WO2024044329A1 - Éditeur de bases crispr - Google Patents

Éditeur de bases crispr Download PDF

Info

Publication number
WO2024044329A1
WO2024044329A1 PCT/US2023/031071 US2023031071W WO2024044329A1 WO 2024044329 A1 WO2024044329 A1 WO 2024044329A1 US 2023031071 W US2023031071 W US 2023031071W WO 2024044329 A1 WO2024044329 A1 WO 2024044329A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
protein
cas
acid sequence
seq
Prior art date
Application number
PCT/US2023/031071
Other languages
English (en)
Inventor
Yan Zhang
David R. Liu
Xin D. GAO
Kevin T. ZHAO
Zhonggang HOU
Original Assignee
The Regents Of The University Of Michigan
The Broad Institute, Inc.
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of Michigan, The Broad Institute, Inc., President And Fellows Of Harvard College filed Critical The Regents Of The University Of Michigan
Publication of WO2024044329A1 publication Critical patent/WO2024044329A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04001—Cytosine deaminase (3.5.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04002—Adenine deaminase (3.5.4.2)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP).
  • the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence.
  • a first Cas protein e.g., Cas5-8 or Cas11
  • an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein
  • gRNA guide RNA
  • the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • BE Leading base editors
  • PAM protospacer adjacent motif
  • the present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP).
  • the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence.
  • a first Cas protein e.g., Cas5-8 or Cas11
  • an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein
  • gRNA guide RNA
  • the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • a target nucleic acid sequence comprising: an engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- CRISPR associated (Cas) (CRISPR-Cas) system, and/or one or more nucleic acids encoding the engineered CRISPR-Cas system
  • the engineered CRISPR-Cas system comprises: a) a first Cas protein, wherein the first Cas protein is optionally selected from the group consisting of: Cas5, Cas6, Cas7, Cas8, or Cas11; b) an effector protein which is optionally tethered or fused to the first Cas protein, wherein the effector protein comprises: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide) protein
  • CRISPR-Cas Clustered Regularly Interspaced
  • the one or more nucleic acids comprises one or more messenger RNAs, one or more vectors, or a combination thereof.
  • the first Cas protein, the effector protein, and the second Cas protein are encoded by a single nucleic acid.
  • the first Cas protein, the effector protein, and the second Cas protein are encoded by different nucleic acids.
  • the guide RNA is encoded by a different nucleic acid than the first Cas protein, the effector protein, and the second Cas protein.
  • the guide RNA, the first Cas protein, the effector protein, and the second Cas protein are encoded by a single nucleic acid.
  • the first Cas protein is selected from the group consisting of: Cas5, Cas6, Cas7, and Cas8 or Cas11.
  • the engineered CRISPR-Cas system is derived from a Type I CRISPR-Cas system.
  • the Type I CRISPR-Cas system is a Type I-B, a Type I-C, or a Type I-D system.
  • the at least one gRNA is encoded in a CRISPR RNA (crRNA) array.
  • the at least one gRNA comprises a non-naturally occurring gRNA.
  • the system further comprises at least one target nucleic acid.
  • the system is a cell free system.
  • compositions comprising any of the systems described above or herein.
  • provided herein is a eukaryotic cell comprising any of the systems above or herein.
  • methods of altering a target nucleic acid sequence comprising: contacting a target nucleic acid sequence with any one of the systems or compositions described above or herein.
  • altering a target nucleic acid sequence comprises changing an A/T pair to a G/C pair, or changing a G/C pair to an A/T pair, in the target nucleic acid sequence.
  • the target nucleic acid sequence encodes a gene product with a disease or condition causing single nucleotide polymorphism.
  • the target nucleic acid sequence is in a cell.
  • the cell is a eukaryotic cell (e.g., mammalian cell or human cell).
  • the target nucleic acid sequence is a genomic DNA sequence.
  • contacting a target nucleic acid sequence comprises introducing the system into the cell.
  • introducing the system into the cell comprises administering the system to a subject (e.g., human subject).
  • the administering comprises in vivo administration.
  • the administering comprises transplantation of ex vivo treated cells comprising the system.
  • FIG. 1 A schematic depicting a novel adenine base editing platform derived from the multi-subunit Cas moiety of Nla type I-C CRISPR-Cas system.
  • a single-stranded DNA specific adenine deaminase (TadA* from ABE8e [Richter et al, NBT 2020, PMID: 32433547]) is fused to a subunit of the Cascade target-recognition Attorney Docket No. UM-41218.601 complex.
  • Cascade is directed by CRISPR RNA (crRNA) to bind PAM-flanked target sequence, bringing TadA* closer to modify nearby accessible adenine residues.
  • crRNA CRISPR RNA
  • a helicase-defective but nuclease-intact Cas3 variant serves as a nickase (nCas3) that cleaves non-target strand (NTS) DNA, tricking human cells to use the opposing target strand (TS) as template in DNA repair to copy inosine intermediate thereby leading to robust TS base editing.
  • NTS non-target strand
  • TS opposing target strand
  • B In vitro DNA cleavage assay showing that in the absence of ATP, wild-type (wt) Cas3 is converted into nCas3 that nicks the NTS but not TS DNA.
  • C Schematics of plasmids used to express all Nla Type I-C components in human cells.
  • Human codon optimized cas5, cas7, cas8, cas11, and cas3 genes are driven from EF1 ⁇ promoters, each has a tethered nuclear localization signal (NLS) and HA epitope tag.
  • CRISPR RNA is expressed from a R-S-R array containing two CRISPR repeats and one spacer, driven by a U6 promoter.
  • FIG. D Schematics of all TadA* fusion configurations analyzed. TadA* is tethered to N- or C- termini of each Cascade subunit.
  • E TadA* tethering to all possible Cascade subunit termini can be tolerated to varying degree, in traditional gene deletion assay with wt CRISPR-Cas3.
  • Cascade-TadA* fusions shown in (D) were assayed in a HAP1- GFP reporter cell line, for their abilities to support large gene deletion, with wt Cas3 and a GFP-targeting crRNA. Gene targeting efficiencies were shown on the Y-axis, as the percentage of EGFP negative cells in the total population. [015] Figure 2.
  • A-C Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions, in conjunction with helicase-deficient nCas3 (D392A), on various genomic sites AAVS1-EGFP in HAP1 cells (A), HIRA (B) and HPRT1 (C) in HEK293T cells. Plasmids encoding all components were transfected into HAP1-EGFP reporter cell line or HEK293T cells.
  • Nla-IC-ABE Define the base editing window for Nla-IC-ABE in human cells.
  • B Results from the 10 target sites shown in (A) were plotted together into a bar graph.
  • X-axis target site nucleotide (nt) positions; Y-axis, normalized A•T-to-G•C editing efficiencies.
  • data for each nt position were normalized relative to the position with the highest editing value, which was set to 100%.
  • Data are mean +/- standard deviation (SD)
  • Data in B was smoothened by fitting to a normal distribution.
  • D Schematic illustration of the editing window (blue box) defined for Nla Type I-ABE. Red box denotes the upstream 5’-TTC PAM. Note: Nla Type I-ABE enabled a distinct window on TS DNA downstream of CRISPR-matched sequence.
  • HBB S and HBB G are shown at the top and bottom, respectively.
  • the pathogenic variant A to be corrected is located at position 43 nt downstream of the 5’-TTC PAM (marked in red).
  • the resulting G after A-to-G conversion was shown in blue.
  • Ex vivo editing of patient hematopoietic stem and progenitor cells (HSPCs) using such a Nla Type I-ABE strategy would offer accessible cure to SCD patients.
  • HSPCs patient hematopoietic stem and progenitor cells
  • Example 2 Correcting W138X mutation in the CTNS gene, which is the underlying cause of rare disease cystinosis.
  • the targeted region of W138X and wt alleles are shown at the top and bottom, respectively.
  • the pathogenic target A at position 41 nt downstream of the 5’-TTC PAM was indicated in red.
  • Patient HSPCs that are ex vivo edited and transduced back would populate all tissue compartments, reduce cystine level and restore normal cellular functions in most diseased organs and cells.
  • the SCD HBB S and CTNS W138X alleles remained inaccessible to base editing until very recently, when the Cas9 NRCH variant was invented via phage-assisted continuous Attorney Docket No. UM-41218.601 evolution to recognize altered PAM specificity (3’-NGG to 3’-NRCH [Miller et al., NBT 2020. PMID: 32042170]).
  • FIG. 1 Tunable editing window achieved using a “guide-length variation” strategy.
  • A Schematics of the guide-length variation strategy. By shortening or elongating the length of crRNA spacer (i.e., guide) sequence in 3-nt increments, we can remodel the overall Nla Cascade architecture and thereby freely slide the editing window over the target region.
  • B Heatmap representation of base editing positions and efficiencies achieved on a GFP target site for Nla Type I-ABE, using CRISPR guides ranging from 23 to 65 nts. Experiments were performed in HAP1-EGFP reporter cells. The PAM (in red) and target sequence are shown at the bottom, with positions of adenines labeled on TS DNA.
  • the wt guide length is 35 nts, further truncations or elongations occur at its 3’ end.
  • C Northern blots showing increasing lengths of mature crRNAs for Nla Type I-ABE in human cells, as the guide/spacer encoded in the R-S-R CRISPR array construct changes from 23 to 65 nts. Note: 35 nt is the wt spacer length.
  • Total RNAs were extracted from human cells transfected with Nla Type I-ABE-encoding plasmids and subjected to 15% denaturing PAGE and northern blot analysis, probing for mature crRNA (anti-repeat probe, top) and 5S rRNA as the loading control (bottom). [019] Figure 6.
  • Nla Type I-ABE mediated base editing on targets with canonical PAM and non- canonical PAM variants.
  • Nla I-C CRISPR-Cas system i.e., Nla Cascade-Cas3 without TadA* fusion
  • Nla Cascade-Cas3 without TadA* fusion
  • Nla Cascade-Cas3 elicits robust gene targeting activity with its consensus PAM
  • 5’-CTC consensus PAM
  • non-canonical PAM variants 5’-CTC, TCC, TTG and TTT.
  • PAM specificity for Nla Type I-ABE by assaying base editing on dozens of genomic target sites flanked by canonical (A) and non-canonical (B) PAMs.
  • B-C Heatmap representations of A•T to G•C edits achieved by different Cascade-TadA* fusions without nCas3, on genomic target sites in HIRA (B) and HPRT1 (C) genes in HEK293T cells.
  • B HIRA
  • C HPRT1
  • TS DNA nicking by H840A nickase Cas9 is a viable strategy to enhance base conversion efficiency of Cascade-TadA* in its NTS editing window.
  • A A schematic depicting the 5’-TTC PAM (in red), CRISPR-target site (in grey), and nicking positions of the nCas9 used. Five different guides for nCas9 are cleaving at 68-, 100-, 122- nts downstream or 47-, and 83- nts upstream of the 1 st nt of the Nla target, respectively.
  • H840A nCas9 directed by its sgRNA to nick TS DNA in the close vicinity. These TS nicking events would cause human cells to use the opposing NTS as template in DNA repair to copy the inosine intermediates created by Cascade-TaA*, thereby enhancing NTS edits and diminishing TS edits.
  • B Heatmap representation of A•T to G•C editing positions and efficiencies achieved by Cascade (via Attorney Docket No. UM-41218.601 Cas11)-TadA* fusion, in conjunction with H840A nCas9.
  • A Schematics of various Type I CRISPR-Cas systems utilized, including a I-B locus from cyanobacteria Synechocystis (Syn), the Bacillus halodurans (Bha) I-C, Thermobifida fusca (Tfu) I-E, Pseudomonas aeruginosa (Pae) I-F and Thioalkalivibrio sulfidiphilus (Tsu) I-G systems.
  • Cas loci right, R-S-R CRISPR array used with the actual repeat sequence and lengths of spacers and repeats indicated.
  • B-F Heatmap representations of A•T to G•C editing positions and efficiencies achieved by Syn I-B (5’-ATG PAM), Bha I-C (5’-TTC PAM), Tfu I-E (5’-AAG PAM), Pae I-F (5’-CC PAM) and Tsu I-G (5’-TTC PAM) based Type I-ABE platforms.
  • APOBEC is tethered to the N- or C- terminus of Cas11, whereas a 2X Uracil Glycosylase Inhibitor (UGI) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. (B-C).
  • Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with C•G-to-T•A edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all cytosines relative to PAM (-1) labeled. Overall, Type IC-CBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. It is Attorney Docket No. UM-41218.601 important to include the 2xUGI fusion on Cas5 because this led to significant increases of the C•G-to-T•A editing efficiencies.
  • tadCBE is tethered to the C- terminus of Cas11, whereas a 2X Uracil Glycosylase Inhibitor (UGI) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C.
  • B Heatmap representations of C•G to T•A edits achieved by Cas11-tadCBE fusion, in conjunction with nCas3 (D392A) and Cas5-2xUGI, on genomic target sites for HPRT1-guide 7 in HEK293T cells.
  • Plasmids encoding all individual components were co-transfected into HEK293T cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with C•G-to-T•A edits at a specific nt location. Sequences of the target region and PAM (in red) are shown at the bottom, with positions of all cytosines relative to PAM (-1) labeled. Overall, Type IC-CBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE. It is important to include the 2xUGI fusion on Cas5 because this led to significant increases of the C•G-to-T•A editing efficiencies.
  • Type IC-CGBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE.
  • Figure 14 Developing Nla type I-C CRISPR-Cas into A to Y base editor (AYBE) in human cells using tadA* and MPGv3.
  • A Schematics of the AYBE constructs used.
  • tadA* is tethered Attorney Docket No. UM-41218.601 to the C- terminus of Cas11 just like regular type I-C ABE.
  • a mutant version of human MPG (MPGv3) is fused to the C- terminus of Cas5. All other crispr-cas-encoding constructs are the same as depicted in Fig 1C. B.
  • Type IC-AYBE exhibited a similar trend in terms of editing window positions, compared to Type IC-ABE.
  • Figure 15 Experimental evidence of the therapeutic potential of Nla Type I-ABE. Exemplary Nla Type I-ABE components, in DNA, RNA, or ribonucleoproteins (RNP) format are shown. Shown here are two example generation of beneficial mutations.
  • A Example 1: Knocking out PCSK9 expression in hepatocytes by mutating the splice junction site that leads to exon skipping. A recent report showed durable LDL cholesterol reductions in primates following one single treatment with PCSK9 Cas9-base editor (PMID: 34012082).
  • the targeted region and guide sequence used are shown.
  • the ‘A’ to be mutated which is critical for normal mRNA splicing, is located at position 44 nt downstream of the 5’-TTC PAM (marked in red).
  • the exemplary gene therapy product is in vivo base editing of patient hepatocytes using this and other similar Nla Type I-ABE strategies to achieve PCSK9 knock down.
  • the clinical goal is that patients with uncontrolled high cholesterol experience significant durable reduction of blood cholesterol level.
  • (B) 15% intended PCSK9 A-to-G editing is achieved using Type I-ABE in HepG2 cells.
  • Plasmids encoding all individual components were co-transfected into HepG2 cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to G•C edits at A44 location either with or without puromycin selection.
  • Cas11-tadA* plasmid contains a puromycin resistant cassette for selection after transfection to enrich for cells with transfected plasmids.
  • C Example 2: Knocking out ASGR1 expression in hepatocytes by mutating the splice junction site that leads to exon skipping. The targeted region and guide sequence used are shown.
  • the ‘A’ to be mutated that is critical for mRNA splicing, is located at position 45 nt downstream of the 5’-TTC PAM (marked in red).
  • the envisioned gene therapy product is in vivo base editing of patient hepatocytes using this and other similar Nla Type I-ABE strategies to achieve ASGR1 knock down.
  • the clinical goal is that patients exhibit Attorney Docket No. UM-41218.601 reduce low-density lipoprotein (LDL)-cholesterol and coronary artery disease risk. (D).
  • Plasmids encoding all individual components were co-transfected into HepG2 cells, and base conversion efficiencies measured via amplicon sequencing NGS and plotted as the percentage of total reads with A•T to G•C edits at a A45 location either with or without puromycin selection.
  • Cas11-tadA* plasmid contains a puromycin resistant cassette for puromycin selection after transfection to enrich for cells with transfected plasmids.
  • Figure 16 Further engineering NlaCas3 nickase to decrease its indel formation in base editing applications.
  • A Cartoon showing the NlaCas3 domain architecture. Important helicase motifs and potentially critical residues for the NlaCas3’s helicase activity are indicated.
  • plasmids encoding all individual components of WT Nla-IC Cascade targeting either EGFP-G1 along with different versions of Cas3 were co-transfected into HAP1EGFP reporter cells.
  • the GFP negative cell percentage was measured via flow cytometry 4 days after transfection.
  • the 5% GFP disruption by single mutant nCas3 (M1) was likely caused by its residual helicase activity that causes smaller deletions or insertions (indels); and is further reduced to 2% in M6, reflecting further mitigation of helicase activities.
  • C To confirm findings from B, we directly measured indel formation by deep sequencing in a base editing experiment using a target site that gave relatively high indel formation for M1 base editing.
  • M6 Cas3 nickase still maintained high capacity for supporting base editing activity. Only a modest drop from ⁇ 60% to 45% was observed in base editing activity when comparing M6 to M1.
  • Plasmids encoding all individual components of Nla- IC-BE targeting HPRT1-G7 were co-transfected into HEK293T cells, and indel formation and base conversion efficiencies measured via amplicon sequencing NGS and calculated as the percentage of total reads with indel or A•T-to-G•C edits at a specific nt location. The highest base conversion efficiency is shown.
  • the present invention relates to systems, compositions, and methods for altering nucleic acids, such as at a single position (e.g., A/T to G/C or G/C to A/T; in a gene with disease causing SNP).
  • the present invention relates to engineered CRISPR/Cas systems comprising: a first Cas protein (e.g., Cas5-8 or Cas11) which is optionally tethered or fused to an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein; and at least one guide RNA (gRNA) configured to hybridize to a portion of a target nucleic acid sequence.
  • a first Cas protein e.g., Cas5-8 or Cas11
  • an effector protein selected from: i) an adenine deaminase, ii) a uracil glycosylase inhibitor, or iii) an APOBEC protein
  • gRNA guide RNA
  • the systems further comprise a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • a second Cas protein selected from: i) Cas3, ii) a helicase- deficient Cas3; or iii) a single-strand nicking Cas endonucleases (e.g., Cas9 Nickase H840A Protein).
  • Type I CRISPR-Cas is the most widespread and diversified type of bacteria adaptive immune system. It can be further classified into eight subtype (I-A through I-F, I-Fv, and I-U) based on their cas gene composition.
  • Type I CRISPR system uses an RNA-guided multi-subunit complex called Cascade to find DNA target site, and then recruits a helicase-nuclease enzyme, Cas3, to travel along and degrade target DNA over a long distance with high processivity.
  • Cascade RNA-guided multi-subunit complex
  • Cas3 helicase-nuclease enzyme
  • nucleic acid or a “nucleic acid sequence” refers to a polymer or oligomer of pyrimidine and/or purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub.1982)).
  • the present technology contemplates any deoxyribonucleotide, ribonucleotide, or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated, or glycosylated forms of these bases, and the like.
  • the polymers or oligomers may be heterogenous or homogenous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced.
  • the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
  • a nucleic acid or nucleic acid sequence comprises other kinds of nucleic acid structures such as, for instance, a DNA/RNA helix, peptide nucleic acid (PNA), morpholino nucleic acid (see, e.g., Braasch and Corey, Biochemistry, 41(14): 4503-4510 (2002)) Attorney Docket No.
  • LNA locked nucleic acid
  • cyclohexenyl nucleic acids see Wang, J. Am. Chem. Soc., 122: 8595- 8602 (2000), and/or a ribozyme.
  • nucleic acid or “nucleic acid sequence” may also encompass a chain comprising non-natural nucleotides, modified nucleotides, and/or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”); further, the term “nucleic acid sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double-stranded, and represent the sense or antisense strand.
  • nucleic acid refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • complementary refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base-paring or other non-traditional types of pairing.
  • the degree of complementarity between two nucleic acid sequences can be indicated by the percentage of nucleotides in a nucleic acid sequence which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • Two nucleic acid sequences are “perfectly complementary” if all the contiguous nucleotides of a nucleic acid sequence will hydrogen bond with the same number of contiguous nucleotides in a second nucleic acid sequence.
  • Two nucleic acid sequences are “substantially complementary” if the degree of complementarity between the two nucleic acid sequences is at least 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%.97%, 98%, 99%, or 100%) over a region of at least 8 nucleotides (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides), or if the two nucleic acid sequences hybridize under at least moderate, preferably high, stringency conditions.
  • 60% e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%.97%, 98%, 99%, or 100%
  • at least 8 nucleotides e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides
  • Exemplary moderate stringency conditions include overnight incubation at 37° C in a solution comprising 20% formamide, 5 ⁇ SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 ⁇ Denhardt’s solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 ⁇ SSC at about 37-50° C, or substantially similar conditions, e.g., the moderately stringent conditions described in Sambrook et al., infra.
  • High stringency conditions are conditions that use, for example (1) low ionic strength and high temperature for washing, such as 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate (SDS) at 50° C, (2) employ a denaturing agent during hybridization, such as formamide, for example, 50% (v/v) Attorney Docket No.
  • BSA bovine serum albumin
  • PVP polyvinylpyrrolidone
  • percent sequence identity refers to the percentage of nucleotides or nucleotide analogs in a nucleic acid sequence, or amino acids in an amino acid sequence, that is identical with the corresponding nucleotides or amino acids in a reference sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity.
  • additional nucleotides in the nucleic acid, that do not align with the reference sequence are not taken into account for determining sequence identity.
  • Methods and computer programs for alignment are well known in the art, including BLAST, Align 2, and FASTA.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (e.g., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid.
  • Hybridization methods involve the annealing of one nucleic acid to another, complementary nucleic acid, e.g., a nucleic acid having a complementary nucleotide sequence.
  • a nucleic acid having a complementary nucleotide sequence The ability of two polymers of nucleic acid containing complementary sequences to find each other and “anneal” or “hybridize” through base pairing interaction is a well-recognized phenomenon.
  • the initial observations of the “hybridization” process by Marmur and Lane, Proc. Natl. Acad. Sci. USA, 46: 453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA, 46: 461 (1960), have been followed by the refinement of this process into an essential tool of modern biology.
  • a “double-stranded nucleic acid” may be a portion of a nucleic acid, a region of a longer nucleic acid, or an entire nucleic acid.
  • a “double-stranded nucleic acid” may be, e.g., without limitation, a double-stranded DNA, a double-stranded RNA, a double-stranded DNA/RNA hybrid, etc.
  • a single-stranded nucleic acid having secondary structure e.g., base-paired secondary structure
  • higher order structure e.g., a stem-loop structure
  • triplex structures are considered to be “double-stranded.”
  • any base-paired nucleic acid is a “double-stranded nucleic acid.”
  • the term “gene” refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide, or a precursor of any of the foregoing.
  • RNA or polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
  • a “gene” refers to a DNA or RNA, or portion thereof, that encodes a polypeptide or an RNA chain that has functional role to play in an organism.
  • genes include regions that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences.
  • a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites, and locus control regions.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild-type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene.
  • mutant refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild- type gene or gene product. [044] As used herein, the term “variant” refers to the exhibition of qualities that have a pattern that deviates from what occurs in nature. In some embodiments, a variant may also be a mutant. Attorney Docket No.
  • nucleic acid molecules or polypeptides mean that the nucleic acid molecule or the polypeptide is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • peptide polypeptide
  • protein protein are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • Binding refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be “associated” or “interacting” or “binding” (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner).
  • Binding interactions are generally characterized by a dissociation constant (Kd) of less than 10 –6 M, less than 10 –7 M, less than 10 –8 M, less than 10 –9 M, less than 10 –10 M, less than 10 –11 M, less than 10 –12 M, less than 10 –13 M, less than 10 –14 M, or less than 10 –15 M.
  • Kd dissociation constant
  • Affinity refers to the strength of binding, increased binding affinity being correlated with a lower Kd.
  • binding domain it is meant a protein domain that is able to bind non-covalently to another molecule.
  • a binding domain can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein binding protein).
  • a DNA-binding protein a DNA-binding protein
  • RNA-binding protein an RNA-binding protein
  • a protein molecule a protein binding protein binding protein.
  • a protein domain-binding protein it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.
  • Recombinant means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and/or ligation steps resulting in a construct having a structural coding or non-coding sequence distinguishable from endogenous nucleic acids found in natural systems.
  • DNA sequences encoding polypeptides can be assembled from cDNA fragments or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free transcription and translation system.
  • Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of Attorney Docket No. UM-41218.601 non-translated DNA may be present 5’ or 3’ from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms). Alternatively, DNA sequences encoding RNA (e.g., DNA-targeting RNA) that is not translated may also be considered recombinant.
  • the term “recombinant” nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention.
  • This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a codon encoding the same amino acid, a conservative amino acid, or a non- conservative amino acid. Alternatively, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
  • a recombinant polynucleotide encodes a polypeptide
  • the sequence of the encoded polypeptide can be naturally occurring (“wild type”) or can be a variant (e.g., a mutant) of the naturally occurring sequence.
  • the term “recombinant” polypeptide does not necessarily refer to a polypeptide whose sequence does not naturally occur.
  • a “recombinant” polypeptide is encoded by a recombinant DNA sequence, but the sequence of the polypeptide can be naturally occurring (“wild type”) or non-naturally occurring (e.g., a variant, a mutant, etc.).
  • a “recombinant” polypeptide is the result of human intervention but may be a naturally occurring amino acid sequence.
  • a “vector” or “expression vector” is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, e.g., an “insert,” may be attached or incorporated so as to bring about the replication of the attached segment in a cell.
  • a cell has been “genetically modified,” “transformed,” or “transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change.
  • the transforming DNA may or may not be integrated (covalently linked) into the genome of the cell.
  • the transforming DNA may be maintained on an episomal element such as a plasmid.
  • a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that Attorney Docket No. UM-41218.601 comprise a population of daughter cells containing the transforming DNA.
  • a “clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • a “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, patient may include either adults, juveniles (e.g., children), or infants. Moreover, patient may mean any living organism, preferably a mammal (e.g., humans and non-humans) that may benefit from the administration of compositions contemplated herein.
  • mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
  • non-mammals include, but are not limited to, birds, fish, and the like.
  • the mammal is a human.
  • contact refers to a state or condition of touching or of immediate or local proximity. Contacting a composition to a target destination, such as, but not limited to, an organ, tissue, cell, or tumor, may occur by any means of administration known to the skilled artisan.
  • a target destination such as, but not limited to, an organ, tissue, cell, or tumor
  • the terms “providing,” “administering,” and “introducing,” are used interchangeably herein and refer to the placement of the compositions of the disclosure into a subject by a method or route which results in at least partial localization of the composition to a desired site.
  • the compositions can be administered by any appropriate route which results in delivery to a desired location in the subject.
  • CRISPR/Cas system for altering a DNA sequence
  • crRNAs CRISPR RNAs
  • CRISPR locus Transcription of a CRISPR locus Attorney Docket No. UM-41218.601 produces a “pre-crRNA,” which is processed to yield crRNAs containing spacer-repeat fragments that guide effector nuclease complexes to cleave dsDNA sequences complementary to the spacer.
  • pre-crRNA Several different types of CRISPR systems are known, (e.g., type I, type II, or type III), and classified based on the Cas protein type and the use of a proto-spacer-adjacent motif (PAM) for selection of proto-spacers in invading DNA.
  • PAM proto-spacer-adjacent motif
  • RNA sequences necessary for CRISPR/Cas systems are referred to collectively as “guide RNA” (gRNA) or single guide RNA (sgRNA).
  • gRNA guide RNA
  • sgRNA single guide RNA
  • guide RNA single guide RNA
  • single guide RNA single guide RNA
  • synthetic guide RNA may refer to a nucleic acid sequence comprising a tracrRNA and a pre-crRNA array containing a guide sequence.
  • guide sequence guide
  • guide and “spacer,” are used interchangeably herein and refer to the nucleotide sequence within a guide RNA that specifies the target site.
  • Cascade CRISPR-Associated Complex for Anti-viral Defense
  • Cascade complex refers to a ribonucleoprotein complex comprised of multiple protein subunits (e.g., Cas proteins) used naturally in bacteria as a mechanism for nucleic acid-based immune defense.
  • the Cascade complex recognizes nucleic acid targets via direct base-pairing to guide RNA contained in the complex. Acceptance of target recognition by Cascade results in a conformational change which, in E. coli and other bacteria, recruits a protein component referred to as Cas3.
  • Cas3 may comprise a single protein unit which contains helicase and nuclease domains.
  • the engineered CRISPR-Cas system may be derived from a CRISPR-Cas system of any type or subtype.
  • the engineered CRISPR-Cas system is derived from a Type I CRISPR- Cas system.
  • Type I system is the most widespread and diversified type of CRISPR and is further classified into eight subtypes (I-A through I-F, I-Fv, and I-U) based on cas gene composition. For example, subtypes I-E and I-F lack the cas4 gene.
  • the Type I CRISPR-Cas system is a Type I-C system. Elements or sequences from any suitable Type I-C CRISPR-Cas system may be used in the context of the disclosed methods.
  • the system comprises Cas11, Cas3, Cas5, Cas7, and Cas8.
  • the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Neisseria species (e.g., Neisseria lactamica).
  • the genus Neisseria comprises many gram-negative ⁇ -proteobacteria that interact with eukaryotic hosts, but only two organisms, the gonococcus (Gc) and its close relative the meningococcus (Mc), are human pathogens, both of which colonize mucosal surfaces.
  • N many non-pathogenic Neisseria species also colonize the human nasopharynx, and among them N. lactamica is the most widely studied commensal bacterium.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Neisseria lactamica (Nla), or variants thereof. [062] N.
  • lactamica Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the N. lactamica Type I-C proteins.
  • the N. lactamica Type I-C proteins may be those as disclosed in International Patent Application No. PCT/US21/034165, incorporated herein by reference in its entirety.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 99 or SEQ ID NO: 100
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 102 or SEQ ID NO: 103
  • the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 105 or SEQ ID NO: 106
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 108 or SEQ ID NO: 109
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 111 or SEQ ID NO: 112.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 99 or SEQ ID NO: 100
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 102 or SEQ ID NO: 103
  • the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 105 or SEQ ID NO: 106
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 108 or SEQ ID NO: 109
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 111 or SEQ ID NO: 112.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences Attorney Docket No.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 101
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 104
  • the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 107
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 110
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 113.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 101
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 104
  • the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 107
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 110
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 113.
  • the Type I-C CRISPR-Cas system is derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Bacillus species (e.g., Bacillus halodurans (Bha)) system, or variants thereof.
  • Bacillus species e.g., Bacillus halodurans (Bha)
  • Bacillus Bacillus is a diverse group of spore-forming bacteria ubiquitous in the environment.
  • Bacillus anthracis the agent of anthrax, is the only obligate Bacillus pathogen in vertebrates.
  • Bacillus larvae, B lentimorbus, B popilliae, B sphaericus, and B thuringiensis are pathogens of specific groups of insects.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I-C system of Bacillus halodurans (Bha), or variants thereof.
  • Bacillus halodurans Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Bacillus halodurans Type I-C proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:156
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 150
  • the Cas8 (Csd1) protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 152
  • the Cas7 (Csd2) protein is encoded by Attorney Docket No.
  • UM-41218.601 a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 148, and a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 154.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 156
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 150
  • the Cas8 (Csd1) protein is encoded by the nucleic acid sequence of SEQ ID NO: 152
  • the Cas7 (Csd2) protein is encoded by the nucleic acid sequence of SEQ ID NO: 148
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 154.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 155
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 149
  • the Cas8 (Csd1) protein comprises the amino acid sequence of SEQ ID NO: 151
  • the Cas7 (Csd2) protein comprises the amino acid sequence of SEQ ID NO: 147
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 153.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 155
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 149
  • the Cas8 (Csd1) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 151
  • the Cas7 (Csd2) protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 147
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 153.
  • the Type I-C CRISPR-Cas system may be derived from CRISPR-Cas elements (e.g., Cascade-Cas3 proteins or variants thereof) from a Desulfovibrio species (e.g., Desulfovibrio vulgaris (Dvu)) system, or variants thereof.
  • Desulfovibrio is a genus of Gram-negative sulfate-reducing bacteria commonly found in aquatic environments.
  • the CRISPR- Cas system used in the context of the present disclosure is derived from the Type I-C system of Desulfovibrio vulgaris (Dvu), or variants thereof.
  • Desulfovibrio vulgaris Type I-C proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Desulfovibrio vulgaris Type I-C proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:168
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 160
  • the Cas8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 162
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 164
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 166.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 168
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 160
  • the Cas8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 162
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 164
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 166.
  • the invention is not limited to these exemplary sequences. Indeed, genetic sequences can vary between different strains, and this natural scope of allelic variation is included within the scope of the invention.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 167
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 159
  • the Cas8 protein comprises the amino acid sequence of SEQ ID NO: 161
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 163
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 165.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 167
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 159
  • the Cas8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 161
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 163
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 165.
  • the Type I CRISPR-Cas system is a Type I-B system.
  • the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cmx8.
  • the Type I CRISPR-Cas system is a Type I-D system. Elements or sequences from any suitable type I-D CRISPR-Cas system may be used in the context of the disclosed methods.
  • the system comprises Cas11, Cas3, Cas5, Cas6, Cas7, and Cas10. Attorney Docket No.
  • the Type I-B or Type I-D CRISPR-Cas system is derived from the cyanobacteria Synechocystis (Syn).
  • the primary strain of Synechocystis sp. is PCC6803.
  • the CRISPR-Cas system used in the context of the present disclosure is derived from the Type I system of Synechocystis sp. PCC6803, or variants thereof.
  • Synechocystis Type I CRISPR/Cas system proteins may comprise the wild-type amino acid sequence or variant having an amino acid sequence that is at least about 85% identical (e.g., about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100%) to the amino acid sequence of any protein of the Synechocystis Type I CRISPR/Cas system proteins.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO:130
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 126
  • the Cmx8 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 122
  • the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 120
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 123
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 128.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 130
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 126
  • the Cmx8 protein is encoded by the nucleic acid sequence of SEQ ID NO: 122
  • the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 120
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 123
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 128.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 129
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 125
  • the Cmx8 protein comprises the amino acid sequence of SEQ ID NO: 121
  • the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 119
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 124
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 127.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of Attorney Docket No. UM-41218.601 SEQ ID NO: 129
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 125
  • the Cmx8 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 121
  • the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 119
  • the Cas7 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 124
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 127.
  • the Cas3 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of 143
  • the Cas5 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 138
  • the Cas6 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 140
  • the Cas7 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 136
  • the Cas10 protein is encoded by a nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 134
  • a Cas11 protein is encoded by the nucleic acid sequence having at least 70% similarity to that of SEQ ID NO: 141.
  • the Cas3 protein is encoded by the nucleic acid sequence of SEQ ID NO: 143
  • the Cas5 protein is encoded by the nucleic acid sequence of SEQ ID NO: 138
  • the Cas6 protein is encoded by the nucleic acid sequence of SEQ ID NO: 140
  • the Cas7 protein is encoded by the nucleic acid sequence of SEQ ID NO: 136
  • the Cas10 protein is encoded by the nucleic acid sequence of SEQ ID NO: 134
  • the Cas11 protein is encoded by the nucleic acid sequence of SEQ ID NO: 141.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises the amino acid sequence of SEQ ID NO: 144
  • the Cas5 protein comprises the amino acid sequence of SEQ ID NO: 137
  • the Cas6 protein comprises the amino acid sequence of SEQ ID NO: 139
  • the Cas7 protein comprises the amino acid sequence of SEQ ID NO: 135
  • the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133
  • the Cas11 protein comprises the amino acid sequence of SEQ ID NO: 142.
  • the invention is not limited to these exemplary sequences.
  • the Cas3 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 144
  • the Cas5 protein comprises an amino acid sequence having at least 70% similarity to that of SEQ ID NO: 137
  • the Cas6 protein comprises the amino acid sequence having at least 70% similarity to that of SEQ ID NO: 139
  • the Cas7 protein comprises an amino acid sequence having at least Attorney Docket No. UM-41218.601 70% similarity to that of SEQ ID NO: 135
  • the Cas10 protein comprises the amino acid sequence of SEQ ID NO: 133
  • the Cas11 protein comprises an amino acid sequence of SEQ ID NO: 142.
  • Any of the proteins described herein may comprise one or more amino acid substitutions as compared to the corresponding wild-type protein.
  • An amino acid “replacement” or “substitution” refers to the replacement of one amino acid at a given position or residue by another amino acid at the same position or residue within a polypeptide sequence.
  • Amino acids are broadly grouped as “aromatic” or “aliphatic.” An aromatic amino acid includes an aromatic ring. Examples of “aromatic” amino acids include histidine (H or His), phenylalanine (F or Phe), tyrosine (Y or Tyr), and tryptophan (W or Trp).
  • Non- aromatic amino acids are broadly grouped as “aliphatic.”
  • “aliphatic” amino acids include glycine (G or Gly), alanine (A or Ala), valine (V or Val), leucine (L or Leu), isoleucine (I or He), methionine (M or Met), serine (S or Ser), threonine (T or Thr), cysteine (C or Cys), proline (P or Pro), glutamic acid (E or Glu), aspartic acid (A or Asp), asparagine (N or Asn), glutamine (Q or Gin), lysine (K or Lys), and arginine (R or Arg).
  • the amino acid replacement or substitution can be conservative, semi-conservative, or non- conservative.
  • the phrase “conservative amino acid substitution” or “conservative mutation” refers to the replacement of one amino acid by another amino acid with a common property.
  • a functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz and Schirmer, Principles of Protein Structure, Springer-Verlag, New York (1979)). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz and Schirmer, supra).
  • conservative amino acid substitutions include substitutions of amino acids within the sub-groups described above, for example, lysine for arginine and vice versa such that a positive charge may be maintained, glutamic acid for aspartic acid and vice versa such that a negative charge may be maintained, serine for threonine such that a free -OH can be maintained, and glutamine for asparagine such that a free -NH2 can be maintained.
  • “Semi-conservative mutations” include amino acid substitutions of amino acids within the same groups listed above, but not within the same sub-group. For example, the substitution of aspartic acid for asparagine, or asparagine for lysine, involves amino acids within the same group, but different sub-groups.
  • Non-conservative mutations involve amino acid substitutions between different groups, for example, lysine for tryptophan, or phenylalanine for serine, etc.
  • Attorney Docket No. UM-41218.601 The one or more nucleic acids encoding the engineered CRISPR-Cas system may be any nucleic acid including DNA, RNA, or combinations thereof.
  • the one or more nucleic acids comprise one or more messenger RNAs, one or more vectors, or any combination thereof.
  • Cas11 may be encoded by a vector, whereas the two or more additional Cas proteins may be encoded by one or more messenger RNA.
  • engineering the system for use in eukaryotic cells may involve codon- optimization or other modification (e.g., to include an appropriate nuclear localization signal (NLS) or purification tag).
  • NLS nuclear localization signal
  • changing native codons to those most frequently used in mammals allows for maximum expression of the system proteins in mammalian cells (e.g., human cells).
  • modified nucleic acid sequences are commonly described in the art as “codon-optimized,” or as utilizing “mammalian-preferred” or “human-preferred” codons.
  • the nucleic acid sequence is considered codon-optimized if at least about 60% (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98%) of the codons encoded therein are mammalian preferred codons.
  • engineering the CRISPR-Cas system involves incorporating elements of the native CRISPR array into the disclosed system.
  • the system and the nucleic acid disclosed herein may comprise at least one guide RNA (gRNA), wherein each gRNA is configured to hybridize to a target nucleic acid sequence.
  • the gRNA may be a crRNA or a crRNA/tracrRNA (e.g., single guide RNA, sgRNA) fusion.
  • gRNA and guide RNA refer to any nucleic acid comprising a sequence that determines the binding specificity of the CRISPR-Cas complex. In instances in which the system comprises two or more guide RNAs, each guide RNA may hybridize to a different target nucleic acid sequence.
  • target DNA sequence refers to a polynucleotide (nucleic acid, gene, chromosome, genome, etc.) to which a guide sequence (e.g., a guide RNA) is designed to have complementarity, wherein hybridization between the target sequence and a guide sequence promotes the formation of a CRISPR/Cas complex, provided sufficient conditions for binding exist.
  • a guide sequence e.g., a guide RNA
  • the target sequence and guide sequence need not exhibit complete complementarity, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
  • the system further comprises at least one target nucleic acid.
  • a target sequence may comprise any polynucleotide, such as DNA or RNA.
  • Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell.
  • Other suitable DNA/RNA Attorney Docket No. UM-41218.601 binding conditions e.g., conditions in a cell-free system are known in the art; see, e.g., Sambrook, referenced herein and incorporated by reference.
  • the target nucleic acid sequence may include a protospacer adjacent motif (PAM).
  • a PAM can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides in length. In certain embodiments, a PAM is between 2-6 nucleotides in length. In some embodiments, the PAM is 3 nucleotides in length.
  • the PAM may be “adjacent to” the target nucleic acid sequence in that it typically immediately precedes the target sequence. In some embodiments, the PAM is 5’ of the target site.
  • PAM sequences are often specific to the particular Cas endonuclease being used in the CRISPR/Cas complex and the species from which it was derived.
  • Type I-C CRISPR-Cas3 elements typically are active in a host cell genome which comprises a protospacer adjacent motif (PAM) comprising the nucleic acid sequence 5’-TTC-3’ or 5’-TTT-3’ located adjacent to the target genomic DNA sequence.
  • PAM sequences and methods of determining PAM sequences for specific Cas proteins are known in the art.
  • the gRNA or portion thereof that hybridizes to a target nucleic acid sequence may be between any length.
  • the guide sequence of the gRNA does not need to be completely complementary to the target site.
  • the guide sequence of the gRNA is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the target site.
  • the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the 3’ end of the target site (e.g., the last 5, 6, 7, 8, 9, or 10 nucleotides of the 3’ end of the target site).
  • “Complementarity” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson- Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule, which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence.
  • a gRNA may also comprise a scaffold sequence (e.g., tracrRNA).
  • a scaffold sequence e.g., tracrRNA.
  • Exemplary scaffold sequences will be evident to one of skill in the art and can be found, for example, in Jinek, et al. Science (2012) 337(6096):816-821, and Ran, et al. Nature Protocols (2013) 8:2281-2308, incorporated herein by reference in their entireties.
  • At least one gRNA is within a crRNA array.
  • a crRNA array comprises multiple guide RNAs (sgRNA) derived from the fusion of CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) expressed a single transcript, which after processing by a nuclease are cleaved into separate gRNAs.
  • the crRNA array may contain multiple repeats separated by unique spacers.
  • an engineered crRNA array may comprise contains two repeats and one spacer, or three repeats and two identical spacers.
  • An exemplary crRNA array-repeat amino acid sequence may comprise SEQ ID NO: 114, SEQ ID NO: 131, SEQ ID NO: 145, SEQ ID NO: 157 or SEQ ID NO: 169.
  • One or all of the at least one gRNAs may be a non-naturally occurring gRNA.
  • the system comprises two or more engineered CRISPR-Cas systems or one or more nucleic acids encoding two or more engineered (CRISPR-Cas) systems.
  • the two or more engineered CRISPR-Cas systems are derived from different subtypes of Type I CRISPR-Cas systems.
  • the two or more engineered CRISPR-Cas systems are orthogonal, which means that each CRISPR-Cas system only functions with its own cognate components (e.g., Cas proteins, PAM sequences, and crRNA (gRNA, spacer, and repeat sequences)).
  • the two or more engineered CRISPR-Cas systems comprise two Type I CRISPR-Cas systems selected from the group consisting of a Type I-B CRISPR-Cas system, a Type I-C CRISPR-Cas system, and a Type I-D CRISPR-Cas system.
  • the two or more engineered CRISPR-Cas systems may be selected from a N.
  • the system is a cell-free system.
  • Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding components of the present system into cells, tissues, or a subject. Such methods can be Attorney Docket No. UM-41218.601 used to administer nucleic acids encoding components of the present system to cells in culture, or in a host organism.
  • Non-viral vector delivery systems include DNA plasmids, cosmids, RNA (e.g., a transcript of a vector described herein), a nucleic acid, and a nucleic acid complexed with a delivery vehicle.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. A variety of viral constructs may be used to deliver the present system and/or components to the cells, tissues and/or a subject. Viral vectors include, for example, retroviral, lentiviral, adenoviral, adeno-associated and herpes simplex viral vectors.
  • Nonlimiting examples of such recombinant viruses include recombinant adeno-associated virus (AAV), recombinant adenoviruses, recombinant lentiviruses, recombinant retroviruses, recombinant herpes simplex viruses, recombinant poxviruses, phages, etc.
  • AAV adeno-associated virus
  • the present disclosure provides vectors capable of integration in the host genome, such as retrovirus or lentivirus. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A., et al., 2001 Nat. Medic.7(1):33-40; and Walther W.
  • Drug selection strategies may be adopted for positively selecting for cells comprising the nucleic acid sequences encoding the present system or components thereof.
  • the present disclosure also provides for DNA segments encoding the proteins and nucleic acids disclosed herein, vectors containing these segments and cells containing the vectors.
  • the vectors may be used to propagate the segment in an appropriate cell and/or to allow expression from the segment (e.g., an expression vector).
  • an expression vector The person of ordinary skill in the art would be aware of the various vectors available for propagation and expression of a nucleic acid sequence.
  • expression vectors for stable or transient expression of the present system may be constructed via conventional methods and introduced into cells.
  • nucleic acids encoding the components of the present system may be cloned into a suitable expression vector, such as a plasmid or a viral vector in operable linkage to a suitable promoter.
  • a suitable expression vector such as a plasmid or a viral vector in operable linkage to a suitable promoter.
  • the selection of expression vectors/plasmids/viral vectors should be suitable for integration and replication in eukaryotic cells.
  • vectors of the present disclosure can drive the expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors examples include pCDM8 (Seed, Nature (1987) 329:840, incorporated herein by reference) and pMT2PC (Kaufman, et al., EMBO J. (1987) 6:187, incorporated herein by reference).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • Attorney Docket No. UM-41218.601 For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
  • Vectors of the present disclosure can comprise any of a number of promoters known to the art, wherein the promoter is constitutive, regulatable or inducible, cell type specific, tissue-specific, or species specific.
  • a promoter sequence of the invention can also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences and introns).
  • Many promoter/regulatory sequences useful for driving constitutive expression of a gene are available in the art and include, but are not limited to, for example, CMV (cytomegalovirus promoter), EF1a (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PGK (mammalian phosphoglycerate kinase promoter), Ubc (human ubiquitin C promoter), human beta-actin promoter, rodent beta-actin promoter, CBh (chicken beta-actin promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), H1 (human polyme
  • Additional promoters that can be used for expression of the components of the present system, include, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1-alpha (EF1- ⁇ ) promoter with or without the EF1- ⁇ intron.
  • CMV cytomegalovirus
  • a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeloproliferative sarcoma virus (MPSV) LTR
  • any regulatable promoter may be used, such that its expression can be modulated within a cell.
  • inducible expression can be accomplished by placing the nucleic acid encoding such a molecule under the control of an inducible promoter/regulatory sequence. Promoters well known in the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention. Thus, it will be appreciated that the present disclosure includes the use of any promoter/regulatory sequence known in the art that is capable of driving expression of the desired protein operably linked thereto. Attorney Docket No.
  • the vectors of the present disclosure may direct the expression of the nucleic acid in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements include promoters that may be tissue specific or cell specific.
  • tissue specific refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest to a specific type of tissue (e.g., seeds) in the relative absence of expression of the same nucleotide sequence of interest in a different type of tissue.
  • cell type specific refers to a promoter that is capable of directing selective expression of a nucleotide sequence of interest in a specific type of cell in the relative absence of expression of the same nucleotide sequence of interest in a different type of cell within the same tissue.
  • the term “cell type specific” when applied to a promoter also means a promoter capable of promoting selective expression of a nucleotide sequence of interest in a region within a single tissue. Cell type specificity of a promoter may be assessed using methods well known in the art, e.g., immunohistochemical staining.
  • the vector may contain, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in host cells; enhancer/promoter sequences from the immediate early gene of human CMV for high levels of transcription; transcription termination and RNA processing signals from SV40 for mRNA stability; 5’- and 3’-untranslated regions for mRNA stability and translation efficiency from highly-expressed genes like ⁇ -globin or ⁇ -globin; SV40 polyoma origins of replication and ColE1 for proper episomal replication; internal ribosome binding sites (IRESes), versatile multiple cloning sites; T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA; a “suicide switch” or “suicide gene” which when triggered causes cells carrying the vector to die (e.g., HSV thymidine kinase, an inducible caspase such as iCas
  • the vectors When introduced into a cell, the vectors may be maintained as an autonomously replicating sequence or extrachromosomal element or may be integrated into host DNA.
  • the present system or components thereof may be delivered to a cell by any suitable means. In certain embodiments, the system is delivered in vivo. In other embodiments, the system is delivered to isolated/cultured cells in vitro or ex vivo to provide modified cells useful for in vivo delivery to patients afflicted with a disease or condition.
  • Vectors according to the present disclosure can be transformed, transfected, or otherwise introduced into a wide variety of host cells. Transfection refers to the taking up of a vector by a cell whether or not any coding sequences are in fact expressed.
  • Transduction refers to entry of a virus into the cell and expression (e.g., transcription and/or translation) of sequences delivered by the viral vector genome.
  • transduction generally refers to entry of the recombinant viral vector into the cell and expression of a nucleic acid of interest delivered by the vector genome.
  • any of the vectors comprising a nucleic acid sequence that encodes the components of the present system is also within the scope of the present disclosure.
  • a vector may be delivered into cells by a suitable method.
  • Methods of delivering vectors to cells are well known in the art and may include DNA or RNA electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA or RNA; delivery of DNA, RNA, or protein by mechanical deformation (see, e.g., Sharei et al. Proc. Natl. Acad. Sci. USA (2013) 110(6): 2082-2087, incorporated herein by reference); or viral transduction.
  • the vectors are delivered to host cells by viral transduction.
  • Nucleic acids can be delivered as part of a larger construct, such as a plasmid or viral vector, or directly, e.g., by electroporation, lipid vesicles, viral transporters, microinjection, and biolistics (high-speed particle bombardment).
  • the construct or the nucleic acid encoding the components of the present system is a DNA molecule.
  • the nucleic acid encoding the components of the present system is a DNA vector and may be electroporated to cells.
  • the nucleic acid encoding the components of the present system is an RNA molecule, which may be electroporated to cells.
  • delivery vehicles such as nanoparticle- and lipid-based mRNA or protein delivery systems can be used.
  • Further examples of delivery vehicles include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery system, gene gun, hydrodynamic, electroporation or nucleofection microinjection, and biolistics.
  • RNP ribonucleoprotein
  • lipid-based delivery system lipid-based delivery system
  • gene gun hydrodynamic, electroporation or nucleofection microinjection
  • biolistics biolistics.
  • Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res.2012; 1: 27) and Ibraheem et al. (Int J Pharm.2014 Jan 1;459(1-2):70-83), incorporated herein by reference.
  • RNP ribonucleoprotein
  • ribonucleoprotein complex refers to a complex of ribonucleic acid and RNA-binding protein(s).
  • an RNP complex typically comprises Cas protein(s) (e.g., Cas5, Cas7, and Cas8) in complex with a gRNA.
  • RNPs may be assembled in vitro and can be delivered directly to cells using standard electroporation, cationic lipids, gold nanoparticles, or other transfection techniques (see, e.g., Kim et al., Genome Res., 24: 1012- Attorney Docket No. UM-41218.601 1019 (2014); Zuris et al., Nat. Biotechnol., 33: 73-80 (2015); and Mout et al., ACS Nano., 11: 2452-2458 (2017)).
  • the disclosure provides an isolated cell comprising the system, the vector(s), nucleic acid(s), or system disclosed herein.
  • the disclosure also provides populations of cells comprising the present systems.
  • Preferred cells are those that can be easily and reliably grown, have reasonably fast growth rates, have well characterized expression systems, and can be transformed or transfected easily and efficiently, including both eukaryotic and prokaryotic cells.
  • suitable prokaryotic cells include, but are not limited to, cells from the genera Bacillus (such as Bacillus subtilis and Bacillus brevis), Escherichia (such as E. coli), Pseudomonas, Streptomyces, Salmonella, and Envinia.
  • Suitable eukaryotic cells are known in the art and include, for example, yeast cells, insect cells, and mammalian cells.
  • yeast cells examples include those from the genera Kluyveromyces, Pichia, Rhino-sporidium, Saccharomyces, and Schizosaccharomyces.
  • Exemplary insect cells include Sf-9 and HIS (Invitrogen, Carlsbad, Calif.) and are described in, for example, Kitts et al., Biotechniques, 14: 810-817 (1993); Lucklow, Curr. Opin. Biotechnol., 4: 564-572 (1993); and Lucklow et al., J. Virol., 67: 4566-4579 (1993), incorporated herein by reference.
  • the cell is a mammalian cell, and in some embodiments, the cell is a human cell.
  • suitable mammalian and human host cells are known in the art, and many are available from the American Type Culture Collection (ATCC, Manassas, Va.).
  • suitable mammalian cells include, but are not limited to, Chinese hamster ovary cells (CHO) (ATCC No. CCL61), CHO DHFR- cells (Urlaub et al., Proc. Natl. Acad. Sci. USA, 97: 4216-4220 (1980)), human embryonic kidney (HEK) 293 or 293T cells (ATCC No. CRL1573), and 3T3 cells (ATCC No. CCL92).
  • CHO Chinese hamster ovary cells
  • CHO DHFR- cells Urlaub et al., Proc. Natl. Acad. Sci. USA, 97: 4216-4220 (1980)
  • human embryonic kidney (HEK) 293 or 293T cells ATCC No. CRL1573)
  • 3T3 cells ATCC No. CCL92.
  • CRL1650 and COS-7 cell lines (ATCC No. CRL1651), as well as the CV-1 cell line (ATCC No. CCL70).
  • exemplary mammalian host cells include primate, rodent, and human cell lines, including transformed cell lines. Normal diploid cells, cell strains derived from in vitro culture of primary tissue, as well as primary explants, are also suitable.
  • Other suitable mammalian cell lines include, but are not limited to, mouse neuroblastoma N2A cells, HeLa, HEK, A549, HepG2, mouse L-929 cells, and BHK or HaK hamster cell lines.
  • the methods comprise contacting a target nucleic acid sequence with a system disclosed herein or a composition comprising the system.
  • the contacting a target nucleic acid sequence comprises introducing the system into the cell.
  • the system may be introduced into eukaryotic or prokaryotic cells by methods known in the art.
  • the cell is a mammalian cell.
  • the cell is a human cell.
  • introducing the system into a cell comprises administering the system to a subject.
  • the subject is human.
  • the administer may comprise in vivo administration.
  • a vector is contacted with a cell in vitro or ex vivo and the treated cell, containing the system, is transplanted into a subject.
  • the target nucleic acid is a nucleic acid endogenous to a target cell.
  • the target nucleic acid is a genomic DNA sequence.
  • genomic refers to a nucleic acid sequence (e.g., a gene or locus) that is located on a chromosome in a cell.
  • the target nucleic acid encodes a gene or gene product.
  • gene product refers to any biochemical product resulting from expression of a gene. Gene products may be RNA or protein. RNA gene products include non-coding RNA, such as tRNA, rRNA, micro RNA (miRNA), and small interfering RNA (siRNA), and coding RNA, such as messenger RNA (mRNA).
  • the target nucleic acid sequence encodes a protein or polypeptide.
  • the systems and methods described herein may be used to correct one or more defects or mutations in a gene (referred to as “gene correction”).
  • the target sequence encodes a defective version of a gene (e.g. with a SNP that causes disease).
  • the target sequence is a “disease-associated” gene.
  • the term “disease-associated gene,” refers to any gene or polynucleotide whose gene products are expressed at an abnormal level or in an abnormal form in cells obtained from a disease-affected individual as compared with tissues or cells obtained from an individual not affected by the disease.
  • a disease-associated gene may be expressed at an abnormally high level or at an abnormally low level, where the altered expression correlates with the occurrence and/or progression of the disease.
  • a disease-associated gene also refers to a gene, the mutation or genetic variation of which is directly responsible or is in linkage disequilibrium with a gene(s) that is responsible for the etiology of Attorney Docket No. UM-41218.601 a disease.
  • genes responsible for such “single gene” or “monogenic” diseases include, but are not limited to, adenosine deaminase, ⁇ -1 antitrypsin, cystic fibrosis transmembrane conductance regulator (CFTR), ⁇ -hemoglobin (HBB), oculocutaneous albinism II (OCA2), Huntingtin (HTT), dystrophia myotonica-protein kinase (DMPK), low-density lipoprotein receptor (LDLR), apolipoprotein B (APOB), neurofibromin 1 (NF1), polycystic kidney disease 1 (PKD1), polycystic kidney disease 2 (PKD2), coagulation factor VIII (F8), dystrophin (DMD), phosphate-regulating endopeptidase homologue, X- linked (PHEX), methyl-CpG-binding protein 2 (MECP2), and ubiquitin-specific peptidase 9Y, Y-linked (USP9Y
  • the target genomic DNA sequence can comprise a gene, the mutation of which contributes to a particular disease in combination with mutations in other genes. Diseases caused by the contribution of multiple genes which lack simple (i.e., Mendelian) inheritance patterns are referred to in the art as a “multifactorial” or “polygenic” disease.
  • multifactorial or polygenic diseases include, but are not limited to, asthma, diabetes, epilepsy, hypertension, bipolar disorder, and schizophrenia. Certain developmental abnormalities also can be inherited in a multifactorial or polygenic pattern and include, for example, cleft lip/palate, congenital heart defects, and neural tube defects.
  • kits may include CRISPR reagents (Cas proteins, guide RNAs, vectors, compositions, etc.), transfection or administration reagents, negative and positive control samples (e.g., cells, template DNA), cells, containers housing one or more components (e.g., microcentrifuge tubes, boxes), detectable labels, detection and analysis instruments, software, instructions, and the like.
  • CRISPR reagents Cas proteins, guide RNAs, vectors, compositions, etc.
  • transfection or administration reagents e.g., cells, template DNA
  • negative and positive control samples e.g., cells, template DNA
  • cells e.g., cells, template DNA
  • containers housing one or more components e.g., microcentrifuge tubes, boxes
  • detectable labels e.g., detection and analysis instruments, software, instructions, and the like.
  • Plasmid transfection CRISPR-Cas3 plasmid transfection was conducted using Lipofectamine 3000 Transfection Reagent (ThermoFisher) per manufacturer’s instructions. HAP1-EGFP reporter cells were seeded one day before transfection at 1x10 5 cells per well of a 24-well plate. For each transfection, we used 1 ⁇ L P3000 Enhancer Reagent, 1.5 ⁇ L Lipofectamine 3000 reagent, and a total of 500 ng crispr-cas plasmids.
  • Tfu I-E system we used 50, 92.5, 25, 95, 95, 92.5, 50 ng of Cas3, Cas5, Cas6, Cas7, Cas8, Cas11 and CRISPR plasmid, respectively.
  • Pae I-F system we used 50, 92.5, 50, 162.5, 95 and 50 ng of Cas2-3, Cas5, Cas6, Cas7, Cas8 and CRISPR plasmids, respectively.
  • WT subunit plasmids are substituted with the same amount of TadA*-, or APOBEC- or 2xUGI- fusion derivative plasmids.
  • Genomic DNA of the edited cells was isolated using Gentra Puregene Cell Kit (Qiagen) per manufacturer’s instructions and used as template for NGS library construction. A 200-300 bp region surrounding the target genomic site was PCR amplified. Following Illumina barcoding, PCR amplicons were pooled and purified through 2% agarose gel electrophoresis and gel extraction using a Monarch DNA Gel Extraction Attorney Docket No. UM-41218.601 Kit (New England Biolabs). Final elution is done with 30 ⁇ L H 2 O.
  • DNA concentration was quantified with a Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific) and sequenced on an Illumina MiSeq instrument (paired-end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols.
  • Bioinformatic analysis of NGS sequencing datasets [0141] Sequencing reads were demultiplexed using the MiSeq Reporter (Illumina), and the FASTQ files were analyzed using CRISPResso2.
  • Base editing efficiency values were reported as the percentage of reads with A•T to G•C conversion at a specific adenine location in the total aligned reads in ABE experiments or as the percentage of reads with C•G to T•A conversion at a specific cytosine location in the total aligned reads in CBE experiments.
  • Heatmaps were generated in GraphPad Prism version 9.
  • UM-41218.601 >human codon optimized Tfu-cas5 with NLS and HA tag (SEQ ID NO: 195) ATGAGCGGCTTCCTGCTGAGACTGGCTGGCCCTATGCAGTCTTGGGGCGAGCACTCTATGTTCGGCGAGAGAGACACCCTGCCTT ATCCTAGCAGATCCGGCCTGATCGGCATGTTTGCTGCTGCCCAGGGTGTCAGAAGAGGCGACCCTCTGGACCGGTACAAAGAACT GAAGTTCACCGTGCGCGTGGACAGACCTGGCGTCAGACTGGTGGATTTCCACACCATTGGCGGCGGACTGCCCAAAGAAAGAACC GTGCCTACAGCCGCTGGCGAGAAGGGATCCTAAGAAAGCCACCATCGTGACCAGCAGAAGCTACCTGGCCGACGCCGTGTTTA CAGTGGCTGTGACAGGACCCGAGGCCGACACAATTGCTGATGCTCTGGCCGCTCCTTACTGGCAGCCTTATCTTGGCAGACGGGC CTTCGTGCCTGATCCTCTCTGCTGGTGCTT
  • UM-41218.601 >human codon optimized Pae-cas2-cas3 nickase (K426A) with NLS and HA tag (SEQ ID NO: 206) ATGAACATCCTGCTGGTGTCCCAGTGCGAGAAGAGAGCCCTGAGCGAGACAAGACGGATCCTGGATCAGTTCGCCGAGCGGAGAG GCGAGAACATGGCAGACACCTATCACACAGGCCGGACTGGACACCCTGCGGAGACTGCTGAAGAAGTCCGCCAGACGGAATAC CGCCGTGGCCTGTCACTGGATCAGAGGCAGAGATCACTCCGAGCTGCTGTGGATCGTGGGCGACGCCTCTAGATTCAATGCTCAG GGCGCCGTGCCTACCAACAGAACCTGCAGAGACATCCTGCGGAAAGAGGACGAGAACGACTGGCACAGCGCCGAGGATATCAGGC TGCTGACAGTGATGGCCGCTCTGTTCCACGATATCGGCAAAAAGCCAGCCAGGCCTTCCAGGCCAAGCTGAGAAATAGAGGCAAG

Abstract

La présente invention concerne des systèmes, des compositions et des procédés pour modifier des acides nucléiques, tels qu'à une position unique (par exemple, A/T à g/C ou g/C à A/T ; dans un gène avec une maladie provoquant un SNP). Plus particulièrement, la présente invention concerne des systèmes CRISPR/Cas modifiés comprenant : une première protéine Cas (par exemple, Cas5-8 ou Cas11) qui serait éventuellement liée ou fusionnée à une protéine effectrice choisie parmi : i) une adénine désaminase, ii) un inhibiteur de l'uracile glycosylase, ou iii) une protéine APOBEC ; et au moins un ARN guide (ARNg) conçu pour s'hybrider à une partie d'une séquence d'acide nucléique cible. Dans certains modes de réalisation, les systèmes comprennent en outre une seconde protéine Cas choisie parmi : i) Cas3, ii) une Cas3 déficiente en hélicase ; ou iii) des endonucléases de Cas de coupure simple brin (par exemple, la protéine H840A de Nickase Cas9).
PCT/US2023/031071 2022-08-24 2023-08-24 Éditeur de bases crispr WO2024044329A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263373411P 2022-08-24 2022-08-24
US63/373,411 2022-08-24

Publications (1)

Publication Number Publication Date
WO2024044329A1 true WO2024044329A1 (fr) 2024-02-29

Family

ID=90013920

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/031071 WO2024044329A1 (fr) 2022-08-24 2023-08-24 Éditeur de bases crispr

Country Status (1)

Country Link
WO (1) WO2024044329A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019246555A1 (fr) * 2018-06-21 2019-12-26 Cornell University Système crispr de type i utilisé comme outil pour l'édition du génome
US20200048622A1 (en) * 2018-06-13 2020-02-13 Caribou Biosciences, Inc. Engineered Cascade Components and Cascade Complexes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20200048622A1 (en) * 2018-06-13 2020-02-13 Caribou Biosciences, Inc. Engineered Cascade Components and Cascade Complexes
WO2019246555A1 (fr) * 2018-06-21 2019-12-26 Cornell University Système crispr de type i utilisé comme outil pour l'édition du génome

Similar Documents

Publication Publication Date Title
US20220186226A1 (en) RNA TARGETING OF MUTATIONS VIA SUPPESSOR tRNAs AND DEAMINASES
US20220220462A1 (en) Nucleobase editors and uses thereof
US20180195089A1 (en) CRISPR Oligonucleotides and Gene Editing
AU2018240571A1 (en) Nucleobase editors comprising nucleic acid programmable DNA binding proteins
KR20220004674A (ko) Rna를 편집하기 위한 방법 및 조성물
CN113631708A (zh) 编辑rna的方法和组合物
JP2023517041A (ja) クラスｉｉのｖ型ｃｒｉｓｐｒ系
JP2022500017A (ja) 核酸塩基編集システムを送達するための組成物および方法
US20230265404A1 (en) Engineered mad7 directed endonuclease
US20230091242A1 (en) Rna-guided genome recombineering at kilobase scale
JP2018011525A (ja) ゲノム編集方法
WO2022251465A1 (fr) Systèmes crispr-cas3 pour ingénierie génomique ciblée
WO2024044329A1 (fr) Éditeur de bases crispr
CA3208612A1 (fr) Virus de la rage recombinants pour therapie genique
US20230287457A1 (en) Type i-c crispr system from neisseria lactamica and methods of use
WO2024026415A1 (fr) Compositions, systèmes et procédés de réécriture par matrice d'arn
WO2022081890A1 (fr) Compositions et méthodes de traitement de la maladie de stockage du glycogène de type 1a
CN117321198A (zh) 用于基因疗法的重组狂犬病病毒

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23858091

Country of ref document: EP

Kind code of ref document: A1