2024047552A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN202211049676 2022-08-31
IN202211049676 2022-08-31

Publications (1)

Publication Number Publication Date
WO2024047552A1 true WO2024047552A1 (fr) 2024-03-07

Family

ID=90098887

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2023/058570 WO2024047552A1 (fr) 2022-08-31 2023-08-30 Systèmes et procédés d'édition ciblée de génome dans des plantes

Country Status (1)

Country Link
WO (1) WO2024047552A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111575298A (zh) * 2020-06-08 2020-08-25 淮阴师范学院 一种水稻叶片白化基因OsHMBPP、蛋白质及应用
US20210180076A1 (en) * 2019-12-17 2021-06-17 University Of Maryland, College Park Compositions and methods for genome editing in plants
CN114058639A (zh) * 2021-10-29 2022-02-18 中国种子集团有限公司 利用单碱基基因编辑技术突变OsWaxy基因改良水稻直链淀粉含量的方法
WO2022159892A1 (fr) * 2021-01-25 2022-07-28 The Broad Institute, Inc. Polypeptides tnpb reprogrammables et leur utilisation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210180076A1 (en) * 2019-12-17 2021-06-17 University Of Maryland, College Park Compositions and methods for genome editing in plants
CN111575298A (zh) * 2020-06-08 2020-08-25 淮阴师范学院 一种水稻叶片白化基因OsHMBPP、蛋白质及应用
WO2022159892A1 (fr) * 2021-01-25 2022-07-28 The Broad Institute, Inc. Polypeptides tnpb reprogrammables et leur utilisation
CN114058639A (zh) * 2021-10-29 2022-02-18 中国种子集团有限公司 利用单碱基基因编辑技术突变OsWaxy基因改良水稻直链淀粉含量的方法

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
JAIN RASHMI, JENKINS JERRY; SHU SHENGQIANG; CHERN MAWSHENG; MARTIN JOEL A.; COPETTI DARIO; DUONG PHAT Q.; PHAM NIKKI T.; KUDRNA DA: "Genome sequence of the model rice variety KitaakeX", BMC GENOMICS, vol. 20, no. 1, 1 December 2019 (2019-12-01), London, UK , pages 1 - 9, XP093174333, ISSN: 1471-2164, DOI: 10.1186/s12864-019-6262-4 *
KARVELIS TAUTVYDAS; DRUTEIKA GYTIS; BIGELYTE GRETA; BUDRE KAROLINA; ZEDAVEINYTE RIMANTE; SILANSKAS ARUNAS; KAZLAUSKAS DARIUS; VENC: "Transposon-associated TnpB is a programmable RNA-guided DNA endonuclease", NATURE, vol. 599, no. 7886, 7 October 2021 (2021-10-07), pages 692 - 696, XP037627757, DOI: 10.1038/s41586-021-04058-1 *
KIM DO YON, CHUNG YUHEE, LEE YUJIN, JEONG DONGMIN, PARK KWANG-HYUN, CHIN HYUN JUNG, LEE JEONG MI, PARK SEYEON, KO SUMIN, KO JEONG-: "AAV-deliverable hypercompact adenine base editors based on transposase B guided by engineered RNA", RESEARCH SQUARE, pages 1 - 20, XP093069291, [retrieved on 20230801], DOI: 10.21203/rs.3.rs-1326630/v1 *
NAWAZ GUL, USMAN BABAR; PENG HAOWEN; ZHAO NENG; YUAN RUIZHI; LIU YAOGUANG; LI RONGBAI: "Knockout of Pi21 by CRISPR/Cas9 and iTRAQ-Based Proteomic Analysis of Mutants Revealed New Insights into M. oryzae Resistance in Elite Rice Line", GENES , vol. 11, no. 7, 1 January 2020 (2020-01-01), US , pages 1 - 23, XP093175425, ISSN: 2073-4425, DOI: 10.3390/genes11070735 *
RUZYATI MARINA, SISHARMINI ATMITRI; APRIANA ANIVERSARI; SANTOSO TRI JOKO; PURWANTO EDI; SAMANHUDI SAMANHUDI; YUNUS AHMAD: "Construction of CRISPR/Cas9_gRNA-OsCKX2 module cassette and its introduction into rice cv. Mentik Wangi mediated by Agrobacterium tumefaciens", BIODIVERSITAS, vol. 23, no. 5, 1 May 2022 (2022-05-01), pages 2679 - 2689, XP093175434, ISSN: 1412-033X, DOI: 10.13057/biodiv/d230552 *
WANG ZHONG-WEI; LV JUN; XIE SHU-ZHANG; ZHANG YU; QIU ZHEN-NAN; CHEN PING; CUI YONG-TAO; NIU YAO-FANG; HU SHI-KAI; JIANG HONG-ZHEN;: "OsSLA4encodes a pentatricopeptide repeat protein essential for early chloroplast development and seedling growth in rice", PLANT GROWTH REGULATION, vol. 84, no. 2, 25 October 2017 (2017-10-25), Dordrecht, pages 249 - 260, XP036420295, ISSN: 0167-6903, DOI: 10.1007/s10725-017-0336-6 *
YANGBIN GAO, YI ZHANG, DA ZHANG, XINHUA DAI, MARK ESTELLE, YUNDE ZHAO: "Auxin binding protein 1 (ABP1) is not required for either auxin signaling or Arabidopsis development", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 112, no. 7, 17 February 2015 (2015-02-17), pages 2275 - 2280, XP055443013, ISSN: 0027-8424, DOI: 10.1073/pnas.1500365112 *

Similar Documents

Publication Publication Date Title
JP7160891B2 (ja) ポリメラーゼＩＩ（Ｐｏｌ－ＩＩ）ベースのガイドＲＮＡ発現のための方法および組成物
Čermák et al. A multipurpose toolkit to enable advanced genome engineering in plants
Tang et al. Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing
Wang et al. Multiplex gene editing in rice with simplified CRISPR‐Cpf1 and CRISPR‐Cas9 systems
Ali et al. Efficient virus-mediated genome editing in plants using the CRISPR/Cas9 system
CN105132451B (zh) 一种CRISPR/Cas9单一转录单元定向修饰骨架载体及其应用
Liu et al. CRISPR/Cas9-mediated genome editing in plants
Lin et al. Efficient linking and transfer of multiple genes by a multigene assembly and transformation vector system
EP3708665A1 (fr) Procédés et compositions pour l'expression de l'arn guide à base d'arn-t
Zhang et al. Engineering artificial microRNAs for multiplex gene silencing and simplified transgenic screen
Soyars et al. Cutting edge genetics: CRISPR/Cas9 editing of plant genomes
WO2017100158A1 (fr) Procédés et compositions pour modification de génome médiée par nucléase augmentée et effets hors-site cible réduits
CA2906724A1 (fr) Utilisation d'arn de guidage tronques (arng tron) pour une augmentation de la specificite d'edition genomique guidee par arn
WO2019006833A1 (fr) Bibliothèque de sgarn spécifique à l'échelle du génome de porc, sa méthode de préparation et son application
US20210155948A1 (en) Method for increasing the expression level of a nucleic acid molecule of interest in a cell
CN110157709B (zh) 一种橡胶树U6基因启动子proHbU6.8及其克隆与应用
WO2022199511A1 (fr) Protéine lt1cas13d et système d'édition génique
Zhong et al. Intron-based single transcript unit CRISPR systems for plant genome editing
CN112384620A (zh) 用于筛选和鉴定功能性lncRNA的方法
WO2024047552A1 (fr) Systèmes et procédés d'édition ciblée de génome dans des plantes
CA3023994C (fr) Procede de criblage de genes resistants au glyphosate, gene mutant epsps et souche deficiente et utilisation
Alok et al. CRISPR/Cas9-mediated gene editing tool and fathomless genetic and metabolic engineering applications in plants
Ren et al. Successive chromosome walking by compatible ends ligation inverse PCR
Onodera et al. Establishment of a conditional TALEN system using the translational enhancer dMac3 and an inducible promoter activated by glucocorticoid treatment to increase the frequency of targeted mutagenesis in plants
CN113278646A (zh) 一种构建水稻多基因编辑突变体库的方法及应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23859593

Country of ref document: EP

Kind code of ref document: A1