WO2024041503A1 - Compounds targeting y220c mutant of p53 - Google Patents

Compounds targeting y220c mutant of p53 Download PDF

Info

Publication number
WO2024041503A1
WO2024041503A1 PCT/CN2023/114172 CN2023114172W WO2024041503A1 WO 2024041503 A1 WO2024041503 A1 WO 2024041503A1 CN 2023114172 W CN2023114172 W CN 2023114172W WO 2024041503 A1 WO2024041503 A1 WO 2024041503A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
membered
heterocycloalkyl
cycloalkyl
independently
Prior art date
Application number
PCT/CN2023/114172
Other languages
French (fr)
Inventor
Sujing LI
Amin LI
Qian Zheng
Chaojie DANG
Xinrui FAN
Wei LONG
Yanping Wang
Original Assignee
Jacobio Pharmaceuticals Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jacobio Pharmaceuticals Co., Ltd. filed Critical Jacobio Pharmaceuticals Co., Ltd.
Publication of WO2024041503A1 publication Critical patent/WO2024041503A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/38—Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381—Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D333/00—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom
    • C07D333/50—Heterocyclic compounds containing five-membered rings having one sulfur atom as the only ring hetero atom condensed with carbocyclic rings or ring systems
    • C07D333/52—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes
    • C07D333/54—Benzo[b]thiophenes; Hydrogenated benzo[b]thiophenes with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to carbon atoms of the hetero ring
    • C07D333/58—Radicals substituted by nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
    • C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D451/00—Heterocyclic compounds containing 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane or granatane alkaloids, scopolamine; Cyclic acetals thereof
    • C07D451/02—Heterocyclic compounds containing 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane or granatane alkaloids, scopolamine; Cyclic acetals thereof containing not further condensed 8-azabicyclo [3.2.1] octane or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane; Cyclic acetals thereof
    • C07D451/04—Heterocyclic compounds containing 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane or granatane alkaloids, scopolamine; Cyclic acetals thereof containing not further condensed 8-azabicyclo [3.2.1] octane or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane; Cyclic acetals thereof with hetero atoms directly attached in position 3 of the 8-azabicyclo [3.2.1] octane or in position 7 of the 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring system
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D491/00—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00
    • C07D491/02—Heterocyclic compounds containing in the condensed ring system both one or more rings having oxygen atoms as the only ring hetero atoms and one or more rings having nitrogen atoms as the only ring hetero atoms, not provided for by groups C07D451/00 - C07D459/00, C07D463/00, C07D477/00 or C07D489/00 in which the condensed system contains two hetero rings
    • C07D491/10—Spiro-condensed systems
    • C07D491/107—Spiro-condensed systems with only one oxygen atom as ring hetero atom in the oxygen-containing ring
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6558—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system
    • C07F9/65586—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system at least one of the hetero rings does not contain nitrogen as ring hetero atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6561—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6564—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms
    • C07F9/6568—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus atoms as the only ring hetero atoms
    • C07F9/65685—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus atoms as the only ring hetero atoms the ring phosphorus atom being part of a phosphine oxide or thioxide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6564—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms
    • C07F9/6571—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and oxygen atoms as the only ring hetero atoms
    • C07F9/657163—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and oxygen atoms as the only ring hetero atoms the ring phosphorus atom being bound to at least one carbon atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
    • C07F9/02—Phosphorus compounds
    • C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6564—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms
    • C07F9/6581—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms
    • C07F9/6584—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom having phosphorus atoms, with or without nitrogen, oxygen, sulfur, selenium or tellurium atoms, as ring hetero atoms having phosphorus and nitrogen atoms with or without oxygen or sulfur atoms, as ring hetero atoms having one phosphorus atom as ring hetero atom

Definitions

  • the present invention relates to compounds that target p53 Y220C, pharmaceutical compositions comprising the compounds and the use thereof.
  • the p53 protein referred to as the “guardian of the human genome” is a tetrameric transcription factor that prevents mutation to the genome by regulating the expression of a subgroup of target genes. Although biologically active as a homotetramer, each p53 monomer is comprised of 393 amino acids, and is divided into five key regulatory domains: the transactivation domain (TAD) , proline-rich region (PR) , the DNA binding domain (DBD) , the oligomerization domain (OD) , and the C-terminus.
  • TAD transactivation domain
  • PR proline-rich region
  • DBD DNA binding domain
  • OD oligomerization domain
  • C-terminus the C-terminus
  • the p53 protein Under normal conditions, the p53 protein has a “cancer suppressor” effect but p53 is unstable, with a half-life ranging from 5 to 30 minutes. Activation of p53 initiates pathways involved in apoptosis, DNA repair, cell cycle arrest, anti-angiogenesis, and senescence in order to avoid propagation of damaged cells. p53 activation occurs via a complicated regulatory network composed of three key steps: (1) p53 stabilization by phosphorylation, (2) DNA binding, and (3) target gene activation.
  • Mutations in p53 located in the DNA binding domain of the protein or periphery of the DNA-binding surface result in aberrant protein folding required for DNA recognition and binding. Mutations in p53 can occur, for example, at amino acids Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, and Arg282.
  • P53 mutations that can abrogate the activity of p53 include, for example, R175H, Y220C, G245S, R248Q, R248W, R273H, and R282W.
  • p53 mutations can either distort the structure of the DNA-binding site or thermodynamically destabilize the folded protein at body temperature. Wild-type function of p53 mutants can be recovered by binding of the p53 mutant to a compound that can shift the folding-unfolding equilibrium towards the folded state, thereby reducing the rate of unfolding and destabilization.
  • the p53 Y220C mutation is associated with many cancers, including breast cancer, non-small cell lung cancer, colorectal cancer, pancreatic cancer, and ovarian cancer.
  • the present disclosure provides the following aspect.
  • a compound of formula (I) or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof:
  • one of X 1 , X 2 , X 3 and X 4 is selected from CR 2 , and the others of X 1 , X 2 , X 3 and X 4 are each independently selected from N or CR 4 ;
  • X 5 is selected from N or CR 1 ;
  • R 1 is independently selected from hydrogen, deuterium, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2 , -N (R’ ) 2 , -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2 , -S (O) R’ , -S (O) N (R’ ) 2 , -NR’S (O) R’ , -NR’S (O) N (R’ ) 2 , -NR’S (O) R’ , -
  • R 2 is -NR 51 R 52 , -OR 53 or -SR 54 ;
  • R 3 is selected from hydrogen, deuterium, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -S (O) R’ , -S (O) N (R’ ) 2 , -S (O) 2 R’ , -S (O) 2 N (R’ ) 2 , -PO (R’ ) 2 , 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C
  • each R 3a is independently selected from deuterium, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2 , -N (R’ ) 2 , -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2 , -S (O) R’ , -S (O) N (R’ ) 2 , -NR’S (O) R’ , -NR’S (O) N (R’ ) 2 , -NR’S (O) R
  • each R 3b is independently selected from deuterium, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2 , -N (R’ ) 2 , -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2 , -S (O) R’ , -S (O) N (R’ ) 2 , -NR’S (O) R’ , -NR’S (O) N (R’ ) 2 , -NR’S (O) R
  • R 4 at each occurrence is independently selected from hydrogen, deuterium, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2 , -N (R’ ) 2 , -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2 , -S (O) R’ , -S (O) N (R’ ) 2 , -NR’S (O) R’ , -NR’S (O) N (R’ ) 2 , -NR’S (O) R’
  • R 51 , R 52 , R 53 and R 54 are each independently selected from hydrogen, deuterium, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -S (O) R’ , -S (O) N (R’ ) 2 , -S (O) 2 R’ , -S (O) 2 N (R’ ) 2 , -PO(R’ ) 2 , 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C 1-6 alkyl, -C 2-6 alkenyl, -
  • R 11 and R 12 are independently selected from hydrogen, deuterium, -OH, halogen, -CN, oxo, -C 1-6 alkyl, -C 1-6 haloalkyl, -C 1-6 alkoxy, -NH 2 , -NHC 1-6 alkyl, -N (C 1-6 alkyl) 2 or 3-6 membered cycloalkyl; wherein said -C 1-6 alkyl, -C 1-6 alkoxy and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C 1-6 alkoxy, -NH-C 1-6 alkyl, -N (C 1-4 alkyl) 2 , or 3-6 membered cycloalkyl;
  • R 13 is selected from hydrogen, deuterium, -C 1-6 alkyl or 3-6 membered cycloalkyl; wherein said -C 1-6 alkyl and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C 1-6 alkoxy, -NH 2 , -NHC 1-6 alkyl, or -N (C 1-4 alkyl) 2 ;
  • each R’a t each occurrence is independently selected from hydrogen, deuterium, halogen, -OH, -CN, oxo, -NH 2 , -NHC 1-6 alkyl, -N (C 1-6 alkyl) 2 , -C 1-6 alkyl, -C 1-6 alkylOC 1-6 alkyl, -C 1-6 alkyl-NHC 1-6 alkyl, -C 1-6 alkyl-N (C 1-6 alkyl) 2 , -C 1-6 haloalkyl, -OC 1-6 alkyl, -C 3-14 cycloalkyl, -C 3-14 heterocycloalkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl; wherein said -C 1-6 alkyl, -OC 1-6 alkyl, -C 3-14 cycloalky
  • heterocycloalkyl, heterocycloalkenyl, and heteroaryl each independently contains 1, 2, 3, 4 or 5 heteroatoms selected from N, O, P or S;
  • n is selected from 1, 2, 3, 4, 5 or 6.
  • X 2 , X 3 , and X 4 in the formula (I-1) are each independently selected from N or CR 4 ;
  • R 1 is independently selected from halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, and 5-12 membered hetero
  • R 1 is independently selected from -F, -Cl, -C 1-3 alkyl, -C 2-4 alkenyl, -C 2-4 alkynyl, -C 1-3 haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C 1-3 alkyl, -C 2-4 alkenyl, -C 2-4 alkynyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C 1-3 alkyl,
  • R 1 is independently selected from -F, -Cl, -C 1-3 alkyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl
  • said -C 1-3 alkyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C 1-3 alkyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said heterocycl
  • R 1 is independently selected from -F, -Cl, -C 1-3 alkyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S, or 6 membered heteroaryl containing 1 or 2 heteroatoms selected from N; said -C 1-3 alkyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl and 6 membered heteroaryl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C 1-3 alkyl, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl.
  • R 1 is independently selected from -C 1-3 alkyl; -C 1-3 haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C 1-3 alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl.
  • R 51 is selected from -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; said -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, 5-6 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen,
  • R 51 is selected from -C 1-6 alkyl, 5 membered cycloalkyl, 5 membered heterocycloalkyl, 6 membered cycloalkyl, or 6 membered heterocycloalkyl; said -C 1-6 alkyl, cycloalkyl, and heterocycloalkyl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH 3 , -CD 3 , -CH 2 CH 3 , -CH 2 CH 2 CH 3 , -CH (CH 3 ) 2 , -CH(OH) CH 2 (OH) , -CH (OCH 3 ) CH 2 (OH) , -CH (OH) CH 2 (OCH 3 ) , -CH 2 CH (OH) (OCH 3 ) , -CH 2 CH (OH) (OCH 3 ) , -CH 2 CH (OH) (OCH 3 ) , -
  • R 51 is selected from or -C 1-6 alkyl, said -C 1-6 alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R 5e ;
  • R 5a , R 5c and R 5d are each independently selected from hydrogen; -C 1-6 alkyl; or -C 1-6 alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 5b and R 5e are each independently selected from -F, -C 1-6 alkyl, oxo, -OC 1-6 alkyl, -NH 2 , -NHC 1-6 alkyl, -N (C 1-6 alkyl) 2 , -CN or 3-6 membered cycloalkyl, wherein, said -C 1-6 alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl.
  • R 51 is selected from or -C 1-3 alkyl-N (C 1-3 alkyl) 2 ;
  • R 5a is independently selected from -C 1-3 alkyl; or -C 1-3 alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 5b is independently selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 or -CN;
  • R 5c and R 5d are each independently selected from -C 1-3 alkyl.
  • R 51 is selected from or -CH 2 CH 2 -N (CH 3 ) 2 ;
  • R 5b is independently selected from -F
  • R 5c and R 5d are each independently selected from methyl.
  • R 51 is selected from
  • R 3 is independently selected from hydrogen, deuterium, halogen, -C 1-6 alkyl, -C 2-6 alkenyl, -C 2-6 alkynyl, -C 1-6 haloalkyl, -CN, -NO 2 , -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2 , -C (O) OR’ , -OC (O) R’ , -N (R’ ) 2 , -NR’ C (O) R’ , -S (O) R’ , -NR’S (O) R’ , -NR’S (O) R’ , -S (O) N (R’ ) 2 , -S (O) 2 R’ , -NR’S (O) 2 R’ , -NR’S (O) 2 R’ , -S (O) 2 N (R’ ) 2 , 3-12 membere
  • R 3 is independently selected from phenyl, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R 3c ;
  • R 3 is independently selected from phenyl, 5 membered heteroaryl, 6 membered heteroaryl ring; said phenyl and heteroaryl at each occurrence are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH 3 , -CD 3 , -CH 2 CH 3 , -CH 2 CH 2 CH 3 , -CH (CH 3 ) 2 , -CH 2 F, -CHF 2 , -CF 3 , -CH 2 CH 2 F, -CH 2 CHF 2 , -CH 2 CF 3 , -CHFCH 3 , -CF 2 CH 3 , -CHFCH 2 F, -CH 2 CHFCH 3 , -CH 2 CF 2 CH 3 , -CH 2 CH 2 CF 3 , -C (CH 3 ) 2 F, -CN,
  • R 3 is independently selected from phenyl, 5 membered heteroaryl, or 6 membered heteroaryl; said phenyl and heteroaryl at each occurrence is independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -CH 3 , -CD 3 , -CH 2 CH 3 , -CH 2 CH 2 CH 3 , -CH (CH 3 ) 2 , -CH 2 F, -CF 3 , -CH 2 CH 2 F, -CHFCH 3 , -CF 2 CH 3 , -C (CH 3 ) 2 F, -OH, -O-CH 3 , -O-CH 2 CH 3 , -O-CH 2 CH 2 CH 3 , -O-CH (CH 3 ) 2 , -C (O) NH 2 , -C (O) NH (CH 3 ) , -C (O) NH (CH 3 ) , -C (O)
  • R 3 is independently selected from
  • R 1 is independently selected from -F, -Cl, -C 1-3 alkyl, -C 2-4 alkenyl, -C 2-4 alkynyl, -C 1-3 haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C 1-3 alkyl, -C 2-4 alkenyl, -C 2-4 alkynyl, -C 1-3 haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C 1-3 alkyl, -C 2-4 alkenyl, -C 2-4 alkynyl,
  • each of R 4 is independently selected from hydrogen, deuterium, -F, -Cl, -C 1-3 alkyl, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 11 and R 12 are independently selected from hydrogen, deuterium, -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl, wherein, said -C 1-3 alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 13 is selected from hydrogen; -C 1-3 alkyl; or -C 1-3 alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 3 is independently selected from phenyl, 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R 3c ;
  • R 51 is selected from or -C 1-6 alkyl, said -C 1-6 alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R 5e ;
  • R 5a , R 5c and R 5d are each independently selected from hydrogen; -C 1-6 alkyl; or -C 1-6 alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 5b and R 5e are each independently selected from -F, -C 1-6 alkyl, oxo, -OC 1-6 alkyl, -NH 2 , -NHC 1-6 alkyl, -N (C 1-6 alkyl) 2 , -CN or 3-6 membered cycloalkyl, wherein, said -C 1-6 alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C 1-3 alkyl, oxo, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 1 is independently selected from -C 1-3 alkyl; -C 1-3 haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C 1-3 alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • each of R 4 is independently selected from hydrogen, deuterium, -F, -Cl, -C 1-3 alkyl, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 , -CN or 3-6 membered cycloalkyl;
  • R 11 and R 12 are independently selected from hydrogen or -C 1-3 alkyl
  • R 13 is selected from hydrogen or -C 1-3 alkyl
  • R 3 is independently selected from phenyl, said phenyl is independently optionally substituted with 1, 2, 3 substituents selected from R 3c ;
  • R 51 is selected from
  • R 1 is independently selected from
  • each of R 4 is hydrogen
  • R 11 and R 12 are independently selected from hydrogen
  • R 13 is selected from hydrogen
  • R 3 is independently selected from
  • R 1 is independently selected from -C 1-3 haloalkyl; or -C 1-3 alkyl optionally substituted with 1, 2 or 3 substituents selected from -F, -CN, -OC 1-3 alkyl, -NH 2 , -NHC 1-3 alkyl, -N (C 1-3 alkyl) 2 or 3-6 membered cycloalkyl such as cyclopropyl.
  • R 3 is independently selected from phenyl, 5-10 membered heterocycloalkenyl containing 1 or 2 heteroatoms selected from N, O or S, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; each of which is independently optionally substituted with 1, 2, 3 substituents selected from R 3a ;
  • R 3 is independently selected from phenyl, pyridinyl, and 5-10 membered benzoheterocycloalkyl containing 1 or 2 heteroatoms selected from N, O or S, each of which is optionally substituted with 1, 2, 3 substituents selected from R 3a ;
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of [1] - [59] , and a pharmaceutically acceptable carrier, diluent, or excipient.
  • a method for treating a disease or condition related to p53 mutant protein comprising administering to a subject a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof to any one of [1] - [59] , or a pharmaceutical composition according to [60] .
  • the present invention provides compounds and methods for restoring wild-type function to mutant p53.
  • the compounds of the present invention can bind to mutant p53 and restore the ability of the p53 mutant to bind DNA.
  • the restoration of activity of the p53 mutant can allow for the activation of downstream effectors of p53 leading to inhibition of cancer progression.
  • the Y220C mutant is a temperature sensitive mutant, which binds to DNA at lower temperature and is denatured at body temperature.
  • a compound of the invention can selectively bind to the p53 Y220Cs and tabilize the Y220C mutant to reduce the likelihood of denaturation of the protein at body temperature.
  • C 1-6 alkyl refers to an alkyl group as defined hereinafter having 1 to 6 carbon atoms in total
  • C 3-8 cycloalkyl refers to a cycloalkyl group as defined hereinafter having 3 to 8 carbon atoms in total
  • C 6-10 aryl refers to an aryl group as defined hereinafter having 6 to 10 carbon atoms in total.
  • Carbon atoms that may exist in the substituents of the chemical group are not included in the total number of carbon atoms in the shorthand notation.
  • arylalkyl means that the aryl group is attached to the rest of the molecule via the alkyl group
  • alkoxyl means that the aliphatic group is attached to the rest of the molecule via an oxy group
  • alkyl optionally substituted by one or more means the alkyl group is unsubstituted or substituted by one or more (such as 1, 2, 3, 4, 5 or 6) halogens, and that the description includes both substituted alkyl groups and unsubstituted alkyl groups.
  • substituted means that any one or more hydrogen atoms on the designated atom or group is replaced with one or more substituents other than hydrogen, provided that the designated atom's normal valence is not exceeded.
  • substituted refers to any level of substitution, e.g., mono-, di-, tri-, tetra-or penta-substitution, where such substitution is permitted.
  • the substituents are independently selected, and substitution may be at any chemically accessible position. It is to be understood that substitution at a given atom is limited by valency. It is to be understood that substitution at a given atom results in a chemically stable molecule.
  • the term “substituted” is contemplated to include all permissible substituents of organic compounds.
  • the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds.
  • the permissible substituents can be one or more and the same or different for appropriate organic compounds.
  • the phrase "optionally substituted” means unsubstituted or substituted.
  • substituted means that a hydrogen atom is removed and replaced by a substituent.
  • a single divalent substituent e.g., oxo, can replace two hydrogen atoms.
  • stereoisomer refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures.
  • the present invention contemplates various stereoisomers and mixtures thereof.
  • the pre fixes D and L, or R and S are used to denote the absolute configuration of the molecule about its chiral center (s) .
  • the prefixes d and l or (+) and (-) are employed to designate the sign of rotation of plane-polarized light by the compound, with (-) or 1 meaning that the compound is levorotatory.
  • a compound prefixed with (+) or d is dextrorotatory.
  • these stereoisomers are identical except that they are mirror images of one another.
  • a specific stereoisomer may also be referred to as an enantiomer, and a mixture of such iso mers is often called an enantiomeric mixture.
  • a 50: 50 mixture of enantiomers is referred to as a racemic mixtu re or a racemate, which may occur where there has been no stereoselection or stereospecificity in a chemical re action or process.
  • the terms “racemic mixture” and “racemate” refer to an equimolar mixture of two enantiome ric species, devoid of optical activity.
  • tautomer refers to an isomer resulted from a proton shift from one atom of a molecule to another atom of the same molecule. All tautomeric forms of the compound of formula I of the present invention are included within the scope of the present invention.
  • alkenyl of the compound in the present application includes both E-and Z-geometric isomers.
  • isotopes of any particular atom or element as specified are contemplated within the scope of the compounds of the invention and their uses.
  • Isotopes include those atoms having the same atomic number but different mass numbers.
  • Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine and iodine, such as 2 H, 3 H, 11 C, 13 C, 14 C, 13 N, 15 N, 15 O, 17 O, 18 O, 32 P, 33 P, 35 S, 18 F, 36 Cl, 123 I or 125 I.
  • isotopes of hydrogen include deuterium and tritium.
  • the isotopes of hydrogen can be denoted as 1 H (hydrogen) , 2 H (deuterium) and 3 H (tritium) . They are also commonly denoted as D for deuterium and T for tritium.
  • CD 3 denotes a methyl group wherein all of the hydrogen atoms are deuterium.
  • Isotopes of carbon include 13 C and 14 C. Isotopically labeled compounds of the present disclosure are equivalent to those unlabeled, for example, deuterated compounds of the present disclosure are equivalent to those non-deuterated.
  • Isotopically-labeled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein, using an appropriate isotopically-labeled reagent in place of the non-labeled reagent.
  • deuterated derivative refers to a compound having the same chemical structure as a reference compound, but with one or more hydrogen atoms replaced by a deuterium atom ( “D” or “ 2 H” ) . It will be recognized that some variation of natural isotopic abundance occurs in a synthesized compound depending on the origin of chemical materials used in the synthesis. Notwithstanding this variation, the concentration of naturally abundant stable hydrogen isotopes is small and immaterial as compared to the degree of stable isotopic substitution of deuterated derivatives described herein.
  • the deuterated derivatives disclosed herein have an isotopic enrichment factor for each deuterium atom, of at least 3500 (52.5%deuterium incorporation at each designated deuterium) , at least 4500 (67.5%deuterium incorporation at each designated deuterium) , at least 5000 (75%deuterium incorporation at each designated deuterium) , at least 5500 (82.5%deuterium incorporation at each designated deuterium) , at least 6000 (90%deuterium incorporation at each designated deuterium) , at least 6333.3 (95%deuterium incorporation at each designated deuterium) , at least 6466.7 (97%deuterium incorporation at each designated deuterium) , or at least 6600 (99%deuterium incorporation at
  • amino refers to the -NH 2 group.
  • cyano refers to the -CN group.
  • nitro refers to the -NO 2 group.
  • halogen as used herein, unless otherwise indicated, means fluoro, chloro, bromo or iodo.
  • the preferred halogen groups include -F, -Cl and -Br.
  • alkyl as used herein, unless otherwise indicated, includes saturated monovalent hydrocarbon radicals having straight or branched.
  • alkyl radicals include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl.
  • C 1-6 as in C 1-6 alkyl is defined to identify the group as having 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement.
  • alkenyl means a straight or branch-chained hydrocarbon radical containing one or more (such as 1, 2, 3, 4, 5 or 6) double bonds and typically from 2 to 20 carbon atoms in length.
  • C 2-6 alkenyl contains from 2 to 6 carbon atoms.
  • Alkenyl group include, but are not limited to, for example, ethenyl, propenyl, butenyl, 2-methyl-2-buten-1-yl, hepetenyl, octenyl and the like.
  • alkynyl contains a straight or branch-chained hydrocarbon radical containing one or more (such as 1, 2, 3, 4, 5 or 6) triple bonds and typically from 2 to 20 carbon atoms in length.
  • C 2-6 alkynyl contains from 2 to 6 carbon atoms.
  • Representative alkynyl groups include, but are not limited to, for example, ethynyl, 1-propynyl, 1-butynyl, heptynyl, octynyl and the like.
  • alkoxyl radicals are oxygen ethers formed from the previously described alkyl groups.
  • a “cycloalkyl” is a cyclic hydrocarbon which is completely saturated. “cycloalkyl” includes monocyclic and bicyclic rings. Typically, a monocyclic cycloalkyl has from 3 to about 12 carbon atoms, more typically 3 to 8 carbon atoms unless otherwise defined, examplary “cycloalkyl” groups includes but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and so on. Cycloalkyl includes bicyclic molecules in which one, two or three or more atoms are shared between the two rings.
  • spirocyclic cycloalkyl refers to a bicyclic cycloalkyl in which each of the rings shares one adjacent atom with the other ring.
  • fused cycloalkyl refers to a bicyclic cycloalkyl in which each of the rings shares two adjacent atoms with the other ring.
  • bridged cycloalkyl refers to a cycloalkyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom.
  • bridged cycloalkyl includes “bicyclic bridged cycloalkyls” which includes two bridgehead carbon atoms and “polycyclic bridged cycloalkyls” which includes more than two bridgehead carbon atoms.
  • Typical bridged cycloalkyls include, but are not limited to adamantyl, noradamantyl, bicyclo [1.1.0] butanyl, norboranyl (bicyclo [2.2.1] heptanyl) , norbomenyl (bicyclo [2.2. l] heptanyl) , norbomadienyl (bicyclo [2.2.
  • cycloalkenyl refers to a partially unsaturated cyclic hydrocarbon group containing 1 to 4 rings and 3 to 8 carbons per ring system. Exemplary such groups include cyclobutenyl, cyclopentenyl, cyclohexenyl, etc. “cycloalkenyl” includes monocyclic, bicyclic, tricyclic, or tetracyclic ring system in which one, two, three or more atoms are shared between the two rings. The term “spirocyclic cycloalkenyl” refers to a bicyclic cycloalkenyl in which each of the rings shares one adjacent atom with the other ring.
  • fused cycloalkenyl refers to a bicyclic cycloalkenyl in which each of the rings shares two adjacent atoms with the other ring.
  • bridged cycloalkenyl refers to a cycloalkenyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom. “bridged cycloalkenyl” includes “bicyclic bridged cycloalkenyl” which includes two bridgehead carbon atoms and “polycyclic bridged cycloalkenyl” which includes more than two bridgehead carbon atoms.
  • heterocycloalkyl refers to a stable 3-18 membered non-aromatic ring radical completely saturated that comprises two to twelve carbon atoms and from one to six heteroatoms selected from nitrogen, oxygen, and sulfur. Unless stated otherwise specifically in the specification, the heterocycloalkyl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system.
  • spirocyclic heterocycloalkyl or “spiro-heterocyclyl” refers to a bicyclic or polycyclic heterocycloalkyl in which each of the rings shares one adjacent atom with the other ring.
  • fused heterocycloalkyl refers to a bicyclic cycloalkyl in which each of the rings shares two adjacent atoms with the other ring.
  • bridged heterocycloalkyl or “bridged-heterocyclyl” refers to a heterocycloalkyl that includes at least two bridgehead atoms and at least one bridging atom.
  • Bridged heterocycloalkyl or “bridged-heterocyclyl” includes “bicyclic bridged heterocycloalkyl” which includes two bridgehead atoms and “polycyclic bridged heterocycloalkyl” which includes at least two bridgehead atoms.
  • the heteroatoms in the heterocycloalkyl radical are optionally oxidized.
  • the heterocycloalkyl is attached to the rest of the molecule through any atom of the ring (s) .
  • heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl [1, 3] dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl octahydroisoindoly, 2-oxopiperazinyl, 2-oxopiperidiny1, 2-oxopyrrolidinyl, oxazolidinyl, piperidnyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, te
  • heterocycloalkenyl refers to the above-mentioned hererocycloalkyl having at least one double bond.
  • a heterocycloalkenyl may be a single ring or multiple rings wherein the multiple rings include “spirocyclic heterocycloalkenyl” , “fused heterocycloalkenyl” , and “bridged heterocycloalkyl” .
  • “Spirocyclic heterocycloalkenyl” refer to a bicyclic heterocycloalkenyl in which each of the rings shares one adjacent atom with the other ring
  • “fused heterocycloalkenyl” refers to a bicyclic heterocycloalkenyl in which each of the rings shares two adjacent atoms with the other ring, such as benzoheterocycloalkyl
  • “bridged heterocycloalkyl” refers to a heterocycloalkenyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom.
  • Bridged heterocycloalkenyl includes “bicyclic bridged heterocycloalkenyl” which includes two bridgehead carbon atoms and “polycyclic bridged heterocycloalkenyl” which includes more than two bridgehead carbon atoms.
  • aryl refers to an unsubstituted or substituted mono or polycyclic aromatic ring system containing carbon ring atoms.
  • the preferred aryls are mono cyclic or bicyclic aromatic ring systems. Phenyl and naphthyl are preferred aryls.
  • heteroaryl represents an aromatic ring system containing carbon (s) and at least one heteroatom.
  • Heteroaryl may be monocyclic or polycyclic, substituted or unsubstituted.
  • a monocyclic heteroaryl group may have 1 to 4 heteroatoms in the ring, while a polycyclic heteroaryl may contain 1 to 10 hetero atoms.
  • a polycyclic heteroaryl ring may contain fused, spiro or bridged ring junction, for example, bycyclic heteroaryl is a polycyclic heteroaryl.
  • Bicyclic heteroaryl rings may contain from 8 to 12 membered atoms.
  • Monocyclic heteroaryl rings may contain from 5 to 8 membered atoms (cabons and heteroatoms) .
  • heteroaryl groups include, but are not limited to thienyl, furanyl, imidazolyl, isoxazolyl, oxazolyl, pyrazolyl, pyrrolyl, thiazolyl, thiadiazolyl, triazolyl, pyridyl, pyridazinyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, benzofuranyl, benzothienyl, benzisoxazolyl, benzoxazolyl, benzopyrazolyl, benzothiazolyl, benzothiadiazolyl, benzotriazolyl adeninyl, quinolinyl or isoquinolinyl.
  • heterocyclyl or “heterocycle” as used herein refers to a single saturated or partially unsaturated non-aromatic ring or a non-aromatic multiple ring system that has at least one heteroatom in the ring (e.g., at least one annular heteroatom selected from oxygen, nitrogen, phosphorus and sulfur) .
  • a heterocyclyl group has from 3 to about 20 annular atoms, for example from 3 to 12 annular atoms, for example from 3 to 10 annular atoms, for example from 5 to 10 annular atoms or for example from 5 to 6 annular atoms.
  • the term includes single saturated or partially unsaturated rings (e.g., 3, 4, 5, 6 or 7-membered rings) having from about 1 to 6 annular carbon atoms and from about 1 to 3 annular heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur in the ring.
  • the rings of the multiple condensed ring (e.g. bicyclic heterocyclyl) system can be connected to each other via fused, spiro and bridged bonds when allowed by valency requirements.
  • heterocyclyl or “heterocyclic ring” or “heterocycle” includes heterocycloalkenyl groups (i.e., the heterocyclyl group having at least one double bond) .
  • a heterocyclyl may be a single ring or multiple rings wherein the multiple rings may be fused, bridged, or spiro.
  • heterocyclyl has 2 to 20 ring carbon atoms (i.e., C 2-20 heterocyclyl) , 2 to 12 ring carbon atoms (i.e., C 2-12 heterocyclyl) , 2 to 10 ring carbon atoms (i.e., C 2-10 heterocyclyl) , 2 to 8 ring carbon atoms (i.e., C 2-8 heterocyclyl) , 3 to 12 ring carbon atoms (i.e., C 3-12 heterocyclyl) , 3 to 8 ring carbon atoms (i.e., C 3-8 heterocyclyl) , or 3 to 6 ring carbon atoms (i.e., C 3-6 heterocyclyl) ; having 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms,
  • heterocyclyl groups include pyrrolidinyl, piperidinyl, piperazinyl, oxetanyl, dioxolanyl, azetidinyl, and morpholinyl.
  • bridged-heterocyclyl refers to a four-to ten-membered cyclic moiety connected at two non-adjacent atoms of the heterocyclyl with one or more (e.g., 1 or 2) four-to ten-membered cyclic moiety having at least one heteroatom where each heteroatom is independently selected from nitrogen, oxygen, and sulfur.
  • bridged-heterocyclyl includes bicyclic and tricyclic ring systems.
  • spiro-heterocyclyl refers to a ring system in which a three-to ten-membered heterocyclyl has one or more additional ring, wherein the one or more additional ring is three-to ten-membered cycloalkyl or three-to ten-membered heterocyclyl, where a single atom of the one or more additional ring is also an atom of the three-to ten-membered heterocyclyl.
  • spiro-heterocyclyl examples include bicyclic and tricyclic ring systems, such as 2-oxa-7-azaspiro [3.5] nonanyl, 2-oxa-6-azaspiro [3.4] octanyl, and 6-oxa-1-azaspiro [3.3] heptanyl.
  • Heterocyclyl groups also include partially unsaturated ring systems containing one or more double bonds, including fused ring systems with one aromatic ring and one non-aromatic ring, but not fully aromatic ring systems. Examples include dihydroquinolines (e.g. 3, 4-dihydroquinoline) , dihydroisoquinolines (e.g.
  • heterocycles include 3, 8-diazabicyclo [3.2.1] octanyl, 2, 5-diazabicyclo [2.2.1] heptanyl, 3, 6-diazabicyclo [3.1.1] heptanyl, 3-oxa-7, 9-diazabicyclo [3.3.1] nonanyl, and hexahydropyrazino [2, 1-c] [1, 4] oxazinyl, for example.
  • the terms “heterocycle” , “heterocyclyl” , and “heterocyclic ring” are used interchangeably.
  • Any hydrogen atom bond with C, N, O, or S in the 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl or 5-12 membered heteroaryl can be replaced with the substituent.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts. Accordingly, pharmaceutical compositions containing the compounds of the present invention as the active ingredient as well as methods of preparing the instant compounds are also part of the present invention. Furthermore, some of the crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents and such solvates are also intended to be encompassed within the scope of this invention.
  • the present invention includes any possible solvates and polymorphic forms.
  • a type of a solvent that forms the solvate is not particularly limited so long as the solvent is pharmacologically acceptable.
  • water, ethanol, propanol, acetone or the like can be used.
  • pharmaceutically acceptable salts refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids.
  • the compound of the present invention is acidic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic bases, including inorganic bases and organic bases.
  • the compound of the present invention is basic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Since the compounds are intended for pharmaceutical use they are preferably provided in substantially pure form, for example at least 60%pure, more suitably at least 75%pure, especially at least 98%pure (%are on a weight for weight basis) .
  • compositions of the present invention comprise a compound (or a pharmaceutically acceptable salt thereof) as an active ingredient, a pharmaceutically acceptable carrier and optionally other therapeutic ingredients or adjuvants.
  • the compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered.
  • the pharmaceutical compositions may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
  • the compounds or a prodrug or a metabolite or pharmaceutically acceptable salts thereof, of this invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques.
  • the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. oral or parenteral (including intravenous) .
  • the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient.
  • compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in-water emulsion or as a water-in-oil liquid emulsion.
  • the compound or a pharmaceutically acceptable salt thereof may also be administered by controlled release means and/or delivery devices.
  • the compositions may be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredient with the carrier that constitutes one or more (such as 1, 2, 3, 4, 5 or 6) necessary ingredients.
  • the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
  • compositions of this invention may include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt.
  • the compounds or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more (such as 1, 2, 3, 4, 5 or 6) other therapeutically active compounds.
  • a tablet containing the composition of this invention may be prepared by compression or molding, optionally with one or more (such as 1, 2, 3, 4, 5 or 6) accessory ingredients or adjuvants.
  • Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
  • Each tablet preferably contains from about 0.05mg to about 5g of the active ingredient and each cachet or capsule preferably containing from about 0.05mg to about 5g of the active ingredient.
  • a formulation intended for the oral administration to humans may contain from about 0.5mg to about 5g of active agent, compounded with an appropriate and convenient amount of carrier material which may vary from about 0.05 to about 95 percent of the total composition.
  • Unit dosage forms will generally contain between from about 0.0lmg to about 2g of the active ingredient, typically 0.01mg, 0.02mg, 1mg, 2mg, 3mg, 4mg, 5mg, 6mg, 7mg, 8mg, 9mg, 10mg, 25mg, 50mg, l00mg, 200mg, 300mg, 400mg, 500mg, 600mg, 800mg or l000mg.
  • compositions of the present invention suitable for parenteral administration may be prepared as solutions or suspensions of the active compounds in water.
  • a suitable surfactant can be included such as, for example, hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Further, a preservative can be included to prevent the detrimental growth of microorganisms.
  • compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions.
  • the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions.
  • the final injectable form must be sterile and must be effectively fluid for easy syringability.
  • the pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol) , vegetable oils, and suitable mixtures thereof.
  • compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder or the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations may be prepared, utilizing a compound of this invention or a pharmaceutically acceptable salt thereof, via conventional processing methods. As an example, a cream or ointment is prepared by admixing hydrophilic material and water, together with about 0.05wt%to about 10wt%of the compound, to produce a cream or ointment having a desired consistency.
  • compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by first mixing the composition with the softened or melted carrier (s) followed by chilling and shaping in molds.
  • the pharmaceutical formulations described above may include, as appropriate, one or more (such as 1, 2, 3, 4, 5 or 6) additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like.
  • other adjuvants can be included to render the formulation isotonic with the blood of
  • dosage levels on the order of from about 0.001mg/kg to about 150mg/kg of body weight per day are useful in the treatment of the above-indicated conditions or alternatively about 0.05mg to about 7g per patient per day.
  • inflammation, cancer, psoriasis, allergy/asthma, disease and conditions of the immune system, disease and conditions of the central nervous system (CNS) may be effectively treated by the administration of from about 0.001 to 50mg of the compound per kilogram of body weight per day or alternatively about 0.05mg to about 3.5g per patient per day.
  • the compound of formula (I-1) can be synthesized by the following steps:
  • the compound with -YH group and L 1 group such as S1-1 as starting material can be reacted with the compound such as S1-2 in the presence of an alkaline agent such as K 2 CO 3 to form the compound of S2-1;
  • the adjacent position of Y atom of compound S3-1 can be halogenated in the presence of halogenating reagents to afford compound S4-1.
  • the adjacent position of Y atom of compound S3-1 can be iodated in the presence of NIS.
  • the compound of S5-1 can be provided by reacting compound S4-1 with reagent S4-2 through a coupling reaction in the presence of a coupling catalyst;
  • the L 1 group of the compound S5-1 can be –converted to the target compound of formula (I-1) through one or more steps of reaction, for example, the compound S5-1 can be substituted with -NH 2 to generate a compound which can be converted to the target compound through a reductive amination reaction when R 2 is -NR 51 R 52 .
  • L 1 , L 2 and L 3 in the general synthetic schemes 1 independently represent a leaving group such as halogen (such as -Cl, -Br or -I) .
  • L 1 is selected from -Br;
  • L 2 is selected from -Br; and
  • L 3 is selected from -I.
  • Y in the general synthetic schemes 1 is selected from O or S;
  • the other variates such as X 2 , X 3 , X 4 , R 1 , R 2 , R 11 , R 12 , R 13 , R 3 , R 51 , R 52 and m are each defined as above in the present invention.
  • reaction mixture was stirred at room temperature for 1 h.
  • the reaction mixture was quenched with water (20 mL) and extracted with EA (40 mL x 2) .
  • the combined organic layers was washed with brine (20 mL) , separated and concentrated under vacuum.
  • the reaction mixture was stirred at room temperature for 1 h.
  • the reaction mixture was quenched with water (100 mL) , extracted with EA (100 mL ⁇ 2) , washed with brine (80 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • Step 1 N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine.
  • Step 2 4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (4) .
  • N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.067 g, 147.48 ⁇ mol)
  • 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.058 g, 275.86 ⁇ mol)
  • Pd (PPh 3 ) 2 Cl 2 (0.011 g, 15.58 ⁇ mol)
  • CuI (0.007 g, 36.76 ⁇ mol)
  • TEA 0.031 g, 306.36 ⁇ mol
  • DMF (1 mL)
  • the reaction was stirred under nitrogen atomosphere at RT for 3 h.
  • the reaction was quenched with water (20 mL) .
  • the resulted solution was extracted with EA (3 x 50 mL) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • Step 2 4- ( (3- (7- ( (3-fluoropiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) am ino) benzenesulfonamide
  • Step 3 4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5) and 4- ( (3- (7- ( ( (3R, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5b)
  • Step1 1- ( (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-triflu oroethyl) benzo [b] thiophen-7-yl) amino) piperidin-1-yl) -3-methoxypropan-2-ol (racemic) (6) .
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmol/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 50-80-100%B (2-30-60 min) ; 269 nm; RT: 33.838 –34.618) to provide the desired product.
  • Step 4 5-fluoro-2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline.
  • Step 5 N- (2- (3- ( (5-fluoro-2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (7) .
  • the mixture was stirred at 25°C for 4h.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 40-80-100%B (2-30-60min) ; 220 nm; RT: 23.767 –27.715 min; ) .
  • the reaction mixture was stirred at room temperature for 2 h.
  • the reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 4 mL) .
  • the organic layers was combined, washed with brine (5 mL) and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 45-75-100%B (2-30-60min) ; 270 nm; RT: 33.580 -36.570 min) .
  • Step 1 dimethyl (4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide (9) .
  • N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.049 g, 107.86 ⁇ mol)
  • dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide (0.068 g, 328.17 ⁇ mol)
  • Pd (PPh 3 ) 2 Cl 2 (0.009 g, 12.75 ⁇ mol)
  • CuI (0.004 g, 21.00 ⁇ mol)
  • TEA 0.015 g, 148.24 ⁇ mol
  • DMF 0.5 mL
  • Step 3 (4-amino-3- (fluoromethoxy) phenyl) dimethylphosphine oxide.
  • Step 4 (3- (fluoromethoxy) -4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide
  • Step 5 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3- (fluoromethoxy) phenyl) dimethylphosphine oxide (racemic) (10)
  • the reaction was stirred under nitrogen atmosphere at RT for 16 h.
  • the crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 30-30-60-80%B (0-2-30-60min) ; 262 nm; RT: 33.31-35.22) to provide the desired product.
  • N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-Amine (0.051 g, 112.26 ⁇ mol) , cuprous iodide (0.007 g, 36.76 ⁇ mol) , 2- (fluoromethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.028 g, 108.83 ⁇ mol) , bis (triphenylphosphine) palladium (II) chloride (0.023 g, 32.58 ⁇ mol) , triethylamine (0.024 g, 237.18 ⁇ mol) , methyl sulfoxide (2 mL) .
  • Step 1 2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline.
  • Step 2 N- (2- (3- ( (2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (12) .
  • Step 6 1-methyl-N- (2- (3- ( (4- (methylsulfonyl) -2- (2, 2, 2-trifluoroethoxy) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (13)
  • N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.045 g, 99.06 ⁇ mol) , cuprous iodide (0.009 g, 47.26 ⁇ mol) , 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -2- (2, 2, 2-trifluoroethoxy) aniline (0.036 g, 117.15 ⁇ mol) , bis (triphenylphosphine) palladium (II) chloride (0.026 g, 36.83 ⁇ mol) , triethylamine (0.022 g, 217.41 ⁇ mol) , methyl sulfoxide (2 mL) .
  • the reaction mixture was stirred at room temperature for 2 h.
  • the reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 4 mL) .
  • the organic layers was combined, washed with brine (5 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmol/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 45-80-100%B (2-30-60min) ; 270 nm; RT:33.274 -34.355 min) .
  • Step 1 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (racemic) (15)
  • the reaction was stirred under nitrogen atomosphere at RT for 6 h.
  • the reaction was quenched with water (5 mL) .
  • the resulted solution was extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 35-70-70%B (2-30-60min) ; 270 nm; RT: 25.18-26.87; ) to provide the desired product.
  • Step 1 N1- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] t hiophen-7-yl) -N4, N4-dimethylcyclohexane-1, 4-diamine (16) .
  • Step2 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) cyclohexan-1-one
  • Step 1 trans-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18) and cis-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino ) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18b) .
  • the reaction mixture was stirred at room temperature for 3 h.
  • Sodium cyanoborohydride (0.04 g, 636.53 mmol) was added to the reaction and stirred at room temperature for 2 h.
  • the reaction was then quenched by the addition of water.
  • the resulting solution was extracted with ethyl acetate (2 x 50 mL) , the organic layers combined and dried over anhydrous Na 2 SO 4 , filtered and concentrated under vacuum.
  • the resulting crude product was further purified by pre-HPLC with MeOH/H 2 O (0.1%ammonium hydroxide) , Flow rate: 25 mL/min; Gradient: 50-85-100%B (2-30-60min) ; 270 nm;RT: 36.800-38.238/40.647-42.205) .
  • Step 1 Synthesis of trans-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19) and cis-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19b)
  • Step 4 3-methoxy-N, N-dimethyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (21)
  • the reaction was stirred under nitrogen atomosphere at RT for 1 h.
  • the reaction was quenched with water (5 mL) .
  • the resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-80-95-95%B (2-30-45-60min) ; 220 nm; RT: 41.58-49.20) to provide the desired product.
  • Step 1 4- ( (3-methoxy-4-nitrophenyl) sulfonyl) morpholine
  • Step 4 N- (2- (3- ( (2-methoxy-4- (morpholinosulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (22)
  • the reaction was stirred under nitrogen atomosphere at RT for 2 h.
  • the reaction was quenched with water (5 mL) .
  • the resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40mL/min; Gradient: 40-80-80%B (2-30-60min) ; 220 nm; RT: 24.95-29.32) to provide the desired product.
  • reaction mixture was stirred at room temperature for 1 h.
  • the mixture was quenched with extracted with H 2 O (20 mL) , extracted with EA (20 mL x 2) .
  • the combined organic layers were washed with brine (10 mL) , separated and concentrated under vacuum.
  • reaction mixture was stirred at room temperature for 1 h.
  • the reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) .
  • the combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum.
  • Step 2 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -3-azabicyclo [3.2.1] octan-8-amine
  • Step 3 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.1] octan-8-amine (25)
  • the reaction was concentrated under vacuum.
  • the crude was added MeOH (3 mL) and Sodium cyanoboronhydride (0.159 g, 3.71 mmol) .
  • the reaction stirred overnight at RT.
  • the reaction was quenched with water (50 mL) , extracted with EA (3 x 20 mL) .
  • the organic layers combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • Step2 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -8-azabicyclo [3.2.1] octan-3-amine.
  • the mixture was extracted with EA (3 x 20 mL) .
  • the organic layers were combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the reaction was quenched with water (10 mL) , extracted with EA (20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L TFA) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-100-100%B (0-45-50min) ; 271 nm; RT: 43.810 –47.680 min) to provide the desired product.
  • Step 1 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-methyl-2-azabicyclo [2.2.1] heptan-5-amine (27) .
  • the reaction was stirred at rt for 12h before sodium cyanoboronhydride (0.037 g, 862.95 ⁇ mol) was added.
  • the reaction was stirred at rt for 5h.
  • the reaction was quenched with aq. Na 2 CO 3 (10 mL) , extracted with DCM (3 x 10 mL) , concentrated under vacuum.
  • Step 1 tert-butyl 5- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) -2-azabicyclo [2.2.1] heptane-2-carboxylate.
  • Step 2 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-azabicyclo [2.2.1] heptan-5-amine (28) .
  • reaction mixture was stirred at 0°C and trimethylsilyl trifluoromethanesulfonate (0.161 g, 724.38 ⁇ mol) was added.
  • the reaction was stirred at rt for 12h.
  • the reaction was quenched with aq. Na 2 CO 3 (10 mL) , extracted with DCM (3 x 10 mL) , concentrated under vacuum.
  • N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.044 g, 258.50 ⁇ mol)
  • N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.099 g, 217.92 ⁇ mol)
  • bis(triphenylphosphine) palladium (II) chloride 0.026 g, 36.83 ⁇ mol
  • cuprous iodide (0.009 g, 47.26 ⁇ mol)
  • triethylamine (0.038 g, 375.53 ⁇ mol)
  • methyl sulfoxide (5 mL) .
  • the reaction mixture was stirred at room temperature for 17 h.
  • the reaction was quenched by the addition of water (5 mL) and extracted with EA (2 x 5 mL) .
  • the organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-90-100%B (2-30-40min) ; 222 nm; RT: 36.225 –37.590 min) .
  • the reaction mixture was stirred under nitrogen at 50°C for 5 h.
  • the reaction was quenched with water (50 mL) .
  • the resulted solution was extracted with EA (3 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the reaction was stirred under nitrogen atomosphere at RT for 16 h.
  • the reaction was quenched with water (5 mL) .
  • the resulted solution was extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • Step 8 N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -3- (piperidin-4-yl) -1H-indol-7-amine (30)
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 30-70-100-100%B (2-30-60-90min) ; 228 nm; RT: 36.80-39.49) to provide the desired product.
  • Step 2 1- (4-fluoroindolin-1-yl) ethan-1-one.
  • Step 3 1- (4-fluoro-7-nitroindolin-1-yl) ethan-1-one.
  • Step 6 4-fluoro-7-nitro-1- (phenylsulfonyl) -1H-indole.
  • Step 7 4- (methylsulfonyl) -7-nitro-1- (phenylsulfonyl) -1H-indole.
  • Step 8 4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-amine.
  • Step 9 tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) carbamate.
  • Step 10 tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) (prop-2-yn-1-yl) carbamate.
  • Step 11 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine.
  • Step 12 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine.
  • Step 13 N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -4- (methylsulfonyl) -1H-indol-7-amine (31) .
  • Step 1 tert-butyl 6- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) -3-azabicyclo [3.2.0] heptane-3-carboxylate.
  • the reaction was cooled to room temperature, and sodium cyanoborohydride (211 mg, 3.43 mmol) , acetic acid (0.01 ⁇ mol) , Ethanol (0.5 mL) was added. The reaction was stirred for 1 h at room temperature.
  • Step 2 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -3-azabicyclo [3.2.0] heptan-6-amine.
  • Step 3 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.0] heptan-6-amine (32) .
  • reaction mixture was stirred at room temperature for 1 h.
  • the reaction mixture was quenched by the addition of water (80 mL) , extracted with EA (80 mL x 2) .
  • the combined organic layers was washed with brine (20 mL) , separated and concentrated under vacuum.
  • reaction mixture was stirred at 50°C for 1 h.
  • the reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) .
  • the combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum.
  • Step 1 1- (2-fluoroethyl) -N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (36)
  • the resulting solution was added to water (10 mL) .
  • the resulting solution was extracted with EA (2 x 10 mL) , the organic layers combined, dried over anhydrous Na 2 SO 4 , the residue was concentrated under vacuum.
  • the crude product purified by pre-HPLC with MeCN/H 2 O (0.1%ammonium hydroxide) , Flow rate: 70 mL/min; Gradient: 40-75-100%B (2-30-60min) ; 263 nm; RT: 33.540-34.450 min.
  • Step 1 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1- (2, 2, 2-trifluoroethyl) piperidin-4-amine (37)
  • the reaction mixture was stirred at room temperature for 2h.
  • the resulting solution was added to water (10 mL) .
  • the resulting solution was extracted with EA (2 x 10 mL) , the organic layers combined, dried over anhydrous Na 2 SO 4 , the residue was concentrated under vacuum.
  • the crude product purified by pre-HPLC with MeOH/H 2 O (0.1%ammonium hydroxide) , Flow rate: 40 mL/min; Gradient: 45-75-100%B (2-30-60min) ; 270 nm; RT: 38.379-40.311 min.
  • Step 1 tert-butyl 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) piperidine-1-carboxylate
  • Step 1 Synthesis of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine.
  • Step 2 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1, 4-dioxaspiro [4.5] decan-8-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine.
  • Step 3 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4 -yl) amino) cyclohexan-1-one.
  • Step 4 cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39) and trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39b) .
  • Step3. 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzenesulfonamide (racemic) (40) .
  • the reaction mixture was stirred at room temperature for 3 h.
  • the reaction was quenched by the addition of water (10 mL) and extracted with EA (3 x 10 mL) .
  • the organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 35-65-90%B (2-30-60min) ; 269 nm; RT: 32.043 –33.407 min) .
  • the reaction was stirred at 60°C for 3 h under nitrogen atmosphere.
  • the reaction was quenched with water (30 mL) , extracted with EA (3 x 20 mL) .
  • the organic layers was combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-30-60min) ; 269 nm; RT: 36.753 –38.278 min) to provide the desired product.
  • Step 3 (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide
  • Step 4 (4- ( (3- (7- ( (3, 3-difluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (43)
  • Step 2 4- (but-3-yn-2-ylamino) benzenesulfonamide .
  • Step 3 4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) ami no) benzenesulfonamide.
  • the mixture was stirred at 25°C for 4h.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonuim hydroxide) , Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 50-70-90%B (2-30-60min) ; 220 nm; RT: 33.580 -36.110 min) .
  • Step 4 (R) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide and (S) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide (44&45) .
  • Step 2 methyl 3-methoxy-4- (prop-2-yn-1-ylamino) benzoate.
  • Step 4 3-methoxy-4- (prop-2-yn-1-ylamino) benzamide.
  • Step 5 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzamide (racemic) (46) .
  • the mixture was stirred at 25°C for 4h.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-80-100%B (2-32-60min) ; 269 nm; RT: 33.448 –35.501 min) .
  • Step 1 3-methoxy-N- (1-methylpiperidin-4-yl) -4- (prop-2-yn-1-ylamino) benzamide.
  • Step 2 4- ( (3- (7- ( (3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-y n-1-yl) amino) -3-methoxy-N- (1-methylpiperidin-4-yl) benzamide (racemic) (47) .
  • reaction mixture was stirred at room temperature for 18 h.
  • the reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 2 mL) .
  • the organic layers was combined, washed with 15%potassium carbonate solution (2 x 2 mL) and brine (5 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • the reaction mixture was stirred at room temperature for 5 h.
  • the reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 2 mL) .
  • the organic layers was combined, washed with brine (5 mL) , dried over anhydrous Na 2 SO 4 and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-32-60min) ; 269 nm; RT: 30.797 –31.863 min) .
  • Step2 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (4-methylpiperazin-1-yl) methanone (racemic) (49) .
  • the reaction was stirred at 60°C for 2 h under nitrogen atmosphere.
  • the reaction was quenched with water (20 mL) , extracted with EA (20 mL x 2) .
  • the combined organic layers was washed with water (30 mL) and brine (30 mL) successively, separated and concentrated under vacuum.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 45-80-100%B (2-32-60min) ; 269 nm; RT: 39.863-41.317 min) to provide the desired product.
  • Step 1 (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (morpholino) methanone.
  • Step 2 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (morpholino) methanone (racemic) (50)
  • the mixture was stirred at 25°C for 4 h.
  • the mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-32-60min) ; 269 nm; RT: 37.007 –38.908 min; ) .
  • N- (4-fluoro-2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.408 g, 0.90 mmol) , selectfluor (0.375 g, 1.06 mmol) , MeCN (10 mL) . The reaction mixture was stirred at room temperature for 1 h.
  • reaction mixture was stirred at 50°C for 1 h.
  • the reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) .
  • the combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum.
  • Step 2 Synthesis of (2-fluoro-5-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide Into a 40-mL vial was placed (4-amino-2-fluoro-5-methoxyphenyl) dimethylphosphine oxide (0.654 g, 3.01 mmol) , DMA (15 mL) , cesium carbonate (3.149 g, 9.67 mmol) , sodium iodide (0.413 g, 2.76 mmol) , N- (4-pyridyl) dimethylamine (0.083 g, 679.40 ⁇ mol) , 3-bromoprop-1-yne (0.746 g, 6.27 mmol) .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention discloses compounds of formula (I) which can bind to mutant p53 and restore the ability of the p53 mutant to bind DNA and activate downstream effectors involved in tumor suppression. Also provided are processes for the synthesis and use of the compounds of formula (I).

Description

COMPOUNDS TARGETING Y220C MUTANT OF P53 FIELD OF THE INVENTION
The present invention relates to compounds that target p53 Y220C, pharmaceutical compositions comprising the compounds and the use thereof.
BACKGROUND OF THE INVENTION
The p53 protein, referred to as the “guardian of the human genome” , is a tetrameric transcription factor that prevents mutation to the genome by regulating the expression of a subgroup of target genes. Although biologically active as a homotetramer, each p53 monomer is comprised of 393 amino acids, and is divided into five key regulatory domains: the transactivation domain (TAD) , proline-rich region (PR) , the DNA binding domain (DBD) , the oligomerization domain (OD) , and the C-terminus.
Under normal conditions, the p53 protein has a “cancer suppressor” effect but p53 is unstable, with a half-life ranging from 5 to 30 minutes. Activation of p53 initiates pathways involved in apoptosis, DNA repair, cell cycle arrest, anti-angiogenesis, and senescence in order to avoid propagation of damaged cells. p53 activation occurs via a complicated regulatory network composed of three key steps: (1) p53 stabilization by phosphorylation, (2) DNA binding, and (3) target gene activation.
But once a mutation occurs, p53 will change and promote the development of cancer. Mutations in p53 located in the DNA binding domain of the protein or periphery of the DNA-binding surface result in aberrant protein folding required for DNA recognition and binding. Mutations in p53 can occur, for example, at amino acids Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, and Arg282. P53 mutations that can abrogate the activity of p53 include, for example, R175H, Y220C, G245S, R248Q, R248W, R273H, and R282W. These p53 mutations can either distort the structure of the DNA-binding site or thermodynamically destabilize the folded protein at body temperature. Wild-type function of p53 mutants can be recovered by binding of the p53 mutant to a compound that can shift the folding-unfolding equilibrium towards the folded state, thereby reducing the rate of unfolding and destabilization.
The p53 Y220C mutation is associated with many cancers, including breast cancer, non-small cell lung cancer, colorectal cancer, pancreatic cancer, and ovarian cancer.
SUMMARY OF THE INVENTION
The present disclosure provides the following aspect.
[1] A compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof:
Y is selected from O, S, S=O, -S (=O) (=NR’ ) -or O=S=O;
one of X1, X2, X3 and X4 is selected from CR2, and the others of X1, X2, X3 and X4 are each independently selected from N or CR4;
X5 is selected from N or CR1;
R1 is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl;
R2 is -NR51R52, -OR53 or -SR54;
R3 is selected from hydrogen, deuterium, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -S (O) R’ , -S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents of R3a;
each R3a is independently selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -S (=O) (=NR’ ) R’ , -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more substituents R3b,
each R3b is independently selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -S (=O) (=NR’ ) R’ , -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2;
R4 at each occurrence is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -S (=O) (=NR’ ) R’ , -NR’ S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl;
R51, R52, R53 and R54 are each independently selected from hydrogen, deuterium, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -S (O) R’ , -S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -PO(R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, =NR’ , -C1-6alkyl-CH (R’ ) 2, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, -S (O) R’ , -S (O) N (R’ ) 2, -NR’S (O) R’ , -NR’S (O) N (R’ ) 2, -S (O) 2R’ , -S (O) 2N (R’ ) 2, -S (=O) (=NR’ ) R’ , -NR’S (O) 2R’ , -NR’S (O) 2N (R’ ) 2, -PO (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl;
R11 and R12 are independently selected from hydrogen, deuterium, -OH, halogen, -CN, oxo, -C1-6alkyl, -C1-6 haloalkyl, -C1-6alkoxy, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2 or 3-6 membered cycloalkyl; wherein said -C1-6alkyl, -C1-6alkoxy and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C1-6alkoxy, -NH-C1-6alkyl, -N (C1-4 alkyl) 2, or 3-6 membered cycloalkyl;
R13 is selected from hydrogen, deuterium, -C1-6alkyl or 3-6 membered cycloalkyl; wherein said -C1-6alkyl and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C1-6alkoxy, -NH2, -NHC1-6alkyl, or -N (C1-4 alkyl) 2;
each R’a t each occurrence is independently selected from hydrogen, deuterium, halogen, -OH, -CN, oxo, -NH2, -NHC1-6 alkyl, -N (C1-6 alkyl) 2, -C1-6alkyl, -C1-6alkylOC1-6alkyl, -C1-6alkyl-NHC1-6alkyl, -C1-6alkyl-N (C1-6alkyl) 2 , -C1-6haloalkyl, -OC1-6alkyl, -C3-14cycloalkyl, -C3-14heterocycloalkyl, -C2-6alkenyl, -C2-6alkynyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl; wherein said -C1-6alkyl, -OC1-6alkyl, -C3-14cycloalkyl, -C3-14heterocycloalkyl, -C2-6alkenyl, -C2-6alkynyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, halogen, -CN, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl; or
two adjacent R’ , together with the atoms to which they are attached respectively, can form 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl, each of which is independently optionally substituted with one or more substituents selected from deuterium, halogen, -CN, -C1-3alkyl, -C1-3haloalkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, 3-6 membered heterocyclyl, or 3-6 membered cycloalkyl;
said heterocycloalkyl, heterocycloalkenyl, and heteroaryl each independently contains 1, 2, 3, 4 or 5 heteroatoms selected from N, O, P or S;
m is selected from 1, 2, 3, 4, 5 or 6.
[2] The compound according to [1] , wherein,
the formula (I) is:
X2, X3, and X4 in the formula (I-1) are each independently selected from N or CR4;
Y is selected from O, S, S=O, or O=S=O.
[3] The compound according to [1] or [2] , wherein, the formula (I) is:
[4] The compound according to [1] or [2] , wherein, the formula (I) is:
[5] The compound according to [1] or [2] , wherein, the formula (I) is:
[6] The compound according to [1] or [2] , wherein, the formula (I) is:
[7] The compound according to [1] or [2] , wherein, the formula (I) is:
[8] The compound according to [1] or [2] , wherein, the formula (I) is:
[9] The compound according to [1] or [2] , wherein, the formula (I) is:
[10] The compound according to any one of [1] to [3] , wherein,
the formula (I) is selected from:
[11] The compound according to any one of [1] to [10] , wherein, R1 is independently selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
[12] The compound according to any one of [1] to [11] , wherein, R1 is independently selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, oxo, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
[13] The compound according to any one of [1] to [12] , wherein, R1 is independently selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
[14] The compound according to any one of [1] to [12] , wherein R1 is independently selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S, or 6 membered heteroaryl containing 1 or 2 heteroatoms selected from N; said -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl and 6 membered heteroaryl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
[15] The compound according to any one of [1] to [14] , wherein R1 is independently selected from -C1-3alkyl; -C1-3haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C1-3alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
[16] The compound according to any one of [1] - [15] , wherein, R1 is independently selected from
[17] The compound according to any one of [1] to [16] , wherein, R2 is -NR51R52.
[18] The compound according to any one of [1] to [17] , wherein, R2 is -NHR51.
[19] The compound according to any one of [1] to [18] , wherein, R51 is selected from -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, 5-6 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, =NR’ , -C1-6alkyl-CH (R’ ) 2, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -OC (O) N (R’ ) 2, -N (R’ ) 2, -NR’ C (O) R’ , -NR’ C (O) OR’ , -NR’ C (O) N (R’ ) 2, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
[20] The compound according to any one of [1] to [19] , wherein, R51 is selected from -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2 or 6 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2; said -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl and 6 membered heterocyclyl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, oxo, =NH, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
[21] The compound according to any one of [1] to [20] , wherein, R51 is selected from -C1-6alkyl, 5 membered cycloalkyl, 5 membered heterocycloalkyl, 6 membered cycloalkyl, or 6 membered heterocycloalkyl; said -C1-6alkyl, cycloalkyl, and heterocycloalkyl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH(OH) CH2 (OH) , -CH (OCH3) CH2 (OH) , -CH (OH) CH2 (OCH3) , -CH2CH (OH) (OCH3) , -CH2CH (OH) (OCH2CH3) , -CH2CH (OCH3) 2, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -C (O) - (CH2) -NH2, -C (O) - (CH2) -NH (CH3) , -C (O) - (CH2) -NH (CH2CH3) , -C (O) - (CH2) -N (CH3) 2, -C (O) - (CH2CH2) -NH2, -C (O) - (CH2CH2) -NH (CH3) , -C (O) - (CH2CH2) -NH (CH2CH3) , -C (O) - (CH2CH2) -N (CH3) 2, -NH2, -NH (CH3) , -NH (CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , or -N (CH3) (CH2CH3) , said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
[22] The compound according to any one of [1] to [21] , wherein, R51 is selected from or -C1-6alkyl, said -C1-6alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R5e;
R5a, R5c and R5d are each independently selected from hydrogen; -C1-6alkyl; or -C1-6alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R5b and R5e are each independently selected from -F, -C1-6alkyl, oxo, -OC1-6alkyl, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-6alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
[23] The compound according to any one of [1] to [22] , wherein, R51 is selected from or -C1-3alkyl-N (C1-3alkyl) 2;
R5a is independently selected from -C1-3alkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R5b is independently selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2 or -CN;
R5c and R5d are each independently selected from -C1-3alkyl.
[24] The compound according to any one of [1] to [22] , wherein, R51 is selected from or -CH2CH2-N (CH3) 2;
R5a is independently selected from methyl, -CH2CH (OH) OCH3 or -C (=O) CH2N (CH3) 2;
R5b is independently selected from -F;
R5c and R5d are each independently selected from methyl.
[25] The compound according to any one of [1] to [24] , R51 is selected from
[26] The compound according to any one of [1] - [25] , wherein R3 is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -NO2, -OR’ , -SR’ , -C (O) R’ , -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -N (R’ ) 2, -NR’ C (O) R’ , -S (O) R’ , -NR’S (O) R’ , -S (O) N (R’ ) 2, -S (O) 2R’ , -NR’S (O) 2R’ , -S (O) 2N (R’ ) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl at each occurrence is independently optionally substituted with one or more substituents selected from halogen, NH2, NH-C1-6alkyl, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -NO2, -OR’ , -SR’ , -C (O) R’ , oxo, -C (O) N (R’ ) 2, -C (O) OR’ , -OC (O) R’ , -N (R’ ) 2, -NR’ C (O) R’ , -S (O) R’ , -NR’S (O) R’ , -S (O) N (R’ ) 2, -S (O) 2R’ , -NR’S (O) 2R’ , -S (O) 2N (R’ ) 2, -S (=O) (=NR’ ) R’ , 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
[27] The compound according to any one of [1] to [25] , wherein R3 is independently selected from phenyl, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R3c;
R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -OC3-6cycloalkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NH) C3-6cycloalkyl; -S (=O) (=NC3-6cycloalkyl) C1-3alkyl; -S (=O) (=NC2-6heterocycloalkyl) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -S (=O) (=NCN) C1-3alkyl; or 3-6 membered cycloalkyl; wherein said C1-3alkyl, C3-6cycloalkyl, C2-6heterocycloalkyl or OC1-3alkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -CN, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
[28] The compound according to any one of [1] to [27] , wherein R3 is independently selected from phenyl or pyridinyl.
[29] The compound according to any one of [1] to [28] , wherein R3 is independently selected from phenyl, 5 membered heteroaryl, 6 membered heteroaryl ring; said phenyl and heteroaryl at each occurrence are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH2F, -CHF2, -CF3, -CH2CH2F, -CH2CHF2, -CH2CF3, -CHFCH3, -CF2CH3, -CHFCH2F, -CH2CHFCH3, -CH2CF2CH3, -CH2CH2CF3, -C (CH3) 2F, -CN, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -SH, -S-CH3, -S-CH2CH3, -S-CH2CH2CH3, -S-CH (CH3) 2, -CHO, -C (O) -CH3, -C (O) -CH2CH3, -C (O) -CH2CH2CH3, -C (O) -CH (CH3) 2, -C (O) NH2, -C (O) NH (CH3) , -C (O) NH (CH2CH3) , -C (O) N (CH3) 2, -C (O) NH (CH2CH2CH3) , -C (O) NH (CH (CH3) 2) , -C (O) N (CH3) (CH2CH3) , -NH2, -NH (CH3) , -NH (CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , -N (CH3) (CH2CH3) , -NHC (O) (CH3) , -NHC (O) (CH2CH3) , -NHC (O) (CH3) 2, -NHC (O) (CH2CH2CH3) , -NHC (O) (CH (CH3) 2) , -NHC (O) (CH3) (CH2CH3) , -S (O) 2H, -S (O) 2 (CH3) , -S (O) 2 (CH2CH3) , -S (O) 2 (CH3) 2, -S (O) 2 (CH2CH2CH3) , -S (O) 2 (CH (CH3) 2) , -S (O) 2 (CH3) (CH2CH3) , -S (O) 2NH2, -S (O) 2NH (CH3) , -S (O) 2NH (CH2CH3) , -S (O) 2N (CH3) 2, -S (O) 2NH (CH2CH2CH3) , -S (O) 2NH (CH (CH3) 2) , -S (O) 2N (CH3) (CH2CH3) , -S (=O) (=NH) CH3, or -S (=O) (=NCH3) CH3, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
[30] The compound according to any one of [1] to [29] , R3 is independently selected from phenyl, 5 membered heteroaryl, or 6 membered heteroaryl; said phenyl and heteroaryl at each occurrence is independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH2F, -CF3, -CH2CH2F, -CHFCH3, -CF2CH3, -C (CH3) 2F, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -C (O) NH2, -C (O) NH (CH3) , -C (O) NH (CH2CH3) , -C (O) N (CH3) 2, -C (O) NH (CH2CH2CH3) , -C (O) NH (CH (CH3) 2) , -C (O) N (CH3) (CH2CH3) , -NH2, -NH (CH3) , -NH(CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , -N (CH3) (CH2CH3) , -S (O) 2H, -S (O) 2 (CH3) , -S (O) 2 (CH2CH3) , -S (O) 2 (CH3) 2, -S (O) 2 (CH2CH2CH3) , -S (O) 2 (CH (CH3) 2) , -S (O) 2 (CH3) (CH2CH3) , -S (O) 2NH2, -S (O) 2NH (CH3) , -S (O) 2NH (CH2CH3) , -S (O) 2N (CH3) 2, -S (O) 2NH (CH2CH2CH3) , -S (O) 2NH (CH (CH3) 2) , -S (O) 2N (CH3) (CH2CH3) , -S (=O) (=NH) CH3, or -S (=O) (=NCH3) CH3, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
[31] The compound according to any one of [1] to [30] , R3 is independently selected from 
[32] The compound according to any one of [1] to [31] , the formula (I) is:
wherein,
R51 is selected from -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2 or 6 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2; said -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl and 6 membered heterocyclyl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, oxo, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R1 is independently selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, oxo, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S;
each of R4 is independently selected from hydrogen, deuterium, -F, -Cl, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R11 and R12 are independently selected from hydrogen, deuterium, -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-3alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R13 is selected from hydrogen; -C1-3alkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R3 is independently selected from phenyl, 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R3c;
R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2N (C1-3alkyl) 2; 3-6 membered cycloalkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -CN, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
[33] The compound according to [32] , wherein,
R51 is selected from or -C1-6alkyl, said -C1-6alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R5e;
R5a, R5c and R5d are each independently selected from hydrogen; -C1-6alkyl; or -C1-6alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R5b and R5e are each independently selected from -F, -C1-6alkyl, oxo, -OC1-6alkyl, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-6alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R1 is independently selected from -C1-3alkyl; -C1-3haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C1-3alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
each of R4 is independently selected from hydrogen, deuterium, -F, -Cl, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
R11 and R12 are independently selected from hydrogen or -C1-3alkyl;
R13 is selected from hydrogen or -C1-3alkyl;
R3 is independently selected from phenyl, said phenyl is independently optionally substituted with 1, 2, 3 substituents selected from R3c;
R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2,  -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) CH3; or -S (=O) (=NCH3) CH3.
[34] The compound according to [33] , wherein,
R51 is selected from
R1 is independently selected from
each of R4 is hydrogen;
R11 and R12 are independently selected from hydrogen;
R13 is selected from hydrogen;
R3 is independently selected from
[35] . The compound according to any one of [1] to [34] , wherein the formula (I) is:
[36] . The compound according to [35] , wherein R1 is independently selected from -C1-3haloalkyl; or -C1-3alkyl optionally substituted with 1, 2 or 3 substituents selected from -F, -CN, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2 or 3-6 membered cycloalkyl such as cyclopropyl.
[37] . The compound according to [35] or [36] , wherein R1 is independently selected from
[38] . The compound according to any one of [35] to [37] , wherein R2 is -NHR51.
[39] . The compound according to any one of [35] to [38] , wherein R51 is selected from -C1-6alkyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, or 3-10 membered heterocycloalkyl; said -C1-6alkyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, or 3-10 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl, or 5-6 membered heterocycloalkyl optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl) , -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OH, -NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) C1-6alkyl, -C (O) C1-6alkyl-NHC1-6alkyl, -C (O) C1-6alkyl-N (C1-6alkyl) 2, -C (O) NHC1-6alkyl, -C (O) N (C1-6alkyl) 2, -C (O) OC1-6alkyl, -OC (O) C1-6alkyl, -NHC1-6alkyl, -N (C1-6alkyl) 2, 3-6 membered cycloalkyl, or 3-12 membered heterocycloalkyl such as 5-12 membered spiro-heterocyclyl or bridged-heterocyclyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, or -OC1-6alkyl) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S.
[40] . The compound according to any one of [35] to [39] , wherein R51 is selected from -C1-6alkyl, 3-6 membered cycloalkyl, or 5-10 membered heterocycloalkyl such as 5-10 membered spiro-heterocyclyl or bridged-heterocyclyl; said -C1-6alkyl, 3-6 membered cycloalkyl, or 5-10 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl, or ) , -CN, -OH, NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) C1-6alkyl-NHC1-6alkyl, -C (O) C1-6alkyl-N (C1-6alkyl) 2, -NHC1-6alkyl, -N (C1-6alkyl) 2, 3-5 membered cycloalkyl, or 5-12 membered heterocycloalkyl such as 5-12 membered spiro-heterocyclyl or bridged-heterocyclyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, or -OC1-6alkyl) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S.
[41] . The compound according to any one of [35] to [40] , wherein R51 is selected from -C1-3alkyl, cyclohexyl, or 6-8 membered heterocycloalkyl such as 6-8 membered spiro-heterocyclyl or bridged-heterocyclyl; said -C1-3alkyl, cyclohexyl, or 6-8 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of oxo, =NH, -OH, -OC1-6alkyl, or) , -CN, -OH, NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) CH2-NHC1-6alkyl, -C (O) CH2-N (C1-6alkyl) 2, -NHC1-6alkyl, -N (C1-6alkyl) 2, cyclopropyl, or 5-12 membered heterocycloalkyl (such as  ) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S, preferably R51 is
[42] . The compound according to any one of [35] to [41] , wherein R2 is selected from:

[43] . The compound according to any one of [35] to [42] , wherein R3 is independently selected from phenyl, 5-10 membered heterocycloalkenyl containing 1 or 2 heteroatoms selected from N, O or S, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; each of which is independently optionally substituted with 1, 2, 3 substituents selected from R3a;
wherein R3a is selected from halogen; oxo; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NH) C3-6cycloalkyl; -S (=O) (=NH) C2-6heterocycloalkyl; -S (=O) (=NC3-6cycloalkyl) C1-3alkyl; -S (=O) (=NC2-6heterocycloalkyl) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -S (=O) (=NCN) C1-3alkyl; -N (C1-3alkyl) S (=O) 2C1-3alkyl; -PO (C1-3alkyl) 2; 3-6 membered cycloalkyl; 3-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, P or S; wherein said C1-3alkyl, OC1-3alkyl, 3-6 membered cycloalkyl, C3-6cycloalkyl, C2-6heterocycloalkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, halogen, -CN, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -COOH, -C (O) OC1-3alkyl, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
[44] . The compound according to [43] , wherein R3 is independently selected from phenyl, pyridinyl, and 5-10 membered benzoheterocycloalkyl containing 1 or 2 heteroatoms selected from N, O or S, each of which is optionally substituted with 1, 2, 3 substituents selected from R3a;
wherein R3a is selected from -F; oxo; -OC1-3alkyl; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -N (C1-3alkyl) S (=O) 2C1-3alkyl; -PO (C1-3alkyl) 2; or 3-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, P or S; wherein said C1-3alkyl, OC1-3alkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -CN, oxo, -C1-3alkyl, -OH, -OC1-3alkyl, -N (C1-3alkyl) 2, -C (O) OC1-3alkyl, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , or -C (=O) N (C1-3alkyl) 2.
[45] . The compound according to [44] , wherein R3 is independently selected from phenyl, pyridinyl, each of which is optionally substituted with 1, 2, 3 substituents selected from R3a;
wherein R3a is selected from -F; oxo; -OC1-3alkyl; -C (=O) NHC1-3alkyl; -S (=O) 2NH2; -S (=O) 2NHC (=O) CH3; -S (=O) 2CH3; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -N (CH3) S (=O) 2CH3; -PO (C1-3alkyl) 2; morpholinyl or 5-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, or P; wherein said C1-3alkyl, OC1-3alkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -CN, oxo, -OH, -OCH3, -N (C1-3alkyl) 2, -C (O) OCH3, or -C (=O) NH2.
[46] . The compound according to any one of [35] to [45] , wherein R3 is independently selected from phenyl optionally substituted with 1, 2, 3 substituents selected from R3a;
wherein R3a is selected from: -F, -OCH3, -OCD3, -OCH2CN, -OCH2CF3, -CH2F, -CHF2, -OCH2CH2OH, -OCH2CH2OCH3, -S (O) 2NH2, -S (O) 2NHCOCH3, -S (O) 2CH3, -S (=O) (=NH) CH3, -S (=O) (=NCH3) CH3, -N (CH3) S (=O) 2CH3, -C (O) NHCH3, -C (O) NHCH (COOCH3) CH2CH2CONH2, -PO (CH3) 2, morpholinyl,
[47] . The compound according to any one of [1] to [46] , wherein both of R11 and R12 are hydrogen.
[48] . The compound according to any one of [1] to [47] , wherein R13 is H.
[49] . The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[50] . The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[51] . The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[52] . The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[53] . The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[54] The compound according to any one of [1] to [48] , wherein the chemical moietyis selected from:
[55] . The compound according to any one of [1] to [54] , wherein the compound of formula (I) is selected from:
















[56] . The compound according to any one of [1] to [54] , wherein the compound of formula (I) is selected from: 
















[57] . The compound according to any one of [1] to [54] , wherein the compound of formula (I) is selected from:








[58] . The compound according to any one of [1] to [54] , wherein the compound of formula (I) is selected from:











[59] . The compound according to any one of [1] to [54] , wherein the compound of formula (I) is selected from:





[60] . A pharmaceutical composition, comprising a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of [1] - [59] , and a pharmaceutically acceptable carrier, diluent, or excipient.
[61] . Use of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of [1] - [59] , or a pharmaceutical composition according to [60] in the manufacture of a medicament for the treatment of a disease or condition in a subject.
[62] . The use according to [61] , wherein the disease or condition is cancer.
[63] . The use according to [62] , wherein the cancer cell expresses the p53 mutant.
[64] . The use according to [63] , wherein the p53 mutant has a mutation at amino acid Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282, and/or a combination thereof.
[65] . The use according to [63] , wherein the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W, and/or a combination thereof, preferably Y220C.
[66] . The use according to any one of [61] to [65] , wherein the disease or condition is selected from the group consisting of ovarian cancer, breast cancer and lung cancer.
[67] . A method for treating a disease or condition related to p53 mutant protein, comprising administering to a subject a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof to any one of [1] - [59] , or a pharmaceutical composition according to [60] .
[68] . The method according to [67] , wherein the disease or condition is cancer.
[69] . The method according to [68] , wherein the cancer cell expresses the p53 mutant.
[70] . The method according to [69] , wherein the p53 mutant has a mutation at amino acid Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282, and/or a combination thereof.
[71] . The method according to [69] , wherein the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W, and/or a combination thereof, preferably Y220C.
[72] . The method according to any one of [67] to [71] , wherein the disease or condition is selected from the group consisting of ovarian cancer, breast cancer and lung cancer.
DETAILED DESCRIPTION
The present invention provides compounds and methods for restoring wild-type function to mutant p53. The compounds of the present invention can bind to mutant p53 and restore the ability of the p53 mutant to bind DNA. The restoration of activity of the p53 mutant can allow for the activation of downstream effectors of p53 leading to inhibition of cancer progression.
The Y220C mutant is a temperature sensitive mutant, which binds to DNA at lower temperature and is denatured at body temperature. A compound of the invention can selectively bind to the p53 Y220Cs and tabilize the Y220C mutant to reduce the likelihood of denaturation of the protein at body temperature.
The total number of carbon atoms present in a chemical group as defined herein is represented by a shorthand notation before the group. For example, C1-6 alkyl refers to an alkyl group as defined hereinafter having 1 to 6 carbon atoms in total; C3-8 cycloalkyl refers to a cycloalkyl group as defined hereinafter having 3 to 8 carbon atoms in total; C6-10 aryl refers to an aryl group as defined hereinafter having 6 to 10 carbon atoms in total. Carbon atoms that may exist in the substituents of the chemical group are not included in the total number of carbon atoms in the shorthand notation.
Unless otherwise indicated in this specification, all combined groups according to the present invention (i.e., groups comprised of two or more groups) are attached to the rest of the molecule in such a way that the lastly described group acts as the point of attachment. By way of example, "arylalkyl" means that the aryl group is attached to the rest of the molecule via the alkyl group; "alkoxyl" means that the aliphatic group is attached to the rest of the molecule via an oxy group; etc.
In the present application, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. Also, the term “optionally substituted” refers to any one or more hydrogen atoms on the designated atom or group may or may not be replaced by a moiety other than hydrogen. For example, "alkyl optionally substituted by one or more (such as 1, 2, 3, 4, 5 or 6) halogens" means the alkyl group is unsubstituted or substituted by one or more (such as 1, 2, 3, 4, 5 or 6) halogens, and that the description includes both substituted alkyl groups and unsubstituted alkyl groups.
The term “substituted” means that any one or more hydrogen atoms on the designated atom or group is replaced with one or more substituents other than hydrogen, provided that the designated atom's normal valence is not exceeded. The term "substituted" , unless otherwise indicated, refers to any level of substitution, e.g., mono-, di-, tri-, tetra-or penta-substitution, where such substitution is permitted. The substituents are independently selected, and substitution may be at any chemically accessible position. It is to be understood that substitution at a given atom is limited by valency. It is to be understood that substitution at a given atom results in a chemically stable molecule. As used herein, the term “substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds. The permissible substituents can be one or more and the same or different for appropriate organic compounds. The phrase "optionally substituted” means unsubstituted or substituted. The term "substituted" means that a hydrogen atom is removed and replaced by a substituent. A single divalent substituent, e.g., oxo, can replace two hydrogen atoms.
The term "stereoisomer" refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures. The present invention contemplates various stereoisomers and mixtures thereof.
Stereochemical definitions and conventions used herein generally follow S. P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., " Stereochemistry of Organic Compounds" , John Wiley &Sons, Inc., New York, 1994. The compounds describ ed herein may contain asymmetric or chiral centers, and therefore exist in different stereoisomeric forms. Man y organic compounds exist in optically active forms, i.e., they have the ability to rotate the plane of plane-polarized light. In describing an optically active compound, the pre fixes D and L, or R and S, are used to denote the absolute configuration of the molecule about its chiral center (s) . The prefixes d and l or (+) and (-) are employed to designate the sign of rotation of plane-polarized light by the compound, with (-) or 1 meaning that the compound is levorotatory. A compound prefixed with (+) or d is dextrorotatory. For a given chemical structure, these stereoisomers are identical except that they are mirror images of one another. A specific stereoisomer may also be referred to as an enantiomer, and a mixture of such iso mers is often called an enantiomeric mixture. A 50: 50 mixture of enantiomers is referred to as a racemic mixtu re or a racemate, which may occur where there has been no stereoselection or stereospecificity in a chemical re action or process. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiome ric species, devoid of optical activity.
The term “tautomer” refers to an isomer resulted from a proton shift from one atom of a molecule to another atom of the same molecule. All tautomeric forms of the compound of formula Ⅰ of the present invention are included within the scope of the present invention.
Unless specified otherwise, the alkenyl of the compound in the present application includes both E-and Z-geometric isomers.
Unless specified otherwise, the bondin this application includes
All isotopes of any particular atom or element as specified are contemplated within the scope of the compounds of the invention and their uses. Isotopes include those atoms having the same atomic number but different mass numbers. Exemplary isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine and iodine, such as 2H, 3H, 11C, 13C, 14C, 13N, 15N, 15O, 17O, 18O, 32P, 33P, 35S, 18F, 36Cl, 123I or 125I. By way of general example and without limitation, isotopes of hydrogen include deuterium and tritium. The isotopes of hydrogen can be denoted as 1H (hydrogen) , 2H (deuterium) and 3H (tritium) . They are also commonly denoted as D for deuterium and T for tritium. In the application, CD3 denotes a methyl group wherein all of the hydrogen atoms are deuterium. Isotopes of carbon include 13C and 14C. Isotopically labeled compounds of the present disclosure are equivalent to those unlabeled, for example, deuterated compounds of the present disclosure are equivalent to those non-deuterated. Isotopically-labeled compounds of the invention can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described herein, using an appropriate isotopically-labeled reagent in place of the non-labeled reagent.
As used herein, “deuterated derivative” refers to a compound having the same chemical structure as a reference compound, but with one or more hydrogen atoms replaced by a deuterium atom ( “D” or “2H” ) . It will be recognized that some variation of natural isotopic abundance occurs in a synthesized compound depending on the origin of chemical materials used in the synthesis. Notwithstanding this variation, the concentration of naturally abundant stable hydrogen isotopes is small and immaterial as compared to the degree of stable isotopic substitution of deuterated derivatives described herein. Thus, unless otherwise stated, when a reference is made to a “deuterated derivative” of a compound of the disclosure, at least one hydrogen is replaced with deuterium at a level that is well above its natural isotopic abundance, which is typically about 0.015%. In some embodiments, the deuterated derivatives disclosed herein have an isotopic enrichment factor for each deuterium atom, of at least 3500 (52.5%deuterium incorporation at each designated deuterium) , at least 4500 (67.5%deuterium incorporation at each designated deuterium) , at least 5000 (75%deuterium incorporation at each designated deuterium) , at least 5500 (82.5%deuterium incorporation at each designated deuterium) , at least 6000 (90%deuterium incorporation at each designated deuterium) , at least 6333.3 (95%deuterium incorporation at each designated deuterium) , at least 6466.7 (97%deuterium incorporation at each designated deuterium) , or at least 6600 (99%deuterium incorporation at each designated deuterium) . The term “isotopic enrichment factor” as used herein means the ratio between the isotopic abundance and the natural abundance of a specified isotope.
In addition to the above-mentioned, as used in the specification and claims, unless otherwise indicated, the following terms have the meanings as set forth below:
"amino" refers to the -NH2 group.
"cyano" refers to the -CN group.
"hydroxy" refers to the---OH group
"nitro" refers to the -NO2 group.
“carboxyl” refers to the –COOH group.
“nitroso” refers to the-N=O group.
The term “halogen” , as used herein, unless otherwise indicated, means fluoro, chloro, bromo or iodo. The preferred halogen groups include -F, -Cl and -Br.
The term “alkyl” , as used herein, unless otherwise indicated, includes saturated monovalent hydrocarbon radicals having straight or branched. For example, alkyl radicals include methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n-pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl. Similary, C1-6, as in C1-6alkyl is defined to identify the group as having 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement.
The term “alkenyl” means a straight or branch-chained hydrocarbon radical containing one or more (such as 1, 2, 3, 4, 5 or 6) double bonds and typically from 2 to 20 carbon atoms in length. For example, “C2-6alkenyl” contains from 2 to 6 carbon atoms. Alkenyl group include, but are not limited to, for example, ethenyl, propenyl, butenyl, 2-methyl-2-buten-1-yl, hepetenyl, octenyl and the like.
The term “alkynyl” contains a straight or branch-chained hydrocarbon radical containing one or more (such as 1, 2, 3, 4, 5 or 6) triple bonds and typically from 2 to 20 carbon atoms in length. For example, “C2-6alkynyl” contains from 2 to 6 carbon atoms. Representative alkynyl groups include, but are not limited to, for example, ethynyl, 1-propynyl, 1-butynyl, heptynyl, octynyl and the like.
The term “alkoxyl” radicals are oxygen ethers formed from the previously described alkyl groups.
The term “oxo” refers to the group =O or (O) , or an oxygen atom attached to other atom (e.g. C, N, S, or P) via a double bond.
A “cycloalkyl” is a cyclic hydrocarbon which is completely saturated. “cycloalkyl” includes monocyclic and bicyclic rings. Typically, a monocyclic cycloalkyl has from 3 to about 12 carbon atoms, more typically 3 to 8 carbon atoms unless otherwise defined, examplary “cycloalkyl” groups includes but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and so on. Cycloalkyl includes bicyclic molecules in which one, two or three or more atoms are shared between the two rings. The term “spirocyclic cycloalkyl” refers to a bicyclic cycloalkyl in which each of the rings shares one adjacent atom with the other ring. The term “fused cycloalkyl” refers to a bicyclic cycloalkyl in which each of the rings shares two adjacent atoms with the other ring. The term “bridged cycloalkyl” refers to a cycloalkyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom. “bridged cycloalkyl” includes “bicyclic bridged cycloalkyls” which includes two bridgehead carbon atoms and “polycyclic bridged cycloalkyls” which includes more than two bridgehead carbon atoms. Typical bridged cycloalkyls include, but are not limited to adamantyl, noradamantyl, bicyclo [1.1.0] butanyl, norboranyl (bicyclo [2.2.1] heptanyl) , norbomenyl (bicyclo [2.2. l] heptanyl) , norbomadienyl (bicyclo [2.2. l] heptadienyl) , tricyclo [2.2.1.0] heptanyl, bicyclo [3.2.1] octanyl, bicyclo [3.2.1] octanyl, bicyclo [3.2.1] octadienyl, bicyclo [2.2.2] octanyl, bicyclo [2.2.2] octenyl, bicyclo [2.2.2] octadienyl, bicyclo [5, 2, 0] nonanyl, bicyclo [4.3.2] undecanyl, tricyclo [5.3.1.1] dodecanyl, and the like.
The term “cycloalkenyl” refers to a partially unsaturated cyclic hydrocarbon group containing 1 to 4 rings and 3 to 8 carbons per ring system. Exemplary such groups include cyclobutenyl, cyclopentenyl, cyclohexenyl, etc. “cycloalkenyl” includes monocyclic, bicyclic, tricyclic, or tetracyclic ring system in which one, two, three or more atoms are shared between the two rings. The term “spirocyclic cycloalkenyl” refers to a bicyclic cycloalkenyl in which each of the rings shares one adjacent atom with the other ring. The term “fused cycloalkenyl” refers to a bicyclic cycloalkenyl in which each of the rings shares two adjacent atoms with the other ring. The term “bridged cycloalkenyl” refers to a cycloalkenyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom. “bridged cycloalkenyl” includes “bicyclic bridged cycloalkenyl” which includes two bridgehead carbon atoms and “polycyclic bridged cycloalkenyl” which includes more than two bridgehead carbon atoms.
The term “heterocycloalkyl” refers to a stable 3-18 membered non-aromatic ring radical completely saturated that comprises two to twelve carbon atoms and from one to six heteroatoms selected from nitrogen, oxygen, and sulfur. Unless stated otherwise specifically in the specification, the heterocycloalkyl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system. The term “spirocyclic heterocycloalkyl” or “spiro-heterocyclyl” refers to a bicyclic or polycyclic heterocycloalkyl in which each of the rings shares one adjacent atom with the other ring. The term “fused heterocycloalkyl” refers to a bicyclic cycloalkyl in which each of the rings shares two adjacent atoms with the other ring. The term “bridged heterocycloalkyl” or “bridged-heterocyclyl” refers to a heterocycloalkyl that includes at least two bridgehead atoms and at least one bridging atom. “Bridged heterocycloalkyl” or “bridged-heterocyclyl” includes “bicyclic bridged heterocycloalkyl” which includes two bridgehead atoms and “polycyclic bridged heterocycloalkyl” which includes at least two bridgehead atoms. The heteroatoms in the heterocycloalkyl radical are optionally oxidized. In some embodiments, the heterocycloalkyl is attached to the rest of the molecule through any atom of the ring (s) . Examples of heterocycloalkyl radicals include, but are not limited to, dioxolanyl, thienyl [1, 3] dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl octahydroisoindoly, 2-oxopiperazinyl, 2-oxopiperidiny1, 2-oxopyrrolidinyl, oxazolidinyl, piperidnyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tet rahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1, 1-dioxo-thiomorpholinyl.
The term “heterocycloalkenyl” refers to the above-mentioned hererocycloalkyl having at least one double bond. A heterocycloalkenyl may be a single ring or multiple rings wherein the multiple rings include “spirocyclic heterocycloalkenyl” , “fused heterocycloalkenyl” , and “bridged heterocycloalkyl” . “Spirocyclic heterocycloalkenyl” refer to a bicyclic heterocycloalkenyl in which each of the rings shares one adjacent atom with the other ring, “fused heterocycloalkenyl” refers to a bicyclic heterocycloalkenyl in which each of the rings shares two adjacent atoms with the other ring, such as benzoheterocycloalkyl, and “bridged heterocycloalkyl” refers to a heterocycloalkenyl that includes at least two bridgehead carbon atoms and at least one bridging carbon atom. “Bridged heterocycloalkenyl” includes “bicyclic bridged heterocycloalkenyl” which includes two bridgehead carbon atoms and “polycyclic bridged heterocycloalkenyl” which includes more than two bridgehead carbon atoms.
The term “aryl” , as used herein, unless otherwise indicated, refers to an unsubstituted or substituted mono or polycyclic aromatic ring system containing carbon ring atoms. The preferred aryls are mono cyclic or bicyclic aromatic ring systems. Phenyl and naphthyl are preferred aryls.
The term “heteroaryl” , as used herein, unless otherwise indicated, represents an aromatic ring system containing carbon (s) and at least one heteroatom. Heteroaryl may be monocyclic or polycyclic, substituted or unsubstituted. A monocyclic heteroaryl group may have 1 to 4 heteroatoms in the ring, while a polycyclic heteroaryl may contain 1 to 10 hetero atoms. A polycyclic heteroaryl ring may contain fused, spiro or bridged ring junction, for example, bycyclic heteroaryl is a polycyclic heteroaryl. Bicyclic heteroaryl rings may contain from 8 to 12 membered atoms. Monocyclic heteroaryl rings may contain from 5 to 8 membered atoms (cabons and heteroatoms) . Examples of heteroaryl groups include, but are not limited to thienyl, furanyl, imidazolyl, isoxazolyl, oxazolyl, pyrazolyl, pyrrolyl, thiazolyl, thiadiazolyl, triazolyl, pyridyl, pyridazinyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, benzofuranyl, benzothienyl, benzisoxazolyl, benzoxazolyl, benzopyrazolyl, benzothiazolyl, benzothiadiazolyl, benzotriazolyl adeninyl, quinolinyl or isoquinolinyl.
The term “heterocyclyl” or “heterocycle” as used herein refers to a single saturated or partially unsaturated non-aromatic ring or a non-aromatic multiple ring system that has at least one heteroatom in the ring (e.g., at least one annular heteroatom selected from oxygen, nitrogen, phosphorus and sulfur) . Unless otherwise specified, a heterocyclyl group has from 3 to about 20 annular atoms, for example from 3 to 12 annular atoms, for example from 3 to 10 annular atoms, for example from 5 to 10 annular atoms or for example from 5 to 6 annular atoms. Thus, the term includes single saturated or partially unsaturated rings (e.g.,  3, 4, 5, 6 or 7-membered rings) having from about 1 to 6 annular carbon atoms and from about 1 to 3 annular heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur in the ring. The rings of the multiple condensed ring (e.g. bicyclic heterocyclyl) system can be connected to each other via fused, spiro and bridged bonds when allowed by valency requirements. The term “heterocyclyl” or “heterocyclic ring” or “heterocycle” includes heterocycloalkenyl groups (i.e., the heterocyclyl group having at least one double bond) . A heterocyclyl may be a single ring or multiple rings wherein the multiple rings may be fused, bridged, or spiro. As used herein, heterocyclyl has 2 to 20 ring carbon atoms (i.e., C2-20heterocyclyl) , 2 to 12 ring carbon atoms (i.e., C2-12 heterocyclyl) , 2 to 10 ring carbon atoms (i.e., C2-10 heterocyclyl) , 2 to 8 ring carbon atoms (i.e., C2-8 heterocyclyl) , 3 to 12 ring carbon atoms (i.e., C3-12 heterocyclyl) , 3 to 8 ring carbon atoms (i.e., C3-8 heterocyclyl) , or 3 to 6 ring carbon atoms (i.e., C3-6 heterocyclyl) ; having 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, sulfur or oxygen. Examples of heterocyclyl groups include pyrrolidinyl, piperidinyl, piperazinyl, oxetanyl, dioxolanyl, azetidinyl, and morpholinyl. As used herein, the term “bridged-heterocyclyl” refers to a four-to ten-membered cyclic moiety connected at two non-adjacent atoms of the heterocyclyl with one or more (e.g., 1 or 2) four-to ten-membered cyclic moiety having at least one heteroatom where each heteroatom is independently selected from nitrogen, oxygen, and sulfur. As used herein, “bridged-heterocyclyl” includes bicyclic and tricyclic ring systems. Also as used herein, the term “spiro-heterocyclyl” refers to a ring system in which a three-to ten-membered heterocyclyl has one or more additional ring, wherein the one or more additional ring is three-to ten-membered cycloalkyl or three-to ten-membered heterocyclyl, where a single atom of the one or more additional ring is also an atom of the three-to ten-membered heterocyclyl. Examples of the spiro-heterocyclyl include bicyclic and tricyclic ring systems, such as 2-oxa-7-azaspiro [3.5] nonanyl, 2-oxa-6-azaspiro [3.4] octanyl, and 6-oxa-1-azaspiro [3.3] heptanyl. Heterocyclyl groups also include partially unsaturated ring systems containing one or more double bonds, including fused ring systems with one aromatic ring and one non-aromatic ring, but not fully aromatic ring systems. Examples include dihydroquinolines (e.g. 3, 4-dihydroquinoline) , dihydroisoquinolines (e.g. 1, 2-dihydroisoquinoline) , dihydroimidazole, tetrahydroimidazole, indoline, isoindoline, isoindolones (e.g. isoindolin-1-one) , isatin, dihydrophthalazine, quinolinone, spiro [cyclopropane-1, 1′-isoindolin] -3′-one, tetr ahydroisoquinoline, tetraline, and the like. Additional examples of heterocycles include 3, 8-diazabicyclo [3.2.1] octanyl, 2, 5-diazabicyclo [2.2.1] heptanyl, 3, 6-diazabicyclo [3.1.1] heptanyl, 3-oxa-7, 9-diazabicyclo [3.3.1] nonanyl, and hexahydropyrazino [2, 1-c] [1, 4] oxazinyl, for example. As used herein, the terms “heterocycle” , “heterocyclyl” , and “heterocyclic ring” are used interchangeably.
Any hydrogen atom bond with C, N, O, or S in the 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl or 5-12 membered heteroaryl can be replaced with the substituent.
The term “composition” , as used herein, is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts. Accordingly, pharmaceutical compositions containing the compounds of the present invention as the active ingredient as well as methods of preparing the instant compounds are also part of the present invention. Furthermore, some of the crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents and such solvates are also intended to be encompassed within the scope of this invention.
When the compound and pharmaceutically acceptable salts thereof exist in the form of solvates or polymorphic forms, the present invention includes any possible solvates and polymorphic forms. A type of a  solvent that forms the solvate is not particularly limited so long as the solvent is pharmacologically acceptable. For example, water, ethanol, propanol, acetone or the like can be used.
The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids. When the compound of the present invention is acidic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic bases, including inorganic bases and organic bases. When the compound of the present invention is basic, its corresponding salt can be conveniently prepared from pharmaceutically acceptable non-toxic acids, including inorganic and organic acids. Since the compounds are intended for pharmaceutical use they are preferably provided in substantially pure form, for example at least 60%pure, more suitably at least 75%pure, especially at least 98%pure (%are on a weight for weight basis) .
The pharmaceutical compositions of the present invention comprise a compound (or a pharmaceutically acceptable salt thereof) as an active ingredient, a pharmaceutically acceptable carrier and optionally other therapeutic ingredients or adjuvants. The compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is being administered. The pharmaceutical compositions may be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
In practice, the compounds or a prodrug or a metabolite or pharmaceutically acceptable salts thereof, of this invention can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g. oral or parenteral (including intravenous) . Thus, the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient. Further, the compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in-water emulsion or as a water-in-oil liquid emulsion. In addition to the common dosage forms set out above, the compound or a pharmaceutically acceptable salt thereof, may also be administered by controlled release means and/or delivery devices. The compositions may be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredient with the carrier that constitutes one or more (such as 1, 2, 3, 4, 5 or 6) necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
Thus, the pharmaceutical compositions of this invention may include a pharmaceutically acceptable carrier and a compound or a pharmaceutically acceptable salt. The compounds or pharmaceutically acceptable salts thereof, can also be included in pharmaceutical compositions in combination with one or more (such as 1, 2, 3, 4, 5 or 6) other therapeutically active compounds.
A tablet containing the composition of this invention may be prepared by compression or molding, optionally with one or more (such as 1, 2, 3, 4, 5 or 6) accessory ingredients or adjuvants. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets may be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent. Each tablet preferably contains from about 0.05mg to about 5g of the active ingredient and each cachet or capsule preferably containing from about 0.05mg to about 5g of the active ingredient. For example, a formulation intended for the oral administration to humans may contain from about 0.5mg to about 5g of active agent, compounded with an appropriate and convenient amount of carrier material which may vary from about 0.05 to about 95 percent of the total composition. Unit dosage forms will generally contain between from about 0.0lmg to about 2g of the active ingredient, typically 0.01mg, 0.02mg, 1mg, 2mg, 3mg, 4mg, 5mg, 6mg, 7mg, 8mg, 9mg, 10mg, 25mg, 50mg, l00mg, 200mg, 300mg, 400mg, 500mg, 600mg, 800mg or l000mg.
Pharmaceutical compositions of the present invention suitable for parenteral administration may be prepared as solutions or suspensions of the active compounds in water. A suitable surfactant can be included such as, for example, hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Further, a preservative can be included to prevent the detrimental growth of microorganisms.
Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. In all cases, the final injectable form must be sterile and must be effectively fluid for easy syringability. The pharmaceutical compositions must be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol) , vegetable oils, and suitable mixtures thereof.
Pharmaceutical compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder or the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations may be prepared, utilizing a compound of this invention or a pharmaceutically acceptable salt thereof, via conventional processing methods. As an example, a cream or ointment is prepared by admixing hydrophilic material and water, together with about 0.05wt%to about 10wt%of the compound, to produce a cream or ointment having a desired consistency.
Pharmaceutical compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories may be conveniently formed by first mixing the composition with the softened or melted carrier (s) followed by chilling and shaping in molds.
In addition to the aforementioned carrier ingredients, the pharmaceutical formulations described above may include, as appropriate, one or more (such as 1, 2, 3, 4, 5 or 6) additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including antioxidants) and the like. Furthermore, other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient. Compositions containing a compound or pharmaceutically acceptable salts thereof, may also be prepared in powder or liquid concentrate form.
Generally, dosage levels on the order of from about 0.001mg/kg to about 150mg/kg of body weight per day are useful in the treatment of the above-indicated conditions or alternatively about 0.05mg to about 7g per patient per day. For example, inflammation, cancer, psoriasis, allergy/asthma, disease and conditions of the immune system, disease and conditions of the central nervous system (CNS) , may be effectively treated by the administration of from about 0.001 to 50mg of the compound per kilogram of body weight per day or alternatively about 0.05mg to about 3.5g per patient per day.
It is understood, however, that the specific dose level for any particular patient will depend upon a variety of factors including the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
METHODS OF PREPRATION
The following examples have been included to provide guidance to one of ordinary skill in the art for practicing representative embodiments of the presently disclosed subject matter. In light of the present disclosure and the general level of skill in the art, those of skill can appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. The synthetic descriptions and specific examples that follow are only intended for the purposes of illustration, and are not to be construed as limiting in any manner to make
All parts and percentages are by weight and all temperatures are degrees Celsius, unless explicitly stated otherwise.
The following abbreviations have been used in the examples:
General Synthetic Schemes 1:
Scheme 1
As exemplified in general synthetic schemes 1, the compound of formula (I-1) can be synthesized by the following steps:
(1) the compound with -YH group and L1 group such as S1-1 as starting material can be reacted with the compound such as S1-2 in the presence of an alkaline agent such as K2CO3 to form the compound of S2-1;
(2) A cyclization reaction of the compound of S2-1 and subsequent aromatization reaction can be occurred to form compound S3-1under acid condition such as polyphosphoric acid;
(3) The adjacent position of Y atom of compound S3-1 can be halogenated in the presence of halogenating reagents to afford compound S4-1. For example, the adjacent position of Y atom of compound S3-1 can be iodated in the presence of NIS.
(4) The compound of S5-1 can be provided by reacting compound S4-1 with reagent S4-2 through a coupling reaction in the presence of a coupling catalyst;
(5) The L1 group of the compound S5-1 can be –converted to the target compound of formula (I-1) through one or more steps of reaction, for example, the compound S5-1 can be substituted with -NH2 to generate a compound which can be converted to the target compound through a reductive amination reaction when R2 is -NR51R52.
L1, L2 and L3 in the general synthetic schemes 1 independently represent a leaving group such as halogen (such as -Cl, -Br or -I) . Preferably, L1 is selected from -Br; L2 is selected from -Br; and L3 is selected from -I.
Y in the general synthetic schemes 1 is selected from O or S;
The other variates such as X2, X3, X4, R1, R2, R11, R12, R13, R3, R51, R52 and m are each defined as above in the present invention.
Example 1
4- ( (3- (3-ethyl-7- ( (1-methylpiperidin-4-yl) amino) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benze nesulfonamide ( “Compound 1” )
Step 1. Synthesis of 1- ( (2-bromophenyl) thio) butan-2-one
To a solution of 2-bromobenzenethiol (16.58 g, 0.09 mol) in 160 ml ACN, K2CO3 (24.42g, 0.18 mol) and 1-bromobutan-2-one (14.60 g, 0.10 mol) were added. The mixture was stirred at room temperature for 2 hours and the solid was removed by filtration. The filtrate was concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v=0%-12%) . This resulted in 19.89 g of 1- ( (2-bromophenyl) thio) butan-2-one as yellow oil. LCMS: m/z =259 [M+1] +.
Step 2. Synthesis of 7-bromo-3-ethylbenzo [b] thiophene
A mixture of polyphosphoric acid (10 mL) and 1- ( (2-bromophenyl) thio) butan-2-one (1.99 g, 7.68 mmol) was slowly heated to 160 ℃ with continuous stirring. The reaction mixture was stirred for 2 hours at 160 ℃. Then the mixture was cooled and water (30 mL) was added. The mixture was extracted with EA (90 mL × 3) , dried over (Na2SO4) , filtered, and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 0%-5%) . This resulted in 1.334 g of 7-bromo-3-ethylbenzo [b] thiophene as yellow oil.
Step 3. Synthesis of 7-bromo-3-ethyl-2-iodobenzo [b] thiophene
To a solution of 7-bromo-3-ethylbenzo [b] thiophene (1.093 g, 4.53 mmol) in 10 mL AcOH, NIS (1.307 g, 5.81 mmol) was added in portion wise. The mixture was stirred at room temperature for 2 hours. The reaction was quenched by the addition of water (20 mL) . The resulting solution was extracted with EA (2 x 30 mL) . Then the organic layers were combined, washed with brine (15 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 0%-5%) . This resulted in 1.186 g of 7-bromo-3-ethyl-2-iodobenzo [b] thiophene as yellow oil.
Step 4. Synthesis of 4- ( (3- (7-bromo-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 7-bromo-3-ethyl-2-iodobenzo [b] thiophene (0.504 g, 1.37 mmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.335 g, 1.59 mmol) , Pd (PPh3) 2Cl2 (0.219 g, 0.31 mmol) , CuI (0.093 g, 0.49 mmol) , DIEA (0.529 g, 4.09 mmol) , DMSO (5 mL) . The reaction mixture was stirred at room temperature for 1 h. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 0%-35%) . This resulted in 0.424 g of 4- ( (3- (7-bromo-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as yellow oil. LCMS: m/z =449 [M+1] +.
Step 5. Synthesis of 4- ( (3- (7-amino-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 4- ( (3- (7-bromo-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.402 g, 0.89 mmol) , NaN3 (0.135 g, 2.08 mmol) , L-Proline (0.038 g, 0.33 mmol) , CuI (0.042 g, 0.22 mmol) , NaI (0.145 g, 0.97 mmol) , Cs2CO3 (0.586 g, 1.80 mmol) , DMSO (5 mL) . The reaction mixture was stirred at 100 ℃ for 5 h. The residue was purified by Prep-HPLC CH3CN/H2O (0.2%HCOOH) (v/v = 0%-50%) . This resulted in 0.048 g of 4- ( (3- (7-amino-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as yellow solid. LCMS: m/z =389 [M+1] +.
Step6. Synthesis of 4- ( (3- (3-ethyl-7- ( (1-methylpiperidin-4-yl) amino) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide ( “Compound 1” )
To a solution of 4- ( (3- (7-amino-3-ethylbenzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.040 g, 4.53 mmol) in 5 ml MeOH, 1-methylpiperidin-4-one (0.087 g, 768.8419 μmol) was added. The mixture was stirred at room temperature for 0.5 hours. Then NaBH3CN (0.087 g 2.03 mmol) and AcOH (0.002 mL) were added to the system. The reaction mixture was stirred at room temperature for 3 days. The residue was purified by Prep-HPLC CH3CN/H2O (0.05%NH3 . . H2O) (v/v = 0%-50%) . This resulted in 0.010 g (17%) of 4- ( (3- (3-ethyl-7- ( (1-methylpiperidin-4-yl) amino) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide ( “Compound 1” ) as white solid. LCMS: m/z =483 [M+1] +.
1H NMR (400 MHz, CD3OD) δ 7.71 –7.65 (m, 2H) , 7.22 –7.15 (m, 1H) , 7.11 –7.03 (m, 1H) , 6.84 –6.73 (m, 2H) , 6.68 –6.59 (m, 1H) , 4.29 –4.20 (m, 2H) , 3.49 –3.40 (m, 1H) , 2.84 –2.73 (m, 4H) , 2.30 (s, 3H) , 2.21 –2.13 (m, 2H) , 2.03 –1.95 (m, 2H) , 1.61 –1.51 (m, 2H) , 1.14 (s, 3H) .
Example 2
(3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (2)
Reaction scheme:
Experimental details:
Step1. 2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine
Into a 20-mL sealed tube was placed 2-iodo-7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene (0.674 g, 1.74 mmol) , Iron (0.605 g, 10.83 mmol) , NH4Cl (0.951 g, 17.78 mmol) , EtOH (8 mL) and H2O (1.5 mL) . The reaction mixture was stirred at 80℃ for 1 h. The reaction mixture was extracted with EA (100 mL x 1) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 0.621 g (99.87%) of 2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine as grey solid. LCMS: m/z = 358 [M+1] +
Step2. tert-butyl (3S, 4R) -3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic)
A mixture of 2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (0.308 g, 0.86 mmol) , tert-butyl 3-fluoro-4-oxopiperidine-1-carboxylate (0.455 g, 2.09 mmol) , and TMSCl (1.156 g, 10.64 mmol) in DMF (5 mL) was degassed and purged with N2, and then BH3. THF (1 M, 9 mL) was added. The mixture was stirred at 0℃ for 1 h under N2 (g) atmosphere. The reaction mixture was quenched with water (20 mL) at 0℃ and extracted with EA (40 mL x 2) . The combined organic layers was washed with brine (30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by silica gel column, eluted with EA/hexane (v/v = 1/5) to afford tert-butyl (3S, 4R) -3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic) . LCMS: m/z = 559 [M+1] +
Step3. tert-butyl (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic)
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl (3S, 4R) -3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic) (0.306 g, 0.55 mmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.184 g, 0.77 mmol) , Pd (dppf) Cl2 (0.103 g, 0.15 mmol) , CuI (0.082 g, 0.43 mmol) , DIEA (0.253 g, 1.96 mmol) , DMSO (5 mL) . The reaction mixture was stirred at room temperature for 1 h. The reaction mixture was quenched with water (20 mL) and extracted with EA (40 mL x 2) . The combined organic layers was washed with brine (20 mL) , separated and concentrated under vacuum. The residue was purified by silica gel column, eluted with EA/hexane (v/v = 3/1) to afford tert-butyl (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic) (0.338 g, 92.09%yield) as a little yellow solid. LCMS: m/z = 670 [M+1] +
Step4. (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic)
Into a 100-mL round-bottom flask was placed tert-butyl (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic) (0.319 g, 0.48 mmol) , DCM (5 mL) and TFA (1 mL) . the reaction mixture was stirred at room temperature for 1 h. The reaction was adjusted to pH = 9 with NaHCO3 (aq. ) and extracted with EA (100 mL x 2) . The combined organic layers were washed with brine (40 mL) , separated and concentrated under vacuum. This resulted in (0.220 g, 81.09%) of (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) as yellow oil. LCMS: m/z = 570 [M+1] +.
Step5. (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (2)
To a solution of (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) (0.100 g, 0.18 mmol) , paraformaldehyde (0.009 g, 0.30 mmol) in 3 mL MeOH. The mixture was stirred at room temperature for 0.5 h. Then NaBH3CN (0.032 g, 0.75 mmol) and HOAc (0.002 mL) were added. The reaction mixture was stirred at room temperature for 2 days.  The residue was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 60 mL/min; Gradient: 50-80-100%B (2-30-60min) ; 244 nm; RT: 35.560 -37.110 min) to afford (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (2) (0.052 g, 50.75%yield) as white solid. LCMS: m/z =584 [M+1] +
1H NMR (400 MHz, MeOD) δ 7.48 (d, J = 8.0 Hz, 1H) , 7.36 –7.25 (m, 2H) , 7.19 (d, J = 7.6 Hz, 1H) , 6.93 (d, J = 8.4 Hz, 1H) , 6.77 (d, J = 7.2 Hz, 1H) , 4.77 (s, 1H) , 4.40 (s, 2H) , 3.95 (s, 3H) , 3.78 –3.62 (m, 3H) , 3.23 –3.14 (m, 1H) , 3.06 (s, 3H) , 2.92 (d, J = 11.2 Hz, 1H) , 2.39 (d, J = 13.2 Hz, 1H) , 2.30 (s, 3H) , 2.28 –2.19 (m, 1H) , 1.96 (d, J = 10.8 Hz, 2H) .
Example 3
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (3)
Reaction scheme:
Experimental Details
Step1. methyl 7-nitrobenzo [b] thiophene-2-carboxylate
To a mixture of 2-chloro-3-nitrobenzaldehyde (10.029 g, 0.05 mol) and K2CO3 (8.235 g, 0.06 mol) in 100 mL DMF was added methyl 2-mercaptoacetate (6.193 g, 0.06 mol) at 0℃. The mixture was stirred at room temperature for 8 hours and the mixture was added to 500 mL water, the mixture was filtered and washed with water and the filter cake was dried in an oven. This resulted in 11.91 g of methyl 7-nitrobenzo [b] thiophene-2-carboxylate as off-white solid.
Step2. 7-nitrobenzo [b] thiophene-2-carboxylic acid
To a 0℃ solution of methyl 7-nitrobenzo [b] thiophene-2-carboxylate (2.44 g, 0.01 mmol) in 20 mL MeOH was added NaOH (2N, 20 mL) . The reaction mixture was stirred at room temperature for 8 h. The mixture was concentrated under vacuum. The mixture was adjusted to pH 2-3 with HCl (6 N) . The mixture was extracted with EA (100 mL) . The organic layers was combined and dried over MgSO4, filtered and concentrated under vacuum to afford 2.27 g of 7-nitrobenzo [b] thiophene-2-carboxylic acid as little yellow solid.
Step3. 7-nitrobenzo [b] thiophene
Into a 40-mL sealed tube was placed 7-nitrobenzo [b] thiophene-2-carboxylic acid (2.105 g, 9.43 mmol) , Cu2O (0.335 g, 1.59 mmol) , DMF (20 mL) . The reaction mixture was stirred at 120℃ for 12 h. The mixture was added to 100 mL water and a lot of precipitation appeared. The mixture was filtered and the filter cake was washed with water and dried in the oven. This resulted in 1.765 g of 7-nitrobenzo [b] thiophene as grey solid.
Step4. 7-nitrobenzo [b] thiophene-3-carbaldehyde
Into a 20-mL sealed tube was placed 7-nitrobenzo [b] thiophene (0.51 g, 2.85 mmol) , dichloro (methoxy) methane (1.65 g, 14.35 mmol) , TiCl4 (1.50 g, 7.91 mmol) , CHCl3 (5 mL) . The reaction mixture was stirred at 60℃ for 2 h. The reaction was quenched with water (50 mL) , extracted with EA (3 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/3) . This resulted in 0.268 g of 7-nitrobenzo [b] thiophene-3-carbaldehyde as yellow solid.
Step5. (7-nitrobenzo [b] thiophen-3-yl) methanol
To a 0℃ solution of methyl 7-nitrobenzo [b] thiophene-3-carbaldehyde (1.699 g, 8.20 mmol) in 20 mL MeOH was added NaBH4 (0.656 g, 17.34 mmol) . The reaction mixture was stirred at room temperature for 0.5h. The reaction was quenched with water (50 mL) , extracted with EA (3 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered, and concentrated under vacuum. This resulted in 1.197 g of (7-nitrobenzo [b] thiophen-3-yl) methanol as light yellow solid.
Step6. 3- (bromomethyl) -7-nitrobenzo [b] thiophene
Into a 20-mL sealed tube was placed (7-nitrobenzo [b] thiophen-3-yl) methanol (0.45 g, 2.15 mmol) , 30%HBr/HOAc (5 mL) . The reaction mixture was stirred at room temperature for 1 h. The reaction was quenched with water (50 mL) , extracted with EA (3 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/6) . This resulted in 0.446 g of 3- (bromomethyl) -7-nitrobenzo [b] thiophene as yellow solid.
Step7. 7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene
Into a 20-mL sealed tube was placed 3- (bromomethyl) -7-nitrobenzo [b] thiophene (0.32 g, 1.18 mmol) , copper (0.221 g, 3.48 mmol) , diphenyl- (trifluoromethyl) -sulfonium trifluoromethanesulfonate (0.918 g, 2.27 mmol) , NMP (3 mL) . The reaction mixture was stirred at 60℃ for 1 h. The reaction was quenched with water (40 mL) , extracted with EA (2 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/5) . This resulted in 0.295 g of 7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene as yellow solid.
Step8. 2-iodo-7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene
Into a 20-mL sealed tube was placed 7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene (0.293 g, 1.12 mmol) , NIS (0.336 g, 1.49 mmol) , trifluoromethanesulfonic acid (0.5 mL) , AcOH (4mL) . The reaction mixture was stirred at room temperature for 3 h. The reaction was quenched with water (30 mL) , extracted with EA (2 x 100 mL) , washed with brine (80 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/8) . This resulted in 0.389 g of 2-iodo-7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene as yellow solid.
Step9. 2-methoxy-4- (methylsulfonyl) -N- (3- (7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) aniline
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 2-iodo-7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophene (0.380 g, 0.98 mmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.259 g, 1.08 mmol) , Pd (dppf) Cl2 (0.080 g, 0.11 mmol) , CuI (0.053 g, 0.28 mmol) , DIEA (0.413 g, 3.20 mmol) , DMSO (5 mL) . The reaction mixture was stirred at room temperature for 1 h. The reaction mixture was quenched with water (100 mL) , extracted with EA (100 mL × 2) , washed with brine (80 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 2/3) . This resulted in 0.526 g (crude) of 2-methoxy-4- (methylsulfonyl) -N- (3- (7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) anil ine as yellow oil. LCMS: m/z = 499 [M+1] +
Step10. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiop hen-7-amine
Into a 20-mL sealed tube was placed 2-methoxy-4- (methylsulfonyl) -N- (3- (7-nitro-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) anil ine (0.518 g, 1.04 mmol) , iron (0.391 g, 7.00 mmol) , NH4Cl (0.430 g, 8.04 mmol) , EtOH (5 mL) and H2O (1 mL) . The reaction mixture was stirred at 80℃ for 1 h. The reaction mixture was extracted with EA (100 mL ×1) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 0.282 g (57.92%) of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine as yellow solid. LCMS: m/z = 469 [M+1] +
Step 11. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (3)
Into a 25-mL round-bottom flask was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.220 g, 0.43 mmol) , 1-methylpiperidin-4-amine (0.259 g, 2.29 mmol) , MeOH (4 mL) . The mixture was stirred at room temperature for 0.5 h. Then NaBH3CN (0.177 g, 4.12 mmol) and HOAc (0.02 mL) were added and stirred for 48 h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-75-100%B (2-30-60min) ; 270 nm; RT: 44.886 –46.470 min) to afford N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -1-methylpiperidin-4-amine (3) (0.038 g, 15.58%yield) as off-white solid. LCMS: m/z = 566 [M+1] +
1H NMR (400 MHz, MeOD) δ 7.48 (d, J = 8.0 Hz, 1H) , 7.34 –7.21 (m, 2H) , 7.12 (d, J = 7.2 Hz, 1H) , 6.93 (d, J = 8.4 Hz, 1H) , 6.70 (d, J = 7.6 Hz, 1H) , 4.40 (s, 2H) , 3.95 (s, 3H) , 3.74 –3.60 (m, 2H) , 3.50 (s, 1H) , 3.06 (s, 3H) , 2.90 (d, J = 11.6 Hz, 2H) , 2.31 (s, 3H) , 2.21 (d, J = 11.2 Hz, 2H) , 2.06 (d, J = 12.0 Hz, 2H) , 1.69 –1.53 (m, 2H) .
Example 4
4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (4)
Reaction scheme:
Experimental details
Step 1. N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine.
Into a 4 mL vail was placed 2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (0.108 g, 302.41 μmol) , 1-methylpiperidin-4-one (0.023 g, 203.26 μmol) . The vail was heated to 130℃ and stirred for 0.5 h. The reaction was cooled to room temperature, and sodium cyanoborohydride (0.113 g, 2.634 mmol) , acetic acid (0.01 μmol) , Ethanol (1 mL) was added. The reaction was stirred for 1 h at 50℃. LCMS showed the reaction was complete, the reaction was concentrated under vacuum and purified by C18 column, eluted with ACN/water (v/v = 1/3) to afford N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.068 g, 149.68 μmol, 49.50%yield) as off-white solid . LCMS: m/z = 455 [M+1] +.
Step 2. 4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (4) .
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.067 g, 147.48 μmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.058 g, 275.86 μmol) , Pd (PPh3) 2Cl2 (0.011 g, 15.58 μmol) , CuI (0.007 g, 36.76 μmol) , TEA (0.031 g, 306.36 μmol) , DMF (1 mL) , and stirred overnight at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-80-100%B (2-30-60min) ; 265 nm; RT: 33.245 –35.153 min) to afford 4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (4) (0.021 g, 39.13 μmol, 26.53%yield) as off-white solid . LCMS: m/z = 537 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.58 (d, J = 8.4 Hz, 2H) , 7.26 (t, J = 7.8 Hz, 1H) , 7.15 (d, J = 7.9 Hz, 1H) , 6.98 (s, 2H) , 6.89 (t, J = 6.1 Hz, 1H) , 6.78 (d, J = 8.4 Hz, 2H) , 6.67 (d, J = 7.8 Hz, 1H) , 5.31 (d, J = 7.9 Hz, 1H) , 4.33 (d, J = 6.0 Hz, 2H) , 3.84 (q, J = 11.1 Hz, 2H) , 2.77 (d, J = 11.0 Hz, 2H) , 2.18 (s, 3H) , 2.01 (t, J =11.6 Hz, 2H) , 1.88 (d, J = 11.8 Hz, 2H) , 1.63 –1.47 (m, 2H) .
Example 5
4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5) and
4- ( (3- (7- ( ( (3R, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5b)
Reaction scheme:
Experimental details:
Step 1  tert-butyl-3-fluoro-4- ( (2- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate
Into a 50 mL 3-necked flask was placed tert-butyl 3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (0.688 g, 1.23 mmol) , 4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.561 g, 1.51 mmol) , Pd (PPh3) 2Cl2 (0.184 g, 260.65 μmol) , CuI (0.081 g, 425.30 μmol) , DIEA (0.573 g, 4.43 mmol) , methyl sulfoxide (7 mL) . The reaction was stirred under nitrogen atomosphere at RT for 3 h. The reaction was quenched with water (20 mL) . The resulted solution was extracted with EA (3 x 50 mL) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 3/2) . This resulted in 0.642 g (1.00 mmol 81.32%yield) of tert-butyl 3-fluoro-4- ( (2- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate as yellow solid. LCMS: m/z = 641 [M+1] +.
Step 2 4- ( (3- (7- ( (3-fluoropiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) am ino) benzenesulfonamide
Into a 20 mL sealed tube was placed tert-butyl 3-fluoro-4- ( (2- (3- ( (4-sulfamoylphenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (0.622 g, 970.79 mmol) , HCl (g) in EA (2mL, 4N) , EA (2 mL) . The reaction was stirred at RT for 1 h. The reaction was concentrated under vacuum, water (2 mL) was added to the reaction. NaOH (aq, 3N) was added until PH = 7, extracted with EA (3 x 50 mL) , washed with brine (30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 0.530 g (980.40 μmol, 100.00%yield) of 4- ( (3- (7- ( (3-fluoropiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide as brown solid. LCMS: m/z = 274 [M+1] +. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 3.012 g (74%yield) of ethyl N- (3-bromo-5-nitro-4- (1H-pyrrol-1-yl) phenyl) -1-methylpiperidin-4-amine as yellow solid. LCMS: m/z = 541 [M+1] +.
Step 3 4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5) and 4- ( (3- (7- ( ( (3R, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (racemic) (5b)
Into a 25-mL round-bottom flask was placed 4- ( (3- (7- ( (3-fluoropiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (0.317 g, 586.38 umol) , triformol (0.043 g, 1.43 mmol) , acetic acid (0.5 mL) , methyl alcohol (5 mL) The reaction mixture was stirred at RT for 1 h. Then NaBH3CN (0.231 g, 5.38 mmol) was added. The reaction mixture was stirred at RT for 1 h. The reaction was quenched with water (20 mL) . The resulted solution was extracted with EA (3 x 50 mL) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 35-65-75%B (2-30-60min) ; 264 nm; RT: 30.01-31.74; ) to provide the desired product. This resulted in 0.055g (99.16 μmol, 16.91%yield) of 4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop -2-yn-1-yl) amino) benzenesulfonamide (racemic) (5) as white solid. LCMS: m/z =555 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.58 (d, J = 8.4 Hz, 2H) , 7.31 –7.20 (m, 2H) , 6.97 (s, 2H) , 6.98 –6.92 (m, 1H) , 6.78 (d, J = 8.2 Hz, 3H) , 5.17 (d, J = 8.5 Hz, 1H) , 4.79 (d, J = 49.5 Hz, 1H) , 4.33 (d, J = 6.0 Hz, 2H) , 3.88 –3.72 (m, 2H) , 3.82 –3.61 (m, 1H) 3.03 (t, J = 11.1 Hz, 1H) , 2.79 (d, J = 11.1 Hz, 1H) , 2.27 (d, J = 13.0 Hz, 1H) , 2.18 (s, 3H) , 2.08 (t, J = 11.4 Hz, 1H) , 2.01 –1.89 (m, 1H) , 1.71 (d, J = 11.9 Hz, 1H) .
And 0.027g (48.68 μmol, 8.30%yield) of 4- ( (3- (7- ( ( (3R, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop -2-yn-1-yl) amino) benzenesulfonamide (racemic) (5b) as white solid. LCMS: m/z =555 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.58 (d, J = 8.4 Hz, 2H) , 7.25 (t, J = 7.9 Hz, 1H) , 7.16 (d, J = 7.9 Hz, 1H) , 6.98 (s, 2H) , 6.90 (t, J = 6.1 Hz, 1H) , 6.77 –6.68 (m, 3H) , 5.57 (d, J = 8.5 Hz, 1H) , 4.71 –4.52 (m, 1H) , 4.33 (d, J = 6.0 Hz, 2H) , 3.85 –3.79 (m, 2H) , 3.59 (d, J = 4.2 Hz, 1H) , 3.10 –3.01 (m, 1H) , 2.69 (d, J = 11.5 Hz, 1H) , 2.23 (s, 3H) , 2.04 –3.01 (m, 1H) , 1.99 –1.88 (m, 1H) , 1.59 –1.47 (m, 1H) .
Example 6
1- ( (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-triflu oroethyl) benzo [b] thiophen-7-yl) amino) piperidin-1-yl) -3-methoxypropan-2-ol (racemic) (6)
Reaction scheme:
Experimental details:
Step1. 1- ( (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-triflu oroethyl) benzo [b] thiophen-7-yl) amino) piperidin-1-yl) -3-methoxypropan-2-ol (racemic) (6) .
Into a 4 mL vial placed (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) (0.036 g, 63.20 μmol) , 2- (methoxymethyl) oxirane (0.044 g, 499.41 μmol) , ethanol (1 mL) . The reaction was stirred at RT for 4 h. The reaction was concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmol/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 50-80-100%B (2-30-60 min) ; 269 nm; RT: 33.838 –34.618) to provide the desired product. This resulted in 0.029 g (69.77%yield) of 1- ( (3S, 4R) -3-fluoro-4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroe thyl) benzo [b] thiophen-7-yl) amino) piperidin-1-yl) -3-methoxypropan-2-ol (racemic) (6) as off-white solid. LCMS: m/z =659 [M+1] +.
1H NMR (400 MHz, MeOD) δ 7.49 (d, J = 8.3 Hz, 1H) , 7.32 –7.25 (m, 2H) , 7.19 (d, J = 8.2 Hz, 1H) , 6.94 (d, J = 8.4 Hz, 1H) , 6.77 (d, J = 7.6 Hz, 1H) , 4.40 (s, 2H) , 3.95 (s, 3H) , 3.90 (s, 1H) , 3.79 –3.61 (m, 3H) , 3.45 –3.33 (m, 5H) , 3.30 –3.29 (m, 2H) , 3.06 (s, 3H) , 2.99 (s, 1H) , 2.57 –2.44 (m, 2H) , 2.44 –2.28 (m, 2H) , 2.03 –1.85 (m, 2H) .
Example 7
N- (2- (3- ( (5-fluoro-2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (7)
Reaction scheme:
Experimental details:
Step 1. 1, 2-difluoro-4-methoxy-5-nitrobenzene
Into a 100 mL flask was placed 4, 5-difluoro-2-nitrophenol (4.76 g, 27.19 mmol) , K2CO3 (11.33 g, 81.98 mmol) , iodomethane (3 mL) , DMF (30 mL) . The reaction was stirred at 20℃ for 1 h. The reaction was quenched by water (50 mL) , extracted by EA (3 x 50 mL) . The organic layers combined and concentrated under vacuum. The residue was purified by silica gel column eluted with EA/Hex (v/v = 2/8) . This resulted in 5.30 g (99%yield) of 1, 2-difluoro-4-methoxy-5-nitrobenzene as white solid. LCMS: m/z = 190 [M+1] +.
Step 2. 1-fluoro-4-methoxy-2- (methylsulfonyl) -5-nitrobenzene.
Into a 100 mL flask was placed methyl 1, 2-difluoro-4-methoxy-5-nitrobenzene (2.99 g, 15.84 mmol) , sodium methanesulfinate (1.90 g, 18.62 mmol) , DMA (10 mL) . The reaction was stirred at 85℃ for 16 h. The reaction was quenched by water (50 mL) . Then a large amount of solids precipitated. The mixture was filtered and collected the filter cake. The filter cake was drying at 60℃ for 16 h. This resulted in 3.00 g (76%yield) of 1-fluoro-4-methoxy-2- (methylsulfonyl) -5-nitrobenzene as white solid. LCMS: m/z = 250 [M+1] +.
Step 3. 5-fluoro-2-methoxy-4- (methylsulfonyl) aniline.
Into a 100-mL round-bottom flask was placed 1-fluoro-4-methoxy-2- (methylsulfonyl) -5-nitrobenzene (4.62 g, 18.54 mmol) , Pd/C (3.47 g, 32.61 mmol) , MeOH (50 mL) . The flask was charged with H2. The reaction mixture was stirred at 20 ℃ for 16 h. The mixture was filtered and collected the filtrate. The filtrate was concentrated under vaccum. The residue was purified by silica gel column eluted with EA/hexane (v/v = 2/8) . This resulted in 2.27 g (55%yield) of 5-fluoro-2-methoxy-4- (methylsulfonyl) aniline as yellow solid. LCMS: m/z = 220 [M+1] +.
Step 4. 5-fluoro-2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline.
Into a 50-mL round-bottom flask was placed 5-fluoro-2-methoxy-4- (methylsulfonyl) aniline (0.91 g, 4.13 mmol) , 3-bromoprop-1-yne (0.62 g, 5.24 mmol) , K2CO3 (1.86 g, 13.42 mmol) , NaI (0.10 g, 0.67 mmol) , DMF (20 mL) . The mixture was stirred at 85℃ for 16 h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 318 mg (29%yield) of 5-fluoro-2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline as light yellow solid. LCMS: m/z = 258 [M+1] +.
Step 5. N- (2- (3- ( (5-fluoro-2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (7) .
Into a 50-mL round-bottom flask was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.066 g, 145.28 μmol) , 5-fluoro-2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.063 g, 244.87 μmol) , CuI (0.043 g, 225.78 μmol) , Pd (PPh3) 2Cl2 (0.051 g, 56.26 μmol) , DIEA (0.041 g, 317.23 μmol) and methyl sulfoxide (2 mL) . The mixture was stirred at 25℃ for 4h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient:  40-80-100%B (2-30-60min) ; 220 nm; RT: 23.767 –27.715 min; ) . This resulted in 22 mg (25%yield) of N- (2- (3- ( (5-fluoro-2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (7) as white solid. LCMS: m/z =584 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.26 (t, J = 7.9 Hz, 1H) , 7.15 (d, J = 8.0 Hz, 1H) , 7.06 (d, J = 6.4 Hz, 1H) , 6.88 (t, J = 5.7 Hz, 1H) , 6.77 (d, J = 12.6 Hz, 1H) , 6.67 (d, J = 7.8 Hz, 1H) , 5.33 (d, J = 7.9 Hz, 1H) , 4.39 (d, J = 6.2 Hz, 2H) , 3.34 (s, 5H) , 3.18 (s, 3H) , 2.76 (d, J = 11.2 Hz, 2H) , 2.17 (s, 3H) , 2.00 (t, J = 10.9 Hz, 2H) , 1.89 (d, J = 14.3 Hz, 2H) , 1.63 –1.46 (m, 2H) , 1.23 (s, 1H) .
Example 8
3-methoxy-N-methyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzamide (8)
Reaction scheme:
Experimental details
Step1. 4-amino-3-methoxy-N-methylbenzamide
Into a 1 L flask was placed 4-amino-3-methoxybenzoic acid (10.01 g, 59.88 mmol) , 2- (7-aza-1H-benzotriazole-1-yl) -1, 1, 3, 3-Tetramethyluronium hexafluorophosphate (68.52 g, 180.2070 mmol) , N, N-diisopropylethylamine (20.96 g, 162.18 mmol) , methylamine hydrochloride (24.87 g, 368.35 mmol) , N, N-dimethylformamide (500 mL) . The reaction mixture was stirred at room temperature for 24 h. The reaction was quenched by the addition of water (10 mL) . Then saturated sodium hydroxide aqueous solution was added to the mixture until pH = 10～11. The resulting solution extracted with EA (2 x 200 mL) . The organic layer was combined, washed with brine (200 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 9/1) . This resulted in 8.53 g (79.05%yield) of 4-amino-3-methoxy-N-methylbenzamide as yellow oil. LCMS: m/z = 181 [M+1] +.
Step2. 3-methoxy-N-methyl-4- (prop-2-yn-1-ylamino) benzamide
Into a 500 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-amino-3-methoxy-N-methylbenzamide (5.003 g, 27.76 mmol) , potassium carbonate (11.775 g, 85.20 mmol) , sodium iodide (4.402 g, 29.37 mmol) , N, N-dimethylformamide (200 mL) . The reaction mixture was stirred 85℃ for 7 h. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 3/1) . The reaction was quenched by the addition of water (200 mL) . The resulting solution extracted with EA (2 x 200 mL) . The organic layers was combined, washed with brine (200 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 2/5) . This resulted in 2.686 g (44.33%yield) of 3-methoxy-N-methyl-4- (prop-2-yn-1-ylamino) benzamide as yellow solid. LCMS: m/z = 219 [M+1] +.
Step3. 3-methoxy-N-methyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzamide (8)
Into a 500 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-methoxy-N-methyl-4- (prop-2-yn-1-ylamino) benzamide (0.029 g, 132.87 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.054 g, 118.87 μmol) , bis(triphenylphosphine) palladium (II) chloride (0.014 g, 19.83 μmol) , cuprous iodide (0.008 g, 42.01 μmol) , triethylamine (0.022 g, 217.41 μmol) , methyl sulfoxide (2 mL) . The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 4 mL) . The organic layers was combined, washed with brine (5 mL) and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 45-75-100%B (2-30-60min) ; 270 nm; RT: 33.580 -36.570 min) . This resulted in 0.010 g (7.42%yield) of 3-methoxy-N-methyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzamide (8) as white solid. LCMS: m/z = 545 [M+1] +.
1H NMR (400 MHz, DMSO) δ 8.10 (s, 1H) , 7.42 (d, J = 8.7 Hz, 1H) , 7.35 (s, 1H) , 7.23 (d, J = 7.8 Hz, 1H) , 7.13 (d, J = 7.6 Hz, 1H) , 6.75 (d, J = 8.4 Hz, 1H) , 6.65 (d, J = 8.1 Hz, 1H) , 6.01 (s, 1H) , 5.29 (d, J = 7.9 Hz, 1H) , 4.33 (d, J = 6.6 Hz, 2H) , 3.84 (s, 3H) , 3.81 –3.74 (m, 2H) , 2.75 (d, J = 4.4 Hz, 4H) , 2.16 (s, 3H) , 1.98 (t, J = 11.3 Hz, 2H) , 1.87 (d, J = 12.1 Hz, 2H) , 1.53 (d, J = 11.9 Hz, 3H) , 1.23 (s, 1H) .
Example 9
dimethyl (4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide (9)
Reaction scheme:
Experimental details
Step 1. dimethyl (4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide (9) .
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.049 g, 107.86 μmol) , dimethyl (4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide (0.068 g, 328.17 μmol) , Pd (PPh3) 2Cl2 (0.009 g, 12.75 μmol) , CuI (0.004 g, 21.00 μmol) , TEA (0.015 g, 148.24 μmol) , DMF (0.5 mL) , and stirred for 1 h at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (trifluoroacetic acid) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 25-45-45%B (2-30-60min) ; 262 nm; RT: 27.501 –29.585 min; ) to afford dimethyl (4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) phenyl) phosphine oxide (9) (0.010 g, 18.74 μmol, 17.38%yield) as off-white solid . LCMS: m/z =534[M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.53 –7.46 (m, 2H) , 7.25 (t, J = 7.9 Hz, 1H) , 7.14 (d, J = 7.9 Hz, 1H) , 6.83 –6.78 (m, 2H) , 6.72 –6.64 (m, 2H) , 5.31 (d, J = 7.9 Hz, 1H) , 4.31 (d, J = 6.1 Hz, 2H) , 3.80 (q, J = 10.8 Hz, 2H) , 2.81 –2.73 (m, 2H) , 2.17 (s, 3H) , 2.04 –1.95 (m, 2H) , 1.91 –1.85 (m, 2H) , 1.55 (d, J = 13.1 Hz, 8H) .
Example 10
(4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3- (fluoromethoxy) phenyl) dimethylphosphine oxide (racemic) (10)
Reaction scheme:
Experimental details:
Step 1 4-bromo-2- (fluoromethoxy) -1-nitrobenzene
Into a 50 mL 3-necked flask was placed 5-bromo-2-nitrophenol (1.16 g, 5.32 mmol) , fluoroiodomethane (1.43 g, 8.94 mmol) , DBU (2.28 g, 14.97 mmol) , ACN (10 mL) . The reaction was stirred at 80℃ for 1 h. The reaction was quenched with water (10 mL) . The resulted solution was extracted with EA (3 x 30 mL) , washed with brine (30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 1.276 g (5.10 mmol, 95.91%yield) of 4-bromo-2- (fluoromethoxy) -1-nitrobenzene as yellow solid. LCMS: m/z = 250 [M+1] +.
Step 2 4-bromo-2- (fluoromethoxy) aniline
Into a 100 mL 3-necked flask was placed 4-bromo-2- (fluoromethoxy) -1-nitrobenzene (1.332 g, 5.32 mmol) , iron (2.678 g, 47.95 mmol) , NH4Cl (2.610 g, 48.79 mmol) , EtOH (15 mL) , water (3 mL) . The reaction was stirred at 95℃ for 2 h. The reaction mixture was filtered and the filter cake was washed with methanol (2 x 30 mL) . The filterate was concentrated under vacuum to afford the crude product. The crude product was purified by silica gel column eluted with EA/hexane (v/v = 1/3) . This resulted in 1.01 g (4.59 mmol, 86.15% yield) of 4-bromo-2- (fluoromethoxy) aniline as yellow oil. LCMS: m/z = 220 [M+1] +.
Step 3 (4-amino-3- (fluoromethoxy) phenyl) dimethylphosphine oxide.
Into a 25 mL 3-necked flask purged and maintained with an inert atmosphere of nitrogen was placed 4-bromo-2- (fluoromethoxy) aniline (0.551 g, 2.50 mmol) , Palladium (II) acetate (0.132 g, 587.95 umol) , DIEA (0.865 g, 6.69 mmol) , DMF (5 mL) . The reaction was stirred under nitrogen atomosphere at 130℃ for 0.5 h. Then dimethylphosphine oxide (0.603 g, 7.72 mmol) was added at 130℃. The reaction was stirred under nitrogen atmosphere at 130℃ for 1 h The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/9) . This resulted in 0.400 g, (1.84 mmol, 73.55%yield) of (4-amino-3- (fluoromethoxy) phenyl) dimethylphosphine oxide as brown oil. LCMS: m/z = 218 [M+1] +.
Step 4 (3- (fluoromethoxy) -4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide
Into a 25 mL 3-necked flask was placed (4-amino-3- (fluoromethoxy) phenyl) dimethylphosphine oxide (0.366 g, 1.68 mmol) , 3-bromoprop-1-yne (0.295 g, 2.47 mmol) , K2CO3 (0.695 g, 5.02 mmol) , KI (0.384 g, 2.31 mmol) , NMP (5 mL) . The reaction mixture was stirred under nitrogen atmosphere at 80 ℃ for 4 h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) . This resulted in 0.066 g (258.59 μmol, 15.34%yield) of (3- (fluoromethoxy) -4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide as brown oil. LCMS: m/z = 256 [M+1] +.
Step 5 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3- (fluoromethoxy) phenyl) dimethylphosphine oxide (racemic) (10)
Into a 10-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed (3- (fluoromethoxy) -4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide (0.071 g, 278.15 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.051 g, 107.98 μmol, Pd (PPh3) 2Cl2 (0.030 g, 42.49 μmol) , CuI (0.018 g, 94.51 μmol) , DIEA (0.063 g, 487.45 μmol) , methyl sulfoxide (1 mL) . The reaction was stirred under nitrogen atmosphere at RT for 16 h. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 30-30-60-80%B (0-2-30-60min) ; 262 nm; RT: 33.31-35.22) to provide the desired product. This resulted in 1.05 mg (1.75 μmol, 0.62%yield) of (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3- (fluoromethoxy) phenyl) dimethylphosphine oxide (racemic) (10) as white solid. LCMS: m/z =600 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ7.53 –7.33 (m, 2H) , 7.31 –7.11 (m, 2H) , 6.96 (s, 1H) , 6.79 (s, 1H) , 6.33 (s, 1H) , 5.92 (s, 1H) , 5.78 (s, 1H) , 5.16 (s, 1H) , 4.80 (d, J = 49.3 Hz, 1H) , 4.37 (s, 2H) , 3.81 (d, J = 11.4 Hz, 2H) , 3.70 –3.65 (m, 1H) , 3.10 –2.98 (m, 1H) , 2.87 –2.76 (m, 1H) , 2.19 (s, 3H) , 2.02 –1.93 (m, 2H) , 1.76 –1.69 (m, 1H) , 1.58 (d, J = 13.2 Hz, 6H) , 1.50 –1.41 (m, 1H) .
Example 11
N- (2- (3- ( (2- (fluoromethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (11)
Reaction scheme:
Experimental details
Step1. 2- (fluoromethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline
Into a 8 mL flask was placed 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol (0.101 g, 448.36 μmol) , bromofluoromethane (0.053 g, 469.32 μmol) , potassium carbonate (0.126 g, 911.69 μmol) , N, N-dimethylformamide (2 mL) . The reaction mixture was stirred at 45℃ for 3 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 5 mL) . The organic layer was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 1/1) . This resulted in 0.096 g (83.22%yield) of 2- (fluoromethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline as yellow oil. LCMS: m/z = 258 [M+1] +.
Step2. N- (2- (3- ( (2- (fluoromethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) ben zo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (11)
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-Amine (0.051 g, 112.26 μmol) , cuprous iodide (0.007 g, 36.76 μmol) , 2- (fluoromethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.028 g, 108.83 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.023 g, 32.58 μmol) , triethylamine (0.024 g, 237.18 μmol) , methyl sulfoxide (2 mL) . The reaction mixture was stirred at room temperature for 2 h. he reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 4 mL) . The organic layer was combined, washed with brine (5 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 50-75-100%B (2-30-60min) ; 270 nm; RT: 32.200 –34.270 min) . This resulted in 0.023 g (35.10%yield) of N- (2- (3- ( (2- (fluoromethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (11) as yellow oil. LCMS: m/z = 584 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.54 (d, J = 8.6 Hz, 1H) , 7.49 (s, 1H) , 7.25 (t, J = 7.7 Hz, 1H) , 7.14 (d, J = 8.2 Hz, 1H) , 7.00 (d, J = 8.4 Hz, 1H) , 6.76 (d, J = 6.4 Hz, 1H) , 6.66 (d, J = 7.7 Hz, 1H) , 5.97 (s, 1H) , 5.84 (s, 1H) , 5.30 (d, J = 7.9 Hz, 1H) , 4.40 (d, J = 6.1 Hz, 2H) , 3.86 –3.76 (m, 2H) , 3.11 (s, 3H) , 2.75 (d, J = 11.1 Hz, 2H) , 2.16 (s, 3H) , 1.98 (t, J = 11.7 Hz, 2H) , 1.87 (d, J = 10.5 Hz, 2H) , 1.53 (d, J = 12.6 Hz, 2H) , 1.23 (s, 1H) .
Example 12
N- (2- (3- ( (2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (12)
Reaction scheme:
Experimental details
Step 1. 2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline.
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol (0.101 g, 448.36 μmol) , 2-bromo-1, 1-difluoroethane (0.094 g, 648.52 μmol) , K2CO3 (0.069 g, 499.26 μmol) , DMF (1 mL) . The reaction was warmed to 50℃ and stirred for 2.5 h. LCMS showed the reaction was complete. The reaction purified with C18 column, eluted with ACN/water (v/v = 1/3) to afford 2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.072 g, 248.88 μmol, 55.51%yield) as a light yellow oil. LCMS: m/z = 290 [M+1] +.
Step 2. N- (2- (3- ( (2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (12) .
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.048 g, 105.66 μmol) , 2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.054 g, 186.66 μmol) , Pd (PPh3) 2Cl2 (0.013 g, 18.42 μmol) , CuI (0.003 g, 15.75 μmol) , TEA (0.025 g, 247.06 μmol) , DMF (0.5 mL) , and stirred for 1 h at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 44-80-100%B (2-22-40min) ; 220 nm; RT: 20.738 –23.498 min) to afford N- (2- (3- ( (2- (2, 2-difluoroethoxy) -4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benz o [b] thiophen-7-yl) -1-methylpiperidin-4-amine (12) (0.021 g, 34.11 μmol, 18.27 %yield) as off-white solid . LCMS: m/z = 616 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.44 (d, J = 8.4 Hz, 1H) , 7.37 (s, 1H) , 7.25 (t, J = 7.9 Hz, 1H) , 7.14 (d, J = 8.0 Hz, 1H) , 6.94 (d, J = 8.4 Hz, 1H) , 6.66 (d, J = 7.8 Hz, 1H) , 6.58 –6.27 (m, 2H) , 5.32 (d, J = 7.9 Hz, 1H) , 4.49 –4.39 (m, 4H) , 3.81 (q, J = 11.1 Hz, 2H) , 3.10 (s, 3H) , 2.78 (d, J = 11.2 Hz, 2H) , 2.18 (s, 3H) , 2.02 (t, J = 11.5 Hz, 2H) , 1.93 –1.84 (m, 2H) , 1.60 –1.48 (m, 2H) .
Example 13
1-methyl-N- (2- (3- ( (4- (methylsulfonyl) -2- (2, 2, 2-trifluoroethoxy) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (13)
Reaction scheme:
Experimental details
Step1. 2-methoxy-4- (methylsulfonyl) -1-nitrobenzene
Into a 500 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-fluoro-2-methoxy-1-nitrobenzene (20.27 g, 118.45 mmol) , sodium methanesulfinate (12.62 g, 123.62 mmol) , DMA (200 mL) . The reaction mixture was stirred at 70℃ for 2 h. The reaction mixture was quenched with H2O (400 mL) , extracted with EA (1000 mL x 2) , washed with NaCl (aq. 500 mL x 3) and concentrated under vacuum. Then MTBE (200 mL) was added, the mixture was stirred at room temperature for 1 h and filtered. This resulted in 24.96 g (91.13%yield) of 2-methoxy-4- (methylsulfonyl) -1-nitrobenzene as yellow solid. LCMS: m/z = 232 [M+1] +.
Step2. 2-methoxy-4- (methylsulfonyl) aniline
Into a 2 L flask purged and maintained with an inert atmosphere of hydrogen, was placed 2- (methylsulfonyl) -5-nitropyridine (24.24 g, 104.83 mmol) , Pd/C (22.32 g, 209.74 mmol) , methanol (1 L) . The reaction mixture was stirred at room temperature for 19 h. Then the catalyst was removed by filtration and the filtrate was concentrated under vacuum. This resulted in 15.79 g (74.85%yield) of 2-methoxy-4- (methylsulfonyl) aniline as yellow solid. LCMS: m/z = 173 [M+1] +.
Step3. 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline
Into a 500 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-bromopropyne (6.57 g, 55.23 mmol) , 2-methoxy-4- (methylsulfonyl) aniline (10.02 g, 49.79 mmol) , sodium iodide (15.58 g, 103.94 mmol) , potassium carbonate (21.39 g, 154.7695 mmol) , N, N-dimethylformamide (200 mL) . The reaction mixture was stirred at 85℃ for 3 h. The reaction was quenched by the addition of water (500 mL) . The resulting solution was extracted with EA (2 x 500 mL) . The organic layer was combined, washed with brine (500 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. This resulted in 7.56 g (63.45%yield) of 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline as yellow oil. LCMS: m/z = 211 [M+1] +.
Step4. 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol
Into a 100 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (2.35 g, 9.82 mmol) , dichloromethane (20 mL) , then tribromoboron (20 mL) was added at -10℃. The reaction mixture was stirred at 0℃ for 1 h. Then 1 M sodium hydroxide aqueous solution was added to the mixture until pH = 11～12. The aqueous layer was collected, Then 2 M hydrochloric acide aqueous solution was added to the mixture until pH = 7～8, and extracted with EA (2 x 100 mL) . The organic layer was combined, washed with brine (100 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 3/5) .
This resulted in 1.275 g (57.63%yield) of 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol as yellow solid. LCMS: m/z = 226 [M+1] +.
Step5. 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -2- (2, 2, 2-trifluoroethoxy) aniline
Into a 8 mL flask was placed 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol (0.102 g, 452.80 μmol) , 1, 1, 1-trifluoro-2-bromoethane (0.084 g, 515.54 μmol) , potassium carbonate (0.126 g, 911.69 μmol) , N, N-dimethylformamide (2 mL) . The reaction mixture was stirred at 45℃ for 3 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 5 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 1/1) . This resulted in 0.098 g (70.43%yield) of 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -2- (2, 2, 2-trifluoroethoxy) aniline as yellow oil. LCMS: m/z = 308 [M+1] +.
Step 6. 1-methyl-N- (2- (3- ( (4- (methylsulfonyl) -2- (2, 2, 2-trifluoroethoxy) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (13)
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.045 g, 99.06 μmol) , cuprous iodide (0.009 g, 47.26 μmol) , 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -2- (2, 2, 2-trifluoroethoxy) aniline (0.036 g, 117.15 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.026 g, 36.83 μmol) , triethylamine (0.022 g, 217.41 μmol) , methyl sulfoxide (2 mL) . The reaction mixture was stirred at room temperature for 2 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 4 mL) . The organic layers was combined, washed with brine (5 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmol/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 45-80-100%B (2-30-60min) ; 270 nm; RT:33.274 -34.355 min) . This resulted in 0.023 g (35.10%yield) of 1-methyl-N- (2- (3- ( (4- (methylsulfonyl) -2- (2, 2, 2-trifluoroethoxy) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluo roethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (13) as yellow oil. LCMS: m/z = 634 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.69 (d, J = 13.5 Hz, 1H) , 7.50 –7.42 (m, 2H) , 7.25 (t, J = 7.8 Hz, 1H) , 7.14 (d, J = 7.8 Hz, 1H) , 6.96 (d, J = 8.2 Hz, 1H) , 6.66 (d, J = 8.0 Hz, 1H) , 6.44 (t, J = 6.1 Hz, 1H) , 5.31 (d, J = 7.8 Hz, 1H) , 4.89 (q, J = 8.8 Hz, 2H) , 4.42 (d, J = 6.0 Hz, 2H) , 4.22 (t, J = 6.5 Hz, 1H) , 3.81 (q, J = 11.3 Hz, 2H) , 3.10 (s, 3H) , 2.76 (d, J = 11.2 Hz, 2H) , 2.17 (s, 3H) , 1.88 (d, J = 11.9 Hz, 2H) , 1.54 (d, J = 11.4 Hz, 2H) , 1.37 (dd, J = 14.9, 7.5 Hz, 1H) .
Example 14
N- [2- [3- [2- (2-methoxyethoxy) -4-methylsulfonyl-anilino] prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -1-methyl-piperidin-4-amine (14)
Reaction scheme:
Experimental details:
Step1. 2- (2-methoxyethoxy) -4-methylsulfonyl-N-prop-2-ynyl-aniline.
Into a 20 mL vial was placed 5- (methylsulfonyl) -2- (prop-2-yn-1-ylamino) phenol (0.100 g, 443.92 μmol) , 1-bromo-2-methoxyethane (0.074 g, 532.41 μmol) , potassium carbonate (0.204 g, 1.48 mmol) , dimethylformamide (4 mL) . The reaction was stirred at 50℃ overnight. The reaction was quenched with water (50 mL) , extracted with EA (3 x 30 mL) . The organic layer was combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v=1/1) . This resulted in 0.113 g (89.84%yield) of 2- (2-methoxyethoxy) -4-methylsulfonyl-N-prop-2-ynyl-aniline as off-white solid. LCMS: m/z = 284 [M+1] +.
Step2. N- [2- [3- [2- (2-methoxyethoxy) -4-methylsulfonyl-anilino] prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -1-methyl-piperidin-4-amine (14) .
Into a 8 mL vial was placed 2- (2-methoxyethoxy) -4-methylsulfonyl-N-prop-2-ynyl-aniline (0.049 g, 172.94 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.050 g, 110.06 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.076 g, 107.66 μmol) , CuI (0.140 g, 735.10 μmol) , DIEA (0.209 g, 1.62 mmol) , methyl sulfoxide (3 mL) . The reaction was stirred at RT for 3 h under nitrogen. The reaction was quenched with water (20 mL) , extracted with EA (3 x 30 mL) . The organic layers was combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmol/L TFA) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 15-40-50%B2-30-40min) ; 270 nm; RT: 36.17 -36.91 min) to provide the desired product. This resulted in 0.014 g (20.86%yield) of N- [2- [3- [2- (2-methoxyethoxy) -4-methylsulfonyl-anilino] prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7 -yl] -1-methyl-piperidin-4-amine (14) as off-white solid. LCMS: m/z =610 [M+1] +.
1H NMR (400 MHz, MeOD) δ 7.52 (d, J = 8.4 Hz, 1H) , 7.36 (s, 1H) , 7.29 (t, J = 7.9 Hz, 1H) , 7.15 (d, J = 8.0 Hz, 1H) , 6.97 (d, J = 8.4 Hz, 1H) , 6.73 (d, J = 7.2 Hz, 1H) , 4.43 (s, 2H) , 4.33 –4.21 (m, 2H) , 3.87 –3.77 (m, 2H) , 3.77 –3.64 (m, 2H) , 3.58 –3.49 (m, 1H) , 3.47 (s, 3H) , 3.06 (d, J = 10.9 Hz, 3H) , 2.95 (d, J = 11.5 Hz, 2H) , 2.36 (s, 3H) , 2.29 (t, J = 11.2 Hz, 2H) , 2.09 (d, J = 12.5 Hz, 2H) , 1.73 –1.58 (m, 2H) .
Example 15
(4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (racemic) (15)
Reaction scheme:
Experimental details:
Step 1 (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (racemic) (15)
Into a 10-mL round-bottom flask was placed (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide (0.078g g, 328.78μmol) , (3S, 4R) -3-fluoro-1-methyl-N- (3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) (0.076 g, 160.92μmol) , Pd (PPh3) 2Cl2 (0.023 g, 32.58 μmol) , CuI (0.020 g, 105.01μmol) , DIEA (0.086 g, 665.41 umol) , methyl sulfoxide (2 mL) . The reaction was stirred under nitrogen atomosphere at RT for 6 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 35-70-70%B (2-30-60min) ; 270 nm; RT: 25.18-26.87; ) to provide the desired product. This resulted in 0.047g (80.81 μmol, 24.57%yield) of (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (racemic) (15) as white solid. LCMS: m/z = 582 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.32 –7.17 (m, 3H) , 7.15 –7.09 (m, 1H) , 6.85 –6.79 (m, 1H) , 6.78 (d, J = 7.7 Hz, 1H) , 6.06 (t, J = 6.4 Hz, 1H) , 5.15 (d, J = 8.5 Hz, 1H) , 4.79 (d, J = 49.5 Hz, 1H) , 4.34 (d, J = 6.3 Hz, 2H) , 3.81 (d, J = 29.5 Hz, 5H) , 3.64 (d, J = 28.8 Hz, 1H) , 3.03 (t, J = 11.4 Hz, 1H) , 2.79 (d, J = 11.6 Hz, 1H) , 2.27 (d, J = 13.0 Hz, 1H) , 2.18 (s, 3H) , 2.08 (t, J = 11.4 Hz, 1H) , 1.99 –1.90 (m, 1H) , 1.71 (d, J = 11.8 Hz, 1H) , 1.58 (d, J = 13.1 Hz, 6H) .
Example 16
N1- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -N4, N4-dimethylcyclohexane-1, 4-diamine (16)
Reaction scheme:
Experimental details:
Step 1. N1- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] t hiophen-7-yl) -N4, N4-dimethylcyclohexane-1, 4-diamine (16) .
Into a 50-mL round-bottom flask was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.083 g, 177.15 μmol) , 4- (dimethylamino) cyclohexan-1-one (0.120 g, 849.80 μmol) , NaCNBH3 (0.079 g, 1.84 mmol) , and EtOH (5 mL) . The mixture was stirred at 60℃ for 16 h. The reaction was quenched by water (20 mL) , extracted with EA (50 mL x 2) . The combined organic layer was washed with water (50 mL) and brine (50 mL) successively, separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 60-90-100%B (2-30-60min) ; 265 nm; RT: 33.497 –37.464 min) . This resulted in 47 mg (44%yield) of N1- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) -N4, N4-dimethylcyclohexane-1, 4-diamine (16) as white solid. LCMS: m/z =594 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.24 (d, J = 10.9 Hz, 2H) , 7.13 (t, J = 7.5 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.67 (t, J = 8.5 Hz, 1H) , 6.51 (t, J = 6.1 Hz, 1H) , 5.21 (dd, J = 40.1, 7.5 Hz, 1H) , 4.38 (d, J = 6.1 Hz, 2H) , 3.90 (s, 3H) , 3.56 (s, 2H) , 3.10 (s, 3H) , 2.21 (s, 3H) , 2.18 (s, 3H) , 2.05 (d, J = 18.8 Hz, 2H) , 1.76 (d, J = 7.6 Hz, 3H) , 1.61 (s, 1H) , 1.48 (s, 1H) , 1.33 (d, J = 14.5 Hz, 2H) .
Example 17
Trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17) and cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17b)
Reaction scheme:
Experimental details
Step1. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -1, 4-dioxaspiro [4.5] decan-8-amine
Into a 25 mL flask was placed titanium ethoxide (0.577 g, 2.53 mmol) , 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.401 g, 855.90 μmol) , toluene (10 mL) , 1, 4-dioxaspiro [4.5] decan-8-one (0.437 g, 2.80 mmol) . The reaction mixture was stirred at 110℃ for 2 h. The reaction was concentrated under vacuum and dissolved with methanol (10 mL) . Then sodium cyanoboronhydride (0.226 g, 5.27 mmol) was added. The reaction mixture was stirred at room temperature for another 15 h. The reaction was quenched by the addition of water (20 mL) and extracted with EA (2 x 20 mL) . The organic layer was combined, washed with brine (20 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 2/5) . This resulted in 0.608 g (93.60%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -1, 4-dioxaspiro [4.5] decan-8-amine as yellow oil. LCMS: m/z = 609 [M+1] +.
Step2. 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) cyclohexan-1-one
Into a 25 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1, 4-dioxaspiro [4.5] decan-8-amine (0.603 g, 990.65 μmol) , acetonitrile (10 mL) , 4-methylbenzenesulfonic acid hydrate (1.583 g, 8.32 mmol) in water (5 mL) . The reaction mixture was stirred at room temperature for 5 h. Then saturated sodium hydrogen carbonate aqueous solution was added to the mixture until pH = 7～8. The resulting solution extracted with EA (2 x 20 mL) . The organic layers was combined, washed with brine (50 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 3/1) . This resulted in 0.447 g (79.91%yield) of 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) cyclohexan-1-one as yellow oil. LCMS: m/z = 565 [M+1] +.
Step3. trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17) and cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17b)
Into a 8 mL flask was placed 2-oxa-6-azaspiro [3.3] heptane (0.100 g, 1.01 mmol) , 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) cyclohexan-1-one (0.050 g, 88.55 μmol) , methanol (2 mL) , acetic acid (0.1 mL) . The reaction mixture was stirred at room temperature for 24 h. Then sodium cyanoboronhydride (0.030 g, 699.70 μmol) was added. The reaction mixture was stirred at room temperature for another 2 h. The reaction was quenched by the addition of water (10 mL) and extracted with EA (2 x 20 mL) . The organic layers was combined, washed with brine (20 mL) and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 40-75-100%B (2-30-60min; 272 nm; RT: 33.268-34.375 min) . This resulted in 0.017 g (29.63%yield) of trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17) as white solid. LCMS: m/z = 648 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.9 Hz, 1H) , 7.27 –7.21 (m, 2H) , 7.11 (d, J = 8.0 Hz, 1H) , 6.88 (d, J = 8.3 Hz, 1H) , 6.63 (d, J = 7.9 Hz, 1H) , 6.50 (s, 1H) , 5.23 (d, J = 8.2 Hz, 1H) , 4.58 (s, 4H) , 4.37 (d, J = 6.5 Hz, 2H) , 3.89 (s, 3H) , 3.79 (d, J = 11.5 Hz, 2H) , 3.21 (s, 4H) , 3.09 (s, 3H) , 1.92 (s, 2H) , 1.69 (s, 2H) , 1.25 (d, J = 14.6 Hz, 3H) , 0.99 (d, J = 13.7 Hz, 3H) .
And 0.010 g (17.43%yield) of cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) pr op-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (17b) as white solid. LCMS: m/z = 648 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.7 Hz, 1H) , 7.29 –7.19 (m, 2H) , 7.11 (d, J = 7.9 Hz, 1H) , 6.88 (d, J = 8.5 Hz, 1H) , 6.63 (d, J = 7.8 Hz, 1H) , 6.51 (t, J = 6.1 Hz, 1H) , 5.27 (d, J = 7.8 Hz, 1H) , 4.59 (s, 4H) , 4.38 (d, J = 6.1 Hz, 2H) , 3.89 (s, 3H) , 3.79 (q, J = 10.8 Hz, 2H) , 3.20 (s, 4H) , 3.09 (s, 3H) , 2.09 (d, J = 15.6 Hz, 1H) , 1.57 (dd, J = 31.9, 18.2 Hz, 6H) , 1.39 (d, J = 10.3 Hz, 2H) , 1.23 (s, 1H) .
Example 18
Trans-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18) and cis-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18b)
Reaction scheme
Experimental Details
Step 1. trans-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18) and cis-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino ) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18b) .
Into a 4-mL sealed tube and maintained with an inert atmosphere of nitrogen, was placed 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) cyclohexan-1-one (0.05 g, 88.55 mmol) , 7-oxa-2-azaspiro [3.5] nonane (0.05 g, 393.11 mmol) , acetic acid (0.03 g, 499.58 mmol) , methanol (1 mL) . The reaction mixture was stirred at room temperature for 3 h. Sodium cyanoborohydride (0.04 g, 636.53 mmol) was added to the reaction and stirred at room temperature for 2 h. The reaction was then quenched by the addition of water. The resulting solution was extracted with ethyl acetate (2 x 50 mL) , the organic layers combined and dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The resulting crude product was further purified by pre-HPLC with MeOH/H2O (0.1%ammonium hydroxide) , Flow rate: 25 mL/min; Gradient: 50-85-100%B (2-30-60min) ; 270 nm;RT: 36.800-38.238/40.647-42.205) . This resulted in 0.008 g (13.37%yield) of trans-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18) as white solid. LCMS: m/z = 676 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.29 –7.19 (m, 2H) , 7.12 (d, J = 7.8 Hz, 1H) , 6.88 (d, J = 8.4 Hz, 1H) , 6.63 (d, J = 7.7 Hz, 1H) , 6.51 (t, J = 6.2 Hz, 1H) , 5.24 (d, J = 8.0 Hz, 1H) , 4.38 (d, J = 6.0 Hz, 2H) , 3.89 (s, 3H) , 3.80 (dd, J = 22.2, 11.3 Hz, 2H) , 3.47 (s, 4H) , 3.10 (s, 3H) , 2.91 (s, 4H) , 1.95 (d, J = 11.1 Hz, 3H) , 1.74 (d, J = 11.7 Hz, 2H) , 1.61 (s, 4H) , 1.27 (dd, J = 23.1, 11.1 Hz, 3H) , 1.10 –0.92 (m, 2H) .
And 0.007 g (11.69%yield) of cis-N- (4- (7-oxa-2-azaspiro [3.5] nonan-2-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (18b) as white solid. LCMS: m/z = 676 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.2 Hz, 1H) , 7.31 –7.19 (m, 2H) , 7.12 (d, J = 7.8 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.64 (d, J = 7.5 Hz, 1H) , 6.51 (t, J = 5.8 Hz, 1H) , 5.22 (d, J = 7.4 Hz, 1H) , 4.38 (d, J = 5.9 Hz, 2H) , 3.89 (s, 3H) , 3.79 (dd, J = 22.2, 11.2 Hz, 2H) , 3.49 (s, 4H) , 3.10 (s, 3H) , 2.89 (s, 4H) , 2.22 (s, 1H) , 1.71 –1.51 (m, 9H) , 1.40 (t, J = 15.1 Hz, 2H) , 1.23 (s, 2H) .
Example 19
Trans-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19) and cis-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19b)
Reaction scheme:
Experimental details:
Step 1. Synthesis of trans-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19) and cis-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (19b)
Into a 8-mL reaction vial was added 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) cyclohexan-1-one (0.033 g, 58.44 μmol) , acetic acid, (0.033 g, 549.52 μmol) , 2, 2'-azanediylbis (ethan-1-ol) (0.554 g, 5.26 mmol) . The reaction mixture was stirred at 60℃ for 2h. The reaction was quenched by aq. Na2CO3 (10 mL) , extracted with DCM (30 mL x 3) and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 35-65-65%B (2-30-60min) ; 270 nm; RT: 26.332-27.528 min and RT: 31.669-33.143 min) to afford trans-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) ben zo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (0.005 g, 13.08%yield) as off-white solid. LCMS: m/z =654 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (dd, J = 8.3, 1.6 Hz, 1H) , 7.25 (dd, J = 8.3, 4.8 Hz, 2H) , 7.12 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.66 (d, J = 7.9 Hz, 1H) , 6.51 (t, J = 6.2 Hz, 1H) , 5.23 (d, J = 8.0 Hz, 1H) , 4.44 –4.23 (m, 4H) , 3.89 (s, 3H) , 3.80 (q, J = 11.0 Hz, 2H) , 3.41 –3.33 (m, 4H) , 3.10 (s, 3H) , 2.54 (d, J = 6.4 Hz, 4H) , 1.74 (d, J = 11.3 Hz, 2H) , 1.46 –1.17 (m, 6H) .
And cis-2, 2'- ( (4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) cyclohexyl) azanediyl) bis (ethan-1-ol) (0.004 g, 10.46%) as off-white solid. LCMS: m/z =654 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.31 –7.23 (m, 2H) , 7.18 (d, J = 8.0 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.69 (d, J = 7.7 Hz, 1H) , 6.52 (t, J = 6.1 Hz, 1H) , 5.05 (d, J = 5.7 Hz, 1H) , 4.38 (d, J = 6.1 Hz, 2H) , 3.95 –3.74 (m, 5H) , 3.71 (s, 1H) , 3.40 (t, J = 6.2 Hz, 4H) , 3.10 (s, 3H) , 2.62 (dd, J = 18.5, 12.6 Hz, 4H) , 2.05 –1.85 (m, 3H) , 1.71 –1.41 (m, 5H) , 1.24 (s, 3H) .
Example 20
N- [2- [3- (2-methoxy-4-methylsulfonyl-anilino) prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -1- (3-methoxypropyl) piperidin-4-amine (20)
Reaction scheme:
Experimental details:
Step1. N- [2- [3- (2-methoxy-4-methylsulfonyl-anilino) prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -1- (3-methoxypropyl) piperidin-4-amine (20) .
Into a 8 mL vial was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.056 g, 119.53 μmol) , 1- (3-methoxypropyl) piperidin-4-one (0.125 g, 729.99 μmol) , titanium ethoxide (0.156 g, 683.89 μmol) , Toluene (1 mL) . The reaction was stirred at 110℃ for 1 h. The reaction was concentrated under vacuum. The crude was added MeOH (1 mL) and Sodium cyanoboronhydride (0.120 g, 2.80 mmol) . The reaction was stirred at r. t overnight. The reaction was quenched with water (20 mL) , extracted with EA (30 mL x 2) . The combined organic layers were washed with water (50 mL) and brine (50 mL) successively, separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 45-80-100%B (2-30-60min) ; 270 nm; RT: 40.998-42.953 min) . This resulted in 0.035 g (46.95%yield) of N- [2- [3- (2-methoxy-4-methylsulfonyl-anilino) prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -1- (3-methoxypropyl) piperidin-4-amine (20) as off-white solid. LCMS: m/z =624 [M+1] +.
1H NMR (400 MHz, Methanol-d4) δ 7.54 –7.47 (m, 1H) , 7.36 –7.25 (m, 2H) , 7.15 (d, J = 8.0 Hz, 1H) , 6.96 (d, J = 8.4 Hz, 1H) , 6.73 (d, J = 7.6 Hz, 1H) , 4.42 (s, 2H) , 3.97 (s, 3H) , 3.76 –3.64 (m, 2H) , 3.58 –3.49 (m, 1H) , 3.45 (d, J = 6.0 Hz, 2H) , 3.34 (s, 3H) , 3.08 (s, 3H) , 3.00 (d, J = 11.6 Hz, 2H) , 2.54 –2.46 (m, 2H) , 2.23 (d, J = 23.2 Hz, 2H) , 2.09 (d, J = 12.2 Hz, 2H) , 1.87 –1.76 (m, 2H) , 1.71 –1.56 (m, 2H) .
Example 21
3-methoxy-N, N-dimethyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (21)
Reaction scheme:
Experimental details:
Step 1 3-methoxy-N, N-dimethyl-4-nitrobenzenesulfonamide
Into a 20 mL sealed tube was placed 3-methoxy-4-nitrobenzenesulfonyl chloride (0.536 g, 2.13 mmol) , dimethylamine (0.542 g, 3.96 mmol) , ACN (5 mL) . The reaction was stirred at RT for 0.5 h. The reaction was stirred at RT for 0.5 h. The reaction mixture was purified with silica gel column eluted with EA/hexane (v/v = 2/3) . This resulted in 0.554 g (2.12 mmol, 99.93%yield) of 3-methoxy-N, N-dimethyl-4-nitrobenzenesulfonamide as light yellow solid. LCMS: m/z = 261 [M+1] +.
Step 2 4-amino-3-methoxy-N, N-dimethylbenzenesulfonamide
Into a 40 mL sealed tube was placed 3-methoxy-N, N-dimethyl-4-nitrobenzenesulfonamide (0.566 g, 2.17 mmol) , iron (1.406 g, 25.17 mmol) , NH4Cl (1.121 g, 20.95 mmol) , MeOH (8 mL) , water (2 mL) . The reaction mixture was stirred under nitrogen at 70℃ for 4 h. The reaction mixture was filtered through celite pad and the filter cake was washed with methanol (2 x 20 mL) . The filterate was then concentrated under reduced pressure to afford the product. This resulted in 0.530 g (2.29 mmol, 99.93%yield) of 4-amino-3-methoxy-N, N-dimethylbenzenesulfonamide as light yellow solid. LCMS: m/z = 231 [M+1] +.
Step 3 3-methoxy-N, N-dimethyl-4- (prop-2-yn-1-ylamino) benzenesulfonamide
Into a 8 mL sealed tube was placed 4-amino-3-methoxy-N, N-dimethylbenzenesulfonamide (0.151 g, 655.71 μmol) , 3-bromoprop-1-yne (0.102 g, 857.43 μmol) , K2CO3 (0.263 g, 1.90 mmol) , NMP (2 mL) . The reaction mixture was stirred under nitrogen at 80℃ for 4 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by silica gel column eluted with EA/hexane (v/v = 2/3) . This resulted in 0.119 g (443.48 μmol, 67.63%yield) of 3-methoxy-N, N-dimethyl-4- (prop-2-yn-1-ylamino) benzenesulfonamide as light yellow solid. LCMS: m/z = 269 [M+1] +.
Step 4 3-methoxy-N, N-dimethyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (21)
Into a 10-mL round-bottom flask was placed 3-methoxy-N, N-dimethyl-4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.098 g, 365.22 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.058 g, 127.67 μmol) , Pd (PPh3) 2Cl2 (0.036 g, 50.99 μmol) , CuI (0.019 g, 99.76 μmol) , DIEA (0.044 g, 340.44 μmol) , methyl sulfoxide (1 mL) . The reaction was stirred under nitrogen atomosphere at RT for 1 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-80-95-95%B (2-30-45-60min) ; 220 nm; RT: 41.58-49.20) to provide the desired product. This resulted in 0.035g (58.85 μmol, 40.09%yield) of 3-methoxy-N, N-dimethyl-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2 -yl) prop-2-yn-1-yl) amino) benzenesulfonamide (21) as white solid. LCMS: m/z =595 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.28 –7.22 (m, 2H) , 7.32 –7.10 (m, 2H) , 6.91 (d, J = 8.4 Hz, 1H) , 6.67 (d, J = 7.8 Hz, 1H) , 6.49 (t, J = 6.2 Hz, 1H) , 5.92 (s, 1H) , 5.78 (s, 1H) , 5.16 (d, J = 7.9 Hz, 1H) , 4.80 (d, J = 49.3 Hz, 2H) , 3.83 (d, J = 35.5 Hz, 5H) , 2.79 (d, J = 11.1 Hz, 2H) , 2.56 (s, 6H) , 2.20 (s, 3H) , 2.08 –2.00 (m, 2H) , 1.92 –1.84 (m, 2H) , 1.60 –1.53 (m, 2H) , 1.23 (s, 1H) .
Example 22
N- (2- (3- ( (2-methoxy-4- (morpholinosulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (22)
Reaction scheme:
Experimental details:
Step 1 4- ( (3-methoxy-4-nitrophenyl) sulfonyl) morpholine
Into a 20 mL sealed tube was placed 3-methoxy-4-nitrobenzenesulfonyl chloride (0.529 g, 2.10 mmol) , morpholine (0.387 g, 4.44 mmol) , ACN (5 mL) . The reaction was stirred at RT for 0.5 h. The reaction was stirred at RT for 0.5 h. The reaction mixture was purified with silica gel column eluted with EA/hexane (v/v = 2/3) . This resulted in 0.690 g (2.28 mmol, 100.00%yield) of 4- ( (3-methoxy-4-nitrophenyl) sulfonyl) morpholine as faint yellow solid. LCMS: m/z = 303 [M+1] +.
Step 2 2-methoxy-4- (morpholinosulfonyl) aniline
Into a 40 mL sealed tube was placed 4- ( (3-methoxy-4-nitrophenyl) sulfonyl) morpholine (0.669 g, 2.57 mmol) , iron (1.275 g, 22.83 mmol) , NH4Cl (1.220 g, 22.80 mmol) , EtOH (10 mL) , water (2 mL) . The reaction mixture was stirred under nitrogen at 90 ℃ for 16 h. The reaction mixture was filtered through celite pad and the filter cake was washed with methanol (2 x 20 mL) . The filterate was then concentrated under reduced pressure to afford the product. This resulted in 0.392 g (1.43 mmol, 56.00%yield) of 2-methoxy-4- (morpholinosulfonyl) aniline as faint yellow solid. LCMS: m/z = 273 [M+1] +.
Step 3 2-methoxy-4- (morpholinosulfonyl) -N- (prop-2-yn-1-yl) aniline
Into a 8 mL sealed tube was placed 2-methoxy-4- (morpholinosulfonyl) aniline (0.161 g, 591.21 μmol) , 3-bromoprop-1-yne (0.099 g, 832.21 μmol) , K2CO3 (0.251 g, 1.81 mmol) , NMP (2 mL) . The reaction mixture was stirred under nitrogen at 80℃ for 16 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified with silica gel column eluted with EA/hexane (v/v = 2/3) . This resulted in 0.138 g (444.63 μmol, 75.20%yield) of 2-methoxy-4- (morpholinosulfonyl) -N- (prop-2-yn-1-yl) aniline as faint yellow solid. LCMS: m/z = 311 [M+1] +.
Step 4 N- (2- (3- ( (2-methoxy-4- (morpholinosulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (22)
Into a 10-mL round-bottom flask was placed 2-methoxy-4- (morpholinosulfonyl) -N- (prop-2-yn-1-yl) aniline (0.072 g, 231.98 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.128 g, 281.75 μmol) , Pd (PPh3) 2Cl2 (0.036 g, 50.99 μmol) , CuI (0.013 g, 68.25 μmol) , DIEA (0.072 g, 557.09 μmol) , methyl sulfoxide (2 mL) . The reaction was stirred under nitrogen atomosphere at RT for 2 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40mL/min; Gradient: 40-80-80%B (2-30-60min) ; 220 nm; RT: 24.95-29.32) to provide the desired product. This resulted in 0.035g (58.85 μmol, 40.09%yield) of N- (2- (3- ( (2-methoxy-4- (morpholinosulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -1-methylpiperidin-4-amine (22) as white solid. LCMS: m/z =595 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.29 –7.21 (m, 2H) , 7.14 (d, J = 8.0 Hz, 1H) , 7.04 (d, J = 1.9 Hz, 1H) , 6.92 (d, J = 8.4 Hz, 1H) , 6.66 (d, J = 7.8 Hz, 1H) , 6.55 (t, J = 6.2 Hz, 1H) , 5.31 (d, J = 7.9 Hz, 1H) , 4.39 (d, J = 6.2 Hz, 2H) , 3.84 (d, J = 39.1 Hz, 5H) , 3.62 (t, J = 4.5 Hz, 4H) , 2.83 (t, J = 4.8 Hz, 4H) , 2.78 –2.70 (m, 2H) , 2.17 (s, 3H) , 1.99 –1.89 (m, 2H) , 1.93 –1.83 (m, 2H) , 1.56 –1.49 (m, 2H) , 1.23 (s, 1H) .
Example 23
3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (23)
Reaction scheme:
Experimental details:
Step1. benzyl (3-methoxy-4-nitrophenyl) sulfane
To a mixture of 4-fluoro-2-methoxy-1-nitrobenzene (20.50 g, 119.80 mmol) and K2CO3 (125.57 g, 908.57 mol) in 200 mL DMF was added phenylmethanethiol (16.34 g, 131.77 mol) at 0℃. The mixture was stirred at room temperature for 8 hours and the mixture was added to 500 mL water, the mixture was filtered and washed with water (100 mL × 2) and dried in the oven. This resulted in 18.10 g (54.88%) of benzyl (3-methoxy-4-nitrophenyl) sulfane as little yellow solid. LCMS: m/z = 276 [M+1] +
Step2. 3-methoxy-4-nitrobenzenesulfonyl chloride
Into a 100-mL round-bottom flask was placed benzyl (3-methoxy-4-nitrophenyl) sulfane (14.47 g, 52.56 mmol) , HOAc (90 mL) , H2O (15 mL) . The mixture was cooled to 0℃. Then NCS (30.45 g, 228.03 mmol) was added over 5 min maintaining the internal temperature below 5℃. The mixture was stirred for 1h at RT. The reaction mixture was poured into water (150 mL) and extracted with EA (300 mL x 2) . The combined organic layers was washed with brine (200 mL) , dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column, eluted with EA/hexane (v/v = 1/1) to afford 3-methoxy-4-nitrobenzenesulfonyl chloride (9.792 g, 74.04%yield) as a little yellow solid.
Step3. 3-methoxy-4-nitrobenzenesulfonamide
To a mixture of 3-methoxy-4-nitrobenzenesulfonyl chloride (0.510 g, 2.03 mmol) in 10 mL MeCN was added ammonium hydroxide (1 mL) at 0℃. The mixture was stirred at room temperature for 0.5 h. The mixture was concentrated under reduced pressure. This resulted in 3-methoxy-4-nitrobenzenesulfonamide (0.491 g, crude) as off-white solid. LCMS: m/z = 233 [M+1] +
Step4. 4-amino-3-methoxybenzenesulfonamide
To a solution of 3-methoxy-4-nitrobenzenesulfonamide (0.481 g, 2.07 mmol) in MeOH (8 mL) was added Pd/C (10%, 0.097 g) under N2. The mixture was degassed under vacuum and purged with H2 (g) for three times. The reaction mixture was stirred at room temperature for 2 h. The solid was filtered off and the filter cake was washed with MeOH (10 mL) . The filtrate was concentrated under vacuum to afford 4-amino-3-methoxybenzenesulfonamide (0.470 g, crude) as grey solid. LCMS: m/z = 203 [M+1] +
Step5. 3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide
A mixture of 4-amino-3-methoxybenzenesulfonamide (0.465 g, 2.30 mmol) , 3-bromoprop-1-yne (0.595 g, 5. 00 mmol) , and K2CO3 (0.958 g, 6.93 mmol) in DMA (10 mL) was degassed and purged with N2 (g) for three times. The mixture was stirred at 50℃ for 12h. The reaction mixture was quenched by the addition of water (20 mL) and extracting with EA (100 mL x 3) . The combined organic layers was washed with brine (30 mL x 4) , filtered, and concentrated under reduced pressure. The residue was purified with C18 column eluted with ACN/water (v/v = 1/2) to afford 0.152 g (27.51%) of 3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide as yellow solid. LCMS: m/z = 241 [M+1] +
Step6. 3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (23)
Into a 8-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.051 g, 0.11 mmol) , 3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.048 g, 0.20 mmol) , Pd (dppf) Cl2 (0.024 g, 0.04 mmol) , CuI (0.018 g, 0.09 mmol) , DIEA (0.057 g, 0.44 mmol) , DMSO (1 mL) . The reaction mixture was stirred at room temperature for 1 h. The mixture was quenched with extracted with H2O (20 mL) , extracted with EA (20 mL x 2) . The combined organic layers were washed with brine (10 mL) , separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-85-95%B (2-30-40min) ; 220 nm; RT: 32.686 –34.791 min) to afford 3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (23) (0.024 g, 37.73%yield) as white solid. LCMS: m/z = 567 [M+1] +
1H NMR (400 MHz, MeOD) δ 7.50 –7.42 (m, 1H) , 7.32 (t, J = 5.9 Hz, 1H) , 7.26 (t, J = 7.9 Hz, 1H) , 7.12 (d, J = 8.0 Hz, 1H) , 6.86 (d, J = 8.4 Hz, 1H) , 6.71 (t, J = 7.7 Hz, 1H) , 4.37 (s, 2H) , 3.93 (s, 3H) , 3.75 –3.59 (m, 2H) , 3.58 –3.45 (m, 1H) , 2.90 (d, J = 12.0 Hz, 2H) , 2.32 (d, J = 6.0 Hz, 3H) , 2.22 (t, J = 11.4 Hz, 2H) , 2.06 (d, J = 12.0 Hz, 2H) , 1.67 –1.53 (m, 2H) .
Example 24
N- (2, 3-dihydroxypropyl) -3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) ben zo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (24)
Reaction scheme:
Experimental details:
Step1. benzyl (3-methoxy-4-nitrophenyl) sulfane
To a mixture of 3-methoxy-4-nitrobenzenesulfonyl chloride (0.512 g, 2.03 mmol) in 10 mL MeCN was added 3-aminopropane-1, 2-diol (0.238 g, 2.61 mmol) at 0℃. The mixture was stirred at room temperature for 3 h. The resulted mixture was concentrated under reduced pressure. This resulted in N- (2, 3-dihydroxypropyl) -3-methoxy-4-nitrobenzenesulfonamide (1.033 g, crude) as colorless oil. LCMS: m/z = 307 [M+1] +
Step2. 4-amino-N- (2, 3-dihydroxypropyl) -3-methoxybenzenesulfonamide
To a solution of N- (2, 3-dihydroxypropyl) -3-methoxy-4-nitrobenzenesulfonamide (1.031 g, 3.36 mmol) in MeOH (8 mL) was added Pd/C (10%, 0.219 g) under N2 (g) . The mixture was degassed under vacuum and purged with H2 (g) for three times. The reaction mixture was stirred at room temperature for 2 hours. The solid was filtered off and the filter cake was washed with MeOH (10 mL) . The combined filtrate was concentrated under vacuum to give 4-amino-N- (2, 3-dihydroxypropyl) -3-methoxybenzenesulfonamide (1.004 g, crude) as grey solid. LCMS: m/z = 277 [M+1] +
Step3. N- (2, 3-dihydroxypropyl) -3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide
A mixture of 4-amino-N- (2, 3-dihydroxypropyl) -3-methoxybenzenesulfonamide (1.001 g, crude) , 3-bromoprop-1-yne (0.467 g, 3.93 mmol) , and K2CO3 (0.795 g, 5.75 mmol) in NMP (10 mL) was degassed and purged with N2 (g) for three times. The mixture was then stirred at 80℃ for 48h. The reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (100 mL x 3) . The combined organic layers was washed with brine (30 mL x 4) , filtered and concentrated under reduced pressure. The residue was purified by C18 column eluted with ACN/water (v/v = 1/4) to afford 0.078 g (6.85%) of N- (2, 3-dihydroxypropyl) -3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide as colorless oil. LCMS: m/z = 315 [M+1] +
Step4. N- (2, 3-dihydroxypropyl) -3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) ben zo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (24)
Into a 8-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.048 g, 0.11 mmol) , N- (2, 3-dihydroxypropyl) -3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.077 g, 0.24 mmol) , Pd (dppf) Cl2 (0.019 g, 0.03 mmol) , CuI (0.009 g, 0.05 mmol) , DIEA (0.062 g, 0.48 mmol) , DMSO (1 mL) . The reaction mixture was stirred at room temperature for 1 h. The reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 35-65-95%B (2-30-60min) ; 270 nm; RT: 38.125 –42.751 min) to afford N- (2, 3-dihydroxypropyl) -3-methoxy-4- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b ] thiophen-2-yl) prop-2-yn-1-yl) amino) benzenesulfonamide (24) (0.015 g, 22.14%yield) as white solid. LCMS: m/z = 641 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.32 –7.23 (m, 2H) , 7.21 (s, 1H) , 7.18 –7.10 (m, 1H) , 7.11 –7.06 (m, 1H) , 6.83 (d, J = 8.0 Hz, 1H) , 6.66 (d, J = 7.6 Hz, 1H) , 6.33 (t, J = 6.0 Hz, 1H) , 5.32 (d, J = 7.6 Hz, 1H) , 4.72 (s, 1H) , 4.51 (s, 1H) , 4.36 (d, J = 6.0 Hz, 2H) , 3.88 –3.75 (m, 4H) , 3.55 –3.42 (m, 2H) , 2.85 –2.75 (m, 3H) , 2.59 –2.52 (m, 1H) , 2.20 (s, 3H) , 2.12 –1.93 (m, 3H) , 1.89 (d, J = 12.4 Hz, 2H) , 1.61 –1.47 (m, 2H) , 1.37 –1.26 (m, 2H) .
Example 25
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.1] octan-8-amine (25)
Reaction scheme:
Experimental details:
Step 1 tert-butyl 8- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) -3-azabicyclo [3.2.1] octane-3-carboxylate
Into a 20 mL sealed tube was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.117 g, 414.07 μmol) , tert-butyl 8-oxo-3-azabicyclo [3.2.1] octane-3-carboxylate (0.561 g, 519.34 μmol) , dibutyltin dichloride (0.082 g, 269.87 μmol) . The reaction was stirred under nitrogen atomosphere at RT for 1 h. Then phenylsilane (0.235 g, 2.17 mmol) was added. The reaction was stirred under nitrogen atomosphere at RT for 48 h. The reaction mixture was concentrated under reduced pressure to afford crude product. The crude product was purified by silica gel column eluted with EA/hexane (v/v = 3/2) . This resulted in 0.194 g (286.22 μmol, 69.12%yield) of tert-butyl 8- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -3-azabicyclo [3.2.1] octane-3-carboxylate as yellow solid. LCMS: m/z = 678 [M+1] +.
Step 2 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -3-azabicyclo [3.2.1] octan-8-amine
Into a 8mL sealed tube was placed tert-butyl 8- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -3-azabicyclo [3.2.1] octane-3-carboxylate (0.192 g, 283.27 μmol) , HCl (g) in EA (2mL, 4N) , EA (2 mL) . The reaction was stirred at RT for 1 h. The reaction was concentrated under vacuum. Water (2 mL) was added to the reaction and NaOH (aq, 3N) was added until PH = 7. Extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 0.153 g (264.85 μmol, 93.49%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -3-azabicyclo [3.2.1] octan-8-amine as brown solid. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . LCMS: m/z = 578 [M+1] +.
Step 3 N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.1] octan-8-amine (25)
Into a 8 mL sealed tube was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -3-azabicyclo [3.2.1] octan-8-amine (0.152 g, 263.12 μmol) , paraformaldehyde (0.054 g, 1.79 mmol) , acetic acid (0.3 mL) , methanol (2 mL) . The reaction mixture was stirred at RT for 1 h. Then NaBH3CN (0.090 g, 2.37 mmol) was added. The reaction mixture was stirred at RT for 4 h. The reaction was quenched with water (10 mL) , the resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate:  70 mL/min; Gradient: 50-80-100%B (2-30-60min) ; 270 nm; RT: 44.33-46.51) to provide the desired product. This resulted in 0.023g (38.87 μmol, 14.77%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -3-methyl-3-azabicyclo [3.2.1] octan-8-amine (25) as white solid. LCMS: m/z =592 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.42 –7.32 (m, 1H) , 7.32 –7.25 (m, 2H) , 7.20 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.71 (d, J = 7.7 Hz, 1H) , 6.52 (t, J = 6.2 Hz, 1H) , 5.18 (d, J = 3.6 Hz, 1H) , 4.39 (d, J = 6.2 Hz, 2H) , 3.86 (d, J = 33.0 Hz, 5H) , 3.51 –3.42 (m, 1H) , 3.10 (s, 3H) , 2.43 (d, J = 10.5 Hz, 2H) , 2.32 –3.28 (m, 4H) , 2.13 (s, 3H) , 1.72 (d, J = 3.6 Hz, 4H) .
Example 26
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -8-methyl-8-azabicyclo [3.2.1] octan-3-amine (26)
Reaction scheme:
Experimental details:
Step1. tert-butyl 3- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) -8-azabicyclo [3.2.1] octane-8-carboxylate.
Into a 20 mL vial was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.147 g, 313.76 μmol) , tert-butyl 3-oxo-8-azabicyclo [3.2.1] octane-8-carboxylate (0.442 g, 1.96 mmol) , titanium ethoxide (0.498 g, 2.18 mmol) , toluene (3 mL) . The reaction was stirred at 110℃ for 16 h. The reaction was concentrated under vacuum. The crude was added MeOH (3 mL) and Sodium cyanoboronhydride (0.159 g, 3.71 mmol) . The reaction stirred overnight at RT. The reaction was quenched with water (50 mL) , extracted with EA (3 x 20 mL) . The organic layers combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column, eluted with EA/hexane (v/v = 1/2) . This resulted in 0.330 g (crude) of tert-butyl 3- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -8-azabicyclo [3.2.1] octane-8-carboxylate as yellow oil. LCMS: m/z = 678 [M+1] +.
Step2. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -8-azabicyclo [3.2.1] octan-3-amine.
Into a 50 mL flask was placed tert-butyl 3- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -8-azabicyclo [3.2.1] octane-8-carboxylate (0.330 g, 486.87 μmol) , HCl in EA (20 mL, 4.0 M) . The reaction stirred at RT for 3 h. The reaction mixture was adjusted to PH = 8 by KHCO3 (aq. ) at 0℃. The mixture was extracted with EA (3 x 20 mL) . The organic layers were combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column, eluted with MeOH/DCM (v/v = 1/9) . This resulted in 0.074 g (26.31%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -8-azabicyclo [3.2.1] octan-3-amine as yellow solid. LCMS: m/z = 578 [M+1] +.
Step3. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -8-methyl-8-azabicyclo [3.2.1] octan-3-amine (26) .
Into a 8 mL vial was placed N- [2- [3- (2-methoxy-4-methylsulfonyl-anilino) prop-1-ynyl] -3- (2, 2, 2-trifluoroethyl) benzothiophen-7-yl] -8-azab icyclo [3.2.1] octan-3-amine (0.075 g, 129.82 μmol) , polyoxymethylene (0.008 g, 266.44 μmol) , sodium cyanoboronhydride (0.058 g, 1.35 mmol) , MeOH (3 mL) , HOAc (0.1 mL) . The reaction mixture was stirred at RT overnight. The reaction was quenched with water (10 mL) , extracted with EA (20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L TFA) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-100-100%B (0-45-50min) ; 271 nm; RT: 43.810 –47.680 min) to provide the desired product. This resulted in 0.017 g (22.13%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -8-methyl-8-azabicyclo [3.2.1] octan-3-amine (26) as off-white solid. LCMS: m/z =592 [M+1] +.
1H NMR (400 MHz, Methanol-d4) δ 7.52 –7.45 (m, 1H) , 7.34 –7.25 (m, 2H) , 7.18 (d, J = 8.0 Hz, 1H) , 6.93 (d, J = 8.4 Hz, 1H) , 6.59 (d, J = 7.6 Hz, 1H) , 4.40 (s, 2H) , 3.95 (s, 3H) , 3.82 (d, J = 12.0 Hz, 1H) , 3.75 –3.63 (m, 2H) , 3.30 (s, 2H) , 3.06 (s, 3H) , 2.40 (s, 3H) , 2.27 –2.08 (m, 6H) , 1.97 (d, J = 14.8 Hz, 2H) .
Example 27
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-methyl-2-azabicyclo [2.2.1] heptan-5-amine (27)
Reaction scheme:
Experimental details:
Step 1. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-methyl-2-azabicyclo [2.2.1] heptan-5-amine (27) .
Into a 8 mL reaction vial was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -2-azabicyclo [2.2.1] heptan-5-amine (0.018 g, 31.93 μmol) , paraformaldehyde (0.002 g, 66.60 μmol) , acetic acid (0.015 g, 249.78 μmol) , methanol (1 mL) . The reaction was stirred at rt for 12h before sodium cyanoboronhydride (0.037 g, 862.95 μmol) was added. The reaction was stirred at rt for 5h. The reaction was quenched with aq. Na2CO3 (10 mL) , extracted with DCM (3 x 10 mL) , concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 50-70-90%B (2-30-60min) ; 270 nm; RT: 43.971-48.403 min) to afford N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -2-methyl-2-azabicyclo [2.2.1] heptan-5-amine (27) (0.004 g, 21.68%) as off-white solid. LCMS: m/z =578 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.29 –7.22 (m, 2H) , 7.16 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.64 (d, J = 7.7 Hz, 1H) , 6.52 (t, J = 6.2 Hz, 1H) , 5.53 (d, J = 4.5 Hz, 1H) , 4.38 (d, J = 6.2 Hz,  2H) , 3.90 (s, 3H) , 3.81 (q, J = 10.6 Hz, 2H) , 3.12 (d, J = 12.6 Hz, 3H) , 2.98 (s, 1H) , 2.74 –2.59 (m, 2H) , 2.36 –2.27 (m, 1H) , 2.22 (d, J = 13.6 Hz, 3H) , 2.01 –1.83 (m, 1H) , 1.69 (d, J = 8.8 Hz, 1H) , 1.62 –1.54 (m, 1H) , 1.42 (d, J = 9.4 Hz, 1H) , 1.23 (s, 1H) .
Example 28
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-azabicyclo [2.2.1] heptan-5-amine (28)
Reaction scheme:
Experimental details:
Step 1. tert-butyl 5- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) -2-azabicyclo [2.2.1] heptane-2-carboxylate.
Into a 8 mL reaction vial was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.061 g, 130.19 μmol) , tert-butyl 5-oxo-2-azabicyclo [2.2.1] heptane-2-carboxylate (0.214 g, 1.01 mmol) , titanium ethoxide (0.233 g, 1.021mmol) , toluene (2 mL) . The reaction stirred at 100℃ for 2h before cooled to RT. Toluene was concentrated under vacuum. The residue was added MeOH (3 mL) and sodium cyanoboronhydride (0.030 g, 699.69 μmol) . The reaction stirred at RT for 2h. The reaction mixture was quenched by the addition of water (10 mL) , extracted with EA (3 x 30 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/3) to afford tert-butyl 5- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -2-azabicyclo [2.2.1] heptane-2-carboxylate (0.083 g, 96.03%) as yellow solid. LCMS: m/z =664 [M+1] +.
Step 2. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -2-azabicyclo [2.2.1] heptan-5-amine (28) .
Into a 8 mL reaction vial was added tert-butyl 5- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -2-azabicyclo [2.2.1] heptane-2-carboxylate (0.080 g, 120.52 μmol) , DCM (3 mL) , 2, 6-Bis (1, 1-dimethylethyl) pyridine (0.122 g, 637.70 μmol) . The reaction mixture was stirred at 0℃ and trimethylsilyl trifluoromethanesulfonate (0.161 g, 724.38 μmol) was added. The reaction was stirred at rt for 12h. The reaction was quenched with aq. Na2CO3 (10 mL) , extracted with DCM (3 x 10 mL) , concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 45-80-95-95%B (2-30-52-90min) ; 270 nm; RT: 61.333-73.370 min) to afford N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -2-azabicyclo [2.2.1] heptan-5-amine (28) (0.028 g, 41.21%) as off-white solid. LCMS: m/z =564 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.30 –7.21 (m, 2H) , 7.15 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.66 (d, J = 7.7 Hz, 1H) , 6.52 (t, J = 6.1 Hz, 1H) , 5.61 (d, J = 6.1 Hz, 1H) , 4.38 (d, J = 6.1 Hz, 2H) , 3.96 –3.73 (m, 5H) , 3.10 (s, 3H) , 2.69 –2.61 (m, 1H) 2.14 –1.95 (m, 1H) , 1.57 (d, J = 23.6 Hz, 2H) , 1.43 –1.32 (m, 2H) , 1.30 –1.11 (m, 2H) .
Example 29
N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -1H-indol-7-amine (29)
Reaction scheme:
Experimental details
Step1. 7-nitro-1- (phenylsulfonyl) -1H-indole
Into a 500 mL flask was placed 7-nitro-1H-indole (5.04 g, 31.08 mmol) , tetrahydrofuran (200 mL) . Then NaH (4.28 g, 178.35 mmol) was added at 0℃ in portions. The reaction mixture was stirred at 0℃ for 3 h. Then benzenesulfonyl chloride (8.46 g, 47.89 mmol) in tetrahydrofuran (100 mL) was added. The reaction mixture was stirred at 0℃ for another 1 h. The reaction was quenched by water (500 mL) , extracted by EA (2 x 200 mL) . The organic layer was combined, washed with brine (200 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The crude was recrystallized with Heptane/EA (v/v = 20/1) to give 8.99 g (95.67%) of 7-nitro-1- (phenylsulfonyl) -1H-indole as yellow solid. LCMS: m/z =303 [M+1] +.
Step2. 1- (phenylsulfonyl) -1H-indol-7-amine
Into a 250 mL flask was placed 7-nitro-1- (phenylsulfonyl) -1H-indole (5.03 g, 16.64 mmol) , methanol (80 mL) , ammonium chloride (10.19 g, 190.50 mmol) in water (10 mL) , iron (4.77 g, 85.42 mmol) . The reaction mixture was stirred at 45℃ for 2 h. Then the catalyst was removed by filtration. The filtrate was extracted with EA (2 x 100 mL) . The organic layers was combined, washed with brine (100 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 2/5) . This resulted in 2.84 g (62.68%yield) of 1- (phenylsulfonyl) -1H-indol-7-amine as yellow solid. LCMS: m/z = 273 [M+1] +.
Step3. 1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine
Into a 100 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 1- (phenylsulfonyl) -1H-indol-7-amine (2.002 g, 7.35 mmol) , 3-bromopropyne (1.05 g, 8.83 mmol) , cesium carbonate (7.313 g, 22.45 mmol) , sodium iodide (3.357 g, 22.40 mmol) , N, N-dimethylformamide (50 mL) . The reaction mixture was stirred at 100℃ for 24 h. The reaction was then quenched by the addition of water (100 mL) . The resulting solution was extracted with EA (2 x 100 mL) . The organic layer was combined, washed with brine (100 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residues were purified by C18 chromatography column eluted with ACN/H2O (v/v = 1/1) . This resulted in 1.474 g (64.60%yield) of 1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine as yellow solid. LCMS: m/z = 311 [M+1] +.
Step4. N- (prop-2-yn-1-yl) -1H-indol-7-amine
Into a 25 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.500 g, 1.61mmol) , tetrahydrofuran (5 mL) , tetrabutylammonium fluoride (5 mL) . The reaction mixture was stirred at 80 ℃ for 3 h. The reaction was then quenched by the addition of ammonium chloride solution (2 M, 30 mL) . The resulting solution was extracted with EA (20 mL) . The organic layers was combined, washed with brine (20 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/hexane (v/v = 1/3) . This resulted in 0.117 g (42.67%yield) of N- (prop-2-yn-1-yl) -1H-indol-7-amine as brown oil. LCMS: m/z = 171 [M+1] +.
Step5. N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -1 H-indol-7-amine (29)
Into a 25 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.044 g, 258.50 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.099 g, 217.92 μmol) , bis(triphenylphosphine) palladium (II) chloride (0.026 g, 36.83 μmol) , cuprous iodide (0.009 g, 47.26 μmol) , triethylamine (0.038 g, 375.53 μmol) , methyl sulfoxide (5 mL) . The reaction mixture was stirred at room temperature for 17 h. The reaction was quenched by the addition of water (5 mL) and extracted with EA (2 x 5 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-90-100%B (2-30-40min) ; 222 nm; RT: 36.225 –37.590 min) . This resulted in 0.011 g (9.10%yield) of N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -1H-in dol-7-amine (29) as white solid. LCMS: m/z = 497 [M+1] +.
1H NMR (400 MHz, DMSO) δ 10.64 (s, 1H) , 7.29 –7.22 (m, 2H) , 7.14 (d, J = 7.5 Hz, 1H) , 6.93 (d, J = 7.6 Hz, 1H) , 6.86 (t, J = 7.6 Hz, 1H) , 6.66 (d, J = 7.8 Hz, 1H) , 6.47 (d, J = 7.6 Hz, 1H) , 6.35 (s, 1H) , 5.84 (s, 1H) , 5.29 (d, J = 7.4 Hz, 1H) , 4.43 (d, J = 5.7 Hz, 2H) , 3.86 –3.76 (m, 2H) , 2.76 (d, J = 11.1 Hz, 2H) , 2.17 (s, 3H) , 1.99 (s, 2H) , 1.88 (d, J = 13.8 Hz, 2H) , 1.53 (d, J = 12.5 Hz, 2H) , 1.23 (s, 1H) .
Example 30
N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -3- (piperidin-4-yl) -1H-indol-7-amine (30)
Reaction scheme:
Experimental details:
Step 1 3-iodo-7-nitro-1H-indole
Into a 100 ml 3-necked flask was placed 7-nitro-1H-indole (2.09 g, 12.88 mmol) , NIS (3.49 g, 15.51 mmol) , ACN (30 mL) . The reaction was stirred at 80℃ for 1 h. The reaction was quenched with Na2CO3 aq (20 mL) . The resulted solution was extracted with EA (3 x 50 mL) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 2.86 g (9.92 mmol, 77.03%yield) of 3-iodo-7-nitro-1H-indole as light yellow solid. LCMS: m/z = 289 [M+1] +.
Step 2 3-iodo-7-nitro-1- (phenylsulfonyl) -1H-indole
Into a 50 ml 3-necked flask was placed 3-iodo-7-nitro-1H-indole (2.608 g, 9.05 mmol) , THF (30 mL) . The reaction was cooled to 0℃. Then NaH (0.522 g, mmol) was added with vigorous stirring at 0 ～ 5℃. The reaction was stirred for about 1 h at 0 ～ 5℃. Then benzenesulfonyl chloride (2.071 g, 11.72 mmol) was added. The reaction was stirred for about 1 h at room temperature. The reaction was quenched with water (20 mL) . The resulted solution was extracted with EA (3 x 50 mL) , washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 2.836 g (6.62 mmol, 73.14%yield) of 3-iodo-7-nitro-1- (phenylsulfonyl) -1H-indole as light yellow solid. LCMS: m/z = 429 [M+1] +.
Step 3 tert-butyl 4- (7-nitro-1- (phenylsulfonyl) -1H-indol-3-yl) -3, 6-dihydropyridine-1 (2H) -carboxylate
Into a 100 ml 3-necked flask was placed 3-iodo-7-nitro-1- (phenylsulfonyl) -1H-indole (2.401 g, 5.60 mmol) , tert-butyl 4- (4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl) -3, 6-dihydropyridine-1 (2H) -carboxylate (3.089 g, 9.90 mmol) , Pd (dppf) Cl2 (0.836 g, 1.14 mmol) , Na2CO3 (1.808 g, 17.05 mmol) , water (4 mL) , 1, 4-Dioxane (20 mL) . The reaction mixture was stirred under nitrogen at 50℃ for 5 h. The reaction was quenched with water (50 mL) . The resulted solution was extracted with EA (3 x 100 mL) , washed with brine (100 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified with silica gel column eluted with EA/hexane (v/v = 3/7) . This resulted in 1.585 g (3.27 μmol, 58.45% yield) of tert-butyl 4- (7-nitro-1- (phenylsulfonyl) -1H-indol-3-yl) -3, 6-dihydropyridine-1 (2H) -carboxylate as yellow solid. LCMS: m/z = 484 [M+1] +.
Step 4 tert-butyl 4- (7-amino-1- (phenylsulfonyl) -1H-indol-3-yl) piperidine-1-carboxylate
Into a 100 ml 3-necked flask was placed tert-butyl 4- (7-nitro-1- (phenylsulfonyl) -1H-indol-3-yl) -3, 6-dihydropyridine-1 (2H) -carboxylate (0.901 g, 1.86 mmol) , EA (8 mL) , MeOH (2 mL) , Pd/C (0.738 g, 3.46 mmol) . The reaction mixture was stirred at RT for 2h under hydrogen atmosphere. The reaction mixture was filtered through celite pad and the filter cake was washed with methanol (3 x 20 mL) . The filtrate was concentrated under reduced pressure to afford the desired product. This resulted in 0.789g (1.73 mmol 92.94%yield) of tert-butyl 4- (7-amino-1- (phenylsulfonyl) -1H-indol-3-yl) piperidine-1-carboxylate as faint yellow solid. LCMS: m/z = 456 [M+1] +.
Step 5 tert-butyl 4- (1- (phenylsulfonyl) -7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate
Into a 25 mL 3-necked flask was placed tert-butyl 4- (7-amino-1- (phenylsulfonyl) -1H-indol-3-yl) piperidine-1-carboxylate (0.295 g, 647.54 μmol) , 3-bromoprop-1-yne (0.082 g, 689.30 μmol) , K2CO3 (0.266 g, 1.92 mmol) , KI (0.219 g, 1.31 mmol) , NMP (5 mL) . The reaction mixture was stirred under nitrogen at 80℃ for 16 h. The reaction was quenched with water (10 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by silica gel column eluted with EA/hexane (v/v = 1/3) . This resulted in 0.132 g (267.41 μmol, 41.29%yield) of tert-butyl 4- (1- (phenylsulfonyl) -7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate as yellow solid. LCMS: m/z = 494 [M+1] +.
Step 6 tert-butyl 4- (7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate
Into a 25 mL 3-necked flask was placed methyl tert-butyl 4- (1- (phenylsulfonyl) -7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate (0.136 g, 275.51 mmol) , tetrabutylammonium fluoride (72.03 g, 275.51 mmol) , THF (2 mL) . The reaction was stirred at 80℃ for 0.5 h. The reaction was quenched with NH4Cl aq (10 mL) . The resulted solution was extracted with EA (3 x 20 mL) , washed with brine (20 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 0.096 g (271.60 μmol, 98.57%yield) of tert-butyl 4- (7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate as yellow oil. LCMS: m/z = 354 [M+1] +.
Step 7 tert-butyl 4- (7- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -1H-indol-3-yl) piperidine-1-carboxylate
Into a 25 mL 3-necked flask was placed tert-butyl 4- (7- (prop-2-yn-1-ylamino) -1H-indol-3-yl) piperidine-1-carboxylate (0.092 g, 260.28 μmol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.079 g, 173.89 μmol) , Pd (PPh3) 2Cl2 (0.038 g, 64.43 μmol) , CuI (0.024 g, 128.41 μmol) , DIEA (0.115 g, 892.05 μmol) , methyl sulfoxide (2 mL) . The reaction was stirred under nitrogen atomosphere at RT for 16 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with MeOH/DCM (v/v = 1/9) . This resulted in 0.073 g (107.37 μmol, 41.25%yield) of tert-butyl 4- (7- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -1H-indol-3-yl) piperidine-1-carboxylate as brown oil. LCMS: m/z = 680 [M+1] +.
Step 8 N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -3- (piperidin-4-yl) -1H-indol-7-amine (30)
Into a 8 mL sealed tube was placed tert-butyl 4- (7- ( (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) ami no) -1H-indol-3-yl) piperidine-1-carboxylate (0.073 g, 107.37 μmol) , TFA (1 mL) , DCM (1 mL) . The reaction was stirred at RT for 1 h. The mixture was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 30-70-100-100%B (2-30-60-90min) ; 228 nm; RT: 36.80-39.49) to provide the desired product. This resulted in 0.009 g (15.52 μmol, 14.45 %yield) of N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -3- (pip eridin-4-yl) -1H-indol-7-amine (30) as white solid. LCMS: m/z =580 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 10.34 (s, 1H) , 7.37 –7.21 (m, 2H) , 7.14 (d, J = 8.0 Hz, 1H) , 7.01 (s, 1H) , 6.95 (d, J = 8.1 Hz, 1H) , 6.84 (t, J = 7.7 Hz, 1H) , 6.66 (d, J = 7.8 Hz, 1H) , 6.47 (d, J = 7.4 Hz, 1H) , 5.80 (t, J = 6.1 Hz, 1H) , 5.29 (d, J = 8.0 Hz, 1H) , 4.42 (d, J = 6.0 Hz, 2H) , 3.82 –3.76 (m, 2H) , 3.02 (d, J = 12.0 Hz, 2H) , 2.75 (d, J = 10.5 Hz, 2H) , 2.69 –2.60 (m, 3H) , 2.17 (s, 3H) , 1.99 (t, J = 11.5 Hz, 2H) , 1.86 (d, J = 11.2 Hz, 4H) , 1.54 (d, J = 11.2 Hz, 4H) , 1.24 (s, 1H) .
Example 31
N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -4- (methylsulfonyl) -1H-indol-7-amine (31)
Reaction scheme:
Experimental details:
Step 1. 4-fluoroindoline.
Into a 250 mL flask was placed 4-fluoro-1H-indole (15.12 g, 111.88 mmol) , acetic acid (80 mL) . The reaction was stirred at RT while sodium cyanoboronhydride (13.99 g, 326.29 mmol) was added in batches. The reaction was stirred at RT for 2h. The reaction was quenched with H2O (200 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/1) to afford 4-fluoroindoline (14.35 g, 93.51%) as yellow solid. LCMS: m/z = 138 [M+1] +.
Step 2. 1- (4-fluoroindolin-1-yl) ethan-1-one.
Into a 250 mL flask was placed acetic anhydride (100 mL) . The reaction was stirred at 0℃ and 4-fluoroindoline (14.41 g, 105.06 mmol) was added in batches. The reaction was stirred at RT for 2h. The reaction was quenched with H2O (200 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/3) to afford 1- (4-fluoroindolin-1-yl) ethan-1-one (12.16 g, 64.58%) as yellow solid. LCMS: m/z = 180 [M+1] +.
Step 3. 1- (4-fluoro-7-nitroindolin-1-yl) ethan-1-one.
Into a 250 mL flask was placed 1- (4-fluoroindolin-1-yl) ethan-1-one (6.07 g, 33.87 mmol) , sulfuric acid (50 mL) . The reaction mixture was stirred at -10℃ under N2 atmosphere and nitric acid (3.0 g, 47.60 mmol) was added dropwise. The reaction was stirred at rt for 1h. The reaction was quenched with H2O (100 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/3) to afford 1- (4-fluoro-7-nitroindolin-1-yl) ethan-1-one (1.67 g, 21.99%) as yellow solid. LCMS: m/z = 225 [M+1] +.
Step 4. 4-fluoro-7-nitroindoline.
Into a 250 mL flask was placed 1- (4-fluoro-7-nitroindolin-1-yl) ethan-1-one (2.146 g, 9.57 mmol) , hydrogen chloride (50 mL) . The reaction mixture was stirred at 100℃ for 1h. The reaction was cooled to rt, concentrated under vacuum. The reaction was quenched with aq. Na2CO3 (50 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/1) to afford 4-fluoro-7-nitroindoline (1.69 g, 96.98%) as yellow solid. LCMS: m/z = 183 [M+1] +.
Step 5. 4-fluoro-7-nitro-1H-indole.
Into a 250 mL flask was placed 4-fluoro-7-nitroindoline (1.351 g, 7.41 mmol) , manganese oxide (6.319 g, 72.68 mmol) , chloroform (50 mL) . The reaction was stirred at 80℃for 16 h before cooled to rt. The reaction mixture was filtrated, washed with EA (50 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/3) to afford 4-fluoro-7-nitro-1H-indole (1.181 g, 88.39%) as  yellow solid. LCMS: m/z = 181 [M+1] +.
Step 6. 4-fluoro-7-nitro-1- (phenylsulfonyl) -1H-indole.
Into a 100 mL flask was placed 4-fluoro-7-nitro-1H-indole (1.184 g, 6.57 mmol) , DMF (30 mL) . The reaction mixture was stirred at 0℃ under N2 atmosphere and NaH (0.459 g, 19.12 mmol) was added portion wise. The reaction was stirred at rt for 30 min and then benzenesulfonyl chloride (2.541 g, 14.38 mmol) was added dropwise. The reaction was stirred at RT for 2h. The reaction was quenched with H2O (50 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/3) to afford 4-fluoro-7-nitro-1- (phenylsulfonyl) -1H-indole (2.036 g, 96.71%) as yellow solid. LCMS: m/z = 321 [M+1] +.
Step 7. 4- (methylsulfonyl) -7-nitro-1- (phenylsulfonyl) -1H-indole.
Into a 100 mL flask was placed 4-fluoro-7-nitro-1- (phenylsulfonyl) -1H-indole (2.01 g, 6.27 mmol) , sodium methanesulfinate (1.366 g, 13.38 mmol) , DMF (30 mL) . The reaction was stirred at 80℃ for 12h. The reaction was cooled to rt and quenched with H2O (100 mL) , extracted with EA (3 x 100 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/2) to afford 4- (methylsulfonyl) -7-nitro-1- (phenylsulfonyl) -1H-indol (1.24 g, 51.94%) as yellow solid. LCMS: m/z = 381 [M+1] +.
Step 8. 4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-amine.
Into a 100 mL flask was placed 4- (methylsulfonyl) -7-nitro-1- (phenylsulfonyl) -1H-indole (1.19 g, 3.12 mmol) , zinc (1.499 g, 22.92 mmol) , NH4Cl (1.367 g, 25.55 mmol) , ethanol (50 mL) , water (10 mL) . The reaction was stirred at 70℃ for 3h. The reaction mixture was filtrated, washed with EA (50 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 1/3) to afford 4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-amine (0.942 g, 85.93%) as yellow solid. LCMS: m/z = 351 [M+1] +.
Step 9. tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) carbamate.
Into a 100 mL flask was placed 4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-amine (0.616 g, 1.75 mmol) , di-tert-butyl dicarbonate (0.443 g, 2.02 mmol) , TEA (0.659 g, 6.51 mmol) , THF (10 mL) , N- (4-pyridyl) dimethylamine (0.041 g, 335.60 μmol) , The reaction mixture was stirred at rt for 2h before quenched with H2O (30 mL) , extracted with EA (3 x 50 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/2) to afford tert-butyl N- [1- (benzenesulfonyl) -4-methylsulfonyl-indol-7-yl] carbamate (0.738 g, 93.18%) as yellow solid. LCMS: m/z = 451 [M+1] +.
Step 10. tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) (prop-2-yn-1-yl) carbamate.
Into a 8 mL reaction vial was placed tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) carbamate (0.742 g, 1.64 mmol) , DMF (10 mL) . The reaction mixture was stirred at 0℃ before NaH (0.221 g, 9.20 mmol) was added in portion-wise. The reaction was stirred at rt for 30 min. 3-bromoprop-1-yne (0.888 g, 7.46 mmol) was added to above mixture. The reaction was stirred at rt for 12h before quenched with H2O (30 mL) , extracted with EA (3 x 50 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/2) to afford tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) (prop-2-yn-1-yl) carbamate (0.533 g, 66.23%) as yellow solid. LCMS: m/z = 489 [M+1] +.
Step 11. 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine.
Into a 50 mL flask was placed tert-butyl (4- (methylsulfonyl) -1- (phenylsulfonyl) -1H-indol-7-yl) (prop-2-yn-1-yl) carbamate (0.456 g, 933.32 μmol) , DCM (6 mL) , trifluoroacetic acid (2 mL) . The reaction was stirred at RT for 1h. The reaction was quenched with aq. Na2CO3 (20 mL) , extracted with DCM (3 x 30 mL) , concentrated under vacuum. The crude was purified by prep-TLC with DCM/MeOH (v/v = 20/1) to afford 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.050 g, 13.79%) as yellow solid. LCMS: m/z = 389 [M+1] +.
Step 12. 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine.
Into a 8 mL reaction vial was placed 4- (methylsulfonyl) -1- (phenylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.049 g, 126.13 μmol) , TBAF (1 M in THF) (2 mL) , THF (0.5 mL) . The reaction was stirred at 80℃ for 1h. The reaction was quenched with H2O (10 mL) , extracted with EA (3 x 30 mL) , concentrated under vacuum. The crude was purified by prep-TLC with DCM/MeOH (v/v = 20/1) to afford 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.023 g, 73.43%) as yellow solid. LCMS: m/z = 249 [M+1] +.
Step 13. N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -4- (methylsulfonyl) -1H-indol-7-amine (31) .
Into a 8 mL reaction vial was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.050 g, 110.06 μmol) , 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) -1H-indol-7-amine (0.021 g, 84.57 μmol) , bis(triphenylphosphine) palladium (II) chloride (0.018 g, 25.49 μmol) , N, N-Diisopropylethylamine (0.031 g, 239.85 μmol) , CuI (0.015 g, 78.76 μmol) , methyl sulfoxide (2 mL) . The reaction was stirred at rt for 1h under N2 atmosphere. The reaction was quenched with H2O (10 mL) , extracted with EA (3 x 20 mL) , concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 40 mL/min; Gradient: 25-55-80%B (2-30-60min) ; 228 nm; RT: 36.803-39.498 min) to afford N- (3- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) -4- (met hylsulfonyl) -1H-indol-7-amine (31) (0.007 g, 11.06%) as off-white solid. LCMS: m/z =575 [M+1] +.
1H NMR (400 MHz, DMSO) δ 11.30 (s, 1H) , 7.52 (d, J = 3.0 Hz, 1H) , 7.46 (d, J = 8.2 Hz, 1H) , 7.25 (t, J = 7.8 Hz, 1H) , 7.15 (d, J = 7.9 Hz, 1H) , 6.88 (s, 1H) , 6.67 (t, J = 5.8 Hz, 2H) , 6.61 (d, J = 8.3 Hz, 1H) , 5.31 (d, J = 8.0 Hz, 1H) , 4.56 (d, J = 3.8 Hz, 2H) , 3.84 (q, J = 11.1 Hz, 2H) , 3.05 (s, 3H) , 2.75 (d, J = 11.4 Hz, 2H) , 2.53 (s, 1H) , 2.18 (d, J = 13.8 Hz, 3H) , 1.98 (t, J = 10.9 Hz, 2H) , 1.88 (d, J = 11.4 Hz, 2H) , 1.54 (dd, J = 21.3, 10.4 Hz, 2H) .
Example 32
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.0] heptan-6-amine (32)
Reaction scheme:
Experimental details
Step 1. tert-butyl 6- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) -3-azabicyclo [3.2.0] heptane-3-carboxylate.
Into a 4 mL vail was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.099 g, 211.31 μmol) , tert-butyl 6-oxo-3-azabicyclo [3.2.0] heptane-3-carboxylate (0.250 g, 1.18 mmol) . The opened-vail was heated to 150℃ and stirred for 0.5 h. The reaction was cooled to room temperature, and sodium cyanoborohydride (211 mg, 3.43 mmol) , acetic acid (0.01 μmol) , Ethanol (0.5 mL) was added. The reaction was stirred for 1 h at room temperature. LCMS showed the reaction was complete, the reaction was concentrated under vacuum and purified with C18 column, eluted with ACN/water (v/v = 1/3) to afford tert-butyl 6- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -3-azabicyclo [3.2.0] heptane-3-carboxylate (0.288 g, 433.89 μmol, 205.33%yield) as clear oil . LCMS: m/z = 664 [M+1] +.
Step 2. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -3-azabicyclo [3.2.0] heptan-6-amine.
Into a 4 mL flask was placed tert-butyl 6- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -3-azabicyclo [3.2.0] heptane-3-carboxylate (0.208 g, 313.36 μmol) , HCl (g) in EtOAc (1M, 0.5 mL) and stirred for 1 h at room temperature. LCMS showed the reaction was complete, the reaction was quenched with sat. NaHCO3 aq. to pH 8 ～ 9 under 0℃, extracted with EA (3 mL x3) . The combined organic layers were washed with water (3 mL) and brine (3 mL) successively, separated, then concentrated with vacuum. The residue was purified with C18 column, eluted with ACN/water (v/v = 1/2) to afford N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-azabicyclo [3.2.0] heptan-6-amine.
LCMS: m/z = 564 [M+1] +.
Step 3. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -3-methyl-3-azabicyclo [3.2.0] heptan-6-amine (32) .
Into a 4 mL flask was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -3-azabicyclo [3.2.0] heptan-6-amine (0.047 g, 70.81 μmol) , paraformaldehyde (0.004 g, 133.22 μmol) , sodium cyanoboronhydride (37 mg, 606.40 μmol) , EtOH (0.5 mL) , glacial acetic acid (0.01 mL) . The reaction was stirred overnight at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-85-100%B (2-30-60min) ; 270 nm; RT: 38.379-39.803 min) to afford N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -3-methyl-3-azabicyclo [3.2.0] heptan-6-amine (32) (5 mg, 8.66 μmol, 12.22%yield) as off-white solid . LCMS: m/z = 578 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.41 –7.38 (m, 1H) , 7.28 –7.23 (m, 2H) , 7.19 –7.15 (m, 1H) , 6.90 (d, J =8.2 Hz, 1H) , 6.53 –6.47 (m, 2H) , 5.33 (d, J = 7.4 Hz, 1H) , 4.39 (d, J = 6.2 Hz, 2H) , 4.12 –4.08 (m, 1H) , 3.90 (s, 3H) , 3.84 –3.79 (m, 2H) , 3.10 (s, 3H) , 2.72 (d, J = 9.1 Hz, 1H) , 2.64 –2.58 (m, 2H) , 2.27 (s, 3H) , 1.99 –1.94 (m, 2H) , 1.86 –1.81 (m, 2H) .
Example 33
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -7-methyl-7-azaspiro [3.5] nonan-2-amine (33)
Reaction scheme:
Experimental details
Step1. tert-butyl 2- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) -7-azaspiro [3.5] nonane-7-carboxylate
Into a 8 mL flask was placed titanium ethoxide (0.072 g, 315.64 μmol) , 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.061 g, 130.20 μmol) , tert-butyl 2-oxo-7-azaspiro [3.5] nonane-7-carboxylate (0.164 g, 685.30 μmol) , toluene (2 mL) . The reaction mixture was stirred at 110℃ for 2 h. The reaction was concentrated under vacuum and dissolved with methanol (2 mL) . Then sodium cyanoboronhydride (0.034 g, 792.99 μmol) was added. The reaction mixture was stirred at room temperature for another 15 h. The reaction was quenched by the addition of water (10 mL) and extracted with EA (2 x 10 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residue was applied onto a silica gel column eluted with EA/heptane (v/v = 1/3) . This resulted in 0.080 g (88.82%yield) of tert-butyl
2- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -7-azaspiro [3.5] nonane-7-carboxylate as yellow oil. LCMS: m/z = 692 [M+1] +.
Step2. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -7-azaspiro [3.5] nonan-2-amine
Into a 8 mL flask was placed tert-butyl 2- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) -7-azaspiro [3.5] nonane-7-carboxylate (0.079 g, 114.19 μmol) , hydrogen chloride (4 M in EA, 2 mL) . The reaction mixture was stirred at room temperature for 0.5 h. Then saturated sodium hydrogen carbonate aqueous solution was added to the mixture until pH = 7～8. The resulting solution was extracted with EA (2 x 10 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. This resulted in 0.067 g (99.16%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -7-azaspiro [3.5] nonan-2-amine as yellow solid. LCMS: m/z = 592 [M+1] +.
Step3. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) -7-methyl-7-azaspiro [3.5] nonan-2-amine (33)
Into a 8 mL flask was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -7-azaspiro [3.5] nonan-2-amine (0.066 g, 111.54 μmol) , paraformaldehyde (0.007 g, 233.13 μmol) , methanol (4 mL) , acetic acid (0.1 mL) . The reaction mixture was stirred at room temperature for 19 h. Then  sodium cyanoboronhydride (0.009 g, 209.91 μmol) was added. The reaction mixture was stirred at room temperature for another 4 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 5 mL) . The organic layers was combined, washed with brine (10 mL) and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 40 mL/min; Gradient: 50-80-100%B (2-30-60min) ; 278 nm; RT: 39.752-43.259) . This resulted in 0.002 g (2.96%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -7-methyl-7-azaspiro [3.5] nonan-2-amine (33) as white solid. LCMS: m/z = 606 [M+1] +.
Example 34
3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (34)
Reaction scheme:
Experimental details:
Step1. tert-butyl 3, 3-difluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate A mixture of 2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-amine (0.506 g, 1.42 mmol) , tert-butyl 3, 3-difluoro-4-oxopiperidine-1-carboxylate (1.053 g, 4.48 mmol) , and TMSCl (1.680 g, 15.46 mmol) in DMF (10 mL) was degassed and purged with N2 (g) , and then BH3. THF (1 M, 15 mL) was added. The mixture was stirred at 0℃ for 1 h. The reaction mixture was quenched with water (20 mL) at 0℃ and extracted with EA (60 mL x 2) . The combined organic layers was washed with brine (30 mL) , dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column, eluted with EA/hexane (v/v = 1/2) to afford tert-butyl 3, 3-difluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (0.932 g, crude) as a little yellow oil. LCMS: m/z = 577 [M+1] +
Step2. 3, 3-difluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine
Into a 100-mL round-bottom flask was placed tert-butyl 3, 3-difluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (0.871 g, 1.51 mmol) , DCM (10 mL) and TFA (2 mL) . the reaction mixture was stirred at room temperature for 1 h. The reaction was adjusted to pH = 9 with NaHCO3 (aq. ) and extracted with EA (100 mL x 2) . The combined organic layers was washed with brine (40 mL) , separated and concentrated under vacuum. This resulted in 0.656 g (91.15%) of 3, 3-difluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine as yellow oil. LCMS: m/z = 477 [M+1] +.
Step3. 3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine
To a solution of 3, 3-difluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (0.628 g, 1.32 mmol) , paraformaldehyde (0.082 g, 2.73 mmol) in 10 mL MeOH. The mixture was stirred at room temperature for 0.5 h. Then NaBH3CN (0.289 g, 6.74 mmol) and HOAc (0.002 mL) were added. The reaction mixture was stirred at room temperature for 12 hours. The residue was purified by silica gel column, eluted with EA/hexane (v/v = 1/2) to afford 3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.544 g, 84.15%yield) as yellow oil. LCMS: m/z = 491 [M+1] +
Step4. 3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (34)
Into a 8-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.097 g, 0.20 mmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.090 g, 0.38 mmol) , Pd (dppf) Cl2 (0.029 g, 0.04 mmol) , CuI (0.035 g, 0.18 mmol) , DIEA (0.077 g, 0.60 mmol) , DMSO (2 mL) . The reaction mixture was stirred at room temperature for 1 h. The reaction mixture was quenched by the addition of water (80 mL) , extracted with EA (80 mL x 2) . The combined organic layers was washed with brine (20 mL) , separated and concentrated under vacuum. The residue was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 60 mL/min; Gradient: 50-80-100%B (2-30-60min) ; 244 nm; RT: 35.560 -37.110 min) to afford 3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (34) (0.053 g, 44.52%yield) as white solid. LCMS: m/z = 602 [M+1] +
1H NMR (400 MHz, MeOD) δ 7.49 (d, J = 8.4 Hz, 1H) , 7.33 –7.23 (m, 2H) , 7.18 (d, J = 8.0 Hz, 1H) , 6.94 (d, J = 8.4 Hz, 1H) , 6.83 (s, 1H) , 4.41 (s, 2H) , 3.99 (d, J = 11.2 Hz, 1H) , 3.95 (s, 3H) , 3.72 –3.63 (m, 2H) , 3.11 (d, J = 9.2 Hz, 1H) , 3.07 (s, 3H) , 2.90 (d, J = 8.0 Hz, 1H) , 2.60 –2.44 (m, 1H) , 2.37 (s, 3H) , 2.35 –2.25 (m, 1H) , 2.06 (d, J = 13.2 Hz, 1H) , 1.98 –1.84 (m, 1H) .
Example 35
diethyl (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) phosphine oxide (racemic) (35)
Reaction scheme:
Experimental details:
Step1. (4-amino-3-methoxyphenyl) diethylphosphine oxide
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-2-methoxyaniline (0.981 g, 4.86 mmol) , diethylphosphine oxide (1.039 g, 9.79 mmol) , Pd (OAc) 2 (0.411 g, 1.83 mmol) , Xantphos (0.381 g, 0.66 mmol) , DIEA (1.841 g, 14.24 mmol) , DMF (10 mL) . The reaction mixture was stirred at 120℃ for 2h. The reaction mixture was quenched by the addition of water (80 mL) , extracted with EA (80 mL x 2) . The combined organic layers was washed with brine (40 mL) , separated and concentrated under vacuum. The mixture was purified by C18 column eluted with ACN/water (v/v = 1/8) to afford 0.775 g (70.24%) of (4-amino-3-methoxyphenyl) diethylphosphine oxide as colorless oil. LCMS: m/z = 228 [M+1] +
Step2. diethyl (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide
A mixture of (4-amino-3-methoxyphenyl) diethylphosphine oxide (0.423 g, 1.86 mmol) , 3-bromoprop-1-yne (0.219 g, 1.84 mmol) , NaI (0.227 g, 1.51 mmol) and K2CO3 (0.578 g, 4.18 mmol) in NMP (10 mL) was degassed and purged with N2 for three times, The mixture was then stirred at 80℃ for 48h. The reaction mixture was purified by C18 column eluted with ACN/water (v/v = 1/3) to afford 0.172 g (34.83%) of diethyl (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide as colorless oil. LCMS: m/z = 266 [M+1] +
Step3. diethyl (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) phosphine oxide (racemic) (35)
Into a 8-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.098 g, 0.21 mmol) , diethyl (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) phosphine oxide (0.098 g, 0.37 mmol) , Pd (dppf) Cl2 (0.021 g, 0.03 mmol) , CuI (0.048 g, 0.25 mmol) , DIEA (0.099 g, 0.77 mmol) , DMSO (1 mL) . The reaction mixture was stirred at 50℃ for 1 h. The reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 50 mL/min; Gradient: 35-65-95%B (2-30-60min) ; 236 nm; RT: 38.125 –42.751 min) to afford diethyl (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) phosphine oxide (racemic) (35) . LCMS: m/z = 610 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.26 (d, J = 7.3 Hz, 1H) , 7.25 –7.12 (m, 2H) , 7.08 (d, J = 10.2 Hz, 1H) , 6.86 (d, J = 6.1 Hz, 1H) , 6.78 (d, J = 6.7 Hz, 1H) , 6.07 (s, 1H) , 5.15 (d, J = 7.9 Hz, 1H) , 4.80 (d, J = 49.5 Hz, 1H) , 4.35 (s, 2H) , 3.84 (s, 3H) , 3.82 –3.71 (m, 2H) , 3.71 –3.55 (m, 1H) , 3.13 –2.95 (m, 1H) , 2.80 (d, J = 8.7 Hz, 1H) , 2.27 (d, J = 12.5 Hz, 1H) , 2.18 (s, 3H) , 2.13 –2.04 (m, 1H) , 1.99 –1.68 (m, 6H) , 1.05 –0.82 (m, 6H) .
Example 36
1- (2-fluoroethyl) -N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (36)
Reaction scheme
Experimental Details
Step 1. 1- (2-fluoroethyl) -N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (36)
Into a 4-mL sealed tube and maintained with an inert atmosphere of nitrogen, was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (0.040 g, 72.51 umol) , 1-fluoro-2-iodoethane (0.025 g, 143.71 umol) , K2CO3 (0.063 g, 455.86 umol) , acetonitrile (1 mL) . The reaction mixture was stirred at 50℃ overninght. The resulting solution was added to water (10 mL) . The resulting solution was extracted with EA (2 x 10 mL) , the organic layers combined, dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The crude product purified by pre-HPLC with MeCN/H2O (0.1%ammonium hydroxide) , Flow rate: 70 mL/min; Gradient: 40-75-100%B (2-30-60min) ; 263 nm; RT: 33.540-34.450 min. This resulted in 0.018 g (41.54%yield) of 1- (2-fluoroethyl) -N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) piperidin-4-amine (36) as white solid. LCMS: m/z = 598 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.40 (dd, J = 8.3, 1.6 Hz, 1H) , 7.35 –7.20 (m, 2H) , 7.14 (d, J = 8.0 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.67 (d, J = 7.8 Hz, 1H) , 6.52 (t, J = 6.2 Hz, 1H) , 5.32 (d, J = 8.0 Hz, 1H) , 4.59 (t, J = 4.8 Hz, 1H) , 4.47 (t, J = 4.9 Hz, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 3.90 (s, 3H) , 3.86 –3.71 (m, 2H) , 3.10 (s, 3H) , 2.89 (d, J = 11.8 Hz, 2H) , 2.65 (t, J = 4.9 Hz, 1H) , 2.58 (t, J = 4.9 Hz, 1H) , 2.14 (t, J = 11.1 Hz, 2H) , 1.90 (d, J = 11.4 Hz, 2H) , 1.54 (dd, J = 20.8, 11.3 Hz, 2H) , 1.24 (s, 1H) .
Example 37
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1- (2, 2, 2-trifluoroethyl) piperidin-4-amine (37)
Reaction scheme
Experimental Details
Step 1. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1- (2, 2, 2-trifluoroethyl) piperidin-4-amine (37)
Into a 4-mL sealed tube and maintained with an inert atmosphere of nitrogen, was placed N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) piperidin-4-amine (0.023 g, 41.69 μmol) , 2, 2, 2-trifluoroethyl trifluoromethanesulfonate (0.017 g, 73.24 μmol) , Cs2CO3 (0.028 g, 85.94 μmol) , acetonitrile (1 mL) . The reaction mixture was stirred at room temperature for 2h. The resulting solution was added to water (10 mL) . The resulting solution was extracted with EA (2 x 10 mL) , the organic layers combined, dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The crude product purified by pre-HPLC with MeOH/H2O (0.1%ammonium hydroxide) , Flow rate: 40 mL/min; Gradient: 45-75-100%B (2-30-60min) ; 270 nm; RT: 38.379-40.311 min. This resulted in 0.016 g (60.56%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) -1- (2, 2, 2-trifluoroethyl) piperidin-4-amine (37) as white solid. LCMS: m/z = 634 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 6.9 Hz, 1H) , 7.25 (t, J = 7.8 Hz, 2H) , 7.15 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.68 (d, J = 7.8 Hz, 1H) , 6.52 (t, J = 6.0 Hz, 1H) , 5.30 (d, J = 8.0 Hz, 1H) , 4.38 (d, J = 6.1 Hz, 2H) , 3.90 (s, 2H) , 3.80 (dd, J = 21.9, 10.9 Hz, 2H) , 3.64 (d, J = 12.7 Hz, 2H) , 3.17 (dd, J = 20.5, 10.3 Hz, 3H) , 3.10 (s, 4H) , 2.93 (d, J = 11.6 Hz, 2H) , 1.89 (d, J = 11.1 Hz, 2H) , 1.55 (dd, J = 20.5, 11.4 Hz, 2H) .
Example 38
N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (38)
Reaction scheme
Experimental Details
Step 1. tert-butyl 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) amino) piperidine-1-carboxylate
Into a 40-mL sealed tube and maintained with an inert atmosphere of nitrogen, was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7 -amine (0.303 g, 0.65 mmol) , tert-butyl 4-oxopiperidine-1-carboxylate (0.646 g, 3.24 mmol) , titanium ethoxide (0.754 g, 3.29 mmol) , toluene (4 mL) . The reaction mixture was stirred at 110℃ for 2 h. Sodium cyanoborohydride (0.170 g, 2.75 mmol) was added to the reaction and stirred at room temperature for 3 h. The reaction was concentrated under vacuum and the residue was applied onto a silica gel column eluted with EA/hexane (v/v = 1/1) . This resulted in 0.348 g (82.56%yield) of tert-butyl 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) piperidine-1-carboxylate as yellow solid. LCMS: m/z = 652 [M+1] +
Step 2. N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thi ophen-7-yl) piperidin-4-amine (38)
Into a 25-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thioph en-7-yl) amino) piperidine-1-carboxylate (0.336 g, 0.52 mmol) and EA (3 mL) . The reaction mixture was stirred at room temperature, then HCl in EA (3 mL, 4 M) was added to the reaction and stirred at room temperature for 2 h. The resulting solution was added to saturated sodium bicarbonate aqueous solution (20 mL) . The resulting solution was extracted with EA (2 x 30 mL) , the organic layers combined, dried over anhydrous Na2SO4, the residue was concentrated under vacuum. A quarter of the resulting crude product was further purified by pre-HPLC with MeOH/H2O (0.1%ammonium hydroxide) , Flow rate: 25 mL/min; Gradient: 40-70-100%B (2-30-60min) ; 220 nm; RT: 32.890-37.835 min. This resulted in 0.028 g (49.30%yield) of N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophe n-7-yl) piperidin-4-amine (38) as yellow solid. LCMS: m/z = 552 [M+1] +
1H NMR (400 MHz, DMSO) δ 7.39 (d, J = 8.3 Hz, 1H) , 7.25 (dd, J = 7.7, 4.8 Hz, 2H) , 7.14 (d, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.65 (t, J = 16.6 Hz, 1H) , 6.52 (t, J = 6.3 Hz, 1H) , 5.33 (d, J = 7.9 Hz, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 3.90 (s, 3H) , 3.80 (dd, J = 22.0, 11.0 Hz, 2H) , 3.42 (s, 2H) , 3.10 (s, 3H) , 2.97 (t, J = 16.5 Hz, 2H) , 2.68 –2.52 (m, 2H) , 1.88 (d, J = 11.1 Hz, 2H) , 1.39 (dd, J = 20.0, 11.3 Hz, 2H) .
Example 39
Cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39) and trans-N- ( (1R, 4R) -4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39b)
Reaction scheme:
Step 1. Synthesis of 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine.
Into a 50 mL flask was added 2-iodo-1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.620 g, 1.82 mmol) , 4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.457 g, 1.90 mmol) , bis (triphenylphosphine) palladium (II) chloride (0.240 g, 339.97 μmol) , N, N-diisopropylethylamine (0.458 g, 3.54 mmol) , CuI (0.177 g, 929.37 μmol) , methyl sulfoxide (20 mL) . The reaction mixture was stirred at rt for 2h. The reaction was quenched with H2O (30 mL) , extracted with EA (50 mL x 3) and concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/1) to afford 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.545 g, 66.21%) as yellow solid. LCMS: m/z = 452 [M+1] +.
Step 2. 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1, 4-dioxaspiro [4.5] decan-8-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine.
Into a 50 mL flask was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.545 g, 1.20 mmol) , 1, 4-dioxaspiro [4.5] decan-8-one (0.574 g, 3.67 mmol) , titanium ethoxide, toluene (10 mL) . The reaction was stirred at 100℃ for 2h before cooled to RT. The reaction mixture was concentrated under vacuum. The residue was added EtOH (5 mL) , sodium cyanoboronhydride (0.392 g, 9.1427 mmol) . The reaction was stirred at RT for 2h. The reaction was quenched with H2O (10 mL) , extracted with EA (3 x 30 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/Hexane (v/v = 1/1) to afford 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1, 4-dioxaspiro [4.5] decan-8-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.626 g, 87.64%) as yellow solid. LCMS: m/z = 592 [M+1] +.
Step 3. 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4 -yl) amino) cyclohexan-1-one.
Into a 50 mL flask was placed 2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -N- (1, 4-dioxaspiro [4.5] decan-8-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (0.731 g, 1.23 mmol) , 4-methylbenzenesulfonic acid hydrate (2.002 g, 10.52 mmol) , acetonitrile (10 mL) , water (5 mL) . The reaction was stirred at RT for 1h under N2 atmosphere. The reaction was quenched with H2O (30 mL) , extracted with EA (3 x 50 mL) , concentrated under vacuum. The crude was purified by silica gel column eluted with EA/hexane (v/v = 3/1) to afford 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-yl) amino) cyclohexan-1-one (0.402 g, 59.41%) as yellow solid. LCMS: m/z = 548 [M+1] +.
Step 4. cis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39) and trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39b) .
Into a 25 mL flask was placed 4- ( (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-yl) amino) cyclohexan-1-one (0.219 g, 399.93 μmol) , 2-oxa-6-azaspiro [3.3] heptane (0.145 g, 1.4627 mmol) , acetic acid (0.264 g, 4.39 mmol) , MeOH (5 mL) . The reaction was stirred at rt for 12h, sodium cyanoboronhydride (0.392 g, 9.1427 mmol) was added to above mixture. The reaction was stirred at RT for 2h. The reaction was quenched with H2O (10 mL) , extracted with EA (3 x 30 mL) , concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: CAN; Flow rate: 70 mL/min; Gradient: 30-60-60%B (2-32-60min) , 248 nm; RT: 30.513-32.468 and RT: 34.848-36.835 min) to affordcis-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39) (0.027 g, 10.70%) as off-white solid. LCMS: m/z =631 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.38 (d, J = 8.3 Hz, 1H) , 7.25 (s, 1H) , 7.06 (s, 1H) , 6.98 (t, J = 7.9 Hz, 1H) , 6.88 (d, J = 8.4 Hz, 1H) , 6.66 (d, J = 8.2 Hz, 1H) , 6.49 (t, J = 6.0 Hz, 1H) , 6.12 (d, J = 7.8 Hz, 1H) , 5.44 (d, J = 8.0 Hz, 1H) , 4.91 (q, J = 8.8 Hz, 2H) , 4.58 (s, 4H) , 4.35 (d, J = 6.1 Hz, 2H) , 3.89 (s, 3H) , 3.21 (s, 5H) , 3.09 (s, 3H) , 1.96 (d, J = 11.1 Hz, 2H) , 1.86 (t, J = 10.5 Hz, 1H) , 1.71 (d, J = 11.3 Hz, 2H) , 1.19 (dd, J = 24.1, 11.5 Hz, 2H) , 0.99 (dd, J = 23.4, 10.9 Hz, 2H) .
And trans-N- (4- (2-oxa-6-azaspiro [3.3] heptan-6-yl) cyclohexyl) -2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -1- (2, 2, 2-trifluoroethyl) -1H-indol-4-amine (39b) (0.023 g, 9.11%) as off-white solid. LCMS: m/z =631 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.38 (d, J = 8.2 Hz, 1H) , 7.25 (s, 1H) , 7.12 (s, 1H) , 6.97 (t, J = 7.9 Hz, 1H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.64 (d, J = 8.1 Hz, 1H) , 6.49 (t, J = 6.0 Hz, 1H) , 6.12 (d, J = 7.8 Hz, 1H) , 5.48 (d, J = 8.0 Hz, 1H) , 4.90 (q, J = 8.9 Hz, 2H) , 4.59 (s, 4H) , 4.35 (d, J = 6.0 Hz, 2H) , 3.89 (s, 3H) , 3.20 (s, 4H) , 3.09 (s, 3H) , 2.09 (d, J = 12.5 Hz, 1H) , 1.69 –1.46 (m, 6H) , 1.39 (s, 2H) , 1.23 (s, 1H) .
Example 40
4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzenesulfonamide (racemic) (40)
Reaction scheme:
Experimental details:
Step1. (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) .
Into a 500 mL round-bottom flask was placed tert-butyl tert-butyl (3S, 4R) -3-fluoro-4- ( (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) amino) piperidine-1-carboxylate (racemic) (16.02 g, 28.69 mmol) , DCM (150 mL) , TFA (50 mL) . The reaction was stirred at RT for 1 h. The reaction was quenched with saturated aqueous solution of NaHCO3 (100 mL) , extracted with EA (3 x 100 mL) . The combined organic layers was washed with brine (200 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. This resulted in 14.04 g (crude) of (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) as off-white solid. LCMS: m/z = 459 [M+1] +.
Step2. (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) .
Into a 500 mL round-bottom flask was placed (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) piperidin-4-amine (racemic) (13.962 g, 30.47 mmol) , polyoxymethylene (1.575 g, 52.45 mmol) , sodium cyanoboronhydride (11.745 g, 189.94 mmol) , MeOH (150 mL) , HOAc (30 mL) . The reaction mixture was stirred overnight at RT. The reaction was quenched with saturated aqueous solution of NaHCO3 (100 mL) , extracted with EA (3 x 100 mL) , The combined organic layers was washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude was purified by silica gel column eluted with MeOH/DCM (v/v = 1/20) . This resulted in 8.513 g (59.43%yield) of (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) as off-white solid. LCMS: m/z = 473 [M+1] +.
Step3. 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzenesulfonamide (racemic) (40) .
Into a 25-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen was placed (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.119 g, 251.97 μmol) , 3-methoxy-4- (prop-2-yn-1-ylamino) benzenesulfonamide (0.094 g, 391.21 μmol) , Bis (triphenylphosphine) palladium (II) chloride (0.051 g, 72.25 μmol) , CuI (0.044 g, 231.03 μmol) , DIEA (0.159 g, 1.23 mmol) , methyl sulfoxide (5 mL) . The reaction was stirred for 2 h at 60℃ under nitrogen atmosphere. The reaction was quenched with water (20 mL) , extracted with EA (30 mL) . The combined organic layers was washed with brine (30 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 50-90-100%B (2-30-40min) ; 270 nm; RT: 26.258-28.090 min) to provide the desired product. This resulted in 0.072 g (48.88%yield) of 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop -2-yn-1-yl) amino) -3-methoxybenzenesulfonamide (racemic) (40) as yellow solid. LCMS: m/z =585 [M+1] +.
1H NMR (400 MHz, Methanol-d4) δ 7.50 –7.43 (m, 1H) , 7.36 –7.26 (m, 2H) , 7.20 (d, J = 8.0 Hz, 1H) , 6.86 (d, J = 8.4 Hz, 1H) , 6.78 (d, J = 7.6 Hz, 1H) , 4.38 (s, 2H) , 3.93 (s, 3H) , 3.80 –3.63 (m, 3H) , 3.22 (d, J = 23.6 Hz, 2H) , 2.95 (d, J = 11.6 Hz, 1H) , 2.33 –2.12 (m, 5H) , 2.02 –1.90 (m, 2H) .
Example 41
4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxy-N-methylbenzamide (racemic) (41)
Reaction scheme:
Experimental details
Step1. 4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxy-N-methylbenzamide (racemic) (41)
Into a 8 mL vial purged and maintained with an inert atmosphere of nitrogen, was placed (3R, 4S) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.137 g, 290.08 μmol) , cuprous iodide (0.015 g, 78.76 μmol) , 3-methoxy-N-methyl-4- (prop-2-yn-1-ylamino) benzamide (0.119 g, 545.24 μmol) , bis(triphenylphosphine) palladium (II) chloride (0.023 g, 32.5813 μmol) , triethylamine (0.119 g, 1.18 mmol) , methyl sulfoxide (4 mL) . The reaction mixture was stirred at room temperature for 3 h. The reaction was quenched by the addition of water (10 mL) and extracted with EA (3 x 10 mL) . The organic layers was combined, washed with brine (10 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 35-65-90%B (2-30-60min) ; 269 nm; RT: 32.043 –33.407 min) . This resulted in 0.075 g (45.95%yield) of 4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop -2-yn-1-yl) amino) -3-methoxy-N-methylbenzamide (racemic) (41) as white solid. LCMS: m/z = 563 [M+1] +.
1H NMR (400 MHz, DMSO) δ 8.11 (s, 1H) , 7.42 (d, J = 8.3 Hz, 1H) , 7.35 (s, 1H) , 7.26 (d, J = 7.5 Hz, 1H) , 7.20 (d, J = 8.3 Hz, 1H) , 6.76 (t, J = 7.9 Hz, 2H) , 6.01 (s, 1H) , 5.22 –5.14 (m, 1H) , 4.90 –4.84 (m, 1H) , 4.80 –4.70 (m, 1H) , 4.33 (d, J = 6.2 Hz, 2H) , 3.89 –3.74 (m, 5H) , 2.75 (d, J = 4.2 Hz, 3H) , 2.20 (s, 3H) , 1.91 (s, 3H) , 1.73 (s, 2H) , 1.23 (s, 1H) .
Example 42
(3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -N, 1-dimethylpiperidin-4-amine (racemic) (42)
Reaction scheme:
Experimental details:
Step1. (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-7-yl) -N, 1-dimethylpiperidin-4-amine (racemic) (42) .
Into a 40 mL vial was placed 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.296 g, 1.24 mmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -N, 1-dimethylpiperidin-4-amine (racemic) (0.281 g, 578.19 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.157 g, 222.40 μmol) , CuI (0.145 g, 761.35 μmol) , DIEA (0.745 g, 5.76 mmol) , Methyl sulfoxide (20 mL) . The reaction was stirred at 60℃ for 3 h under nitrogen atmosphere. The reaction was quenched with water (30 mL) , extracted with EA (3 x 20 mL) . The organic layers was combined, washed with brine (50 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-30-60min) ; 269 nm; RT: 36.753 –38.278 min) to provide the desired product. This resulted in 0.015 g (4.35%yield) of (3S, 4R) -3-fluoro-N- (2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-7-yl) -N, 1-dimethylpiperidin-4-amine (racemic) (42) as off-white solid. LCMS: m/z =598 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.58 (d, J = 8.0 Hz, 1H) , 7.47 –7.37 (m, 2H) , 7.29 –7.21 (m, 2H) , 6.89 (d, J = 8.4 Hz, 1H) , 6.50 (t, J = 6.4 Hz, 1H) , 4.84 (d, J = 50.0 Hz, 1H) , 4.39 (d, J = 6.4 Hz, 2H) , 3.94 –3.79 (m, 5H) , 3.28 –3.20 (m, 1H) , 3.09 (s, 3H) , 2.96 (t, J = 12.4 Hz, 1H) , 2.83 (s, 4H) , 2.10 (d, J = 21.2 Hz, 4H) , 2.06 –1.89 (m, 2H) , 1.52 (d, J = 12.0 Hz, 1H) .
Example 43
(4- ( (3- (7- ( (3, 3-difluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (43)
Reaction scheme:
Experimental details:
Step 1 4-bromo-2-methoxyaniline
Into a 500 mL 3-necked flask was placed 4-bromo-2-methoxy-1-nitrobenzene (15.75 g, 67.87 mmol) , iron (28.61 g, 512.31 mmol) , NH4Cl (28.40 g, 530.92 mmol) , EtOH (150 mL) , water (15 mL) . The reaction was stirred at RT for 3 h. The reaction mixture was filtered through celite pad and the filter cake was washed with methanol (2 x 200 mL) . The filtrate was concentrated under reduced pressure to afford the product. The crude product was purified by silica gel column eluted with EA/hexane (v/v = 1/2) . This resulted in 13.82 g (68.39 mmol, 100.00%yield) of 4-bromo-2-methoxyaniline as yellow oil. LCMS: m/z = 202 [M+1] +.
Step 2 (4-amino-3-methoxyphenyl) dimethylphosphine oxide
Into a 250 mL 3-necked flask was placed 4-bromo-2-methoxyaniline (5.055 g, 25.01 mmol) , Palladium (II) acetate, (0.868 g, 3.87mmol) , dimethylbisdiphenylphosphinoxanthene (2.143 g, 3.70 mmol) , DIEA (6.442 g, 49.84 mmol) , The reaction was stirred under nitrogen atmosphere at 130℃ for 0.5 h. Then dimethylphosphine oxide (4.83 g, 61.88 mmol) was added at 130℃. The reaction was stirred under nitrogen atmosphere at 130℃ for 3 h The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/9) , filtered and concentrated under vacuum. This resulted in 4.798 g, (24.08 mmol, 96.27%yield) of (4-amino-3-methoxyphenyl) dimethylphosphine oxide as brown oil. LCMS: m/z = 200 [M+1] +.
Step 3 (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide
Into a 250 mL 3-necked flask was placed (4-amino-3-methoxyphenyl) dimethylphosphine oxide (2.059 g, 10.33 mmol) , 3-bromoprop-1-yne (1.693 g, 14.23 mmol) , K2CO3 (3.305 g, 23.91 mmol) , KI (1.877 g, 11.30 mmol) NMP (25 mL) . The reaction mixture was stirred under nitrogen at 80 ℃ for 4 h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) , filtered and concentrated under vacuum. This resulted in 1.351 g, (5.69 mmol, 55.09%yield) of (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide as brown oil. LCMS: m/z = 238 [M+1] +.
Step 4 (4- ( (3- (7- ( (3, 3-difluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (43)
Into a 10-mL round-bottom flask was placed (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide (0.102 g, 429.95 μmol) , 3, 3-difluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.089 g, 181.53 μmol) , Pd (PPh3) 2Cl2 (0.034 g, 48.16 μmol) , CuI (0.022 g, 115.51 μmol) , DIEA (0.105 g, 812.42 μmol) , methyl sulfoxide (2 mL) . The reaction was stirred under nitrogen atmosphere at RT for 16 h. The reaction was quenched with water (5 mL) . The resulted solution was extracted with EA (3 x 10 mL) , washed with brine (10 mL) , dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The crude product was purified by preparative HPLC (Mobile Phase A: water (0.1%ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 55-85-100%B (2-32-50min) ; 225 nm; RT: 30.53-31.56) to provide the desired product. This resulted in 0.010g (16.67 μmol, 9.18%yield) of (4- ( (3- (7- ( (3, 3-difluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-y n-1-yl) amino) -3-methoxyphenyl) dimethylphosphine oxide (43) as white solid. LCMS: m/z =600 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 7.28 –7.12 (m, 4H) , 6.85 (d, J = 7.8 Hz, 2H) , 6.06 (t, J = 6.3 Hz, 1H) , 5.38 (d, J = 8.9 Hz, 1H) , 4.34 (d, J = 6.4 Hz, 2H) , 3.85 (s, 3H) , 3.79 (d, J = 11.0 Hz, 2H) , 2.78 (d, J = 11.6 Hz, 2H) , 2.25 (s, 3H) , 2.17 (s, 1H) , 1.95 –1.82 (m, 3H) , 1.58 (d, J = 13.2 Hz, 6H) , 1.24 (s, 1H) .
Example 44&45
(R) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide and
(S) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide (44&45)
Reaction scheme:
Experimental details:
Step 1. but-3-yn-2-yl methanesulfonate
Into a 100 mL flask was placed but-3-yn-2-ol (2.30 g, 32.82 mmol) , DCM (20 mL) , TEA (2 mL) , MsCl (3 mL) . The reaction was stirred at 20℃ for 4 h. The reaction was quenched by H2O (20 mL) , extracted by DCM (3 x 20 mL) . The organic layers combined and concentrated under vacuum. This resulted in 1.99 g (crude) of but-3-yn-2-yl methanesulfonate as red oil. LCMS: m/z = 149 [M+1] +.
Step 2. 4- (but-3-yn-2-ylamino) benzenesulfonamide .
Into a 100 mL flask was placed but-3-yn-2-yl methanesulfonate (1.83 g, 12.35 mmol) , 4-aminobenzenesulfonamide (1.53 g, 9.06 mmol) , Cs2CO3 (2.87 g, 8.81 mmol) , DMF (3 mL) . The reaction was stirred at 85℃ for 3 h. The reaction mixture was purified by C18 chromatography column eluted with ACN/H2O (0.15%TFA) (v/v=1/3) . This resulted in 0.38 g (13%yield) of 4- (but-3-yn-2-ylamino) benzenesulfonamide as yellow solid. LCMS: m/z = 225 [M+1] +.
Step 3. 4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) ami no) benzenesulfonamide.
Into a 100 mL flask was placed 4- (but-3-yn-2-ylamino) benzenesulfonamide (0.058 g, 258.61umol) , N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.082 g, 180.50 μmol) , CuI (0.047 g, 246.78 μmol) , Pd (PPh3) 2Cl2 (0.081 g, 99.68 μmol) , DIEA (0.050 g, 386.87 μmol) and Methyl sulfoxide (2 mL) . The mixture was stirred at 25℃ for 4h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonuim hydroxide) , Mobile Phase B: ACN; Flow rate: 25 mL/min; Gradient: 50-70-90%B (2-30-60min) ; 220 nm; RT: 33.580 -36.110 min) . This resulted in 53 mg (34%yield) of 4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) b enzenesulfonamide (racemic) as white solid. LCMS: m/z =551 [M+1] +.
Step 4. (R) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide and (S) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) benzenesulfonamide (44&45) .
4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) b enzenesulfonamide (racemic) was separated via chiral separation to give 8 mg (18%yield) of
(R) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) ami no) benzenesulfonamide as white solid. LCMS: m/z =551 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.58 (d, J = 8.6 Hz, 2H) , 7.25 (t, J = 7.8 Hz, 1H) , 7.14 (d, J = 7.9 Hz, 1H) , 6.98 (s, 2H) , 6.79 (t, J = 7.8 Hz, 3H) , 6.66 (d, J = 7.8 Hz, 1H) , 5.28 (d, J = 8.1 Hz, 1H) , 4.73 –4.63 (m, 1H) , 3.89 –3.76 (m, 2H) , 2.76 (d, J = 11.5 Hz, 2H) , 2.17 (s, 3H) , 2.00 (t, J = 11.4 Hz, 2H) , 1.88 (d, J = 12.3 Hz, 2H) , 1.58 (d, J = 6.7 Hz, 3H) , 1.25 (d, J = 9.4 Hz, 3H) .
And 4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) amino) b enzenesulfonamide via chiral separation to give 10mg (22%yield) of
(S) -4- ( (4- (7- ( (1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) but-3-yn-2-yl) ami no) benzenesulfonamide as white solid. LCMS: m/z =551 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.58 (d, J = 8.6 Hz, 2H) , 7.25 (t, J = 7.8 Hz, 1H) , 7.14 (d, J = 7.9 Hz, 1H) , 6.98 (s, 2H) , 6.79 (t, J = 7.8 Hz, 3H) , 6.66 (d, J = 7.7 Hz, 1H) , 5.29 (d, J = 7.8 Hz, 1H) , 4.66 (dd, J = 14.0, 6.9 Hz, 1H) , 3.92 –3.74 (m, 2H) , 2.77 (d, J = 11.3 Hz, 2H) , 2.18 (s, 3H) , 2.01 (t, J = 11.2 Hz, 2H) , 1.88 (d, J = 12.0 Hz, 2H) , 1.41 –1.25 (m, 3H) , 1.23 (s, 3H) .
Example 46
4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzamide (racemic) (46)
Reaction scheme:
Experimental details:
Step 1. methyl 4-amino-3-methoxybenzoate
Into a 500 mL flask was placed 4-amino-3-methoxybenzoic acid (15.06 g, 90.09 mmol) , MeOH (200 mL) , sulfuric acid (15 mL) . The reaction was stirred at 65℃ for 16 h. The reaction was quenched with NaOH (2N, 500 mL) at 10℃. Then an amount of precipitation appeared. The mixture was filtered and the filter cake was collected. The filter cake was dried at 60℃ for 16h. This resulted in 14.35 g (87.91%yield) of methyl 4-amino-3-methoxybenzoate as white solid. LCMS: m/z = 182 [M+1] +.
Step 2. methyl 3-methoxy-4- (prop-2-yn-1-ylamino) benzoate.
Into a 100 mL flask was placed methyl 4-amino-3-methoxybenzoate (4.15 g, 22.90 mmol) , Cs2CO3 (3.73 g, 11.45 mmol) , 3-bromoprop-1-yne (8.89 g, 74.73 mmol) , KI (2.77 g, 16.69 mmol) , DMF (20 mL) . The reaction was stirred at 85 ℃ for 3 h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 1.40 g (27%yield) of methyl 3-methoxy-4- (prop-2-yn-1-ylamino) benzoate as light yellow solid. LCMS: m/z = 220 [M+1] +.
Step 3. 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid.
Into a 25-mL round-bottom flask was placed methyl 3-methoxy-4- (prop-2-yn-1-ylamino) benzoate (0.82 g, 3.73 mmol) , MeOH (4 mL) , THF (4 mL) , H2O (4 mL) , LiOH (0.81 g, 33.95 mmol) . The reaction mixture was stirred at 50 ℃ for 3 h. The reaction was diluted with water (50 mL) . Then Na2CO3 (aq, 100 mL) was added until PH>8. Meanwhile a amount of precipitation appeared. The mixture was filtered and the filter cake was collected. The filter cake was dried at 60℃ for 16h. This resulted in 0.75 g (97%yield) of 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid as yellow solid. LCMS: m/z = 206 [M+1] +.
Step 4. 3-methoxy-4- (prop-2-yn-1-ylamino) benzamide.
Into a 50-mL round-bottom flask was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid (0.137 g, 667.61 μmol) , NH4Cl (0.324 g, 6.06 mmol) , HATU (0.455 g, 1.20 mmol) , DIEA (1.919 g, 14.85 mmol) , DMF (5 mL) . The mixture was stirred at 20℃ for 3h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 83 mg (60%yield) of 3-methoxy-4- (prop-2-yn-1-ylamino) benzamide as light yellow solid. LCMS: m/z = 205 [M+1] +.
Step 5. 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzamide (racemic) (46) .
Into a 50-mL round-bottom flask was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzamide (0.069 g, 337.86 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.106 g, 224.44 μmol) , CuI (0.014 g, 73.51 μmol) , Pd (PPh3) 2Cl2 (0.037 g, 52.41 μmol) , DIEA (0.058 g, 448.77 μmol) and methyl sulfoxide (2 mL) . The mixture was stirred at 25℃ for 4h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 50-80-100%B (2-32-60min) ; 269 nm; RT: 33.448 –35.501 min) . This resulted in 43 mg (34%yield) of 4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxybenzamide (racemic) (46) as white solid. LCMS: m/z =549 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.69 (s, 1H) , 7.47 (d, J = 8.2 Hz, 1H) , 7.39 (s, 1H) , 7.30 –7.17 (m, 2H) , 6.98 (s, 1H) , 6.81 –6.69 (m, 2H) , 6.05 (t, J = 6.2 Hz, 1H) , 5.17 (d, J = 8.5 Hz, 1H) , 4.79 (d, J = 49.7 Hz, 1H) , 4.34 (d, J = 6.1 Hz, 2H) , 3.84 (s, 3H) , 3.80 (s, 1H) , 3.64 (d, J = 30.1 Hz, 2H) , 3.02 (t, J = 10.9 Hz, 1H) , 2.79 (d, J =11.1 Hz, 1H) , 2.32 –2.21 (m, 1H) , 2.17 (d, J = 9.7 Hz, 3H) , 2.07 (t, J = 11.1 Hz, 1H) , 2.01 –1.86 (m, 1H) , 1.71 (d, J = 9.8 Hz, 1H) .
Example 47
4- ( (3- (7- ( (3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxy-N- (1-methylpiperidin-4-yl) benzamide (racemic) (47)
Reaction scheme:
Experimental details
Step 1. 3-methoxy-N- (1-methylpiperidin-4-yl) -4- (prop-2-yn-1-ylamino) benzamide.
Into a 4 mL vail was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid (0.049 g, 238.78 μmol) , 1-methylpiperidin-4-amine (0.044 g, 385.33 μmol) , ECDI (0.049 g, 315.64 μmol) , HOBT (0.043 g, 318.23 μmol) , DMAP (0.003 g, 24.56 μmol) , TEA (0.042 g, 415.06 μmol) , DMF (0.5 mL) . The reaction was stirred for 3 h at 40℃. LCMS showed the reaction was complete, the reaction purified with C18 column, eluted with ACN/water (v/v = 1/3) to afford 3-methoxy-N- (1-methylpiperidin-4-yl) -4- (prop-2-yn-1-ylamino) benzamide (0.050 g, 165.90 μmol, 69.48%yield) as clear oil . LCMS: m/z = 302 [M+1] +.
Step 2. 4- ( (3- (7- ( (3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-y n-1-yl) amino) -3-methoxy-N- (1-methylpiperidin-4-yl) benzamide (racemic) (47) .
Into a 4 mL flask purged and maintained with nitrogen atmosphere was placed 3-methoxy-N- (1-methylpiperidin-4-yl) -4- (prop-2-yn-1-ylamino) benzamide (0.049 g, 162.58 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.049 g, 103.75 μmol) , Pd (PPh3) 2Cl2 (0.009 g, 12.75 μmol) , CuI (0.003 g, 15.75 μmol) , TEA (0.035 g, 345.89 μmol) , DMF (0.5 mL) , and stirred overnight at room temperature. LCMS showed the reaction was complete. The reaction was quenched with water (4 mL) , extracted with EA (2 mL x 2) . The combined organic layers were washed with water (2 mL) and brine (2 mL) successively, separated, then concentrated with vacuum. The residue was purified with prep-HPLC (Mobile Phase A: water (ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 50 mL/min; Gradient: 55-80-100%B (2-30-60min) ; 248 nm; RT: 33.450 -36.020 min) to afford 4- ( (3- (7- ( (3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxy-N- (1-methylpiperidin-4-yl) benzamide (racemic) (47) (42 mg, 65.04 μmol, 40.00%yield) as an off-white solid. LCMS: m/z = 646 [M+1] +
1H NMR (400 MHz, DMSO-d6) δ 7.88 (d, J = 7.8 Hz, 1H) , 7.46 (d, J = 8.2 Hz, 1H) , 7.36 (s, 1H) , 7.32 –7.16 (m, 2H) , 6.77 (dd, J = 10.9, 7.9 Hz, 2H) , 6.02 (t, J = 6.5 Hz, 1H) , 5.15 (d, J = 8.5 Hz, 1H) , 4.79 (d, J = 49.0 Hz, 1H) , 4.34 (d, J = 6.3 Hz, 2H) , 3.95 –3.77 (m, 5H) , 3.76 –3.55 (m, 2H) , 3.03 (t, J = 11.3 Hz, 1H) , 2.77 (d, J =11.3 Hz, 3H) , 2.27 (d, J = 13.2 Hz, 1H) , 2.17 (d, J = 9.2 Hz, 6H) , 2.10 –1.88 (m, 4H) , 1.80 –1.66 (m, 3H) , 1.63 –1.52 (m, 2H) .
Example 48
(1, 1-dioxidothiomorpholino) (4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) methanone (racemic) (48)
Reaction scheme:
Experimental details
Step1. (1, 1-dioxidothiomorpholino) (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) methanone
Into a 8 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid (0.053 g, 258.27 μmol) , 4-thiomorpholine-1, 1-dione hydrochloride (0.139 g, 809.81 μmol) , 2- (7-aza-1H-benzotriazole-1-yl) -1, 1, 3, 3-tetramethyluronium hexafluorophosphate (0.366 g, 962.58 μmol) , N, N-diisopropylethylamine (0.119 g, 920.75 μmol) , N, N-dimethylformamide (2 mL) . The reaction mixture was stirred at room temperature for 18 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 2 mL) . The organic layers was combined, washed with 15%potassium carbonate solution (2 x 2 mL) and brine (5 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The residues were purified by C18 chromatography column eluted with ACN/H2O (v/v = 3/1) . This resulted in 0.092 g (110.50%yield) of (1, 1-dioxidothiomorpholino) (3-methoxy-4- (prop-2-yn-1-ylamino)phenyl) methanone (crude) as white solid. LCMS: m/z = 323 [M+1] +.
Step2. (1, 1-dioxidothiomorpholino) (4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoro ethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) methanone (racemic) (48)
Into a 100 mL flask purged and maintained with an inert atmosphere of nitrogen, was placed (3R, 4S) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.103 g, 218.09 μmol) , cuprous iodide (0.008 g, 42.01 μmol) , (1, 1-dioxidothiomorpholino) (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) methanone (0.084 g, 260.5629 μmol) , bis(triphenylphosphine) palladium (II) chloride (0.021 g , 29.75 μmol) , triethylamine (0.153 g, 1.51 mmol) , methyl sulfoxide (1 mL) . The reaction mixture was stirred at room temperature for 5 h. The reaction was quenched by the addition of water (2 mL) and extracted with EA (2 x 2 mL) . The organic layers was combined, washed with brine (5 mL) , dried over anhydrous Na2SO4 and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-32-60min) ; 269 nm; RT: 30.797 –31.863 min) . This resulted in 0.026 g (17.88%yield) of (1, 1-dioxidothiomorpholino) (4- ( (3- (7- ( ( (3R, 4S) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethy l) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) methanone (racemic) (48) as white solid. LCMS: m/z = 667 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.31 –7.19 (m, 2H) , 7.02 (dd, J = 10.5, 2.5 Hz, 2H) , 6.82 –6.74 (m, 2H) , 6.02 (t, J = 6.3 Hz, 1H) , 5.16 (d, J = 8.6 Hz, 1H) , 4.80 (d, J = 49.6 Hz, 1H) , 4.34 (d, J = 6.3 Hz, 2H) , 3.90 (s, 4H) , 3.86 –3.76 (m, 5H) , 3.74 –3.55 (m, 1H) , 3.25 (d, J = 4.4 Hz, 4H) , 3.03 (t, J = 10.8 Hz, 1H) , 2.80 (d, J = 12.0 Hz, 1H) , 2.25 (t, J = 13.1 Hz, 1H) , 2.18 (s, 3H) , 2.08 (t, J = 11.1 Hz, 1H) , 2.02 –1.89 (m, 1H) , 1.72 (d, J = 9.8 Hz, 1H) .
Example 49
(4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (4-methylpiperazin-1-yl) methanone (racemic) (49)
Reaction scheme:
Experimental details:
Step1. (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (4-methylpiperazin-1-yl) methanone.
Into a 4 mL sealed tube was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid (0.101 g, 492.18 μmol) , 1-methylpiperazine (0.107 g, 1.07 mmol) , 2- (7-aza-1H-benzotriazole-1-yl) -1, 1, 3, 3-tetramethyluronium hexafluorophosphate (0.324 g, 852.12 μmol) , N, N-diisopropylethylamine (0.205 g, 1.59 mmol) , N, N-dimethylformamide (2 mL) . The reaction was stirred overnight at RT. The reaction was quenched with water (50 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with water (20 mL) and brine (30 mL x 2) successively, separated and concentrated under vacuum. The crude was purified by silica gel column eluted with MeOH/DCM (v/v = 1/9) . This resulted in 0.19 g (crude) of (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (4-methylpiperazin-1-yl) methanone as brown-yellow oil. LCMS: m/z = 288 [M+1] +.
Step2. (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (4-methylpiperazin-1-yl) methanone (racemic) (49) .
Into a 25-mL round-bottom flask was placed (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (4-methylpiperazin-1-yl) methanone (0.167 g, 581.16 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.100 g, 211.74 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.043 g, 60.91 μmol) , CuI (0.036 g, 189.03 mmol) , DIEA (0.164 g, 1.27 mmol) , methyl sulfoxide (5 mL) . The reaction was stirred at 60℃ for 2 h under nitrogen atmosphere. The reaction was quenched with water (20 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with water (30 mL) and brine (30 mL) successively, separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeOH; Flow rate: 70 mL/min; Gradient: 45-80-100%B (2-32-60min) ; 269 nm; RT: 39.863-41.317 min) to provide the desired product. This resulted in 0.061 g (45.60%yield) of (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (4-methylpiperazin-1-yl) methanone (racemic) (49) as off-white solid. LCMS: m/z =632 [M+1] +.
1H NMR (400 MHz, MeOD) δ 7.29 (t, J = 7.8 Hz, 1H) , 7.19 (d, J = 7.8 Hz, 1H) , 7.01 (d, J = 8.1 Hz, 1H) , 6.96 (s, 1H) , 6.85 (d, J = 8.2 Hz, 1H) , 6.77 (d, J = 7.7 Hz, 1H) , 4.96 –4.89 (m, 1.5H) , 4.83 –4.73 (m, 0.5H) , 4.35 (s, 2H) , 3.89 (s, 3H) , 3.77 –3.62 (m, 6H) , 3.25 –3.15 (m, 1H) , 2.98 –2.88 (m, 1H) , 2.56 –2.42 (m, 4H) , 2.42 –2.36 (m, 1H) , 2.30 (d, J = 7.1 Hz, 6H) , 2.27 –2.20 (m, 1H) , 2.01 –1.91 (m, 2H) .
Example 50
(4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (morpholino) methanone (racemic) (50)
Reaction scheme:
Experimental details:
Step 1. (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (morpholino) methanone.
Into a 50-mL round-bottom flask was placed 3-methoxy-4- (prop-2-yn-1-ylamino) benzoic acid (0.065 g, 316.74 μmol) , morpholine (0.125 g, 1.43 mmol) , HATU (0.280 g, 0.74 mmol) , DIEA (0.296 g, 2.29 mmol) , DMF (5 mL) . The mixture was stirred at 20℃ for 3h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 94 mg (98%yield) of (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (morpholino) methanone as light yellow solid. LCMS: m/z = 275 [M+1] +.
Step 2. (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (morpholino) methanone (racemic) (50)
Into a 50-mL round-bottom flask was placed (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (morpholino) methanone (0.069 g, 251.54 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.106 g, 224.44 μmol) , CuI (0.014 g, 73.51 μmol) , Pd (PPh3) 2Cl2 (0.037 g, 52.41 μmol) , DIEA (0.058 g, 448.77 μmol) and methyl sulfoxide (2 mL) . The mixture was stirred at 25℃ for 4 h. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: ACN; Flow rate: 70 mL/min; Gradient: 55-80-100%B (2-32-60min) ; 269 nm; RT: 37.007 –38.908 min; ) . This resulted in 41 mg (29%yield) of (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (morpholino) methanone (racemic) (50) as white solid. LCMS: m/z =619 [M+1] +.
1H NMR (400 MHz, DMSO) δ 7.34 –7.15 (m, 2H) , 7.02 –6.88 (m, 2H) , 6.77 (m, 2H) , 5.98 (t, J = 6.3 Hz, 1H) , 5.16 (d, J = 8.6 Hz, 1H) , 4.79 (d, J = 49.3 Hz, 1H) , 4.33 (d, J = 6.3 Hz, 2H) , 3.86 –3.82 (mii, 3H) , 3.82 –3.75 (m, 2H) , 3.73 –3.65 (m, 1H) , 3.59 (d, J = 3.9 Hz, 4H) , 3.52 (d, J = 3.8 Hz, 4H) , 3.03 (t, J = 10.7 Hz, 1H) , 2.79 (d, J = 11.0 Hz, 1H) , 2.36 –2.21 (m, 1H) , 2.17 (d, J = 10.6 Hz, 3H) , 2.07 (t, J = 11.2 Hz, 1H) , 2.01 –1.88 (m, 1H) , 1.71 (d, J = 9.7 Hz, 1H)
Example 51
N- (4-fluoro-2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (51)
Reaction scheme:
Experimental details:
Step1. N- (4-fluoro-2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.408 g, 0.90 mmol) , selectfluor (0.375 g, 1.06 mmol) , MeCN (10 mL) . The reaction mixture was stirred at room temperature for 1 h. The mixture purified by silica gel column, eluted with EA/hexane (v/v = 1/4) to afford 0.304 g (71.67%) of N- (4-fluoro-2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine as yellow oil. LCMS: m/z = 473 [M+1] +
Step2. N- (4-fluoro-2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) be nzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (51)
Into a 20-mL sealed tube purged and maintained with an inert atmosphere of nitrogen, was placed N- (4-fluoro-2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.268 g, 0.57 mmol) , 2-methoxy-4- (methylsulfonyl) -N- (prop-2-yn-1-yl) aniline (0.271 g, 1.13 mmol) , Pd (dppf) Cl2 (0.098 g, 0.14 mmol) , CuI (0.164 g, 0.86 mmol) , DIEA (0.314 g, 2.43 mmol) , DMSO (5 mL) . The reaction mixture was stirred at 50℃ for 1 h. The reaction mixture was quenched by the addition of water (20 mL) , extracted with EA (20 mL x 2) . The combined organic layers was washed with brine (10 mL) , separated and concentrated under vacuum. The mixture was purified by preparative HPLC (Mobile Phase A: water (10 mmoL/L ammonium hydroxide) , Mobile Phase B: MeCN; Flow rate: 60 mL/min; Gradient: 50-75-95%B (2-30-55min) ; 242 nm; RT: 34.125 –36.751 min; ) to afford N- (4-fluoro-2- (3- ( (2-methoxy-4- (methylsulfonyl) phenyl) amino) prop-1-yn-1-yl) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (51) (0.092 g, 27.78%yield) as white solid. LCMS: m/z = 584 [M+1] +
1H NMR (400 MHz, MeOD) δ 7.52 –7.46 (m, 1H) , 7.32 –7.23 (m, 2H) , 7.23 –7.13 (m, 1H) , 6.93 (d, J = 8.4 Hz, 1H) , 4.40 (s, 2H) , 3.95 (s, 3H) , 3.74 –3.63 (m, 2H) , 3.51 (d, J = 22.0 Hz, 1H) , 3.06 (s, 3H) , 2.86 (d, J = 11.8 Hz, 2H) , 2.29 (s, 3H) , 2.14 (t, J = 11.2 Hz, 2H) , 1.92 (d, J = 12.4 Hz, 2H) , 1.67 –1.51 (m, 2H) .
Example 52
(2-fluoro-4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiop hen-2-yl) prop-2-yn-1-yl) amino) -5-methoxyphenyl) dimethylphosphine oxide (racemic) (52)
Reaction scheme:
Experimental details
Step 1. Synthesis of (4-amino-2-fluoro-5-methoxyphenyl) dimethylphosphine oxide
Into a 40-mL vial was placed 4-bromo-5-fluoro-2-methoxyaniline (1.084 g, 4.93 mmol) , dimethylphosphine oxide (0.508 g, 6.51 mmol) , palladium (II) acetate (0.150 g, 668.13 μmol) , dimethylbisdiphenylphosphinoxanthene (0.652 g, 1.13 mmol) N, N-Diisopropylethylamine (1.495 g, 11.57 mmol) , DMF (10 mL) . The mixture was stirred at 130℃ under nitrogen atmosphere overnight. Then the resulted reaction was purified by C18 chromatography column eluted with ACN/water (v/v = 1/6) . This resulted in 0.955 g (89.26%yield) of (4-amino-2-fluoro-5-methoxyphenyl) dimethylphosphine oxide. LCMS: m/z = 218 [M+1] +.
Step 2. Synthesis of (2-fluoro-5-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide Into a 40-mL vial was placed (4-amino-2-fluoro-5-methoxyphenyl) dimethylphosphine oxide (0.654 g, 3.01 mmol) , DMA (15 mL) , cesium carbonate (3.149 g, 9.67 mmol) , sodium iodide (0.413 g, 2.76 mmol) , N- (4-pyridyl) dimethylamine (0.083 g, 679.40 μmol) , 3-bromoprop-1-yne (0.746 g, 6.27 mmol) . Then the mixture was stirred at 90℃ overnight. The resulted reaction was purified by C18 chromatography column eluted with ACN/water (v/v = 1/3) . This resulted in 0.255 g (33.18%yield) of (2-fluoro-5-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide. LCMS: m/z = 256 [M+1] +.
Step 3. Synthesis of (2-fluoro-4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiop hen-2-yl) prop-2-yn-1-yl) amino) -5-methoxyphenyl) dimethylphosphine oxide (racemic) (52) Into a 40-mL vial was placed (2-fluoro-5-methoxy-4- (prop-2-yn-1-ylamino) phenyl) dimethylphosphine oxide (0.251 g, 983.45 μmol) , (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (racemic) (0.470 g, 995.17 μmol) , bis (triphenylphosphine) palladium (II) chloride (0.070 g, 99.16 μmol) , copper (I) iodide (0.034 g, 178.52 μmol) N, N-Diisopropylethylamine (0.437 g, 3.38 mmol) , methyl sulfoxide (10 mL) . The mixture was stirred at 40℃ for 4h. The resulted reaction was diluted with water (30 mL) and extracted with EA (10 mL x 3) . The organic phase was dried over Na2SO4 and concentrated under vacuum. The resulted reaction was purified by C18 chromatography column eluted with ACN/water (0.1%ammonium bicarbonate) (v/v = 1/1) to give the crude product. Then the crude was concentrated and purified by C18 chromatography column eluted with ACN/water (0.1%formic acid) (v/v = 1/1) to give the product. This resulted in 0.100 g (16.96%yield) of (2-fluoro-4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -5-methoxyphenyl) dimethylphosphine oxide (racemic) (52) (HCOOH salt) as white solid. LCMS: m/z = 600 [M+1] +.
1H NMR (400 MHz, DMSO-d6) δ 8.15 (s, 1H) , 7.27 (t, J = 7.8 Hz, 1H) , 7.21 (d, J = 7.9 Hz, 1H) , 7.02 (dd, J = 12.3, 5.8 Hz, 1H) , 6.78 (d, J = 7.7 Hz, 1H) , 6.65 (dd, J = 11.9, 5.0 Hz, 1H) , 6.45 (t, J = 6.4 Hz, 1H) , 5.18 (d, J = 8.5 Hz, 1H) , 4.74 (s, 1H) , 4.35 (d, J = 6.2 Hz, 2H) , 3.82 (s, 3H) , 3.79 (d, J = 11.0 Hz, 1H) , 3.69 (s, 1H) , 3.62 (s, 1H) , 3.04 (t, J = 11.1 Hz, 1H) , 2.80 (d, J = 11.0 Hz, 1H) , 2.33 –2.67 (m, 1H) , 2.19 (s, 3H) , 2.12 –2.06 (m, 1H) , 1.99 –1.90 (m, 1H) , 1.76 –1.68 (m, 1H) , 1.62 (d, J = 13.5 Hz, 6H) .
Example 53&54
(S) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (54) and
(R) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (53)
Reaction scheme
Experimental Details
Step 1. 2-methoxy-6- (methylthio) -3-nitropyridine.
Into a 100-mL three necked bottle purged and maintained with an inert atmosphere of nitrogen, was placed 6-fluoro-2-methoxy-3-nitropyridine (2.03 g, 10.77 mmol) , ACN (20 mL) . Then NaSCH3 (2.31 g, 32.96 mmol) was added at -20℃. The reaction mixture was stirred at 25℃ for 2 h. The mixture was quenched with water (20 mL) . Solid precipitated out, filtered to collect the filter cake. This resulted in 1.93 g (89.54%yield) of 2-methoxy-6- (methylthio) -3-nitropyridine as white solid. LCMS: m/z = 201 [M+1] +.
Step 2. imino (6-methoxy-5-nitropyridin-2-yl) (methyl) -l6-sulfanone.
Into a 100-mL three necked bottle was placed 2-methoxy-6- (methylthio) -3-nitropyridine (1.93 g, 9.63 mmol) , PhI (OAc) 2 (6.64 g, 20.62 mmol) , NH4OAc (6.48 g, 84.07 mmol) , MeOH (20 mL) . The reaction mixture was stirred at 25℃ for 4 h. The resulting solution was added to water (30 mL) . The resulting solution was extracted with EA (2 x 30 mL) . The organic layers were combined and washed with brine (20 mL) , dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) . This resulted in 1.17 g (52.49%yield) of imino (6-methoxy-5-nitropyridin-2-yl) (methyl) -l6-sulfanone as red oil. LCMS: m/z = 232 [M+1] +.
Step 3. N- ( (5-amino-6-methoxypyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) -2, 2, 2-trifluoroacetamide Into a 50-mL three necked bottle purged and maintained with an inert atmosphere of nitrogen, was placed imino (6-methoxy-5-nitropyridin-2-yl) (methyl) -l6-sulfanone (1.10 g, 4.76 mmol) , TFAA (1.12 g, 5.33 mmol) , THF (10 mL) . The reaction mixture was stirred at 25℃ for 1 h. Then Fe (1.77 g, 31.69 mmol) , NH4Cl (2.59 g, 48.42 mmol) , MeOH (10 mL) , H2O (5 mL) was added. The reaction was stirred at 50 ℃ for another 1 h. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 0.333 g (23.54%yield) of N- ( (5-amino-6-methoxypyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) -2, 2, 2-trifluoroacetamide as red solid. LCMS: m/z = 298 [M+1] +.
Step 4. 2, 2, 2-trifluoro-N- ( (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) acet amide
Into a 50-mL flask was placed N- ( (5-amino-6-methoxypyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) -2, 2, 2-trifluoroacetamide (0.205 g, 0.69 mmol) , 3-Bromopropyne (0.222 g, 1.87 mmol) , DIEA (0.230 g, 1.78 mmol) , DMF (5 mL) . The reaction mixture was stirred at 80 ℃ for 4 h. LCMS showed that the reaction was completed. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) . This resulted in 0.199 g (85.63%yield) of 2, 2, 2-trifluoro-N- ( (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) acetamid e as red solid. LCMS: m/z = 336 [M+1] +.
Step 5. imino (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) -l6-sulfanone
Into a 50-mL flask was placed 2, 2, 2-trifluoro-N- ( (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) (oxo) -l6-sulfaneylidene) acetamid e (0.214 g, 0.64 mmol) , K2CO3 (0.213 g, 1.54 mmol) , MeOH (2 mL) . The reaction mixture was stirred at 20℃ for 1 h. LCMS showed that the reaction was completed. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) . This resulted in 0.146 g (95.60%yield) of imino (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) -l6-sulfanone as red solid. LCMS: m/z = 240 [M+1] +.
Step 6. (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone
Into a 50-mL three necked bottle and maintained with an inert atmosphere of nitrogen, was placed (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.122 g, 0.26 mmol) , CuI (0.020 g, 0.11 mmol) , Pd (PPh3) 2Cl2 (0.065 g, 0.092 mmol) , DIEA (0.125 g, 0.97 mmol) and DMF (5 mL) . Then imino (6-methoxy-5- (prop-2-yn-1-ylamino) pyridin-2-yl) (methyl) -l6-sulfanone (0.097 g, 0.35 mmol) was added at 60 ℃. The reaction mixture was stirred at 60 ℃ for 1 h. LCMS showed that the reaction was completed. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 0.147 g (97.50%yield) of (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone as off white solid. LCMS: m/z = 584 [M+1] +.
Step 7. (S) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (54) and (R) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (53)
The racemic sample (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (0.13 g, 0.22 mmol) was separated by prep-chiral HPLC (Column: IG, Mobile Phase A: n-Hexane, Mobile Phase B: EtOH; Flow rate: 20 mL/min; EtOH=50: 50; 220 nm; RT: 6.792) to provide 0.029 g (22.31%yield) (S) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (54) as white solid. LCMS: m/z =584 [M+1] +
1H NMR (600 MHz, DMSO) δ 7.57 (d, J = 8.0 Hz, 1H) , 7.28 (t, J = 7.8 Hz, 1H) , 7.22 (d, J = 8.0 Hz, 1H) , 7.11 (d, J = 8.0 Hz, 1H) , 6.79 (d, J = 7.8 Hz, 1H) , 6.65 (t, J = 6.2 Hz, 1H) , 5.20 (d, J = 7.4 Hz, 1H) , 4.82 (d, J =49.4 Hz, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 3.98 (s, 3H) , 3.68 (d, J = 28.3 Hz, 2H) , 3.09 (s, 1H) , 3.04 (s, 3H) , 2.84 (s, 1H) , 2.51 (s, 2H) , 2.23 (s, 3H) , 2.17 (s, 1H) , 2.04 –1.88 (m, 2H) , 1.74 (d, J = 11.6 Hz, 1H) .
The racemic sample (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (0.13 g, 0.22 mmol) was separated by prep-chiral HPLC (Column: IG, Mobile Phase A: n-Hexane, Mobile Phase B: EtOH; Flow rate: 20 mL/min; EtOH=50: 50; 220 nm; RT: 8.859) to provide 0.031 g (23.84%yield) (R) - (5- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -6-methoxypyridin-2-yl) (imino) (methyl) -l6-sulfanone (53) as white solid. LCMS: m/z =584 [M+1] +.
1H NMR (600 MHz, DMSO) δ 7.57 (d, J = 8.0 Hz, 1H) , 7.28 (t, J = 7.9 Hz, 1H) , 7.22 (d, J = 7.9 Hz, 1H) , 7.12 (t, J = 11.1 Hz, 1H) , 6.79 (d, J = 7.8 Hz, 1H) , 6.68 –6.60 (m, 1H) , 5.22 (d, J = 7.6 Hz, 1H) , 4.83 (d, J = 49.2 Hz, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 3.98 (s, 3H) , 3.84 (dd, J = 22.1, 11.0 Hz, 2H) , 3.69 (d, J = 29.3 Hz, 1H) , 3.13 (d, J = 25.0 Hz, 1H) , 3.04 (s, 3H) , 2.87 (s, 1H) , 2.51 (s, 1H) , 2.45 –2.33 (m, 1H) , 2.26 (s, 3H) , 2.19 (d, J = 7.7 Hz, 1H) , 2.03 –1.93 (m, 1H) , 1.75 (d, J = 12.2 Hz, 1H) .
Example 55&56
(S) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (56) and
(R) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (55)
Reaction scheme
Experimental Details
Step 1. 3-methoxy-4-nitrobenzenethiol.
Into a 100-mL three necked bottle purged and maintained with an inert atmosphere of nitrogen, was placed 4-fluoro-2-methoxy-1-nitrobenzene (3.41 g, 19.93 mmol) , DMF (20 mL) . Then Na2S (1.89 g, 24.22 mmol) was added at -20℃. The reaction mixture was stirred at 25℃ for 2 h. The mixture was quenched by HCl (aq) (4 M, 200 mL) . Solid was precipitated out, filtered to collect the filter cake. This resulted in 4.212 g (94.13%yield) of 3-methoxy-4-nitrobenzenethiol as yellow solid. LCMS: m/z = 184 [M-1] -.
Step 2. 3- ( (3-methoxy-4-nitrophenyl) thio) oxetane.
Into a 50-mL flask was placed 3-methoxy-4-nitrobenzenethiol (0.718 g, 3.88 mmol) , 3-bromooxetane (0.990 g, 7.28 mmol) , Cs2CO3 (2.185 g, 6.71 mmol) , DMF (10 mL) . The reaction mixture was stirred at 60℃ for 16 h. LCMS showed that the reaction was completed. The resulting solution was added to water (30 mL) . The resulting solution was extracted with EA (2 x 15 mL) . The organic layers were combined and washed with brine (20 mL) , dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The crude product was purified by washing with HEX/EA (v/v = 8/2) . This resulted in 0.959 g (92.52%yield) of 3- ( (3-methoxy-4-nitrophenyl) thio) oxetane as yellow solid. LCMS: m/z = 242 [M+1] +
Step 3. imino (3-methoxy-4-nitrophenyl) (oxetan-3-yl) -l6-sulfanone.
Into a 100-mL three necked bottle was placed 3- ( (3-methoxy-4-nitrophenyl) thio) oxetane (0.958 g, 3.97 mmol) , PhI(OAc) 2 (2.133 g, 6.62 mmol) , NH4OAc (1.935 g, 25.10 mmol) , MeOH (10 mL) . The reaction mixture was stirred at 25℃ for 4 h. The reaction mixture was concentrated under vaccum. The crude was purified by crystallization (Hex/EA=5/1) . This resulted in 0.669 g (61.88%yield) of imino (3-methoxy-4-nitrophenyl) (oxetan-3-yl) -l6-sulfanone as red oil. LCMS: m/z = 273 [M+1] +.
Step 4. tert-butyl ( (3-methoxy-4-nitrophenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate.
Into a 50-mL three necked bottle and maintained with an inert atmosphere of nitrogen, imino (3-methoxy-4-nitrophenyl) (oxetan-3-yl) -l6-sulfanone (0.659 g, 2.42 mmol) , THF (10 mL) . Then NaH (1.945 g, 32.41 mmol) and Boc2O (3.084 g, 14.13 mmol) were added at -10 ℃. The reaction mixture was stirred at 25℃ for 2 h. The resulting solution was added to water (30 mL) . The resulting solution was extracted with EA (2 x 15 mL) . The organic layers were combined and washed with brine (20 mL) , dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The crude product was purified by washing with HEX/EA (v/v = 1/1) . This resulted in 0.536 g (59.47%yield) of tert-butyl ( (3-methoxy-4-nitrophenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate as yellow solid. LCMS: m/z = 373 [M+1] +.
Step 5. tert-butyl ( (4-amino-3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate
Into a 50-mL flask was placed tert-butyl ( (3-methoxy-4-nitrophenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate (0.561 g, 1.51 mmol) , Pd/C (0.571 g, 5.37 mmol) , MeOH (20 mL) . The reaction was stirred at 25℃ for 4 h under hydrogen atmosphere. LCMS showed that the reaction was completed. The reaction mixture was filtered to collect filtrate. The filtrate was concentrated under vaccum to give 0.486 g (94.22%yield) of tert-butyl ( (4-amino-3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate as colorless oil. LCMS: m/z = 343 [M+1] +.
Step 6. tert-butyl ( (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate
Into a 50-mL flask was placed tert-butyl ( (4-amino-3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate (0.467 g, 1.36 mmol) , 3-Bromopropyne (0.331 g, 2.78 mmol) , DIEA (0.360 g, 2.78 mmol) , DMF (5 mL) . The reaction mixture was stirred at 80℃ for 4 h. LCMS showed that the reaction was completed. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 2/8) . This resulted in 0.234 g (46.83%yield) of tert-butyl ( (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate as red solid. LCMS: m/z = 381 [M+1] +.
Step 7. tert-butyl ( (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate
Into a 50-mL three necked bottle and maintained with an inert atmosphere of nitrogen, was placed (3S, 4R) -3-fluoro-N- (2-iodo-3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-7-yl) -1-methylpiperidin-4-amine (0.211 g, 0.45 mmol) , CuI (0.051 g, 0.21 mmol) , Pd (PPh3) 2Cl2 (0.131 g, 0.18 mmol) , DIEA (0.214 g, 1.66 mmol) and DMF (2 mL) . Then tert-butyl ( (3-methoxy-4- (prop-2-yn-1-ylamino) phenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate (0.214 g, 0.56 mmol) was added at 60 ℃. The reaction mixture was stirred at 60 ℃ for 1 h. LCMS showed that the reaction was completed. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 1/1) . This resulted in 0.288 g (88.94%yield) of tert-butyl ( (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate as off white solid. LCMS: m/z = 725 [M+1] +.
Step 8. (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone
Into a 50-mL flask was placed tert-butyl ( (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (oxetan-3-yl) (oxo) -l6-sulfaneylidene) carbamate (0.183 g, 0.25 mmol) , DCM (2 mL) , TFA (1 mL) . The mixture was stirred at 20℃ for 1 h. LCMS showed that the reaction was completed. The resulting solution was added to sodium carbonate aqueous solution (50 mL) and extracted with EA (3 x 50 mL) . The organic layers were combined and washed with brine (50 mL) , dried over anhydrous Na2SO4, the residue was concentrated under vacuum. The reaction mixture was purified by C18 column eluted with ACN/H2O (v/v = 4/6) . This resulted in 0.122 g (77.35%yield) of (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone as off white solid. LCMS: m/z = 625 [M+1] +.
Step 9. (S) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (56) and (R) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (55)
The racemic sample (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (0.080 g, 0.13 mmol) was separated by prep-chiral HPLC (Column: IG, Mobile Phase A: n-Hexane, Mobile Phase B: EtOH; Flow rate: 20 mL/min; EtOH=50: 50; 220 nm; RT: 6.792) to provide 0.026 g (32.50%yield) (S) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (56) as white solid. LCMS: m/z =625 [M+1] +
1H NMR (600 MHz, DMSO) δ 7.40 (dd, J = 8.4, 1.7 Hz, 1H) , 7.31 –7.20 (m, 3H) , 6.88 (t, J = 6.6 Hz, 1H) , 6.79 (d, J = 7.8 Hz, 1H) , 6.46 (t, J = 6.2 Hz, 1H) , 5.17 (d, J = 8.5 Hz, 1H) , 4.80 (d, J = 49.3 Hz, 1H) , 4.72 –4.64 (m, 3H) , 4.64 –4.59 (m, 1H) , 4.59 –4.54 (m, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 4.21 (s, 1H) , 3.88 (s, 3H) , 3.82 (dd, J = 22.5, 11.5 Hz, 2H) , 3.72 –3.58 (m, 1H) , 3.04 (t, J = 10.5 Hz, 1H) , 2.81 (d, J = 10.4 Hz, 1H) , 2.27 (d, J = 13.3 Hz, 1H) , 2.20 (s, 3H) , 2.15 –2.06 (m, 1H) , 2.00 –1.89 (m, 1H) , 1.72 (d, J = 10.5 Hz, 1H) .
The racemic sample (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) pro p-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (0.080 g, 0.13 mmol) was separated by prep-chiral HPLC (Column: IG, Mobile Phase A: n-Hexane, Mobile Phase B: EtOH; Flow rate: 20 mL/min; EtOH=50: 50; 220 nm; RT: 8.859) to provide 0.025 g (31.25%yield) (R) - (4- ( (3- (7- ( ( (3S, 4R) -3-fluoro-1-methylpiperidin-4-yl) amino) -3- (2, 2, 2-trifluoroethyl) benzo [b] thiophen-2-yl) prop-2-yn-1-yl) amino) -3-methoxyphenyl) (imino) (oxetan-3-yl) -l6-sulfanone (55) as white solid. LCMS: m/z =625 [M+1] +.
1H NMR (600 MHz, DMSO) δ 7.40 (dd, J = 8.4, 1.7 Hz, 1H) , 7.33 –7.19 (m, 3H) , 6.88 (d, J = 8.4 Hz, 1H) , 6.79 (d, J = 7.8 Hz, 1H) , 6.46 (t, J = 6.2 Hz, 1H) , 5.16 (d, J = 8.5 Hz, 1H) , 4.80 (d, J = 49.8 Hz, 1H) , 4.73 –4.65 (m, 3H) , 4.64 –4.60 (m, 1H) , 4.59 –4.53 (m, 1H) , 4.38 (d, J = 6.2 Hz, 2H) , 4.21 (s, 1H) , 3.87 (d, J = 11.4 Hz, 3H) , 3.82 (dd, J = 21.1, 11.9 Hz, 2H) , 3.71 –3.60 (m, 1H) , 3.03 (t, J = 10.9 Hz, 1H) , 2.80 (d, J = 11.2 Hz, 1H) , 2.26 (d, J = 12.7 Hz, 1H) , 2.20 (d, J = 10.5 Hz, 3H) , 2.08 (t, J = 11.3 Hz, 1H) , 2.00 –1.89 (m, 1H) , 1.72 (d, J = 9.8 Hz, 1H) .
Pharmacological Experiments
1. In vitro DNA binding assay.
After His-p53 Y220C (94-294) protein was placed with a compound in the present of MAb Anti His-Tb cryptate (Cisbio, Cat. NO. 61HI2TLA) in a 384 well microplate (Greiner) for 15 min at 25 ℃, the assay plate was transferred into 27 ℃ incubator and incubated for 60 min. Biotinalyted p53 consensus DNA(ID: p53-SEQUENCE 2
-F: 5’ (biotin) -ATTAGGCATGTCTAGGCATGTCTAGG 3’
-R: 5’ CCTAGACATGCCTAGACATGCCTAAT 3’ ) was added into the assay plate in the present of Streptaidin-d2 (Cisbio, Cat. NO. 610SADLF) cryptate (Final concentration : 20 mM HEPES pH = 7.4, 75 mM KCl, 1mM MgCl2, 0.1% (w/v) BSA, 1 mM DTT, 2.5 nM His-P53 Y220C (94-294) protein, 0.33 nM MAb Anti His-Tb cryptate, 2.5nM Streptaidin -d2 cryptate, 10 nM Biotinalyted DNA) and incubated for another 60 min. Wells containing 2 μM reference compound Ref-1a served as high control, and wells containing same percentage of DMSO served as low control. Homogeneous time-resolved fluorescence (HTRF) signals were read on Tecan Spark multimode microplate reader. HTRF ratios for each individual well were calculated by equation: HTRF ratio = (Signal F665/Signal F620) *1000. The percent of activation of compounds treated wells were normalized between high control and low control (%Activation = (HTRF ratio compound treated –HTRF ratio low control) / (HTRF ratio high control –HTRF ratio low control) *100%) . Then the data were analyzed either by fitting a 4-parameter logistic model or by Excel to calculate EC50 values. And the EC50 was the concentration at 50%Activation on the curve.
The structure of reference compound:
The p53 (Y220C) EC50 (μM) values of some example compounds of the present invention were shown in the following table.
Table 1

2. Cell viability assay.
Cells were collected and counted. A desired number of cells was seeded into 96-well microplate and cultured in 37 ℃ cell incubator overnight. Compounds dissolved in cell culture medium were added into cell plate and cultured for 6 days. After balancing CellTiter-Glo reagent and cells at room temperature for 30 min, equal volume of CellTiter –Glo reagents was added to assay plate and shaken for 2 min for cell lysis. The cells were balanced at room temperature for 10 minutes and Luminescence signal was read using Envision. The percent of cell viability for compounds treated wells were normalized between High control and low control. Wells containing cell culture medium and same percentage DMSO served as Low control. Wells containing cells and same percentage DMSO served as High control. Cell viability (%) = (Luminescence readout Compound treated–Luminescence readout Low control) / (Luminescence readout High control –Luminescence readout Low control) *100%. Then the data were analyzed either by fitting a 4-parameter logistic model or by Excel to calculate IC50 values. And the IC50 was the concentration at 50%Cell viability on the curve.
3. Reporter gene assay
NUGC-3_P53_Luc single clonal cell line was established using pGL4.38 [luc2P/p53 RE/Hygro] Vector (E365A, promega) . NUGC-3_P53_Luc single clonal cells were cultured in 37 ℃ cell incubator before use. NUGC-3_P53_Luc cells were collected and washed twice with PBS to remove phenol red and then resuspended in medium to a proper concentration. Tested compound dilutions were transferred into 384 well assay plates (PerkinElmer) . A desired number of cells was seeded into the assay plate and cultured for 6 hours at 37℃ cell incubator. Britelite plus Luciferase Assay Reagent were added into each well and the luminescence value was recorded on Envision. The percent of activity value of compounds treated wells was normalized between high control and low control. Wells containing cells and Ref-1a (10μM) served as high control, and wells containing cells and same percentage of DMSO served as low control. Activity value (%) =(Luminescence readout Compound treated–Luminescence readout Low control) / (Luminescence readout High control –Luminescence readout Low control) *100%. Then the data were analyzed either by fitting a 4-parameter logistic model or by Excel to calculate EC50 values and the EC50 was the concentration at 50%Activity on the curve.
The EC50 (μM) values of some example compounds of the present invention were shown in the following table 3.
Table 3

Claims (67)

  1. A compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof:
    Y is selected from O, S, S=O, -S (=O) (=NR’) -or O=S=O;
    one of X1, X2, X3 and X4 is selected from CR2, and the others of X1, X2, X3 and X4 are each independently selected from N or CR4;
    X5 is selected from N or CR1;
    R1 is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl;
    R2 is -NR51R52, -OR53 or -SR54;
    R3 is selected from hydrogen, deuterium, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -S (O) R’, -S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents of R3a;
    each R3a is independently selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -S (=O) (=NR’) R’, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more substituents R3b,
    each R3b is independently selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2,  -S (O) 2R’, -S (O) 2N (R’) 2, -S (=O) (=NR’) R’, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2;
    R4 at each occurrence is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -S (=O) (=NR’) R’, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl or 5-12 membered heteroaryl;
    R51, R52, R53 and R54 are each independently selected from hydrogen, deuterium, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -S (O) R’, -S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, and 5-12 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, =NR’, -C1-6alkyl-CH (R’) 2, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, -S (O) R’, -S (O) N (R’) 2, -NR’S (O) R’, -NR’S (O) N (R’) 2, -S (O) 2R’, -S (O) 2N (R’) 2, -S (=O) (=NR’) R’, -NR’S (O) 2R’, -NR’S (O) 2N (R’) 2, -PO (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-12 membered aryl, 5-12 membered heteroaryl;
    R11 and R12 are independently selected from hydrogen, deuterium, -OH, halogen, -CN, oxo, -C1-6alkyl, -C1-6 haloalkyl, -C1-6alkoxy, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2 or 3-6 membered cycloalkyl; wherein said -C1-6alkyl, -C1-6alkoxy and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C1-6alkoxy, -NH-C1-6alkyl, -N (C1-4 alkyl) 2, or 3-6 membered cycloalkyl;
    R13 is selected from hydrogen, deuterium, -C1-6alkyl or 3-6 membered cycloalkyl; wherein said -C1-6alkyl and 3-6 membered cycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from deuterium, -OH, halogen, -CN, oxo, -C1-6alkoxy, -NH2, -NHC1-6alkyl, or -N (C1-4 alkyl) 2;
    each R’ at each occurrence is independently selected from hydrogen, deuterium, halogen, -OH, -CN, oxo, -NH2, -NHC1-6 alkyl, -N (C1-6 alkyl) 2, -C1-6alkyl, -C1-6alkylOC1-6alkyl, -C1-6alkyl-NHC1-6alkyl, -C1-6alkyl-N (C1-6alkyl) 2, -C1-6haloalkyl, -OC1-6alkyl, -C3-14cycloalkyl, -C3-14heterocycloalkyl, -C2-6alkenyl, -C2-6alkynyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl; wherein said -C1-6alkyl, -OC1-6alkyl, -C3-14cycloalkyl, -C3-14heterocycloalkyl, -C2-6alkenyl, -C2-6alkynyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, halogen, -CN, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl; or
    two adjacent R’, together with the atoms to which they are attached respectively, can form 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 3-12 membered heterocyclyl, 6-12 membered aryl, or 5-12 membered heteroaryl, each of which is independently optionally substituted with one or more substituents selected from deuterium, halogen, -CN, -C1-3alkyl, -C1-3haloalkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, 3-6 membered heterocyclyl, or 3-6 membered cycloalkyl;
    said heterocycloalkyl, heterocycloalkenyl, heterocyclyl and heteroaryl each independently contains 1, 2, 3, 4 or 5 heteroatoms selected from N, O, P or S;
    m is selected from 1, 2, 3, 4, 5 or 6.
  2. The compound according to claim 1, wherein,
    the formula (I) is:
    X2, X3, and X4 in the formula (I-1) are each independently selected from N or CR4;
    Y is selected from O, S, S=O, or O=S=O.
  3. The compound according to claim 1 or 2, wherein, the formula (I) is:
  4. The compound according to claim 1 or 2, wherein, the formula (I) is:
  5. The compound according to claim 1 or 2, wherein, the formula (I) is:
  6. The compound according to claim 1 or 2, wherein, the formula (I) is:
  7. The compound according to claim 1 or 2, wherein, the formula (I) is:
  8. The compound according to claim 1 or 2, wherein, the formula (I) is:
  9. The compound according to claim 1 or 2, wherein, the formula (I) is:
  10. The compound according to any one of claims 1 to 3, wherein,
    the formula (I) is selected from:

  11. The compound according to any one of claims 1 to 10, wherein, R1 is independently selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
  12. The compound according to any one of claims 1 to 11, wherein, R1 is independently selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, oxo, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
  13. The compound according to any one of claims 1 to 12, wherein, R1 is independently selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S.
  14. The compound according to any one of claims 1 to 12, wherein R1 is independently selected from -F, -Cl, -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S, or 6 membered heteroaryl containing 1 or 2 heteroatoms selected from N; said -C1-3alkyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 5 membered heteroaryl and 6 membered heteroaryl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
  15. The compound according to any one of claims 1 to 14, wherein R1 is independently selected from -C1-3alkyl; -C1-3haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C1-3alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
  16. The compound according to any one of claims 1 to 15, wherein, R1 is independently selected from 
  17. The compound according to any one of claims 1 to 16, wherein, R2 is -NR51R52.
  18. The compound according to any one of claims 1 to 17, wherein, R2 is -NHR51.
  19. The compound according to any one of claims 1 to 18, wherein, R51 is selected from -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, 5-6 membered heteroaryl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, oxo, =NR’, -C1-6alkyl-CH (R’) 2, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -OC (O) N (R’) 2, -N (R’) 2, -NR’C (O) R’, -NR’C (O) OR’, -NR’C (O) N (R’) 2, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, phenyl, or 5-6 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
  20. The compound according to any one of claims 1 to 19, wherein, R51 is selected from -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2 or 6 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2; said -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl and 6 membered heterocyclyl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, oxo, =NH, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
  21. The compound according to any one of claims 1 to 20, wherein, R51 is selected from -C1-6alkyl, 5 membered cycloalkyl, 5 membered heterocycloalkyl, 6 membered cycloalkyl, or 6 membered heterocycloalkyl; said -C1-6alkyl, cycloalkyl, and heterocycloalkyl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH (OH) CH2 (OH) , -CH (OCH3) CH2 (OH) , -CH (OH) CH2 (OCH3) , -CH2CH (OH) (OCH3) , -CH2CH (OH) (OCH2CH3) , -CH2CH (OCH3) 2, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -C (O) - (CH2) -NH2, -C (O) - (CH2) -NH (CH3) , -C (O) - (CH2) -NH (CH2CH3) , -C (O) - (CH2) -N (CH3) 2, -C (O) - (CH2CH2) -NH2, -C (O) - (CH2CH2) -NH (CH3) , -C (O) - (CH2CH2) -NH (CH2CH3) , -C (O) - (CH2CH2) -N (CH3) 2, -NH2, -NH (CH3) , -NH (CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , or -N (CH3) (CH2CH3) , said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
  22. The compound according to any one of claims 1 to 21, wherein, R51 is selected from or -C1-6alkyl, said -C1-6alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R5e;
    R5a, R5c and R5d are each independently selected from hydrogen; -C1-6alkyl; or -C1-6alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R5b and R5e are each independently selected from -F, -C1-6alkyl, oxo, -OC1-6alkyl, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-6alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl.
  23. The compound according to any one of claims 1 to 22, wherein, R51 is selected from or -C1-3alkyl-N (C1-3alkyl) 2;
    R5a is independently selected from -C1-3alkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R5b is independently selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2 or -CN;
    R5c and R5d are each independently selected from -C1-3alkyl.
  24. The compound according to any one of claims 1 to 22, wherein, R51 is selected from or -CH2CH2-N (CH3) 2;
    R5a is independently selected from methyl, -CH2CH (OH) OCH3 or -C (=O) CH2N (CH3) 2;
    R5b is independently selected from -F;
    R5c and R5d are each independently selected from methyl.
  25. The compound according to any one of claims 1 to 24, R51 is selected from
  26. The compound according to any one of claims 1 to 25, wherein R3 is independently selected from hydrogen, deuterium, halogen, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -NO2, -OR’, -SR’, -C (O) R’, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -N (R’) 2, -NR’C (O) R’, -S (O) R’, -NR’S (O) R’, -S (O) N (R’) 2, -S (O) 2R’, -NR’S (O) 2R’, -S (O) 2N (R’) 2, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl; said -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl at each occurrence is independently optionally substituted with one or more substituents selected from halogen, NH2, NH-C1-6alkyl, -C1-6alkyl, -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -NO2, -OR’, -SR’, -C (O) R’, oxo, -C (O) N (R’) 2, -C (O) OR’, -OC (O) R’, -N (R’) 2, -NR’C (O) R’, -S (O) R’, -NR’S (O) R’, -S (O) N (R’) 2, -S (O) 2R’, -NR’S (O) 2R’, -S (O) 2N (R’) 2, -S (=O) (=NR’) R’, 3-12 membered cycloalkyl, 3-12 membered cycloalkenyl, 3-12 membered heterocycloalkyl, 3-12 membered heterocycloalkenyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
  27. The compound according to any one of claims 1 to 25, wherein R3 is independently selected from phenyl, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R3c;
    R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -OC3-6cycloalkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NH) C3-6cycloalkyl; -S (=O) (=NC3-6cycloalkyl) C1-3alkyl; -S (=O) (=NC2-6heterocycloalkyl) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -S (=O) (=NCN) C1-3alkyl; or 3-6 membered cycloalkyl; wherein said C1-3alkyl, C3-6cycloalkyl, C2-6heterocycloalkyl or OC1-3alkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -CN, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
  28. The compound according to any one of claims 1 to 27, wherein R3 is independently selected from phenyl or pyridinyl.
  29. The compound according to any one of claims 1 to 28, wherein R3 is independently selected from phenyl, 5 membered heteroaryl, 6 membered heteroaryl ring; said phenyl and heteroaryl at each occurrence are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH2F, -CHF2, -CF3, -CH2CH2F, -CH2CHF2, -CH2CF3, -CHFCH3, -CF2CH3, -CHFCH2F, -CH2CHFCH3, -CH2CF2CH3, -CH2CH2CF3, -C (CH3) 2F, -CN, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -SH, -S-CH3, -S-CH2CH3, -S-CH2CH2CH3, -S-CH (CH3) 2, -CHO, -C (O) -CH3, -C (O) -CH2CH3, -C (O) -CH2CH2CH3, -C (O) -CH (CH3) 2, -C (O) NH2, -C (O) NH (CH3) , -C (O) NH (CH2CH3) , -C (O) N (CH3) 2, -C (O) NH (CH2CH2CH3) , -C (O) NH (CH (CH3) 2) , -C (O) N (CH3) (CH2CH3) , -NH2, -NH (CH3) , -NH (CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , -N (CH3) (CH2CH3) , -NHC (O) (CH3) , -NHC (O) (CH2CH3) , -NHC (O) (CH3) 2, -NHC (O) (CH2CH2CH3) , -NHC (O) (CH (CH3) 2) , -NHC (O) (CH3) (CH2CH3) , -S (O) 2H, -S (O) 2 (CH3) , -S (O) 2 (CH2CH3) , -S (O) 2 (CH3) 2, -S (O) 2 (CH2CH2CH3) , -S (O) 2 (CH (CH3) 2) , -S (O) 2 (CH3) (CH2CH3) , -S (O) 2NH2, -S (O) 2NH (CH3) , -S (O) 2NH (CH2CH3) , -S (O) 2N (CH3) 2, -S (O) 2NH (CH2CH2CH3) , -S (O) 2NH (CH (CH3) 2) , -S (O) 2N (CH3) (CH2CH3) , -S (=O) (=NH) CH3, or -S (=O) (=NCH3) CH3, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
  30. The compound according to any one of claims 1 to 29, R3 is independently selected from phenyl, 5 membered heteroaryl, or 6 membered heteroaryl; said phenyl and heteroaryl at each occurrence is independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -CH3, -CD3, -CH2CH3, -CH2CH2CH3, -CH (CH3) 2, -CH2F, -CF3, -CH2CH2F, -CHFCH3, -CF2CH3, -C (CH3) 2F, -OH, -O-CH3, -O-CH2CH3, -O-CH2CH2CH3, -O-CH (CH3) 2, -C (O) NH2, -C (O) NH (CH3) , -C (O) NH (CH2CH3) , -C (O) N (CH3) 2, -C (O) NH (CH2CH2CH3) , -C (O) NH (CH (CH3) 2) , -C (O) N (CH3) (CH2CH3) , -NH2, -NH (CH3) , -NH (CH2CH3) , -N (CH3) 2, -NH (CH2CH2CH3) , -NH (CH (CH3) 2) , -N (CH3) (CH2CH3) , -S (O) 2H, -S (O) 2 (CH3) , -S (O) 2 (CH2CH3) , -S (O) 2 (CH3) 2, -S (O) 2 (CH2CH2CH3) , -S (O) 2 (CH (CH3) 2) , -S (O) 2 (CH3) (CH2CH3) , -S (O) 2NH2, -S (O) 2NH (CH3) , -S (O) 2NH (CH2CH3) , -S (O) 2N (CH3) 2, -S (O) 2NH (CH2CH2CH3) , -S (O) 2NH (CH (CH3) 2) , -S (O) 2N (CH3) (CH2CH3) , -S (=O) (=NH) CH3, or -S (=O) (=NCH3) CH3, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 heteroatom selected from N, O, or S.
  31. The compound according to any one of claims 1 to 30, R3 is independently selected from 
  32. The compound according to any one of claims 1 to 31, the formula (I) is:
    wherein,
    R51 is selected from -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2 or 6 membered heterocyclyl containing 1 heteroatom selected from N, O, S, S (=O) , S (=O) (=NH) or S (=O) 2; said -C1-3alkyl, cyclopentyl, cyclohexyl, 5 membered heterocyclyl and 6 membered heterocyclyl are each independently optionally substituted with 1, 2 or 3 substituents selected from -F, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, oxo, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R1 is independently selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, 5-12 membered heteroaryl, said -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, and 5-12 membered heteroaryl are independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from -F, -Cl, -C1-3alkyl, -C2-4alkenyl, -C2-4alkynyl, -C1-3haloalkyl, -CN, oxo, 3-6 membered cycloalkyl, 3-6 membered heterocycloalkyl, 6-10 membered aryl, or 5-12 membered heteroaryl, said heterocycloalkyl, heterocycloalkenyl, and heteroaryl are each independently contains 1 or 2 heteroatoms selected from N or S;
    each of R4 is independently selected from hydrogen, deuterium, -F, -Cl, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R11 and R12 are independently selected from hydrogen, deuterium, -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-3alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R13 is selected from hydrogen; -C1-3alkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R3 is independently selected from phenyl, 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; said phenyl and 5-6 membered heteroaryl are independently optionally substituted with 1, 2, 3 substituents selected from R3c;
    R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2N (C1-3alkyl) 2; 3-6 membered cycloalkyl; or -C1-3alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -CN, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
  33. The compound according to claim 32, wherein,
    R51 is selected from or -C1-6alkyl, said -C1-6alkyl is optionally substituted with 1, 2, 3, 4, 5, or 6 R5e;
    R5a, R5c and R5d are each independently selected from hydrogen; -C1-6alkyl; or -C1-6alkyl substituted with 1, 2, 3, 4, 5 or 6 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R5b and R5e are each independently selected from -F, -C1-6alkyl, oxo, -OC1-6alkyl, -NH2, -NHC1-6alkyl, -N (C1-6alkyl) 2, -CN or 3-6 membered cycloalkyl, wherein, said -C1-6alkyl is optionally substituted with 1, 2, 3 or 4 substituents selected from -F, -C1-3alkyl, oxo, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R1 is independently selected from -C1-3alkyl; -C1-3haloalkyl; 5 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; or -C1-3alkyl substituted with 1, 2 or 3 substituents selected from -F, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    each of R4 is independently selected from hydrogen, deuterium, -F, -Cl, -C1-3alkyl, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -CN or 3-6 membered cycloalkyl;
    R11 and R12 are independently selected from hydrogen or -C1-3alkyl;
    R13 is selected from hydrogen or -C1-3alkyl;
    R3 is independently selected from phenyl, said phenyl is independently optionally substituted with 1, 2, 3 substituents selected from R3c;
    R3c is selected from -F; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) CH3; or -S (=O) (=NCH3) CH3.
  34. The compound according to claim 33, wherein,
    R51 is selected from
    R1 is independently selected from
    each of R4 is hydrogen;
    R11 and R12 are independently selected from hydrogen;
    R13 is selected from hydrogen;
    R3 is independently selected from
  35. The compound according to any one of claims 1 to 34, wherein the formula (I) is:
  36. The compound according to claim 35, wherein R1 is independently selected from -C1-3haloalkyl; or -C1-3alkyl optionally substituted with 1, 2 or 3 substituents selected from -F, -CN, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2 or 3-6 membered cycloalkyl such as cyclopropyl.
  37. The compound according to claim 35 or 36, wherein R1 is independently selected from
  38. The compound according to any one of claims 35 to 37, wherein R2 is -NHR51.
  39. The compound according to any one of claims 35 to 38, wherein R51 is selected from -C1-6alkyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, or 3-10 membered heterocycloalkyl; said -C1-6alkyl, -C1-6haloalkyl, 3-6 membered cycloalkyl, or 3-10 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl, or 5-6 membered heterocycloalkyl optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl) , -C2-6alkenyl, -C2-6alkynyl, -C1-6haloalkyl, -CN, -OH, -NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) C1-6alkyl, -C (O) C1-6alkyl-NHC1-6alkyl, -C (O) C1-6alkyl-N (C1-6alkyl) 2, -C (O) NHC1-6alkyl, -C (O) N (C1-6alkyl) 2, -C (O) OC1-6alkyl, -OC (O) C1-6alkyl, -NHC1-6alkyl, -N (C1-6alkyl) 2, 3-6 membered cycloalkyl, or 3-12 membered heterocycloalkyl such as 5-12 membered spiro-heterocyclyl or bridged-heterocyclyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, or -OC1-6alkyl) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S.
  40. The compound according to any one of claims 35 to 39, wherein R51 is selected from -C1-6alkyl, 3-6 membered cycloalkyl, or 5-10 membered heterocycloalkyl such as 5-10 membered spiro-heterocyclyl or bridged-heterocyclyl; said -C1-6alkyl, 3-6 membered cycloalkyl, or 5-10 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, -OC1-6alkyl, or  ) , -CN, -OH, -NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) C1-6alkyl-NHC1-6alkyl, -C (O) C1-6alkyl-N (C1-6alkyl) 2, -NHC1-6alkyl, -N (C1-6alkyl) 2, 3-5 membered cycloalkyl, or 5-12 membered heterocycloalkyl such as 5-12 membered spiro-heterocyclyl or bridged-heterocyclyl (optionally substituted with one or more of halogen, -CN, oxo, =NH, -OH, or -OC1-6alkyl) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S.
  41. The compound according to any one of claims 35 to 40, wherein R51 is selected from -C1-3alkyl, cyclohexyl, or 6-8 membered heterocycloalkyl such as 6-8 membered spiro-heterocyclyl or bridged-heterocyclyl; said -C1-3alkyl, cyclohexyl, or 6-8 membered heterocycloalkyl are each independently optionally substituted with one or more (such as 1, 2, 3, 4, 5 or 6) substituents selected from halogen, -C1-6alkyl (optionally substituted with one or more of oxo, =NH, -OH, -OC1-6alkyl, or) , -CN, -OH, NH2, oxo, =NH, -OC1-6alkyl, -SC1-6alkyl, -C (O) CH2-NHC1-6alkyl, -C (O) CH2-N (C1-6alkyl) 2, -NHC1-6alkyl, -N (C1-6alkyl) 2, cyclopropyl, or 5-12 membered heterocycloalkyl (such as  ) , wherein said heterocycloalkyl independently contains one or more heteroatoms selected from N, O, or S, preferably R51 is
  42. The compound according to any one of claims 35 to 41, wherein R2 is selected from:

  43. The compound according to any one of claims 35 to 42, wherein R3 is independently selected from phenyl, 5-10 membered heterocycloalkenyl containing 1 or 2 heteroatoms selected from N, O or S, or 5-6 membered heteroaryl containing 1 or 2 heteroatoms selected from N, O or S; each of which is independently optionally substituted with 1, 2, 3 substituents selected from R3a;
    wherein R3a is selected from halogen; oxo; -C1-3alkyl; -OC1-3alkyl; -NH2; -NHC1-3alkyl; -N (C1-3alkyl) 2; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -C (=O) N (C1-3alkyl) 2; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NH) C3-6cycloalkyl; -S (=O) (=NH) C2-6heterocycloalkyl; -S (=O) (=NC3-6cycloalkyl) C1-3alkyl; -S (=O) (=NC2-6heterocycloalkyl) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -S (=O) (=NCN) C1-3alkyl; -N (C1-3alkyl) S (=O) 2C1-3alkyl; -PO (C1-3alkyl) 2; 3-6 membered cycloalkyl; 3-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, P or S; wherein said C1-3alkyl, OC1-3alkyl, 3-6 membered cycloalkyl, C3-6cycloalkyl, C2-6heterocycloalkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, halogen, -CN, -C1-3alkyl, oxo, -OH, -OC1-3alkyl, -NH2, -NHC1-3alkyl, -N (C1-3alkyl) 2, -COOH, -C (O) OC1-3alkyl, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , -C (=O) N (C1-3alkyl) 2, -S (=O) 2NH2, -S (=O) 2NH (C1-3alkyl) , -S (=O) 2C1-3alkyl, -S (=O) 2N (C1-3alkyl) 2, -S (=O) (=NH) C1-3alkyl, -S (=O) (=NC1-3alkyl) C1-3alkyl, or 3-6 membered cycloalkyl.
  44. The compound according to claim 43, wherein R3 is independently selected from phenyl and 5-10 membered benzoheterocycloalkyl containing 1 or 2 heteroatoms selected from N, O or S, each of which is optionally substituted with 1, 2, 3 substituents selected from R3a;
    wherein R3a is selected from -F; oxo; -OC1-3alkyl; -C (=O) NH2, -C (=O) NH (C1-3alkyl) ; -CN; -S (=O) 2NH2; -S (=O) 2NH (C1-3alkyl) ; -S (=O) 2NHC (=O) C1-3alkyl; -S (=O) 2N (C1-3alkyl) 2; -S (=O) 2C1-3alkyl; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -N (C1-3alkyl) S (=O) 2C1-3alkyl; -PO (C1-3alkyl) 2; 3-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, P or S; wherein said C1-3alkyl, OC1-3alkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -CN, oxo, -C1-3alkyl, -OH, -OC1-3alkyl, -N (C1-3alkyl) 2, -C (O) OC1-3alkyl, -C (=O) NH2, -C (=O) NH (C1-3alkyl) , or -C (=O) N (C1-3alkyl) 2.
  45. The compound according to claim 44, wherein R3 is independently selected from phenyl, pyridinyl, each of which is optionally substituted with 1, 2, 3 substituents selected from R3a;
    wherein R3a is selected from -F; oxo; -OC1-3alkyl; -C (=O) NHC1-3alkyl; -S (=O) 2NH2; -S (=O) 2NHC (=O) CH3; -S (=O) 2CH3; -S (=O) (=NH) C1-3alkyl; -S (=O) (=NC1-3alkyl) C1-3alkyl; -N (CH3) S (=O) 2CH3; -PO (C1-3alkyl) 2; morpholinyl or 5-6 membered heterocycloalkyl optionally containing 1, 2 or 3 heteroatoms selected from N, O, or P; wherein said C1-3alkyl, OC1-3alkyl or 3-6 membered heterocycloalkyl at each occurrence is independently optionally substituted with 1, 2, 3, 4, 5 or 6 substituents selected from deuterium, -F, -CN, oxo, -OH, -OCH3, -N (C1-3alkyl) 2, -C (O) OCH3, or -C (=O) NH2.
  46. The compound according to any one of claims 35 to 45, wherein R3 is independently selected from phenyl optionally substituted with 1, 2, 3 substituents selected from R3a;
    wherein R3a is selected from: -F, -OCH3, -OCD3, -OCF3, -OCH2CN, -OCH2CF3, -CH2F, -CHF2, -OCH2CH2OH, -OCH2CH2OCH3, -S (O) 2NH2, -S (O) 2NHCOCH3, -S (O) 2CH3, -S (=O) (=NH) CH3, -S (=O) (=NCH3) CH3, -N (CH3) S (=O) 2CH3, -C (O) NHCH3, -C (O) NHCH (COOCH3) CH2CH2CONH2, -PO (CH3) 2 , morpholinyl,

  47. The compound according to any one of claims 1 to 46, wherein both of R11 and R12 are hydrogen.
  48. The compound according to any one of claims 1 to 47, wherein R13 is H.
  49. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  50. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  51. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  52. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  53. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  54. The compound according to any one of claims 1 to 48, wherein the chemical moietyis selected from:
  55. A pharmaceutical composition, comprising a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of claims 1-59, and a pharmaceutically acceptable carrier, diluent, or excipient.
  56. Use of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of claims 1-59, or a pharmaceutical composition according to claim 60 in the manufacture of a medicament for the treatment of a disease or condition in a subject.
  57. The use according to claim 61, wherein the disease or condition is cancer, preferably solid tumor, e.g. advanced solid tumor.
  58. The use according to claim 62, wherein the cancer cell expresses the p53 mutant.
  59. The use according to claim 63, wherein the p53 mutant has a mutation at amino acid Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282, and/or a combination thereof.
  60. The use according to claim 63, wherein the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W, and/or a combination thereof, preferably Y220C.
  61. The use according to any one of claims 61 to 65, wherein the disease or condition is selected from the group consisting of ovarian cancer, breast cancer, lung cancer and/or a combination thereof.
  62. A method for treating a disease or condition related to p53 mutant protein, comprising administering to a subject a therapeutically effective amount of a compound of formula (I) , or a stereoisomer, tautomer, deuterated derivative, prodrug or pharmaceutically acceptable salt thereof according to any one of claims 1-59, or a pharmaceutical composition according to claim 60.
  63. The method according to claim 67, wherein the disease or condition is cancer, preferably solid tumor, e.g. advanced solid tumor.
  64. The method according to claim 68, wherein the cancer cell expresses the p53 mutant.
  65. The method according to claim 69, wherein the p53 mutant has a mutation at amino acid Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282, and/or a combination thereof.
  66. The method according to claim 69, wherein the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W, and/or a combination thereof, preferably Y220C.
  67. The method according to any one of claims 67 to 71, wherein the disease or condition is selected from the group consisting of ovarian cancer, breast cancer, lung cancer and/or a combination thereof.
PCT/CN2023/114172 2022-08-22 2023-08-22 Compounds targeting y220c mutant of p53 WO2024041503A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CNPCT/CN2022/113858 2022-08-22
CN2022113858 2022-08-22

Publications (1)

Publication Number Publication Date
WO2024041503A1 true WO2024041503A1 (en) 2024-02-29

Family

ID=90012517

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2023/114172 WO2024041503A1 (en) 2022-08-22 2023-08-22 Compounds targeting y220c mutant of p53

Country Status (1)

Country Link
WO (1) WO2024041503A1 (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109069481A (en) * 2016-02-19 2018-12-21 皮姆维制药公司 For restoring the method and compound of Mutation p53 function
WO2021061643A1 (en) * 2019-09-23 2021-04-01 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262541A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Companion diagnostic tool for mutant p53 reactivating compounds
WO2021262483A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262484A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Combination therapy for treatment of cancer
WO2023016434A1 (en) * 2021-08-10 2023-02-16 Jacobio Pharmaceuticals Co., Ltd. Compounds targeting mutant of p53

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109069481A (en) * 2016-02-19 2018-12-21 皮姆维制药公司 For restoring the method and compound of Mutation p53 function
WO2021061643A1 (en) * 2019-09-23 2021-04-01 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262541A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Companion diagnostic tool for mutant p53 reactivating compounds
WO2021262483A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. METHODS AND COMPOUNDS FOR RESTORING MUTANT p53 FUNCTION
WO2021262484A1 (en) * 2020-06-24 2021-12-30 Pmv Pharmaceuticals, Inc. Combination therapy for treatment of cancer
WO2023016434A1 (en) * 2021-08-10 2023-02-16 Jacobio Pharmaceuticals Co., Ltd. Compounds targeting mutant of p53

Similar Documents

Publication Publication Date Title
ES2930804T3 (en) RHO-associated protein kinase inhibitor, pharmaceutical composition that comprises it, as well as method of preparation and use thereof
JP6692836B2 (en) Naphthyridine compounds as JAK kinase inhibitors
ES2753260T3 (en) Derivatives of fused tricyclic benzimidazoles as modulators of TNF activity
WO2022184178A1 (en) Kras g12d inhibitors
ES2735750T3 (en) Condensed imidazole and pyrazole derivatives as modulators of TNF activity
ES2386828T3 (en) Quinoline derivatives and their use as 5-HT6 ligands
CN110582491B (en) Rho-related protein kinase inhibitor, pharmaceutical composition containing Rho-related protein kinase inhibitor, and preparation method and application of Rho-related protein kinase inhibitor
WO2022105855A1 (en) Kras g12d inhibitors
US9890168B2 (en) 2,4-disubstituted 7H-pyrrolo[2,3-d]pyrimidine derivative, preparation method and medicinal use thereof
WO2021057832A1 (en) Kras mutant protein inhibitor
KR102442235B1 (en) Fused pentacyclic imidazole derivatives
ES2724578T3 (en) Certain protein kinase inhibitors
WO2021088945A1 (en) Compound as shp2 inhibitor and use thereof
AU2014400628A1 (en) Aminopyridazinone compounds as protein kinase inhibitors
EP3202767B1 (en) Azabicyclo derivatives, process for preparation thereof and medical use thereof
WO2017202390A1 (en) Heterocyclic compound serving as fgfr4 inhibitor
WO2023016434A1 (en) Compounds targeting mutant of p53
WO2022213975A1 (en) Compounds targeting y220c mutant of p53
TW202328124A (en) 1,4-oxazepane derivatives and uses thereof
AU2020390378A1 (en) Tri-heterocyclic compound as JAK inhibitor, and use thereof
AU2020270303B2 (en) Compound used as kinase inhibitor and application thereof
WO2022121981A1 (en) Novel camptothecin derivative, composition containing same, and use thereof
WO2024041503A1 (en) Compounds targeting y220c mutant of p53
WO2023205595A2 (en) Egfr inhibitors in cancer treatment
WO2022174765A1 (en) Fused ring compound as wee-1 inhibitor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23856593

Country of ref document: EP

Kind code of ref document: A1