WO2024044759A2

WO2024044759A2 - Methods of using exonucleases to make tiny rnas on argonaute proteins

Info

Publication number: WO2024044759A2
Application number: PCT/US2023/072930
Authority: WO
Inventors: Kotaro NAKANISHI
Original assignee: Ohio State Innovation Foundation
Priority date: 2022-08-25
Filing date: 2023-08-25
Publication date: 2024-02-29
Also published as: WO2024044759A3

Abstract

The present disclosure relates to method of making tiny RNAs loaded on Argonaute protein using exonucleases.

Description

Docket No.103361-353WO1 METHODS OF USING EXONUCLEASES TO MAKE TINY RNAS ON ARGONAUTE PROTEINS STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with Government Support under Grant No. GM124320 awarded by the National Institutes of Health. The Government has certain right in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to, and the benefit of, U.S. Provisional Patent Application No. 63/400,886, filed 08/25/2022, entitled “METHODS OF USING EXONUCLEASES TO MAKE TINY RNAS ON ARGONAUTE PROTEINS,” which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING The sequence listing submitted on August 25^th, 2023, as an .XML file entitled “103361- 353WO1_ST26.xml” created on August 22^nd, 2023, and having a file size of 9,984 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5). FIELD The present disclosure relates to method of making tiny RNAs loaded on Argonaute protein using exonucleases. BACKGROUND MicroRNAs (miRNAs) are small noncoding RNAs that post-transcriptionally regulate gene expression. Although their sequences differ, their length generally falls within the range of ~20-23 nucleotides because precursor miRNAs are processed by a Dicer, which is a molecular ruler that generates size-specific miRNA duplexes. Once miRNAs are loaded onto an Argonaute (AGO) protein, one of the two miRNA strands is ejected while the remaining strand (guide strand) and the AGO protein form an RNA-induced silencing complex (RISC). A substantial number of ~18 nucleotide RNAs (also referred to as tiny RNAs (tyRNAs)) were found to be bound to the AGO, demonstrating further processing of the RNA after loading. However, it remained unknown how the RNAs are converted from ~20-23 to ~18 nucleotides. Docket No.103361-353WO1 Given the limitations described above, there is a need to understand how tyRNAs are generated, and develop a complete system for generating tyRNAs to regulate gene expression. SUMMARY The present disclosure provides a system for trimming, cleaving, or cutting a target nucleic acid. The present disclosure provides a system for regulating expression of a target nucleic acid. The present disclosure also provides a method of regulating a target nucleic acid. The present disclosure also provides a kit for generating tiny RNA (tyRNA). In one aspect, disclosed herein is a nucleic acid trimming system comprising a non- coding ribonucleic acid (non-coding RNA) and an exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA. In some embodiments, the exonuclease comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also known as ^ƍK([R^^ In some embodiments, the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). In some embodiments, the system further comprises an Argonaute (AGO) protein. In some embodiments, the exonuclease and the AGO protein stabilize the non-coding RNA. In some embodiments, the AGO comprises AGO1, AGO2, AGO3, or AGO4. In some embodiments, non-coding RNA comprises at least 19 nucleotides. In some embodiments, said system generates a tiny RNA (tyRNA) from the non-coding RNA. In some embodiments, the tyRNA comprises less than 19 nucleotides. In some embodiments, the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. In some embodiments, the system requires a manganese (Mn) ion. In some embodiments, the Mn ion comprises Mn²⁺. In one aspect, disclosed herein is a method of treating a neurodegenerative disease or an autoimmune disease in a subject in need thereof, the method comprising administering the nucleic acid trimming system of any preceding aspect, a cell expressing the nucleic acid trimming system of any preceding aspect, or a therapeutic composition comprising the tyRNA of any preceding aspect, wherein the tyRNA increases or decreases expression of a target nucleic acid relative to a reference control. In some embodiments, the nucleic acid trimming system, the cell, or the therapeutic composition is administered with a pharmaceutically acceptable carrier comprising an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, or a nanoparticle. In some Docket No.103361-353WO1 embodiments, the neurodegenerative disease or the autoimmune disease affects expression of the target nucleic acid. In some embodiments, the neurodegenerative disease comprises Parkinson’s disease, Alzheimer’s disease, Huntington disease, or manganism. In some embodiments, the autoimmune disease comprises Aicardi-Goutieres syndrome, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, Guillain-Barre syndrome, psoriasis, Graves’ disease, myasthenia gravis, or scleroderma. In some embodiments, the target nucleic acid comprises DNA or RNA. In one aspect, disclosed herein is a method of screening one or more exonuclease enzymes for a nucleic acid trimming system, the method comprising expressing or isolating the one or more exonuclease enzymes from a biological sample, loading a non-coding ribonucleic acid (non-coding RNA) onto an Argonaute (AGO) protein, exposing the non- coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into a tyRNA, and incorporating at least one of the exonuclease enzymes into the nucleic acid trimming system when the tyRNA comprises less than 19 nucleotides. In some embodiments, the one or more exonuclease enzymes comprise ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, EXO5, or variants thereof. In one aspect, disclosed herein is a method for regulating a target nucleic acid using a nucleic acid trimming system comprising a non-coding RNA and an exonuclease enzyme the method comprising exposing the non-coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into the tyRNA, and exposing the tyRNA to the target nucleic acid; wherein the tyRNA increases or decreases expression of the target nucleic acid relative to a control nucleic acid. In some embodiments, exonuclease comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also known as ^ƍK([R^^ In some embodiments, the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). In some embodiments, the system further comprises an Argonaute (AGO) protein. In some embodiments, the exonuclease and AGO protein stabilize the non-coding RNA. In some embodiments, the AGO comprises AGO1, AGO2, AGO3, or AGO4. In some embodiments, non-coding RNA comprises at least 19 nucleotides. In some embodiments, the tyRNA comprises less than 19 nucleotides. In some embodiments, the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. Docket No.103361-353WO1 In some embodiments, the target nucleic acid comprises DNA or RNA. In some embodiments, said system requires a manganese (Mn) ion. In some embodiments, the Mn ion comprises Mn²⁺. In one aspect, disclosed herein is a kit for generating tiny RNA (tyRNA), the kit comprising an exonuclease enzyme, and a non-coding RNA wherein the exonuclease enzyme trims the non-coding RNA. In some embodiments, the exonuclease comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also known as ^ƍK([R^^ In some embodiments, the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). In some embodiments, the kit further comprising an Argonaute (AGO) protein. In some embodiments, the AGO comprises AGO1, AGO2, AGO3, or AGO4. In some embodiments, the non-coding RNA comprises at least 19 nucleotides. In some embodiments, the kit generates tyRNA comprising less than 19 nucleotides. In some embodiments, the kit generates tyRNA comprising 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. In some embodiments, the kit further comprises a manganese (Mn) compound selected from manganese (II) chloride, manganese (II) sulfate, manganese (II) oxide, manganese (II) sulfide, or variants thereof. In some embodiments, the exonuclease enzyme, the non-coding RNA, the AGO protein, or the manganese compound are lyophilized, flash frozen with liquid nitrogen (N2), or stored in a buffered solution. In some embodiments, the buffered solution comprises water, saline, a phosphate buffered saline, or a Tris buffered saline. In some embodiments, the kit is used to regulate expression of a target nucleic acid. In some embodiments, the target nucleic acid comprises DNA or RNA. In some embodiments, the biological sample comprises an expression vector or a cell. BRIEF DESCRIPTION OF FIGURES The accompanying figures, which are incorporated in and constitute a part of this specification, illustrate several aspects described below. Figures 1A, 1B, 1C, 1D, and 1E show VSHFLILF^^ƍĺ^ƍ^H[RQXFOHDVHV^FRQYHUW^PL51$V^WR^ tyRNAs. Figure. 1A shows the pathways towards AGO-associated tyRNAs. Figure. 1B shows the in vivo stability of 14- and 23-nt ss miR-20a and their siRNA-like duplexes Figure. 1C Docket No.103361-353WO1 shows the accumulation of tyRNAs upon expression of ISG20. Figure. 1D shows the in vivo trimming of FLAG-AGO2-associated miR-20a by ISG20, TREX1, ERI1, PARN, and EXO5 and their catalytic mutants. A representative gel image (top) and western blots with antibodies for each protein (bottom). Figure. 1E shows the tyRNA synthesis on four human AGOs by ISG20, TREX1, ERI1, and PARN. Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, 2J, 2K, and 2L show that ISG20, TREX1, and ERI1 generates tyRNAs autonomously. Figures. 2A, 2B, 2C, and 2D show the in vitro JXLGH^WULPPLQJ^E\^^ƍĺ^ƍ^H[RQXFOHDVHV^LQ^WKH^SUHVHQFH^RI^^^P0^0Q&O^^^^/HIW^^$^UHSUHVHQWDWLYH^ gel image for each AGO. (Right) The relative amount of each guide length after incubation ZLWK^HLWKHU^^ƍĺ^ƍ^H[RQXFOHDVH^^Figure. 2E shows the in vitro trimming of AGO2-associated miR-20a by the catalytically dead exonuclease mutants at 2 mM MnCl2. Figure. 2F shows the in vitro trimming of AGO2-associated miR-^^D^ E\^ ^ƍĺ^ƍ^ H[RQXFOHDVHV^ LQ^ ^^ P0^0J&O^^ Figures. 2G, 2H, 2I, and 2J show the in vitro trimming of different miRNAs by ISG20. (Left) A representative gel image for each AGO. (Right) The relative amount of each guide length after incubation with ISG20. Figure. 2K shows the docking model of ISG20 (blue ribbon model) on a guide (red stick model)-bound AGO3 (surface model). Figure. 2L shows the in vitro trimming of AGO3-associated different miRNAs, followed by target cleavage. Figure 3 shows the nucleic acid sequence of the cyBR-20a (SEQ ID NO: 3). Figure 4 shows the nucleic acid sequence of the cyBR-7a (SEQ ID NO: 6). DETAILED DESCRIPTION The following description of the disclosure is provided as an enabling teaching of the disclosure in its best, currently known embodiment(s). To this end, those skilled in the relevant art will recognize and appreciate that many changes can be made to the various embodiments of the invention described herein, while still obtaining the beneficial results of the present disclosure. It will also be apparent that some of the desired benefits of the present disclosure can be obtained by selecting some of the features of the present disclosure without utilizing other features. Accordingly, those who work in the art will recognize that many modifications and adaptations to the present disclosure are possible and can even be desirable in certain circumstances and are a part of the present disclosure. Thus, the following description is provided as illustrative of the principles of the present disclosure and not in limitation thereof. Reference will now be made in detail to the embodiments of the invention, examples of which are illustrated in the drawings and the examples. This invention may, however, be Docket No.103361-353WO1 embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Terminology Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. The term “comprising” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. As used in this disclosure and in the appended claims, the singular forms “a,” “an,” “the,” include plural referents unless the context clearly dictates otherwise. The following definitions are provided for the full understanding of terms used in this specification. Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10”as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that Docket No.103361-353WO1 each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed. As used herein, the terms "may," "optionally," and "may optionally" are used interchangeably and are meant to include cases in which the condition occurs as well as cases in which the condition does not occur. Thus, for example, the statement that a formulation "may include an excipient" is meant to include cases in which the formulation includes an excipient as well as cases in which the formulation does not include an excipient. The term “comprising,” and variations thereof as used herein is used synonymously with the term “including” and variations thereof and are open, non-limiting terms. Although the terms “comprising” and “including” have been used herein to describe various embodiments, the terms “consisting essentially of” and “consisting of” can be used in place of “comprising” and “including” to provide for more specific embodiments and are also disclosed. An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant. "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also, for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels. Docket No.103361-353WO1 By “reduce” or other forms of the word, such as “reducing” or “reduction,” means lowering of an event or characteristic (e.g., a disease symptom). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reducing a symptom” means reducing the signs and any side effects of symptoms caused by a disease relative to a standard or a control. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed. A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative." Reference also is made herein to proteins, polypeptides, peptides, or compositions comprising proteins, polypeptides, or peptides. As used herein, a polypeptide and/or protein is defined as a polymer of amino acids, with a non-limiting OHQJWK^^^^^DPLQR^DFLGV^^*DUUHWW^^^ Grisham, Biochemistry, 2nd edition, 1999, Brooks/Cole, 110). A peptide is defined as a short polymer of amino acids, of a length typically of 20 or less amino acids, and more typically of a length of 12 or OHVV^ DPLQR^ DFLGV^ ^*DUUHWW^ ^^*ULVKDP^^ %LRFKHPLVWU\^^ ^QG^ HGLWLRQ^^ ^^^^^^ Brooks/Cole, 110). An “enzyme” is a biological molecule, usually a protein or peptide, that acts under certain conditions, such as pH, temperature, and/or salt concentration, to accelerate biochemical reactions, either inside or outside of a tissue or cell. The molecules upon which enzymes initiate a reaction are called “substrates,” and the enzyme converts the substrates into different molecules called “products.” Enzyme functions are usually measured based on the enzyme “activity” which refers to the amount of substrate converted into a product or products by the enzyme within a given amount of time. An ”exonuclease” refers to a type of enzyme essential to genome stability by acting to cleave, trim, or cut the free ends (such as the three prime (3’) end or the five prime (5’) end) of Docket No.103361-353WO1 nucleic acids, including but not limited to DNA. Exonucleases are also involved in several aspects of cellular metabolism and maintenance. The term “trim,” “trimming,” or grammatical variations thereof, refers to the process of cutting smaller fragments or pieces of a nucleic acid from a parent or original nucleic acid. A “nucleic acid” is a chemical compound that serves as the primary information- carrying molecules in cells and make up the cellular genetic material. Nucleic acids comprise nucleotides, which are the monomers made of a 5-carbon sugar (usually ribose or deoxyribose), a phosphate group, and a nitrogenous base. A nucleic acid can also be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). A chimeric nucleic acid comprises two or more of the same kind of nucleic acid fused together to form one compound comprising genetic material. A “nucleotide” is a compound consisting of a nucleoside, which consists of a nitrogenous base and a 5-carbon sugar, linked to a phosphate group forming the basic structural unit of nucleic acids, such as DNA or RNA. The four types of nucleotides are adenine (A), cytosine (C), guanine (G), and thymine (T), each of which are bound together by a phosphodiester bond to form a nucleic acid molecule. The terms “ribonucleic acid” and “RNA” as used herein mean a polymer composed of ribonucleotides. The terms “deoxyribonucleic acid” and “DNA” as used herein mean a polymer composed of deoxyribonucleotides. The term “oligonucleotide” denotes single- or double-stranded nucleotide multimers of from about 2 to up to about 100 nucleotides in length. Suitable oligonucleotides may be prepared by the phosphoramidite method described by Beaucage and Carruthers, Tetrahedron Lett., 22:1859-1862 (1981), or by the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981), both incorporated herein by reference, or by other chemical methods using either a commercial automated oligonucleotide synthesizer or VLSIPS™ technology. When oligonucleotides are referred to as “double-stranded,” it is understood by those of skill in the art that a pair of oligonucleotides exist in a hydrogen-bonded, helical array typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term “double-stranded,” as used herein is also meant to refer to those forms which include such structural features as bulges and loops, described more fully in such biochemistry texts as Stryer, Biochemistry, Third Ed., (1988), incorporated herein by reference for all purposes. A single-stranded oligonucleotide can exist as a linear molecule without any hydrogen-bonded nucleotides, or can fold three-dimensionally to form hydrogen bonds between individual nucleotides along the single stranded oligonucleotide. Docket No.103361-353WO1 The term “polynucleotide” refers to a single or double stranded polymer composed of nucleotide monomers. Polynucleotides can be any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides may have any three-dimensional structure, and may perform any function, known or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component. A polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine (T) when the polynucleotide is RNA. Thus, the term "polynucleotide sequence" is the alphabetical representation of a polynucleotide molecule. In some embodiments, the polynucleotide is composed of nucleotide monomers of generally greater than 100 nucleotides in length and up to about 8,000 or more nucleotides in length. “Expression” as used herein refers to the process by which information from a gene is used in the synthesis of a functional gene product that enables it to produce a peptide/protein end product, and ultimately affect a phenotype, as the final effect. As used herein, the term “chemical compound” or “compound,” refers to a chemical substance consisting of two or more different types of atoms or chemical elements in a fixed stoichiometric proportion. These compounds have a unique and defined chemical structure held together in a defined spatial arrangement by chemical bonds. Chemical compounds can be held together by covalent bonds, ionic bonds, metallic ions, or coordinate covalent bonds. A “variant” or a “derivative” of a particular compound may be defined as a chemical or molecule having at least 50% structural identity or similarity to a parent or original compound. In some embodiments a variant compound may show, for example, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or greater structural identity or similarity relative to a reference parent or original compound. “Lyophilized,” also referred to as “freeze drying” or “cryodesiccation” refers to a low temperature dehydration process that involves freezing a molecule, biomolecule, compound, Docket No.103361-353WO1 or composition and lowering the pressure, and removing any moisture by sublimation. Nucleic acid trimming systems and kits More than 2,000 microRNAs (miRNAs) have been reported as of 2019 in humans. miRNAs are varied in sequence, but their lengths fall within a range of ~19-23 nucleotides (nt) because precursor miRNAs are processed by Dicer which is a molecular ruler that generates size-specific miRNA duplexes. After those duplexes are loaded into Argonaute proteins (AGO), one of the two strands is ejected while the remaining strand (guide) strand and AGO form the RNA-induced silencing complex (RISC). Therefore, the 19-23 nucleotide length of small RNAs is the hallmark of mature miRNAs. This size definition was exploited to eliminate ~18-nucleotide RNAs during sample preparation or analysis in most of the early next generation RNA sequencing (RNAseq) of miRNAs. On the other hand, RNAseq without RNA elimination found a substantial number of ~10-18 nucleotide tiny RNAs (tyRNAs) bound to AGOs. Although some tyRNAs are known to regulate gene expression similarly to mature miRNAs, little is known about how tyRNAs are generated. Disclosed herein is the discovery of exonuclease enzymes that trim, cleave, and/or cut non-coding RNA (such as, for example miRNA) into tyRNA. This is demonstrated by exposing or expressing exonuclease enzymes (such as, for example interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also known as ^ƍK([R^) in the presence of miRNAs, and detecting nucleic acids with 18 nucleotides or less. These findings demonstrated that exonuclease enzymes are key components to the process of generating tyRNAs. Also, this disclosure presents implications for dysregulation in neurodegenerative diseases. Notably dysregulation of manganese concentrations and exonuclease activity further indicates dysregulation of tyRNA generation leading to neurodegenerative diseases, such as Parkinson’s disease, Alzheimer’s disease, Huntington disease, and manganism. It should be noted that a “non-coding RNA” refers to a functional RNA molecule that is not translated into a protein. Functions of non-coding RNA include, but are not limited to regulation of protein translation, RNA splicing, DNA replication, gene expression, chromosomal stability, and hormonal pathways. In some embodiments, the nucleic acid trimming system comprises non-coding RNA including, but not limited to microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, and long non-codingRNA (long ncRNA). Docket No.103361-353WO1 The present disclosure provides a system for trimming, cleaving, or cutting a target nucleic acid. The present disclosure also provides a system for regulating expression of a target nucleic acid. The present disclosure also provides a kit for generating tiny RNA (tyRNA). In one aspect, disclosed herein is a nucleic acid trimming system comprising a non- coding ribonucleic acid (non-coding RNA) and an exonuclease enzyme comprising interferon- stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 ^HQKDQFHG^51$L^^DOVR^NQRZQ^DV^^ƍK([R^, wherein the exonuclease enzyme targets and trims the non-coding RNA and wherein the system generates a tiny RNA (tyRNA) from the non- coding RNA. As used herein, “tiny RNA” or “tyRNA” refers to small RNA molecules comprising less than 19 nucleotides that are loaded into Argonaute (AGO) proteins, recruit the effector complexes to target messenger RNA (mRNA), and establish post-transcriptional regulation of gene expression. It should also be noted that tyRNAs can also be referred to as cleavage- inducing tyRNAs (cityRNAs). In some embodiments, the tyRNA comprises less than 19 nucleotides. In some embodiments, the tyRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. In one aspect, disclosed herein is a kit for generating tiny RNA (tyRNA), the kit comprising an exonuclease enzyme, and a non-coding RNA wherein the exonuclease enzyme trims the non-coding RNA. In some embodiments, the non-coding RNA includes, but is not limited to microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, and long non-codingRNA (long ncRNA). In some embodiments, the system further comprises an Argonaute (AGO) protein. In some embodiments, the exonuclease and AGO protein stabilize the non-coding RNA. In some embodiments, the AGO comprises AGO1, AGO2, AGO3, or AGO4. In some embodiments, the non-coding RNA comprises at least 19 nucleotides. In some embodiments, the non-coding RNA comprises 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, Docket No.103361-353WO1 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, or more nucleotides. In some embodiments, the tyRNA comprises less than 19 nucleotides. In some embodiments, the tyRNA comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. In some embodiments, the system requires a manganese (Mn) ion. In some embodiments, the Mn ion comprises Mn²⁺. In some embodiments, the kit further comprises a manganese (Mn) compound selected from manganese (II) chloride, manganese (II) sulfate, manganese (II) oxide, manganese (II) sulfide, or variants thereof. In some embodiments, the exonuclease enzyme, the non-coding RNA, the AGO protein, or the manganese compound are lyophilized or stored in a buffered solution. In some embodiments, the buffered solution comprises water, saline, a phosphate buffered saline, or a Tris buffered saline. In some embodiments, the kit is used to regulate expression of a target nucleic acid. In one embodiment, the target nucleic acid sequence is from a mammal. In one embodiment, the target nucleic acid sequence is from a human. The target nucleic acid sequence can be RNA or DNA. In a specific example, the target RNA can be mRNA. The cityRNA disclosed herein can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% identical to the target nucleic acid, or any amount below or between these amounts. The target nucleic acid can be longer than the tyRNA. For example, it can be considerably longer, as in part of an mRNA that encodes a protein. In some embodiments, the tyRNA can have at least one chemically modified nucleotide. These modified nucleotides may confer increased stability, decreased off-target effects, and/or reduced toxicity, as compared to a ssDNA not having the chemically modified nucleotide. They can also facilitate detection. In some embodiments, the at least one chemically modified nucleotide comprises a chemically modified nucleobase, a chemically modified ribose, a chemically modified phosphodiester linkage, or a combination thereof. In some embodiments, the chemically modified nucleobase is selected from 5- formylcytidine (5fC), 5-methylcytidine (5meC), 5-methoxycytidine (5moC), 5- hydroxycytidine (5hoC), 5-hydroxymethylcytidine (5hmC), 5-formyluridine (5fU), 5- methyluridine (5-meU), 5-methoxyuridine (5moU), 5-carboxymethylesteruridine (5camU), Docket No.103361-353WO1 SVHXGRXULGLQH^ ^Ȍ^^^ 1^-PHWK\OSVHXGRXULGLQH^ ^PH^Ȍ^^^ 1^-methyladenosine (me6A), or thienoguanosine (thG). In some embodiments, the chemically moGLILHG^ULERVH^LV^VHOHFWHG^IURP^^ƍ-O-PHWK\O^^^ƍ- O-0H^^^^ƍ-)OXRUR^^^ƍ-)^^^^ƍ-deoxy-^ƍ-fluoro-beta-D-arabino-QXFOHLF^DFLG^^^ƍ)-$1$^^^^ƍ-6^^^ƍ- 6)$1$^^^ƍ-D]LGR^^81$^^^ƍ-O-methoxy-HWK\O^^^ƍ-O-0(^^^^ƍ-O-$OO\O^^^ƍ-O-(WK\ODPLQH^^^ƍ-O- Cyanoethyl, Locked nucleic acid (LAN), Methylene-cLAN, N-MeO-amino BNA, or N-MeO- aminooxy BNA. In some embodiments, the chemically modified phosphodiester linkage is selected from 3KRVSKRURWKLRDWH^ ^36^^^ %RUDQRSKRVSKDWH^^ SKRVSKRGLWKLRDWH^ ^36^^^^ ^ƍ^^ƍ-DPLGH^^ 1^ƍ- phosphoramidate (NP), PhosSKRGLHVWHU^^32^^^RU^^ƍ^^ƍ-SKRVSKRGLHVWHU^^^ƍ^^ƍ-PO). In some embodiments, SEQ ID NO: 1, or variations thereof comprise a 2’-O-methyl- adenosine (mA), a 2’-O-methyl-cytidine (mC), a 2’-O-methyl-guanosine (mG), a 2’-O-methyl- uridine (mU), a phosphorothioate, a 2’-fluoro-adenosine (2’-F-A), a 2’-fluoro-uridine (2’-F- U), a 2’-fluoro-cytidine (2’-F-C), a 2’-fluoro-guanosine (2’-F-G), or a modification of any preceding aspect. In some embodiments, SEQ ID NO: 4, or variations thereof comprise a 2’-O-methyl- adenosine (mA), a 2’-O-methyl-cytidine (mC), a 2’-O-methyl-guanosine (mG), a 2’-O-methyl- uridine (mU), a phosphorothioate, a 2’-fluoro-adenosine (2’-F-A), a 2’-fluoro-uridine (2’-F- U), a 2’-fluoro-cytidine (2’-F-C), a 2’-fluoro-guanosine (2’-F-G), or a modification of any preceding aspect. In some embodiments, SEQ ID NO: 1, or variations thereof comprise a monophosphate group at the 5 prime (5’) end, depicted as “p”. In some embodiments, SEQ ID NO: 4, or variations thereof comprises a monophosphate group at the 5 prime (5’) end, depicted as “p”. Exonucleases are enzymes that function to cleave or trim nucleotides one at a time from the end (exo) of a polynucleotide chain or nucleic acid. The hydrolyzing reaction, enhanced in the presence of an exonuclease, breaks phosphodiester bonds at either the three prime (3’) or the five prime (5’) end of the polynucleotide chain or nucleic acid. Eukaryotes and prokaryotes can cleave nucleic acid using 5’ to 3’ exonucleases, 3’ to 5’ exonucleases, and/or poly(A)- specific 3’ to 5’ exonucleases. Thus, in some embodiments, the exonuclease is derived from an organism. In some embodiments, the exonuclease is derived from a eukaryote. In some embodiments, the exonuclease is derived from a prokaryote. In some embodiments, the exonuclease is derived from a virus. In some embodiments, the exonuclease is derived from a bacterium. In some embodiments, the exonuclease is derived from a yeast. Docket No.103361-353WO1 In some embodiments, the exonuclease is derived from a strain of E. coli. In some embodiments, the exonuclease derived from E. coli is selected from an exonuclease I, an exonuclease II, an exonuclease III, an exonuclease IV, an exonuclease V, or an exonuclease VIII. In some embodiments, the exonuclease is an exonuclease I. As used herein, an “exonuclease I” refers to a type of exonuclease enzyme capable of breaking single stranded nucleic acid in the 3’ to 5’ direction, releasing deoxyribonucleoside 5’-monophosphate molecules one after another. In some embodiments, the exonuclease is an exonuclease II. As used herein, an “exonuclease II, refers to a type of exonuclease enzyme that generally associates with DNA polymerase I, which contains a 5’ exonuclease that clips off the RNA primer contained immediately upstream from the site of DNA synthesis in a 5’ to 3’ manner. In some embodiments, the exonuclease is an exonuclease III. As used herein, an exonuclease III refers to a type of exonuclease displaying four catalytic activities including 1) 3’ to 5’ exodeoxyribonuclease activity, specific for double stranded DNA, 2) RNase activity, 3) 3’ phosphatase activity, and 4) AP endonuclease activity. In some embodiments, the exonuclease is an exonuclease IV. As used herein, an exonuclease IV refers to a type of exonuclease enzyme that adds a water molecule, so it can break the bond of an oligonucleotide to nucleoside 5’ monophosphate. In some embodiments, the exonuclease is an exonuclease V. As used herein, an exonuclease V refers to a 3’ to 5’ hydrolyzing enzyme that catalyzes linear double-stranded nucleic acids and single-stranded nucleic acids. In some embodiments, the exonuclease enzyme is an exonuclease VIII. As used herein, an exonuclease VIII refers to a 5’ to 3’ dimeric protein that does not require energy in the form of adenosine triphosphate (ATP), or any gaps or nicks in the nucleic acid strand, but requires a free 5’ hydroxyl (OH) group to carry out functions. In some embodiments, the exonuclease is a 3’ to 5’ exonuclease. In some embodiments, the 3’ to 5’ exonuclease is the ISG20. In some embodiments, the 3’ to 5’ exonuclease is the TREX1. In some embodiments, the 3’ to 5’ exonuclease is the ERI1. In some embodiments, the system comprises ISG20, or variants thereof. In some embodiments, the system comprises TREX1, or variants thereof. In some embodiments, the system comprises ERI1, or variants thereof. In some embodiments, the system comprises ISG20 and TREX1. In some embodiments, the system comprises ISG20 and ERI1. In some embodiments, the system comprises TREX1 and ERI1. In some embodiments, the system comprises TREX1, ISG20, and ERI1. In some embodiments, the system comprises one or more exonuclease enzymes selected from ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, EXO5, or variants thereof. Docket No.103361-353WO1 In some embodiments, the Argonaute polypeptide is from Vanderwaltozyma polyspora (also known as Kluyveromyces polysporus). Additional non-limiting examples of yeast Argonaute polypeptides can be from additional yeast species of the genus Kluyveromyces: K. aestuari, K. africanus, K. bacillisporus, K. blattae, K. dobzhanskii, K. hubeiensis, K. lactis, K. lodderae, K. marxianus, K. nonfermentans, K. piceae, K. sinensis, K. thermotolerans, K. waltii, K. wickerhamii, or K. yarrowii. Additional non-limiting examples of yeast Argonaute polypeptides can be from Yarrowia lipolytica, Pichia pastori, Candida vulgaris, Saccharomyces castellii, or Schizosaccharomyces pombe. In some embodiments, the AGO protein used with the methods disclosed herein is from a eukaryote. In some embodiments, the AGO protein is from a mammal. In some embodiments, the AGO protein is from a primate. In some embodiments, the AGO protein is from a human. In some embodiments, the AGO protein is a full length AGO protein. In some embodiments, the AGO protein comprises a portion of the AGO protein. In one embodiment, the AGO protein is a wild-type sequence. In one embodiment, the AGO protein is a sequence with at least one mutation. In one embodiment, the AGO protein comprises an amino acid sequence that is different from a naturally-occurring AGO protein. In some embodiments, the system and methods may comprise additional polypeptides in addition to the AGO protein. For example, additional components of the RNA-induced silencing complex (RISC) may be present. Methods of treating, preventing, ameliorating, and/or decreasing disease In one aspect, disclosed herein is a method of treating and/or preventing a neurodegenerative disease or an autoimmune disease in a subject in need thereof, the method comprising administering the nucleic acid trimming system of any preceding aspect, a cell expressing the nucleic acid trimming system of any preceding aspect, or a therapeutic composition comprising the tyRNA of any preceding aspect, wherein the tyRNA increases or decreases expression of a target nucleic acid relative to a reference control. In some embodiments, the tyRNA increases expression of the target nucleic acid by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, or more relative to a reference control. In some embodiments, the tyRNA decreases expression of the target nucleic acid by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, or more relative to a reference control. Docket No.103361-353WO1 In some embodiments, the nucleic acid trimming system, the cell, or the therapeutic composition is administered with a pharmaceutically acceptable carrier comprising an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, or a nanoparticle. One or more active agents (e.g. [nucleic acid trimming systems and/or components thereof]) can be administered in the “native” form or, if desired in the form of salts, esters, amides, prodrugs, or a derivative that is pharmacologically suitable. Salts, esters, amides, prodrugs, and other derivatives of the active agents can be prepared using standards procedures known to those skilled in the art of synthetic organic chemistry and described, for example, by March (1992) Advanced Organic Chemistry; Reactions, Mechanisms, and Structure, 4^th Ed. N.Y. Wiley- Interscience. In some embodiments, the neurodegenerative disease or the autoimmune disease affects expression of the target nucleic acid. In some embodiments, the neurodegenerative disease includes, but is not limited to Alzheimer’s disease, ataxia, Huntington’s disease, Parkinson’s disease, amyotrophic lateral sclerosis (ALS), Friedreich ataxia, Lewy body disease, spinal muscular atrophy, Alpers’ disease, Batten disease, Cerebro-oculo-facio-skeletal syndrome, Leigh syndrome, Prion diseases, monomelic amyotrophy, multiple system atrophy, striatonigral degeneration, motor neuron disease, multiple sclerosis (MS), Creutzfeldt-Jakob disease, Parkinsonism, spinocerebellar ataxia, dementia, manganism, and other related diseases. In some embodiments, the autoimmune disease comprises Aicardi-Goutieres syndrome, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, Guillain- Barre syndrome, psoriasis, Graves’ disease, myasthenia gravis, or scleroderma. In some embodiments, the target nucleic acid comprises DNA or RNA. The system, cell, or therapeutic composition may be administered in such amounts, time, and route deemed necessary in order to achieve the desired result. The exact amount of the system, cell, or therapeutic composition will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular system, cell, or therapeutic composition, its mode of administration, its mode of activity, and the like. The system, cell, or therapeutic composition is preferably formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the system, cell, or therapeutic composition will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disease being treated and the severity of the disease; the activity of the system, cell, or Docket No.103361-353WO1 therapeutic composition employed; the specific system, cell, or therapeutic composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific system, cell, or therapeutic composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific system, cell, or therapeutic composition employed; and like factors well known in the medical arts. The system, cell, or therapeutic composition may be administered by any route. In some embodiments, the system, cell, or therapeutic composition is administered via a variety of routes, including oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, subcutaneous, intraventricular, transdermal, interdermal, rectal, intravaginal, and/or intraperitoneal. In general, the most appropriate route of administration will depend upon a variety of factors including the nature of the system, cell, or therapeutic composition (e.g., its stability in the environment of the subject), the condition of the subject (e.g., whether the subject is able to tolerate the selected route(s) of administration), etc. The exact amount of system, cell, or therapeutic composition required to achieve a therapeutically or prophylactically effective amount will vary from subject to subject, depending on species, age, and general condition of a subject, severity of the side effects, identity of the particular compound(s), mode of administration, and the like. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult. In some embodiments, the system, cell, or therapeutic composition is administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more times. In some embodiments, the system, cell, or therapeutic composition is administered daily. In some embodiments, the system, cell, or therapeutic composition is administered every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, or more. In some embodiments, the system, cell, or therapeutic composition is administered every week, every 2 weeks, every 3 weeks, every 4 weeks, or more. In some embodiments, the system, cell, or therapeutic composition is administered every month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, or more. In some embodiments, the Docket No.103361-353WO1 system, cell, or therapeutic composition is administered every year, every 2 years, every 3 years, every 4 years, every 5 years, or more. Methods of screening exonucleases for regulating gene expression The present disclosure also provides a method of regulating a target nucleic acid. In one aspect, disclosed herein is a method of screening one or more exonuclease enzymes for a nucleic acid trimming system, the method comprising expressing or isolating the one or more exonuclease enzymes from a biological sample, loading a non-coding ribonucleic acid (non-coding RNA) onto an Argonaute (AGO) protein, exposing the non- coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into a tyRNA, and incorporating at least one of the exonuclease enzymes into the nucleic acid trimming system when the tyRNA comprises less than 19 nucleotides. In one aspect, disclosed herein is a method for regulating a target nucleic acid using a nucleic acid trimming system comprising a non-coding RNA and an exonuclease enzyme, the method comprising exposing the non-coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into the tyRNA, and exposing the tyRNA to the target nucleic acid; wherein the tyRNA increases or decreases expression of the target nucleic acid relative to a control nucleic acid. In some embodiments, the one or more exonuclease enzymes comprise ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, EXO5, or variants thereof. In some embodiments, the method comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also NQRZQ^DV^^ƍK([R^^ In some embodiments, the exonuclease is derived from an organism of any preceding aspect. In some embodiments, the method comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). In some embodiments, the method further comprises an Argonaute (AGO) protein. In some embodiments, the exonuclease and AGO protein stabilize the non-coding RNA. In some embodiments, the method comprises AGO1, AGO2, AGO3, or AGO4. In some embodiments, the AGO protein is derived from a yeast species of any preceding aspect. In some embodiments, the AGO protein is derived from an organism of any preceding aspect. In some embodiments, the method comprises a full length AGO. In some embodiments, the method comprises a portion of the AGO protein. In some embodiments, the method comprises a wild-type AGO protein. In some embodiments, the method comprises an AGO protein with at least one Docket No.103361-353WO1 mutation. In some embodiments, the method comprises an AGO protein with an amino acid sequence that varies from a naturally-occurring AGO protein. In some embodiments, the method comprises additional polypeptides and/or proteins in addition to the AGO protein. In some embodiments, the method comprises additional components of the RNA-induced silencing complex (RISC). In some embodiments, the method comprises a non-coding RNA with at least 19 nucleotides. In some embodiments, the non-coding RNA comprises 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, or more nucleotides. In some embodiments, the method comprises a tyRNA with less than 19 nucleotides. In some embodiments, the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. In some embodiments, the method comprises a tyRNA with at least one chemically modified nucleotide. In some embodiments, the at least one chemically modified nucleotide comprises a modification of any preceding aspect. In some embodiments, the tyRNA increases expression of the target nucleic acid by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to a control nucleic acid. In some embodiments, the tyRNA decreases expression of the target nucleic acid by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% relative to a control nucleic acid. In some embodiments, the target nucleic acid comprises DNA or RNA. In some embodiments, the method requires a manganese (Mn) ion. In some embodiments, the Mn ion comprises Mn²⁺. In some embodiments, the biological sample comprises an expression vector. In some embodiments, the expression vector comprises a plasmid or a virus or viral vector. A plasmid or a viral vector can be capable of extrachromosomal replication or, optionally, can integrate into the host genome. As used herein, the term "integrated" used in reference to an expression vector (e.g., a plasmid or viral vector) means the expression vector, or a portion thereof, is incorporated (physically inserted or ligated) into the chromosomal DNA of a host cell. As used Docket No.103361-353WO1 herein, a “viral vector” refers to a virus-like particle containing genetic material which can be introduced into a eukaryotic cell without causing substantial pathogenic effects to the eukaryotic cell. A wide range of viruses or viral vectors can be used for transduction but should be compatible with the cell type the virus or viral vector are transduced into (e.g., low toxicity, capability to enter cells). Suitable viruses and viral vectors include adenovirus, lentivirus, retrovirus, among others. In some embodiments, the expression vector encoding a chimeric polypeptide is a naked DNA or is comprised in a nanoparticle (e.g., liposomal vesicle, porous silicon nanoparticle, gold-DNA conjugate particle, polyethyleneimine polymer particle, cationic peptides, etc.). In some embodiments, the biological sample comprises a cell. In some embodiments, the cell comprises a bacterial cell (such as, for example Escherichia coli (E. coli) bacterial cells). In some embodiments, the cell comprises a eukaryotic cell. As used herein, the terms "cell," "cell line" and "cell culture" include progeny. It is also understood that all progenies may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included. The "host cells" used in the present invention generally are prokaryotic or eukaryotic hosts. A number of embodiments of the disclosure have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. By way of non-limiting illustration, examples of certain embodiments of the present disclosure are given below. EXAMPLES The following examples are set forth below to illustrate the compositions, devices, methods, and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods and results. These examples are not intended to exclude equivalents and variations of the present invention which are apparent to one skilled in the art. Docket No.103361-353WO1 Example 1: Manganese-dependent microRNA trimming by 3’Æ5’ exonucleases generates 14-nucleotides or shorter tiny RNAs MicroRNAs (miRNAs) are about 22-nucleotide (nt) non-coding RNAs forming the effector complexes with Argonaute (AGO) proteins to repress gene expression. Although tiny RNAs (tyRNAs) shorter than 19 nt have been found to bind to plant and vertebrate AGOs, their biogenesis remains a long-standing question. In vivo and in vitro VWXGLHV^VKRZ^VHYHUDO^^ƍĺ^ƍ^ exonucleases, such as interferon-stimulated gene 20 kDa (ISG20), three prime repair H[RQXFOHDVH^ ^^ ^75(;^^^^ DQG^ (5,^^ ^HQKDQFHG^ 51$L^^ DOVR^ NQRZQ^ DV^ ^ƍK([R^^^ FDSDEOH^ RI^ trimming AGO-associated full-length miRNAs to 14 nt or shorter tyRNAs. Their guide trimming occurs in a manganese-dependent manner but independently of the guide sequence and the loaded four human AGO paralogs. It is also shown that ISG20-mediated guide trimming makes Argonaute3 (AGO3) a slicer. Given the high Mn²⁺ concentrations in stressed cells, virus-infected cells, and neurodegeneration, this study sheds light on the roles of the Mn²⁺-dependent exonucleases in remodeling gene silencing. In the canonical miRNA biogenesis, Dicer processes the hairpin-structured precursor miRNAs into about 22-nt miRNA duplexes. AGOs load the duplexes and eject the passenger strand, forming the effector complexes of the RNA interference (RNAi). Previous RNA sequencing studies identified AGO-associated 10–18-nt tyRNAs in plants and vertebrates that mapped onto tRNAs and miRNAs. However, how those tyRNAs are synthesized remains unknown. The present study focused on the biogenesis of miRNA-derived tyRNAs. RESULTS Several hypothetical pathways towards AGO-associated tyRNAs were contemplated (FIG. 1A). If short single-stranded (ss) RNAs are directly loaded into AGOs, they must exist stably in the cell. To test the idea, 14- or 23-nt ss miR-20a or their small interfering RNA (siRNA)-like duplex were transfected into HEK293T cells. Only the guide RNA was UDGLRODEHOHG^DW^LWV^^ƍ^HQG^^%RWK^^^- and 23-nt ssRNAs and the 14-nt siRNA-like duplex were degraded (FIG. 1B), showing that neither has a chance of being loaded into AGOs efficiently. In contrast, the 23-nt siRNA-like duplex remained 19-23 nt, and no tyRNA was detected, indicating that a detectable level of tyRNAs is not generated in normal conditions. These results prompted thinking that after the canonical RISC assembly, the AGO-associated miRNAs are WULPPHG^ WR^ W\51$V^ E\^ \HW^ XQLGHQWLILHG^ ^ƍĺ^ƍ^ H[RQXFOHDVHV^ ^)LJ^^ ^$^ ERWWRP^ SDWKZD\^^^ Previous studies repRUWHG^WKH^H[SUHVVLRQ^RI^,6*^^^^D^^ƍĺ^ƍ^H[RQXFOHDVH^^LQGXFHG^E\^LQWHUIHURQ^ upon viral infection and stress and by estrogen hormone. When ISG20 was exogenously Docket No.103361-353WO1 expressed, a small amount of 13-14 nt was detected (FIG. 1C). To test whether the generated tyRNA is associated with AGO, FLAG-AGO2 was co-expressed with ISG20 in HEK293T cells (FIG.1D bottom) that were also transfected with an siRNA duplex whose 23-nt miR-20a JXLGH^LV^UDGLRODEHOHG^DW^LWV^^ƍ^HQG^^$IWHU^^^^KRXUV^^)/$*-AGO2 was immunopurified, and the associated RNAs were resolved on a denaturing gel. Co-expression of ISG20 generated AGO- associated tyRNAs (FIG.1D top). tyRNA generation was also observed when TREX1 or ERI1 was co-expressed instead of ISG20. ERI1 is known to negatively regulate global miRNAs abundance in mouse lymphocytes, but the mechanism remains unclear. Poly(A)-specific ribonuclease (PARN) shortened the 23 nt guide down to 19 nt, whereas exonuclease 5 (EXO5) did not trim the guide at all. The experiment was repeated with their catalytically dead mutants to confirm that the observed trimming was due to their exonuclease activity. As a result, none of the mutants generated tyRNA (FIG.1D), proving that the catalytic center of the exonucleases is essential for tyRNA generation. ISG20, TREX1, and ERI1 also generated tyRNAs from AGO1-, AGO3-, and AGO4-associated miR-20a (FIG. 1E). To characterize their guide trimming, an in vitro trimming system was reconstituted. FLAG-tagged human AGO1, AGO2, AGO3, and AGO4 were programmed with a ^ƍ-end radiolabeled 23-nt miR-20a, immobilized on anti-FLAG beads to wash out free guide RNAs, and incubated with one of the abovementioned exonucleases in the presence of manganese. All exonucleases, except for EXO5, trimmed miR-20a that had been loaded onto slicer-deficient AGO1 and AGO4 as well as slicing-competent AGO2 and AGO3 (FIGS. 2A-2D). In contrast, the catalytic mutants of the exonucleases showed no trimming activity (FIG. 2E), further supporting the conclusion that the observed guide trimmings are solely due to the catalytic activity of the exonucleases, not that of the AGOs. Each exonuclease similarly trimmed the loaded miR-20a across the four AGOs, but the trimming patterns differed between the exonucleases (FIGS. 2A-2D). PARN generated an abundance of 21 nt. ERI1 ceased trimming when the guide length became 19 nt while developing a small population of 14-15-nt tyRNAs. In contrast, ISG20 and TREX1 shortened miR-20a to 13 and 14 nt, respectively. Replacing manganese with magnesium drastically reduced the trimming activities of ISG20, TREX1, and ERI1, but not PARN (FIG. 2F). These results show that these exonucleases can synthesize tyRNAs from miRNAs in a Mn²⁺-dependent manner with different processing rates. Next, the susceptivity of GLIIHUHQW^PL51$V^WR^WKH^^ƍĺ^ƍ^H[RQXFOHDVHV was investigated. To this end, FLAG-WDJJHG^$*2V^ZHUH^SURJUDPPHG^ZLWK^D^^ƍ-end radiolabeled 23-nt miR-20a, 21-nt let-7a, 22-nt miR-16, or 23-nt miR-19b, followed by incubation with ISG20. Although miR-20a was trimmed slower than the others, all the tested miRNAs were shortened to 13-14 Docket No.103361-353WO1 nt, regardless of which AGO was loaded (FIGS. 2G-2J). This shows that ISG20 can generate tyRNAs from a variety of miRNAs that are incorporated into any AGO. The docking model, herein, indicates that the nucleic acid- binding cleft of AGO sequesters the guide nucleotide 1- 14 (g1-J^^^^ SRVLWLRQV^ ZKLOH^ WKH^ UHPDLQLQJ^ ^ƍ^ KDOI^ LV^ DFFHVVLEOH^ WR^ ,6*^^^ ^FIG. 2K). This explains why trimming stops when the guide length becomes 13–14 nt. A previous study revealed that 14-nt variants of miR-20a and let-7a, but not of miR-16 or miR-^^E^^ZKRVH^^ƍ^^- 9 nt were trimmed from their mature miRNAs, conferred a decent slicing activity on AGO3. These results prompted testing of whether trimming of AGO3-associated specific miRNAs makes the RISCs a slicer. To this end, FLAG-AGO3 was programmed with the same full- length miRNAs used in Fig. 2D, incubated with ISG20, and mixed with a cap-labeled target RNA containing a complementary sequence to each guide. Cleavage was observed only when FLAG-AGO3 was programmed with miR-20a and let-7a (FIG. 2L), demonstrating that ISG20 catalytically activates AGO3. DISCUSSION ISG20, TREX1, and ERI1 convert AGO-associated miRNAs to tyRNAs, which requires Mn²⁺, an essential transition metal for human health. Dysregulation of the cellular Mn²⁺ concentration has been implicated in neurodegenerative diseases, such as Parkinson’s disease, Alzheimer’s disease, Huntington’s disease, and manganism. Notably, the ISG20 level is elevated in neurodegenerative disease models and brain injury, while the malfunction of TREX1 causes autoimmune diseases such as Aicardi-Goutieres syndrome. Natural killer cells and T cells deficient in ERI1 enhance the RNAi. These results show a correlation between the Mn²⁺-dependent guide-trimming and neurodegenerative diseases. MATERIALS AND METHODS FLAG-AGOs used for in vitro assays were purified. Cloning, expression, and purification of recombinant proteins. Recombinant AGOs were purified from insect cells. Exonucleases, including ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, or EXO5, were cloned into a SUMO-fused pRSFDuet-1 vector (Novagen). Catalytic mutants were created from these constructs with site-directed mutagenesis, using PCR primers designed to anneal to the mutation site. PCR products were subsequently digested by DpnI (NEB) and WUDQVIRUPHG^ LQWR^ '+^Į^ E. coli cells (Invitrogen). All plasmids were verified by Sanger sequencing (OSU Shared Resources). Docket No.103361-353WO1 Exonuclease plasmids were transformed into BL21 Rosetta 2(DE3)pLysS E.coli cells (Novagen) for expression. Cells were harvested by centrifugation at 5,000 xg for 10 minutes at 4°C, then the remaining pellet was resuspended with Lysis Buffer (1x PBS, 500 mM NaCl, 40 P0^LPLGD]ROH^^^^^JO\FHURO^^^^^P0^ȕ-mercaptoethanol, and 1 mM PMSF) and lysed in a C3 homogenizer. After homogenization, cells were centrifuged at 23,000 rpm at 4°C, and the supernatant was loaded onto a 5 mL HisTrap HP Column (Cytiva) equilibrated with Nickel %XIIHU^ $^ ^^[^ 3%6^^ ^^^^ P0^ 1D&O^^ ^^^ P0^ ,PLGD]ROH^^ ^^^ *O\FHURO^^ DQG^ ^^^ P0^ ȕ- mercaptoethanol). The column was washed with Nickel Buffer A to remove non-specifically bound proteins. Exonucleases were eluted over a step-wise gradient to Nickel Buffer B (1x 3%6^^ ^^^^P0^1D&O^^ ^^^0^ ,PLGD]ROH^^ ^^^*O\FHURO^^ DQG^ ^^^P0^ ȕ-mercaptoethanol). The following fractions were taken for the step wise gradient: 2 x 10 mL fractions of 1% B, 2 x 10 mL 3%, 1 x 10 mL 4%, 1 x 5 mL 5%, 1 x 5 mL 6%, 1 x 5 mL 7%, 1 x 5 mL 8%, 1 x 5 mL 9%, 2 x 10 mL of 10%, 1 x 10 mL 100%. Eluted samples intended for tag- cleavage were digested with Ulp1 protease overnight during dialysis against Dialysis Buffer A (1x PBS, 500 mM NaCl, ^^^P0^ȕ-mercaptoethanol). Digested protein was loaded onto a 5 mL HisTrap HP Column (Cytiva) to remove cleaved SUMO tag, and the flow-through fraction was dialyzed overnight against Dialysis Buffer B (20 mM Tris-+&O^ S+^ ^^^^^ ^^^^ P0^ 1D&O^^ DQG^ ^^^ P0^ ȕ- mercaptoethanol). The dialyzed, tag-free exonucleases were concentrated by ultrafiltration and flash frozen in liquid nitrogen prior to storage at -80°C. In vitro trimming assay with exonucleases )RU^5,6&^DVVHPEO\^^^^^^0^RI^UHFRPELQDQW^)/$*-AGO1, 2, 3, and 4 were incubated for 1 hour at ^^^&^ZLWK^^^^0^RI^^ƍ^HQG-labeled 23-nt miR-20a, 21-nt let-7a, 22-nt miR-16, or 23-nt miR-19b in 1x Trimming Buffer (25 mM HEPES-KOH pH 7.5, 50 mM KCl, 5 mM DTT, 0.2 mM EDTA, 0.05 mg/mL BSA). The assembled RISC reactions were pulled down through a 2-hour incubation at room temperature with anti-FLAG M2 beads (Sigma Aldrich) that had been pre-washed twice with 1X PBS and 1X Trimming buffer. The beads were washed 8 times with IP wash buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, and 0.05% NP-40) and twice with 1x trimming buffer that included either 2 mM MnCl2 or MgCl2. For the trimming reaction, the beads were incubated with 500 pmol of recombinant exonuclease (ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, or EXO5) for 4 hours at 37°C. The beads were then washed with IP wash buffer 4 times, mixed with 2x urea quenching dye (8 M urea, 1 mM EDTA, 0.05% (w/v) xylene cyanol, 0.05% (w/v) bromophenol blue, 10% (v/v) phenol), and resolved on an 8 M urea 16% (w/v) polyacrylamide Docket No.103361-353WO1 gel. Images were analyzed by Typhoon Imaging System (GE Healthcare), quantified by Image Lab (Bio-Rad), and statistically analyzed using GraphPad Prism. In vitro trimming followed by in vitro cleavage assay with four miRNAs )RU^5,6&^DVVHPEO\^^^^^^0^recombinant FLAG-$*2^^ZDV^LQFXEDWHG^ZLWK^^^^0^RI^ 23-nt miR-20a, 21-nt let-7a, 22-nt miR-16, or 23-nt miR-19b in 1x Trimming Buffer for 1-hour at 37°C. The assembled RISC reactions were pulled down through a 2-hours incubation at room temperature with anti-FLAG M2 beads (Sigma Aldrich) that had bene pre-washed twice with 1X PBS and 1X Trimming buffer. The beads were then washed with IP wash buffer 8 times and twice with a 1x trimming buffer that included 2 mM MnCl2. For the trimming reaction, the beads were then incubated with 500 pmol of ISG20 for 4 hours at 37°C. The beads were then washed with IP wash buffer 8-times followed by two washes with 1x Reaction buffer (25 mM HEPES-KOH pH 7.5, 50 mM KCl, 5 mM DTT, 0.2 mM EDTA, 0.05 mg/mL BSA, 0.5 8^^/^5LERORFN^^5 mM MgCl2). For the cleavage reaction, 10 pmol of the spiked target of miR-20a, let-7a, miR-16, or miR-19b was added to the beads with 1X Reaction Buffer and incubated for 1 hour. The beads were mixed with 2X urea quenching dye. The cleavage products were loaded on an 8 M urea 16% (w/v) polyacrylamide gel. Images were analyzed by Typhoon Imaging System (GE Healthcare) and quantified by Image Lab (Bio-Rad). Cell culture HEK293T cells were grown in Dulbecco's modified Eagle's medium (DMEM) (Gibco) supplemented with 10% FBS (Gibco) at 37°C in 5% CO2 incubator. In vivo RNA stability assay The cells were transfected with 25 nM 5’ end labeled single-stranded 14-nt miR-20a, single- stranded 23-nt miR-20a, 14-nt siRNA-like miR-20a duplex, or 23-nt siRNA-like miR- 20a duplex. After a 48-hour transfection, the cells were lysed using 1X RIPA buffer (Cell 6LJQDOLQJ^7HFKQRORJ\^^FRQWDLQLQJ^^^P0^306)^DQG^LQFXEDWHG^ZLWK^^^^^^J^P/^SURWHLQDVH^.^ at 56°C for 1 hour. Total RNA was extracted using UltraPure™ Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) (InvitrogenTM) and precipitated with ethanol. The level of radioactivity of each sample was measured using scintillation counter and the samples adjusted to the same radioactivity were loaded on an 8 M urea 16% (w/v) polyacrylamide gels. Images were analyzed by Typhoon Imaging System (GE Healthcare). In vivo RNA degradation assay The cells were co-transfected with 25 nM 5’ end labeled 23-nt siRNA-like miR-20a GXSOH[^^DQG^^^^^J^RI^D^SODVPLG^ZKLFK^FRQWDLQHG^HLWKHU^)/$*-MBP or ISG20. After a 48-hour Docket No.103361-353WO1 transfection, the cells were lysed using 1X RIPA buffer (Cell Signaling Technology) containing 1 mM PMSF. Total RNA was extracted using UltraPure™ Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) (InvitrogenTM) and precipitated with ethanol. The level of radioactivity of each sample was measured using scintillation counter and the samples adjusted to the same radioactivity were loaded on an 8 M urea 16% (w/v) polyacrylamide gels. Images were analyzed by Typhoon Imaging System (GE Healthcare). In vivo trimming assay with exonucleases The cells were co-transfected with 25 nM 5’ end labeled 23-nt siRNA-like miR-20a GXSOH[^^^^^^J^RI^)/$*-$*2^SODVPLG^^DQG^^^^^J^RI^D^SODVPLG^ZKLFK^FRQWDLQHG^HLWKHU^)/$*- MBP or an exonuclease (ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, or EXO5). HEK293T cells were grown in DMEM media (Gibco) supplemented with 10% FBS (Gibco). The cells were co-transfected with 25 nM 5’ end labeled siRNA-like miR-^^D^GXSOH[^^^^^^J^RI^D^SODVPLG^RI^HLther FLAG-AGO plasmid, DQG^^^^^J^RI^D^SODVPLG^RI^ZKLFK^FRQWDLQHG^HLWKHU^)/$*-MBP or an either exonuclease (ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, or EXO5). After a 48-hours of the transfection, the cells were lysed using 1X RIPA buffer (Cell Signaling Technology) containing 1 mM PMSF. The cell lysate was incubated with anti-FLAG beads for the immunoprecipitation. The beads were washed 8-times with IP wash buffer (300 mM NaCl, 50 mM Tris-HCl pH 7.5, and 0.05% NP-40) and then mixed with 2X urea quenching dye. The cleavage products were loaded on an 8 M urea 16% (w/v) polyacrylamide gels. Images were analyzed by Typhoon Imaging System (GE Healthcare), quantified by Image Lab (Bio-Rad), and statistically analyzed using GraphPad Prism. The band intensities of tyRNAs (15 nt and shorter) were divided by those of the sum of tyRNAs and the full-length guide RNAs (18 - 23 nt). Western blot analysis The cells were co-transfected with 25 nM 23-nt siRNA-like miR-^^D^GXSOH[^^^^^^J^RI FLAG-$*2^ SODVPLG^^ DQG^ ^^^ ^J^ RI^ D^ SODVPLG^ ZKLFK^ FRQWDLQHG^ HLWKHU^ )/$*-MBP or an exonuclease (ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, or EXO5). Forty eight hours post-transfection, the cells were lysed using 1X RIPA buffer FRQWDLQLQJ^^^P0^306)^^7KH^^^^^^J^RI^WKH^ZKROH^FHOO^O\VDWH^ZDV^ORDGHG^RQWR^DQ^6'6-PAGE (Bolt^TM 4-12% Bis-Tris gel) and transferred to nitrocellulose membrane. The membranes were incubated with primary antibodies: anti-FLAG antibody (1:2,000, Sigma), anti-ISG20 antibody ^^^^J^P/^^3URWHLQWHFK^^^DQWL-TREX1 antibody (1:1,000, Thermo Fisher Scientific), anti-ERI1 Docket No.103361-353WO1 antibody (1:1,000, Proteintech), anti-PARN antibody (1:2,000, FORTIS), anti-EXO5 antibody ^^^^^ ^J^P/^^ $WODV^ $QWLERGLHV^^^ DQG^RU^ DQWL-alpha-WXEXOLQ^ DQWLERG\^ ^^^^^^^ ^J^P/^^ &HOO^ Signaling Technology), and secondary antibodies: anti-mouse or rabbit (1:15,000, LI-COR). The protein bands were visualized by Odyssey. Example 2: Design of cityRNA-Booster for RNAi (cyBR) cyBR is a pseudo hairpin RNA composed of a 14-nucleotide (nt) cityRNA and a Booster. Design of cyBR-20a 1. 14-nt single-stranded modified miR-20a (14-nt ssmd miR-20a) 11111 ^ ^ ^ ^ ^ ^ ^ ^ ^ 12345678901234 5’pUAAAGUGCUUAUAG (SEQ ID NO: 1) * The 5’ end of 14-nt miR-20a has a monophosphate group depicted as “p.” * The 14-nt miR-20a has the following modifications: 5'-P.mU.*.2'-F-A.mA.2'-F-A.mG.2'-F-U.mG.2'-F-C.mU.2'-F-U.mA.2'-F-U.*.mA.*.2'-F-G 3' Symbols for modifications 5'-P: 5'-Phosphate mA, mC, mG, mU: 2'-OMe RNA Bases (A, C, G, U) *: Phosphorothioate 2'-F-A: 2'-Fluoro-adenosine 2'-F-U: 2'-Fluoro-uridine 2'-F-C: 2'-Fluoro-cytidine 2'-F-G: 2'-Fluoro-guanosine 2.Booster-20a 5’GGGCCCGGGGUAACCCGGGCCCCUAUAAGCACUUUAAA3’ (SEQ ID NO: 2) * The underscored parts form a stem (FIG. 3). * The 5’-end has a hydroxyl group. 3. cyBR for miR-20a (cyBR-20a) (SEQ ID NO: 3) Docket No.103361-353WO1 Design of cyBR-7a 1. 14-nt single-stranded modified let-7a (14-nt ssmd let-7a) 11111 ^ ^ ^ ^ ^ ^ ^ ^ ^ 12345678901234 5’pugagguaguagguu (SEQ ID NO: 4) * The 5’ end of 14-nt let-7a has a monophosphate group depicted as “p.” * The 14-nt miR-20a has the following modifications. 5'-P.mU.*.2'-F-G.mA.2'-F-G.mG.2'-F-U.mA.2'-F-G.mU.2'-F-A.mG.2'-F-G.*.mU.*.2'-F-U 3' Symbols for modifications 5'-P: 5'-Phosphate mA, mC, mG, mU: 2'-OMe RNA Bases (A, C, G, U) *: Phosphorothioate 2'-F-A: 2'-Fluoro-adenosine 2'-F-U: 2'-Fluoro-uridine 2'-F-C: 2'-Fluoro-cytidine 2'-F-G: 2'-Fluoro-guanosine 2. Booster-7a 5’GGGCCCGGGGUAACCCGGGCCCAACCUACUACCUCAAA3’ (SEQ ID NO: 5) * The underscored parts form a stem (FIG.4). * The 5’-end has a hydroxyl group. 3. cyBR for let-7a (cyBR-7a) 11111111112222 ^ ^ ^ ^ ^ ^ ^ ^ ^ 12345678901234567890123 5’pUGAGGUAGUAGGUUGGGCCCGGGG ||||||||||||||||||||||| U 3’AAACUCCAUCAUCCAACCCGGGCCCAA

It will be apparent to those skilled in the art that various modifications and variations can be made in the present disclosure without departing from the scope or spirit of the invention. Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the methods disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

Claims

Docket No.103361-353WO1 CLAIMS What is claimed is: 1. A nucleic acid trimming system comprising a non-coding ribonucleic acid (non-coding RNA) and an exonuclease enzyme comprising interferon-stimulated gene 20 kDa (ISG20), WKUHH^SULPH^UHSDLU^H[RQXFOHDVH^^^^75(;^^^^RU^(5,^^^HQKDQFHG^51$L^^DOVR^NQRZQ^DV^^ƍK([R^, wherein the exonuclease enzyme targets and trims the non-coding RNA and wherein the system generates a tiny RNA (tyRNA) from the non-coding RNA. 2. The system of claim 1, wherein the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). 3. The system of claim 1 or 2, wherein the system further comprises an Argonaute (AGO) protein. 4. The system of any one of claims 1-3, wherein the exonuclease and the AGO protein stabilize the non-coding RNA. 5. The system of claim 3 or 4, wherein the AGO comprises AGO1, AGO2, AGO3, or AGO4. 6. The system of any one of claims 1-5, wherein the non-coding RNA comprises at least 19 nucleotides. 7. The system of any one of claims 1-6, wherein the tyRNA comprises less than 19 nucleotides. 8. The system of any one of claims 1-7, wherein the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. 9. The system of any one of claims 1-8, wherein said system requires a manganese (Mn) ion. 10. The system of claim 9, wherein the Mn ion comprises Mn²⁺. Docket No.103361-353WO1 11. A method of regulating a target nucleic acid using a nucleic acid trimming system comprising a non-coding RNA and an exonuclease enzyme the method comprising: a. exposing the non-coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into a tyRNA; and b. exposing the tyRNA to the target nucleic acid; wherein the tyRNA increases or decreases expression of the target nucleic acid relative to a control nucleic acid. 12. The method of claim 11, wherein the exonuclease comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also NQRZQ^DV^^ƍK([R^^ 13. The method of claim 11 or 12, wherein the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). 14. The method of any one of claims 11-13, wherein the system further comprises an Argonaute (AGO) protein. 15. The method of any one of claims 11-14, wherein the exonuclease and AGO protein stabilize the non-coding RNA. 16. The system of claim 14 or 15, wherein the AGO comprises AGO1, AGO2, AGO3, or AGO4. 17. The method of any one of claims 11-16, wherein the non-coding RNA comprises at least 19 nucleotides. 18. The method of any one of claims 11-17, wherein the tyRNA comprises less than 19 nucleotides. 19. The method of any one of claims 11-18, wherein the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. Docket No.103361-353WO1 20. The method of any one of claims 11-19, wherein the target nucleic acid comprises DNA or RNA. 21. The method of any one of claims 11-20, wherein said system requires a manganese (Mn) ion. 22. The method of claim 21, wherein the Mn ion comprises Mn²⁺. 23. method of treating a neurodegenerative disease or an autoimmune disease in a subject in need thereof, the method comprising administering the nucleic acid trimming system of any one of claims 1-10, a cell expressing the nucleic acid trimming system of any one of claims 1- 10, or a therapeutic composition comprising the tyRNA of any one of claims 1-10, wherein the tyRNA increases or decreases expression of a target nucleic acid relative to a reference control. 24. The method of claim 23, wherein the nucleic acid trimming system, the cell, or the therapeutic composition is administered with a pharmaceutically acceptable carrier comprising an excipient, a diluent, a salt, a buffer, a stabilizer, a lipid, an emulsion, or a nanoparticle. 25. The method of claim 23 or 24, wherein the neurodegenerative disease or the autoimmune disease affects expression of the target nucleic acid. 26. The method of any one of claims 23-25, wherein the neurodegenerative disease comprises Parkinson’s disease, Alzheimer’s disease, Huntington disease, or manganism. 27. The method of any one of claims 23-26, wherein the autoimmune disease comprises Aicardi-Goutieres syndrome, rheumatoid arthritis, systemic lupus erythematosus, multiple sclerosis, Guillain-Barre syndrome, psoriasis, Graves’ disease, myasthenia gravis, or scleroderma. 28. The method of any one of claims 23-27, wherein the target nucleic acid comprises DNA or RNA. Docket No.103361-353WO1 29. A kit for generating a tiny RNA (tyRNA), the kit comprising: a. an exonuclease enzyme, and b. a non-coding RNA; wherein the exonuclease enzyme trims the non-coding RNA. 30. The kit of claim 29, wherein the exonuclease comprises interferon-stimulated gene 20 kDa (ISG20), three prime repair exonuclease 1 (TREX1), or ERI1 (enhanced RNAi, also NQRZQ^DV^^ƍK([R^^ 31. The kit of claim 29 or 30, wherein the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non-codingRNA (long ncRNA). 32. The kit of any one of claims 29-31, further comprising an Argonaute (AGO) protein. 33. The kit of claim 32, wherein the AGO comprises AGO1, AGO2, AGO3, or AGO4. 34. The kit of any one of claims 29-33, wherein the non-coding RNA comprises at least 19 nucleotides. 35. The kit of any one of claims 29-34, wherein said kit generates tyRNA comprising less than 19 nucleotides. 36. The kit of any one of claims 29-35, wherein said kit generates tyRNA comprising 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. 37. The kit of any one of claims 29-36, wherein the kit further comprises a manganese (Mn) compound selected from manganese (II) chloride, manganese (II) sulfate, manganese (II) oxide, manganese (II) sulfide, or variants thereof. 38. The kit of any one of claims 29-37, wherein the exonuclease enzyme, the non-coding RNA, the AGO protein, or the manganese compound are lyophilized, flash frozen with liquid nitrogen (N₂), or stored in a buffered solution. Docket No.103361-353WO1 39. The kit of claim 38, wherein the buffered solution comprises water, saline, a phosphate buffered saline, or a Tris buffered saline. 40. The kit of any one of claims 29-39, wherein said kit is used to regulate expression of a target nucleic acid. 41. The kit of claim 40, wherein the target nucleic acid comprises DNA or RNA. 42. A method of screening one or more exonuclease enzymes for a nucleic acid trimming system, the method comprising: a. expressing or isolating the one or more exonuclease enzymes from a biological sample, b. loading a non-coding ribonucleic acid (non-coding RNA) onto an Argonaute (AGO) protein, c. exposing the non-coding RNA to the exonuclease enzyme, wherein the exonuclease enzyme targets and trims the non-coding RNA into a tyRNA, and d. incorporating at least one of the exonuclease enzymes into the nucleic acid trimming system when the tyRNA comprises less than 19 nucleotides. 43. The method of claim 42, wherein the tyRNA comprises 10, 11, 12, 13, 14, 15, 16, 17, or 18 nucleotides. 44. The method of claim 42 or 43, wherein the one or more exonuclease enzymes comprise ISG20, ISG20 D11N/D94N, TREX1, TREX1 D200N, ERI1, ERI1 D234A, PARN, PARN D28A, EXO5, or variants thereof. 45. The method of any one of claims 42-44, wherein the non-coding RNA comprises microRNA (miRNA), siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, or long non- codingRNA (long ncRNA). 46. The method of any one of claims 42-45, wherein the AGO protein comprises AGO1, AGO2, AGO3, or AGO4. Docket No.103361-353WO1 47. The method of any one of claims 42-46, wherein the biological sample comprises an expression vector or a cell.