WO2024026440A1 - Identification microbienne universelle - Google Patents

Identification microbienne universelle Download PDF

Info

Publication number
WO2024026440A1
WO2024026440A1 PCT/US2023/071182 US2023071182W WO2024026440A1 WO 2024026440 A1 WO2024026440 A1 WO 2024026440A1 US 2023071182 W US2023071182 W US 2023071182W WO 2024026440 A1 WO2024026440 A1 WO 2024026440A1
Authority
WO
WIPO (PCT)
Prior art keywords
regions
pcr
variable
amplification
dna
Prior art date
Application number
PCT/US2023/071182
Other languages
English (en)
Inventor
Pallavi BUGGA
Vishwaratn ASTHANA
Jeremy Scott VANEPPS
Erika MARTINEZ-NIEVES
Original Assignee
The Regents Of The University Of Michigan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of Michigan filed Critical The Regents Of The University Of Michigan
Publication of WO2024026440A1 publication Critical patent/WO2024026440A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Definitions

  • oligonucleotide primers that hybridize to sequence regions of nucleic acids flanking ribosomal 16S, 23S, 5S, 18S, 5.8S, and 25-28S internal transcribed spacer regions (ITSs) and other conserved genes from 2 or more different bacteria or fungi, polymerase chain reaction (PCR or qPCR) amplification, high resolution melt curve analysis and amplicon size determination for microbial identification.
  • telomeres When a patient presents with signs and symptoms of an infection, it may be difficult for a caregiver to determine the pathogenic microbial species in a timely manner.
  • the conventional standards for pathogen diagnosis are culture-based detection, biochemical assay identification, and antibiotic susceptibility testing (AST).
  • AST antibiotic susceptibility testing
  • this approach is time intensive, often taking 12-48 hours to grow the pathogen to the point where additional biochemical assays can be performed to confirm species identity and perform AST. 1
  • culturing is limited in part by sensitivity. For example, 30% of cases of sepsis are culture negative.
  • NGS next-generation sequencing
  • the present invention provides better quantitative readouts, to help clinicians differentiate between pathogenic and non-pathogenic bacteria (including contaminants), unlike NGS.
  • Current nucleic acid sequencing technologies have shown minimal clinical utility, in part for this reason.
  • Mass spectrometry e.g., matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) is slow (e.g., 24-120 hours), costly, labor intensive, reliant on complex technology, and sensitive to small variations in sample preparation and handling. Accordingly, new methods, compositions, systems and kits are needed for improved diagnosis and management of microbial infections.
  • MALDI-TOF matrix-assisted laser desorption/ionization-time of flight
  • a rapid (1-2 hours), culture-free, low cost, universal microbial identification system that is unbiased by pre-defined target organisms facilitates the transition from broad- to narrow- and targeted-spectrum antibiotics, and/or obviates the need for broad-spectrum antibiotics.
  • oligonucleotide primers that hybridize to sequence regions of nucleic acids flanking ribosomal 16S, 23S, 5S, 18S, 5.8S, and 25-28S internal transcribed spacer regions (ITSs) and other conserved genes from 2 or more different bacteria or fungi, polymerase chain reaction (PCR or qPCR) amplification, high resolution melt curve analysis and amplicon size determination for microbial identification.
  • the present invention provides a method of identifying multiple different microbes, comprising contacting nucleic acid from the multiple different microbes with two or more oligonucleotide primers that hybridize to sequence regions of the nucleic acid from the multiple different microbes that are conserved among different microbes, wherein the conserved regions flank variable ribosomal internal transcribed regions (ITS) and conserved genes to produce one or more amplification products, determining the fragment lengths of the one or more amplification products, and identifying the multiple different microbes by comparing the fragment lengths to a database of fragment lengths from a plurality of different microbes.
  • ITS variable ribosomal internal transcribed regions
  • the multiple microbes are bacteria and the variable ribosomal internal transcribed regions are 16S-23S and 23S-5S variable ribosomal internal transcribed regions. In some embodiments, the multiple microbes are fungi and the variable ribosomal internal transcribed regions are 18S-5.8S and 5.8S-28S variable ribosomal internal transcribed regions.
  • At least one of the one or more amplification products is amplified by polymerase chain reaction (PCR), quantitative PCR (qPCR) and/or colony PCR.
  • PCR polymerase chain reaction
  • qPCR quantitative PCR
  • colony PCR high-resolution melt curve analysis is performed on one or more amplification products.
  • the number of ITS repeats are quantified by qPCR or electrophoresis.
  • the fragment length of at least one of the one or more amplification products is determined by gel electrophoresis or capillary electrophoresis.
  • At least one of said two or more primers comprises a mixed base and/or an inosine.
  • periodic removal of dominant amplification products is followed by replenishment of PCR reagents and serial amplification.
  • a concentration of at least one of the one or more amplification products is determined by fluorescent quantification.
  • the conserved sequence regions flank one or more variable regions in tRNA synthetase, nirS, rpo, C0X1, rbcL, LSU, fus, ileS, lep, leu, pyrG, rps, dna, rnp, rpm, gyr,rec, rpl, and tuf.
  • the present invention provides a system, comprising two or more amplification primers that hybridize to sequence regions of nucleic acid from multiple different microbes that are conserved among different microbes, wherein the conserved regions flank variable ribosomal internal transcribed regions (ITS) and conserved genes to produce one or more amplification products, one or more PCR amplification reagents, a PCR amplification instrument, a melt curve instrument, one or more capillary gel electrophoresis reagents and a capillary gel electrophoresis instrument.
  • the multiple microbes are bacteria and the variable ribosomal internal transcribed regions are 16S-23S and 23S-5S variable ribosomal internal transcribed regions.
  • the multiple microbes are fungi and the variable ribosomal internal transcribed regions are 18S-5.8S and 5.8S-28S variable ribosomal internal transcribed regions.
  • the system comprises a database of amplification product fragment lengths.
  • Figure 1 shows an overview of the universal microbial identification system.
  • Universal primers targeting the flanks of conserved bacterial genes are used to PCR amplify the heterogenous internal transcribed spacer (ITS) regions producing a unique amplicon signature based on the length of the ITS gaps, (a) 3 hypothetical bacterial genomes (A, B, & C) with different ITS gap lengths, the resulting (b) amplicon lengths and (c) gel electrophoretic readout that demonstrates unique identifying signatures, a) shows 3 hypothetical bacterial genomes (A, B, and C). b) shows different ITS gap lengths in the 3 bacterial genomes. C) shows a gel electrophoresis with unique identifying signatures for A, B and C bacterial genome. Additional universal primers that amplify other ITS gaps (i.e., 23s-5s region) support accuracy and resolution.
  • ITS internal transcribed spacer
  • Figure 2 shows quantification of bacterial DNA concentration using PCR cycle counting.
  • 75 ng of S. aureus genomic DNA was PCR amplified. After every 3 cycles the reaction was paused and 2 uL of the PCR reactant was sampled and analyzed by PAGE, after which the PCR reaction was resumed. This process was repeated until cycle 35.
  • an identical reaction was carried out using SYBR Green qPCR, albeit without pausing the reaction and aliquoting out reactant, a) Unique bands corresponding to S. aureus emerge at cycle 21 of the PCR reaction, b) Plotting the band intensity vs cycle number shows the characteristic log2 -linear relationship that is shared with the fluorescence vs cycle number for the same reaction run using qPCR. The Ct value for that sample was 21.
  • Figure 3 shows sensitivity and specificity of the universal bacterial identification system
  • Lane 1 ladder
  • Lane 2 water
  • Lane 3 human DNA only, 35 cycles
  • Lane 4 human DNA only, 60 cycles
  • Lane 5 E.
  • Figure 4 shows amplification of diverse co-mixtures of bacteria in a single reaction. Varying ratios of E. coli to B. subtilis were PCR amplified for 35 cycles and visualized by polyacrylamide gel electrophoresis (PAGE). At an E. coli to B. subtilis ratio of 1 : 1, 75 ng of E. coli genomic DNA was mixed with 75 ng of B. subtilis genomic DNA. At 1 : 10, 7.5 ng of E. coli genomic DNA was mixed with 75 ng of B. subtilis DNA etc. Both species are readily identified when present within an order of magnitude of each other.
  • PAGE polyacrylamide gel electrophoresis
  • Figure 5 shows simulated amplification profiles comprising amplicon length signatures for 45 of the most common clinical pathogens using 16S-23S universal primer sets.
  • the universal primers used by the universal microbial diagnostic system of the present invention generate a unique amplicon signature for each pathogen.
  • Figure 6 shows simulated amplification profiles comprising expected amplicon length signatures for 45 of the most common clinical pathogens using the 23s-5s universal primer sets.
  • the universal primers used by the universal microbial diagnostic system of the present invention generate a unique amplicon signature for each pathogen.
  • Figure 7 shows simulated amplification profiles with associated ITS repeats comprising expected amplicon length signatures and associated ITS repeats for 45 of the most common clinical pathogens using the 23S-5S universal primer sets.
  • Figure 8 shows simulated amplification profiles and expected amplicon length signatures for 188 clinically infectious pathogens using the 16S-23S universal primer set in red and the 23S-5S universal primer set in green. Two primers in combination generate a unique amplicon signature for 97 of 188 pathogens in the database. The remaining pathogens with overlapping amplicon signatures are distinguished using high-resolution melt curves and ITS ratios.
  • Figure 9 shows experimental amplicon signatures generated using universal ITS primers, a) PAGE of PCR reactants from DNA isolated from different bacterial species, b) analysis results of the gel. Band analysis was restricted to PCR products ⁇ 1,000 bp which are unlikely to be spurious. Each PCR reactant profile is unique for each species.
  • Figure 10 shows a molecular weight (MW) calibration curve.
  • MW molecular weight
  • Figure 11 shows high-resolution melt data
  • a) Six bacteria with overlapping amplicon signatures after amplification with the 16S-23S and 23S-5S universal primer sets generate unique melt curves in silico as seen via uMELT.
  • the unique melt signatures distinguish the 6 bacteria based on variances in sequence composition
  • b) Standard melt curve analysis was experimentally performed on 6 representative bacteria i.e., B. subtilis, C. jejuni, E.coli, K. pneumoniae, P. aeruginosa, and S. aureus.
  • Figure 12 shows assay performance in fungal samples.
  • Candida albicans was amplified using a universal fungal primer pair designed against the 18S-5.8S ITS region. Varying concentrations of the amplified fungal DNA ranging from 10 to 989 ng/uL were analyzed via electrophoresis on a 10% PAGE gel.
  • Figure 13 shows simulated amplification profiles with corresponding ITS repeats comprising expected amplicon length signatures and associated ITS repeats for 45 of the most common clinical pathogens using the 16S-23S universal primer sets.
  • Figure 14 shows simulated amplification profiles with corresponding ITS repeats.
  • Expected amplicon length signatures and associated ITS repeats were generated for 188 clinical pathogens using the 16S-23S universal primer set in red and the 23S-5S universal primer set in green. The number of repeats ranges from 0-20.
  • polypeptide As used herein, the term “about” represents an insignificant modification or variation of the numerical value such that the basic function of the item to which the numerical value relates is unchanged.
  • protein is used synonymously with “peptide,” “polypeptide,” or “peptide fragment.”
  • a "purified” polypeptide, protein, peptide, or peptide fragment is substantially free of cellular material or other contaminating proteins from the cell, tissue, or cell-free source from which the amino acid sequence is obtained, or substantially free from chemical precursors or other chemicals when chemically synthesized.
  • module means to alter, either by increasing or decreasing, the activity of a gene or protein.
  • inhibitor means to prevent or reduce the activity of gene or protein.
  • bioactivity indicates an effect on one or more cellular or extracellular process (e.g., via binding, signaling, etc.) that can impact physiological or pathophysiological processes.
  • Ranges provided herein are understood to be shorthand for all of the values within the range.
  • a range of 1 to 50 is understood to include any number, combination of numbers, or sub-range from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 (as well as fractions thereof unless the context clearly dictates otherwise).
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
  • any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness are to be understood to include any integer within the recited range, unless otherwise indicated.
  • cell culture refers to any in vitro culture of cells. Included within this term are continuous cell lines (e.g., with an immortal phenotype), primary cell cultures, transformed cell lines, finite cell lines (e.g., non-transformed cells), and any other cell population maintained in vitro.
  • zz? vitro refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments can consist of, but are not limited to, test tubes and cell lysate.
  • zz? vivo refers to the natural environment (e.g., an animal or a cell) and to processes or reaction that occur within a natural environment.
  • universal means not specific to a single microbial species or strain.
  • a universal primer is able to bind to and amplify multiple bacterial species and strains with equivalent amplification efficiency, and/or is able to simultaneously amplify 2 or more bacterial targets in a sample.
  • a “mixed base” refers to a variable base within an oligonucleotide. If, for example, an oligonucleotide contains an A:C mixed base in a given position, 50% of oligonucleotides would contain an adenine, while the remaining 50% of oligonucleotides would contain a cytosine at that same position. The inclusion of mixed bases allows for primers to better accommodate template sequence mismatches.
  • oligonucleotide primers that hybridize to sequence regions of nucleic acids flanking ribosomal 16S, 23S, 5S, 18S, 5.8S, and 25-28S internal transcribed spacer regions (ITSs) and other conserved genes from 2 or more different bacteria or fungi, polymerase chain reaction (PCR or qPCR) amplification, high resolution melt curve analysis and amplicon size determination for microbial identification.
  • Antimicrobial resistance is a significant international problem.
  • the CDC estimates that within the US alone, approximately 2.8 million infections and more than 35,000 deaths occur annually as a result of drug-resistant bacteria.
  • Numerous studies have shown that the indiscriminate administration of broad-spectrum antibiotics is one of the main contributors to the increasing prevalence of antibiotic resistance.
  • Culture, the conventional standard for bacterial and fungal identification is a time intensive process, often taking 24-72 hours. Further, many organisms are unculturable, requiring unique species-specific molecular assays to identify. Due to this extended diagnostic period, broad-spectrum antibiotics and other antimicrobials are prescribed to prevent worsening of the patient’s condition.
  • Multiplex PCR refers to a process by which multiple primers are added into 1 reaction mixture to simultaneously amplify one or more pathogen templates.
  • Multiplex PCR has significant drawbacks. For example, when multiple primers are added into a shared reaction, specific primers may have differential binding affinity to the template DNA and thus differential amplification efficacy than others. As a result, species within the sample amplify at differential rates than others, making quantification and assessment of polymicrobial samples difficult or impossible. Additionally, the total number of species that can be interrogated is limited, as the likelihood of non-specific binding and primer-dimer formation increases.
  • Methods such as MALDI-TOF may require culturing which is often the rate limiting factor in pathogen identification.
  • culturing which is often the rate limiting factor in pathogen identification.
  • mNGS metagenomic Next Generation Sequencing
  • MinlON and Nanopore are amplification-free sequencing platforms that are more rapid than Illumina but with lower throughput. (Wang, Q, Boenigk, S, Boehm, V, Gehring, NH, Altmueller, J, and Dieterich, C (2021). Single cell transcriptome sequencing on the Nanopore platform with ScNapBar. RNA.
  • MinlON and Nanopore suffer from a number of unique limitations, including low accuracy - 75% and 90% for MinlON and Nanopore, respectively.
  • PCR polymerase chain reaction
  • ITS internal transcribed spacer
  • the preset invention By integrating high-resolution melt curve analysis, and quantifying the number of ITS repeats, in some embodiments the preset invention identifies up to 188 clinical pathogens.
  • High-resolution melt curve analysis generates melt curves based on the size and sequence composition of an oligonucleotide amplicon. Melt analysis discriminates between amplicon signatures of similar length.
  • the frequency of ITS repeats are used to further discriminate between microbial species because diverse species have differing numbers of ITS repeats present within their cells.
  • the number of the repeats are determined by first amplifying the ITS regions via qPCR, then analyzing band intensity via gel electrophoresis.
  • the methods, compositions, systems and kits of the present invention identify the unique amplicon and melt curve signature generated by multiple bacterial and fungal species in a single reaction within 1-2 hours for substantially less cost than established diagnostic modalities.
  • the diagnostic efficacy of the platform is supported by quantification of ITS repeats.
  • the methods, compositions, systems and kits of the present invention further determine the concentration of each pathogen with a limit of detection of 100 colony forming units (CFU) per PCR reaction.
  • CFU colony forming units
  • the present invention provides universal primers that target gaps between uniquely conserved regions in the bacterial genome, including the ribosomal 16S-23S and 23S-5S internal transcribed spacer (ITS) regions. While the 16S, 23S and 5S genes themselves are conserved with limited variation between bacteria, the ITS regions between the 3 genes comprises unique length heterogeneities that may be assessed using DNA fractionation methods such as gel electrophoresis. (Fig. 1). In some embodiments, universal primers target gaps between uniquely conserved regions in the fungal genome, including between the 18S, 5.8S, and 25-28S ITS regions.
  • ITS internal transcribed spacer
  • ITS regions are targeted and amplified to improve the specificity.
  • Use of universal primers enables the methods, compositions, systems and kits to be target-agnostic such that a clinician does not require a priori knowledge of the causative pathogen to order the correct test and obtain a diagnosis, a problem commonly encountered with PCR or serology-based assays.
  • concentration of each identified organism may be determined. This information assists the clinician with discriminating a true pathogen versus contaminant/commensal organism.
  • these primers target specific bacterial sequences, the methods, compositions, systems and kits are resilient to human genomic contamination, precluding the need for timely and costly human genomic extraction protocols.
  • Use of robust methodologies such as PCR and electrophoresis facilitates both speed and cost, thereby making the universal bacterial identification methods, compositions, systems and kits practical clinical tools to overcome the limitations of existing diagnostic assays such as sequencing.
  • the methods, compositions, systems and kits of the present invention comprise high-resolution melt curve analysis to distinguish differently sized amplicons to further resolve bacterial or fungal identification. This method is helpful when the size of 2 amplicons, or the combined amplicon signatures generated from the entire primer set, appear to overlap. In such cases, melt curves distinguish the 2 pathogens because Tm is more sensitive to sequence variations (e.g., GC content). In some embodiments, melt curve analysis provides assurance that methods, compositions, systems and kits of the present invention perform robustly. In some embodiments, melt curve analysis is performed in combination with qPCR.
  • the methods, compositions, systems and kits of the present invention incorporate qPCR amplification in combination with quantification of gel electrophoresis band intensity in order to determine ITS ratios.
  • the bacterial or fungal ITS region of interest is amplified by qPCR to the threshold cycle (CT), and then characterized by gel electrophoresis.
  • CT threshold cycle
  • relative band intensities are quantified to determine ITS ratios.
  • the threshold cycle number is prospectively determined, whereupon qPCR amplification is abrogated at threshold and immediately characterized via electrophoresis.
  • a cycle counting method (Fig. 2) is used to retrospectively quantify gel band intensities at CT.
  • the universal bacterial identification system addresses multiple unmet needs in health care.
  • the system identifies a bacterial or fungal pathogen within a few hours. Without having a priori knowledge of the infectious organism, the system determines both the identity and concentration of each pathogen in a clinical sample without the need for culturing, and detects as few as a single infectious cell.
  • PCR is inexpensive with primers and reagents for each reaction costing on the order of cents (the next cheapest diagnostic modality is MALDI-TOF at approximately $10 per sample). 19
  • the system is also resilient to human genomic contamination precluding the need for timely or costly methods to clear human DNA.
  • custom universal primers bind to conserved bacterial or fungal genes and amplify non-conserved gaps located in-between known as internal transcribed spacers (ITS). Because ITS regions are non-coding, and as a result not well conserved due to a lack of evolutionary pressure, these regions tend to have significant length and sequence heterogeneity between bacterial species. 20 Diversity in ITS length facilitates discrimination at the species level using robust and low-cost techniques including, for example, PCR and gel electrophoresis.
  • ITS internal transcribed spacers
  • the methods, systems, compositions and kits of the present invention are not limited to the exemplary 188 bacteria analyzed.
  • the database of bacterial species against which primers are designed in silica is expandable to comprise additional genomes of interest.
  • the capacity to generate a unique amplicon signature using universal ITS primers was confirmed in a cohort of bacteria including Gram negatives vs positives, aerobes vs anaerobes, and spore formers, and nonoverlapping readout predicted by simulation is maintained.
  • bacterial samples at clinically relevant concentrations (> 10,000 CFU/mL) are sufficiently amplified after 35 cycles using a rapid cycling protocol that takes under an hour to complete, followed by time needed to perform gel electrophoresis, gel staining, and imaging using conventional apparatuses.
  • Capillary electrophoretic apparatuses and microfluidic platforms reduce DNA fragmentation analysis to approximately 30 minutes. 21,22
  • determining the concentration of the pathogenic strain is often critical. Providing a quantitative readout differentiates infectious from commensal bacteria and/or contaminants. For example, a pathogen load of ⁇ 100,000 CFU/mL in urine is often considered non-infectious. 23 Similarly, low levels of circulating bacterial DNA may be found in blood which may be picked up as a false positive by endpoint assays such as multiplex PCR or Next Generation Sequencing (NGS). Accordingly, detecting bacterial DNA is not necessarily equivalent to detecting live bacteria. Free floating bacterial DNA is confined to low circulating levels because it is degraded by ubiquitously expressed DNases, so detecting bacterial DNA above background levels is informative.
  • the present invention provides DNA precipitation, nucleases, chelation agents and/or DNA intercalators to remove DNA not sequestered within a viable membrane before PCR amplifying the sample.
  • the clinical sample is filtered after treatment with a nuclease to concentrate bacterial or fungal cells and to remove extracellular DNA, debris, or other particulate matter.
  • human cells are selectively lysed using a non-ionic detergent and treated with DNAse to remove human genomic contamination.
  • selective lysis, DNA nucleases, and filtration are used together to purify bacterial or fungal cells.
  • concentration estimates can be obtained from qPCR amplification.
  • concentration is determined by sampling a very small volume ( ⁇ 1 uL) of the PCR reaction every few cycles and running the sample on a gel. From left to right, the lane in which the bands appear first indicates the relative Ct of the sample, which is converted into a concentration (CFU/mL) using an oligonucleotide standard template.
  • oligonucleotide standards are run in parallel with the same reaction matrix (to recreate the effect of potential background inhibitors and lysates that may present within the target sample).
  • the reaction is started in a qPCR apparatus and terminated once the reaction amplification has reached fluorescence threshold. At this point it is transferred to a gel while the oligonucleotide standards continue to cycle in the qPCR apparatus. Accordingly, the CT noted on qPCR aligns closely with the appearance of bands via gel electrophoresis.
  • the methods, compositions, systems and kits of the present invention are capable of detecting as few as a single bacterium in a reaction.
  • centrifuging and concentrating the bacteria is performed prior to DNA extraction.
  • the bacteria are concentrated by fdtration.
  • the methods, compositions, systems and kits of the present invention comprise colony PCR.
  • Colony PCR is performed directly on bacterial cells without the need to separately extract and purify cellular DNA. Bacterial cells (or colonies) are lysed, and PCR reagents are added directly to the lysate. Colony PCR shortens the time from sample-to- answer, allowing for more rapid administration of tailored antibiotics, and provides less loss in DNA yield than separately extracting and purifying bacterial DNA before amplification.
  • the universal bacterial identification system of the present invention is distinct from a multiplex platform that uses multiple species-specific primer pairs to assay an upper limit of 10 to 20 pathogens at a time.
  • the universal microbial diagnostic methods, systems, compositions and kits of the present invention provide a single primer pair to interrogate the clinical pathogen database comprising hundreds of potential microbial and bacterial pathogens, and is not limited to a single clinical compartment or bacterial classifier (e.g., Gram positive vs. Gram negative) vs. conventional bioassays.
  • bacterial classifier e.g., Gram positive vs. Gram negative
  • the universal microbial identification systems, methods, compositions, reaction mixtures and kits of the present invention rapidly identify a pathogen within several hours. Without requiring a priori knowledge of the infectious organism, the system determines both the identity and concentration of each pathogen in a clinical sample without the need for cell culture, and may detect as few as several or a single infectious cell.
  • the present invention provides strong advantages in cost, ease of use, operator engagement, and time consumption.
  • the system of the present invention is resilient to human genomic contamination precluding the need for timely or costly methods to eliminate human DNA.
  • the universal bacterial identification methods, compositions, systems and kits of the present invention provide a major resolution to the decades-long struggle to rapidly and accurately identify clinical pathogens.
  • the present invention comprises an instrument or system in a clinical pathology laboratory.
  • the instrument or system is a point of care apparatus.
  • the instrument or system comprises a sample collection vessel into which a patient’s sample is deposited.
  • the vessel is in fluid connection with an internal apparatus capable of performing colony-qPCR.
  • the instrument or system administers PCR reagents directly into the sample.
  • the instrument or system comprises a thermocycler.
  • the instrument or system quantifies fluorescence of the amplification productions.
  • the sample is assessed through an internal capillary electrophoresis apparatus.
  • the observed and measured band electrophoretic band sizes and patterns are then aligned with a band and pattern database via a CPU processer contained within the instrument or system.
  • a patient sample is collected, the sample is directed to a suitable laboratory, facility or point of care end-user, and an instrument or system of the present invention performs colony qPCR, followed by capillary electrophoresis.
  • the electrophoretic band sizes and patterns are then compared to a pre-generated database of band sizes and patterns to identify one or more microbial species in the sample.
  • the methods, compositions, systems and kits of the present invention identify a microbe in a sample.
  • the sample is a biological sample or an environmental sample.
  • the biological sample is from a mammal.
  • the mammal is a human.
  • the biological sample is a fluid sample or a tissue sample.
  • Primers amplifying the 16s-23s and 23s-5s ITS regions were derived from published sources. 31,32 ’ 33
  • a first primer design step common pathogenic bacteria and fungi are compiled in a database and aligned at their 16S, 23S, or 5S sites (for bacteria), 18S, 5.8S, 25S, or 25-28S sites (for fungi), together with other conserved regions of interest.
  • the greatest conserved region across microbial species is identified within the targeted sites.
  • candidate primer sequences are generated from regions of greatest conservation between species.
  • primers and primer pairs with the least binding affinity for human genomic DNA are selected.
  • universal primers are modified to include mixed bases (in a 1 : 1 ratio) as well as inosine, a universal base. Inosine is included on the 3’ end of the primer to facilitate polymerase extension in the presence of a potential mismatch near the tail end of the primer binding site. Use of additional mixed and universal bases is avoided in some embodiments to prevent off- target binding and amplification. Examples of primer sequences are shown in Table 1.
  • a Matlab script was developed to establish primer binding sites and subsequent amplification profiles for each bacterial genome.
  • the code searches each bacterial genome for primer binding sites by first probing for complementary base pair matches, followed by calculation of the binding affinity (AG) of each hit using integrated Nucleic Acid Package (NUPACK) code. Only primer binding sites with a AG ⁇ -9 kcal/mole were found to be adequately stable to form a dimer, a prerequisite for amplification. Next, each primer is elongated 5’ -> 3’ until it reaches the next inversely oriented primer binding site along the genome, the intervening sequence of which is considered an amplicon. Only amplicons ⁇ 1,000 bp are included in the identity matrix generated for each universal ITS primer pair (Figs. 5, 6, 7, 8). This process was also performed for fungal genomes.
  • FAST-A11 (FASTA) files containing bacterial genomic sequences were obtained from National Center for Biotechnology Information (NCBI). (Table 2.)
  • DNA was extracted using the Lucigen MasterPure complete DNA & RNA purification and MasterPure gram positive DNA purification kits according to the manufacturer’s instruction (Lucigen, Middleton, WI, USA). DNA was reconstituted in TE buffer and stored at -20°C. Purity and yields were quantified using a UV-Vis spectrophotometer (Nanodrop 2000, Thermo Fisher Scientific, Waltham, MA, USA). Pre-purified DNA was purchased from ATCC for Campylobacter jejuni (ATCC 11168) and Acinetobacter baumannii (BAA-1605).
  • Candida albicans (strain: BWP17) was grown overnight (16 hr.) at 37°C in Yeast
  • SUBSTITUTE SHEET (RULE 26) Peptone Dextrose (YPD) media supplemented with 0.01% (m/v) uridine.
  • Yeast DNA was extracted using the MasterPure Yeast DNA Purification Kit (Lucigen, Middleton, WI, USA). DNA was reconstituted in TE buffer and stored at -20°C. Purity and yields were quantified using a UV-Vis spectrophotometer (Nanodrop 2000, Thermo Fisher Scientific, Waltham, MA, USA).
  • Bacterial DNA was amplified using iTaq polymerase StepOnePlus thermocycler from ThermoFisher Scientific (Waltham, MA, USA) according to the manufacturer’s instruction using the following thermocycler protocol: 1) 95°C for 3 min, 2) 95°C for 15s, 3) 60°C for 30s, 4) 72°C for 1 min, and 5) Repeat steps #2 to #4 for 35 cycles.
  • PCR reactants were subsequently separated via electrophoresis on a 10% polyacrylamide (PAGE) gel (ThermoFisher Scientific, Waltham, MA, USA) then stained with GelRed (Biotium, Fremont, CA, USA) and imaged on a ChemiDoc XRS+ molecular imager (Bio-Rad, Hercules, CA, USA).
  • Gel images were analyzed using Gel Analyzer 19.1 (www.gelanalyzer.com). The intensity as a function of distance from the well was plotted for each lane of the gel. Peaks were identified by comparison to a standard 50 bp dsDNA ladder (New England Biolabs, Ipswich, MA, USA) that was fit to an exponential function of molecular weight versus distance. (Fig. 9 and Fig. 10)
  • Staphylococcus aureus genomic DNA 150ng was isolated and amplified as described above. Every 3 cycles of the PCR run, the reaction was paused and 2 pL of the PCR reactant was removed, after which the PCR reaction was resumed. This process was repeated until cycle 35.
  • Escherichia coli genomic DNA 150 ng was isolated as described above. It was then
  • Human genomic DNA (Promega, Madison, WI, USA), isolated (as described above) E. coli genomic DNA, or a combination of the two were amplified by PCR and visualized with PAGE as described previously.
  • 375 ng (2.5 uL of 150 ng/pL) of human DNA and 75 ng (2.5 uL of 30 ng/pL) of E. coli DNA were used as PCR template.
  • Reactions with increasing dilution ratios of E. coli to human DNA were created. Specifically, a 1 : 1 ratio corresponds to 2.5 pL of 150 ng/pL (375ng) human genomic DNA and 2.5 pL of 30 ng/pL (75ng) E.
  • coli genomic DNA while 1: 10 corresponds to 2.5 pL of 150 ng/pL (375ng) human genomic DNA and 2.5 pL of 3 ng/pL (7.5ng) E. coli genomic DNA, and so on. PCR was run for either 30 or 60 cycles.
  • E. coli was grown overnight, diluted, then re-grown to mid-log phase as described above. 50 pL of mid-log liquid culture was then added to 450 pL of porcine urine (Mohammed Tiba Laboratory, University of Michigan, Ann Arbor, MI). This process was repeated to create serial log dilutions. Concentrations (CFU/mL) of the dilutions were confirmed by plating on LB agar followed by colony enumeration. DNA was subsequently extracted, PCR amplified, and visualized by PAGE as outlined above.
  • a high-resolution melt platform, uMELT was used to perform high-resolution melt curve analysis of 188 bacteria .
  • uMELT was used to perform high-resolution melt curve analysis of 188 bacteria .
  • Melt curve signatures alone may be too dense and convoluted if used in isolation to distinguish and identify 188 bacteria.
  • amplicon length signatures and ITS ratios all 188 bacteria in the set are uniquely identified.
  • uMELT was performed on 6 bacteria with overlapping length signatures (G.
  • Candida albicans DNA was extracted and purified as above.
  • Fungal DNA was amplified using SYBR green quantitative PCR (using the StepOnePlus Real-Time PCR System from Thermo Fisher Scientific, Waltham, MA, USA) according to the kit instructions, and using the following thermocycler protocol: 1) 95°C for 3 min, 2) 95°C for 15s, 3) 55°C for 30s, 4) 72°C for 1 min, and 5) Repeat steps #2 to #4 for 35 cycles. Amplification was performed using forward and reverse primers designed against the 18S and 5.8S conserved
  • SUBSTITUTE SHEET (RULE 26) fungal regions, respectively: FWD - 5’GTCCCTGCCCTTTGTACACA - I(Inosine)3’ and REV - 5’TTTCGCTGCGTTCTTCATCG- I(Inosine)3 ’ .
  • PCR reactants were subsequently separated via electrophoresis on a 10% polyacrylamide (PAGE) gel (ThermoFisher Scientific, Waltham, MA, USA) then stained with GelRed (Biotium, Fremont, CA, USA) and imaged on a ChemiDoc XRS+ molecular imager (Bio-Rad, Hercules, CA, USA).
  • a 50 bp DNA ladder purchased from New England Biolabs (NEB, Ipswich, MA) was used for size determination. (Fig 12)
  • the sensitivity of the methods, compositions, systems and kits of the present invention were tested using serial 10-fold dilutions of E. coli. (Fig. 3). Under the prescribed conditions, the system detects bacterial DNA at as low of a concentration as 30 pg/uL which corresponds to approximately 250 cells per reaction.
  • SUBSTITUTE SHEET (RULE 26) DNA was mixed with human genomic DNA and amplified. 21 (Fig. 3) The universal primers do not amplify human genome within a typical number of PCR cycles (i.e., 35 cycles) and produce only very faint bands when significantly over cycled. Of note, the bands produced by the human genome are distinct and can be separated out from the unique band signature produced by bacteria. In addition, the presence of very high concentrations of human DNA does not interfere with the ability to amplify and detect bacterial DNA, even at the sensitivity limit of the system.

Abstract

L'invention concerne des procédés, des compositions, des kits et des systèmes pour la détection, l'identification et la quantification de bactéries et de champignons. La présente invention concerne plus particulièrement des procédés, des compositions, des kits et des systèmes comprenant des amorces oligonucléotidiques s'hybridant avec des régions de séquences d'acides nucléiques flanquant les régions d'espacement transcrites internes (ITS) ribosomiques 16S, 23S, 5S, 18S, 5,8S et 25à 28S et d'autres gènes conservés de deux ou plusieurs bactéries ou champignons différents, l'amplification par réaction en chaîne de la polymérase (PCR ou qPCR), l'analyse de la courbe de fusion à haute résolution et la détermination de la taille de l'amplicon pour l'identification des micro-organismes.
PCT/US2023/071182 2022-07-29 2023-07-28 Identification microbienne universelle WO2024026440A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263393550P 2022-07-29 2022-07-29
US63/393,550 2022-07-29

Publications (1)

Publication Number Publication Date
WO2024026440A1 true WO2024026440A1 (fr) 2024-02-01

Family

ID=89707377

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/071182 WO2024026440A1 (fr) 2022-07-29 2023-07-28 Identification microbienne universelle

Country Status (1)

Country Link
WO (1) WO2024026440A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140004509A1 (en) * 2012-06-29 2014-01-02 General Electric Company Kit for isothermal dna amplification starting from an rna template
US20170321257A1 (en) * 2016-05-09 2017-11-09 The Board Of Trustees Of The Leland Stanford Junior University Bacterial pathogen identification by high resolution melting analysis
WO2021112673A1 (fr) * 2019-12-02 2021-06-10 Inbiome B.V. Procédés d'identification de microbes dans un environnement clinique et non clinique.

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140004509A1 (en) * 2012-06-29 2014-01-02 General Electric Company Kit for isothermal dna amplification starting from an rna template
US20170321257A1 (en) * 2016-05-09 2017-11-09 The Board Of Trustees Of The Leland Stanford Junior University Bacterial pathogen identification by high resolution melting analysis
WO2021112673A1 (fr) * 2019-12-02 2021-06-10 Inbiome B.V. Procédés d'identification de microbes dans un environnement clinique et non clinique.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ROZAK ET AL.: "Offset recombinant PCR: a simple but effective method for shuffling compact heterologous domains", NUCLEIC ACIDS RES, vol. 33, 2005, pages 1 - 8, XP055378275, DOI: 10.1093/nar/gni081 *

Similar Documents

Publication Publication Date Title
Long et al. Diagnosis of sepsis with cell-free DNA by next-generation sequencing technology in ICU patients
Peker et al. Diagnosis of bloodstream infections from positive blood cultures and directly from blood samples: recent developments in molecular approaches
Opota et al. Microbial diagnosis of bloodstream infection: towards molecular diagnosis directly from blood
Metzgar et al. The IRIDICA BAC BSI assay: rapid, sensitive and culture-independent identification of bacteria and Candida in blood
DK2430188T3 (en) METHOD AND KIT FOR DETECTING ANTIBIOTIC RESISTANT BACTERIA
US20180135108A1 (en) Method for detecting bacterial and fungal pathogens
CN114898808B (zh) 一种预测肺炎克雷伯菌对头孢吡肟敏感性的方法及系统
Yong et al. Identification of Brucella spp. isolated from human brucellosis in Malaysia using high-resolution melt (HRM) analysis
Sousa et al. A prospect of current microbial diagnosis methods
Haslam Future applications of metagenomic next-generation sequencing for infectious diseases diagnostics
Bagudo et al. Advances in automated techniques to identify complex
Valencia-Shelton et al. Nonculture techniques for the detection of bacteremia and fungemia
Zhao et al. A new droplet digital PCR assay: improving detection of paucibacillary smear-negative pulmonary tuberculosis
Chen et al. Application of Nanopore Sequencing in the Diagnosis and Treatment of Pulmonary Infections
Si et al. A LAMP-based system for rapid detection of eight common pathogens causing lower respiratory tract infections
Guido et al. In vitro diagnosis of sepsis: a review
Wang et al. Performance of PCR‐REBA assay for screening and identifying pathogens directly in whole blood of patients with suspected sepsis
Sutherland et al. Rapid Analytical Methods to Identify Antibiotic‐Resistant Bacteria
WO2024026440A1 (fr) Identification microbienne universelle
WO2021039777A1 (fr) Méthode d'examen de la polyarthrite rhumatoïde
Li et al. Serum Cell-free DNA-based Detection of Mycobacterium Avium Complex Infection
Wolk et al. Code sepsis: rapid methods to diagnose sepsis and detect hematopathogens: Part II: challenges to the laboratory diagnosis of sepsis
Ismail et al. Routine Use of 16S rRNA Gene Sequencing for Diagnosis of Culture-Negative Bacterial Infections in Body Fluids Other than Blood: Benefits in a Limited Resource Hospital
Hewitt et al. Toward rapid sequenced-based detection and characterization of causative agents of bacteremia
Kawai et al. Development and evaluation of a loop-mediated isothermal amplification method for the rapid detection of Chlamydophila pneumoniae

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23847585

Country of ref document: EP

Kind code of ref document: A1