WO2024047004A1

WO2024047004A1 - Multimodal probe and method of manufacturing the same

Info

Publication number: WO2024047004A1
Application number: PCT/EP2023/073587
Authority: WO
Inventors: Simon DUMAS; Stéphanie DESCROIX; Céline VALLOT; Leïla PERIE; Eve MOUTAUX
Original assignee: Institut Curie; Centre National De La Recherche Scientifique; Sorbonne Universite
Priority date: 2022-08-29
Filing date: 2023-08-29
Publication date: 2024-03-07

Abstract

The invention relates to a probe comprising a bead, a first binding assembly and a second binding assembly, wherein: – the first binding assembly comprises a first bead-binding portion and a first probe portion, – the second binding assembly comprises a second bead-binding portion, a second probe portion, and a cleavable portion between the second bead-binding portion and the second probe portion, – the first and second bead-binding portions are attached to the bead; – the first probe portion is a portion capable of binding to a first analyte; – the second probe portion is a portion capable of binding to a second analyte.

Description

MULTIMODAL PROBE AND METHOD OF MANUFACTURING THE SAME

TECHNICAL FIELD

The present invention relates to a multimodal probe for separating different modalities, and the method of producing such a probe. The probe is applicable for performing a single-cell multiomics analysis.

TECHNICAL BACKGROUND

Recent advances in single-cell sequencing and droplet microfluidics have allowed molecular modalities to be analyzed from a large number of individual cells at a single-cell resolution. The most common method today is based on compartmentalizing single cells within micro-droplets forming an emulsion in a microfluidic device, in which the targeted modality, such as transcriptome, genome, proteome or epigenome, is associated with a unique DNA barcode before being subjected to sequencing.

For example, Klein AM, et al., Cell. 2015; 161 (5): 1187-1201 (2015) proposes a droplet-microfluidic approach for indexing RNA molecules of individual cells with unique DNA barcodes in droplets, followed by next-generation sequencing. DNA barcodes are brought in droplets by polymer beads that are coencapsulated with cells. The teaching of this document is limited to the analysis of a single cellular modality, e.g., RNA.

Over the last years, there has been an increasing interest in establishing links between different cellular modalities at a single-cell resolution. Several methods for such single-cell multiomics sequencing protocols have been reviewed in, for example, Macaulay IC, et.al., Nat Methods. 2015;12(6):519-22, Matula, K., Rivello, F., Huck, W. T. S., Adv. Biosys. 4, 1900188 (2020), and Lee, J., Hyeon, D.Y. & Hwang, D. Exp Mol Med 52, 1428-1442 (2020), such as the G&T-seq method for quantifying the genome and transcriptome, the SNARE-seq method for quantifying the transcriptome and epigenome, and the CITE-seq method for quantifying the transcriptome and proteome.

G&T-seq involves bead-based separation of RNA and DNA, in which the beads on which RNA is captured can be extracted from a supernatant containing DNA. In other words, it requires a physical separation step of RNA and DNA and it is difficult to be adapted to a droplet microfluidics platform. SNARE-seq and CITE-seq are based on droplet microfluidics, which allows high-throughput but lacks physical separation. In these methods, the two modalities are captured and processed (e.g. hybridization, reverse transcription and amplification) simultaneously in the droplet, which requires compromise among buffers and reagents to allow them to be compatible to both analytes. Another approach is to add a step of splitting the product including the different cellular modalities into two fractions to treat them separately at the expense of a significant sample loss. In parallel, microfluidics-based methods to extract beads from droplet with minimal sample loss are being developed (Ali-Cherif et al., Angew. Chem. Int. Ed., 2012 ; Serra et al., Sens. Actuators B Chem., 2020 ; Dumas et al., Adv. Mater. Technol., 2022). However, there is still a need for an upgraded multimodal barcoding bead system compatible with such a bead extraction platform, in which the multiple cellular modalities are associated with the same barcode in the droplet, after which the bead and the droplet are separated and treated separately.

SUMMARY OF THE INVENTION

It is a first object of the invention to provide a probe comprising a bead, and at least a first binding assembly and a second binding assembly, wherein:

- the first binding assembly comprises a first bead-binding portion and a first probe portion,

- the second binding assembly comprises a second bead-binding portion, a second probe portion, and a cleavable portion between the second bead-binding portion and the second probe portion,

- the first and second bead-binding portions are attached to the bead;

- the first probe portion is a portion capable of binding to a first analyte; and

- the second probe portion is a portion capable of binding to a second analyte.

In some embodiments, the first binding assembly and the second binding assembly are polynucleotide sequences, wherein the cleavable portion comprises a cleavable molecular moiety.

In some embodiments, the first binding assembly further comprises at least one barcode portion, preferably located between the first bead-binding portion and the first probe portion; the second binding assembly further comprises at least one barcode portion, preferably located between the cleavable portion and the second probe portion; the barcode portion(s) is/are the same between the first binding assembly and the second binding assembly, preferably wherein: the barcode portion(s) of the first binding assembly are connected to each other and/or to the first bead-binding portion and/or to the first probe portion via respective connectors; and the barcode portion(s) of the second binding assembly are connected to each other and/or to the cleavable portion and/or to the second probe portion via respective connectors, and more preferably wherein the connectors are single-stranded nucleotide sequences which form doublestranded sequences with complementary single-stranded connectors.

In some embodiments, the connectors for the first binding assembly are different from the connectors for the second binding assembly.

In some embodiments, the first binding assembly and/or the second binding assembly further comprise(s) at least one additional portion selected from a primer-binding site capable of hybridizing a primer, a sequencing adapter, a spacer, a tag, a sample barcode, a unique molecular identifier, or any combination thereof.

In some embodiments, the first binding assembly comprises, from proximal to distal with respect to the bead, a first bead-binding portion, three barcode portions, additional portions of a primer-binding site and a unique molecular identifier, and a first probe portion of poly(T) tail, all the portions being connected to each other via respective connectors; and the second binding assembly comprises, from proximal to distal with respect to the bead, a second bead-binding portion, a cleavable portion, an additional portion of a sequencing adapter, three barcode portions, and a second probe portion, all the portions being connected to each other via the respective connectors.

In some embodiments, the cleavable portion is electromagnetically, enzymatically, chemically, or thermally cleavable.

In some embodiments, the first binding assembly does not comprise a cleavable portion which is cleavable by a same mechanism as the cleavable portion of the second binding assembly.

In some embodiments, the first binding assembly comprises a cleavable portion different from the cleavable portion of the second binding assembly, and the cleavable portion of the first binding assembly is cleavable by a different mechanism from the cleavable portion of the second binding assembly.

In some embodiments, the first binding assembly does not comprise any cleavable portion.

In some embodiments, the bead comprises a magnetic material.

It is a second object of the invention to provide a method of preparing the above-mentioned probe, the method comprising:

- providing a bead;

- attaching the first binding portion and the second portion to the bead; - assembling the first binding assembly from the first binding portion attached to the bead; and

- assembling the second binding assembly from the second binding portion attached to the bead.

In some embodiments, the method further comprises attaching barcode portion(s) of the first binding assembly to each other and/or to the first beadbinding portion and/or to the first probe portion via respective connectors, and attaching barcode portion(s) of the second binding assembly to each other and/or to the cleavable portion and/or to the second probe portion via respective connectors for the second binding assembly.

In some embodiments of the method, attaching the barcode portion(s) via respective connectors is performed by a split and pool method by ligation (or primer elongation).

It is a third object of the invention to provide a method of separating a first analyte and a second analyte in a droplet, comprising:

- providing a droplet containing the first analyte, the second analyte, and the above-mentioned probe;

- binding the first analyte to the first binding assembly,

- binding the second analyte to the second binding assembly,

- releasing the second binding assembly from the probe,

- extracting the probe from the droplet, the first analyte remaining bound to the probe, and the droplet containing the second analyte released from the probe.

In some embodiments of the separation method, the first analyte and the second analyte are of a same biological sample, wherein the biological sample is preferably a single cell.

In some embodiments of the separation method, the droplet is within a fluid, and the step of extracting the probe is performed by passing the droplet within the fluid through a constriction in a main channel, and supplying a fluid immiscible with the fluid of the droplet downstream of the constriction, the constriction preferably having at least one width dimension which is equal to or less than the diameter of the bead in a non-constricted state.

In some embodiments, the separation method further comprises a step of adding a molecule comprising a sequencing adapter or a primer-binding site to the droplet and/or to the probe recovered after the extraction.

The present invention makes it possible to selectively release some binding assemblies and optionally barcodes from the beads. Among several binding assemblies for capturing different analytes, only one binding assembly (or some binding assemblies) can be released from the bead while the other binding assembly (or other binding assemblies) remains captured on the bead, thereby allowing different analytes to be separated easily.

This is achieved because the second binding assembly is provided with a cleavable portion. Advantageously, the first binding assembly does not comprise such a cleavable portion, or if it does, comprises a cleavable portion which is cleavable by a different mechanism from the cleavable portion for the second binding assembly. Thus, upon a suitable cleavage treatment, the second binding assembly, or the second binding assembly together with the second analyte, is released from the bead in the droplet while the first analyte remains captured on the bead via the first binding assembly. The bead can be then extracted from the droplet while preferably keeping the emulsion integrity. The multiple binding assemblies may comprise a common barcode, allowing the different analytes present in the sample to be associated with a unique barcode.

One advantage of the invention is that this probe is simple to implement as it is already fully compatible with conventional methods such as hydrogel beads fabrication, barcoding (split and pool) and encapsulation methods. This advantage can be coupled with the concept of the single-cell multiomics analysis. For instance, a first cellular modality is captured on the bead and extracted out of the droplet to be treated following a different adapted protocol, while the second cellular modality can be associated with a barcode having a UV-cleavable portion and treated conventionally in the droplet.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1a shows one example of a step of making beads which may be used in the invention.

Figure 1b shows beads containing a ferrofluid which may be used in the invention.

Figure 2 shows a schematic diagram of a probe of the present invention.

Figure 3a to Figure 3c show an example of the method of extracting a bead from a droplet according to the present invention.

Figure 4 shows an example of a main channel comprising a narrowed portion and a non-narrowed portion, which may be used in the method of extracting a bead from a droplet.

Figure 5 shows a schematic diagram of an example of the probe of the present invention.

Figure 6 shows an example of a collecting reservoir for collecting beads separately from droplets. Figure 7a shows an example of the step of introducing a biological sample and a bead into a droplet.

Figure 7b shows an example of the step of releasing a second binding assembly from a bead into a droplet, while a first binding assembly to which a first analyte is bound remains tethered to the bead.

Figure 7c shows an example of extracting a bead from a droplet, thereby separating the first analyte on the bead from the second analyte in the droplet.

Figure 8a to Figure 8e illustrate schematically two application examples of the invention, in which the content of an extracted droplet (second analyte) is subjected to amplification after the extraction.

Figure 9a to Figure 9e illustrate schematically one application example of the invention, in which the first analyte bound on the bead is subjected to, after the extraction, reverse transcription and amplification.

Figure 10 illustrates schematically another application example of the invention, in which the first analyte bound on the bead is subjected to, after the extraction, reverse transcription and amplification.

DESCRIPTION OF EMBODIMENTS

The invention will now be described in more detail without limitation in the following description.

As shown in Fig. 2, the probe 15 of the present invention comprises a bead 16, a first binding assembly 17, and a second binding assembly 18. Each component will be described below.

Beads and method of making beads

Beads

The term “beads" herein means three-dimensional particles, preferably made from natural or synthetic polymers, having preferably a substantially spherical shape in a non-constricted state. The term “ non-constricted state" herein refers to the shape of the beads freely suspended in a suspension at zero or a low flow rate. In this state, the beads are not deformed by shear, by contact with a surface, by a magnetic force or the like.

The beads may be hydrogel beads. Polyacrylamide beads are a preferred example.

In some embodiments, the beads contain a magnetic material such as magnetic fluid, magnetic nanoparticles or a magnetic core. Examples of the magnetic fluid is a ferrofluid. The term “ferrofluid’ refers to a suspension comprising magnetic nanoparticles (/.e. particles having a maximum dimension of less than 1 pm). Examples of magnetic nanoparticles include, but are not limited to, those comprising or consisting of iron, cobalt, zinc, cadmium, nickel, gadolinium, chromium, copper, manganese, terbium, europium, gold, silver, platinum, and alloys thereof. Examples of the magnetic core include an iron oxide core.

In some embodiments, the beads contain a ferrofluid, as shown in Fig. 1b. The proportion of ferrofluid in the beads may for example range from 0.5 to 50%, preferably from 1 to 30 %, more preferably from 2 to 20% (v/v). The proportion of the magnetic nanoparticles in the beads may for example range from 0.01 to 1 %, preferably 0.05% to 0.7%, more preferably 0.1 % to 0.5% (v/v).

The beads may be magnetic such as paramagnetic or superparamagnetic, and in particular paramagnetic.

The particle size distribution of the bead population may be adjusted, which may include for example straining the beads in order to remove all beads having a diameter above a threshold value.

The diameter of each individual bead may range for example from 10 nm to 1 mm, preferably from 100 nm to 500 pm, more preferably from 1 pm to 250 pm, even more preferably from 10 pm to 150 pm, most preferably from 25 pm to 100 pm. An example of diameter is approximately 50 pm. As a population, the beads may be characterized by a median volume diameter Dv50 ranging for example from 10 nm to 1 mm, preferably from 100 nm to 500 pm, more preferably from 1 pm to 250 pm, even more preferably from 10 pm to 150 pm, most preferably from 25 pm to 100 pm. An example of median volume diameter Dv50 diameter is approximately 50 pm.

The diameter may be determined by microscope imaging, optionally with fluorescence labeling. For example, two-dimensional images of the beads may be captured and the average diameter or median diameter may be calculated from, for example, 100 beads, based on such microscopy images. The maximum dimension measured on each microscopy image corresponds to the diameter of the bead.

Making beads

Beads used in the invention may be formed by any conventional method known to the skilled person, as described, for example, in Zilionis R et al., Immunity. 2019;50(5):1317-1334.

The beads may be in particular formed in a conventional microfluidic chip.

The term “microfluidic" herein means a device or chip in which the minimal channel or chamber dimensions are of the order of 1 to less than 1000 pm. The term “millifluidic" herein means a device or chip in which the minimal channel or chamber dimensions are of the order of 1 to 10 mm. The term “nanofluidic" herein means a device or chip in which the minimal channel or chamber dimensions are of the order of less than 1 pm.

Although the description below makes reference to microfluidic devices or chips, millifluidic or nanofluidic devices or chips may be used equivalently.

One example of a method of making beads is illustrated in Fig. 1a.

In a microfluidic chip, a gel precursor may be passed through a main channel 1 and a fluid immiscible with the gel precursor as a continuous phase may be passed through at least one side channel 2, thereby forming droplets of the gel precursor within the immiscible fluid. The gel precursor may contain the magnetic material as described above and/or one or more bead-binding portions which will be described in detail later.

Fig. 1a illustrates two side channels for the immiscible fluid, which are perpendicular to the main channel (so-called “flow-focusing" geometry), but the channel geometry is not limited to this flow-focusing geometry, and may be a T- junction in which two incoming flows of fluid are orthogonally joined, or a co-flow geometry in which one fluid flows in an inner channel and the other fluid flows in an outer channel in the same direction, the outlet of the inner channel being disposed in the outer channel.

As shown in Fig. 1a, a cross-linking initiator may be injected from an additional channel 3 fluidically connected to the main channel 1 , but alternatively the cross-linking initiator may be premixed in the gel precursor (in this case, there may be no need for the additional channel).

The flow rates of the gel precursor, the immiscible fluid, and possibly the cross-linking initiator may vary depending on the application, and in particular on the dimensions of the channel. The throughput may be approximately from 100 to 6000 droplets/s.

The formed droplets may then be cross-linked to form beads dispersed in a surrounding fluid, which is preferably an aqueous phase. If the immiscible fluid used for forming the beads is fluorocarbon-based or oil-based, the beads may be transferred to an aqueous phase as a surrounding fluid, or said fluid may be removed and replaced by an aqueous phase as a surrounding fluid. This replacement may take place before, or preferably after cross-linking. The conditions for cross-linking may be selected depending on the composition of the precursor gel and may include for example heating or electromagnetic irradiation such as UV irradiation, or chemical cross-linking such as the addition of calcium in the case of alginate cross-linking. The beads may be conditioned in a packed configuration, for example owing to a centrifugation or magnetic sedimentation step.

Binding Assemblies

The first binding assembly and the second binding assembly of the probe of the invention are attached to the bead. The first binding assembly comprises a first bead-binding portion and a first probe portion, and the second binding assembly comprises a second bead-binding portion, a second probe portion and a cleavable portion between the second bead-binding portion and the second probe portion.

Fig. 2 schematically shows an example of the probe 15 of the invention. The first binding assembly 17 and the second binding assembly 18 are attached to the bead 16 via the first bead-binding portion 17a and the second bead-binding portion 18a, respectively.

In some embodiments, the first binding assembly 17 and the second binding assembly 18 may be a single-stranded or double-stranded polynucleotide sequence. Alternatively, the first binding assembly 17 and the second binding assembly 18 may be partially single-stranded and partially double-stranded polynucleotide sequence.

The term “bead-binding portion" refers to a portion which is attached to the bead. The bead-binding portion may be a single-stranded or double-stranded polynucleotide sequence.

The term “polynucleotide" as used herein refers to a nucleic acid sequence. The nucleic acid sequence may be a DNA or a RNA sequence, preferably the nucleic acid sequence is a DNA sequence. This term also encompasses what is sometimes referred to as oligonucleotides. The polynucleotide sequences used in the present invention may be designed and purchased commercially from any DNA synthesis facilities/companies, or synthesized by standard techniques.

The bead-binding portion may be a single-stranded sequence having a length of 5 to 100 nucleotides (nt), 5 to 90 nt, 5 to 80 nt, 5 to 70 nt, 5 to 60 nt, 5 to 50 nt, 5 to 40 nt, 5 to 30 nt, 5 to 20 nt, 10 to 100 nt, 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt or 10 to 20 nt, for example, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nt. Alternatively, the bead-binding portion may be a double-stranded sequence having a length of 5 to 100 base pairs (bp), 5 to 90 bp, 5 to 80 bp, 5 to 70 bp, 5 to 60 bp, 5 to 50 bp, 5 to 40 bp, 5 to 30 bp, 5 to 20 bp, 10 to 100 bp, 10 to 90 bp, 10 to 80 bp, 10 to 70 bp, 10 to 60 bp, 10 to 50 bp, 10 to 40 bp, 10 to 30 bp or 10 to 20 bp, for example, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 bp.

Preferably, the bead-binding portion is a double-stranded sequence.

The bead-binding portion may vary depending on the composition of the bead; for example, in the case of polyacrylamide beads, the bead-binding portion may be an Acrydite-modified nucleotide sequence or a nucleotide sequence having an acrylic phosphoroam idite moiety.

In an alternative case, the beads may comprise streptavidin on their surface, and the binding portion may be a biotin-modified nucleotide sequence (e.g., biotinylated DNA primer).

More generally, the bead-binding portion comprises a chemical moiety which adapted to specifically, covalently or non-covalently, binding to a corresponding chemical moiety on the bead surface.

The bead-binding portion may be the same or different between the first and second binding assemblies. The bead-binding portion of the first binding assembly and the bead-binding portion of second binding assembly are preferably the same.

Referring again to Fig. 2, the first binding assembly 17 and the second binding assembly 18 comprise a first probe portion 17b and a second probe portion 18b, respectively.

The term “probe portion" refers to a portion which may bind to an analyte in a specific manner. In the present invention, the first probe portion is a portion capable of (specifically) binding to a first analyte and the second probe portion is a portion capable of (specifically) binding to a second analyte.

For example, the binding between the probe portion and the analyte may occur through the hybridization of the probe portion with the analyte, or through ligation (either by blunt ligation or “sticky end” ligation).

The term “hybridization" refers to the process in which two single-stranded polynucleotide sequences bind via hydrogen bonding between the bases of the nucleotide residues (i.e., base pairing) to form a stable double-stranded complex. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may also comprise three or more strands forming a multi stranded complex.

The term “ligation" as used herein refers to the covalent binding or joining of two polynucleotides to produce a single larger polynucleotide. Ligation can include chemical as well as enzymatic ligation. In general, the ligation methods discussed herein utilize enzymatic ligation by a ligase (such as T7 DNA ligase or a T4 DNA ligase). The ligation may be blunt-end ligation or sticky-end ligation. The probe portions 17b, 18b may be located at a distal position with respect to the bead 16. More specifically, each of the probe portions 17b and 18b may be located at the distal end of the binding assembly 17 and 18, respectively.

The term “dista as used herein refers to a relative position in a binding assembly, the position being farther from the bead. The term “proximar as used herein refers to a relative position in a binding assembly, the position being closer to the bead.

When the binding occurs through the hybridization, the probe portion may be a single-stranded or double-stranded polynucleotide sequence having a sufficient length to allow for the hybridization to the analyte.

The probe portion may be 5’-phosophoryated on the strand(s).

The probe portion may be a single-stranded sequence having a length of 10 to 100 nt, 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt or 10 to 20 nt, for example, a length of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, or 100 nt. Alternatively, the probe portion may be a double-stranded sequence having a length of 10 to 100 bp, 10 to 90 bp, 10 to 80 bp, 10 to 70 bp, 10 to 60 bp, 10 to 50 bp, 10 to 40 bp, 10 to 30 bp or 10 to 20 bp, for example, a length of 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, or 100 bp.

When the probe portion is double-stranded, the portion may be subjected to a suitable denaturation treatment (i.e., separation of a double-stranded sequence into single, complementary strands by heating or with a reagents such as NaOH) prior to the hybridization to the analyte, allowing the resulting singlestranded sequence to bind to the target analyte.

The term “analyte" as used herein (also referred to as “cellular modality”) refers to a variety of biological and chemical molecules including, but not limited to, nucleic acids, polypeptides, amino acids, polysaccharides and lipids. Specific examples thereof include DNA such as genomic and mitochondrial DNA, RNA such as mRNA and microRNA, modified or artificial nucleic acids such as block nucleic acids, peptide nucleic acids, thiolated nucleic acids, epigenetic information such as chromatin and DNA methylation, cell surface, intracellular, or extracellular proteins, lipid messengers involved in cell signaling, steroid hormones, sphingolipids, prostaglandins, phosphatidylserine lipids, oxysterol and cholesterol derivatives.

The first analyte and the second analyte may be contained in a biological sample. The term “biological sample" means any sample obtained from a biological source. Examples thereof include whole blood, serum, plasma, saliva, urine, sputum, lymph, a cell, an organelle, an organoid, cellular assembly, an aggregate of cells, an island of cells, an embryo, a dendrimer, a tissue slice, a unicellular or multicellular organism, a virus, or any combination of these. Preferably, the biological sample is a single cell or a lysed single cell, or a fraction extracted from a single cell (such as a nucleus from a single cell).

The cells may include, as an exemplary and non-exhaustive list, eukaryotic cells, including animal cells (such as mammal cells and more specifically human cells), yeast cells, fungal cells, plant cells, protozoa, prokaryotic cells, such as bacteria. Any combination of the above may also be used. The cells may be of any cell type, including circulating tumor cells, hematopoietic cells, red blood cells, circulating endothelial cells, parasites, circulating fetal cells and the like.

A biological sample may also be obtained from a multicellular organism, which may include animals, notably but not exclusively, laboratory model animals such as nematodes, embryos, notably non-human embryos (such as fish embryos), flies, eggs, plants, fungi, genetically modified organisms (GMOs).

By way of example, the first analyte may be mRNA and the second analyte may be chromatin - or conversely. In other examples, the first analyte may be mRNA and the second analyte may be membrane proteins - or conversely.

The probe portions may be designed to have a complementary sequence of a part of the analyte of interest.

The term “complementary as used herein refers to the hybridization or base pairing between nucleotides or nucleic acids, such as, for instance, between the two strands of a DNA molecule or between an polynucleotide primer and a primer-binding site on a single-stranded nucleic acid to be sequenced or amplified. Complementary nucleotides are, generally, A and T (or A and II), or C and G. Two single-stranded RNA or DNA molecules are said to be complementary when the nucleotides of one strand pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%. Alternatively, complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementary.

When the analyte is mRNA, the probe portion may comprise a poly(T) tail (a stretch of thymine nucleotides) which has a sufficient length to allow poly(A)- tailed RNAs to be captured by hybridization. The term “poly(A) taif’ means a chain of adenine nucleotides, and can refer to a poly (A) tail that is to be added to an RNA transcript at the end of transcription, or can refer to the poly (A) tail that already exists at the 3' end of an RNA transcript. A poly (A) tail is typically 5 to 300 nucleotides in length.

When the analyte is DNA, the probe portion may comprise polynucleotides which are complementary to a specific target sequence, coding or non-coding, contained in the genome. For example, the probe portion may comprise a polynucleotide sequence complementary to repetitive sequences.

When the analyte is a protein, the protein may be labeled beforehand with a barcoded antibody (an antibody comprising an antibody barcode and a polynucleotide capture sequence, e.g., poly(A) tail), and the probe portion may comprise a sequence complementary to the capture sequence, e.g., poly(T) tail.

In some embodiments, the analyte may be subjected to a pretreatment (e.g., “tag mentation" of chromatin, which will be further described later) to add sequencing adapters. In this case, the probe portion may be designed to contain the same sequencing adapters to hybridize with the analyte.

The term “sequencing adapte as used herein refers to a molecule (e.g., polynucleotide sequence) which is adapted to allow a sequencing instrument to sequence a target polynucleotide.

Referring back to Fig. 2, the second binding assembly further comprises a cleavable portion 18c between the second binding portion and the second probe portion. Fig. 2 illustrates for convenience a photocleavable portion which is already cleaved, but the photocleavable portion 18c is not cleaved prior to a suitable cleavage treatment.

The term “cleavable portion" as used herein refers to a portion which can be cleaved under certain conditions, by a specific mechanism. The cleavable portion may be electromagnetically (e.g. by UV light of a specific wavelength), enzymatically, chemically, or thermally cleavable. The conditions applied to cleave the cleavable portions are such that the rest of the binding assembly is not damaged or cleaved.

Examples of the cleavable portion include a photocleavable spacer (for example, available from Integrated DNA Technologies among other suppliers), a thermally-cleavable linker, a linker containing a disulfide bond which is broken by reduction, a linker containing an azo group which is broken by reduction, a linker containing a uracil residue which can be excised by Uracil Glycosylase or USER® enzyme (NEB), and a linker containing a restriction site recognized by a restriction enzyme, preferably a linker containing a uracil residue which can be excised by Uracil Glycosylase or USER® enzyme (NEB). The cleavable portion may be a polynucleotide sequence, single-stranded or double-stranded, which comprises a cleavable molecular moiety.

As used herein, the term “cleavable molecular moiety” refers to any chemical bond that can be cleaved by a cleavage mechanism as explained above. Suitable cleavable chemical bonds are well known in the art and include, but are not limited to, acid labile bonds, protease/peptidase labile bonds, photolabile bonds, disulfide bonds, and esterase labile bonds.

The cleavable portion may be a single-stranded sequence having a length of 5 to 100 nt, 5 to 90 nt, 5 to 80 nt, 5 to 70 nt, 5 to 60 nt, 5 to 50 nt, 5 to 40 nt, 5 to 30 nt, 5 to 20 nt, 10 to 100 nt, 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt or 10 to 20 nt, for example, a length of 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nt. Alternatively, the cleavable portion may be a double-stranded sequence having a length of 5 to 100 bp, 5 to 90 bp, 5 to 80 bp, 5 to 70 bp, 5 to 60 bp, 5 to 50 bp, 5 to 40 bp, 5 to 30 bp, 5 to 20 bp, 10 to 100 bp, 10 to 90 bp, 10 to 80 bp, 10 to 70 bp, 10 to 60 bp, 10 to 50 bp, 10 to 40 bp, 10 to 30 bp or 10 to 20 bp, for example, a length of 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 bp.

The cleavable portion is preferably a double-stranded sequence.

The cleavable portion may be 5’-phosophoryated on the strand(s).

The cleavable portion may also comprise an additional moiety, such as 3SpC3 (three-carbon group), which prevents the backward extension during amplification (e.g., PCR).

In some embodiments, the first binding assembly of the probe of the present invention does not comprise a cleavable portion which is cleavable by the same mechanism as the cleavable portion of the second binding assembly.

In some embodiments, the first binding assembly comprises a cleavable portion different from the cleavable portion of the second binding assembly, the cleavable portion of the first binding assembly is cleavable by a different mechanism from the cleavable portion of the second binding assembly. For example, the first binding assembly may comprise a cleavable portion which is chemically cleavable while the second binding assembly may comprise a cleavable portion which is electromagnetically, e.g. UV-cleavable.

In other embodiments, the first binding assembly does not comprise any cleavable portion as defined above. In this case, preferably, the first bead-binding portion 17a is directly connected to the first probe portion 17b or at least one barcode portion 17d, which is described below. Referring back to Fig. 2, the first and second binding assemblies may further comprise at least one barcode portion 17d, 18d. Fig. 2 illustrates three barcode portions 17d, 18d in each binding assembly, but the binding assembly may comprise one barcode portion, two barcode portions, four barcode portions, and so on.

The term “barcode portion" generally refers to a polynucleotide sequence that can be used as an identifier for an associated analyte, or as an identifier of the source of an associated analyte, such as a cell-of-origin (cell barcode).

The barcode portion(s) of the first binding assembly is/are preferably located between the first bead-binding portion and the first probe portion. The barcode portion(s) of the second binding assembly is/are preferably located between the cleavable portion and the second probe portion.

The barcode portion(s) are preferably the same between the first binding assembly and the second binding assembly. Alternatively, the barcode portion(s) are different between the first binding assembly and the second binding assembly, as long as the barcode portion for the first binding assembly and the barcode portion for the second binding assembly are identified as pertaining to a same probe.

The barcode portion may be a single-stranded or double-stranded polynucleotide sequence. The barcode portion may be a single-stranded having a length of 5 to 100 nt, 5 to 90 nt, 5 to 80 nt, 5 to 70 nt, 5 to 60 nt, 5 to 50 nt, 5 to 40 nt, 5 to 30 nt, 5 to 20 nt, 10 to 100 nt, 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt or 10 to 20 nt, for example, a length of 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nt. Alternatively, the barcode portion may be a double-stranded sequence having a length of 5 to 100 bp, 5 to 90 bp, 5 to 80 bp, 5 to 70 bp, 5 to 60 bp, 5 to 50 bp, 5 to 40 bp, 5 to 30 bp, 5 to 20 bp, 10 to 100 bp, 10 to 90 bp, 10 to 80 bp, 10 to 70 bp, 10 to 60 bp, 10 to 50 bp, 10 to 40 bp, 10 to 30 bp or 10 to 20 bp, for example, a length of 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 bp.

Each barcode portion is preferably a double-stranded polynucleotide sequence.

Each barcode portion may be 5’-phosphorylated on the strand(s).

In some embodiments, the first binding assembly and/or the second binding assembly further comprises at least one additional portion selected from a primer-binding site capable of hybridizing a primer, a sequencing adapter, a spacer, a tag, a sample barcode, a unique molecular identifier (UMI), or any combination thereof.

Examples of the primer include a polymerase chain reaction (PCR) primer, reverse transcription (RT)-PCR primer, library preparation primer, or a sequencing primer.

Example of the sequencing adapter include a library preparation primer (such as Illumina PEI, PE2 or PE2-N6), library reading sequences (Readl (R1 ), Read2 (R2), Readl N (R1 N), Read2N (R2N), Truseq Read1/2, Nextera Read1/2) a flow cell binding site (such as Illumina P5 and P7), or an index sequence. The flow cell binding site, as used herein, refers to a polynucleotide sequence which binds to a complementary sequence immobilized at the surface of a flow cell which is a part of a sequencing instrument.

The term "tag" as used herein refers to a moiety or part of a molecule that enables or enhances the ability to detect and/or identify, either directly or indirectly, a molecule or molecular complex (e.g., binding assembly).

The term “sample barcode" (also referred to as “sample identifie ) is a known polynucleotide sequence that can be used to identify a sample.

The term “unique molecular identifier or “UMI" as used herein refers to a sequencing linker or a subtype of nucleic acid barcode for detecting and quantifying unique amplified products. In theory, no two original fragments should have the same UMI sequence. As such, UMIs can be used to determine if two similar sequence reads are derived from different original fragments or if they are simply duplicates created during amplification (such as by PCR).

The at least one additional portion may be located at the distal end of the bead-binding portion, or of the cleavable portion if present. Specifically, when the barcode portion(s) is/are present, the additional portion(s) may be located between the bead-binding portion and the barcode portion(s), or between the cleavable portion and the barcode portion(s). Alternatively, the additional portion(s) may be located between the barcode portion(s) and the probe portion.

In the probe of the present invention, the first binding assembly may further comprise connectors for the first binding assembly, and the second binding assembly may further comprise connectors for the second binding assembly. The connectors for the first binding assembly are preferably different from the connectors for the second binding assembly.

The term “connector as used herein refers to a molecule or segment of a molecule (e.g., polynucleotide sequence) which is capable of binding to another corresponding (e.g., complementary) connector. In the probe of the invention, at least one connector may be present at one or both ends of each portion. One connector at an end of a portion can bind to a corresponding connector at an end of another portion, thereby allowing the connection of the two portions via the connectors.

The connectors for the first binding assembly may be the same with each other or different from each other. The connectors for the first binding assembly are preferably different from each other.

The connectors for the second binding assembly may be the same with each other or different from each other. The connectors for the second binding assembly are preferably different from each other.

In cases where two or more barcode portion(s) are present, the barcode portions may be attached to each other via the connectors. In other words, the barcode portions of the first binding assembly may be attached via the connectors for the first binding assembly while the barcode portions of the second binding assembly may be attached via the connectors for the second binding assembly.

Preferably, the connectors for the first binding assembly are different from the connectors for the second binding assembly, in other words, the connectors for the first binding assembly are specific to the first binding assembly and the connectors for the second binding assembly are specific to the second binding assembly. The use of such different connectors for the first binding assembly and the connectors for the second binding assembly allows the first binding assembly and the second binding assembly to be distinguished from each other. Even when the first and second binding assemblies have the same barcode portions, the use of such different connectors still allows the first and second binding assemblies to be distinguished from each other (as the intermediate connectors are different between the first and second binding assemblies).

The other portions as explained above may be also attached to each other via connectors. In other words, the portions of the first binding assembly may be attached via the connectors for the first binding assembly while the portions of the second binding assembly may be attached via the connectors for the second binding assembly.

For example, the barcode portion(s) of the first binding assembly may be attached to each other, to the first bead-binding portion, and/or to the first probe portion via the connectors for the first binding assembly, and the barcode portion(s) of the second binding assembly may be attached to each other, to the cleavable portion, and/or to the second probe portion via the connectors for the second binding assembly.

The connectors for the first and second binding assemblies may be a single-stranded polynucleotide sequence having a length of 2 to 50 nt, 2 to 40 nt, 2 to 30 nt, 3 to 20 nt, or 4 to 10 nt, preferably 2 to 20 nt, more preferably 4 to 8 nt, for example, a length of 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 nt.

The connectors are preferably single-stranded polynucleotide sequences located at an end of a portion (e.g., 3’ overhang or 5’ overhang). A single-stranded connector at one end of a portion may bind to a complementary single-stranded connector at one end of another portion to form a double-stranded sequence, thereby allowing the two portions to be connected to each other via the connectors.

As explained above, the first and second binding assemblies may be single-stranded or double-stranded. However, this does not mean that binding assemblies have to be one or another. For example, the binding assemblies may be partially single-stranded and partially double-stranded (e.g., the probe portion is single-stranded and the rest is double-stranded). They may be also subjected to denaturation or hybridization treatment depending on the application. For example, if binding assemblies are double-stranded at the time of fabrication, the binding assemblies may be subjected to a suitable denaturation treatment prior to the hybridization to the analytes, allowing the resulting single-stranded sequence to bind to the target analyte.

Although the above description relates to a probe comprising a first binding assembly and a second binding assembly, it is also possible to have more than two binding assemblies. Each additional (third, fourth, etc.) binding assembly may be similar to the first binding assembly or to the second binding assembly described above. Each binding assembly comprises a probe portion which binds to a different analyte. For example, in one variation, the probe comprises a first binding assembly which does not comprise any cleavable portion, a second binding assembly which comprises a cleavable portion which may be cleaved by a first mechanism, and a third binding assembly which comprises a cleavable portion which may be cleaved by a second mechanism different from the first mechanism. More generally, it is preferred that at most one binding assembly is devoid of a cleavable portion, and that all binding assemblies which comprise a cleavable portion have different cleavable portions, which are cleaved by different mechanisms.

Manufacturing of the probe

The method of preparing the probe of the present invention (also referred to as “preparation method”) is explained below. The probe prepared by the preparation method of the invention comprises a bead, a first binding assembly and a second binding assembly; the first binding assembly comprises a first bead-binding portion and a first probe portion; the second binding assembly comprises a second bead-binding portion, a second probe portion and a cleavable portion between the second bead-binding portion and the second probe portion; the first probe portion is a portion capable of binding to a first analyte; and the second probe portion is a portion capable of binding to a second analyte.

The bead, the first and second binding assemblies are as defined above.

The method comprises providing a bead; attaching the first binding portion and the second portion to the bead; assembling first binding assembly from the first binding portion attached to the bead; and assembling the second binding assembly from the second binding portion attached to the bead.

The bead may be provided by the method as described above. The beadbinding portions may be attached to the bead after the bead formation or during the bead formation (the binding portions may be pre-mixed in the gel precursor for beads, or the gel precursor and the binding portions may be co-injected to the microfluidic chip).

In some embodiments of the preparation method of the invention, the beads are polyacrylamide beads, and the bead-binding portions may be Acrydite- modified nucleotide sequences or nucleotide sequences having an acrylic phosphoroamidite moiety.

In this case, the first and second bead-binding portions may be attached to the polyacrylamide bead by standard free radical polymerization via a thioether bond.

Alternatively, the beads may be streptavidin beads, and the bead-binding portions may be biotinylated DNA primers. In this case, the first and second beadbinding portions may be attached to the streptavidin bead via the high affinity interaction between the streptavidin and biotin.

The bead-binding portions may be attached to the bead after the bead formation, or preferably during the bead formation, i.e., the bead-binding portions may be simultaneously injected with the gel precursor to a microfluidic chip.

In some embodiments of the preparation method of the invention, the first binding assembly and the second binding assembly are polynucleotide sequences, wherein the cleavable portion comprises a cleavable molecular moiety.

The first binding assembly may be assembled by ligation of the first probe portion with the first bead-binding portion. The second binding assembly may be assembled by ligation of the cleavable portion with the first bead-binding portion, followed by the ligation of the second probe portion with the cleavable portion.

Alternatively, the first binding assembly and the second binding assembly may be assembled by hybridization, primer extension, oligonucleotide synthesis (or oligo synthesis).

The term “primer extension" as used herein refers to the extension (polymerization) of a nucleic acid sequence from a free 3’-hydroxy group, thereby creating a strand of nucleic acid complementary to an opposing strand.

The term “oligo synthesis" as used herein refers to chemical synthesis of relatively short fragments of nucleic acids, in which bases are added one by one, using, for example, a split and pool approach (the split and pool approach is as described below).

In some embodiments of the preparation method of the invention, the first binding assembly does not comprise a cleavable portion which is cleavable by the same mechanism as the cleavable portion of the second binding assembly.

In some embodiments the preparation method of the invention, the first binding assembly comprises a cleavable portion different from the cleavable portion of the second binding assembly, and the cleavable portion of the first binding assembly is cleavable by a different mechanism from the cleavable portion of the second binding assembly.

In other embodiments of the preparation method of the invention, the first binding assembly does not comprise any cleavable portion.

In some embodiments of the preparation method of the invention, the first binding assembly further comprises at least one barcode portion, preferably located between the first bead-binding portion and the first probe portion; and the second binding assembly further comprises at least one barcode portion, preferably located between the cleavable portion and the second probe portion.

The barcode portion(s) are preferably the same between the first binding assembly and the second binding assembly.

The method for adding the barcode portion(s) to each binding assembly (also referred to as “barcoding") may be performed in accordance with a conventional method such as split and pool method, for example as in the abovementioned article by Klein et al, in which the split and pool synthesis by hybridization and extension is described.

The term “split and pool method’ refers to a combinatorial synthesis process in which a sample mixture (e.g., beads) is divided into different aliquots (e.g., each well of a multi-well plate such as 96-well plate); and a unique sequence (e.g., unique barcode) contained in each aliquot is incorporated into each sample (e.g., each bead in the well); and the sample mixture from all the aliquots are pooled and then redistributed to new aliquots (e.g., new aliquots with different barcodes) in each aliquot.

In the preparation method of the present invention, the split and pool method by ligation may be performed. The split and pool method by consecutive ligation is, for example, described in Grosselin et al., Nat Genet. 2019;51 (6):1060- 1066.

The preparation method of the present invention may further comprise: attaching the barcode portion(s) of the first binding assembly to each other, to the first bead-binding portion, and/or to the first probe portion via respective connectors for the first binding assembly, and attaching the barcode portion(s) of the second binding assembly to each other and/or to the cleavable portion and/or to the second probe portion via respective connectors for the second binding assembly, as described above.

In the preparation method of the invention, barcoding may be performed based on the split and pool method in combination with the use of the above connectors. For example, in the case where the split and pool method is repeated three times, three barcode portions (BC1 , BC2 and BC3) are incorporated into each binding assembly, as shown in Fig. 5. Each barcode portion of the first binding assembly and of the second binding assembly may be attached at its proximal and distal ends via single-stranded connectors for the first binding assembly and for the second binding assembly, respectively.

The distal single-stranded connector of a barcode portion may be complementary to the proximal single-stranded connector of a neighboring barcode portion. In other words, the distal single-stranded connector of BC1 may be complementary to the proximal single-stranded connector of BC2; and the distal single-stranded connector of BC2 may be complementary to the proximal single-stranded connector of BC3.

Thus, barcode portions of the first binding assembly and of the second binding assembly are attached to each other by, for example, ligation via connectors specific to the first binding assembly and to the second binding assembly.

Advantage of the use of such connectors in combination with the split and pool method is that a large number of barcode combinations (for example, 884,736 different barcode combinations in the case of three rounds of split and pool in a 96-well plate) can be generated while the first and second binding assemblies of the same probe have the same barcode portions which can be still be distinguished between the first and second binding assemblies (as the intermediate connectors are different between the first and second binding assemblies).

The first binding portion and the first probe portion may be also attached by ligation via connectors for the first binding assembly; and the second binding portion, the cleavable portion, and the second probe portions may be also attached by ligation via connectors for the second binding assembly.

In the preparation method of the present invention, the first binding assembly and/or the second binding assembly may further comprise at least one additional portion selected from a primer-binding site capable of hybridizing a primer, a sequencing adapter, a spacer, a tag, a sample barcode, a unique molecular identifier (UMI), or any combination thereof.

The at least one additional portion of the first binding assembly and/or the second binding assembly may be also attached via connectors for the first binding assembly and/or the second binding assembly, respectively.

Use of the probe for binding and separating analytes

The probe of the invention may be used to separate a first analyte and a second analyte in a bead-containing droplet. The method (also referred to as “separation method’) comprises providing a droplet containing the first analyte, the second analyte, and the above-described probe, binding the first analyte to the first binding assembly, binding the second analyte to the second binding assembly, releasing the second binding assembly from the probe, and extracting the probe from the droplet, the first analyte remaining bound to the probe, and the droplet containing the second analyte. Preferably, the first analyte binds to the first binding assembly before the release of the second binding assembly from the probe. Preferably, the second analyte binds to the second binding assembly before the release of the second binding assembly from the probe; in this case, during the release step, the second analyte is released from the probe together with the second binding assembly. In other variations, the second analyte may bind to the second binding assembly after it has been released from the probe.

For convenience, the separation of two analytes is explained below, but the separation of two or more analytes is also possible. Specifically, two or more binding assemblies can be tethered to the bead, as described above, allowing for the separation of two or more analytes. Use may be made in particular of different cleavable portions in different binding assemblies, so that that release of binding assemblies for different analytes from the bead may be performed in different treatment steps. The beads may be encapsulated in droplets according to any known method in the art, as described, for example, in the abovementioned article by Zilionis R et al. and in Abate et al. Lab on a Chip. 2009;9(18):2628-2631 , using a commercially available machine, such as 10X Genomics Chromium and a microfluidic chip known from, for example, the abovementioned article by Klein et al.

Fig. 7a shows an example of encapsulating the probe of the invention in a droplet while introducing a biological sample containing the analytes.

Below, the term “bead” may be used as the bead to which the first binding assembly and second binding assembly are attached. In other words, the “bead’ may be used interchangeably with the “probe."

In the example shown in Fig. 7a, the beads 3 may be packed in a fluid so that the bead release can be easily synchronized with the droplet generation by tuning the flow rates. Biological samples (e.g., blood, serum, plasma, urine, nuclei, cells and the like) 14 containing at least two different analytes (e.g., mRNA, DNA, amino acids, polysaccharides, and the like) may be fed to the main channel 1 via a side channel. The fluid containing the beads 3 and the fluid containing the biological sample 14 may be the same or miscible with each other. A fluid which is immiscible with the fluid passing through the main channel 1 may be fed through the side channels 2 to form bead-containing droplet.

When a droplet contains a biological sample 14 in addition to the bead 3, the first analyte may bind to the first binding assembly and the second analyte may bind to the second binding assembly. The first analyte and the second analytes may be initially dispersed in the droplet for example due to a lysis buffer which may be comprised in or may constitute the fluid passing through the main channel 1.

As shown in Fig. 7b, after the biological sample and the bead (probe) are encapsulated in a droplet, the droplets may be collected in a reservoir. The second binding assembly may be released from the bead via the cleavage of the cleavable portion in a treatment step. This treatment step may comprise subjecting the droplets to specific conditions conducive to cleavage, such as exposure to a certain temperature, exposure to electromagnetic radiation (such as UV light), addition of an enzyme and/or of a reactant into the droplets.

The first analyte bound to the first binding assembly may remain tethered to the bead.

The beads may then be extracted from the droplets, which will be explained in detail later. Thus, the first analyte may be recovered with the beads, while the second analyte may be recovered with the droplets. Fig. 7b illustrates that the free second binding assembly (not bound with the second analyte) is released and dispersed in the droplet. In this case, the free second binding assembly may then bind to the second analyte. Alternatively, the second binding assembly may capture (bind to) the second analyte before the release in the droplet, and then the second analyte bound to the second binding assembly may be released and dispersed in the droplet.

Method of use of the probe in a multiomics analysis

The probe of the present invention can be also used for performing multiomics analysis (e.g., transcriptom ic, genomic, epigenetic, proteomic; metabolomic, and/or lipidomic analyses). Particularly, the probe of the present invention can be used for performing a single-cell multiomics analysis. As an example, the use of the probe for studying chromatin and mRNA will be explained below.

Fig. 5 schematically illustrates the probe used in this example. The probe 15 may be prepared according to the method as above.

The probe 15 contains a bead 16, a first binding assembly 17 and a second binding assembly 18. The bead may contain a magnetic material such as magnetic fluid, a magnetic nanoparticle or a magnetic core.

The first binding assembly 17 may contain, from proximal to distal, a first bead-binding portion BB1 , barcode portions BC1 to BC3, additional portions R2 (primer-binding site) and UMI (unique molecular identifier), and a first probe portion polyT. The first binding assembly 17 may be double stranded, except for the single-stranded UMI and polyT.

The second binding assembly 18 may contain, from proximal to distal, a second bead-binding portion BB2, a cleavable portion PC, an additional portion P5 (ilium ina flow cell adapter), barcode portions BC1 to BC3, and a second probe portion R1 N. The cleavable portion may be photocleavable. The second binding assembly 18 may be double stranded.

In this example, the first probe portion polyT (poly(T) tail) may capture poly (A)-tailed mRNA, and the second probe portion R1 N captures DNA tagged with R1 N.

Fig. 5 illustrates for convenience a photocleavable portion which is already cleaved, but the photocleavable portion is not cleaved prior to a suitable cleavage treatment.

Connectors are not shown in Fig. 5, but all the portions of the first binding assembly 17 and the second binding assembly 18 may be attached to each other via connectors for the first binding assembly and via connectors for the second binding assembly, respectively.

For chromatin profiling, nuclei may be isolated from cells by a conventional method, and subjected to tagmentation by CUT&Tag, as described in, for example, Kaya-Okur et al. Nat. Comm. 10, 1930 (2019).

The tagmentation is a process in which unfragmented DNA is cleaved and tagged for analysis. CUT&Tag is a cleavage and tagmentation method in which a complex of protein A and a Tn5 transposase which is conjugated to sequencing adapters, performs antibody-targeted cleavage of chromatin and simultaneous addition of the adapters.

In this example, when the isolated nuclei are subjected to CUT&Tag, DNA sequences corresponding to the binding sites of the target protein or histone modification of interest may be modified at 5’ and 3’ ends with sequencing adapters, such as R1 N and R2N. In this case, as shown in Fig. 5, the probe portion of the second binding assembly may comprise the sequencing adapter (for example, R1 N).

By reference to Fig. 7a, the beads 3 in a fluid, preferably an aqueous fluid, may be fed to the main channel 1 of a microfluidic chip through an upstream side channel. In this example, the beads 3 may be packed in the fluid so that the bead release can be easily synchronized with the droplet generation by tuning the flow rates.

The tagmented nuclei 14 in a nuclei buffer may be fed to the main channel 1 via another upstream side channel. The nuclei buffer may contain a primer for downstream analysis, such as Reverse i7 primer (5’-P7-i7-R2N-3’; P7 is an ilium ina flow cell adapter, i7 is a sample barcode, and R2N is a sequencing primer site). A lysis/PCR buffer may be passed through the main channel 1. The fluid containing the beads (probes) 3, the nuclei buffer, and the lysis/PCR buffer may be the same or miscible with each other. A fluid which is immiscible with the fluid(s) passing through/fed to the main channel 1 (preferably fluorocarbon-based or oil-based) may be passed through at least one downstream side channel 2 to form a bead-containing droplet (which may also contain a tagmented nucleus 14).

The fluorocarbon-based or oil-based fluid may comprise a surfactant such as a Fluosurf (Emulseo), or dSurf or Picosurf (RAN Biotech).

In the droplet, mRNA may bind to the first binding assembly at the first probe portion via the hybridization between the poly(A) tail of the mRNA and the poly(T) tail (polyT) of the first probe portion. The tagmented nuclei (DNA) of target may bind to the second binding assembly at the second probe portion via the hybridization between the R1 N of the tagmented DNA and the R1 N of the second probe portion. This hybridization between the R1 N of the tagmented DNA and the R1 N of the second probe portion may occur after the cleavage treatment, such as during the downstream amplification process (e.g., PCR).

As shown in Fig. 7b, the droplets may be then collected in a reservoir. The second binding assembly may be released from the bead via the cleavage of the cleavable portion by a treatment step. This treatment step may comprise subjecting the droplets to specific conditions conducive to cleavage, such as exposure to a certain temperature, exposure to electromagnetic radiation (such as UV light), addition of an enzyme and/or of a reactant into the droplets. The droplet illustrated in Fig. 7b shows that the free second binding assembly is released in the droplet (the second binding assembly and the tagmented DNA fragments are dispersed in the droplet) while the first binding assembly remains on the bead, capturing mRNA molecules via the first probe portion. However, the tagmented DNA fragments may be captured by the second binding assembly prior to the treatment step of cleavage, and then after the treatment step, the second analyte bound to the second binding assembly may be released in the droplet.

A lysis treatment may be also performed, for example, by heating the emulsion of the droplets. The lysis treatment may be performed at an appropriate timing (for example, before, during or after the cleavage treatment) under appropriate conditions (for example, at 45°C for 15 min).

Subsequently, the droplets may be reinjected to a microfluidic device which is suitable for extracting a bead from a droplet. Specifically, as shown in Fig. 7c, the droplets in a fluid are reinjected to the microfluidic device, and a fluid which is immiscible with the fluid containing the droplets is supplied to the microfluidic device in a downstream channel (in this example, via two side channels), and the beads and the droplets are separated through a constriction 5 of the microfluidic device (the microfluidic device for extracting a bead from a droplet will be explained in detail below).

As shown in Fig. 6, for example, the droplets 4 and extracted beads 3 may be collected (from an outlet of the downstream channel) in a collecting reservoir 9

The collecting reservoir 9 may be a test tube for example, which may have a volume ranging from 100 pL to 100 mL, in particular from 500 pL to 50 mL, such as from 1 to 5 mL. The collecting reservoir 9 may be equipped with a plug 11 and inlet conduit 12 and outlet conduit 13 inserted into the collecting reservoir 9 through the plug 11. The plug may be a polydimethylsiloxane (PDMS) plug. The collecting reservoir 9 may be also equipped or associated with a magnetic element 10, such as a magnet. The magnetic element 10 may optionally be fixed to the collecting reservoir 9.

Preferably, both the inlet conduit 12 and outlet conduit 13 may have an open end within the collecting reservoir 9. The inlet conduit 12 may extend deeper in the collecting reservoir 9 than the outlet conduit 13, so that the open end of the inlet conduit 12 is below the open end of the outlet conduit 13 as shown in the figure. The stream containing the droplets and extracted beads may be introduced into the collecting reservoir 9 via the inlet conduit 12.

The extracted beads 3 may be collected using a magnetic element 10 to the collecting reservoir 9 while the droplets 4 may gather at or near the surface of the immiscible fluid the as the droplets are generally less dense than the fluid.

Optionally, the emulsion of the droplets may be withdrawn from the collecting reservoir 9 via the outlet conduit 13 (for example using a syringe or a peristaltic pump or the like), while the beads remain in the collecting reservoir 9 owing to the magnetic element 10.

The emulsion of droplets may be further transported to another reservoir, such as another test tube. The beads 3 and droplets 4, thus collected separately, may be subjected to different downstream analyses.

Fig. 8a and Fig. 8b illustrate schematically one example of the downstream analyses (amplification) of the extracted droplets.

Fig. 8a illustrates the content of an extracted droplet. In the droplet, the released second binding assembly 18 (excluding the binding portion and the cleavable portion), DNA fragment 19 tagmented with R1 N and R2N at 5’ and 3’ ends, and a Reverse i7 primer (R2N-i7-P7) contained in the nuclei buffer may be dispersedly present. The droplets are then subjected to droplet PCR of the DNA fragments 19, using the released partial second binding assembly 18 and Reverse i7 as primers (in other words, the second probe portion binds to the DNA fragment after the release of the binding assembly from the bead).

The PCR conditions may be optimized to increase the yield of the target sequence of DNA fragments 19.

The resulting PCR products 20 (Fig. 8b) may be then purified by a conventional cleanup kit, such as Qiagen Minelute or Macherey-Nagel Nucleospin, and/or by size selection with SPRI (Solid-phase reversible immobilization) beads to remove primers.

Fig. 8c to Fig. 8e illustrate another example of the downstream analyses (amplification) of the extracted droplets. Fig. 8c illustrates the content of an extracted droplet. In the droplet, the released second binding assembly 18 (excluding the binding portion and the cleavable portion), and DNA fragment 19 tagmented with R1 N and R2N at 5’ and 3’ ends may be dispersedly present. The droplets are then subjected to linear PCR of the DNA fragments 19, using the released partial second binding assembly 18 as a primer, as shown in Fig. 8d (in other words, unlike the process shown in Fig. 8a and Fig. 8b in which a Reverse i7 primer (R2N-i7-P7) is added to the nuclei buffer, only the bead primer is used). Thus, it is possible that the nuclei buffer does not contain an additional primer, such as the Reverse i7 primer.

After this linear PCR in droplets, the PCR products may be purified, as explained above.

Then, the emulsion of droplets may be broken (the contents of the droplets are released), followed by a second PCR in bulk to add a P7 sequence. For example, as shown in Fig. 8e, a Reverse i7 primer (R2N-i7-P7) may be added, and then bulk PCR may be performed. For this bulk PCR, a commercially available kit may be used, for example, KAPA Hotstart ReadyMix kit from Roche.

Fig. 8c to Fig. 8e show the case of the second binding assembly comprising a P5 sequence, but the P5 may be replaced by a linker. In this case, after the linear PCR in droplets and the disruption of the droplet emulsion, a P5- linker may be also added, and then bulk PCR may be performed, using the P5- linker and Reverse i7 primer (R2N-i7-P7) as primers.

Either of the two cases (droplet PCR as shown in Fig. 8a and Fig. 8b, and the combination of the linear PCR in droplets and the bulk PCR, as shown in Fig. 8c to Fig. 8e) mentioned above may be performed. Preferably, the combination of the linear PCR and the bulk PCR may be performed. Indeed, this is a common amplification procedure in many sequencing workflows, such as in a workflow using 10X Atac seq kit.

The PCR product sample 20 (amplified either as shown in Fig. 8a and Fig. 8b, or in Fig. 8c to Fig. 8e) may be also verified for the quality control. The sample may be then sequenced by next generation sequencing or high-throughput sequencing.

The term “sequencing" or “(to) sequence" as used herein refers to a method by which the identity of at least 10 consecutive nucleotides (e.g., the identity of at least 20, at least 50, at least 100 or at least 200 or more consecutive nucleotides) of a polynucleotide sequence is obtained.

The terms “next-generation sequencing" or “high-throughput sequencing" , as used herein, refer to the so-called parallelized sequencing-by-synthesis or sequencing-by-ligation platforms currently employed by Illumina, Life Technologies, and Roche, etc. Next-generation sequencing methods may also include nanopore sequencing methods such as that commercialized by Oxford Nanopore Technologies, electronic-detection based methods such as Ion Torrent technology commercialized by Life Technologies, or single-molecule fluorescence-based methods such as that commercialized by Pacific Biosciences.

The extracted beads may be used for RNA analysis, based on conventional approaches such as drop-seq, smart-seq2 and smart-seq3. Specifically, the beads may be subjected to reverse transcription and template switching.

The term “reverse transcription (RT)” as used herein means a method wherein a complementary DNA (cDNA) copy of an RNA molecule is synthesized. The cDNA product can be used as a template for PCR.

The term “template switching" as used herein refers to an activity of a polymerase that is capable of switching template strands in a homology dependent manner during DNA synthesis. An example of a polymerase with template switching activity is M-MLV reverse transcriptase.

As shown in Fig. 9a, during the reverse transcription, cDNA 22 may be synthesized by a reverse transcriptase (e.g., M-MLV type reverse transcriptase) using the captured mRNA 21 as a template. A few additional nucleotides may be added by the reverse transcriptase at the 3’ end of the newly synthesized cDNA strand (for example, CCC as illustrated in Fig. 9a), which can then anneal to the matching 3’-end riboguanosines (GGG as illustrated in Fig. 9a) of a template switching oligo (TSO), which is complementary to R1. Thus, the reverse transcriptase may switch the template strands from 21 to TSO to continue the polymerization. The TSO may be contained in a reverse transcription buffer. The beads may be treated with exonuclease I (Fig. 9b).

Subsequently, the cDNA bound on the bead may be amplified, using R1 primer and R2 primer, which results in dispersed double-stranded cDNA in a solution, no longer bound on the bead (Fig. 9c). The cDNA may be then fragmented and tagmented with sequencing adapters such as R1 N primers on 3’ end and R2N primers on 5’ end (Fig. 9d). For the tagmentation of cDNA, a conventional kit such as NEBNext Ultra II may be used. As shown in Fig. 9d, at the end of the fragmentation and tagmentation, fragments of various lengths may be obtained: fragments containing R2, barcode portions (BC), UMI, cDNA and R1 N, fragments containing R2N, cDNA and R1N, and fragments containing R2N, cDNA and R1.

Only the fragments containing R2, barcode portions (BC), UMI, cDNA and R1 N may be further amplified by PCR using primers containing sequencing adapters (e.g., primers P7-i7-R2 and R1 N-P5), as shown in Fig. 9e. Fig. 9a to Fig. 9e show an example of the amplification using two different primers R1 and R2. However, the amplification process is not limited to this example. For example, this amplification process may be performed with a single primer, called ISPCR primer, as shown in Fig. 10a to Fig. 10d.

In Fig. 10a, the first binding assembly 17’ may be the same as the first binding assembly 17 of Fig. 5, except that the additional portion R2 (primerbinding site) is an ISPCR primer (ISPCR) (for simplicity, first bead-binding portion BB1 is not illustrated, and three barcode portions BC1 to BC3 are illustrated as BC)

During the reverse transcription, cDNA 22 may be synthesized by a reverse transcriptase (e.g., M-MLV type reverse transcriptase) using the captured mRNA 21 as a template. A few additional nucleotides may be added by the reverse transcriptase at the 3’ end of the newly synthesized cDNA strand (for example, CCC as illustrated in Fig. 10a), which can then anneal to the matching 3’-end riboguanosines (GGG as illustrated in Fig. 10a) of a template switching oligo (TSO), which is complementary to ISPCR. Thus, the reverse transcriptase may switch the template strands from 21 to TSO to continue the polymerization. The TSO may be contained in a reverse transcription buffer.

Subsequently, the cDNA bound on the bead may be amplified, using the ISPCR primer, which results in dispersed double-stranded cDNA in a solution, no longer bound on the bead (Fig. 10b). The amplified cDNA may be then treated for the library preparation, as described above. Specifically, the amplified cDNA may be fragmented and tagmented with sequencing adapters such as a R1 N and R2N primers on 3’ end and on 5’ end (Fig. 10c). At the end of the fragmentation and tagmentation, fragments of various lengths may be obtained. Only the fragments containing ISPCR, barcode portions (BC), UMI, cDNA and R1 N may be further amplified by PCR using primers containing sequencing adapters (e.g., primers P7-i7-ISPCR and R1 N-P5) (Fig. 10d).

For the tagmentation of cDNA and library preparation, a conventional kit such as NEBNext Ultra II, Nextera XT, a custom solution based on Tn5 tagmentation or fragmentation, or any other library preparation kit such as Roche Hyperprep or Illumina DNA Prep may be used.

In either of the two cases (using two different primers R1 and R2 as shown in Fig. 9, or using a single primer ISPCR as shown in Fig. 10), The resulting PCR products may be added with sequencing adapters P7 and P5 at their both ends. The final PCR products may be purified by size selection, using SPRI beads, for example, to remove primers, and subjected to be quality control such as Qubit, Tapestation, Bioanalyzer and a conventional gel electrophoresis. The sample may be then sequenced by next generation sequencing or high-throughput sequencing, for example.

Extracting beads from droplets using a microfluidic device Extraction of beads from droplets

The extraction of a bead from a droplet may be performed in a microfluidic device which comprises in particular a main channel having a constriction.

The device and in particular the main channel of the device may be prepared for instance by microlithography, soft lithography, hot embossing, microcontact printing, direct laser writing, additive or subtractive 3D printing, micromachining, removing sacrificial wires or materials, injection molding or extrusion.

In other possible embodiments, the main channel and any additional (e.g. side) channel may be tubes which are assembled together.

Typical but non-exhaustive examples of materials which may be used to make the device and in particular the channels of the device include elastomers, thermoplastics, resins, glass, fused silica, silicone or combinations thereof. Elastomers can be, for instance and in a non-limiting manner, silicones such as polydimethylsiloxane, polyurethanes, acrylic elastomers, fluoroelastomers, polyenes, materials marketed under the brand Tygon® and combinations thereof. Thermoplastic polymers can be, for instance and in a non-limiting manner, polyolefins, such as polyethylene, polypropylene, and more generally polyenes and their copolymers, low or high density, crosslinked or not, cyclic olefin polymers, cyclic olefin copolymers, acrylates such as polymethylmethacrylates, polycarbonates, polyesters, fluorinated polymers, polyamides and combinations thereof. Resins may notably be epoxy, polyester and/or polyurethane resins.

The method of the extraction using such a device comprises providing a bead-containing droplet of a first fluid within a second fluid, passing the droplet through a constriction in a main channel, and supplying a third fluid immiscible with the first fluid in a downstream channel, downstream of the constriction so as to extract the bead from the droplet.

In some embodiments, the first fluid is aqueous and the second fluid is fluorocarbon-based or oil-based, as described above.

In some embodiments, the third fluid supplied in the downstream channel is the same as the second fluid.

Alternatively, the third fluid supplied through in the downstream channel may be different from the second fluid and miscible with the second fluid. For the sake of simplicity, it will be considered below that the second fluid is supplied in the downstream channel, but the description applies similarly if a third fluid different from the second fluid is supplied in the downstream channel.

In some embodiments, the second fluid is supplied to the downstream via at least one side channel. More particularly, the second fluid may be supplied to the downstream channel via two side channels downstream of the constriction, which are arranged in a symmetrical way with respect to a longitudinal direction of the main channel.

The term “longitudinal direction" herein refers to the direction of passing the droplet (/.e., direction of the droplet flow) in the constriction of the main channel. The term “transverse dimension" refers to a direction perpendicular to the longitudinal direction. When the main channel extends along a length of the microfluidic device, the width direction and the thickness direction are transverse directions. Generally, the maximum dimension of the microfluidic device is less in the thickness direction than in the width direction. If the microfluidic device comprises a substantially planar substrate such as a plate or wafer (together with a cover), the thickness direction is perpendicular to the plane of the substrate.

The method of extracting a bead from a droplet and the microfluidic device suitable for implementing the method are explained below by reference to Fig. 3a to Fig. 3c, in which XYZ axes are shown; the X axis corresponds to the width direction, the Y axis to the longitudinal direction, and the Z axis perpendicular to the plane of Fig. 3a-3c to the thickness direction.

As shown in Fig. 3a, the microfluidic device comprises a main channel 1 which comprises a constriction 5; and a downstream channel 2’ downstream of the constriction.

By “constriction" is meant an area of the main channel which has a transverse dimension smaller than the transverse dimension of the main channel in an area immediately upstream of the constriction (in other terms, a reduced transverse dimension). In other words, the constriction may have a thickness dimension (Z axis of Fig. 3) or width dimension (X axis of Fig. 3) smaller than the thickness or width dimension of the main channel in an area immediately upstream of the constriction. Preferably, the constriction has a width dimension smaller than the width dimension of the main channel in an area immediately upstream of the constriction.

Preferably, the outlet of the main channel is positioned in the constriction, at the junction with the downstream channel.

The downstream channel may be aligned, i.e. in the same orientation as the main channel, as shown in Fig. 3a (i.e., the direction of flow in the downstream channel may be the same as the direction of flow in the main channel). Alternatively, the downstream channel can have a different orientation from the main channel, such as a perpendicular orientation.

The downstream channel 2’ may further comprise at least one side channel, preferably two side channels. In Fig. 3a, for example, the downstream channel 2’ further comprises two side channels 2 which are connected to the main channel at an acute angle (with respect to the portion of the main channel upstream of the junction). In this example, the second fluid may be supplied via the two side channels, and the flow direction of the second fluid may be aligned with the flow direction of the main channel 1 (from top to down in Fig. 3a). Alternatively, the two side channels 2 may be arranged in a flow-focusing geometry (arranged perpendicularly to the main channel) or a co-flow geometry.

In the context of the present invention, the droplet 4 may be the droplet encapsulating the probe of the invention and a biological sample.

Below, the term “bead” may be used as the bead to which the first binding assembly and second binding assembly are attached. In other words, the “bead’ may be used interchangeably with the “probe" of the invention.

The droplet 4 flows along the main channel 1 and passes through the constriction 5, and second fluid is supplied through the downstream channel downstream of the constriction (two side channels 2 in Fig. 3a as an example).

As the droplet 4 passes through the constriction, the droplet 4 may deform easily while the bead 3 may show more resistance. As a result, the droplet 4 may flow through the constriction faster than the bead 3 (Fig. 3b). The droplet 4 may be then broken by the shearing force exerted by the second fluid supplied in the downstream channel (supplied via the at least one side channel if present) downstream of the constriction, releasing the bead 3 from the droplet 4 (Fig. 3c). Thus, the bead can be extracted from the droplet while keeping the emulsion integrity.

After the extraction, the bead may be surrounded by a small amount of the first fluid, and therefore may be provided in a reduced droplet of first fluid within the flow of second fluid. The volume of first fluid in this reduced droplet may be less than 10%, preferably less than 5%, or less than 2%, or less than 1 %, or less than 0.5%, or less than 0.1 %, relative to the volume of first fluid in the (initial) droplet before extraction.

In some embodiments, the constriction has a transverse dimension which is equal to or less than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state). Preferably, the constriction has a transverse dimension which is at least 10% smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state). The transverse dimension of the constriction (as measured at the longitudinal position wherein the transverse dimension is minimal) may be for example from 10 to 90%, or from 20 to 80%, or from 30 to 75%, or from 40 to 70%, or from 50 to 65% smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state).

As shown in Fig. 3a-3c, the constriction may have a tapered shape, wherein the transverse dimension gradually decreases from upstream to downstream (towards the junction with the downstream channel). The transverse dimension may be minimal at the junction with the downstream channel. Alternatively, other shapes are possible. For example, the constriction may have a stepped portion, wherein the transverse dimension is reduced in one or more discrete increments from upstream to downstream.

Only one transverse dimension may be reduced in the constriction. Preferably, as shown in Fig. 3a-3c, the width of the channel is reduced along the constriction, while the thickness of the channel may remain constant. The opposite is also possible, i.e. the thickness of the channel is reduced along the constriction, while the width of the channel may remain constant. Alternatively, two transverse dimensions may be reduced, e.g. both the thickness and the width of the channel are reduced along the constriction.

Immediately downstream of the constriction, the transverse dimension of the downstream channel (in which the supplied second fluid, the extracted bead and the remaining droplet continue to flow) is larger than the transverse dimension of the constriction. Preferably, the transverse dimension of the downstream channel immediately downstream of the constriction is equal to or, as illustrated in Fig. 3a-3c, larger than the transverse dimension of the main channel upstream of the constriction.

As shown in Fig. 3a-3c, when the downstream channel comprises a side each side channel, each side channel 2 may be connected to the downstream channel at an acute angle (with respect to the portion of the main channel upstream of the junction), which may be between 10 and 85°, preferably between 20 and 75°, more preferably between 30 and 60°, such as between 40 and 50°. Alternatively, each side channel 2 may be connected perpendicularly to the downstream channel. Alternatively, each side channel 2 may be connected to the downstream channel at an obtuse angle (with respect to the portion of the main channel upstream of the junction), which may be between 100 and 175°, preferably between 110 and 165°, more preferably between 120 and 150°, such as between 130 and 140°. The above-described extraction may be parallelized, using a microfluidic device comprising two or more main channels in parallel.

Each main channel may be independently connected to a different downstream channel. In this case, each downstream channel may be provided with respective side channels, as described above. Alternatively, several main channels, for example all main channels, may be connected to the same downstream channel.

The microfluidic device having two or more main channels makes it possible to parallelize the above-described extraction process, increasing the extraction throughput. Moreover, even if some of the main channels are blocked or clogged, e.g., at the constrictions, other channels are not affected and keep extracting the bead from the droplet.

For the sake of simplicity, the extraction method will be described below mostly by referring to one main channel, but the description applies similarly if the microfluidic device comprises several main channels.

Positioning of beads

The extraction method may further comprise a step of positioning the bead at the rear of the droplet before the droplet reaches the constriction. The rear end of the droplet is the upstream end of the droplet relative to the direction of flow. By “positioning the bead at the rear of the droplet’ is meant that the bead is displaced within the droplet from any position in the droplet to a position which is at the rear end of the droplet along the longitudinal direction (/.e., upstream end along the direction of the droplet flow), and which is preferably substantially centered along the transverse directions.

The positioning step facilitates and improves the quality of the later extraction of the bead from the droplet.

This positioning step is preferably carried out by passing the droplet through a narrowed portion of the main channel upstream of the constriction, which has a transverse dimension equal to or smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state).

The narrowed portion may have a transverse dimension which is for example from 0 to 30%, or from 1 to 20%, or from 2 to 15%, or from 5 to 10% smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state). The narrowed portion may have a transverse dimension which is from 0 to 20 pm smaller, or from 1 to 15 pm, or from 2 to 10 m or from 3 to 8 pm smaller than the diameter of the bead in a nonconstricted state (or the Dv50 of the beads in a non-constricted state).

Owing to the narrowed portion, the beads may be slightly compressed in the transverse direction upstream of the constriction, so that a friction force directs the bead to the rear of the droplet and maintains it in this position before the bead is extracted from the droplet.

The narrowed portion may extend from an inlet of the main channel (by which the droplets are supplied) down to (and possibly including) the constriction.

Alternatively, the main channel may comprise a non-narrowed portion in addition to the narrowed portion, wherein the non-narrowed portion may extend from an inlet of the main channel (by which the droplets are supplied) to a transition area, and the narrowed portion may extend from the transition area down to (and possibly including) the constriction.

The non-narrowed portion has at least one transverse dimension which is larger than the narrowed portion. In some embodiments, all transverse dimensions of the non-narrowed portion are larger than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state).

The transverse dimension of the narrowed portion equal to or smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state) may be in particular the width direction or the thickness direction. In some embodiments, both the width dimension and the thickness dimension are equal to or smaller than the diameter of the bead (or the Dv50 of the beads in a non-constricted state) in a non-constricted state as described above.

When a non-narrowed portion and a narrowed portion are present, the transition between both portions may be a step or a series of steps (along the width and/or thickness). Alternatively, the main channel may be tapered, the width and/or thickness decreasing gradually in the transition area.

The narrowed portion may extend down to and encompass the constriction.

The transverse dimension in the narrowed portion which is equal to or smaller than the diameter or Dv50 as defined above may be in the same direction as the reduced transverse dimension in the constriction (in which case the transverse dimension in the constriction is even smaller than the transverse dimension in the narrowed portion upstream of the constriction), or it may be in a different direction.

For example, the transverse dimension in the narrowed portion which is equal to or smaller than the diameter or Dv50 as defined above may be the width, while the reduced transverse dimension in the constriction may be the thickness. Alternatively, the transverse dimension in the narrowed portion which is equal to or smaller than the diameter or Dv50 as defined above may be the thickness, while the reduced transverse dimension in the constriction may be the width.

Alternatively, the transverse dimension in the narrowed portion which is equal to or smaller than the diameter or Dv50 as defined above may be the thickness, while the reduced transverse dimension in the constriction may be the thickness.

Alternatively, the transverse dimension in the narrowed portion which is equal to or smaller than the diameter or Dv50 as defined above may be the width, while the reduced transverse dimension in the constriction may be the width.

Alternatively, the transverse dimensions in the narrowed portion which are equal to or smaller than the diameter or Dv50 as defined above may be the width and thickness, while the reduced transverse dimension in the constriction may be the width only, or the thickness only, or both the width and the thickness.

Alternatively, the transverse dimension(s) in the narrowed portion which is(are) equal to or smaller than the diameter or Dv50 as defined above may be the width only, or the thickness only, or both the width and the thickness, while the reduced transverse dimensions in the constriction may be both the width and the thickness.

Fig. 4 shows an example of the main channel comprising a narrowed portion 6 and a non-narrowed portion 7 upstream of the narrowed portion 6, and a transition area 8 between the narrowed and non-narrowed portions. In Fig. 4, the narrowed portion 6 has a dimension in the thickness direction which is smaller than the diameter of the bead in a non-constricted state (or the Dv50 of the beads in a non-constricted state), and thus the transition area 8 forms a stepped portion in the thickness direction. This way, the bead upstream of the transition area 8 (bead in the non-narrowed portion 7) is not compressed while the bead downstream of the transition area 8 (in the narrowed portion 6) may be slightly compressed in the thickness direction. Thus, the bead may be positioned at the rear of the droplet and then kept at the rear of the droplet due to the friction force until the droplet reaches the constriction (constriction not shown in Fig. 4).

In some embodiments, the main channel may have a width immediately upstream of the constriction from 10 to 500 pm, preferably from 20 to 200 pm, more preferably from 50 to 150 pm, even more preferably from 70 to 120 pm.

In some embodiments, the main channel may have a thickness immediately upstream of the constriction from 5 to 300 pm, preferably from 10 to 150 pm, more preferably from 20 to 100 pm, even more preferably from 30 to 80 pm.

In some embodiments, the thickness of the main channel immediately upstream of the constriction is less than the width of the main channel immediately upstream of the constriction.

In some embodiments, the constriction has a minimum thickness from 5 to 300 pm, preferably from 10 to 150 pm, more preferably from 20 to 100 pm, even more preferably from 30 to 80 pm.

Alternatively, the constriction may have a minimum thickness from 1 to 100 pm, preferably from 5 to 80 pm, more preferably from 10 to 50 pm, even more preferably from 15 to 40 pm. In some embodiments, the constriction has a minimum width from 1 to 100 pm, preferably from 5 to 80 pm, more preferably from 10 to 50 pm, even more preferably from 15 to 40 pm.

Alternatively, the constriction may have a minimum width from 5 to 300 pm, preferably from 10 to 150 pm, more preferably from 20 to 100 pm, even more preferably from 30 to 80 pm. In some embodiments, the (minimum) width of the constriction is less than the (minimum) thickness of the constriction.

Alternatively, the (minimum) thickness of the constriction is less than the (minimum) width of the constriction.

Alternatively, the positioning of the bead at the rear of the droplet may be achieved differently, such as by applying a magnetic field having a suitable magnitude and orientation to the main channel upstream of the constriction.

Plurality of droplets

Although the method of the invention is mostly described herein by making reference to one bead-containing droplet, it advantageously comprises providing a plurality of droplets (as described above) and successively passing the droplets through the constriction so as to the extract the beads from their respective droplets.

The method may thus be continuous and involve the processing of a stream of droplets. The entirety of the present description must be interpreted in this context.

The flow rate of the droplets and the flow rate of the second fluid supplied in the downstream channel downstream of the constriction (e.g. via one or more side channels) may vary depending on the application, and in particular on the dimensions of the channel. They may be selected so that most of the beads (e.g., all the beads) are extracted from the droplets, and so that a low volume of first fluid remains around the extracted beads. The term “flow rate of the droplet(s)” herein means the flow rate of the second fluid (e.g., oil) carrying the droplets.

Specifically, the ratio of the flow rate of the second fluid (supplied in the downstream channel) to the flow rate of the droplets flowing through the main channel (upstream of the constriction) may range from 1 to 30, preferably from 1 to 20, more preferably 2 to 10, still more preferably from 3 to 6, particularly preferably from 3.5 to 5.

The flow rate of the droplets flowing through the main channel (upstream of the constriction) may range from 50 to 1000 pL/h and the flow rate of the second fluid supplied in the downstream channel may be from 50 to 2000 pL/h, preferably the flow rate of the droplets flowing through the main channel (upstream of the constriction) is from 50 to 450 pL/h and the flow rate of the second fluid supplied in the downstream channel is from 200 to 2000 pL/h, more preferably the flow rate of the droplets flowing through the constriction in the main channel is from 100 to 450 pL/h and the flow rate of the second fluid supplied in the downstream channel is from 500 to 1600 pL/h.

The flow rate of fluid entering the downstream channel from the main channel through the constriction is not taken into account in the flow rate of the second fluid supplied in the downstream channel, in the above.

The invention may be implemented in the context of research, diagnosis, analysis, synthesis or quality control devices and methods, in medicine, biology, life sciences, the food industry, the cosmetics industry, pharmacy, legal analysis, safety, biosafety, the energy industry or chemistry.

EXAMPLES

The following examples illustrate the invention without limiting it.

Example 1 - Synthesis of polyacrylamide beads attached with bead-binding portions

A mixture of the 1^st and 2^nd strands (SEQ ID NO:1 , SEQ ID NO:2 and SEQ ID NO:3) of a bead-binding portion (each at 2 mM) shown in Table 1 is heated at the annealing temperature of 95°C for 5 min, and allowed to cool down to room temperature to obtain a 2 mM double-stranded bead-binding portion (doublestranded acrydite DNA) having a 1^st strand carrying a 5'-Acrydite modification and a 2^nd strand carrying a 4-nt connector (either the connector for the first binding assembly (capturing mRNA) or the connector for the second binding assembly (capturing nuclei subjected to CUT&Tag (C&T)) at the 5' end. Table 1 : List of sequences used for synthesis of bead-binding portions

BA1 = first binding assembly, BA2 = second binding assembly, bold letters = connectors, /5ACryd/ = 5' Acrydite modification, /5Phos/ = 5 - terminal phosphorylation. Unless otherwise specified, the sequences are 5’ to 3’. 1^st strand and 2^nd strand form together a double strand.

As shown in Fig. 1a, a mixture of the obtained bead-binding portion (2mM) and a gel precursor (25% v/v H2O, 22.73 % v/v 100 pM Sulforhodamine B, 1.13% v/v Ferrofluid (Ferrotec® EMG700SP), 11.3% v/v TBEST buffer (Tris-Buffered Saline-EDTA-Triton Solution) (10 mM Tris-HCI [pH 8.0], 137 mM NaCI, 2.7 mM KCI, 10 mM EDTA (Ethylenediaminetetraacetic acid) and 0.1 % (v/v) Triton X-100), 28.4% 4X AB (Acrylamide/bis-acrylamide) solution (14.4% w/w Acrylamide/Bis solution, 10.32% w/w Acrylamide solution, 38.2% v/v H2O)) is injected through a main channel 1 at 320 pL/h; 2.5% w/v APS (ammonium persulfate) as a crossliking initiator is injected through a side channel at 44 pL/h, and oil (HFE-7500™ with 1 % Fluosurf (manufactured by Emulseo) and 0.4% v/v TEMED (tetramethylethylenediamine)) as a continuous phase is injected through two side channels 2 at 320 pL/h.

The median diameter Dv50 of the obtained droplets is approximately 42 pm with a volume of 39 pL, and the droplet generation throughput is approximately 2000 droplets/s.

The resulting droplets are kept at 60°C overnight for cross-linking to form beads. The emulsion of beads in the oil is broken with 20% perfluoro-octan-1- ol/80% HFE-7500™ (v/v) and the remaining oil is dissolved in 1 % Span80 in hexane. The beads are suspended in TBEST to let them swell, thereby having a final median diameter Dv50 of 50 pm (after 20% swelling).

The beads are passed through a 70-pm cell strainer to remove any dust and large beads, and then stored in a hydrogel bead wash (HBW) buffer (10mM Tris HCI pH8, 0.1 mM EDTA, 0.1 % v/v Tween-20) at 4°C.

Example 2 - Assembling of the first binding assembly and second binding assembly Ligation of a cleavable and non-cleavable portions

A mixture of 1^st strand for the first binding (SEQ ID N0:4 and SEQ ID N0:5, interrupted by a spacer, 250 pM, see Table 2) and 2^nd strands for the first binding assembly (SEQ ID NO:6, 250 pM, see Table 2) and a mixture of 1^st strand for the second binding assembly (SEQ ID NO:7 and SEQ ID NO:8, interrupted by a spacer, 250 pM, see Table 2) and 2^nd strands for the second binding assembly (SEQ ID NO:9, 250 pM, see Table 2) are separately subjected to annealing at 95°C for 5 min under agitation of 650 rpm to obtain double-stranded S1 RNA primer and double-stranded S1 C&T primer. A pellet of the beads from Example 1 (300 pL, approximately 12 million beads) are washed 3 times in HBW buffer (10mM Tris HCI pH8, 0.2 mM EDTA, 0.1 % v/v Tween-20) and resuspended in a ligation mix on ice (double-stranded S1 C&T primer (4 pM), double-stranded S1 RNA primer (4 pM), 1X T7 ligase buffer and 1X T7 DNA ligase). Ligation is performed for 30 min at room temperature (first 15 min under agitation). The resulting beads are washed 3 times in HBW.

Table 2: List of sequences used for ligation of non-cleavable and cleavable portions

BA1 = first binding assembly, BA2 = second binding assembly, bold letters = connectors, /5Phos/ = 5'-terminal phosphorylation, /iSp9/ = non-photocleavable spacer, /iSpPC/ = photocleavable spacer, /3SpC3/ = C3 spacer, underlined letters = R2 (primer-binding site), italic letters = P5 (Illumina flow cell adapter). Unless otherwise specified, the sequences are 5’ to 3’. 1^st strand and 2^nd strand for BA1 form together a double-stranded S1 RNA primer, and 1^st strand and 2^nd strand for BA2 form together a double-stranded S1 C&T primer. Ligation of barcode portions

Hydrogel beads carrying the first binding assembly and the second binding assembly are produced by split and pool method.

Respective double-strand barcode portions for the first binding assembly (BC1 RNA to BC3 RNA) and the second binding assembly (BC1 C&T to BC3 C&T) are separately prepared by mixing an equal volume of 1^st and 2^nd strands (250 pM each, see Table 3 for sequences) at the annealing temperature of 95°C for 5 min under agitation of 650 rpm, and then at room temperature for 25 min.

Table 3: List of sequences used for ligation of barcode portions 1 to 3

BC = cell barcode, bold letters = connectors, /5Phos/ = 5'-terminal phosphorylation, NNNNN... = cell barcode, unique for each well (N can be A, G, C or T). Unless otherwise specified, the sequences are 5’ to 3’. Respective 1^st strand and 2^nd strand form together a double-stranded cell barcode.

In a 96-well plate, the double-stranded barcode portion BC1 RNA primer (6.25 pM), the double-stranded barcode portion BC1 C&T primer (6.25 pM), 1X T7 ligase buffer and 1X T7 DNA ligase are added to each well. The beads are split in the 96-well plate. Ligation is performed for 30 min at room temperature (15 min under agitation and 15 min under no agitation), and ligase is inactivated at 65°C for 10 min. The obtained beads are allowed to cool down for 30 min to room temperature, and are pooled in a tube and washed 3 times per well in cold HBW. This process is repeated with BC2 and BC3 primers.

Ligation of probe portions A mixture of 1^st and 2^nd strands of a probe portion for the first binding assembly (S2 RNA, 250 pM each, SEQ ID NO: 10 and SEQ ID NO: 11 , see Table 4) and a mixture of 1^st and 2^nd strands of a probe portion for the second binding assembly (S2 C&T, 250 pM each, SEQ ID NO:12 and SEQ ID NO:13, see Table 4) are separately subjected to annealing at 95°C for 5 min under agitation of 650 rpm (see Table 3 for sequences) to obtain double-stranded S2 RNA primer and double-stranded S2 C&T primer.

Table 4: List of sequences used for ligation of probe portions

Bold letters = connectors, /5Phos/ = 5'-terminal phosphorylation, NNNN... = UMI, TTTT... = poly(T) tail with a VN anchor (V = any base but not T; N as described above), underlined letters = R1 N (sequencing adapter (also used as a probe portion). Unless otherwise specified, the sequences are 5’ to 3’. Respective 1^st strand and 2^nd strand form together a double-stranded sequence.

A pellet of the obtained beads (300 pL) is resuspended in a ligation mix on ice (double-stranded S2 C&T primer (4 pM), double-stranded S2 RNA primer (4 pM), 1X T7 ligase buffer and 1X T7 DNA ligase). Ligation is performed under the same conditions as above. The resulting beads are washed 3 times in HBW.

Example 3 - Preparation of nuclei

Isolation of nuclei

Nuclei are isolated from cells by incubation for 10 min on ice in NE1 buffer (20 mM HEPES (4-(2-hydroxyethyl)-1 -piperazineethanesulfonic acid), 10mM KCI, 0.5mM Spermidine, 20% v/v Glycerol, 1 % w/v BSA (bovine serum albumin), 0.1 % w/v lgepal-CA630, 0.01 % w/v Digitonin, 1X Roche CompleteProtease inhibitor cocktail, 0.5 U/pL SUPERaseln™, 0.5 U/pL RNAseOUT™). After centrifugation, nuclei are washed twice and resuspended in a wash buffer 1 (20 mM HEPES, 2 mM EDTA, 150mM NaCI, 0.5mM Spermidine, 0.01 % Igepal CA-630, 0.01 % Digitonin, 1 % w/v BSA, 1X Roche Complete protease inhibitor cocktail, 0.5U/pL SUPERaseln™, 0.5U/pL RNAseOUT™).

CUT&Tag tagmentation

The nucleus sample is divided into 100,000 cells per tube. The nucleus samples are then centrifuged and resuspended in the wash buffer 1 , added with antibody specific to protein of interest, and incubated with rotation at 4°C overnight.

The nuclei are then washed with a wash buffer 2 (20mM HEPES, 2 mM EDTA, 150mM NaCI, 0.5mM Spermidine, 0.01 % Igepal CA-630, 0.01 % Digitonin, 1 % w/v BSA, 1X Roche Complete protease inhibitor cocktail, 0.2 LI/pL SUPERaseln™, 0.2 U/pL RNAseOUT™) and resuspended in Dig-300 (20 mM HEPES, 2 mM EDTA, 300 mM NaCI, 0.5 mM Spermidine, 0.01 % Igepal CA-630, 0.01 % Digitonin, 0.1 % w/v BSA, 1X Roche Complete protease inhibitor cocktail, 0.5 U/pL SUPERaseln™, 0.5U/pL RNAseOUT™). To this suspension, 0.4 pL of pA-Tn5 complex (manufactured by Diagenode) is added, and the suspension is incubated for 1 h at room temperature.

The resulting nuclei are washed twice and resuspended in a Tag buffer (20mM HEPES, 150mM NaCI, 0.5mM Spermidine, 0.01 % Igepal CA-630, 0.01 % Digitonin, 1X Roche Complete protease inhibitor cocktail, 0.5U/pL SUPERaseln™, 0.5 U/pL RNAseOUT™). To this suspension, 10 mM MgCl2 is added to trigger tagmentation, and incubated at 37°C for 1 h under agitation of 550 rpm. The nuclei are washed with the Dig-300 buffer and resuspended in 1 ml PBS (Phosphate-buffered saline) + 1 % BSA. The tagmented double-stranded DNA in nuclei are flanked with R1 N and R2N.

Example 4 - Co-encapsulation of the beads (probes) and nuclei in droplets

The beads obtained in Example 2 are washed 4 times in 100 mM Tris HCI pH8 + 0.6% Triton X-100, and resuspended in 10 mM Tris HCI pH8 + 0.1 % Triton X-100. The beads are packed by centrifugation (4000 g for 1 min, supernatant removed).

As shown in Fig. 7a, in a microfluidic chip (similar to the one used in Klein et al. Cell. 2015) equipped with syringe pumps, a PCR/lysis mix (11 .25 mM DTT (Dithiothreitol), 2.25X KAPA Hifi™ Buffer GC, 2.25 U/pL KAPA Hifi™ (non Hot Start), 4.5 mM MgCl2, 0.22% Triton X100, 1.1 % Tween-20) is injected at 200 pL/h through a mail channel 1 , and co-flowed with a diluted suspension of nuclei 14 in a nuclei buffer (n = 133/pL; nuclei buffer: 51 % v/v PBS, 15% v/v Optiprep, 0.5% v/v BSA, 0.5 pM Reverse i7 (P7-i7-R2N: CAAGCAGAAGACGGCATACGAGAT NNNNNNGTCTCGTGGGCTCGG (SEQ ID NO:14); NNNNNN is the i7 sample identifier which varies for each experiment), 2.25 mM dNTPs (each), 1.125 LI/pL SUPERase In™, 1.125 U/pL RNAse OUT™) at 200 pL/h and the packed beads 3 at 50 pL/h through side channels. Oil (HFE-7500™ + 1.5% Emulseo (or 0.75% Picosurf/RAN biotech) is injected at 200-300 pL/h through two side channels 2 to form bead-containing droplets.

The beads are released at the same frequency as the droplet generation (120 Hz). The bead loading (proportion of bead-containing droplets) and the nuclei loading (proportion of nucleus-containing droplets) is approximately 95% and 10%, respectively, for the droplet volume of 0.8 nL.

Example 5 - Cleavage of second binding assembly

The generated droplets are collected in a reservoir made of an 1.5-mL Eppendorf tube with a PDMS plug and inlet and outlet conduits inserted in the tube through the plug as shown in Fig. 6. The droplets are collected in the reservoir through the inlet conduit and remained packed near the surface as they were lighter in density than the oil.

The emulsion of droplets in the oil are exposed to UV light for 1 min to cleave the cleavable portion of the second binding assembly. The emulsion is then heated at 60°C for 5 min for lysis.

The packed bead-containing droplets (the volume of the droplets ranging between 0.5 nL to 1 nL, the bead diameter of 50 pm) are taken out of the reservoir using an oil-filled syringe connected to the outlet and mounted on a syringe pump, then reinjected to a microfluidic chip for bead extraction by pushing the droplets backward.

Example 6 - Bead extraction using a microfluidic chip

A microfluidic chip is fabricated by a standard photolithography process. Specifically, a SU8-2050 photoresist mold was spun on a 4-inch (approximately 100 mm) silicon wafer having a thickness of approximately 60 pm, then exposed through a chromium mask and developed according to the manufacturer’s instructions. The mold is then silanized with fluorinated silane, and PDMS (curing agent at a ratio 1 :10) is poured and baked 2h at 70°C. This process is repeated twice to prepare a chip having two different thicknesses.

As shown in Fig. 3a to Fig. 3c and Fig. 4, the microfluidic chip has a main channel 1 having an inlet (width: 80 pm, thickness: 60-70 pm) for reinjecting the bead-containing droplet phase and an outlet (width: 110 pm, thickness: 45-50 pm) for recovering beads and droplets, and a downstream channel comprising two side channels 2 (width: 80 pm, thickness: 45-50 pm) for introducing oil to break the droplets. The main channel also comprises a constriction 5 with a gradually reduced width, the minimum width being 20 pm wide and the thickness being 45- 50 pm.

As shown in Fig. 3a, the bead-containing droplets in the oil are passed through the main channel 1 from the inlet at a flow rate of 200 pL/h. The droplets are then passed through the constriction 5, and oil (HFE-7500™) is supplied through the two side channels 2 downstream of the constriction 5 at a flow rate of 800 pL/h.

The main channel 1 has a non-narrowed portion extending from the inlet of the main channel to a transition area, and a narrowed portion extending from the transition area to the constriction 5, i.e., the thickness of the main channel is equal to or slightly smaller than the bead diameter (approximately 50 pm) after the transition area, so that the beads are slightly compressed in the thickness direction, and the friction force keeps the beads at the rear of the droplets. The beads are then extracted from the droplets upon passing through the constriction 5

The droplets and the extracted beads are collected in a collecting reservoir equipped with a plug and inlet and outlet conduits inserted in the reservoir through the plug, as shown in Fig. 6. The extracted beads are collected at the bottom using a magnet while the droplets are packed near the surface as they are lighter than the oil.

Example 7 - DNA library preparation for sequencing

The droplets obtained in Example 6 are subjected to droplet PCR. From the surface of the reservoir, 20 pL of the droplets are pipetted out and redispersed in HFE-7500™ with 4% fluosurf (or 5% RAN biotech). The emulsion is split into PCR tubes, and the bottom oil layer is removed with a syringe. The DNA sequence of the captured analyte is thus amplified.

As shown in Fig. 8a, the partial second binding assembly released from the bead and the Reverse i7 contained in the droplet are used as the primers. The final PCR products are shown in Fig. 8b.

The emulsion is broken with 50 pL of droplet breaker (perfluorooctanol 20% in HFE-7500™), and 20 pL of water is added, followed by the centrifugation. The bottom oil layer is removed. The aqueous phase is pipetted out and purified with a PCR cleanup kit (Qiagen Minelute or Nucleospin). The aqueous phase is further purified by size selection with SPRI (Solid-phase reversible immobilization) beads at the ratio of 0.7 to get rid of primers. The sample is subjected to Qubit and TapeStation (D1000) for quality control, and then sequenced.

Example 8 - RNA library preparation for sequencing

After the surficial emulsion (droplets) is pipetted out in Example 7, the magnet is removed, and beads are resuspended. Then, 10 mL of 6X SSC (saline- sodium citrate) buffer (room temperature), and 0.5 mL of pure perfluoro-octan-1 - ol are added, and the mixture is shaken vigorously by hand for 20 sec to break the emulsion and ensure RNA hybridization on beads. After the centrifugation (1000 g for 5min), the interphase layer containing the beads is washed with 15 mL of 6X SSC buffer. The aqueous phase is transferred and washed again with 6X SSC buffer to remove residual oil.

Template-switching reverse transcription

The beads are centrifuged and resuspended in 50 pL of RT buffer (25 mM Tris HCI 1 M pH 8, 2.5% PEG8000, 30 mM NaCI, 2.5 mM MgCI₂, 1 mM GTP, 0.5 mM dNTP, 8 mM DTT, 0.5 U/pL RRI (Recombinant ribonuclease inhibitor), Biot- TSO (/5BiosG/ACACTCTTTCCCTACACGACGCrGrGrG (SEQ ID NO: 15); /5BiosG/ indicates 5’ biotinylation), 2 U/pL Maxima H minus reverse), and subjected to template-switching reverse transcription.

Exonuclease I treatment (optional)

The beads are washed twice with a wash buffer (10 mM TrisHCI pH8, 1 mM EDTA, 0.01 % Tween 20), and again washed with 10mM TrisHCI pH8. The beads are resuspended in an exonuclease mix (1X Exonuclease I Buffer, Exonuclease I (NEB M0293), and incubated for 45min at 37°C with rotation. The beads are then washed twice with the wash buffer. cDNA amplification

The beads are resuspend in H₂O and counted. Then, 100,000 beads (10,000 nuclei) per tube are placed in a PCR strip, and after the centrifugation, resuspend in a PCR mix (1X Kapa Hifi™ buffer, 0.3 mM dNTPs, 0.3 pM Primer R1 (ACACTCTTTCCCTACACGACGC (SEQ ID NO: 16)), 0.3 pM Primer R2 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 17)), 0.02 U/pL Polymerase Kapa), and subjected to PCR. The beads are centrifuged, and the supernatant is purified with SPRI beads at the ratio of 1 . Qubit and Tapestation (D5000) are performed for quality control. Library preparation

The cDNA samples is fragmented, using NEBNext Ultra II kit (E7805S), and purified with SPRI beads (1X ratio). Following NEBNext Ultra II kit instructions, the ligation of connectors (R1 N primer on 3’ end and R2N primer on 5’ end) is performed. The cDNA sample is purified again with SPRI beads (0.5X ratio) to remove small fragments. PCR is performed on cDNA to add P5, P7 and sample identifier (i7) (PCR mix: 1X DNA Kapa Hifibuffer, 0.3 mM dNTPs, 0.3 pM primer P7-i7-R2 (CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGG AGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 18), in which NNNNNN is the i7 sample identifier which vary for each experiment), 0.3 pM Primer P5-R1 N (AATGATACGGCGACCACCGAGATCTTCGTCGGCAGCGTCAGATGTGTATA AGAGACAG (SEQ ID NO: 19)), 0.02 U/pL Polymerase Kapa). The PCR products are purified with SPRI beads (ratio 0.8X) and resuspend in H2O. Qubit and Tapestation are performed for the quality control. The sample is then sequenced for further analysis.

Example 9 - Alternative example of the invention

In this Example 9, the invention is implemented as described above, except that the combination of a linear PCR in droplets and a bulk PCR linear PCR is performed for DNA library preparation and that a PCR using a single ISPCR primer is performed for RNA library preparation.

Preparation of beads containing first and second binding assemblies

Polyacrylamide beads attached with bead-binding portions are prepared in the same way as in Example 1 .

Then, first and second binding assemblies are assembled on the polyacrylamide beads in the same way as in Example 2 except that different sequences are used for the ligation of cleavable/non-cleavable portions and for the ligation of probe portion.

Regarding the ligation of cleavable/non-cleavable portions, sequences provided in Table 5 are used instead of those shown in Table 2.

Regarding the ligation of probe portion, sequences provided in Table 6 are used instead of the sequences shown in Table 4.

Table 5: List of alternative sequences used for ligation of a cleavable and non- cleavable portions

BA1 = first binding assembly, BA2 = second binding assembly, bold letters = connectors, /5Phos/ = 5’-terminal phosphorylation, underlined letters = ISPCR (primer-binding site), iSpPC = photocleavable spacer, italic letters = P5 (Illumina flow cell adapter). Unless otherwise specified, the sequences are 5’ to 3’. 1 st strand and 2nd strand for BA1 form together a double-stranded S1 RNA primer, and 1 st strand and 2nd strand for BA2 form together a double-stranded S1 C&T primer.

Table 6: List of alternative sequences used for ligation of probe portions

Bold letters = connectors, /5Phos/ = 5'-terminal phosphorylation, NNNN... =

UMI, TTTT... = poly(T) tail with a VN anchor (V = any base but not T; N as described above), underlined letters = R1 N (sequencing adapter (also used as a probe portion). Unless otherwise specified, the sequences are 5’ to 3’. Respective 1^st strand and 2^nd strand form together a double-stranded sequence.

Co-encapsulation of the beads and nuclei in droplets

The nuclei are then prepared in the same manner as in Example 3. The beads obtained as above are co-encapsulated with the nuclei in droplets, in the same way as in Example 4, except that the nuclei buffer does not contain the Reverse i7 sequence (P7-i7-R2N). DNA library preparation for sequencing

After the cleavage treatment and bead extraction as described in Examples 5 and 6, the droplets packed near the surface are collected and then subjected to a linear PCR. The PCR conditions are as follows: gap filling at 72°C for 5 min, then heating to 98°C for 3 min, and 8 cycles of 98°C for 20 s, 59°C for 20 s and 72°C for 30 s, followed by a final extension at 72°C for 1 min, at a ramp rate of 1 °C/s to avoid coalescence.

The emulsion is then broken, and centrifuged. The aqueous phase is purified by size selection with SPRI beads at the ratio of 0.8, and then subjected to a second PCR using a Kapa HotStart Readymix (2X) and a primer P7-i7-R2N (SEQ ID NO: 14). The PCR conditions are as follows: heating to 98°C for 3 min, and 18 cycles of 98°C for 20 s, 65°C for 15 s and 72°C for 15 s, followed by a final extension at 72°C for 1 min. The sample is again purified by size selection with SPRI beads at the ratio of 0.8, and then subjected to Qubit and TapeStation (D1000) for quality control, and then sequenced.

RNA library preparation for sequencing

The extracted beads are collected with a magnet, and washed once with HFE-7500™, and most of the oil is removed. Then, 500 pL of a 5X RT at a room temperature (250mM Tris pH8, 375mM KCI, 15mM MgCl2, 50mM DTT) is added onto the beads, and 100 pL of 20% perfluorooctanol in HFE to break the emulsion. After a quick centrifugation, the beads are magnetically collected on the side of the tube and the residual oil is removed. The pellet of the beads is washed twice with 200 pL of a cold 2X RT (5X RT, 1 % Pluronic F68).

Subsequently, 25 pL of the 2X RT solution containing the beads is taken out, and combined with 25 pL of 2X RT Mastermix solution (4.8% PEG800, 4% PM400 (Ficoll400), 1 mM dNTPs, 1 U/pL Ribolock RNAse Inhibitor, Biot-TSO (/5BiosG/AAGCAGTGGTATCAACGCAGAGTGAATrGrGrG (SEQ ID NQ:30) 2U/pL Maxima Reverse H minus reverse transcriptase), and subjected to template-switching reverse transcription on a thermomixer under agitation at 25°C for 30 min, at 42°C for 90 min, at 85°C for 10 min, and then held at 4°C.

The beads are resuspend in H2O and counted, and 100,000 beads (10,000 nuclei) per tube are placed in a PCR strip, and after the centrifugation, resuspend in a Kapa Hotstart Readymix with 0.3 pM of an ISPCR primer (AAGCAGTGGTATCAACGCAGAGT (SEQ ID NO:31 )), and subjected to PCR. The beads are centrifuged, and the supernatant is purified with SPRI beads at the ratio of 1 . Qubit and Tapestation (D5000) are performed for quality control. The cDNA samples is fragmented, using Nextera XT kit, which contains a Tn5 transposase. Nextera Readl and Nextera Read2 are added on 3’ end and on 5’ end of the DNA fragments by the transposase. PCR is performed on the cDNA sample to add P5, P7 and sample identifier (i7) (PCR mix: Kapa Hotstart Readymix, 0.3 pM primer P7-i7-Nextera Read2 (CAAGCAGAAGACGGCATACGAGATNNNNNNGTCTCGTGGGCTCGG (SEQ ID NO:32), in which NNNNNN is the i7 sample identifier which vary for each experiment), and 0.3 pM Primer P5-ISPCR

(AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTG GTATCAACGCAGAGTAC (SEQ ID NO:33)). The PCR products are purified with SPRI beads (ratio 0.8X) and resuspend in H2O. Qubit and Tapestation are performed for the quality control. The sample is then sequenced for further analysis.

Claims

CLAIMS A probe comprising a bead, and at least a first binding assembly and a second binding assembly, wherein:

- the first and second bead-binding portions are attached to the bead;

- the second probe portion is a portion capable of binding to a second analyte. The probe of claim 1 , wherein:

- the first binding assembly and the second binding assembly are polynucleotide sequences, wherein the cleavable portion comprises a cleavable molecular moiety. The probe of claim of 1 or 2, wherein:

- the first binding assembly further comprises at least one barcode portion, preferably located between the first bead-binding portion and the first probe portion;

- the second binding assembly further comprises at least one barcode portion, preferably located between the cleavable portion and the second probe portion;

- the barcode portion(s) is/are the same between the first binding assembly and the second binding assembly. The probe of claim 3, wherein:

- the barcode portion(s) of the first binding assembly are connected to each other and/or to the first bead-binding portion and/or to the first probe portion via respective connectors; and

- the barcode portion(s) of the second binding assembly are connected to each other and/or to the cleavable portion and/or to the second probe portion via respective connectors. 5. The probe of claim of 4, wherein the connectors are single-stranded nucleotide sequences which form double-stranded sequences with complementary single-stranded connectors.

6. The probe of claim 4 or 5, wherein the connectors for the first binding assembly are different from the connectors for the second binding assembly.

7. The probe of any one of claims 1 to 6, wherein the first binding assembly and/or the second binding assembly further comprise(s) at least one additional portion selected from a primer-binding site capable of hybridizing a primer, a sequencing adapter, a spacer, a tag, a sample barcode, a unique molecular identifier, or any combination thereof.

8. The probe of any one of claims 1 to 7, wherein

- the first binding assembly comprises, from proximal to distal with respect to the bead, a first bead-binding portion, three barcode portions, additional portions of a primer-binding site and a unique molecular identifier, and a first probe portion of poly(T) tail, all the portions being connected to each other via respective connectors; and

- the second binding assembly comprises, from proximal to distal with respect to the bead, a second bead-binding portion, a cleavable portion, an additional portion of a sequencing adapter, three barcode portions, and a second probe portion, all the portions being connected to each other via the respective connectors.

9. The probe of any one of claims 1 to 8, wherein the cleavable portion is electromagnetically, enzymatically, chemically, or thermally cleavable.

10. The probe of any one of claims 1 to 9, wherein the first binding assembly does not comprise a cleavable portion which is cleavable by a same mechanism as the cleavable portion of the second binding assembly.

11. The probe of claim 10, wherein the first binding assembly comprises a cleavable portion different from the cleavable portion of the second binding assembly, and the cleavable portion of the first binding assembly is cleavable by a different mechanism from the cleavable portion of the second binding assembly. The probe of claim 10, wherein the first binding assembly does not comprise any cleavable portion. The probe of any one of claims 1 to 12, wherein the bead comprises a magnetic material. A method of preparing a probe according to any one of claims 1 to 13, the method comprising:

- providing a bead;

- attaching the first binding portion and the second portion to the bead;

- assembling the first binding assembly from the first binding portion attached to the bead; and

- assembling the second binding assembly from the second binding portion attached to the bead. The method of claim 14, further comprising:

- attaching barcode portion(s) of the first binding assembly to each other and/or to the first bead-binding portion and/or to the first probe portion via respective connectors, and

- attaching barcode portion(s) of the second binding assembly to each other and/or to the cleavable portion and/or to the second probe portion via respective connectors for the second binding assembly. The method of claim 14 and 15, wherein attaching the barcode portion(s) via respective connectors is performed by a split and pool method by ligation. A method of separating a first analyte and a second analyte in a droplet, comprising:

- providing a droplet containing the first analyte, the second analyte, and the probe of any one of claims 1 to 13;

- binding the first analyte to the first binding assembly,

- binding the second analyte to the second binding assembly,

- releasing the second binding assembly from the probe,

- extracting the probe from the droplet, the first analyte remaining bound to the probe, and the droplet containing the second analyte released from the probe. 18. The method of claim 17, wherein the first analyte and the second analyte are of a same biological sample, wherein the biological sample is preferably a single cell. 19. The method of claim 18, wherein the droplet is within a fluid, and the step of extracting the probe is performed by passing the droplet within the fluid through a constriction in a main channel, and supplying a fluid immiscible with the fluid of the droplet downstream of the constriction, the constriction preferably having at least one width dimension which is equal to or less than the diameter of the bead in a non-constricted state.