WO2024037430A1

WO2024037430A1 - Composition and method for establishing genetic transformation system by taking petiole of echinacea purpurea (linn.) moench as explant

Info

Publication number: WO2024037430A1
Application number: PCT/CN2023/112437
Authority: WO
Inventors: 吴鸿; 杨李文; 何韩军; 杨跃生
Original assignee: 岭南现代农业科学与技术广东省实验室
Priority date: 2022-08-16
Filing date: 2023-08-11
Publication date: 2024-02-22
Also published as: CN115197960A

Abstract

Disclosed are a composition and method for establishing a genetic transformation system by taking the petiole of Echinacea purpurea (Linn.) Moench as an explant. The present invention belongs to the technical field of plant genetic engineering breeding. The composition comprises: an agrobacterium infection solution; an MS propagation culture medium; an MS antibacterial culture medium; an MS resistance screening 1 culture medium; an MS resistance screening 2 culture medium; and a rooting induction culture medium. The method for establishing the genetic transformation system is provided. Echinacea purpurea (Linn.) Moench can be rapidly and effectively subjected to genetic transformation. The method is simple and convenient, and a large number of explant materials with consistency can be obtained while reserving stock plants and reducing the damage to the stock plants, which is beneficial to the transgenic plants to maintain their original excellent traits and have transgenic functions.

Description

A composition and method for establishing a genetic transformation system using Echinacea petioles as explants

Technical field

The present invention relates to the technical field of plant genetic engineering breeding, and more specifically to a composition and method for establishing a genetic transformation system using Echinacea petioles as explants.

Background technique

Echinacea purpurea (Linn.) Moench) is a perennial herbaceous plant of the genus Echinacea in the family Compositea. Its flowers are composed of tubular flowers and tongue-shaped flowers. They are shaped like pine cones and are also called pine cones. chrysanthemum. It originated in North America and is a local herb with high medicinal value. For example, its roots contain polysaccharides, phenolic compounds, alkyl amides and other active substances, which have anti-inflammatory, antifungal, antioxidant and other effects; in addition, it is composed of Echinacea purpurea The brewed medicine can treat trauma, coughs, colds, respiratory infections, and some chronic diseases caused by immune system defects.

However, Echinacea is greatly affected by geographical factors. Problems such as uneven quality, low content of bioactive ingredients and low seed germination rate are more prominent, which seriously affect the large-scale production and sustainable development of Echinacea. In addition, the breeding method of Echinacea is traditional breeding. The process is cumbersome and the cycle is long, making it difficult to achieve the goal of directional breeding in the short term.

Based on plant tissue culture technology, establishing a genetic transformation system for Echinacea can accurately target important bioactive components and directionally improve the genetic traits of Echinacea, which is of great significance for accelerating its localization and improving its medicinal value.

However, in terms of establishing a genetic transformation system for Echinacea, there are currently few reports on establishing a genetic transformation system for Echinacea using Agrobacterium tumefaciens and cultivating transgenic plants.

Therefore, establishing a genetic transformation system for transforming Agrobacterium tumefaciens into Agrobacterium tumefaciens and cultivating Echinacea with excellent traits is of great significance in advancing the genetic breeding process of medicinal Echinacea.

Therefore, whether Echinacea petioles can be used as explants to establish a genetic transformation system is an issue that those skilled in the art urgently need to solve.

Contents of the invention

In view of this, the present invention provides a composition and method for establishing a genetic transformation system using Echinacea petioles as explants. Combining the advantages of Agrobacterium tumefaciens with simple operation and low cost, GUS gene is used as a reporter gene and ordinary PCR method to quickly verify transgenic plants, effectively improving the efficiency of transgenic breeding of Echinacea.

In order to achieve the above objects, the present invention adopts the following technical solutions:

A composition for establishing a genetic transformation system using Echinacea petioles, including: Agrobacterium infection solution: 4.4g/L MS culture medium base salt, 30g/L sucrose, 0.1mmol/L acetosyringone, pH=5.8;

MS propagation medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/L NAA, pH=5.8;

MS antibacterial medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L inositol, 0.4mg/L6-BA, 0.01mg/L NAA, 200mg/ Ltermentin, pH=5.8;

MS resistance screening 1 medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/L NAA , 100mg/L Temetin, 3mg/L hygromycin, pH=5.8;

MS resistance screening 2 medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.6mg/L 6-BA, 0.01mg/L NAA , 50mg/L Temetin, 6mg/L hygromycin, pH=5.8;

Rooting induction medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L inositol, 0.02mg/L NAA, 50mg/L timentin, pH=5.8.

Further, the MS culture medium base salt was purchased from Coolaber Company's PM1271 MS culture medium base salt, product number PM1271-2×250g.

The present invention also provides an establishment method based on the above composition, including the following steps:

(1) Place the sterile tissue culture seedlings of Echinacea in a sterile environment, take the petioles and inoculate them and then culture them in the dark for induction to obtain explants;

(2) Introduce the vector containing the reporter gene into Agrobacterium, continue to culture the obtained engineering strain, collect the cells by centrifugation, and resuspend them in Agrobacterium infection solution to obtain a bacterial liquid for later use;

(3) Infect the explant obtained in step (1) with the bacterial solution of step (2); inoculate the infected explant and then culture it in the dark;

(4) Rinse the explants after dark culture in step (3) and soak them in sterile water containing timeentin;

(5) Transfer the explants treated in step (4) and culture them in the dark;

(6) Transfer the explants after dark culture in step (5) to MS resistance screening 1 medium for preliminary screening until resistant callus grows;

(7) Transfer the resistant callus in step (6) to MS Resistance Screening 2 medium and culture until adventitious buds grow, then transfer to rooting induction medium to induce adventitious roots to obtain complete Echinacea transgenic seedlings.

Preferably: Step (1) is placed in a sterile environment: placed on a clean bench; petiole: length 1 to 2 cm; inoculation: inoculated into MS propagation medium; dark culture induction: time 2 to 4 days.

Preferred: Step (2) The vector containing the reporter gene: plasmid pCAMBIA1305; continue culturing: place in LB liquid culture medium containing kanamycin and rifampicin, and culture with shaking at 28°C for 1 to 2 days; transfer the bacterial solution Expand the culture in LB liquid medium containing kanamycin and rifampicin until the OD600 value is 0.5-0.8; centrifuge: 4000-6000rpm, 5 minutes.

Furthermore, too high a rotational speed will damage the strain, too low a rotational speed will result in incomplete centrifugation, and low rotational speed will require longer centrifugation time.

Preferably: the infection time of step (3) is 20 minutes. After infection, the excess bacterial liquid on the surface of the explant is sucked up; inoculation: inoculation into MS multiplication medium, dark culture: co-culture for 2 days under dark conditions.

Further, blot dry using sterile filter paper.

Preferred: Step (4) Rinse: Rinse 3 times with sterile water until there is no hyphae residue visible to the naked eye on the surface of the explant; Concentration of Temetin: 200mg/L; Soaking treatment: Soak for 10 to 15 minutes, and absorb the water ;

Further, transfer to sterile filter paper to absorb moisture.

Preferably: Step (5) transfer: to MS antibacterial medium; dark culture: time 7 days.

Preferred: Step (6) Preliminary screening: Change the MS resistance screening 1 medium every other week for 2 to 4 weeks. Preferred: step (7) transfer: replace the MS resistance screening 2 medium every half month; adventitious buds: also include GUS staining and PCR identification; transfer: the adventitious buds identified as positive are cut from the base and then transferred into rooting induction medium.

The present invention also provides the application of the above-mentioned composition or the above-mentioned establishment method in agricultural production and breeding.

It can be seen from the above technical solutions that compared with the existing technology, the present invention provides a composition and method for establishing a genetic transformation system using Echinacea petioles as explants. The technical effect achieved is that Echinacea can be quickly and effectively transformed. Genetic transformation is a simple and convenient method. While retaining the mother plant and reducing damage to the mother plant, it can obtain a large amount of consistent explant materials, which is conducive to the transgenic plants maintaining their original excellent traits and having transgenic functions.

Description of drawings

In order to explain the embodiments of the present invention or the technical solutions in the prior art more clearly, the drawings needed to be used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings in the following description are only These are embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on the provided drawings without exerting creative efforts.

Figure 1 is a schematic diagram of the vector map used in the transformation system provided by the present invention.

Figure 2 is a diagram showing the growth of Echinacea explants provided by the present invention in culture media with different hygromycin concentrations. A is 0 mg/L, B is 3 mg/L, C is 6 mg/L, and D is 10 mg/L. L, E is 15mg/L.

Figure 3 is a diagram showing the embryogenic callus induced by screening the Echinacea petiole provided by the present invention in the resistance screening 1 medium.

Figure 4 is a diagram showing the differentiation of adventitious buds from the resistant callus of Echinacea embryos provided by the present invention.

Figure 5 is a GUS staining diagram of transgenic Echinacea leaves provided by the present invention, where a: blank control, b: positive adventitious buds.

Figure 6 is a drawing showing the PCR detection results of transgenic plants provided by the present invention, where M: DL2000maker; +: positive control; -: negative control; 1, 2, 3: transformed plants.

Figure 7 is a diagram showing the adventitious roots induced by the adventitious buds of Echinacea provided by the present invention.

Detailed ways

The technical solutions in the embodiments of the present invention will be described clearly and completely below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

The embodiment of the present invention discloses a composition and method for establishing a genetic transformation system using Echinacea petioles as explants.

Example 1

A composition and method for establishing a genetic transformation system using Echinacea petioles as explants, including the following steps:

1) Agrobacterium GV3101 competent cell transformation: pCAMBIA1305 vector containing GUS gene (Figure 1, purchased from

HonorGene (Product No. HG-VZC0568). Transformed into Agrobacterium tumefaciens GV3101 competent strain using heat shock transformation method

(Purchased from Shanghai Weidi Biotechnology Co., Ltd., product specification CAT#: AC1004).

The specific transformation steps are as follows: Take out the Agrobacterium competent cells stored in the -80°C refrigerator, wait for a moment at room temperature or in the palm of your hand until it is partially melted, and insert it into ice when it is in a mixed state of ice and water; add 100ng of the pCAMBIA1305 vector containing the GUS gene, and gently use your fingers. Blast the wall of the tube to mix well, then let it stand on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 37°C for 5 minutes, and ice bath for 5 minutes; add 700 μl of antibiotic-free LB liquid culture medium, and incubate with shaking at 28°C for 2 to 3 hours; Centrifuge at 6000 rpm for 1 min at room temperature, take about 100 μl of the supernatant and gently pipette to resuspend the bacterial mass and spread it on an LB plate containing 50 mg/L kanamycin, invert it and place it in a 28°C incubator for 2 to 3 days; use monoclonal bacteria As a template, positive transformed strains were identified by PCR. The identification primer sequences are as follows:

GUS-F 5’-CATCCTCGACGATAGCACCC-3’, such as SEQ ID No.1;

GUS-R 5’-ATGAGGAACTTGCCGTCGTT-3’, such as SEQ ID No. 2.

The identification sequence length is 459bp (catcctcgacgatagcaccctcccggtggggctgtacagcgagcgccacgaagagggcctcggaaaagtcattcgtaacaagccgaacttcgacttcttcaactatgcaggcctgcaccgtccggtgaaaatctacacgaccccgtttacgtacgtcgaggacatctcggttgtgaccgacttcaatgg cccaaccgggactgtgacctatacggtggactttcaaggcaaagccgagaccgtgaaagtgtcggtcgtggatgaggaaggcaaagtggtcgcaagcaccgagggcctgagcggtaacgtggagaattccgaatgtcatcctctgggaaccactgaacacgtatctctaccagatcaaagtggaactggtgaacgacggactgaccatcga tgtctatgaagagccgttcggcgtgcggaccgtggaagtcaacgacggcaagttcctcat, such as SEQ ID No.3)

PCR amplification procedure:

Reaction system: 20 μL system, 10 μL of enzyme (Jinsha Biotech 2×GS Taq PCR Mix ForPAGE), 1 μL of Primer 1 (10 μM), 1 μL of Primer 2 (10 μM), 1 μL of cDNA, and 7 μL of ddH2O.

2) Hygromycin screening pressure test: Select 5 different concentration gradients of hygromycin, respectively 0, 3, 6, 10, 15mg/L, and cut petioles about 1cm long from the robustly growing sterile Echinacea tissue culture seedlings. As explants, inoculate into MS propagation medium containing different concentrations of hygromycin (4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L inositol, 0.4mg/L 6-BA, 0.01mg/L NAA, adjust pH = 5.8), and screen out the lowest hygromycin concentration that can effectively inhibit the growth of Echinacea tissue.

Results: When the hygromycin concentration was greater than 6 mg/L, the explants browned and died within half a month, and there was no obvious callus growth, as shown in Figure 2.

3) Preparation of Agrobacterium infection solution: Pick positive monoclonal Agrobacterium in 1 ml of LB liquid culture medium containing 50 mg/L kanamycin and 50 mg/L rifampicin, and culture it with shaking at 28°C for 1 day; Transfer to 50ml of LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L) containing 50mg/L kanamycin and 50mg/L rifampicin for expanded culture, until the OD600 value is 0.5～0.8, centrifuge at 5000rpm for 5 minutes to collect the cells; resuspend the cells in Agrobacterium infection solution (4.4g/L MS medium base salt, 30g/L sucrose, 0.1mmol/L acetosyringone, pH=5.8) , adjust the OD600 value of the bacterial solution to 0.5 as a backup for infection.

4) Agrobacterium infection of Echinacea explants: Cut the petioles of robustly growing sterile Echinacea tissue culture seedlings as explants, with a length of about 1cm, and transfer them to MS propagation medium (4.4g/L MS medium base Salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/L NAA, pH=5.8) were pre-cultured in the dark for 2 days; treated with the above 3 ) The prepared bacterial solution was used to infect the pre-cultured petiole explants. The infection time was 20 minutes. During the infection period, shake continuously. Agrobacterium and explants are in full contact; the infected explants are dried with sterile filter paper to dry the excess bacterial liquid on the surface, and then transferred to MS propagation medium for co-cultivation under dark conditions for 2 days; after the co-culture is completed Rinse the explant with sterile water 2 to 3 times until there is no visible hyphae remaining on the surface of the explant, and then add 200 mg/L timentin (purchased from Sangon Bioengineering (Shanghai) Co., Ltd. , product specification A600950-0001), soaked in sterile water for 10 minutes to remove Agrobacterium, absorb the water with sterile filter paper, and transfer the petiole explants to MS antibacterial medium (4.4g/L MS medium base salt, Culture in the dark with 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/L NAA, 200mg/L timetin (pH=5.8) 7d.

5) Resistance screening of transgenic adventitious buds of Echinacea: Transfer the explants to MS resistance screening 1 medium (4.4g/LMS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L Preliminary screening was carried out in myo-inositol, 0.4mg/L6-BA, 0.01mg/L NAA, 100mg/L timementin, 3mg/L hygromycin, pH=5.8), and fresh MS antibiotics were replaced every other week. Resistance Screening 1 medium; after the explants grow green resistant callus (about 2 to 4 weeks, see Figure 3), cut out the green resistant callus and transfer it to MS Resistance Screening 2 medium ( 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.6mg/L 6-BA, 0.01mg/L NAA, 50mg/L Temetin ( timentin), 6mg/L hygromycin, pH=5.8) for adventitious bud induction and screening, and replace the fresh MS Resistance Screening 2 medium every half a month until the resistant calli differentiate into adventitious buds (Figure 4 ).

6) Rooting induction of Echinacea-resistant adventitious buds: Select normally growing adventitious buds, cut some leaves in a clean bench for GUS staining and PCR identification, and detect whether the GUS gene in the vector has been integrated into the Echinacea genome (Figure 5 and Figure 6) . Adventitious buds identified as positive were cut from the base and transferred to rooting induction medium (4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L inositol, Adventitious root induction was carried out in 0.02 mg/L NAA, 50 mg/L timementin (pH=5.8) (Figure 7), and the transgenic regenerated seedlings of Echinacea were obtained.

7) Seedling hardening and transplanting of Echinacea transgenic plants: After the regenerated seedlings have grown 3 to 4 strong leaves and the root length exceeds 4cm, the seedlings can be hardened and transplanted. Open the tissue culture bottle and place it in the scattered light of the greenhouse. After 3 days of seedlings, take out the Echinacea tissue culture seedlings from the tissue culture bottle, clean the remaining culture medium at the roots, and transplant them into moist nutrient soil. During the process of seedling hardening and transplanting, pay attention to moisturizing to prevent the tissue culture seedlings from drying up and dying.

In summary, Echinacea is a species that is difficult to transform. Currently, there are no reports on genetic transformation systems related to Echinacea in China. The technical difficulty lies in how to establish a transformation system and provide methods for establishing a genetic transformation system (including appropriate culture medium combinations).

Each embodiment in this specification is described in a progressive manner. Each embodiment focuses on its differences from other embodiments. The same and similar parts between the various embodiments can be referred to each other.

The above description of the disclosed embodiments enables those skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be practiced in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention will not be are not limited to the embodiments shown herein but are to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

A composition for establishing a genetic transformation system using Echinacea petioles, which is characterized by including:

Agrobacterium infection solution: 4.4g/L MS medium base salt, 30g/L sucrose, 0.1mmol/L acetosyringone, pH=5.8;

MS propagation medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/LNAA, pH= 5.8;

MS antibacterial medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/LNAA, 200mg/ Ltermentin, pH=5.8;

MS resistance screening 1 medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.4mg/L 6-BA, 0.01mg/LNAA, 100mg/L Temetin, 3mg/L Hygromycin, pH=5.8;

MS resistance screening 2 medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L myo-inositol, 0.6mg/L 6-BA, 0.01mg/LNAA, 50mg/L Temetin, 6mg/L Hygromycin, pH=5.8;

Rooting induction medium: 4.4g/L MS medium base salt, 30g/L sucrose, 4.8g/L agar powder, 0.1g/L inositol, 0.02mg/LNAA, 50mg/L timentin, pH =5.8.
The method for establishing the composition according to claim 1 is characterized in that it includes the following steps:

(1) Place the sterile tissue culture seedlings of Echinacea in a sterile environment, take the petioles and inoculate them and then culture them in the dark for induction to obtain explants;

(2) Introduce the vector containing the reporter gene into Agrobacterium, continue to culture the obtained engineering strain, collect the cells by centrifugation, and resuspend them in Agrobacterium infection solution to obtain a bacterial liquid for later use;

(3) Infect the explant obtained in step (1) with the bacterial solution of step (2); inoculate the infected explant and then culture it in the dark;

(4) Rinse the explants after dark culture in step (3) and soak them in sterile water containing timeentin;

(5) Transfer the explants treated in step (4) and culture them in the dark;

(6) Transfer the explants after dark culture in step (5) to MS resistance screening 1 medium for preliminary screening until resistant callus grows;

(7) Transfer the resistant callus of step (6) to MS Resistance Screening 2 medium and culture until adventitious buds grow, then transfer to rooting induction medium to induce adventitious roots to obtain complete Echinacea transgenic seedlings.
The establishment method according to claim 2, characterized in that, in step (1), the step (1) is placed in a sterile environment: placed on a ultra-clean table; the petiole: a length of 1 to 2 cm; the inoculation: inoculated to MS for propagation Medium; the dark culture induction: time 2 to 4 days.
The establishment method according to claim 3, characterized in that the vector containing the reporter gene in step (2): plasmid pCAMBIA1305; the continued culture: placed in LB liquid culture medium containing kanamycin and rifampicin , culture with shaking at 28°C for 1 to 2 days; transfer the bacterial solution to LB liquid culture medium containing kanamycin and rifampicin for expanded culture until the OD600 value is 0.5 to 0.8; the centrifugation: 4000 to 6000 rpm, Time 5min.
The establishment method according to claim 4, characterized in that the infection time in step (3) is 20 minutes, and after infection, the excess bacterial liquid on the surface of the explant is sucked up; the inoculation: inoculation to MS multiplication Medium, the dark culture: dark conditions Cultivated for 2 days.
The establishment method according to claim 5, characterized in that, the washing in step (4): washing with sterile water 3 times until there is no hyphae residue visible to the naked eye on the surface of the explant; the concentration of termetin: 200mg/L; the soaking treatment: soak for 10 to 15 minutes and absorb the water.
The establishment method according to claim 6, characterized in that: transfer in step (5): to MS bacteriostatic medium; and said dark culture: time: 7 days.
The establishment method according to claim 7, characterized in that the preliminary screening in step (6): MS resistance screening 1 medium is replaced every other week for 2 to 4 weeks.
The establishment method according to claim 8, characterized in that, the transfer in step (7): replace MS resistance screening 2 culture medium every half month; the adventitious buds: also include GUS staining and PCR identification; Transfer as described above: Adventitious shoots identified as positive were cut from the base and then transferred to rooting induction medium.
Application of the composition of claim 1 or the method of any one of claims 2 to 9 in agricultural production and breeding.