WO2024040156A2 - Novel cyclic gamma aapeptide pan-coronavirus inhibitor and method of treating coronavirus infection - Google Patents

Novel cyclic gamma aapeptide pan-coronavirus inhibitor and method of treating coronavirus infection Download PDF

Info

Publication number
WO2024040156A2
WO2024040156A2 PCT/US2023/072368 US2023072368W WO2024040156A2 WO 2024040156 A2 WO2024040156 A2 WO 2024040156A2 US 2023072368 W US2023072368 W US 2023072368W WO 2024040156 A2 WO2024040156 A2 WO 2024040156A2
Authority
WO
WIPO (PCT)
Prior art keywords
cov
coronavirus
sars
infection
hcov
Prior art date
Application number
PCT/US2023/072368
Other languages
French (fr)
Other versions
WO2024040156A3 (en
Inventor
Jianfeng Cai
Shibo Jiang
Lu LU
Songyi XUE
Xinling Wang
Lei Wang
Wei Xu
Shuai XIA
Original Assignee
University Of South Florida
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of South Florida, Fudan University filed Critical University Of South Florida
Publication of WO2024040156A2 publication Critical patent/WO2024040156A2/en
Publication of WO2024040156A3 publication Critical patent/WO2024040156A3/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/12—Cyclic peptides, e.g. bacitracins; Polymyxins; Gramicidins S, C; Tyrocidins A, B or C

Definitions

  • This invention relates to treatment and/or prevention of coronavirus infection. Specifically, the invention provides a novel cyclic y-AApeptide-based fusion inhibitor and associated method of preventing and/or treating a respiratory virus such as SARS CoV2.
  • Coronaviruses consist of four genera: Alphacoronavirus (a), Betacoronavirus (P), Gammacoronavirus (y) and Deltacoronavirus (5). 7 Two Alphacoronaviruses (HCoV-NL63 and HCoV-229E) and 5 Betacoronaviruses, including low pathogenic CoVs (HCoV-OC43, HCoV- HKU1 ) and 3 high pathogenic CoVs (SARS-CoV, MERS-CoV, and SARS-CoV-2) can infect humans.
  • SARS-CoV-2 neutralizing antibodies generally target RBD in S1 subunit. 18 21 However, nAbs lack oral bioavailability and lose neutralizing activity against SARS-CoV-2 variants that escape immune surveillance.
  • pan-CoV fusion inhibitors such as EK1 peptide and EK1 C4 lipopeptide, targeting the heptad repeat 1 (HR1 ) domain in S2 subunit of SARS- CoV-2 S protein with highly potent antiviral activity against all HCoVs tested, 22 - 23 demonstrating the potential of using S protein to develop pan-antiviral inhibitors, de Vries et al. 24 synthesized a dimeric lipopeptide [SARSHRc-PEG4]2-chol, and with daily intranasal administration to SARS-CoV-2 ferrets, it could completely prevent SARS-CoV-2 direct-contact transmission with limited toxicity.
  • these peptides Despite providing excellent inhibitory against SARS-CoV-2 virus and broad-spectrum antiviral activity, 22 - 23 - 25 however, these peptides generally suffer from low enzymatic stability and poor oral bioavailability.
  • OBTC one-bead-two- compound
  • the receptor-binding domain (RBD) in S1 subunit and heptad repeat 1 (HR1 ) domain in S2 subunit of SARS-CoV-2 spike (S) protein are the targets of neutralizing antibodies (nAbs) and pan-coronavirus (CoV) fusion inhibitory peptides, respectively.
  • nAbs neutralizing antibodies
  • CoV pan-coronavirus
  • neither nAb- nor peptide-based drugs can be used orally.
  • the inventors screened a one-bead-two-compound (OBTC) cyclic y-AApeptide library against SARS-CoV-2 spike protein and identified a hit: S- 20 with potent membrane fusion inhibitory activity, but moderate selectivity index (SI).
  • OBTC one-bead-two-compound
  • S-20-1 After modification, one derivative, S-20-1 , exhibited improved fusion inhibitory activity and SI (>1000). S-20-1 effectively inhibited infection by pseudotyped and authentic SARS-CoV-2 and pseudotyped variants of concern (VOCs), including B.1 .617.2 (Delta) and B.1 .529 (Omicron), as well as MERS-CoV, SARS-CoV, HCoV-OC43, HCoV-229E, and HCoV-NL63. It could also inhibit infection of a pseudotyped SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ) from bats.
  • VOCs pseudotyped SARS-CoV-2 and pseudotyped variants of concern
  • S-20-1 also demonstrated excellent in vivo efficacy and good in vivo safety profiles in mice. Intranasal application of S-20-1 to mice before or after challenge with HCoV-OC43 or SARS- CoV-2 provided significant protection from infection. Importantly, S-20-1 was highly resistant to proteolytic degradation, had long half-life, and possessed favorable oral bioavailability. Mechanistic studies suggest that S-20-1 binds with high affinity to RBD in S1 and HR1 domain in S2 of SARS-CoV-2 S protein.
  • S-20-1 is a potential candidate for further development as a novel therapeutic and prophylactic drug against infection by SARS-CoV-2 and its variants, as well as future emerging and reemerging CoVs.
  • the compound may be selected from the group consisting of the compounds S-13, S-20, S- 23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof. In some embodiments, the compound may be selected from the group consisting of S-20, S- 20-1 , derivatives, and isomers thereof.
  • a method of treating a coronavirus infection in a patient in need thereof comprising: administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to treat the coronavirus infection of the patient.
  • the compound is S-20 or S-20-1 .
  • the coronavirus may be selected from the group consisting of severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), severe acute respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof.
  • SARS-CoV-1 severe acute respiratory syndrome coronavirus 1
  • SARS CoV-2 severe acute respiratory syndrome coronavirus 2
  • MERS-CoV Middle East respiratory syndrome coronavirus
  • HcoV-OC43 human coronavirus HKU1
  • HKU1 HKU1
  • HcoV-NL63 human coron
  • the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof.
  • the variants may be selected from the group consisting of B.1.1.7 (Alpha), B.1.351 (Beta), B.1.1.248 (Gamma), B.1.617.2 (Delta), and B.1 .1 .529 (Omicron).
  • the composition is administered orally.
  • a method of preventing a coronavirus infection in a patient in need thereof comprising: prophylactically administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to prevent the coronavirus infection of the patient.
  • the compound is S-20 or S-20-1 .
  • the coronavirus may be selected from the group consisting of severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), severe acute respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof.
  • SARS-CoV-1 severe acute respiratory syndrome coronavirus 1
  • SARS CoV-2 severe acute respiratory syndrome coronavirus 2
  • MERS-CoV Middle East respiratory syndrome coronavirus
  • HcoV-OC43 human coronavirus HKU1
  • HKU1 HKU1
  • HcoV-NL63 human coron
  • the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof.
  • the variants may be selected from the group consisting of B.1.1.7 (Alpha), B.1.351 (Beta), B.1.1.248 (Gamma), B.1.617.2 (Delta), and B.1 .1 .529 (Omicron).
  • the composition is administered orally.
  • kits for treating or preventing coronavirus infection comprising: a composition comprising a therapeutically effective amount of at least one cyclic y AApeptide pan-CoV fusion inhibitor and a pharmaceutically acceptable carrier and instructions for use of the composition.
  • the at least one cyclic y AApeptide pan-CoV fusion inhibitor may be selected from compounds S-1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-11 , S-12, S-13, S-14, S-15, S-16, S-17, S-18, S-19, S-20, S-21 , S-22, S-23, S-24, S-25, S- 26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, derivatives, and isomers thereof.
  • the at least one cyclic y AApeptide pan-CoV fusion inhibitor may be selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof.
  • the compound is S-20 or S-20-1 .
  • FIG. 1 is an image depicting the proposed mechanism of action of S-20-1 against SARS-CoV- 2 infection.
  • SARS-CoV-2 The entry of SARS-CoV-2 into the host cell is initiated by binding of RBD in S1 subunit of S protein to ACE2 (the receptor of SARS-CoV-2), which triggers the conformation change of S2 subunit of S protein and exposes the fusion intermediate structure consisting of HR1 , HR2, and fusion peptide (FP). Then, HR1 and HR2 interact with each other to form 6- HB, bringing the viral and host cell membranes together for fusion.
  • ACE2 the receptor of SARS-CoV-2
  • FP fusion peptide
  • S-20-1 is able to bind with RBD in S1 subunit and HR1 in S2 subunit to block viral attachment and fusion, respectively.
  • S-20-1 also has oral bioavailability like PaxlovidTM, noted above, which targets the intracellular main protease (MP ro ).
  • MP ro the intracellular main protease
  • S-20-1 is superior to peptide- and lipopeptide-based pan-CoV fusion inhibitors because it is much more resistant to proteolytic enzymes and has a longer half-life than EK1 , as well as good oral bioavailability. Therefore, S-20-1 has better potential to be developed as an orally usable drug for treatment of SARS-CoV infection.
  • FIG. 2 is a flow chart depicting preparation of the cyclic y-AApeptides library.
  • FIG. 3A-B are images depicting a library developed for inhibitors targeting SARS-CoV-2 S protein
  • FIG. 4 is a representative picture of beads for screening.
  • the bright green bead is the positive bead picked up manually.
  • FIG. 5 is a series of chemical structures of cyclic y-AApeptide compounds S-1 to S-43. Structures highlighted in red are the seven lead compounds shown in Fig. 6c.
  • FIG. 6A-B are a series of images depicting screening for SARS-CoV-2 fusion and entry inhibitors from a cyclic y-AApeptide library. Inhibition of cell-cell fusion mediated by the S protein of SARS-CoV-2 by putative hits at 50 pM (a) and 5 pM (b). The dot line in figures means the inhibition rate of 50% (a) and 80% (b).
  • FIG. 6C is a series of chemical structures of seven hits with inhibitory effect against SARS- CoV-2 S-mediated cell-cell fusion.
  • FIG. 6D-E are a series of images depicting screening for SARS-CoV-2 fusion and entry inhibitors from a cyclic y-AApeptide library, (d) Inhibitory activity of hits (S-13, S-20, S-23, S- 24, S-25, S-30, and S-32) from SARS-CoV-2 pseudovirus infection assay, (e) Cytotoxicity of hits (S-13, S-20, S-23, S-24, S-25, S-30, and S-32) on Huh-7 cells.
  • FIG. 7A is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI. (a) Chemical structures of four modified hits.
  • FIG. 7B is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI.
  • FIG. 7C-D are a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI.
  • FIG. 7E is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI.
  • FIG. 8A-B are a series of graphs depicting cytotoxicity of S-20-1 on (a) Huh-7 and (b) Caco-2 cells.
  • FIG. 8C is a graph depicting cytotoxicity of S-20-1 on RD cells.
  • FIG. 9A-B are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (a) B.1 .1 .7 (Alpha), (b) B.1 .351 (Beta), FIG. 9C-D are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (c) P.1 (Gamma), (d) C.37 (Lambda),
  • FIG. 9E-F are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (e) B.1 .617.2 (Delta), (f) B.1 .1 .529 (Omicron),
  • FIG. 9G-H are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (g) mutant with N501Y, K417N, and E484K mutation. Inhibition of infection by PsV of SARS-variants on Caco-2 cells: (h) B.1 .1 .7 (Alpha).
  • FIG. 91-J are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS-variants on Caco-2 cells: (i) B.1.351 (Beta), (j) B.1.617.2 (Delta).
  • FIG. 9K is an image depicting inhibition of S-20-1 against infection by pseudotyped SARS- CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS-variants on Caco- 2 cells: (k) B.1.1.529 (Omicron).
  • Figure 10A-B are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (a) SARS-CoV-2; (b) SARS-CoV.
  • FIG. 10C-D are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (c) MERS-CoV; (d) HCoV-229E..
  • FIG. 10E-F are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (e) HCoV-NL63. Inhibitory activity of S-20-1 against infection of pseudotyped (f) SARS-CoV.
  • FIG. 10G-H are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of pseudotyped (g) MERS-CoV; (h) HCoV-229E.
  • FIG. 101-J are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of pseudotyped (i) HCOV-NL63 and (j) SARr-CoV W1 V1 .
  • FIG. 10K-L are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of authentic (k) HCoV- OC43 and (I) HCoV-229E. RD cells and Huh-7 cells were infected with (k) HCoV-OC43 and (I) HCoV-229E, respectively.
  • Figure 11A-F are a series of images depicting prevention and treatment effect of S-20-1 against mouse infection by HCoV-OC43 and SARS-CoV-2 Delta variant,
  • Viral RNA expression level after incubation of S-20-1 with authentic SARS-CoV-2 Delta on Caco-2 cells e.
  • Figure 12A-C are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry,
  • Huh-7 cells were pretreated with S-20-1 at 50 gM at 37 °C for 1 h, washed with PBS to remove unbound S-20-1 , and infected with SARS-CoV-2 at 37 °C.
  • Huh-7 and RD cells were treated with S-20-1 at the indicated time points before or after addition of pseudotyped SARS-CoV-2 (b).
  • Supernatants containing free S-20-1 and viral particles were removed 12 h later.
  • Figure 12D-E are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry.
  • Huh-7 and RD cells were treated with S-20-1 at the indicated time points before or after addition of authentic HCoV-0043 (d).
  • Supernatants containing free S-20-1 and viral particles were removed 12 h later.
  • a series of well-established assays were performed to confirm the stage at which S-20-1 blocked entry of SARS-CoV-2 or HCoV-OC43 into target cells. Data were analyzed with One-way ANOVA (a) and Two-way ANOVA (c, e). NS means no significance.
  • Figure 12F-K are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry. Affinity of binding between S-20 and S1 (f), S-20-1 and S1 (g), S-20 and RBD (h), S-20-1 and RBD (i), S-20 and HR1 (j), or S-20-1 and HR1 (k), was determined by fluorescence polarization.
  • Figure 13 are chemical structures of FITC-labeled cyclic y-AApeptides S-20 and S-20-1 .
  • Figure 14A-D are a series of images depicting HPLC analytic trace of S-20 (a), S-20-1 (b), FITC-S-20 (c) and FITCS-20-1 (d).
  • Figure 15A-B are a series of graphs depicting binding affinity of (a) S-20 and (b) S-20-1 to HR2 protein measured by fluorescence polarization (FP) assay.
  • Figure 16A-D are a series of images depicting the chemical structure of S-20 and molecular docking analysis of the interaction between S-20 and its potential target sites.
  • Side chains of S-20 are designated by a (chiral side chain) or b (acyl side chain) in each AApeptide building block, respectively.
  • Residues of HR1 from different helical chains are shown in red, black, and purple, respectively.
  • Figure 17A-D are a series of images depicting evaluation of the stability of sequences in various proteolytic enzymes. Metabolic stability of S-20-1 in proteinase K (a) and trypsin (b). Analytic HPLC traces of S-20-1 before (c) and after (d) incubation with Pronase (0.1 mg/ml).
  • IP intraperitoneal
  • OP oral administration
  • Figure 19A-C are a series of images depicting standard calibration curve for low concentration (5 ng/ml to 1000 ng/ml) (a) and high concentration (1 gg/ml to 50 gg/ml) (b). The concentration of S-20-1 at different time points (c).
  • Figure 20A-C are a series of images depicting the in vivo safety evaluation of S-20-1.
  • (a) Flow diagram of in vivo safety experiments,
  • a nanoparticle includes “nanoparticles” or “plurality of nanoparticles”.
  • compositions, and methods are intended to mean that the products, compositions, and methods include the referenced components or steps, but not excluding others.
  • Consisting essentially of when used to define products, compositions, and methods, shall mean excluding other components or steps of any essential significance. Thus, a composition consisting essentially of the recited components would not exclude trace contaminants and pharmaceutically acceptable carriers. “Consisting of” shall mean excluding more than trace elements of other components or steps.
  • patient is used to describe a mammal, preferably a human, to whom treatment is administered, including prophylactic treatment with the compositions of the present invention.
  • mammals include humans, rodents, aquatic mammals, domestic animals such as dogs and cats, farm animals such as sheep, pigs, cows and horses.
  • “Patient” and “subject” are used interchangeably herein.
  • administering refers to the process by which the compositions of the present invention are delivered to the patient.
  • the compositions may be administered in various ways, including but not limited to, orally, nasally, and parenterally.
  • Parenteral administration refers to modes of administration other than enteral and topical administration, usually by injection, and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, intrathecal, intraventricular, intracisternal, intranigral, subarachnoid, intraspinal, and intrasternal injection and infusion. Dosing can be by any suitable route, e.g., by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
  • a “therapeutic agent” as used herein refers to a substance, composition, compound, chemical, component or extract that has measurable specified or selective physiological activity when administered to an individual in a therapeutically effective amount.
  • the therapeutic agent may be a an antiviral composition.
  • therapeutic agents as used in the present invention include, but are not limited to, small molecules.
  • the small molecules may be cyclic y AApeptides.
  • cyclic y AApeptides include, but are not limited to, dual target fusion inhibitors such as compounds S- 1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-1 1 , S-12, S-13, S-14, S-15, S-16, S-17, S- 18, S-19, S-20, S-21 , S-22, S-23, S-24, S-25, S-26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, and derivatives and isomers thereof.
  • dual target fusion inhibitors such as compounds S- 1 , S-2, S-3, S-4, S-5, S-6, S-7,
  • At least one therapeutic agent is used in the compositions of the present invention, however in some embodiments, multiple therapeutic agents are used.
  • the novel cyclic y AApeptides described herein may be combined with another antiviral composition that targets a different area of the virus such as a composition targeting intracellular main protease (MP ro ) such as PAXLOVIDTM.
  • one or more therapeutic agents may be encapsulated within a nanoparticle.
  • a “therapeutically effective amount” as used herein is defined as concentrations or amounts of components which are sufficient to effect beneficial or desired clinical results, including, but not limited to, any one or more of treating symptoms of coronaviruses, particularly CoV-2 infection and preventing coronavirus infection, particularly CoV-2 infection.
  • Compositions of the present invention can be used to effect a favorable change in the condition whether that change is an improvement, such as stopping, reversing, or reducing CoV-2 infection, or a complete elimination of symptoms due to CoV-2 infection.
  • a suitable single dose size is a dose that is capable of preventing or alleviating (reducing or eliminating) a symptom in a patient when administered one or more times over a suitable time period.
  • One of skill in the art can readily determine appropriate single dose sizes for systemic administration based on the size of the animal and the route of administration.
  • the dose may be adjusted according to response.
  • the dosing of compounds and compositions to obtain a therapeutic or prophylactic effect is determined by the circumstances of the patient, as is known in the art.
  • the dosing of a patient herein may be accomplished through individual or unit doses of the compounds or compositions herein or by a combined or prepackaged or pre-formulated dose of a compounds or compositions.
  • the amount of the compound in the drug composition will depend on absorption, distribution, metabolism, and excretion rates of the drug as well as other factors known to those of skill in the art. Dosage values may also vary with the severity of the condition to be alleviated.
  • the compounds may be administered once, or may be divided and administered over intervals of time. It is to be understood that administration may be adjusted according to individual need and professional judgment of a person administrating or supervising the administration of the compounds used in the present invention.
  • the dose of the compounds administered to a subject may vary with the particular composition, the method of administration, and the particular disorder being treated.
  • the dose should be sufficient to affect a desirable response, such as a therapeutic or prophylactic response against a particular disorder or condition. It is contemplated that one of ordinary skill in the art can determine and administer the appropriate dosage of compounds disclosed in the current invention according to the foregoing considerations.
  • Dosing frequency for the composition includes, but is not limited to, at least about once every three weeks, once every two weeks, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, or daily.
  • the interval between each administration is less than about a week, such as less than about any of 6, 5, 4, 3, 2, or 1 day.
  • the interval between each administration is constant.
  • the administration can be carried out daily, every two days, every three days, every four days, every five days, or weekly.
  • the administration can be carried out twice daily, three times daily, or more frequently.
  • Administration can also be continuous and adjusted to maintaining a level of the compound within any desired and specified range.
  • the administration of the composition can be extended over an extended period of time, such as from about a week or shorter up to about a year or longer.
  • the dosing regimen can be extended over a period of any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , and 12 months.
  • the interval between each administration is no more than about a week.
  • the compounds used in the present invention may be administered individually, or in combination with or concurrently with one or more other compounds used against viruses, including coronaviruses such as SARS CoV-2. Additionally, compounds used in the present invention may be administered in combination with or concurrently with other therapeutics for coronaviruses or other respiratory viruses.
  • Prevention or “preventing” or “prophylactic treatment” as used herein refers to any of: halting the effects of coronavirus infection, reducing the effects of coronavirus infection, reducing the incidence of coronavirus infection, reducing the development of coronavirus infection, delaying the onset of symptoms of coronavirus infection, increasing the time to onset of symptoms of coronavirus infection, and reducing the risk of development of coronavirus infection.
  • the coronavirus infection is SARS CoV-2.
  • Treatment refers to any of the alleviation, amelioration, elimination and/or stabilization of a symptom, as well as delay in progression of a symptom of a particular disorder.
  • treatment may include any one or more of the following: amelioration and/or elimination of one or more symptoms associated with coronavirus infection, reduction of one or more symptoms of coronavirus infection, stabilization of symptoms of coronavirus infection, and delay in progression of one or more symptoms of coronavirus infection.
  • the coronavirus infection is SARS CoV2.
  • “Infection” as used herein refers to the invasion of one or more microorganisms such as bacteria, viruses, fungi, yeast, or parasites in the body of a patient in which they are not normally present.
  • the infection is from a respiratory virus such as a respiratory syncytial virus, Influenza virus, or coronavirus.
  • the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).
  • coronaviruses contemplated herein include, but are not limited to, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV- HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), porcine deltacoronavirus (PDCoV) (porcine), infectious bronchitis virus (IBV, avian), and other coronaviruses of pandemic potential including Alphacoronavirus, Betacoronavirus, Deltacoronavirus, duvinacovirus, Embecovirus, Gammacoronavirus, Merbecovirus, Nobecovirus and Sarbecovirus.
  • SARS-CoV-1 severe acute respiratory syndrome coronavirus 1
  • MERS-CoV Middle East respiratory syndrome coronavirus
  • VOCs Variations of concern
  • B.1.1.7 Alpha
  • Beta Beta
  • B.1.1.248 Gamma
  • B.1.617.2 Delta
  • B.1.1.529 Omicron
  • Future coronaviruses and reemerging coronaviruses are also contemplated for use with the therapeutic agents described herein.
  • the pharmaceutical compositions of the subject invention can be formulated according to known methods for preparing pharmaceutically useful compositions.
  • pharmaceutically acceptable carrier means any of the standard pharmaceutically acceptable carriers.
  • the pharmaceutically acceptable carrier can include diluents, adjuvants, and vehicles, as well as implant carriers, and inert, non-toxic solid or liquid fillers, diluents, or encapsulating material that does not react with the active ingredients of the invention. Examples include, but are not limited to, phosphate buffered saline, physiological saline, water, and emulsions, such as oil/water emulsions.
  • the carrier can be a solvent or dispersing medium containing, for example, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
  • Formulations are described in a number of sources that are well known and readily available to those skilled in the art. For example, Remington’s Pharmaceutical Sciences (Martin EW [1995] Easton Pennsylvania, Mack Publishing Company, 19 th ed.) describes formulations which can be used in connection with the subject invention.
  • the subject compounds may be formulated into various pharmaceutical forms.
  • compositions there may be cited all compositions usually employed for systemically or topically administering drugs.
  • a pharmaceutically acceptable carrier which may take a wide variety of forms depending on the form of preparation desired for administration.
  • These pharmaceutical compositions are desirably in unitary dosage form suitable, preferably, for administration nasally, orally, rectally, percutaneously, or by parenteral injection.
  • any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs and solutions; or solid carriers such as starches, sugars, kaolin, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules and tablets. Because of their ease in administration, tablets and capsules often represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed.
  • the carrier will usually comprise sterile water, at least in large part, though other ingredients, for example, to aid solubility, may be included.
  • injectable solutions for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution.
  • a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g. each enantiomer and diastereomer, and a mixture of isomers, such as racemic or scalemic mixture.
  • Compounds described herein can contain one or more asymmetric centers and, thus potentially give rise to diastereomers and optical isomers.
  • the present invention includes all such possible diastereomers as well as their racemic mixtures, their substantially pure resolved enantiomers, all possible geometric isomers, and pharmaceutically acceptable salts thereof. Mixtures of stereoisomers, as well as isolated specific stereoisomers, are also included.
  • structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, optical, and geometric (or conformational)) forms of the structure or a form thereof (including salts, solvates, esters, and prodrugs and transformed prodrugs thereof); for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms.
  • isomeric e.g., enantiomeric, diastereomeric, optical, and geometric (or conformational)
  • the compounds described herein or a form thereof described herein may include one or more chiral centers, and as such may exist as racemic mixtures (R/S) or as substantially pure enantiomers and diastereomers.
  • the compounds may also exist as substantially pure (R) or (S) enantiomers (when one chiral center is present).
  • the compounds described herein or a form thereof described herein are (S) isomers and may exist as enantiomerically pure compositions substantially comprising only the (S) isomer.
  • the compounds described herein or a form thereof described herein are (R) isomers and may exist as enantiomerically pure compositions substantially comprising only the (R) isomer.
  • the compounds described herein or a form thereof described herein may also exist as a (R,R), (R,S), (S,R) or (S,S) isomer, as defined by IUPAC Nomenclature Recommendations.
  • the term “substantially pure” refers to compounds described herein or a form thereof consisting substantially of a single isomer in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99%, or in an amount equal to 100% of the single isomer.
  • the term “racemate''” refers to any mixture of isometric forms that are not “enantiomerically pure”, including mixtures such as, without limitation, in a ratio of about 50/50, about 60/40, about 70/30, or about 80/20, about 85/15 or about 90/10.
  • All stereoisomers for example, geometric isomers, optical isomers and the like
  • the present compounds described herein or a form thereof including salts, solvates, esters and prodrugs and transformed prodrugs thereof
  • which may exist due to asymmetric carbons on various substituents including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, diastereomeric and regioisomeric forms, are contemplated within the scope of the description herein.
  • Individual stereoisomers of the compounds described herein or a form thereof described herein may, for example, be substantially free of other isomers, or may be present in a racemic mixture, as described supra.
  • Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization. Enantiomers can be separated by use of a chiral HPLC column or other chromatographic methods known to those skilled in the art.
  • Enantiomers can also be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Masher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers.
  • an appropriate optically active compound e.g., chiral auxiliary such as a chiral alcohol or Masher's acid chloride
  • isotopologue refers to isotopically-enriched compounds described herein or a form thereof which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
  • One or more compounds described herein or a form thereof described herein may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and the description herein is intended to embrace both solvated and unsolvated forms
  • solvate means a physical association of a compound described herein or a form thereof described herein with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. As used herein, “solvate” encompasses both solution-phase and isolatable solvates.
  • compound refers to a chemical formulation, either organic or inorganic, that induces a desired pharmacological and/or physiological effect on a subject when administered in a therapeutically effective amount.
  • “Compound” is used interchangeably herein with “drug” and “therapeutic agent”.
  • salts denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases.
  • pharmaceutically acceptable salt(s) means those salts of compounds disclosed or a form thereof described herein that are safe and effective (i. e., nontoxic, physiologically acceptable) for use in mammals and that possess biological activity, although other salts are also useful. All such acid salts and base salts are intended to be included within the scope of pharmaceutically acceptable salts as described herein. In addition, all such acid and base salts are considered equivalent to the free forms of the corresponding compounds for purposes of this description.
  • salt is intended to apply equally to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates, isotopologues or prodrugs of the instant compounds.
  • substituent means positional variables on the atoms of a core molecule that are attached at a designated atom position, replacing one or more hydrogen atoms on the designated atom, provided that the atom of attachment does not exceed the available valence or shared valence, such that the substitution results in a stable compound. Accordingly, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. Any carbon atom as well as heteroatom with a valence level that appears to be unsatisfied as described or shown herein is assumed to have a sufficient number of hydrogen atom (s) to satisfy the valences described or shown.
  • the term "and the like,” with reference to the definitions of chemical terms provided herein, means that variations in chemical structures that could be expected by one skilled in the art include, without limitation, isomers (including chain, branching or positional structural isomers), hydration of ring systems (including saturation or partial unsaturation of monocyclic, bicyclic or polycyclic ring structures) and all other variations where allowed by available valences which result in a stable compound.
  • SARS-CoV-2 S protein consists of several important targets for the development of viral fusion and entry inhibitors. 32 For example, neutralizing antibodies (nAbs) and other proteins inhibit SARS-CoV-2 infection by binding RBD in S1 subunit and blocking viral attachment to the receptor on the host cell. 18 21 Peptides derived from the HR2 domain, such as 2019-nCoV- HR2P, suppress SARS-CoV-2 fusion and entry by interacting with the HR1 in S2 subunit and interfering with the interaction between HR1 and HR2 to form the fusion-active 6-HB. 40
  • pan-CoV fusion inhibitors such as EK1 peptide and EK1 C4 lipopeptide, targeting the HR1 domain in S2 subunit of SARS-CoV-2 S protein with highly potent antiviral activity against all HCoVs tested. 22 - 23 Therefore, these peptide- based pan-CoV fusion inhibitors can be developed for intranasally applied therapeutics for treatment of SARS-CoV-2 infection. 37 However, their future clinical use may not be preferably selected because of their lack of oral bioavailability.
  • the inventors also previously established several cyclic y-AApeptide-based OBTC combinatorial libraries in which the cyclic y- AApeptides possess high proteolytic enzyme stability and potent biological activity. 26 ' 30 For example, several cyclic y-AApeptides were identified to target EphA2, EGFR and HER2 with excellent binding affinity and specificity. 27 - 30 ’ 31 Accordingly, the inventors sought to identify y- AApeptide-based pan-CoV fusion inhibitors with oral bioavailability.
  • the inventors have successfully identified cyclic y-AApeptide-based pan-CoV fusion and entry inhibitors with oral bioavailability. More specifically, a cyclic y-AApeptide-based OBTC combinatorial library was first screened against SARS-CoV-2 S protein and 43 active beads with SARS-CoV-2 S protein-mediated cell-cell fusion inhibitory activity at 50 pM were identified. Upon validation, seven potential hits were selected for further evaluation using SARS-CoV-2 PsV infection assay. The four best hits with better PsV inhibitory activity, including S-20, were selected for modification. The inventors found that one of the derivative compounds, S-20-1 , exhibited the most potent inhibitory activities against infection by pseudotyped and authentic SARS-CoV-2 and highest SI (>1 ,000).
  • S-20-1 is highly resistant to proteolytic degradation (showing no noticeable degradation up to 24 h when it was incubated with Pronase) and has a long half-life ( ⁇ 24 h) with oral administration, which is much longer than the that ( ⁇ 2 h) of nirmatrelvir through oral administration. 41
  • the inventors believe that the following two reasons may explain why S-20-1 with small size has a long half-life: 1 ) the unnatural backbones in y-AApeptides are highly resistant to enzymatic hydrolysis, and 2) the cyclization of y-AApeptides can rigidity functional groups to further increase stability towards proteolysis.
  • S-20-1 possesses favorable oral bioavailability with P app values of 30 10 ⁇ 6 cm/s.
  • S-20-1 may be used in combination therapies with other orally applicable COVID-19 drugs with different mechanism of action or targeting different proteins, such as MP ro inhibitors (e.g., Paxlovid). 42 These combinations may have synergistic effect and raise the genetic barrier to drug resistance.
  • MP ro inhibitors e.g., Paxlovid
  • S-20-1 acts at the early entry stage of the viral life cycle, including attachment, post-attachment stages and fusion stage, but not the post-entry stage. Further investigation demonstrated that S-20-1 has dual targets in S protein, including RBD in the S1 subunit and HR1 in S2 subunit, suggesting that it inhibited SARS-CoV-2 fusion with and entry into the host cell by binding with RBD to block its interaction with the ACE2 receptor on the host cell, just like neutralizing antibodies, and interacting with HR1 to interfere with fusion activity and 6-HB formation, just like EK1 (Fig. 1). Of course, it is impossible to allow one cyclic peptide to bind both RBD and HR1 at the same time because of its limit size.
  • the inventors propose different S-20-1 molecules may bind RBD and HR1 simultaneously or separately to inhibit viral infection.
  • HR1 is a highly conserved domain in S protein of HCoVs, providing the basis of broad-spectrum anti-HCoV activity of S-20-1 like the peptide-based pan-CoV fusion inhibitors EK1 and EK1 C4. 22 ’ 23 Moreover, as S-20-1 could potently bind with RBD and HR1 in the spike protein, it is hard to generate the drug resistance in the clinical application.
  • the inventors first constructed an OBTC combinatorial library comprised of thioether-bridge- mediated cyclic y-AApeptides as shown in Fig. 2 described in Shi et al. (2017) 27 , herein incorporated into this disclosure in its entirety. They contained a diverse and random set of hydrophobic and charged side chain units, resulting in a theoretical diversity of 320,000 compounds, with each compound being encoded by an 8-mer peptide (Fig. 3a).
  • the OBTC library was incubated with His-tag SARS-CoV-2 S protein, followed by incubation with Dylight 488 6x-His Tag Monoclonal Antibody (Fig. 3b). Putative positive beads were microscopically identified from the library pool (Fig. 4), and the encoding peptides were analyzed by tandem MS/MS of MALDI. The chemical structures of 43 putative hits were determined unambiguously (Fig. 5).
  • the inventors first assessed the inhibitory activity of these 43 putative hits in vitro using a SARS-CoV-2 S protein-mediated cell-cell fusion assay established in the lab. 22 - 23 ’ 25 Under 50- pM concentration, 29 hits exhibited more than 50% inhibition (Fig. 6a). To confirm inhibitory activity and select final hits for further investigation, these compounds were tested again at a 5-pM concentration (Fig. 6b), revealing seven compounds (S-13, S-20, S-23, S-24, S-25, S- 30, and S-32) still able to efficiently inhibit SARS-CoV-2 S-mediated cell-cell fusion (> 80%). To further validate these compounds (Fig.
  • PsV pseudovirus
  • S-20-1 With ICso of 0.8 pM and the CC50 of more than 800 pM, S-20-1 exhibited an exceptional SI (>1 ,000).
  • Fig. 8a Based on its performance, the inventors selected S-20-1 and tested its inhibitory activity against authentic SARS-CoV-2 infection of Caco-2 cells. As anticipated, S-20-1 effectively blocked authentic SARS-CoV-2 infection at the cellular level in a dose-dependent manner with an IC50 of 8.14 pM. (Fig. 7e), consistent with the results from the PsV infection assay. S-20-1 also exhibited low cytotoxicity on Caco-2 cells, with the CC50 of 692.7 pM (Fig.
  • S-20-1 was demonstrated to be a potent and highly selective inhibitor against SARS-CoV-2 infection (Fig. 7e, Table 2).
  • S-20-1 potently inhibited infection by pseudotyped B.1.1.7 (Fig. 9a), B.1.351 (Fig. 9b), P.1 (Fig. 9c), C.37 (Fig. 9d), B.1.617.2 (Fig. 9e), B.1.1.529 (Fig. 9f), and the mutant with N501Y, K417N and E484K mutations (Fig. 9g) in the Huh-7 cell line with IC50 values ranging from 0.54 to 10.23 pM.
  • the inventors also tested the anti-PsV activity of S-20-1 against some of the most virulent SARS-CoV-2 variants in Caco-2 cells. Its inhibitory activity was consistent with that for Huh-7 cells, revealing IC50 values ranging from 4.44 to 6.37 against B.1.1.7 (Fig. 9h), B.1 .351 (Fig. 9i), B.1 .617.2 (Fig. 9j) and B.1.1.529 (Fig. 9k). Together, S-20-1 exhibited broadspectrum inhibitory activity against predominant SARS-CoV-2 variants.
  • S-20-1 potently inhibited cell-cell fusion-mediated by S proteins of 5 HCoVs and blocked infection by 4 pseudotyped HCoVs and 1 pseudotyped bat SARSr-CoV, as well as 2 authentic HCoVs
  • S-20-1 As an analog of S-20, S-20-1 was expected to have strong binding affinity to S protein and have broad-spectrum antiviral activity against diverse HCoVs, including a-HCoV and -HCoV, since these HCoV share conserved regions in S protein.
  • SARS-CoV-2 Fig. 10a
  • SARS- CoV Fig. 10b
  • MERS-CoV Fig. 10c
  • HCoV-229E Fig. 10d
  • HCoV-NL63 Fig.
  • S-20-1 also exhibited potent inhibitory activity against infection of pseudotyped SARS-CoV (Fig. 10f), MERS-CoV (Fig. 10g), HCoV-229E (Fig. 10h), HCoV-NL63 (Fig. 10i), and bat SARSr-CoV WIV1 (Fig. 10j) with ICsos ranging from 1 .30 to 12.02 pM, consistent with the result of SARS-CoV-2 PsV (Fig. 7c), indicating that S-20-1 is a pan-CoV entry inhibitor.
  • pseudotyped SARS-CoV Fig. 10f
  • MERS-CoV Fig. 10g
  • HCoV-229E Fig. 10h
  • HCoV-NL63 Fig. 10i
  • bat SARSr-CoV WIV1 Fig. 10j
  • HCoV-OC43- infected mouse model To evaluate the protective effect of S-20-1 in vivo, the inventors first used an HCoV-OC43- infected mouse model to assess the prophylactic and therapeutic potential of S-20-1 as an antiviral agent (Fig. 11a).
  • S-20-1 was administered to newborn mice in prevention or treatment group via the intranasal route at a single dose of 80 mg/kg 0.5 h pre- or postchallenge with HCoV-OC43 at 100 TCID50, respectively.
  • mice At four days post-infection, mice were sacrificed, and brains were excised to evaluate viral load.
  • Fig. 11b relative HCoV-OC43 RNA level of both prevention and treatment group was significantly lower than that of non-treatment control group. Results showed that S-20-1 could effectively protect newborn mice from infection of HCoV-OC43.
  • the inventors then tested the protective efficacy of S-20-1 on SARS-CoV-2 Delta variant- infected hACE2-transgenic mouse model, C57BL/6-Tgtn (CAG-human ACE2- IRESLuciferaseWPRE-polyA) 37 as described before (Fig. 11c).
  • inhibitory activity was assessed against the SARS-CoV-2 Delta variant on Caco-2 cells in vitro, and viral load was significantly decreased about 2 logs (100-fold) at 50 pM concentration of S-20-1 (Fig. 11d).
  • S-20-1 was intranasally administered at the dose of 60 mg/kg to hACE2-transgenic mice (female, eight weeks old) 0.5 h before (prevention group) or after (treatment group) at 10,000 pfu of SARS-CoV-2 Delta variant via the intranasal route.
  • Viral load in the brain of mice in the prevention and treatment groups was 2.02 and 2.16 logs, respectively, lower than that in the non-treatment control group (Fig. 11e), while that in the lung of mice in the prevention and treatment groups was 2.5 logs and 2.3 logs, respectively, lower than that in the non-treatment control group (Fig. 11f). Therefore, intranasally administered S-20-1 exhibited prophylactic and therapeutic effect against SARS-CoV-2 Delta infection.
  • S-20-1 inhibited SARS-CoV-2 infection at the early stage of viral entry
  • the inventors To gain mechanistic insight of S-20-1 against SARS-CoV-2 infection, the inventors first used the time-of-removal assay to determine whether the inhibitory activity of S-20-1 resulted from binding to virus or host cell surface to block SARS-CoV-2 entry. S-20-1 were incubated with Huh-7 cells at 37 °C for 1 h and then cells were washed with PBS before SARS-CoV-2 was added. No inhibitory activity was observed after washing (Fig. 12a), suggesting that S-20-1 targets virus, not host cells. Next, S-20-1 was added to Huh-7 cells at different time points before, during, and after SARS-CoV-2 infection to determine affected stage of the viral life cycle. As shown in Fig.
  • S-20-1 exhibited more than 80% inhibition of SARS-CoV-2 infection when added 0.5 h before, at the same time (0 h), or 0.5 and 1 h after the addition of virus.
  • the inhibitory activity was then gradually decreased to -60% at 2 h and 4 h, 35% at 6 h, and 15% at 8 h, indicating that S-20-1 may target the early stage of the virus life cycle.
  • the inventors used a previously reported assay by adjusting the temperature to distinguish the process of entry, post-entry, attachment, and post- attachment 38 . As shown in Fig.
  • S-20-1 could inhibit 80%, 70%, and 75% in the entry stage, attachment stage, and post-attachment stage, respectively, with no effect at the post-entry stage, in good agreement with its targeting at the early fusion stage.
  • the inventors also assessed the inhibitory activity of S-20-1 against HCoV-OC43 infection with the same assays described above. As shown in Fig. 12d-e, S-20-1 exhibited results similar to those when SARS-CoV-2 was tested, suggesting that S-20-1 targets the early entry stage of SARS-CoV-2, HCoV-OC43, and other HCoVs.
  • the binding affinity of S-20 and S-20-1 toward various subunits in S protein was then determined by fluorescence polarization assays 33 .
  • the inventors successfully obtained FITC- labeled cyclic y-AApeptides S-20 and S-20-1. (Fig. 13, 14 and Table 3). Both compounds exhibited excellent binding affinity toward S1 subunit with KD of 50 nM (Fig. 12f ) and 67 nM (Fig. 12g), respectively. This similarity confirmed that modification of S-20 with negative charges did not change its binding activity to S1 protein.
  • the inventors next measured the binding affinity of both compounds toward RBD, revealing KD values of 57 nM (Fig. 12h) and 61 nM (Fig.
  • the hydrophobic side chains of 1 a, 2a, 2b, 3b, and 4a of S-20 could form either Pi-Pi interaction or hydrophobic interactions with either one or more residues of 473Y, 421 Y, 455L, 456F, 489Y and 486F on RBD owing to close contacts.
  • cationic 1 b and hydrophilic 4b may form hydrogen bonding with 459S and 487N, respectively.
  • the arrangement of the hydrophobic and hydrophilic groups on S-20 also enables its favorable binding with the residues on HR1 (Fig. 16c, d).
  • the inventors next assessed the metabolic stability of S-20-1 in the presence of proteinase K and trypsin. As shown in Fig. 17a, b, the inhibition of SARS- CoV-2 PsV infection showed no decrease within 4-h incubation of S-20-1 in the presence of proteinase K and trypsin. Next, S- 20-1 was incubated for 24 h with Pronase, a broad-specificity mixture of proteases extracted from Streptomyces griseus, followed by analysis with RP-HPLC. S-20-1 was remarkably stable and showed no noticeable degradation, even at 24 h (Fig. 17c, d), indicating its high resistance to various proteolytic enzymes in blood.
  • the parallel artificial membrane permeability assay is a high-throughput screening (HTS) technique to predict passive permeability by numerous different biological membranes, such as the gastrointestinal tract (GIT), blood brain barrier (BBB), and dermal layer 39 .
  • GIT gastrointestinal tract
  • BBB blood brain barrier
  • dermal layer 39 a biological membrane that influences the ability of S-20-1 to penetrate the BBB and PAMPA-GIT to determine the gastrointestinal absorption rate and thus predict the oral bioavailability of S-20-1.
  • Verapamil was used as positive control and Theophylline as negative control.
  • the Papp values for favorable, medium, and low permeabilities are expected to be >20 x 10 6 cm/s, 1-20 x 10“® cm/s and ⁇ 1 x 10 6 cm/s, respectively.
  • S-20 and S-20-1 at 100 pM displayed favorable permeability with Papp values of 536 x 10“ 6 cm/s and 30 x 10“ 6 cm/s, respectively, while Verapamil (positive control) at 50
  • Carbamazepine and Antipyrine were used as the positive and negative controls, respectively, as Carbamazepine is fully orally bioavailable with favorable permeability at pH 5.0, 6.2, and 7.4 with Papp values of 135 x 10“® cm/s, 158 x 10 6 cm/s and 160 x 10-® cm/s, respectively, while Antipyrine is poorly orally bioavailable with low Papp values at different pH values.
  • S-20-1 displayed favorable permeability at pH 5.0, 6.2, and 7.4 with Papp at 616 x 10 ⁇ 6 cm/s, 326 x 10 ⁇ 6 cm/s and 31 x 10 ⁇ 6 cm/s, respectively (Fig. 18b).
  • S-20-1 may have a higher absorption rate under fed conditions than that in fasted conditions. Therefore, S-20-1 is expected to have potential oral bioavailability.
  • S-20-1 exhibited excellent pharmacokinetic (PK) profile and oral bioavailability tested in mouse model
  • Fig. 18c To exploit the in vivo stability and oral bioavailability of S-20-1 , the inventors investigated its pharmacokinetics (Fig. 18c) by administering S-20-1 in C57BU6 mice via intraperitoneal (IP) and oral administration (OP) of S-20-1 at 50 mg/kg over 48 h, respectively.
  • IP intraperitoneal
  • OP oral administration
  • S-20-1 demonstrated excellent PK parameters with a long half-life (T1/2) of 14.53 h and a high peak concentration (Cmax) of 120,637 pg/L (Fig. 18d; Fig. 19).
  • T1/2 long half-life
  • Cmax peak concentration
  • OP peak concentration
  • mice Eight-week-old Balb/c mice were used to test the in vivo safety of S-20-1. Mice were administered with S-20-1 intranasally once daily for three days, and their body weight was monitored every day for 12 days (Fig. 20a). The body weight of mice in both S-20-1 and PBS groups exhibited no significant changes (Fig. 20b). The mice were euthanized on the 12 th day (Fig. 20a) and their liver, lung, kidney, and brain tissues were collected. Histological sections of the tissues were stained with hematoxylin and eosin (H&E) and examined microscopically. Both S-20-1 and PBS groups showed similar histological features (Fig. 20c). No inflammatory changes were observed in these tissues, suggesting that S-20-1 is safe.
  • H&E hematoxylin and eosin
  • 293T, RD, and Caco-2 cells were purchased from ATCC and stocked in the laboratory.
  • Huh-7 cells were obtained from the Chinese Academy of Science Cell Bank (Shanghai, China).
  • Caco-2 cells were cultured in MEM containing 10% FBS.
  • Other cells were cultured with DMEM containing 10 % FBS.
  • HCoV-OC43 (VR-1558) and HCoV-229E (VR-740) were obtained from ATCC and propagated in the laboratory.
  • SARS-CoV-2 nCoV-SH01 , GenBank number: MT121215.1
  • SARS-CoV-2 Delta variant were isolated by Fudan University.
  • the OBTC library was synthesized as discussed in Huang et al (2020, Shi et al (2017), Shi et al. (2019), Yan et al. (2019), and Zheng et al. (2021 ), 26 30 herein incorporated by reference into this disclosure in their entirety.
  • Beads were incubated with blocking buffer (1 % BSA in Tris buffer with 1000x excess of Escherichia coli lysate) for 1 h at room temperature. After washing with Tris buffer four times, beads were incubated with SARS-CoV-2 Spike Protein S1/S2 (aa11 -1208) and His Tag Recombinant Protein at the concentration of 50 nM for 4 h with 1 % BSA in Tris buffer and 1000x excess of Escherichia coli lysate. After thoroughly washing with Tris buffer, beads were incubated with 6x-His Tag Monoclonal Antibody (HIS. H8) and Dylight 488 (1 : 1000 dilution) for 2 h at room temperature. Next, beads were washed with Tris buffer four times and transferred into a six-well plate to be screened under a fluorescence microscope. Beads emitting green fluorescence were picked up as the putative hits.
  • blocking buffer (1 % BSA in Tris buffer with 1000x excess of Es
  • Each positive bead was transferred into a 1.5 ml Eppendorf microtube and denatured in 100 pL 8 M guanidine-HCI for 1 h at room temperature. After thoroughly washing with Tris buffer, water, DMF, CAN, in the end, the bead was placed into ACN overnight in each microtube and allowed ACN to evaporate. Beads were cleaved in a 5:4:1 (v/v/v) solution of ACN/glacial acetic acid/HzO containing cyanogen bromide (CNBr) at a concentration of 50 mg/mL overnight at room temperature. After evaporation, the residue was dissolved in ACN/HzO (1 :1 ) and analyzed by MALDI-TOF.
  • FITC-labeled cyclic y-AA peptides were synthesized following the previous report. 26 - 30 Briefly, Fmoc-Lys (Dde)-OH was first attached to Rink amide resin. After removing the Fmoc protecting group, the desired building blocks for sequence synthesis were added. Then the y- AA peptides were cyclized, removing the Dde protecting group and coupling with Fmoc-p-Ala. The removed Fmoc protecting group was reacted with FITC.
  • FITC-labeled cyclic y-AA peptides were cleaved by 1 : 1 (v/v) DCM/TFA containing 2% triisopropylsilane and purified by the Waters HPLC system. Detailed structure information can be found in the Fig. 5.
  • HeLa cells were plated in confocal dishes and serum-starved overnight. Following that, HeLa cells were treated with 1 pM FITC-labeled S-20 or S-20-1 , respectively, for 2 h and then washed with PBS buffer three times. Next, the cells were fixed with MeOH for 5 min at room temperature, followed by washing with PBS three more times. Cells were then incubated with 1 pg/mL DAPI/PBS for 15 min in the absence of light, followed by thoroughly washing with PBS again. Finally, cells were observed by the inverted Nikon fluorescence microscope.
  • FITC-labeled y-AApeptides 50 nM FITC-labeled y-AApeptides were incubated with protein (0-2 pM) in PBS.
  • Dissociation constants (Kd) were determined by plotting fluorescence anisotropy values as a function of protein concentration, and the plots were fitted to the following equation.
  • y [FPmin (FPmox — FPn ?)]
  • Lst and x refer to the concentration of the peptide and protein, respectively. The experiments were conducted in triplicate and repeated three times.
  • BBB PAMPA included brain the sink buffer (BSB), lipid solution (BBB-1 ) and StirwellTM PAMPA Sandwich plate preloaded with magnetic stirring disks. 4 pL of lipid solution were transferred into the acceptor well to which 200 pL of BSB (pH 7.4) were added. Then, 180 pL of diluted test compounds (50-250 pM in system buffer at pH 7.4 from a 10 mM DMSO solution) were added to the donor wells.
  • BSB sink buffer
  • BB-1 lipid solution
  • StirwellTM PAMPA Sandwich plate preloaded with magnetic stirring disks 4 pL of lipid solution were transferred into the acceptor well to which 200 pL of BSB (pH 7.4) were added. Then, 180 pL of diluted test compounds (50-250 pM in system buffer at pH 7.4 from a 10 mM DMSO solution) were added to the donor wells.
  • the PAMPA sandwich plate was assembled, placed on the Gut-BoxTM and stirred with 60 pm Aqueous Boundary Layer (ABL) settings for 1 h incubation. Distribution of compounds in the donor and acceptor buffer (150 pL aliquot) was determined by UV spectra measurement from 250 to 498 nm using the TECAC Infinite M-1000 Pro microplate reader. Permeability (Papp, 10' 6 cm/s) of each compound was calculated by Pion PAMPA evolution software. The assay was performed in triplicate.
  • PAMPA-GIT assay 30 was also realized by using a method developed by plON.
  • the inventors also used the TECAN Freedom EVO150 robot to perform all liquid handling steps and analyzed the data by plON's PAMPA Evolution software.
  • the plON's GIT PAMPA includes the acceptor sink buffer (ASB), GIT-0 Lipid solution and the StirwellTM PAMPA sandwich plate preloaded with magnetic disks.
  • ASB acceptor sink buffer
  • GIT-0 Lipid solution the StirwellTM PAMPA sandwich plate preloaded with magnetic disks.
  • Four pL of lipid were transferred in the acceptor well, followed by addition of 200 pL of ASB (pH 7.4).
  • 180 pL of diluted test compound 50-250 pM in system buffer at pH 5.0, 6.2 and 7.4 from a 10 mM DMSO solution
  • the PAMPA sandwich plate was assembled and placed on the Gur-BoxTM and stirred with 40 pm Aqueous Boundary Layer (ABL) settings for 30 min. Distribution of the compounds in the donor and acceptor buffers (150 pL aliquot) was determined by UV spectra measurement from 250 to 498 nm using the TECAN Infinite M-1000 Pro microplate reader. Then the Permeability (Pe, cm.s 1 ) of each compound was calculated by Pion PAMPA evolution software. The assay was performed in triplicate.
  • Cyclic y-AA peptides S-20-1 (0.1 mg/mL) were incubated with 0.1 mg/mL protease in 100 mM ammonium bicarbonate buffer (pH 7.8) at 37 °C for 24 h. After that, water and ammonium bicarbonate in the reaction mixtures were removed using speed vacuum. The residues were dissolved in 100 pL H2O/ACN and analyzed on a Waters analytical HPLC system.
  • Plasmids encoding spike protein of coronavirus including SARS-CoV-2, SARS-CoV-2 variants (Alpha, Beta, gamma, lambda, Delta, Omicron), SARS-CoV, MERS-CoV, HCoV-OC43, HCoV-229E, SARSr-CoV WIV1 , luciferase reporter vector (pNL4-3.
  • Luc.R-E- Luc.R-E-
  • plasmids encoding EGFP were maintained in the laboratory.
  • Luc.R-E- were co-transfected into 293T cells using Vigofect transfection reagent, and then the supernatants were changed with fresh medium containing 10% FBS. After 48h, the supernatants containing pseudoviruses were collected, filtered with a 0.45 pm filter, and stocked.
  • target cells Huh-7 cells
  • Huh-7 cells were seeded at 8000 per well in a 96-well plate and cultured at 37 °C for 12 hours.
  • the compound was diluted with DMEM without FBS, and then the same volume of pseudoviruses was added. Afterwards, the mixture was transferred into Huh-7 cells and incubated for 30 min. After 12 hours, the mixture was replaced with fresh medium. Forty-eight hours later, the cells were lysed with cell lysis buffer, and luciferase activity was detected with the Luciferase Assay System (Promega, Madison, Wl, USA).
  • S-20-1 The inhibitory activity of S-20-1 against authentic viruses was tested according to Guo et al. (2021 ), 45 herein incorporated by reference into this disclosure in its entirety.
  • S-20-1 was serially diluted with DMEM without FBS. Then 100 TCID50 of virus were mixed with diluted S-20-1. After incubation for 30 min, the mixtures were transferred to target cells (RD for HCoV-OC43, Huh-7 for HCoV-229E, and Caco-2 for SARS-CoV-2 and SARS-CoV-2 Delta). The medium was changed 12 hours later, and cell viability was detected with CCK8 kit (HCoV-OC43 and HCoV-229E).
  • the cell-cell fusion assay was established and performed as in Liu et al. (2021 ), 46 herein incorporated into this disclosure in its entirety.
  • PAAV-IRES-EGFP S was transfected to 293T cells to obtain effector cells expressing S protein of coronaviruses, including SARS- CoV-2, SARS-CoV, MERS-CoV, HCoV-229E and HCoV-NL63, and GFP.
  • serially diluted S-20-1 was mixed with effector cells, and the mixture was transferred to Huh-7 cells (target cells).
  • trypsin 80 mg/ml
  • fused cells were counted, and the fusion rate was calculated to determine inhibitory activity.
  • S-20-1 was added to Huh-7 cells to incubate at 37 °C for 1 hour. After S-20-1 was removed, SARS-CoV-2 pseudovirus was added to infect cells. S-20-1 was not removed from the group set as control. The medium was changed 12 hours later, and luciferase activity was tested as described above.
  • Viral entry assay was performed as previously described in Liu et al. (2020) and Fang et al. (2021 ), 38 ’ 47 herein incorporated by reference into this disclosure in their entirety. Briefly, S-20- 1 and virus were added to target cells at 37 °C for 1 hour, and then cells were washed with cold PBS three times. To perform the viral attachment assay, the mixture of S-20-1 and virus was added to target cells to incubate for 1 hour at 4 °C before washing with cold PBS. For the post-attachment assay, virus was incubated with target cells at 4 °C for 1 hour. Then the cells were thoroughly washed with cold PBS to remove unattached virus.
  • S-20-1 was added and incubated at 37 °C for an additional 1 hour.
  • the post-entry assay was performed like the postattachment assay, except that virus was incubated with cells at 37 °C.
  • the inhibition effects of S-20-1 were detected as above.
  • Cytotoxicity of compound to cells was tested as previously described in Xia et al.,. 22 herein incorporated by reference in its entirety into this disclosure. Briefly, serially diluted compounds were added to target cells. After culture at 37 °C for 12 hours, the medium was changed with fresh medium. Forty-eight hours later, the supernatant was removed, and cell viability was analyzed with Cell Counting Kit (CCK-8). In a 96-well plate, 100 pL of diluted CCK8 reagent were added to each well, and the absorbance was measured at 450 nm.
  • S-20-1 was administered either p.o. or i.p. to mice at the dose of 50 mg/kg, volume 150 pL. Following administration, 100
  • _iL blood samples were collected at 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h and 48 h (n 3 per time point, and each mouse was used for three time points; thus 9 mice were used for either p.o. or i.p., making a total of 18 mice).
  • the relative viral RNA expression level in brain was tested through RT-PCR and calculated as 2 ⁇ aact >.
  • the HCoV-OC43 RNA level was adjusted with mouse housekeeping gene GAPDH.
  • the primer of HCoV-OC43 and GAPDH follows:
  • OC43-S-Forward GACACCGGTCCTCCTCCTAT (SEQ ID NO: 4);
  • SARS-CoV-2 Delta C57BL/6-Tgtn (CAG-human ACE2-IRES-LuciferaseWPRE-polyA) transgenic mice infected with SARS-CoV-2 were used as described in Xia et al. (2021 ).
  • 37 Eight- week-old female hACE2 transgenic mice were challenged with SARS-CoV-2 Delta variant at 10,000 pfu via the intranasal route.
  • S-20-1 was administered at the dose of 60 mg/kg through the intranasal route 30 min before or after viral challenge. Then the mice were euthanized at 4 days post-infection, and brains, lungs and intestines were dissected.
  • Viral RNA was extracted with TRIzol reagent according to the manual. Real-time RT-PCR was conducted to evaluate viral RNA load in tissues as described previously.
  • S-20-1 was incubated with proteinase K (1 microunit/ml) for different time and then centrifuged at 500 g for 5 min to remove the proteinase K.
  • S- 20-1 was incubated with trypsin (25 mg/ml) for different time, followed by addition of FBS to final proportion of 20% and heated at 56 °C for 30 min to inactivate trypsin.
  • the inhibitory activity of treated S-20-1 was tested on Huh-7 cells.
  • S-20-1 a modified cyclic y-AApeptide-based pan-CoV fusion and entry inhibitor, S-20-1.
  • S-20-1 By targeting the RBD in S1 subunit and HR1 in S2 subunit of S protein, S-20-1 exhibited potent and broad-spectrum inhibitory activity against infection by SARS-CoV-2, its variants, and other HCoVs, as well as bat SARSr-CoVs. It protected mice from infection of SARS-CoV-2 and HCoV-OC43 infection with a good in vivo safety profile.
  • S-20-1 was highly resistant to proteolytic degradation, and it exhibited long half-life and favorable oral bioavailability. As such, S-20-1 is a promising orally deliverable antiviral therapeutic and prophylactic candidate against current SARS-CoV-2 and its variants, as well as future emerging and re-emerging HCoVs.
  • a diagnosis of CoV-2 infection is confirmed.
  • the patient is orally administered a therapeutically effective amount of a composition comprising S-20-1 for a time period sufficient to alleviate the symptoms.
  • the patient is retested twice over a several week timespan and tests negative for the virus.
  • a 38 year old female patient tests negative for COVID-19 and is orally administered a therapeutically effective amount of a composition comprising S-20-1.
  • the female is exposed to the CoV-2 virus through contact with multiple people infected with the virus.
  • the female does not develop a CoV-2 infection as confirmed by testing.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)

Abstract

A novel compound and method of treating and preventing coronavirus infection in a patient is presented. Cyclic γ AApeptide pan-coronavirus inhibitors which bind to RBD and HR1 on the spike protein were found to exhibit high proteolytic enzyme stability and good oral bioavailability. In particular, compound S-20-1 effectively inhibited infection by pseudotyped and authentic SARS-CoV-2 and pseudotyped variants of concern (VOCs), including B.1.617.2 (Delta) and B.1.529 (Omicron), as well as MERS-CoV, SARS-CoV, HCoV-OC43, HCoV-229E, and HCoV-NL63 as well as infection of a pseudotyped SARS-related coronavirus WIV1 (SARSr-CoV-WIV1) from bats.

Description

NOVEL CYCLIC GAMMA AAPEPTIDE PANCORONAVIRUS INHIBITOR AND METHOD OF TREATING CORONAVIRUS INFECTION
CROSS REFERENCE TO RELATED APPLICATIONS
This application is a nonprovisional of and claims priority to U.S. Provisional Patent Application Serial No. 63/371 ,671 , entitled “Novel Cyclic Gamma-AApeptide-based Long- Acting Pan-Coronavirus Fusion Inhibitor with Potential Oral Bioavailability by Targeting Two Sites in Spike Protein”, filed August 17, 2022, the contents of which are hereby incorporated by reference into this disclosure.
FIELD OF INVENTION
This invention relates to treatment and/or prevention of coronavirus infection. Specifically, the invention provides a novel cyclic y-AApeptide-based fusion inhibitor and associated method of preventing and/or treating a respiratory virus such as SARS CoV2.
BACKGROUND OF THE INVENTION
Several vaccines1 and therapeutics2 have been approved for use against COVID-19 caused by SARS- CoV-2 infection. However, their effectiveness against the emerging variants of SARS-CoV-2, such as the B.1.1.7 (Alpha)3, B.1.351 (Beta)4, B.1.1.248 (Gamma)5, B.1.617.2 (Delta)6, and B.1.1.529 (Omicron)7 appear to decline. Therefore, developing more effective and broader spectrum prophylactics and therapeutics is still urgently needed.
Coronaviruses consist of four genera: Alphacoronavirus (a), Betacoronavirus (P), Gammacoronavirus (y) and Deltacoronavirus (5).7 Two Alphacoronaviruses (HCoV-NL63 and HCoV-229E) and 5 Betacoronaviruses, including low pathogenic CoVs (HCoV-OC43, HCoV- HKU1 ) and 3 high pathogenic CoVs (SARS-CoV, MERS-CoV, and SARS-CoV-2) can infect humans.8 12 To date, several strategies have been adopted for the development of anti- SARS-CoV-2 therapeutics by targeting viral spike (S) protein (S1 and S2 subunits), viral enzymes (PLpro, 3CLpro, RdRp and helicase),13 and some structure proteins.13 Generally, small molecular inhibitors with oral bioavailability are more suitable for intracellular targets, i.e., viral proteases, by the necessity of cell permeability. One inhibitor of main protease (MPro)/3C-like protease (3CLpro), Paxlovid™, was recently approved by the US FDA as an oral drug for treatment of SARS-CoV-2 infecton.14 However, instances of reinfection after completing the recommended course of Paxlovid are reported15 and recent study shows that this type of MPro inhibitors tends to induce rapid drug resistance.16-17
SARS-CoV-2 neutralizing antibodies (nAbs) generally target RBD in S1 subunit.18 21 However, nAbs lack oral bioavailability and lose neutralizing activity against SARS-CoV-2 variants that escape immune surveillance.
The inventors previously identified a series of pan-CoV fusion inhibitors, such as EK1 peptide and EK1 C4 lipopeptide, targeting the heptad repeat 1 (HR1 ) domain in S2 subunit of SARS- CoV-2 S protein with highly potent antiviral activity against all HCoVs tested,22-23 demonstrating the potential of using S protein to develop pan-antiviral inhibitors, de Vries et al.24 synthesized a dimeric lipopeptide [SARSHRc-PEG4]2-chol, and with daily intranasal administration to SARS-CoV-2 ferrets, it could completely prevent SARS-CoV-2 direct-contact transmission with limited toxicity. Despite providing excellent inhibitory against SARS-CoV-2 virus and broad-spectrum antiviral activity,22-23-25 however, these peptides generally suffer from low enzymatic stability and poor oral bioavailability.
The inventors previously established several cyclic y-AApeptide-based one-bead-two- compound (OBTC) combinatorial libraries in which the cyclic y-AApeptides possess high proteolytic enzyme stability and good oral availability.26'30 Through screening these OBTC libraries, several important hits, such as cyclic y-AApeptides targeting EphA2, EGFR and HER2 were identified, 27-30-31 suggesting that these libraries can be used for identification of y- AApeptide-based pan-CoV fusion inhibitors with oral bioavailability.
Given the lack of effective and broader spectrum prophylactics and therapeutics for respiratory viruses such as SARS CoV-2, what is needed are peptide-based pan-CoV fusion inhibitors with high proteolytic enzyme stability and good oral bioavailability.
SUMMARY OF INVENTION
The receptor-binding domain (RBD) in S1 subunit and heptad repeat 1 (HR1 ) domain in S2 subunit of SARS-CoV-2 spike (S) protein are the targets of neutralizing antibodies (nAbs) and pan-coronavirus (CoV) fusion inhibitory peptides, respectively. However, neither nAb- nor peptide-based drugs can be used orally. The inventors screened a one-bead-two-compound (OBTC) cyclic y-AApeptide library against SARS-CoV-2 spike protein and identified a hit: S- 20 with potent membrane fusion inhibitory activity, but moderate selectivity index (SI). After modification, one derivative, S-20-1 , exhibited improved fusion inhibitory activity and SI (>1000). S-20-1 effectively inhibited infection by pseudotyped and authentic SARS-CoV-2 and pseudotyped variants of concern (VOCs), including B.1 .617.2 (Delta) and B.1 .529 (Omicron), as well as MERS-CoV, SARS-CoV, HCoV-OC43, HCoV-229E, and HCoV-NL63. It could also inhibit infection of a pseudotyped SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ) from bats.
S-20-1 also demonstrated excellent in vivo efficacy and good in vivo safety profiles in mice. Intranasal application of S-20-1 to mice before or after challenge with HCoV-OC43 or SARS- CoV-2 provided significant protection from infection. Importantly, S-20-1 was highly resistant to proteolytic degradation, had long half-life, and possessed favorable oral bioavailability. Mechanistic studies suggest that S-20-1 binds with high affinity to RBD in S1 and HR1 domain in S2 of SARS-CoV-2 S protein. Thus, with its pan-CoV fusion and entry inhibitory activity by targeting two sites in S protein, desirable half-life, and promising oral bioavailability, S-20-1 is a potential candidate for further development as a novel therapeutic and prophylactic drug against infection by SARS-CoV-2 and its variants, as well as future emerging and reemerging CoVs.
In an embodiment, a compound selected from the group consisting of compounds S-1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-11 , S-12, S-13, S-14, S-15, S-16, S-17, S-18, S-19, S-20, S-21 , S-22, S-23, S-24, S-25, S-26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S- 35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20- 1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, derivatives, and isomers thereof is presented.
The compound may be selected from the group consisting of the compounds S-13, S-20, S- 23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof. In some embodiments, the compound may be selected from the group consisting of S-20, S- 20-1 , derivatives, and isomers thereof.
In an embodiment, a method of treating a coronavirus infection in a patient in need thereof is presented comprising: administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to treat the coronavirus infection of the patient.
In some embodiments, the compound is S-20 or S-20-1 . The coronavirus may be selected from the group consisting of severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), severe acute respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof. In some embodiments, the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof. The variants may be selected from the group consisting of B.1.1.7 (Alpha), B.1.351 (Beta), B.1.1.248 (Gamma), B.1.617.2 (Delta), and B.1 .1 .529 (Omicron). In some embodiments, the composition is administered orally.
A method of preventing a coronavirus infection in a patient in need thereof is presented comprising: prophylactically administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to prevent the coronavirus infection of the patient.
In some embodiments, the compound is S-20 or S-20-1 . The coronavirus may be selected from the group consisting of severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), severe acute respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof. In some embodiments, the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof. The variants may be selected from the group consisting of B.1.1.7 (Alpha), B.1.351 (Beta), B.1.1.248 (Gamma), B.1.617.2 (Delta), and B.1 .1 .529 (Omicron). In some embodiments, the composition is administered orally.
In a further embodiment, a kit for treating or preventing coronavirus infection is presented comprising: a composition comprising a therapeutically effective amount of at least one cyclic y AApeptide pan-CoV fusion inhibitor and a pharmaceutically acceptable carrier and instructions for use of the composition. The at least one cyclic y AApeptide pan-CoV fusion inhibitor may be selected from compounds S-1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-11 , S-12, S-13, S-14, S-15, S-16, S-17, S-18, S-19, S-20, S-21 , S-22, S-23, S-24, S-25, S- 26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, derivatives, and isomers thereof. In some embodiments, the at least one cyclic y AApeptide pan-CoV fusion inhibitor may be selected from the group consisting of S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof. In some embodiments, the compound is S-20 or S-20-1 . BRIEF DESCRIPTION OF THE DRAWINGS
For a fuller understanding of the invention, reference should be made to the following detailed description, taken in connection with the accompanying drawings, in which:
FIG. 1 is an image depicting the proposed mechanism of action of S-20-1 against SARS-CoV- 2 infection. The entry of SARS-CoV-2 into the host cell is initiated by binding of RBD in S1 subunit of S protein to ACE2 (the receptor of SARS-CoV-2), which triggers the conformation change of S2 subunit of S protein and exposes the fusion intermediate structure consisting of HR1 , HR2, and fusion peptide (FP). Then, HR1 and HR2 interact with each other to form 6- HB, bringing the viral and host cell membranes together for fusion. Like SARS-CoV-2 nAb and EK1 peptide, S-20-1 is able to bind with RBD in S1 subunit and HR1 in S2 subunit to block viral attachment and fusion, respectively. Different from nAb and EK1 peptide, S-20-1 also has oral bioavailability like Paxlovid™, noted above, which targets the intracellular main protease (MPro). S-20-1 is superior to peptide- and lipopeptide-based pan-CoV fusion inhibitors because it is much more resistant to proteolytic enzymes and has a longer half-life than EK1 , as well as good oral bioavailability. Therefore, S-20-1 has better potential to be developed as an orally usable drug for treatment of SARS-CoV infection.
FIG. 2 is a flow chart depicting preparation of the cyclic y-AApeptides library.
FIG. 3A-B are images depicting a library developed for inhibitors targeting SARS-CoV-2 S protein, (a) Schematic presentation of OBTC TentalGel beads. Chemical structures of y- AApeptide (i) and a-peptide (ii). (b) Scheme showing the overall strategy. Briefly, the beads were incubated with blocking buffer (1% BSA in Tris buffer with 1000 x excess of E. coil lysate), His-tag SARS-CoV-2 S protein, and Dylight 488 6x-His Tag Monoclonal Antibody, respectively. Then the beads were transferred into 6-well plate. Following that, beads were observed under a fluorescence microscope and the beads emitting green fluorescence were picked up. After thorough wash, the decoding sequence were cleavage from the beads and analyzed by MALDI to determine the cyclic compounds' structures.
FIG. 4 is a representative picture of beads for screening. The bright green bead is the positive bead picked up manually.
FIG. 5 is a series of chemical structures of cyclic y-AApeptide compounds S-1 to S-43. Structures highlighted in red are the seven lead compounds shown in Fig. 6c.
FIG. 6A-B are a series of images depicting screening for SARS-CoV-2 fusion and entry inhibitors from a cyclic y-AApeptide library. Inhibition of cell-cell fusion mediated by the S protein of SARS-CoV-2 by putative hits at 50 pM (a) and 5 pM (b). The dot line in figures means the inhibition rate of 50% (a) and 80% (b).
FIG. 6C is a series of chemical structures of seven hits with inhibitory effect against SARS- CoV-2 S-mediated cell-cell fusion.
FIG. 6D-E are a series of images depicting screening for SARS-CoV-2 fusion and entry inhibitors from a cyclic y-AApeptide library, (d) Inhibitory activity of hits (S-13, S-20, S-23, S- 24, S-25, S-30, and S-32) from SARS-CoV-2 pseudovirus infection assay, (e) Cytotoxicity of hits (S-13, S-20, S-23, S-24, S-25, S-30, and S-32) on Huh-7 cells.
FIG. 7A is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI. (a) Chemical structures of four modified hits.
FIG. 7B is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI. (b) HeLa cells incubated with FITC labeled S-20 (i-iii) and FITC labeled S-20-1 (iv-vi) at 1 pM for 2 h. respectively, and then stained with DAPI. (i, iv) DAPI channel; (II, v) FITC channel; (Hi, vi) merged.
FIG. 7C-D are a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI. (c) Inhibitory activity of 4 modified cyclic y-AApeptides in PsV infection assays against SARS-CoV-2. (d) Cytotoxicity of 4 modified cyclic y-AApeptides on Huh-7 cell line.
FIG. 7E is a series of images depicting identification of four modified cyclic y-AApeptides with improved SARS-CoV-2 fusion/entry inhibitory activity and SI. (e) Inhibitory activity of S-20-1 on authentic SARS-CoV-2 replication on Caco-2 cell line.
FIG. 8A-B are a series of graphs depicting cytotoxicity of S-20-1 on (a) Huh-7 and (b) Caco-2 cells.
FIG. 8C is a graph depicting cytotoxicity of S-20-1 on RD cells.
FIG. 9A-B are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (a) B.1 .1 .7 (Alpha), (b) B.1 .351 (Beta), FIG. 9C-D are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (c) P.1 (Gamma), (d) C.37 (Lambda),
FIG. 9E-F are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (e) B.1 .617.2 (Delta), (f) B.1 .1 .529 (Omicron),
FIG. 9G-H are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS- variants on Huh-7 cells: (g) mutant with N501Y, K417N, and E484K mutation. Inhibition of infection by PsV of SARS-variants on Caco-2 cells: (h) B.1 .1 .7 (Alpha).
FIG. 91-J are a series of images depicting inhibition of S-20-1 against infection by pseudotyped SARS-CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS-variants on Caco-2 cells: (i) B.1.351 (Beta), (j) B.1.617.2 (Delta).
FIG. 9K is an image depicting inhibition of S-20-1 against infection by pseudotyped SARS- CoV-2 variants in different cell lines. Inhibition of infection by PsV of SARS-variants on Caco- 2 cells: (k) B.1.1.529 (Omicron).
Figure 10A-B are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (a) SARS-CoV-2; (b) SARS-CoV.
FIG. 10C-D are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (c) MERS-CoV; (d) HCoV-229E..
FIG. 10E-F are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 on cell-cell fusion mediated by the S protein of (e) HCoV-NL63. Inhibitory activity of S-20-1 against infection of pseudotyped (f) SARS-CoV.
FIG. 10G-H are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of pseudotyped (g) MERS-CoV; (h) HCoV-229E. FIG. 101-J are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of pseudotyped (i) HCOV-NL63 and (j) SARr-CoV W1 V1 .
FIG. 10K-L are a series of graphs depicting inhibition of S-20-1 against infection of divergent HCoVs and SARSr-CoV. Inhibitory activity of S-20-1 against infection of authentic (k) HCoV- OC43 and (I) HCoV-229E. RD cells and Huh-7 cells were infected with (k) HCoV-OC43 and (I) HCoV-229E, respectively.
Figure 11A-F are a series of images depicting prevention and treatment effect of S-20-1 against mouse infection by HCoV-OC43 and SARS-CoV-2 Delta variant, (a) Schematic diagram of S-20-1 administration and HCoV-OC43 challenge, (b) In vivo efficacy of S-20-1 (80 mg/kg) against HCoV-OC43 infection in newborn mice. Viral RNA expression level in brain tissue of mice in each group on the 4th day post-infection was detected, (c) Schematic diagram of S-20-1 administration and SARS-CoV-2 challenge, (d) Viral RNA expression level after incubation of S-20-1 with authentic SARS-CoV-2 Delta on Caco-2 cells, e. f In vivo efficacy of S-20-1 (60 mg/kg) against SARS-CoV-2 Delta variant infection in hACE2- transgenic C57BL/6 mice. Viral RNA expression level in mouse brain (e) and lung (f) of each group on the 4th day post-infection was detected. These data were analyzed by Student’s t- test (d) and One-way ANOVA (b, e, f).
Figure 12A-C are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry, (a) In PsV infection assay, Huh-7 cells were pretreated with S-20-1 at 50 gM at 37 °C for 1 h, washed with PBS to remove unbound S-20-1 , and infected with SARS-CoV-2 at 37 °C. In time-of- addition assays, Huh-7 and RD cells were treated with S-20-1 at the indicated time points before or after addition of pseudotyped SARS-CoV-2 (b). Supernatants containing free S-20-1 and viral particles were removed 12 h later. A series of well-established assays were performed to confirm the stage at which S-20-1 blocked entry of SARS-CoV-2 or HCoV-OC43 into target cells. Data were analyzed with One-way ANOVA (a) and Two-way ANOVA (c, e). NS means no significance.
Figure 12D-E are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry. In time-of- addition assays, Huh-7 and RD cells were treated with S-20-1 at the indicated time points before or after addition of authentic HCoV-0043 (d). Supernatants containing free S-20-1 and viral particles were removed 12 h later. A series of well-established assays were performed to confirm the stage at which S-20-1 blocked entry of SARS-CoV-2 or HCoV-OC43 into target cells. Data were analyzed with One-way ANOVA (a) and Two-way ANOVA (c, e). NS means no significance.
Figure 12F-K are a series of images depicting inhibition of SARS-CoV-2 infection by S-20-1 that specifically targets at RBD and HR1 domain at the early stage of viral entry. Affinity of binding between S-20 and S1 (f), S-20-1 and S1 (g), S-20 and RBD (h), S-20-1 and RBD (i), S-20 and HR1 (j), or S-20-1 and HR1 (k), was determined by fluorescence polarization.
Figure 13 are chemical structures of FITC-labeled cyclic y-AApeptides S-20 and S-20-1 .
Figure 14A-D are a series of images depicting HPLC analytic trace of S-20 (a), S-20-1 (b), FITC-S-20 (c) and FITCS-20-1 (d).
Figure 15A-B are a series of graphs depicting binding affinity of (a) S-20 and (b) S-20-1 to HR2 protein measured by fluorescence polarization (FP) assay.
Figure 16A-D are a series of images depicting the chemical structure of S-20 and molecular docking analysis of the interaction between S-20 and its potential target sites. Side chains of S-20 are designated by a (chiral side chain) or b (acyl side chain) in each AApeptide building block, respectively. Residues of HR1 from different helical chains are shown in red, black, and purple, respectively.
Figure 17A-D are a series of images depicting evaluation of the stability of sequences in various proteolytic enzymes. Metabolic stability of S-20-1 in proteinase K (a) and trypsin (b). Analytic HPLC traces of S-20-1 before (c) and after (d) incubation with Pronase (0.1 mg/ml).
Figure 18A-D are a series of images depicting evaluation of membrane passive permeability, oral bioavailability, and PK profiles of S-20-1 in mouse model, (a) PAMPA-BBB assay for standards, S-20, and S-20-1 at pH 7.4. (b) PAMPA-GIT assay for standards, S-20, and S-20- 1 at different pH conditions, (c) Time-concentration plot of S-20-1 in PK study. Plasma concentration and time curve following intraperitoneal (IP) (red) and oral administration (OP) (blue) administration of 50 mg/kg S-20-1 in C57BL/6 mice (data indicated are means ± SD, n = 3). (d) Pharmacokinetics parameters of S-20-1 over 48 h in mice.
Figure 19A-C are a series of images depicting standard calibration curve for low concentration (5 ng/ml to 1000 ng/ml) (a) and high concentration (1 gg/ml to 50 gg/ml) (b). The concentration of S-20-1 at different time points (c).
Figure 20A-C are a series of images depicting the in vivo safety evaluation of S-20-1. (a) Flow diagram of in vivo safety experiments, (b) Body weight changes of mice administered with S-20-1 or PBS intranasally. (c) Histological changes of mouse lung, liver, brain, and kidney after administration with S-20-1 or PBS intranasally. Tissues were stained with H&E. The scale bar shown in slides were 1000 gm and 100 gm, respectively.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
In the following detailed description of the preferred embodiments, reference is made to the accompanying drawings, which form a part hereof, and within which are shown by way of illustration specific embodiments by which the invention may be practiced. It is to be understood that other embodiments may be utilized, and structural changes may be made without departing from the scope of the invention.
Definitions
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are described herein. All publications mentioned herein are incorporated herein by reference in their entirety to disclose and describe the methods and/or materials in connection with which the publications are cited. It is understood that the present disclosure supercedes any disclosure of an incorporated publication to the extent there is a contradiction.
As used herein, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, ‘‘a nanoparticle” includes “nanoparticles” or “plurality of nanoparticles”.
As used in this specification and the appended claims, the term “or” is generally employed in its sense including “and/or” unless the context clearly dictates otherwise.
All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximations which are varied up or down by increments of 1 .0, 0.1 , 0.01 or 0.001 as appropriate. It is to be understood, even if it is not always explicitly stated that all numerical designations are preceded by the term “about”. It is also to be understood, even if it is not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art and can be substituted for the reagents explicitly stated herein. Concentrations, amounts, solubilities, and other numerical data may be expressed or presented herein in a range format. It is to be understood that such a range format is used merely for convenience and brevity and thus should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. As an illustration, a numerical range of “about 1 to about 5” should be interpreted to include not only the explicitly recited values of about 1 to about 5, but also include the individual values and sub-ranges within the indicated range. Thus, included in this numerical range are individual values such as 2, 3, and 4 and sub-ranges such as from 1 -3, from 2-4 and from 3-5, etc. This same principle applies to ranges reciting only one numerical value. Furthermore, such an interpretation should apply regardless of the range or the characteristics being described.
As used herein, the term “comprising” is intended to mean that the products, compositions, and methods include the referenced components or steps, but not excluding others. “Consisting essentially of” when used to define products, compositions, and methods, shall mean excluding other components or steps of any essential significance. Thus, a composition consisting essentially of the recited components would not exclude trace contaminants and pharmaceutically acceptable carriers. “Consisting of” shall mean excluding more than trace elements of other components or steps.
As used herein, “about” means approximately or nearly and in the context of a numerical value or range set forth means ±10% of the numerical.
As used herein “patient” is used to describe a mammal, preferably a human, to whom treatment is administered, including prophylactic treatment with the compositions of the present invention. Non-limiting examples of mammals include humans, rodents, aquatic mammals, domestic animals such as dogs and cats, farm animals such as sheep, pigs, cows and horses. “Patient” and “subject” are used interchangeably herein.
“Administering” or “administration” as used herein refers to the process by which the compositions of the present invention are delivered to the patient. The compositions may be administered in various ways, including but not limited to, orally, nasally, and parenterally.
“Parenteral administration” as used herein refers to modes of administration other than enteral and topical administration, usually by injection, and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subcapsular, intrathecal, intraventricular, intracisternal, intranigral, subarachnoid, intraspinal, and intrasternal injection and infusion. Dosing can be by any suitable route, e.g., by injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. Various dosing schedules including but not limited to single or multiple administrations over various time-points, bolus administration, and pulse infusion are contemplated herein.
A “therapeutic agent” as used herein refers to a substance, composition, compound, chemical, component or extract that has measurable specified or selective physiological activity when administered to an individual in a therapeutically effective amount. In some embodiments, the therapeutic agent may be a an antiviral composition. Examples of therapeutic agents as used in the present invention include, but are not limited to, small molecules. The small molecules may be cyclic y AApeptides. Examples of cyclic y AApeptides include, but are not limited to, dual target fusion inhibitors such as compounds S- 1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-1 1 , S-12, S-13, S-14, S-15, S-16, S-17, S- 18, S-19, S-20, S-21 , S-22, S-23, S-24, S-25, S-26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, and derivatives and isomers thereof. At least one therapeutic agent is used in the compositions of the present invention, however in some embodiments, multiple therapeutic agents are used. In some embodiments, the novel cyclic y AApeptides described herein may be combined with another antiviral composition that targets a different area of the virus such as a composition targeting intracellular main protease (MPro) such as PAXLOVID™. In some embodiments, one or more therapeutic agents may be encapsulated within a nanoparticle.
A “therapeutically effective amount” as used herein is defined as concentrations or amounts of components which are sufficient to effect beneficial or desired clinical results, including, but not limited to, any one or more of treating symptoms of coronaviruses, particularly CoV-2 infection and preventing coronavirus infection, particularly CoV-2 infection. Compositions of the present invention can be used to effect a favorable change in the condition whether that change is an improvement, such as stopping, reversing, or reducing CoV-2 infection, or a complete elimination of symptoms due to CoV-2 infection. In accordance with the present invention, a suitable single dose size is a dose that is capable of preventing or alleviating (reducing or eliminating) a symptom in a patient when administered one or more times over a suitable time period. One of skill in the art can readily determine appropriate single dose sizes for systemic administration based on the size of the animal and the route of administration. The dose may be adjusted according to response. The dosing of compounds and compositions to obtain a therapeutic or prophylactic effect is determined by the circumstances of the patient, as is known in the art. The dosing of a patient herein may be accomplished through individual or unit doses of the compounds or compositions herein or by a combined or prepackaged or pre-formulated dose of a compounds or compositions.
The amount of the compound in the drug composition will depend on absorption, distribution, metabolism, and excretion rates of the drug as well as other factors known to those of skill in the art. Dosage values may also vary with the severity of the condition to be alleviated. The compounds may be administered once, or may be divided and administered over intervals of time. It is to be understood that administration may be adjusted according to individual need and professional judgment of a person administrating or supervising the administration of the compounds used in the present invention.
The dose of the compounds administered to a subject may vary with the particular composition, the method of administration, and the particular disorder being treated. The dose should be sufficient to affect a desirable response, such as a therapeutic or prophylactic response against a particular disorder or condition. It is contemplated that one of ordinary skill in the art can determine and administer the appropriate dosage of compounds disclosed in the current invention according to the foregoing considerations.
Dosing frequency for the composition includes, but is not limited to, at least about once every three weeks, once every two weeks, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, or daily. In some embodiments, the interval between each administration is less than about a week, such as less than about any of 6, 5, 4, 3, 2, or 1 day. In some embodiments, the interval between each administration is constant. For example, the administration can be carried out daily, every two days, every three days, every four days, every five days, or weekly. In some embodiments, the administration can be carried out twice daily, three times daily, or more frequently. Administration can also be continuous and adjusted to maintaining a level of the compound within any desired and specified range.
The administration of the composition can be extended over an extended period of time, such as from about a week or shorter up to about a year or longer. For example, the dosing regimen can be extended over a period of any of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , and 12 months. In some embodiments, there is no break in the dosing schedule. In some embodiments, the interval between each administration is no more than about a week. The compounds used in the present invention may be administered individually, or in combination with or concurrently with one or more other compounds used against viruses, including coronaviruses such as SARS CoV-2. Additionally, compounds used in the present invention may be administered in combination with or concurrently with other therapeutics for coronaviruses or other respiratory viruses.
“Prevention” or “preventing” or “prophylactic treatment” as used herein refers to any of: halting the effects of coronavirus infection, reducing the effects of coronavirus infection, reducing the incidence of coronavirus infection, reducing the development of coronavirus infection, delaying the onset of symptoms of coronavirus infection, increasing the time to onset of symptoms of coronavirus infection, and reducing the risk of development of coronavirus infection. In some embodiments, the coronavirus infection is SARS CoV-2.
“Treatment” or “treating” as used herein refers to any of the alleviation, amelioration, elimination and/or stabilization of a symptom, as well as delay in progression of a symptom of a particular disorder. For example, “treatment” of coronavirus infection may include any one or more of the following: amelioration and/or elimination of one or more symptoms associated with coronavirus infection, reduction of one or more symptoms of coronavirus infection, stabilization of symptoms of coronavirus infection, and delay in progression of one or more symptoms of coronavirus infection. In some embodiments, the coronavirus infection is SARS CoV2.
“Infection” as used herein refers to the invasion of one or more microorganisms such as bacteria, viruses, fungi, yeast, or parasites in the body of a patient in which they are not normally present. In certain embodiments, the infection is from a respiratory virus such as a respiratory syncytial virus, Influenza virus, or coronavirus. In some embodiments, the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Other coronaviruses contemplated herein include, but are not limited to, severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV- HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), porcine deltacoronavirus (PDCoV) (porcine), infectious bronchitis virus (IBV, avian), and other coronaviruses of pandemic potential including Alphacoronavirus, Betacoronavirus, Deltacoronavirus, duvinacovirus, Embecovirus, Gammacoronavirus, Merbecovirus, Nobecovirus and Sarbecovirus. Also contemplated herein are variants of concern (VOCs) including, but not limited to, B.1.1.7 (Alpha), B.1.351 (Beta), B.1.1.248 (Gamma), B.1.617.2 (Delta) and B.1.1.529 (Omicron). Future coronaviruses and reemerging coronaviruses are also contemplated for use with the therapeutic agents described herein. The pharmaceutical compositions of the subject invention can be formulated according to known methods for preparing pharmaceutically useful compositions. Furthermore, as used herein, the phrase “pharmaceutically acceptable carrier" means any of the standard pharmaceutically acceptable carriers. The pharmaceutically acceptable carrier can include diluents, adjuvants, and vehicles, as well as implant carriers, and inert, non-toxic solid or liquid fillers, diluents, or encapsulating material that does not react with the active ingredients of the invention. Examples include, but are not limited to, phosphate buffered saline, physiological saline, water, and emulsions, such as oil/water emulsions. The carrier can be a solvent or dispersing medium containing, for example, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Formulations are described in a number of sources that are well known and readily available to those skilled in the art. For example, Remington’s Pharmaceutical Sciences (Martin EW [1995] Easton Pennsylvania, Mack Publishing Company, 19th ed.) describes formulations which can be used in connection with the subject invention.
For ease of administration, the subject compounds may be formulated into various pharmaceutical forms. As appropriate compositions there may be cited all compositions usually employed for systemically or topically administering drugs. To prepare the pharmaceutical compositions of this invention, atranorin or other polyphenolic lichen acid isolate, as the active ingredient is combined in intimate admixture with a pharmaceutically acceptable carrier, which may take a wide variety of forms depending on the form of preparation desired for administration. These pharmaceutical compositions are desirably in unitary dosage form suitable, preferably, for administration nasally, orally, rectally, percutaneously, or by parenteral injection. For example, in preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols and the like in the case of oral liquid preparations such as suspensions, syrups, elixirs and solutions; or solid carriers such as starches, sugars, kaolin, lubricants, binders, disintegrating agents and the like in the case of powders, pills, capsules and tablets. Because of their ease in administration, tablets and capsules often represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. For parenteral compositions, the carrier will usually comprise sterile water, at least in large part, though other ingredients, for example, to aid solubility, may be included. Injectable solutions, for example, may be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution.
Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g. each enantiomer and diastereomer, and a mixture of isomers, such as racemic or scalemic mixture. Compounds described herein can contain one or more asymmetric centers and, thus potentially give rise to diastereomers and optical isomers. Unless stated to the contrary, the present invention includes all such possible diastereomers as well as their racemic mixtures, their substantially pure resolved enantiomers, all possible geometric isomers, and pharmaceutically acceptable salts thereof. Mixtures of stereoisomers, as well as isolated specific stereoisomers, are also included.
Unless otherwise stated, structures depicted herein are also meant to include all isomeric (e.g., enantiomeric, diastereomeric, optical, and geometric (or conformational)) forms of the structure or a form thereof (including salts, solvates, esters, and prodrugs and transformed prodrugs thereof); for example, the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise stated, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms.
The compounds described herein or a form thereof described herein may include one or more chiral centers, and as such may exist as racemic mixtures (R/S) or as substantially pure enantiomers and diastereomers. The compounds may also exist as substantially pure (R) or (S) enantiomers (when one chiral center is present). In one embodiment, the compounds described herein or a form thereof described herein are (S) isomers and may exist as enantiomerically pure compositions substantially comprising only the (S) isomer. In another embodiment, the compounds described herein or a form thereof described herein are (R) isomers and may exist as enantiomerically pure compositions substantially comprising only the (R) isomer. As one of skill in the art will recognize, when more than one chiral center is present, the compounds described herein or a form thereof described herein may also exist as a (R,R), (R,S), (S,R) or (S,S) isomer, as defined by IUPAC Nomenclature Recommendations.
As used herein, the term “substantially pure” refers to compounds described herein or a form thereof consisting substantially of a single isomer in an amount greater than or equal to 90%, in an amount greater than or equal to 92%, in an amount greater than or equal to 95%, in an amount greater than or equal to 98%, in an amount greater than or equal to 99%, or in an amount equal to 100% of the single isomer. As used herein, the term “racemate'' refers to any mixture of isometric forms that are not “enantiomerically pure”, including mixtures such as, without limitation, in a ratio of about 50/50, about 60/40, about 70/30, or about 80/20, about 85/15 or about 90/10.
All stereoisomers (for example, geometric isomers, optical isomers and the like) of the present compounds described herein or a form thereof (including salts, solvates, esters and prodrugs and transformed prodrugs thereof), which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, diastereomeric and regioisomeric forms, are contemplated within the scope of the description herein. Individual stereoisomers of the compounds described herein or a form thereof described herein may, for example, be substantially free of other isomers, or may be present in a racemic mixture, as described supra.
Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and/or fractional crystallization. Enantiomers can be separated by use of a chiral HPLC column or other chromatographic methods known to those skilled in the art.
Enantiomers can also be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Masher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers.
The term “isotopologue” refers to isotopically-enriched compounds described herein or a form thereof which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature.
One or more compounds described herein or a form thereof described herein may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and the description herein is intended to embrace both solvated and unsolvated forms
As used herein, the term “solvate” means a physical association of a compound described herein or a form thereof described herein with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. As used herein, “solvate” encompasses both solution-phase and isolatable solvates.
The term “compound” as used herein refers to a chemical formulation, either organic or inorganic, that induces a desired pharmacological and/or physiological effect on a subject when administered in a therapeutically effective amount. “Compound” is used interchangeably herein with “drug” and “therapeutic agent”. When the compound name disclosed herein conflicts with the structure depicted, the structure shown will supersede the use of the name to define the compound intended.
The compounds described herein or a form thereof can form salts, which are intended to be included within the scope of this description. Reference to a compound or a form thereof herein is understood to include reference to salts thereof, unless otherwise indicated. The term “salt(s)”, as employed herein, denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases.
The term “pharmaceutically acceptable salt(s)”, as used herein, means those salts of compounds disclosed or a form thereof described herein that are safe and effective (i. e., nontoxic, physiologically acceptable) for use in mammals and that possess biological activity, although other salts are also useful. All such acid salts and base salts are intended to be included within the scope of pharmaceutically acceptable salts as described herein. In addition, all such acid and base salts are considered equivalent to the free forms of the corresponding compounds for purposes of this description.
The use of the terms “salt,” “solvate,” “ester,” “prodrug” and the like, is intended to apply equally to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates, isotopologues or prodrugs of the instant compounds.
As used herein , the term “ substituent ” means positional variables on the atoms of a core molecule that are attached at a designated atom position, replacing one or more hydrogen atoms on the designated atom, provided that the atom of attachment does not exceed the available valence or shared valence, such that the substitution results in a stable compound. Accordingly, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. Any carbon atom as well as heteroatom with a valence level that appears to be unsatisfied as described or shown herein is assumed to have a sufficient number of hydrogen atom (s) to satisfy the valences described or shown. As used herein, the term "and the like," with reference to the definitions of chemical terms provided herein, means that variations in chemical structures that could be expected by one skilled in the art include, without limitation, isomers (including chain, branching or positional structural isomers), hydration of ring systems (including saturation or partial unsaturation of monocyclic, bicyclic or polycyclic ring structures) and all other variations where allowed by available valences which result in a stable compound.
SARS-CoV-2 S protein consists of several important targets for the development of viral fusion and entry inhibitors.32 For example, neutralizing antibodies (nAbs) and other proteins inhibit SARS-CoV-2 infection by binding RBD in S1 subunit and blocking viral attachment to the receptor on the host cell.18 21 Peptides derived from the HR2 domain, such as 2019-nCoV- HR2P, suppress SARS-CoV-2 fusion and entry by interacting with the HR1 in S2 subunit and interfering with the interaction between HR1 and HR2 to form the fusion-active 6-HB.40
The inventors previously identified a series of pan-CoV fusion inhibitors, such as EK1 peptide and EK1 C4 lipopeptide, targeting the HR1 domain in S2 subunit of SARS-CoV-2 S protein with highly potent antiviral activity against all HCoVs tested.22-23 Therefore, these peptide- based pan-CoV fusion inhibitors can be developed for intranasally applied therapeutics for treatment of SARS-CoV-2 infection.37 However, their future clinical use may not be preferably selected because of their lack of oral bioavailability. The inventors also previously established several cyclic y-AApeptide-based OBTC combinatorial libraries in which the cyclic y- AApeptides possess high proteolytic enzyme stability and potent biological activity.26'30 For example, several cyclic y-AApeptides were identified to target EphA2, EGFR and HER2 with excellent binding affinity and specificity.27-30’31 Accordingly, the inventors sought to identify y- AApeptide-based pan-CoV fusion inhibitors with oral bioavailability.
The following non-limiting examples illustrate exemplary systems and components thereof in accordance with various embodiments of the disclosure. The examples are merely illustrative and are not intended to limit the disclosure in any way.
Example 1 - Development of cyclic y-AApeptide-based pan-CoV fusion and entry inhibitors with oral bioavailability
The inventors have successfully identified cyclic y-AApeptide-based pan-CoV fusion and entry inhibitors with oral bioavailability. More specifically, a cyclic y-AApeptide-based OBTC combinatorial library was first screened against SARS-CoV-2 S protein and 43 active beads with SARS-CoV-2 S protein-mediated cell-cell fusion inhibitory activity at 50 pM were identified. Upon validation, seven potential hits were selected for further evaluation using SARS-CoV-2 PsV infection assay. The four best hits with better PsV inhibitory activity, including S-20, were selected for modification. The inventors found that one of the derivative compounds, S-20-1 , exhibited the most potent inhibitory activities against infection by pseudotyped and authentic SARS-CoV-2 and highest SI (>1 ,000).
Most importantly, S-20-1 is highly resistant to proteolytic degradation (showing no noticeable degradation up to 24 h when it was incubated with Pronase) and has a long half-life (~24 h) with oral administration, which is much longer than the that (~2 h) of nirmatrelvir through oral administration.41 The inventors believe that the following two reasons may explain why S-20-1 with small size has a long half-life: 1 ) the unnatural backbones in y-AApeptides are highly resistant to enzymatic hydrolysis, and 2) the cyclization of y-AApeptides can rigidity functional groups to further increase stability towards proteolysis. In addition, S-20-1 possesses favorable oral bioavailability with Papp values of 30 10~6 cm/s. To further confirm its proteolytic stability, long half-life, and oral bioavailability, the inventors evaluate the prophylactic and therapeutic effects through the oral route once daily. S-20-1 may be used in combination therapies with other orally applicable COVID-19 drugs with different mechanism of action or targeting different proteins, such as MPro inhibitors (e.g., Paxlovid).42 These combinations may have synergistic effect and raise the genetic barrier to drug resistance.
Mechanistic studies suggested that S-20-1 acts at the early entry stage of the viral life cycle, including attachment, post-attachment stages and fusion stage, but not the post-entry stage. Further investigation demonstrated that S-20-1 has dual targets in S protein, including RBD in the S1 subunit and HR1 in S2 subunit, suggesting that it inhibited SARS-CoV-2 fusion with and entry into the host cell by binding with RBD to block its interaction with the ACE2 receptor on the host cell, just like neutralizing antibodies, and interacting with HR1 to interfere with fusion activity and 6-HB formation, just like EK1 (Fig. 1). Of course, it is impossible to allow one cyclic peptide to bind both RBD and HR1 at the same time because of its limit size. The inventors propose different S-20-1 molecules may bind RBD and HR1 simultaneously or separately to inhibit viral infection. HR1 is a highly conserved domain in S protein of HCoVs, providing the basis of broad-spectrum anti-HCoV activity of S-20-1 like the peptide-based pan-CoV fusion inhibitors EK1 and EK1 C4.22’23 Moreover, as S-20-1 could potently bind with RBD and HR1 in the spike protein, it is hard to generate the drug resistance in the clinical application.
Results
Library design, synthesis, and screening
Inspired by the backbone of the chiral peptide nucleic acid (PNA), the inventors recently developed a class of peptidomimetic y-AApeptides which shows remarkable resistance to proteolytic degradation, robust helical folding propensity, and promising applications in biomedical sciences.32 34 The chemodiversity and modular synthesis of y-AApeptides make them ideal candidates to create combinatorial libraries bearing unnatural ligands.26 30 To date, macrocyclic y-AApeptides have been identified to bind nucleic acids and proteins with high affinity and specificity.26 30 Here, the inventors have screened a library of y-AApeptides against S protein of SARS-CoV-2.
The inventors first constructed an OBTC combinatorial library comprised of thioether-bridge- mediated cyclic y-AApeptides as shown in Fig. 2 described in Shi et al. (2017) 27, herein incorporated into this disclosure in its entirety. They contained a diverse and random set of hydrophobic and charged side chain units, resulting in a theoretical diversity of 320,000 compounds, with each compound being encoded by an 8-mer peptide (Fig. 3a). The OBTC library was incubated with His-tag SARS-CoV-2 S protein, followed by incubation with Dylight 488 6x-His Tag Monoclonal Antibody (Fig. 3b). Putative positive beads were microscopically identified from the library pool (Fig. 4), and the encoding peptides were analyzed by tandem MS/MS of MALDI. The chemical structures of 43 putative hits were determined unambiguously (Fig. 5).
S-20-1, a modified cyclic y-AApeptide, exhibited high fusion inhibitory activity and low cytotoxicity
The inventors first assessed the inhibitory activity of these 43 putative hits in vitro using a SARS-CoV-2 S protein-mediated cell-cell fusion assay established in the lab.22-23’25 Under 50- pM concentration, 29 hits exhibited more than 50% inhibition (Fig. 6a). To confirm inhibitory activity and select final hits for further investigation, these compounds were tested again at a 5-pM concentration (Fig. 6b), revealing seven compounds (S-13, S-20, S-23, S-24, S-25, S- 30, and S-32) still able to efficiently inhibit SARS-CoV-2 S-mediated cell-cell fusion (> 80%). To further validate these compounds (Fig. 6c), the inventors used the well-established SARS- CoV-2 pseudovirus (PsV) infection assay22'23 25 to assess the inhibitory activity of these compounds against SARS-CoV-2 PsV infection as indicated by the half maximal inhibitory concentration (ICso). Their cytotoxicity was simultaneously evaluated, and half-maximal cytotoxic concentration (CCso) was calculated to determine selectivity index (SI=CC5o/IC5o). All seven compounds showed excellent antiviral activities against SARS-CoV-2 PsV infection with ICso of 1 -5 |j (Fig. 6d, Table 1 ). These compounds only exhibited cytotoxicity at noticeably higher concentration (Fig. 6e) and revealed decent selectivity with SI between 1.6 and 14.3 (Table 1 ).
Table 1 - Inhibitory activity, cytotoxicity, and selective index (SI) of the 7 lead compounds Compound IC50 CC50 SI Compound IC50 CC50 SI
(pM) (pM) (pM) (pM)
S-13 5.02 25.5 5.08 S-25 3.51 6.52 1.86
S-20 2.93 41.94 14.31 S-30 4.44 7.16 1.61
S-23 2.45 12.75 5.20 S-32 12.18 41.95 3.44
S-24 4.03 8.54 2.12
Note: The inhibitory activity and cytotoxicity of the compounds were tested using Huh-7 cells.
In determining whether the SI of these hits could be improved, the inventors believed that the low-to-moderate SI was caused by the ability of cyclic y-AApeptides to cross the host cell membrane and potentially work on intracellular targets. Therefore, negative charges could be introduced to decrease cell permeability, thereby minimizing potential cytotoxicity35-36 and increasing SI. To this end, the inventors added two negative charges to each of four compounds S-20, S-23, S-24, S-25 (Fig. 7a) that showed the best PsV inhibitory activity, and their ability to cross the cell membrane declined. No fluorescence was observed for S-20-1 at 1 pM (Fig. 7b v) after incubation with HeLa cells compared to S-20 (Fig. 7b ii) at the same condition, which showed strong fluorescence, demonstrating the abolishment of cell permeability of S-20-1 .
The modified compounds were then tested for antiviral activity and cytotoxicity using the PsV assay (Fig. 7c) and cytotoxicity assay (Fig. 7d). As shown in Table 2, modification of the compounds with negative charges did not significantly alter their antiviral activity. S-20-1 even revealed a >3-fold better activity (IC50: 0.8 pM) compared with S-20 (ICso: 2.9 pM), suggesting no effect of modification on the binding of these cyclic peptidomimetics toward S protein. Cytotoxicity of these compounds (Fig. 7d) was also largely diminished, leading to a remarkable improvement of SI (95 ~ >1 ,000) (Table 2). With ICso of 0.8 pM and the CC50 of more than 800 pM, S-20-1 exhibited an exceptional SI (>1 ,000). (Fig. 8a) Based on its performance, the inventors selected S-20-1 and tested its inhibitory activity against authentic SARS-CoV-2 infection of Caco-2 cells. As anticipated, S-20-1 effectively blocked authentic SARS-CoV-2 infection at the cellular level in a dose-dependent manner with an IC50 of 8.14 pM. (Fig. 7e), consistent with the results from the PsV infection assay. S-20-1 also exhibited low cytotoxicity on Caco-2 cells, with the CC50 of 692.7 pM (Fig. 8b).Taken together, S-20-1 was demonstrated to be a potent and highly selective inhibitor against SARS-CoV-2 infection (Fig. 7e, Table 2). Table 2 - Inhibitory activity, cytotoxicity, and selective index (SI) of the 4 selected compounds
Compound IC50 (pM) CC50 (pM) SI
S-20-1 0.8 > 800 > 1000
S-23-1 1.83 174.7 95.46
S-24-1 1.05 > 800 > 761.9
S-25-1 1.66 > 800 > 481.93
Note: The inhibitory activity and cytotoxicity of the compounds were tested using Huh-7 cells
S-20-1 efficiently inhibited various SARS-CoV-2 variants in different cell lines
Next, the inventors evaluated the in vitro efficacy of S-20-1 against infection by SARS-CoV-2 variants, as cited previously, and on different cell lines. The inventors found that S-20-1 potently inhibited infection by pseudotyped B.1.1.7 (Fig. 9a), B.1.351 (Fig. 9b), P.1 (Fig. 9c), C.37 (Fig. 9d), B.1.617.2 (Fig. 9e), B.1.1.529 (Fig. 9f), and the mutant with N501Y, K417N and E484K mutations (Fig. 9g) in the Huh-7 cell line with IC50 values ranging from 0.54 to 10.23 pM. The inventors also tested the anti-PsV activity of S-20-1 against some of the most virulent SARS-CoV-2 variants in Caco-2 cells. Its inhibitory activity was consistent with that for Huh-7 cells, revealing IC50 values ranging from 4.44 to 6.37 against B.1.1.7 (Fig. 9h), B.1 .351 (Fig. 9i), B.1 .617.2 (Fig. 9j) and B.1.1.529 (Fig. 9k). Together, S-20-1 exhibited broadspectrum inhibitory activity against predominant SARS-CoV-2 variants.
S-20-1 potently inhibited cell-cell fusion-mediated by S proteins of 5 HCoVs and blocked infection by 4 pseudotyped HCoVs and 1 pseudotyped bat SARSr-CoV, as well as 2 authentic HCoVs
As an analog of S-20, S-20-1 was expected to have strong binding affinity to S protein and have broad-spectrum antiviral activity against diverse HCoVs, including a-HCoV and -HCoV, since these HCoV share conserved regions in S protein. First, the inventors found that S-20-1 potently inhibited cell-cell fusion mediated by S protein of SARS-CoV-2 (Fig. 10a), SARS- CoV (Fig. 10b), MERS-CoV (Fig. 10c), HCoV-229E (Fig. 10d) and HCoV-NL63 (Fig. 10e) with ICsos ranging from 1 .47 to 5.44 pM, con- firming that S-20-1 is a pan-HCoV fusion inhibitor. S-20-1 also exhibited potent inhibitory activity against infection of pseudotyped SARS-CoV (Fig. 10f), MERS-CoV (Fig. 10g), HCoV-229E (Fig. 10h), HCoV-NL63 (Fig. 10i), and bat SARSr-CoV WIV1 (Fig. 10j) with ICsos ranging from 1 .30 to 12.02 pM, consistent with the result of SARS-CoV-2 PsV (Fig. 7c), indicating that S-20-1 is a pan-CoV entry inhibitor. Finally, like authentic SARS-CoV-2 (Fig. 7e), authentic HCoV-OC43 and HCoV-229E infection in RD cells and Huh-7 cells was effectively inhibited by S-20-1 with ICsos of 6.25 pM (Fig. 10k) and 9.46 pM (Fig. 101), respectively. The cytotoxicity of S-20-1 on RD cells was also detected with the CC50 of 274.2 pM (Fig. 8c). Overall, S-20-1 demonstrates broadspectrum antiviral activity against infection by HCoVs and SARSr-CoVs tested.
Intranasally applied S-20-1 efficiently protected mice from infection by HCoV-OC43 and SARS-CoV-2 Delta variant
To evaluate the protective effect of S-20-1 in vivo, the inventors first used an HCoV-OC43- infected mouse model to assess the prophylactic and therapeutic potential of S-20-1 as an antiviral agent (Fig. 11a). S-20-1 was administered to newborn mice in prevention or treatment group via the intranasal route at a single dose of 80 mg/kg 0.5 h pre- or postchallenge with HCoV-OC43 at 100 TCID50, respectively. At four days post-infection, mice were sacrificed, and brains were excised to evaluate viral load. As shown in Fig. 11b, relative HCoV-OC43 RNA level of both prevention and treatment group was significantly lower than that of non-treatment control group. Results showed that S-20-1 could effectively protect newborn mice from infection of HCoV-OC43.
The inventors then tested the protective efficacy of S-20-1 on SARS-CoV-2 Delta variant- infected hACE2-transgenic mouse model, C57BL/6-Tgtn (CAG-human ACE2- IRESLuciferaseWPRE-polyA)37 as described before (Fig. 11c). First, inhibitory activity was assessed against the SARS-CoV-2 Delta variant on Caco-2 cells in vitro, and viral load was significantly decreased about 2 logs (100-fold) at 50 pM concentration of S-20-1 (Fig. 11d). Then S-20-1 was intranasally administered at the dose of 60 mg/kg to hACE2-transgenic mice (female, eight weeks old) 0.5 h before (prevention group) or after (treatment group) at 10,000 pfu of SARS-CoV-2 Delta variant via the intranasal route. Viral load in the brain of mice in the prevention and treatment groups was 2.02 and 2.16 logs, respectively, lower than that in the non-treatment control group (Fig. 11e), while that in the lung of mice in the prevention and treatment groups was 2.5 logs and 2.3 logs, respectively, lower than that in the non-treatment control group (Fig. 11f). Therefore, intranasally administered S-20-1 exhibited prophylactic and therapeutic effect against SARS-CoV-2 Delta infection.
S-20-1 inhibited SARS-CoV-2 infection at the early stage of viral entry
To gain mechanistic insight of S-20-1 against SARS-CoV-2 infection, the inventors first used the time-of-removal assay to determine whether the inhibitory activity of S-20-1 resulted from binding to virus or host cell surface to block SARS-CoV-2 entry. S-20-1 were incubated with Huh-7 cells at 37 °C for 1 h and then cells were washed with PBS before SARS-CoV-2 was added. No inhibitory activity was observed after washing (Fig. 12a), suggesting that S-20-1 targets virus, not host cells. Next, S-20-1 was added to Huh-7 cells at different time points before, during, and after SARS-CoV-2 infection to determine affected stage of the viral life cycle. As shown in Fig. 12b, S-20-1 exhibited more than 80% inhibition of SARS-CoV-2 infection when added 0.5 h before, at the same time (0 h), or 0.5 and 1 h after the addition of virus. The inhibitory activity was then gradually decreased to -60% at 2 h and 4 h, 35% at 6 h, and 15% at 8 h, indicating that S-20-1 may target the early stage of the virus life cycle. Next, the inventors used a previously reported assay by adjusting the temperature to distinguish the process of entry, post-entry, attachment, and post- attachment38. As shown in Fig. 12c, S-20-1 could inhibit 80%, 70%, and 75% in the entry stage, attachment stage, and post-attachment stage, respectively, with no effect at the post-entry stage, in good agreement with its targeting at the early fusion stage. The inventors also assessed the inhibitory activity of S-20-1 against HCoV-OC43 infection with the same assays described above. As shown in Fig. 12d-e, S-20-1 exhibited results similar to those when SARS-CoV-2 was tested, suggesting that S-20-1 targets the early entry stage of SARS-CoV-2, HCoV-OC43, and other HCoVs.
The binding affinity of S-20 and S-20-1 toward various subunits in S protein was then determined by fluorescence polarization assays33. The inventors successfully obtained FITC- labeled cyclic y-AApeptides S-20 and S-20-1. (Fig. 13, 14 and Table 3). Both compounds exhibited excellent binding affinity toward S1 subunit with KD of 50 nM (Fig. 12f ) and 67 nM (Fig. 12g), respectively. This similarity confirmed that modification of S-20 with negative charges did not change its binding activity to S1 protein. The inventors next measured the binding affinity of both compounds toward RBD, revealing KD values of 57 nM (Fig. 12h) and 61 nM (Fig. 12i), respectively, suggesting that both S-20 and S-20-1 mainly target RBD on S1 subunit, which may account for their excellent inhibitory activity against SARS-CoV-2 in vitro. However, potent binding affinity to S1 subunit alone could not plausibly explain why S-20-1 exhibited broad-spectrum antiviral activity against various HCoVs, as the S1 subunit is not well conserved in S protein. Recalling that the inventors had previously identified EK1 peptide and EK1 C4 lipopeptide targeting the HR1 domain in S2 subunit of SARS-CoV-2 S protein22’23’25, S-20-1 might also bind to this domain. Indeed, the inventors found that S-20 and S-20-1 bound with HR1 domain tightly with KD values of 92 nM (Fig. 12j) and 277 nM (Fig. 12k), respectively, possibly explaining the broad-spectrum activity of S-20-1 toward various HCoVs. Interestingly, neither S-20 nor S-20-1 bound to the HR2 domain (Fig. 15), which is consistent with results from pan-CoV fusion inhibitor EK1 peptide that binds with HR1 , but not HR2. These results suggest that S-20-1 inhibit SARS- CoV-2 infection, possibly by binding RBD in S1 subunit and HR1 region in S2 subunit of S protein on virus separately. Co-crystallographic analysis of the S-20-1 /S protein complex is performed, in order to determine whether or not S-20-1 can bind RBD and HR1 regions in one S protein simultaneously.
Table 3 -HRMS of all compounds including FITC labeled compounds
Compound HRMS (ESI) ([M+2H] 2+) HRMS (ESI) ([M+2H] 2+) Found Molecular
Calcd weight
S-20 670.3692 670.3697 1 ,338.7239
S-20-1 841.9382 841.9393 1 ,681.8618
FITC-S-20 964.9549 964.9544 1 ,926.8918
FITC-S-20-1 1 ,101.0053 1 ,101.0040 2,200.6440
Docking of S-20, which shares the active group of S-20-1, with RBD or HR1
Using the Schrodinger Glide docking program30, the inventors could not dock S-20-1 with either RBD or HR1 because of S-20-1 ’s long tail. When the docking analysis was reperformed with S-20, which has no tail, to mimic S-20-1 , it was found that S-20 could bind with both RBD and HR1 via a number of hydrophilic and hydrophobic interactions.
As shown in Fig. 16a, b, the hydrophobic side chains of 1 a, 2a, 2b, 3b, and 4a of S-20 could form either Pi-Pi interaction or hydrophobic interactions with either one or more residues of 473Y, 421 Y, 455L, 456F, 489Y and 486F on RBD owing to close contacts. In addition, cationic 1 b and hydrophilic 4b may form hydrogen bonding with 459S and 487N, respectively. On the other hand, the arrangement of the hydrophobic and hydrophilic groups on S-20 also enables its favorable binding with the residues on HR1 (Fig. 16c, d). For instance, 1 a of S-20 deeply inserted into the hydrophobic domain formed by 930A, 931 1, 934I, and 938L from three HR1 chains on the HR1/ HR2 fusion core. Additionally, 2b, 3b, and 4a potentially adopted hydrophobic contacts with 942A, 945L, and 944A across different HR1 chains. Hydrophilic interactions between S-20 and HR1 could also be identified, including potential hydrogen bonds forming between 1 b and 935Q, 4b and 936D, respectively. Most residues in HR1 are highly conserved among HCoVs, including SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV- 229E, and HCoV-NL63/OC43, which may explain why S-20 and S-20-1 have broad-spectrum inhibitory activity against divergent HCoVs like EK1 peptide. Overall, the computational simulation is highly consistent with the experimental data, thus providing guidance to optimize and develop more potent derivatives. S-20-1 was resistant to various proteolytic enzymes in blood
The inventors next assessed the metabolic stability of S-20-1 in the presence of proteinase K and trypsin. As shown in Fig. 17a, b, the inhibition of SARS- CoV-2 PsV infection showed no decrease within 4-h incubation of S-20-1 in the presence of proteinase K and trypsin. Next, S- 20-1 was incubated for 24 h with Pronase, a broad-specificity mixture of proteases extracted from Streptomyces griseus, followed by analysis with RP-HPLC. S-20-1 was remarkably stable and showed no noticeable degradation, even at 24 h (Fig. 17c, d), indicating its high resistance to various proteolytic enzymes in blood.
S-20-1 possessed favorable passive permeability to the blood brain barrier (BBB) and gastrointestinal tract membranes, suggesting good oral bioavailability
The parallel artificial membrane permeability assay (PAMPA) is a high-throughput screening (HTS) technique to predict passive permeability by numerous different biological membranes, such as the gastrointestinal tract (GIT), blood brain barrier (BBB), and dermal layer39. Here, the inventors employed PAMPA-BBB to evaluate the ability of S-20-1 to penetrate the BBB and PAMPA-GIT to determine the gastrointestinal absorption rate and thus predict the oral bioavailability of S-20-1. For the PAMPA-BBB assay, Verapamil was used as positive control and Theophylline as negative control. The Papp values for favorable, medium, and low permeabilities are expected to be >20 x 10 6 cm/s, 1-20 x 10“® cm/s and <1 x 10 6 cm/s, respectively. Surprisingly, S-20 and S-20-1 at 100 pM displayed favorable permeability with Papp values of 536 x 10“6 cm/s and 30 x 10“6 cm/s, respectively, while Verapamil (positive control) at 50 |JM and Theophylline (negative control) at 250 pM exhibited Papp values of 155 x 10~6 and <10 x 10“6 cm/s, respectively (Fig. 18a). These results suggest that both S-20 and S-20-1 can effectively pass through BBB, which may explain why S-20-1 showed strong protection against SARS-CoV-2 infection in mouse brain.
For the PAMPA-GIT assay, Carbamazepine and Antipyrine were used as the positive and negative controls, respectively, as Carbamazepine is fully orally bioavailable with favorable permeability at pH 5.0, 6.2, and 7.4 with Papp values of 135 x 10“® cm/s, 158 x 10 6 cm/s and 160 x 10-® cm/s, respectively, while Antipyrine is poorly orally bioavailable with low Papp values at different pH values. S-20-1 displayed favorable permeability at pH 5.0, 6.2, and 7.4 with Papp at 616 x 10~6 cm/s, 326 x 10~6 cm/s and 31 x 10~6 cm/s, respectively (Fig. 18b). These results suggest that S-20-1 may have a higher absorption rate under fed conditions than that in fasted conditions. Therefore, S-20-1 is expected to have potential oral bioavailability. S-20-1 exhibited excellent pharmacokinetic (PK) profile and oral bioavailability tested in mouse model
To exploit the in vivo stability and oral bioavailability of S-20-1 , the inventors investigated its pharmacokinetics (Fig. 18c) by administering S-20-1 in C57BU6 mice via intraperitoneal (IP) and oral administration (OP) of S-20-1 at 50 mg/kg over 48 h, respectively. For IP administration, S-20-1 demonstrated excellent PK parameters with a long half-life (T1/2) of 14.53 h and a high peak concentration (Cmax) of 120,637 pg/L (Fig. 18d; Fig. 19). For OP administration, S-20-1 exhibited even longer half-life (T1/2 = 24.29 h) and an excellent oral bioavailability of -2.4%, compared to IP.
S-20-1 had good in vivo safety profiles in mouse model
Eight-week-old Balb/c mice were used to test the in vivo safety of S-20-1. Mice were administered with S-20-1 intranasally once daily for three days, and their body weight was monitored every day for 12 days (Fig. 20a). The body weight of mice in both S-20-1 and PBS groups exhibited no significant changes (Fig. 20b). The mice were euthanized on the 12th day (Fig. 20a) and their liver, lung, kidney, and brain tissues were collected. Histological sections of the tissues were stained with hematoxylin and eosin (H&E) and examined microscopically. Both S-20-1 and PBS groups showed similar histological features (Fig. 20c). No inflammatory changes were observed in these tissues, suggesting that S-20-1 is safe.
Materials and Methods
All chemicals were purchased from commercial suppliers and directly used without further purification. Fmoc-protected amino acids were purchased from Chem-impex and used for the building block preparation. TentaGel resin (0.23 mmol/g) used for OBTC library preparation was purchased from RAPP Polymere. Rink Amide-MBHA resin (0.55 mmol/g) used for the synthesis of cyclic y-AA peptides was purchased from GL Biochem. Analysis and purification of cyclic y-AA peptides was performed on the Waters Breeze 2 HPLC system and lyophilized on a Labcono lyophilizer. Purity of the compounds was determined to be > 95% by analytical HPLC. The mass of each compound was confirmed by high-resolution mass spectrometry detected by Agilent 6220 using electrospray ionization time-of-flight (ESI-TOF). MS/MS analysis for the decoding sequence was obtained with an Applied Biosystems 4700 Proteomics Analyzer.
293T, RD, and Caco-2 cells were purchased from ATCC and stocked in the laboratory. Huh-7 cells were obtained from the Chinese Academy of Science Cell Bank (Shanghai, China). Caco-2 cells were cultured in MEM containing 10% FBS. Other cells were cultured with DMEM containing 10 % FBS. HCoV-OC43 (VR-1558) and HCoV-229E (VR-740) were obtained from ATCC and propagated in the laboratory. SARS-CoV-2 (nCoV-SH01 , GenBank number: MT121215.1 ) and SARS-CoV-2 Delta variant were isolated by Fudan University.
One-Bead-Two-Compound library Synthesis, Screening, and Analysis
The OBTC library was synthesized as discussed in Huang et al (2020, Shi et al (2017), Shi et al. (2019), Yan et al. (2019), and Zheng et al. (2021 ), 26 30 herein incorporated by reference into this disclosure in their entirety.
Screening of One-Bead-Two-Compound library
Prescreening
All TentaGel beads were left to swell in DMF for 1 h, washed with Tris buffer three times, and equilibrated in Tris buffer overnight. After that, the beads were incubated with blocking buffer (1% BSA in Tris buffer with 1000x excess of Escherichia coli lysate) for 1 h. After thorough washing with Tris buffer, beads were incubated with 6x-His-Tag Monoclonal Antibody (HIS. H8) and Dylight 488 (1 : 1000 dilution) for 2 h at room temperature. Beads were washed with Tris buffer, and any beads emitting green fluorescence were picked up manually under microscopy and excluded from the next screening. The remaining beads were washed with Tris buffer and denatured by 8 M guandine-HCI for 1 h, followed by washing with DI water (5x), Tris buffer (5x) and DMF (5x). Finally, beads were incubated with DMF for 1 h and then equilibrated with Tris buffer overnight.
Screening
Beads were incubated with blocking buffer (1 % BSA in Tris buffer with 1000x excess of Escherichia coli lysate) for 1 h at room temperature. After washing with Tris buffer four times, beads were incubated with SARS-CoV-2 Spike Protein S1/S2 (aa11 -1208) and His Tag Recombinant Protein at the concentration of 50 nM for 4 h with 1 % BSA in Tris buffer and 1000x excess of Escherichia coli lysate. After thoroughly washing with Tris buffer, beads were incubated with 6x-His Tag Monoclonal Antibody (HIS. H8) and Dylight 488 (1 : 1000 dilution) for 2 h at room temperature. Next, beads were washed with Tris buffer four times and transferred into a six-well plate to be screened under a fluorescence microscope. Beads emitting green fluorescence were picked up as the putative hits.
Cleavage and Analysis Each positive bead was transferred into a 1.5 ml Eppendorf microtube and denatured in 100 pL 8 M guanidine-HCI for 1 h at room temperature. After thoroughly washing with Tris buffer, water, DMF, CAN, in the end, the bead was placed into ACN overnight in each microtube and allowed ACN to evaporate. Beads were cleaved in a 5:4:1 (v/v/v) solution of ACN/glacial acetic acid/HzO containing cyanogen bromide (CNBr) at a concentration of 50 mg/mL overnight at room temperature. After evaporation, the residue was dissolved in ACN/HzO (1 :1 ) and analyzed by MALDI-TOF.
Synthesis of FITC-labeled Cyclic y-AA peptides
FITC-labeled cyclic y-AA peptides were synthesized following the previous report.26-30 Briefly, Fmoc-Lys (Dde)-OH was first attached to Rink amide resin. After removing the Fmoc protecting group, the desired building blocks for sequence synthesis were added. Then the y- AA peptides were cyclized, removing the Dde protecting group and coupling with Fmoc-p-Ala. The removed Fmoc protecting group was reacted with FITC. FITC-labeled cyclic y-AA peptides were cleaved by 1 : 1 (v/v) DCM/TFA containing 2% triisopropylsilane and purified by the Waters HPLC system. Detailed structure information can be found in the Fig. 5.
Cell permeability assay
The cell permeability study was conducted following the previous report.33 Briefly, HeLa cells were plated in confocal dishes and serum-starved overnight. Following that, HeLa cells were treated with 1 pM FITC-labeled S-20 or S-20-1 , respectively, for 2 h and then washed with PBS buffer three times. Next, the cells were fixed with MeOH for 5 min at room temperature, followed by washing with PBS three more times. Cells were then incubated with 1 pg/mL DAPI/PBS for 15 min in the absence of light, followed by thoroughly washing with PBS again. Finally, cells were observed by the inverted Nikon fluorescence microscope.
Fluorescence polarization assay
50 nM FITC-labeled y-AApeptides were incubated with protein (0-2 pM) in PBS. Dissociation constants (Kd) were determined by plotting fluorescence anisotropy values as a function of protein concentration, and the plots were fitted to the following equation. y = [FPmin (FPmox — FPn ?)]
Figure imgf000032_0001
Lst and x refer to the concentration of the peptide and protein, respectively. The experiments were conducted in triplicate and repeated three times.
Molecular docking studies
Molecular docking studies were carried out as previously described.30 The molecular docking of S-20 toward RBD and HR1 was carried out using the Schrodinger Glide program. The conformational search of S-20 was performed using mixed torsional/low-mode sampling as implemented in Schrodinger (2015) with AMBER force field. The RBD (PDB: 6M0J) and HR1 (PDB: 7C53) of SARS-CoV-2 were chosen for docking. After removal of water and redundant small molecules using PyMol, the proteins were prepared using Schrodinger Protein Preparation Wizard with default settings. Grids were generated using the centroid of the interaction surface as the centers for docking. Docking was performed using the Glide module in Schrodinger (2015) with default parameters.
PAMPA-BBB assay
Following a previous report,30 the PAMPA-BBB assay procedure was developed by plON. All liquid handling steps were performed on the TECAN Freedom EVO150 robot and analyzed by Pion PAMPA Evolution software. BBB PAMPA included brain the sink buffer (BSB), lipid solution (BBB-1 ) and Stirwell™ PAMPA Sandwich plate preloaded with magnetic stirring disks. 4 pL of lipid solution were transferred into the acceptor well to which 200 pL of BSB (pH 7.4) were added. Then, 180 pL of diluted test compounds (50-250 pM in system buffer at pH 7.4 from a 10 mM DMSO solution) were added to the donor wells. The PAMPA sandwich plate was assembled, placed on the Gut-Box™ and stirred with 60 pm Aqueous Boundary Layer (ABL) settings for 1 h incubation. Distribution of compounds in the donor and acceptor buffer (150 pL aliquot) was determined by UV spectra measurement from 250 to 498 nm using the TECAC Infinite M-1000 Pro microplate reader. Permeability (Papp, 10'6cm/s) of each compound was calculated by Pion PAMPA evolution software. The assay was performed in triplicate.
PAMPA-GIT assay
PAMPA-GIT assay30 was also realized by using a method developed by plON. The inventors also used the TECAN Freedom EVO150 robot to perform all liquid handling steps and analyzed the data by plON's PAMPA Evolution software. The plON's GIT PAMPA includes the acceptor sink buffer (ASB), GIT-0 Lipid solution and the Stirwell™ PAMPA sandwich plate preloaded with magnetic disks. Four pL of lipid were transferred in the acceptor well, followed by addition of 200 pL of ASB (pH 7.4). Then, 180 pL of diluted test compound (50-250 pM in system buffer at pH 5.0, 6.2 and 7.4 from a 10 mM DMSO solution) were added to the donor wells. The PAMPA sandwich plate was assembled and placed on the Gur-Box™ and stirred with 40 pm Aqueous Boundary Layer (ABL) settings for 30 min. Distribution of the compounds in the donor and acceptor buffers (150 pL aliquot) was determined by UV spectra measurement from 250 to 498 nm using the TECAN Infinite M-1000 Pro microplate reader. Then the Permeability (Pe, cm.s 1) of each compound was calculated by Pion PAMPA evolution software. The assay was performed in triplicate.
Assessment of enzymatic stability of S-20- 1
Cyclic y-AA peptides S-20-1 (0.1 mg/mL) were incubated with 0.1 mg/mL protease in 100 mM ammonium bicarbonate buffer (pH 7.8) at 37 °C for 24 h. After that, water and ammonium bicarbonate in the reaction mixtures were removed using speed vacuum. The residues were dissolved in 100 pL H2O/ACN and analyzed on a Waters analytical HPLC system.
Inhibition of pesudovirus infection
Assays for measuring the inhibitory activity of the compounds against pseudotyped coronavirus infection were conducted as previously described in Liu et al (2022) and Zhou et al (2021 ),43’44 herein incorporated by reference into this disclosure in their entirety. Plasmids encoding spike protein of coronavirus, including SARS-CoV-2, SARS-CoV-2 variants (Alpha, Beta, gamma, lambda, Delta, Omicron), SARS-CoV, MERS-CoV, HCoV-OC43, HCoV-229E, SARSr-CoV WIV1 , luciferase reporter vector (pNL4-3. Luc.R-E-), and plasmids encoding EGFP were maintained in the laboratory. For the package of pseudoviruses, pcDNA3.1 - SARS-CoV-2-S and pNL4-3. Luc.R-E- were co-transfected into 293T cells using Vigofect transfection reagent, and then the supernatants were changed with fresh medium containing 10% FBS. After 48h, the supernatants containing pseudoviruses were collected, filtered with a 0.45 pm filter, and stocked. To determine the inhibitory activity of a given compound, target cells (Huh-7 cells) were seeded at 8000 per well in a 96-well plate and cultured at 37 °C for 12 hours. The compound was diluted with DMEM without FBS, and then the same volume of pseudoviruses was added. Afterwards, the mixture was transferred into Huh-7 cells and incubated for 30 min. After 12 hours, the mixture was replaced with fresh medium. Forty-eight hours later, the cells were lysed with cell lysis buffer, and luciferase activity was detected with the Luciferase Assay System (Promega, Madison, Wl, USA).
Inhibition of authentic coronavirus infection
The inhibitory activity of S-20-1 against authentic viruses was tested according to Guo et al. (2021 ), 45 herein incorporated by reference into this disclosure in its entirety. In brief, S-20-1 was serially diluted with DMEM without FBS. Then 100 TCID50 of virus were mixed with diluted S-20-1. After incubation for 30 min, the mixtures were transferred to target cells (RD for HCoV-OC43, Huh-7 for HCoV-229E, and Caco-2 for SARS-CoV-2 and SARS-CoV-2 Delta). The medium was changed 12 hours later, and cell viability was detected with CCK8 kit (HCoV-OC43 and HCoV-229E). For SARS-CoV-2 and SARS-CoV-2 Delta, the supernatants were collected after 48 hours. The viral RNA load was tested as reported in Guo et al (2021 ).45 Briefly, the viral RNA was extracted with RNA extraction kit (Transgene, China). Then the N gene of SARS-CoV-2 was tested by real-time RT-PCR. The sequence of primer and probe follows:
Forward: GGGGAACTTCTCCTGCTAGAAT (SEQ ID NO: 1 );
Reverse: CAGACATTTTGCTCTCAAGCTG (SEQ ID NO: 2);
Probe: 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3' (SEQ ID NO: 3)
Inhibition of S protein-mediated cell-cell fusion
The cell-cell fusion assay was established and performed as in Liu et al. (2021 ), 46 herein incorporated into this disclosure in its entirety. In brief, PAAV-IRES-EGFP S was transfected to 293T cells to obtain effector cells expressing S protein of coronaviruses, including SARS- CoV-2, SARS-CoV, MERS-CoV, HCoV-229E and HCoV-NL63, and GFP. Then serially diluted S-20-1 was mixed with effector cells, and the mixture was transferred to Huh-7 cells (target cells). For SARS-CoV and NL63 S-mediated cell-cell fusion assay, trypsin (80 mg/ml) was added to the mixture. After incubation for 2-4 hours, fused cells were counted, and the fusion rate was calculated to determine inhibitory activity.
Time-of-addition assay and time-of-removal assay
Assays were performed as described in Yang et al. (2015) and Si et al. (2018), 38’47 herein incorporated by reference into this disclosure in their entirety. For time-of-addition assay, Huh-7 cells (for pseudotyped SARS-CoV-2) and RD cells (for HCoV-OC43) were seeded into a 96-well plate at 10,000 per well, respectively. S-20-1 was added at the final concentration of 50 pM 0.5 h before or 0, 0.5, 1 , 2, 4, 6, and 8 h after addition of SARS-CoV-2 pseudoviruses or HCoV-OC43 (100 TCID50). The inhibitory activity of S-20-1 was determined as described above.
For time-of-removal assay, S-20-1 was added to Huh-7 cells to incubate at 37 °C for 1 hour. After S-20-1 was removed, SARS-CoV-2 pseudovirus was added to infect cells. S-20-1 was not removed from the group set as control. The medium was changed 12 hours later, and luciferase activity was tested as described above.
Assays for detecting viral entry, attachment, post-attachment, and post-entry
Viral entry assay was performed as previously described in Liu et al. (2020) and Fang et al. (2021 ),38’47 herein incorporated by reference into this disclosure in their entirety. Briefly, S-20- 1 and virus were added to target cells at 37 °C for 1 hour, and then cells were washed with cold PBS three times. To perform the viral attachment assay, the mixture of S-20-1 and virus was added to target cells to incubate for 1 hour at 4 °C before washing with cold PBS. For the post-attachment assay, virus was incubated with target cells at 4 °C for 1 hour. Then the cells were thoroughly washed with cold PBS to remove unattached virus. S-20-1 was added and incubated at 37 °C for an additional 1 hour. The post-entry assay was performed like the postattachment assay, except that virus was incubated with cells at 37 °C. The inhibition effects of S-20-1 were detected as above.
Cytotoxicity assay
Cytotoxicity of compound to cells (Huh-7 cells and Caco-2 cells) was tested as previously described in Xia et al.,.22 herein incorporated by reference in its entirety into this disclosure. Briefly, serially diluted compounds were added to target cells. After culture at 37 °C for 12 hours, the medium was changed with fresh medium. Forty-eight hours later, the supernatant was removed, and cell viability was analyzed with Cell Counting Kit (CCK-8). In a 96-well plate, 100 pL of diluted CCK8 reagent were added to each well, and the absorbance was measured at 450 nm.
Mouse pharmacokinetic studies
In two separate experiments, S-20-1 was administered either p.o. or i.p. to mice at the dose of 50 mg/kg, volume 150 pL. Following administration, 100 |_iL blood samples were collected at 10 min, 20 min, 30 min, 1 h, 2 h, 4 h, 8 h, 24 h and 48 h (n=3 per time point, and each mouse was used for three time points; thus 9 mice were used for either p.o. or i.p., making a total of 18 mice). After drug administration, 100 pL of blood were collected into 1.5-mL Eppendorf tubes containing 30 pL disodium EDTA (0.5 M, pH 8.0) and kept on ice until plasma collection (< 30 min), followed by centrifugation at 4,000 rpm/min for 10 min at 4 °C. sera were collected and stored at -80 °C for future analysis. Serum samples of 50 pL were added to 135 pL acetonitrile and 15 pL glacial acetic acid. Samples were allowed to rest on ice for 15 min and then centrifuged at 10,000 rpm and 4 °C for 15 min. Clarified supernatants were transferred to vials and analyzed by LC/MS/MS. PK parameters were obtained using PKSolver. Evaluation of the in vivo protective activity of S-20-1
The protective effect of S-20-1 against coronavirus in vivo was performed according to Xia et al. (2020), 22 herein incorporated by reference in its entirety into this disclosure. Animal studies were approved by the Institutional Laboratory Animal Care and Use Committee at Fudan University (Approval number: 20200821 -002). For HCoV-OC43, infected newborn mice were established as previously described. Pregnant Balb/c mice (18 days) were separated into three groups after delivery of their offspring. Each group contained seven newborn mice. For mice in the prophylactic and therapeutic groups, S-20-1 was administered through the intranasal route at 80 mg/kg before or after challenge with HCoV-OC43. At the 4th day postinfection, the newborn mice were dissected. The relative viral RNA expression level in brain was tested through RT-PCR and calculated as 2< aact>. The HCoV-OC43 RNA level was adjusted with mouse housekeeping gene GAPDH. The primer of HCoV-OC43 and GAPDH follows:
OC43-S-Forward: GACACCGGTCCTCCTCCTAT (SEQ ID NO: 4);
OC43-S-Reverse: ACACTTCCCTTCAGTGCCAT (SEQ ID NO: 5);
GDPAH-Forward: TGCTGTCCCTGTATGCCTCTG (SEQ ID NO: 6);
GDPAH-Reverse: TTGATGTCACGCACGATTTCC (SEQ ID NO: 7).
For SARS-CoV-2 Delta, C57BL/6-Tgtn (CAG-human ACE2-IRES-LuciferaseWPRE-polyA) transgenic mice infected with SARS-CoV-2 were used as described in Xia et al. (2021 ).37 Eight- week-old female hACE2 transgenic mice were challenged with SARS-CoV-2 Delta variant at 10,000 pfu via the intranasal route. For prevention and therapy groups, S-20-1 was administered at the dose of 60 mg/kg through the intranasal route 30 min before or after viral challenge. Then the mice were euthanized at 4 days post-infection, and brains, lungs and intestines were dissected. Viral RNA was extracted with TRIzol reagent according to the manual. Real-time RT-PCR was conducted to evaluate viral RNA load in tissues as described previously.
Evaluation of in vitro proteolytic enzyme stability and in vivo safety of S-20-1
For stability, the resistance of S-20-1 to proteinase K and trypsin was performed as previously described in Zhou et al. (2021 ), 44 herein incorporated in its entirety into this disclosure. S-20-1 was incubated with proteinase K (1 microunit/ml) for different time and then centrifuged at 500 g for 5 min to remove the proteinase K. To determine the stability of S-20-1 against trypsin, S- 20-1 was incubated with trypsin (25 mg/ml) for different time, followed by addition of FBS to final proportion of 20% and heated at 56 °C for 30 min to inactivate trypsin. The inhibitory activity of treated S-20-1 was tested on Huh-7 cells.
Eight-week-old mice (two groups, n=6) were used to evaluate the safety of S-20-1 in vivo. As described in Fang et al. (2021 ), 48 herein incorporated by reference in its entirety into this disclosure, 100 mg/kg S-20-1 were intranasally administered to mice daily for three consecutive days. Then bodyweight was monitored for 12 days, followed by observing the behavior of mice. At 12 days, mice were euthanized to harvest the brains, lungs, livers, and kidneys for hematoxylin and eosin staining.
Statistical analysis
Student's t test and Analysis of Variance (ANOVA) were used to compare the difference by GraphPad Prism in this manuscript. * P < 0.05, " P < 0.01 , *** P < 0.001 , and **** P < 0.0001.
Conclusion
In conclusion, the inventors identified a modified cyclic y-AApeptide-based pan-CoV fusion and entry inhibitor, S-20-1. By targeting the RBD in S1 subunit and HR1 in S2 subunit of S protein, S-20-1 exhibited potent and broad-spectrum inhibitory activity against infection by SARS-CoV-2, its variants, and other HCoVs, as well as bat SARSr-CoVs. It protected mice from infection of SARS-CoV-2 and HCoV-OC43 infection with a good in vivo safety profile. Most importantly, S-20-1 was highly resistant to proteolytic degradation, and it exhibited long half-life and favorable oral bioavailability. As such, S-20-1 is a promising orally deliverable antiviral therapeutic and prophylactic candidate against current SARS-CoV-2 and its variants, as well as future emerging and re-emerging HCoVs.
Example 2 - Treatment of CoV-2 infection with S-20-1 (prophetic)
A 49 year old male patient presents with headache, vomiting, nausea, and loss of taste and smell. A diagnosis of CoV-2 infection is confirmed. The patient is orally administered a therapeutically effective amount of a composition comprising S-20-1 for a time period sufficient to alleviate the symptoms. The patient is retested twice over a several week timespan and tests negative for the virus.
Example 3 - Prophylactic treatment of CoV-2 infection with S-20-1 (prophetic)
A 38 year old female patient tests negative for COVID-19 and is orally administered a therapeutically effective amount of a composition comprising S-20-1. The female is exposed to the CoV-2 virus through contact with multiple people infected with the virus. The female does not develop a CoV-2 infection as confirmed by testing.
The sequence listing entitled “Novel Cyclic Gamma AApeptide Pan-Coronavirus Inhibitor and Method of Treating Coronavirus Infection” in XML format, created on August 1 1 , 2023 and being 8,000 bytes in size, is hereby incorporated by reference into this disclosure.
References
1 Haque, A. & Pant, A. B. Efforts at COVID-19 Vaccine Development: Challenges and Successes. Vaccines 8, 739 (2020).
2 Weston, S. et al. Broad Anti-coronavirus Activity of Food and Drug Administration- Approved Drugs against SARS-CoV-2 In Vitro and SARS-CoV In Vivo. J. Virol. 94, e01218-20 (2020).
3 Davies, N. G. et al. Increased mortality in community-tested cases of SARS-CoV-2 lineage B.1.1.7. Nature 593, 270-274 (2021 ).
4 Andreano, E. et al. Hybrid immunity improves B cells and antibodies against SARS- CoV-2 variants. Nature 600, 530-535 (2021 ).
5 Mlcochova, P. et al. SARS-CoV-2 B.1.617.2 Delta variant replication and immune evasion. Nature 599, 114-119 (2021 ).
6 Ai, J. et al. Omicron variant showed lower neutralizing sensitivity than other SARS- CoV-2 variants to immune sera elicited by vaccines after boost. Emerg. Microbes. Infect. 11 , 337-343 (2022).
7 Woo, P. C. et al. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J. Virol. 86, 3995-4008 (2012).
8 Hu, T. et al. A comparison of COVID-19, SARS and MERS. PeerJ B, e9725 (2020).
9 Lin, M. H. et al. Disulfiram can inhibit MERS and SARS coronavirus papain-like proteases via different modes. Antiviral. Res. 150, 155-163 (2018).
10 Sheahan, T. P. et al. Comparative therapeutic efficacy of remdesivir and combination lopinavir, ritonavir, and interferon beta against MERS-CoV. Nat. Commun. 11 , 222 (2020). 11 Wang, M. et al. Remdesivir and chloroquine effectively inhibit the recently emerged novel coronavirus (2019-nCoV) in vitro. Cell Res. 30, 269-271 (2020).
12 Zaher, N. H., Mostafa, M. I. & Altaher, A. Y. Design, synthesis and molecular docking of novel triazole derivatives as potential CoV helicase inhibitors. Acta Pharm. 70, 145-159 (2020).
13 O'Keefe, B. R. et al. Broad-spectrum in vitro activity and in vivo efficacy of the antiviral protein griffithsin against emerging viruses of the family Coronaviridae. J. Virol. 84, 251 1 -2521 (2010).
14 Owen, D. R. et al. An oral SARS-CoV-2 Mpro inhibitor clinical candidate for the treatment of COVID-19. Science 374, 1586-1593 (2021 ).
15 Bloom, J. COVID Rebound Following Paxlovid Therapy; Should We Worry? (April 26, 2022)
16 Artese, A. et al. Current status of antivirals and druggable targets of SARS CoV-2 and other human pathogenic coronaviruses. Drug Resist. Updat. 53, 100721 (2020).
17 Sacco, M. D. et al. The P132H mutation in the main protease of Omicron SARS-CoV- 2 decreases thermal stability without compromising catalysis or small-molecule drug inhibition. Cell Res. 30, 498-500 (2022).
18 Cao, L. et al. De novo design of picomolar SARS-CoV-2 miniprotein inhibitors. Science 370, 426-431 (2020).
19 Jiang, S., Hillyer, C. & Du, L. Neutralizing Antibodies against SARS-CoV-2 and Other Human Coronaviruses. Trends Immunol. 41, 355-359 (2020).
20 Starr, T. N. et al. SARS-CoV-2 RBD antibodies that maximize breadth and resistance to escape. Nature 597, 97-102 (2021 ).
21 Kim, C. et al. A therapeutic neutralizing antibody targeting receptor binding domain of SARS-CoV-2 spike protein. Nat. Commun. 12, 288 (2021 ).
22 Xia, S. et al. Inhibition of SARS-CoV-2 (previously 2019-nCoV) infection by a highly potent pan-coronavirus fusion inhibitor targeting its spike protein that harbors a high capacity to mediate membrane fusion. Cell Res. 30, 343-355 (2020). 23 Xia, S. et al. A pan-coronavirus fusion inhibitor targeting the HR1 domain of human coronavirus spike. Sci. Adv. 5, eaav4580 (2019).
24 de Vries, R. D. et al. Intranasal fusion inhibitory lipopeptide prevents direct-contact SARS-CoV-2 transmission in ferrets. Science 371 , 1379-1382 (2021 ).
25 Lan, Q. et al. 25-Hydroxycholesterol-Conjugated EK1 Peptide with Potent and Broad- Spectrum Inhibitory Activity against SARS-CoV-2, Its Variants of Concern, and Other Human Coronaviruses. Int. J. Mol. Sci. 22 11869 (2021 ).
26 Huang, B. et al. Activation of E6AP/UBE3A-Mediated Protein Ubiquitination and Degradation Pathways by a Cyclic gamma-AA Peptide. J. Med. Chem. 65, 2497-2506 (2022).
27 Shi, Y. et al. One-Bead-Two-Compound Thioether Bridged Macrocyclic gamma- AApeptide Screening Library against EphA2. J. Med. Chem. 60, 9290-9298 (2017).
28 Shi, Y. et al. Stabilization of IncRNA GAS5 by a Small Molecule and Its Implications in Diabetic Adipocytes. Cell Chem. Biol. 26, 319-330 (2019).
29 Yan, H. et al. Cyclic Peptidomimetics as Inhibitor for miR-155 Biogenesis. Mol. Pharm. 16, 914-920 (2019).
30 Zheng, M. ef al. Discovery of Cyclic Peptidomimetic Ligands Targeting the Extracellular Domain of EGER. J. Med. Chem. 64, 11219-11228 (2021 ).
31 Zheng, M. et al. Peptidomimetic-based antibody surrogate for HER2. Acta Pharm. Sin. B. 11 , 2645-2654 (2021 ).
32 Sang, P. et al. alpha-Helix-Mimicking Sulfono-gamma-AApeptide Inhibitors for p53- MDM2/MDMX Protein-Protein Interactions. J. Med. Chem. 63, 975-986 (2020).
33 Sang, P. et al. Inhibition of beta-catenin/B cell lymphoma 9 protein-protein interaction using alpha-helix-mimicking sulfono-gamma-AApeptide inhibitors. Proc. Natl. Acad. Sci. U. S. A. 116, 10757-10762 (2019).
34 Sang, P. et al. The activity of sulfono-y-AApeptide helical foldamers that mimic GLP- 1 . Sci. Adv. 6, eaaz4988 (2020).
35 Skotland, T., Iversen, T. G., Torgersen, M. L. & Sandvig, K. Cell-penetrating peptides: possibilities and challenges for drug delivery in vitro and in vivo. Molecules 20, 13313-13323 (2015). 36 Yang, N. J. & Hinner, M. J. Getting across the cell membrane: an overview for small molecules, peptides, and proteins. Methods Mol. Biol. 1266, 29-53 (2015).
37 Xia, S. et al. Structural and functional basis for pan-CoV fusion inhibitors against SARS-CoV-2 and its variants with preclinical evaluation. Signal Transduct Target Ther G, 288 (2021 ).
38 Liu, Z. et al. Sodium Copper Chlorophyllin Is Highly Effective against Enterovirus (EV) A71 Infection by Blocking Its Entry into the Host Cell. ACS Infect. Dis. 6, 882-890 (2020).
39 Bujard, A., Petit, C., Carrupt, P. A., Rudaz, S. & Schappler, J. HDM-PAMPA to predict gastrointestinal absorption, binding percentage, equilibrium and kinetics constants with human serum albumin and using 2 end-point measurements. Eur. J. Pharm. Sci. 97, 143-150 (2017).
40 Xia, S. et al. Fusion mechanism of 2019-nCoV and fusion inhibitors targeting HR1 domain in spike protein. Cell Mol Immunol 17, 765-767 (2020).
41 Sigh, R. S. P. et al. Innovative Randomized Phase I Study and Dosing Regimen Selection to Accelerate and Inform Pivotal COVID-19 Trial of Nirmatrelvir. Clin. Pharmacol. Ther. 112, 101 -11 1 (2022).
42 Tanne, J. H. Covid-19: FDA authorizes pharmacists to prescribe Paxlovid. BMJ 378, 01695 (2022).
43 Liu, Z. et al. A novel STING agonist-adjuvanted pan-sarbecovirus vaccine elicits potent and durable neutralizing antibody and T cell responses in mice, rabbits and NHPs. Cell Res. 32, 269-287 (2022).
44 Zhou, J. et al. A highly potent and stable pan-coronavirus fusion inhibitor as a candidate prophylactic and therapeutic for COVID-19 and other coronavirus diseases. Acta Pharm. Sin. B. 12, 1652-1661 (2021 ).
45 Guo, L. et al. Engineered trimeric ACE2 binds viral spike protein and locks it in "Three-up" conformation to potently inhibit SARS-CoV-2 infection. Cell Res. 31 , 98-100 (2021 ).
46 Liu, Z. et al. An ultrapotent pan-beta-coronavirus lineage B (beta-CoV-B) neutralizing antibody locks the receptor-binding domain in closed conformation by targeting its conserved epitope. Protein Cell 13, 655-675 (2021 ). 47 Si, L. et al. Triterpenoids manipulate a broad range of virus-host fusion via wrapping the HR2 domain prevalent in viral envelopes. Sci. Adv. 4, eaau8408 (2018).
48 Fang, Y. et al. Inhibition of viral suppressor of RNAi proteins by designer peptides protects from enteroviral infection in vivo. Immunity 54, 2231 -2244 (2021 ).
The disclosures of all publications cited above are expressly incorporated herein by reference, each in its entirety, to the same extent as if each were incorporated by reference individually.
It is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described, and all statements of the scope of the invention which, as a matter of language, might be said to fall there between. Now that the invention has been described,

Claims

What is claimed is:
1 . A compound selected from the group consisting of compounds S-1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-11 , S-12, S-13, S-14, S-15, S-16, S-17, S-18, S- 19, S-20, S-21 , S-22, S-23, S-24, S-25, S-26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5, compounds S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A, derivatives, and isomers thereof.
2. The compound of claim 1 , wherein the compound is selected from the group consisting of the compounds S-13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof.
3. The compound of claim 2, wherein the compound is selected from the group consisting of S-20, S-20-1 , derivatives, and isomers thereof.
4. A method of treating a coronavirus infection in a patient in need thereof comprising: administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S- 20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S- 25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier; wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to treat the coronavirus infection of the patient.
5. The method of claim 4, wherein the compound is S-20.
6. The method of claim 4, wherein the compound is S-20-1 .
7. The method of claim 4, wherein the coronavirus is selected from the group consisting of severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1 ), severe acute respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof. The method of claim 7, wherein the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof. The method of claim 8, wherein the variants are selected from the group consisting of B.1 .1 .7 (Alpha), B.1 .351 (Beta), B.1 .1 .248 (Gamma), B.1 .617.2 (Delta), and B.1.1.529 (Omicron). The method of claim 4, wherein the composition is administered orally. A method of preventing a coronavirus infection in a patient in need thereof comprising: prophylactically administering to the patient in need thereof a therapeutically effective amount of a composition comprising a compound selected from the group consisting of S-13, S- 20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S- 25-1 , derivatives, and isomers thereof; and a pharmaceutically acceptable carrier; wherein the compound binds to a spike protein of the coronavirus to block viral attachment and fusion to prevent the coronavirus infection of the patient. The method of claim 1 1 , wherein the compound is S-20. The method of claim 1 1 , wherein the compound is S-20-1. The method of claim 1 1 , wherein the coronavirus is selected from the group consisting of respiratory syndrome coronavirus 2 (SARS CoV-2), Middle East respiratory syndrome coronavirus (MERS-CoV), human coronavirus OC43 (HcoV-OC43), human coronavirus HKU1 (HCoV-HKU1 ), human coronavirus NL63 (HCoV-NL63), human coronavirus 229E (HcoV-229E), SARS-related coronavirus WIV1 (SARSr-CoV-WIV1 ), and variants thereof.
15. The method of claim 14, wherein the coronavirus is severe acute respiratory syndrome coronavirus 2 (SARS CoV-2) virus or variants thereof.
16. The method of claim 15, wherein the variants are selected from the group consisting of B.1 .1 .7 (Alpha), B.1 .351 (Beta), B.1 .1 .248 (Gamma), B.1 .617.2 (Delta), and B.1.1.529 (Omicron).
17. The method of claim 1 1 , wherein the composition is administered orally.
18. A kit for treating or preventing coronavirus infection comprising: a composition comprising a therapeutically effective amount of at least one cyclic y AApeptide pan-CoV fusion inhibitor; and a pharmaceutically acceptable carrier; and instructions for use of the composition.
19. The kit of claim 18, wherein the at least one cyclic y AApeptide pan-CoV fusion inhibitor is a compound selected from the group consisting of S-1 , S-2, S-3, S-4, S-5, S-6, S-7, S-8, S-9, S-10, S-1 1 , S-12, S-13, S-14, S-15, S-16, S-17, S-18, S- 19, S-20, S-21 , S-22, S-23, S-24, S-25, S-26, S-27, S-28, S-29, S-30, S-31 , S-32, S-33, S-34, S-35, S-36, S-37, S-38, S-39, S-40, S-41 , S-42, and S-43 shown in Figure 5; S-20-1 , S-23-1 , S-24-1 , and S-25-1 shown in Figure 7A; derivatives; and isomers thereof.
20. The kit of claim 19, wherein the at least one cyclic y AApeptide pan-CoV fusion inhibitor is a compound selected from the group consisting of the compounds S- 13, S-20, S-23, S-24, S-25, S-30, S-32, S-20-1 , S-23-1 , S-24-1 , S-25-1 , derivatives, and isomers thereof.
21 . The kit of claim 20, wherein the compound is selected from the group consisting of S-20, S-20-1 , derivatives, and isomers thereof.
PCT/US2023/072368 2022-08-17 2023-08-17 Novel cyclic gamma aapeptide pan-coronavirus inhibitor and method of treating coronavirus infection WO2024040156A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263371671P 2022-08-17 2022-08-17
US63/371,671 2022-08-17

Publications (2)

Publication Number Publication Date
WO2024040156A2 true WO2024040156A2 (en) 2024-02-22
WO2024040156A3 WO2024040156A3 (en) 2024-04-11

Family

ID=89942272

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/072368 WO2024040156A2 (en) 2022-08-17 2023-08-17 Novel cyclic gamma aapeptide pan-coronavirus inhibitor and method of treating coronavirus infection

Country Status (1)

Country Link
WO (1) WO2024040156A2 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MX2022011231A (en) * 2020-03-11 2022-11-07 Biolinerx Ltd Cxcr4 inhibitor for the treatment of acute respiratory distress syndrome and viral infections.
US11753447B2 (en) * 2020-07-31 2023-09-12 The Regents Of The University Of California Cyclic peptides, methods of synthesis, and methods of treatment
US20230042837A1 (en) * 2021-06-16 2023-02-09 University Of South Florida Cyclic compounds for treating cancer

Also Published As

Publication number Publication date
WO2024040156A3 (en) 2024-04-11

Similar Documents

Publication Publication Date Title
KR101755058B1 (en) Combinations of a specific hcv ns5a inhibitor and an hcv ns3 protease inhibitor
JP2021046436A (en) Peptidomimetic macrocycles and formulations thereof
KR101153254B1 (en) Antiviral compounds and methods
EA012650B1 (en) Use of [d-meala]-[etval]-cyclosporin for the treatment of hepatitis c infection and pharmaceutical composition comprising said [d-meala]-[etval]-cyclosporin
EA022303B1 (en) Combinations of hepatitis c virus inhibitors
CN111643656B (en) Broad-spectrum coronavirus membrane fusion inhibitor and application thereof in resisting AIDS virus
JP2014510746A (en) Macrocyclic compound and method for producing the same
JP5894935B2 (en) Sangliferin compounds
US20180327458A1 (en) Pharmaceutical compositions for prevention or treatment of neurodegenerative diseases
US20180305345A1 (en) Compositions and methods for enhancing oncolytic virus efficacy
US20200199624A1 (en) Recombinant oncolytic virus
Wang et al. Characterisation and evaluation of antiviral recombinant peptides based on the heptad repeat regions of NDV and IBV fusion glycoproteins
EA022408B1 (en) Sanglifehrin derivatives and methods for their production
WO2024040156A2 (en) Novel cyclic gamma aapeptide pan-coronavirus inhibitor and method of treating coronavirus infection
CA3207775A1 (en) Compounds for use in the treatment of sinusitis, pneumonia or otitis
WO2014066502A2 (en) Flavivirus protease inhibitors
WO2020014652A1 (en) Peptoid-peptide macrocycles, pharmaceutical compositions and methods of using the same
US10774114B2 (en) Respiratory syncytial virus (RSV) replication inhibitors
US11834480B2 (en) Protein inhibitors with reduced immunogenicity and resistance to degradation, and methods for their preparation and use
US11331371B2 (en) Labyrinthopeptins as anti-viral agents
US20230355725A1 (en) Neil2 protein therapy for treatment of viral infection
WO2017214076A1 (en) Peptides having tetrahedral mimicking groups as inhibitors of rhomboid proteases
WO2023235109A1 (en) Novel main protease inhibitors, and compositions and methods thereof
Xue Development of Antiviral Peptidomimetics
JP2022541030A (en) Anti-infective action of hnRNPA2B1 and its application

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23855670

Country of ref document: EP

Kind code of ref document: A2