WO2024026385A1 - Inhibition of kir2dl2 and/or kir2dl3 for the enhancement of adoptive immunotherapies - Google Patents

Abstract

Disclosed herein is a method for enhancing adoptively transferred autologous or allogeneic immune effector cells (T cells) in patients who are HLA-C1+. In some embodiments, the method involves ablating KIR2DL2 and/or KIR2DL3 expression in the T cells prior to adoptive transfer. In some embodiments, the T cells are further engineered to express a CAR. Therefore, disclosed herein are enhanced CAR-T cells that are engineered to have ablated KIR2DL2 and/or KIR2DL3 expression or activity.

Description

INHIBITION OF KIR2DL2 AND/OR KIR2DL3 FOR THE ENHANCEMENT OF ADOPTIVE IMMUNOTHERAPIES CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims benefit of U.S. Provisional Application No. 63/369,701, filed July 28, 2022, which is hereby incorporated herein by reference in its entirety. SEQUENCE LISTING [0001] This application contains a sequence listing filed in ST.26 format entitled “320803-2910 Sequence Listing” created on June 19, 2023, having 715,239 bytes. The content of the sequence listing is incorporated herein in its entirety. BACKGROUND OF THE INVENTION [0002] Surgery, radiation therapy, and chemotherapy have been the standard accepted approaches for treatment of cancers including leukemia, solid tumors, and metastases. Immunotherapy (sometimes called biological therapy, biotherapy, or biological response modifier therapy), which uses the body's immune system, either directly or indirectly, to shrink or eradicate cancer has been studied for many years as an adjunct to conventional cancer therapy. It is believed that the human immune system is an untapped resource for cancer therapy and that effective treatment can be developed once the components of the immune system are properly harnessed. SUMMARY OF THE INVENTION [0003] Disclosed herein is a method for enhancing adoptively transferred autologous or allogeneic immune effector cells (T cells) in patients who are HLA-C1+. Therefore, in some embodiments, a sample from the subject is assayed to determine their HLA profile and treated with the disclosed enhanced T cells if determined to be HLA-C1+. In some embodiments, the method involves ablating KIR2DL3 expression in the T cells prior to adoptive transfer. In some embodiments, the T cells are further engineered to express a CAR. Therefore, disclosed herein are enhanced CAR-T cells that are engineered to have ablated KIR2DL2 or KIR2DL3 expression or activity alone or KIR2DL3 and KIR2DL2 expression or activity. [0004] Also disclosed are isolated nucleic acid sequences encoding the disclosed polypeptides, vectors comprising these isolated nucleic acids, and cells containing these vectors. The lymphocytes disclosed herein can be an immune effector cell selected from the group consisting of an alpha-beta T cells, a gamma-delta T cell, a Natural Killer (NK) cells, a Natural Killer T (NKT) cell, a B cell, an innate lymphoid cell (ILC), a cytokine induced killer (CIK) cell, a cytotoxic T lymphocyte (CTL), a lymphokine activated killer (LAK) cell, and a regulatory T cell. In some embodiments, the lymphocytes are TILs. [0005] Also disclosed is a method for treating a subject with adoptive cell therapy, in a subject, e.g. providing an anti-cancer immunity, that involves administering to the subject an effective amount of an enhanced T cell disclosed herein. Therefore, disclosed are methods of treating cancer in a subject that involves collecting lymphocytes from the subject, treating the lymphocytes ex vivo to inhibit KIR2DL2 and/or KIR2DL3 expression or activity, and transferring the modified lymphocytes back to the subject. [0006] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. BRIEF DESCRIPTION OF FIGURES [0007] FIGs.1A and 1B show design, validation, and testing of the strategy for KIR2DL2/3 abrogation in primary human T cells. A strategy was designed for the abrogation of KIR2DL2/3 expression during CAR-T cell manufacturing. It was validated using an in vivo model of NSG mice bearing acute lymphoblastic leukemia grafts. FIG. 1A is a schematic representation of the gene editing validation protocol. First, the KIR2DL2 and KIR2DL3 loci were analyzed for the presence of guide RNAs (gRNAs) with the highest cutting score (1). Due to the low expression of KIR2DL2 within PBMCs, the KIR2DL2/3+ population was enriched by fluorescent activated cell sorting (2). KIR2DL2+ T cells were then nucleofected (Neon Transfection System, Thermo Fisher Scientific) with either a non-targeting guide RNA (NTC gRNA) or a gRNA targeting KIR2DL2 exon 1 (3). KIR2DL2/3 expression was analyzed 48 hours after nucleofection by flow cytometry (4). FIG.1B is a flow cytometry histogram of a representative experiment (left panel) and KIR2DL2/3 mean fluorescence intensity (MFI, right panel) comparisons between pre-sorted, unedited (NTC) and KIR2DL2/3-ablated T cells. Data are shown as a mean ± SD of three independent experiments. DETAILED DESCRIPTION [0008] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims. [0009] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure. [0010] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. [0011] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed. [0012] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible. [0013] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of chemistry, biology, and the like, which are within the skill of the art. [0014] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20 °C and 1 atmosphere. [0015] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible. Definitions [0016] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. [0017] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician. [0018] The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination. [0019] The term “pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio. [0020] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder. KIR2DL3 Ablation or Inhibition [0021] In some embodiments, immune effector cells are modified ex vivo to inhibit or ablate KIR2DL2 and/or KIR2DL3 expression, and then adoptively transferred back to the subject. [0022] As used herein the terms “inhibit” and “ablate” connote a partial or complete reduction in the expression and/or function of the KIR2DL2 and/or KIR2DL3 polypeptide encoded by the endogenous gene. Thus, the expression or function of the KIR2DL3 gene product can be completely or partially disrupted or reduced (e.g., by 50%, 75%, 80%, 90%, 95% or more, e.g., 100%) in a selected group of cells (e.g., a tissue or organ) or in the entire animal. [0023] KIR2DL3 is a co-inhibitory receptor that may act as an immune checkpoint mechanism in the modulation of T cell activity. Its inhibitory effect is well characterized in natural killer (NK) cells, but little is known about its mechanism of action in T cells. [0024] Multiple technologies exist to induce disruption of a gene, including CRISPR/Cas-based system, TALEN, MegaTAL, or other sequence-specific nucleases. In addition to genetic ablation using nucleases, other methods can be used to achieve reversible inhibition of KIR2DL2 and/or KIR2DL3 expression or activity. For instance, CRISPR/Cas systems can be engineered to induce reversible inhibition of gene transcription. Alternatively, small molecules or monoclonal antibodies could be dosed in vivo to block the interaction between KIR2DL2 and/or KIR2DL3 and its ligand. Small molecule inhibitors that target the phosphatase SHP1 could prevent KIR2DL2 and/or KIR2DL3 inhibition. Each of these and other approaches have different advantages and disadvantages. For example, genetic ablation has the advantage of inducing a permanent disruption in this pathway only on adoptively transferred T cells, which may allow for long-term prevention of KIR2DL2- and/or KIR2DL3-induced inhibition without affecting other KIR2DL2- and/or KIR2DL3-expressing cells in the immune system. On the other hand, transient inhibition with small molecule inhibitors or antibodies may allow for real-time control of the magnitude and duration of the checkpoint blockade. [0025] In some embodiments, the ex vivo KIR2DL2 and/or KIR2DL3 ablation involves contacting the immune effector cells with a targeted nuclease, a guide RNA (gRNA), an siRNA, an antisense RNA, microRNA (miRNA), or short hairpin RNA (shRNA). [0026] In some embodiments, the targeted nuclease may introduce a double- stranded break in a target region in the KIR2DL2 and/or KIR2DL3 gene of the immune effector cells. The targeted nuclease may be an RNA-guided nuclease. In some embodiments, the RNA-guided nuclease is a Cpf1 (Cas12) nuclease or a Cas9 nuclease and the method further comprises introducing into the immune effector cell a gRNA that specifically hybridizes to the target region in the KIR2DL2 and/or KIR2DL3 gene. In some embodiments, the Cas12 nuclease or the Cas9 nuclease and the gRNA are introduced into the cell as a ribonucleoprotein (RNP) complex. Therefore, in some embodiments, the ex vivo KIR2DL2 and/or KIR2DL3 ablation involves performing clustered regularly interspaced short palindromic repeats (CRISPR)/Cas genome editing. [0027] In some embodiments, KIR2DL2 has the amino acid sequence:

NP_055034), comprising a signal peptide (lower case and italicized), EXTRACELLULAR DOMAIN (capitalized), transmembrane domain (lower case and bold, and INTRACELLULAR DOMAIN (capitalized and bold). [0028] In some embodiments, KIR2DL2 gene has the nucleic acid sequence:

[0029] In some embodiments, the KIR2DL2 gene has the consensus sequence:

3’UTR (upper case and bold), EXONS (upper case), and introns (lower case). [0030] In some embodiments, the protein coding sequence of the KIR2DL2 gene has the consensus sequence:

CCCATG (SEQ ID NO:3), comprising a 5’UTR and 3’UTR (upper case and bold) and a signal peptide (lower case). [0031] In some embodiments, the protein coding sequence of the KIR2DL2 gene has the consensus sequence:

CCCATG (SEQ ID NO:4), comprising a 5’UTR and 3’UTR (upper case and bold) and a signal peptide (lower case). [0032] In some embodiments, the KIR2DL3 gene has the consensus sequence:

GCCCTCA (SEQ ID NO:624), comprising a promoter region (italicized), 5’UTR and 3’UTR (upper case and bold), EXONS (upper case), and introns (lower case). [0033] In some embodiments, the protein coding sequence of the KIR2DL3 gene has the consensus sequence:

GTCTGCCCTCA (SEQ ID NO:625), comprising a 5’UTR and 3’UTR (upper case and bold) and a signal peptide (lower case). [0034] In some embodiments, KIR2DL3 has the amino acid sequence:

( , _ ), comprising a signal peptide (lower case and italicized), EXTRACELLULAR DOMAIN (capitalized), stem region (lower case), transmembrane domain (lower case and bold, and INTRACELLULAR DOMAIN (capitalized and bold). [0035] Therefore, disclosed herein are gRNAs and crRNAs that can be used to ablate KIR2DL3 expression in immune effector cells. Note that differences between a gRNA and a crRNA are based on Cas specificities. While gRNAs are designed to couple with a tracer RNA (tracRNA) to pair with the Cas9, the crRNA are designed to form a ribonucleoprotein (RNP) complex with the Cas12 with no need of tracRNA. [0036] In some embodiments, the gRNA and crRNA can be used to ablate KIR2DL2 and/or KIR2DL3 expression in immune effector cells are provided in Table 1 and/or 2.

Table 1. KIR2DL2 guide RNA (gRNA*) and CRISPR RNA (crRNA*) Cas9 ^{Region t PAM Specificity Score} Efficiency Score score) 25 89 32 73 63 74 72 76 47 87 Promote 4 97 16 49 61 92 34 5 73 91 51 01 56 5'UTR + peptide

28 -1 gtgctgtctgtgcagacagg (SEQ ID NO:30) cgg 42.4198704 65.8510863

-1 gctgacgaccatgagcgaca (SEQ ID NO:31) tgg 17.4180397 68.97222201 1 gtcgctcatggtcgtcagca (SEQ ID NO:32) tgg 15.8075075 48.88926217 1 cagggggcctggccacatga (SEQ ID NO:33) ggg 25.6759978 53.42004189 46 84 17 Signal p 24 Exon 2 57 16 08 19 Cas9 Region t Score 72 18 08 31 56 26 75 63 Exon 3 09 28 13 1 36 96

2 1 ctcattggagagcaccatga (SEQ ID NO:57) tgg 24.7282726 54.6636991

1 cattggagagcaccatgatg (SEQ ID NO:58) ggg 22.3248805 64.51568239 -1 tttcaccaggcgacctgggt (SEQ ID NO:59) ggg 21.945129 56.88886502 -1 atttcaccaggcgacctggg (SEQ ID NO:60) tgg 21.3848745 59.80225741 16 96 27 24 73 97 39 71 24 39 75 26 93 62 39 83 13 76 05 81 91 28

7 -1 cctgggtgggccaggaggga (SEQ ID NO:86) agg 10.6308453 45.10008683

Cas9 Region targeted Strand Sequence PAM ^{Specificity Score} Efficiency Score (_{Off target score)} (On target score) -1 ctgcagagaacctacattca (SEQ ID NO:87) tgg 58.126023 41.77042991 55 6 12 23 99 23 62 07 76 04 64 27 Exon 4 54 71 06 55 98 69 09 49 91 12 96 4

88 -1 taggttcctccgtgggtggc (SEQ ID NO:113) agg 18.6401946 33.90580348

1 ttccaggccgactttcctct (SEQ ID NO:114) ggg 18.3037756 51.86413845 1 atgtaccatctatccaggga (SEQ ID NO:115) ggg 17.9123846 65.85919053 1 tgacatgtaccatctatcca (SEQ ID NO:116) ggg 17.6685576 64.17145284 16 07 69 36 54 67 67 75 19 31 6 31 6 21 21 72 89 74 11 61 13 39 56 71 93

09 Exon 5 1 actgaaccaagctctaaaac (SEQ ID NO:143) cgg 48.7345562 54.98912793

-1 gttttagagcttggttcagt (SEQ ID NO:144) ggg 37.0092113 55.32743764 -1 ggttttagagcttggttcag (SEQ ID NO:145) tgg 36.4002409 55.47355384 -1 ggtgaaggccaactatttga (SEQ ID NO:146) agg 20.7173391 43.55714515 5 3 66 36 22 99 93 64 37 38 07 Exon 6 46 55 66 74 34 35 07 9 7 2 62 Exon 7 98 8

44 -1 ttctgttccctgcagactct (SEQ ID NO:172) tgg 25.0386945 36.77304996

Cas9 Region targeted Strand Sequence PAM Specificity Score Efficiency Score 1 aacagatatcatcgtgtaca (SEQ ID NO:173) cgg 45.2890654 62.71699919 08 05 46 96 28 2 4 99 Exon 8 4 12 43 38 54 02 73 17 44 96 05 92 09 3' UTR 1 44 6

27 -1 agactgaaagctagtctgag (SEQ ID NO:199) ggg 69.6237996 65.42780553

1 cttacttcctagtctacttg (SEQ ID NO:200) agg 67.8417065 55.35650233 -1 gaagactgaaagctagtctg (SEQ ID NO:201) agg 66.7107553 60.44061624 -1 ctccctagaagacgccctca (SEQ ID NO:202) agg 66.5546099 51.7559014 -1 96 1 29 -1 55 -1 02 1 89 -1 48 1 34 1 76 -1 76 -1 61 -1 84 -1 17 -1 82 -1 53 -1 72 -1 03 -1 15 -1 52 -1 59 -1 12 -1 75 -1 93 -1 21 -1 9 -1

55 -1 gagaggcacattcagatttg (SEQ ID NO:228) tgg 23.7410105 49.60496574

1 aaggcatgagtctgcatctt (SEQ ID NO:229) agg 22.5261758 31.64102817 -1 gttttttctccagcaggcag (SEQ ID NO:230) tgg 21.269244 46.35960697 -1 gagaactgtgggctaagcaa (SEQ ID NO:231) agg 20.1230219 57.13606536 32 39 23 7 82 72 48 95 06 41 96 49 41 66 21 53 27 61 2 38 Cpf1 (C Region Score KIR2DL promote

-1 gcgccctgcccatgcagttta (SEQ ID NO:254) tttg 13.282476

Signal peptide 1 cagggttcttcttgctgcagg (SEQ ID NO:255) tttc 17.9146425 + Exon 2 1 tttccagggttcttcttgctg (SEQ ID NO:256) tttc 16.1254393 -1 gagaccccatcatggtgctct (SEQ ID NO:257) tttg 96.1936289 Exon 3 Exon 4 Exon 5 Exon 6 Exon 8 3' UTR

-1 gaattgtgagttcctcagtgt (SEQ ID NO:282) tttg 91.0259628

-1 actgctgacagaagactgaaa (SEQ ID NO:283) tttt 88.8907291 -1 tccagcaggcagtggggacct (SEQ ID NO:284) tttc 86.4077082 1 agtcttctgtcagcagtaaaa (SEQ ID NO:285) tttc 86.2360603

Table 2. KIR2DL3 guide RNA (gRNA*) and CRISPR RNA (crRNA*) in silico analysis. _Cas9 Region P^A Specificity Score Efficiency Score Targets _targeted ^M DL2 Promote 5'UTR + Signal peptide ^lly, a_tched

Signal 1 cagggggcctggccacatga (SEQ ID NO:329) ggg 25.6759978 53.42004189 Yes

peptide + 1 cagggttcttcttgctgcag (SEQ ID NO:330) ggg 16.7082395 47.66879684 Yes Exon 2 1 tcttcttgctgcagggggcc (SEQ ID NO:331) tgg 16.3937902 23.97461357 Yes 1 agggttcttcttgctgcagg (SEQ ID NO:332) ggg 16.3044063 53.09881316 Yes Table 2 Cas9

Region ets _targeted DL2 Exon 3

-1 gacgatgtccagagggtcac (SEQ ID NO:355) tgg 17.8540881 39.43995673 Yes

-1 agcatctgtaggtccctgca (SEQ ID NO:356) agg 17.5270305 61.14244139 Yes -1 catgggaccgatggagaagt (SEQ ID NO:357) tgg 17.5075974 47.77644971 Yes -1 gggagctgacaactgatagg (SEQ ID NO:358) ggg 17.1716987 66.56681924 Yes l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched

1 cacttccttctgcacagaga (SEQ ID NO:379) agg 12.553479 47.81811254 Yes

1 ccacagaaaaccttccctcc (SEQ ID NO:380) tgg 12.179199 51.892235 Yes 1 ccttccctcctggcccaccc (SEQ ID NO:381) agg 11.4972374 51.59938375 Yes -1 ccaggagggaaggttttctg (SEQ ID NO:382) tgg 11.2593255 54.0490957 Yes l^ly, a_tched l^ly, a_tched Table 2

Cas9 _{Region targeted Strand Sequence PAM Specificity Score Efficiency Score} ^Targets K_IR2DL2 i^ally, m_atched i^ally, m_atched i^ally, m_atched i^ally, m_atched Exon 4

-1 gcatctgtaggttcctccgt (SEQ ID NO:401) ggg 23.7641164 64.09139455 Yes

-1 ggatagatggtacatgtcat (SEQ ID NO:402) agg 22.5719786 58.79313198 Yes 1 caaggtcaacggaacattcc (SEQ ID NO:403) agg 22.5410529 45.79626069 Yes 1 ccgggccccacggttctggc (SEQ ID NO:404) agg 22.1712727 46.55746509 Yes i^ally, m_atched

-1 gctccgggagctgcaggaca (SEQ ID NO:431) agg 13.2586199 56.31871721 Yes

1 gcttgtttctgtcacaggtg (SEQ ID NO:432) agg 13.1370879 59.34421277 Yes 1 tgaccttgtcctgcagctcc (SEQ ID NO:433) cgg 13.1335213 44.62611872 Yes -1 aggttcctccgtgggtggca (SEQ ID NO:434) ggg 12.996601 51.90925589 Yes i^ally, m_atched i^ally, m_atched i^ally, m_atched Exon 5 i^ally, m_atched i^ally, m_atched i^ally, Exon 6 _matched

-1 tcagaacatgcaggtgtctg (SEQ ID NO:457) ggg 28.9464104 58.45282741 No

_{-1 aggtcccaatcagaacatgc (SEQ ID NO:458) agg 27.9159958 62.88478036} ^Partially, m_{ismatched -1 ctggggttacctggaagaag (SEQ ID NO:459) agg 25.5617285 55.0454841} ^Partially, m_ismatched i^ally, m_atched i^ally, m_atched i^ally, m_atched i^ally, m_atched Exon 7

g gg g g g gg . .

Table 2 (continued). KIR2DL3 guide RNA (gRNA*) and CRISPR RNA (crRNA*) in silico analysis. Cas9 _{Region targeted Strand Sequence PAM} ^Specificity Efficiency Targets S_core Score KIR2DL2 1 aacagatatcatcgtgtaca (SEQ ID NO:479) cgg 45.2890654 62.71699919 Yes l^ly, a_tched Exon 8 ^lly, a_tched l^ly, a_tched l^ly, a_tched 3' UTR l^ly, a_tched

g g gg . . -1 gaaggctgaaagctagtctg (SEQ ID NO:504) agg 67.5454207 60.21593691 Partially,

mismatched -_{1 aaggctgaaagctagtctga (SEQ ID NO:505) ggg 65.6494179 54.96128006} ^Partially, m_ismatched 1 t t t t SEQ ID NO:506 61702876 6732684796 Y l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly,

_atched -1 gacatttgtaagcaagggag (SEQ ID NO:533) agg 25.1192321 53.53298664 Partially,

mismatched -_{1 ggcaacccagttttgagaca (SEQ ID NO:534) ggg 24.7611803 56.99338082} ^Partially, m_ismatched 1 t t t t SEQ ID NO:535 241212625 6289687787 N l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched

. . -1 cgccttcagattccagctgc (SEQ ID NO:561) tgg 12.0110431 46.85022416 Partially,

mismatched -1 gttttctctccagcaggcag (SEQ ID NO:562) tgg 11.5641021 47.76062242 No 1 taccagcagctggaatctga (SEQ ID NO:563) agg 11.2821164 58.57564638 Yes Table 2

Cpf1 (Cas12) Region S^{trand Sequence} Specificity Efficiency Targets _targeted ^{PAM Score Score} KIR2DL2 Promot Signal peptide Exon 2 l^ly, Exon 3 _atched l^ly, a_tched Exon 4

Exon 5 -1 aagggtttcctagaacacgagac (SEQ ID NO:582) tttg 39.2845023 ^ally, m_ismatched

1 ctcacctctctcctgtctcgtgt (SEQ ID NO:583) tttc 37.6898834 ^Partially, m_ismatched -1 ctagaacacgagacaggagagag (SEQ ID NO:584) tttc 28.0859682 ^Partially, m_ismatched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, Exon 6 _atched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched Exon 8 l^ly, 3' UTR _atched

-1 ctgctgacagaaggctgaaagct (SEQ ID NO:603) ttta 90.2140047 ^ally, m_ismatched

-1 taagcaagggagaggcacgttca (SEQ ID NO:604) tttg 85.9786723 ^Partially, m_ismatched -1 aaggagggaaaactacattgaaa (SEQ ID NO:605) tttg 85.3860235 ^Partially, m_ismatched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched l^ly, a_tched

-1 agacagggctgttgtctccctag (SEQ ID NO:623) tttg 13.2493833 Yes

[0037] Also disclosed are methods of disrupting KIR2DL2 and/or KIR2DL3 expression in T cells ex vivo while effectively expressing chimeric receptors. Therefore, disclosed herein is a chimeric cell expressing a chimeric receptor, wherein the chimeric receptor is encoded by a transgene, and wherein the transgene is inserted in the genome of the cell at a location that disrupts expression or activity of an endogenous KIR2DL2 and/or KIR2DL3 protein. [0038] In other embodiments, the subject is treated with a KIR2DL2 and/or KIR2DL3 inhibitor prior to, during, or after treatment with adoptive cell immunotherapy. For example, the KIR2DL2 and/or KIR2DL3 inhibitor can be a blocking antibody that binds KIR2DL2 and/or KIR2DL3 Ig domains and blocks its binding to an HLA-C1. In some embodiments, the blocking antibody binds an HLA-C1 and blocks its binding to KIR2DL3 without blocking its binding to TCRs. Soluble receptors, such as KIR2DL2 and/or KIR2DL3 fragments or HLA-C fragments that block this interaction are also contemplated for use in the disclosed methods. The structure or human KIR2DL2 and/or KIR2DL3 and its binding to HLA-Cw3 is described in Boyington, JC, et al. Nature 2000405:537-43, which is incorporated by reference for the teaching of these binding sites. Chimeric antigen receptors (CAR) [0039] In particular embodiments, the immune effector cells with ablated KIR2DL2 and/or KIR2DL3 are engineered to express a chimeric antigen receptor (CAR) polypeptide. CARs generally incorporate an antigen recognition domain from the single-chain variable fragments (scFv) of a monoclonal antibody (mAb) with transmembrane signaling motifs involved in lymphocyte activation (Sadelain M, et al. Nat Rev Cancer 20033:35–45). The disclosed CAR is generally made up of three domains: an ectodomain, a transmembrane domain, and an endodomain. The ectodomain comprises the recognition domain. It also optionally contains a signal peptide (SP) so that the CAR can be glycosylated and anchored in the cell membrane of the immune effector cell. The transmembrane domain (TD), as its name suggests, connects the ectodomain to the endodomain and resides within the cell membrane when expressed by a cell. The endodomain is the business end of the CAR that transmits an activation signal to the immune effector cell after antigen recognition. For example, the endodomain can contain an intracellular signaling domain (ISD) and optionally a co-stimulatory signaling region (CSR). [0040] A “signaling domain (SD)” generally contains immunoreceptor tyrosine-based activation motifs (ITAMs) that activate a signaling cascade when the ITAM is phosphorylated. The term “co-stimulatory signaling region (CSR)” refers to intracellular signaling domains from costimulatory protein receptors, such as CD28, 41BB, and ICOS, that are able to enhance T-cell activation by T-cell receptors. [0041] In some embodiments, the endodomain contains an SD or a CSR, but not both. In these embodiments, an immune effector cell containing the disclosed CAR is only activated if another CAR (or a T-cell receptor) containing the missing domain also binds its respective antigen. [0042] Additional CAR constructs are described, for example, in Fresnak AD, et al. Engineered T cells: the promise and challenges of cancer immunotherapy. Nat Rev Cancer. 2016 Aug 23;16(9):566-81, which is incorporated by reference in its entirety for the teaching of these CAR models. [0043] For example, the CAR can be a TRUCK, Universal CAR, Self-driving CAR, Armored CAR, Self-destruct CAR, Conditional CAR, Marked CAR, TenCAR, Dual CAR, or sCAR. [0044] TRUCKs (T cells redirected for universal cytokine killing) co-express a chimeric antigen receptor (CAR) and an antitumor cytokine. Cytokine expression may be constitutive or induced by T cell activation. Targeted by CAR specificity, localized production of pro- inflammatory cytokines recruits endogenous immune cells to tumor sites and may potentiate an antitumor response. [0045] Universal, allogeneic CAR T cells are engineered to no longer express endogenous T cell receptor (TCR) and/or major histocompatibility complex (MHC) molecules, thereby preventing graft-versus-host disease (GVHD) or rejection, respectively. [0046] Self-driving CARs co-express a CAR and a chemokine receptor, which binds to a tumor ligand, thereby enhancing tumor homing. [0047] CAR T cells engineered to be resistant to immunosuppression (Armored CARs) may be genetically modified to no longer express various immune checkpoint molecules (for example, cytotoxic T lymphocyte-associated antigen 4 (CTLA4) or programmed cell death protein 1 (PD1)), with an immune checkpoint switch receptor, or may be administered with a monoclonal antibody that blocks immune checkpoint signaling. [0048] A self-destruct CAR may be designed using RNA delivered by electroporation to encode the CAR. Alternatively, inducible apoptosis of the T cell may be achieved based on ganciclovir binding to thymidine kinase in gene-modified lymphocytes or the more recently described system of activation of human caspase 9 by a small-molecule dimerizer. [0049] A conditional CAR T cell is by default unresponsive, or switched ‘off’, until the addition of a small molecule to complete the circuit, enabling full transduction of both signal 1 and signal 2, thereby activating the CAR T cell. Alternatively, T cells may be engineered to express an adaptor-specific receptor with affinity for subsequently administered secondary antibodies directed at target antigen. [0050] Marked CAR T cells express a CAR plus a tumor epitope to which an existing monoclonal antibody agent binds. In the setting of intolerable adverse effects, administration of the monoclonal antibody clears the CAR T cells and alleviates symptoms with no additional off- tumor effects. [0051] A tandem CAR (TanCAR) T cell expresses a single CAR consisting of two linked single-chain variable fragments (scFvs) that have different affinities fused to intracellular co- stimulatory domain(s) and a CD3ȗ domain. TanCAR T cell activation is achieved only when target cells co-express both targets. [0052] A dual CAR T cell expresses two separate CARs with different ligand binding targets; one CAR includes only the CD3ȗ domain and the other CAR includes only the co- stimulatory domain(s). Dual CAR T cell activation requires co-expression of both targets on the tumor. [0053] A safety CAR (sCAR) consists of an extracellular scFv fused to an intracellular inhibitory domain. sCAR T cells co-expressing a standard CAR become activated only when encountering target cells that possess the standard CAR target but lack the sCAR target. [0054] The antigen recognition domain of the disclosed CAR is usually an scFv. There are however many alternatives. An antigen recognition domain from native T-cell receptor (TCR) alpha and beta single chains have been described, as have simple ectodomains (e.g. CD4 ectodomain to recognize HIV infected cells) and more exotic recognition components such as a linked cytokine (which leads to recognition of cells bearing the cytokine receptor). In fact almost anything that binds a given target with high affinity can be used as an antigen recognition region. [0055] The endodomain is the business end of the CAR that after antigen recognition transmits a signal to the immune effector cell, activating at least one of the normal effector functions of the immune effector cell. Effector function of a T cell, for example, may be cytolytic activity or helper activity including the secretion of cytokines. Therefore, the endodomain may comprise the “intracellular signaling domain” of a T cell receptor (TCR) and optional co- receptors. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. [0056] Cytoplasmic signaling sequences that regulate primary activation of the TCR complex that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs (ITAMs). Examples of ITAM containing cytoplasmic signaling sequences include those derived from CD8, CD3ȗ, CD3į, CD3Ȗ, CD3İ, CD32 (Fc gamma RIIa), DAP10, DAP12, CD79a, CD79b, FcȖRIȖ, FcȖRIIIȖ, FcİRIȕ (FCERIB), and FcİRIȖ (FCERIG). [0057] In particular embodiments, the intracellular signaling domain is derived from CD3 zeta (CD3ȗ) (TCR zeta, GenBank accno. BAG36664.1). T-cell surface glycoprotein CD3 zeta (CD3ȗ) chain, also known as T-cell receptor T3 zeta chain or CD247 (Cluster of Differentiation 247), is a protein that in humans is encoded by the CD247 gene. [0058] First-generation CARs typically had the intracellular domain from the CD3ȗ chain, which is the primary transmitter of signals from endogenous TCRs. Second-generation CARs add intracellular signaling domains from various costimulatory protein receptors (e.g., CD28, 41BB, ICOS) to the endodomain of the CAR to provide additional signals to the T cell. Preclinical studies have indicated that the second generation of CAR designs improves the antitumor activity of T cells. More recent, third-generation CARs combine multiple signaling domains to further augment potency. T cells grafted with these CARs have demonstrated improved expansion, activation, persistence, and tumor-eradicating efficiency independent of costimulatory receptor/ligand interaction (Imai C, et al. Leukemia 200418:676–84; Maher J, et al. Nat Biotechnol 200220:70–5). [0059] For example, the endodomain of the CAR can be designed to comprise the CD3ȗ signaling domain by itself or combined with any other desired cytoplasmic domain(s) useful in the context of the CAR of the invention. For example, the cytoplasmic domain of the CAR can comprise a CD3ȗ chain portion and a costimulatory signaling region. The costimulatory signaling region refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or their ligands that is required for an efficient response of lymphocytes to an antigen. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, CD8, CD4, b2c, CD80, CD86, DAP10, DAP12, MyD88, BTNL3, and NKG2D. Thus, while the CAR is exemplified primarily with CD28 as the co-stimulatory signaling element, other costimulatory elements can be used alone or in combination with other co-stimulatory signaling elements. [0060] In some embodiments, the CAR comprises a hinge sequence. A hinge sequence is a short sequence of amino acids that facilitates antibody flexibility (see, e.g., Woof et al., Nat. Rev. Immunol., 4(2): 89-99 (2004)). The hinge sequence may be positioned between the antigen recognition moiety (e.g., anti-CD123 scFv) and the transmembrane domain. The hinge sequence can be any suitable sequence derived or obtained from any suitable molecule. In some embodiments, for example, the hinge sequence is derived from a CD8a molecule or a CD28 molecule. [0061] The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane- bound or transmembrane protein. For example, the transmembrane region may be derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8 (e.g., CD8 alpha, CD8 beta), CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, or CD154, KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a, CD18) , ICOS (CD278) , 4-1BB (CD137) , GITR, CD40, BAFFR, HVEM (LIGHTR) , SLAMF7, NKp80 (KLRF1) , CD160, CD19, IL2R beta, IL2R gamma, IL7R Į, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226) , SLAMF4 (CD244, 2B4) , CD84, CD96 (Tactile) , CEACAM1, CRTAM, Ly9 (CD229) , CD160 (BY55) , PSGL1, CD100 (SEMA4D) , SLAMF6 (NTB-A, Ly108) , SLAM (SLAMF1, CD150, IPO-3) , BLAME (SLAMF8) , SELPLG (CD162) , LTBR, and PAG/Cbp. Alternatively the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. In some cases, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain. A short oligo- or polypeptide linker, such as between 2 and 10 amino acids in length, may form the linkage between the transmembrane domain and the endoplasmic domain of the CAR. [0062] In some embodiments, the CAR has more than one transmembrane domain, which can be a repeat of the same transmembrane domain, or can be different transmembrane domains. [0063] In some embodiments, the CAR is a multi-chain CAR, as described in WO2015/039523, which is incorporated by reference for this teaching. A multi-chain CAR can comprise separate extracellular ligand binding and signaling domains in different transmembrane polypeptides. The signaling domains can be designed to assemble in juxtamembrane position, which forms flexible architecture closer to natural receptors, that confers optimal signal transduction. For example, the multi-chain CAR can comprise a part of an FCERI alpha chain and a part of an FCERI beta chain such that the FCERI chains spontaneously dimerize together to form a CAR. [0064] In some embodiments, the recognition domain is a single chain variable fragment (scFv) antibody. The affinity/specificity of an scFv is driven in large part by specific sequences within complementarity determining regions (CDRs) in the heavy (V_H) and light (V_L) chain. Each V_H and V_L sequence will have three CDRs (CDR1, CDR2, CDR3). [0065] In some embodiments, the recognition domain is derived from natural antibodies, such as monoclonal antibodies. In some cases, the antibody is human. In some cases, the antibody has undergone an alteration to render it less immunogenic when administered to humans. For example, the alteration comprises one or more techniques selected from the group consisting of chimerization, humanization, CDR-grafting, deimmunization, and mutation of framework amino acids to correspond to the closest human germline sequence. [0066] Also disclosed are bi-specific CARs that target two different antigens. Also disclosed are CARs designed to work only in conjunction with another CAR that binds a different antigen, such as a tumor antigen. For example, in these embodiments, the endodomain of the disclosed CAR can contain only a signaling domain (SD) or a co-stimulatory signaling region (CSR), but not both. The second CAR (or endogenous T-cell) provides the missing signal if it is activated. For example, if the disclosed CAR contains an SD but not a CSR, then the immune effector cell containing this CAR is only activated if another CAR (or T- cell) containing a CSR binds its respective antigen. Likewise, if the disclosed CAR contains a CSR but not a SD, then the immune effector cell containing this CAR is only activated if another CAR (or T-cell) containing an SD binds its respective antigen. [0067] Tumor antigens are proteins that are produced by tumor cells that elicit an immune response, particularly T-cell mediated immune responses. The additional antigen binding domain can be an antibody or a natural ligand of the tumor antigen. The selection of the additional antigen binding domain will depend on the particular type of cancer to be treated. Tumor antigens are well known in the art and include, for example, a glioma-associated antigen, carcinoembryonic antigen (CEA), EGFRvIII, IL-llRa, IL-13Ra, EGFR, FAP, B7H3, Kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, ȕ-human chorionic gonadotropin, alphafetoprotein (AFP), ALK, CD19, TIM3, cyclin Bl, lectin-reactive AFP, Fos-related antigen 1, ADRB3, thyroglobulin, EphA2, RAGE-1, RUl, RU2, SSX2, AKAP-4, LCK, OY-TESl, PAX5, SART3, CLL-1, fucosyl GM1, GloboH, MN-CA IX, EPCAM, EVT6-AML, TGS5, human telomerase reverse transcriptase, plysialic acid, PLAC1, RUl, RU2 (AS), intestinal carboxyl esterase, lewisY, sLe, LY6K, mut hsp70-2, M-CSF, MYCN, RhoC, TRP-2, CYPIBI, BORIS, prostase, prostate-specific antigen (PSA), PAX3, PAP, NY-ESO-1, LAGE-la, LMP2, NCAM, p53, p53 mutant, Ras mutant, gplOO, prostein, OR51E2, PANX3, PSMA, PSCA, Her2/neu, hTERT, HMWMAA, HAVCR1, VEGFR2, PDGFR-beta, survivin and telomerase, legumain, HPV E6,E7, sperm protein 17, SSEA-4, tyrosinase, TARP, WT1, prostate-carcinoma tumor antigen- 1 (PCTA-1), ML-IAP, MAGE, MAGE-A1,MAD-CT-1, MAD-CT-2, MelanA/MART 1, XAGE1 , ELF2M, ERG (TMPRSS2 ETS fusion gene), NA17, neutrophil elastase, sarcoma translocation breakpoints, NY-BR-1, ephnnB2, CD20, CD22, CD24, CD30, TIM3, CD38, CD44v6, CD97, CD171, CD179a, androgen receptor, FAP, insulin growth factor (IGF)-I, IGFII, IGF-I receptor, GD2, o-acetyl-GD2, GD3, GM3, GPRC5D, GPR20, CXORF61, folate receptor (FRa), folate receptor beta, ROR1, Flt3, TAG72, TN Ag, Tie 2, TEM1, TEM7R, CLDN6, TSHR, UPK2, and mesothelin. In a preferred embodiment, the tumor antigen is selected from the group consisting of folate receptor (FRa), mesothelin, EGFRvIII, IL-13Ra, CD123, CD19, TIM3, BCMA, GD2, CLL-1, CA-IX, MUCl, HER2, and any combination thereof. [0068] Non-limiting examples of tumor antigens include the following: Differentiation antigens such as tyrosinase, TRP-1, TRP-2 and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pi 5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor-suppressor genes such as p53, Ras, HER- 2/neu; unique tumor antigens resulting from chromosomal translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens, such as the Epstein Barr virus antigens EBVA and the human papillomavirus (HPV) antigens E6 and E7. Other large, protein- based antigens include TSP- 180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, pl85erbB2, pl80erbB-3, c-met, nm- 23H1, PSA, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catenin, CDK4, Mum-1, p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3\CA 27.29\BCAA, CA 195, CA 242, CA-50, CAM43, CD68\P1, CO-029, FGF-5, G250, Ga733\EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB/70K, NY-CO-1, RCASl, SDCCAG16, TA-90\Mac-2 binding protein\cyclophilm C-associated protein, TAAL6, TAG72, TLP, TPS, GPC3, MUC16, LMP1, EBMA-1, BARF-1, CS1, CD319, HER1, B7H6, L1CAM, IL6, and MET. Nucleic Acids and Vectors [0069] Also disclosed are polynucleotides and polynucleotide vectors encoding the disclosed chimeric receptors. Also disclosed are oligonucleotides for use in inserting the chimeric receptors into the genome of a T cell at a site that will disrupt Sirt2 expression or activity. [0070] Nucleic acid sequences encoding the disclosed chimeric receptors, and regions thereof, can be obtained using recombinant methods known in the art, such as, for example by screening libraries from cells expressing the gene, by deriving the gene from a vector known to include the same, or by isolating directly from cells and tissues containing the same, using standard techniques. Alternatively, the gene of interest can be produced synthetically, rather than cloned. Immune effector cells [0071] Also disclosed are immune effector cells that are engineered to express the disclosed chimeric receptors. These cells are preferably obtained from the subject to be treated (i.e. are autologous). However, in some embodiments, immune effector cell lines or donor effector cells (allogeneic) are used. Immune effector cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. Immune effector cells can be obtained from blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll™ separation. For example, cells from the circulating blood of an individual may be obtained by apheresis. In some embodiments, immune effector cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient or by counterflow centrifugal elutriation. A specific subpopulation of immune effector cells can be further isolated by positive or negative selection techniques. For example, immune effector cells can be isolated using a combination of antibodies directed to surface markers unique to the positively selected cells, e.g., by incubation with antibody- conjugated beads for a time period sufficient for positive selection of the desired immune effector cells. Alternatively, enrichment of immune effector cells population can be accomplished by negative selection using a combination of antibodies directed to surface markers unique to the negatively selected cells. [0072] In some embodiments, the immune effector cells comprise any leukocyte involved in defending the body against infectious disease and foreign materials. For example, the immune effector cells can comprise lymphocytes, monocytes, macrophages, dendritic cells, mast cells, neutrophils, basophils, eosinophils, or any combinations thereof. For example, the immune effector cells can comprise T lymphocytes. [0073] T cells or T lymphocytes can be distinguished from other lymphocytes, such as B cells and natural killer cells (NK cells), by the presence of a T-cell receptor (TCR) on the cell surface. They are called T cells because they mature in the thymus (although some also mature in the tonsils). There are several subsets of T cells, each with a distinct function. [0074] T helper cells (T_H cells) assist other white blood cells in immunologic processes, including maturation of B cells into plasma cells and memory B cells, and activation of cytotoxic T cells and macrophages. These cells are also known as CD4+ T cells because they express the CD4 glycoprotein on their surface. Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs). Once activated, they divide rapidly and secrete small proteins called cytokines that regulate or assist in the active immune response. These cells can differentiate into one of several subtypes, including T_H1, T_H2, T_H3, T_H17, T_H9, or T_FH, which secrete different cytokines to facilitate a different type of immune response. [0075] Cytotoxic T cells (T_C cells, or CTLs) destroy virally infected cells and tumor cells, and are also implicated in transplant rejection. These cells are also known as CD8⁺ T cells since they express the CD8 glycoprotein at their surface. These cells recognize their targets by binding to antigen associated with MHC class I molecules, which are present on the surface of all nucleated cells. Through IL-10, adenosine and other molecules secreted by regulatory T cells, the CD8+ cells can be inactivated to an anergic state, which prevents autoimmune diseases. [0076] Memory T cells are a subset of antigen-specific T cells that persist long-term after an infection has resolved. They quickly expand to large numbers of effector T cells upon re-exposure to their cognate antigen, thus providing the immune system with “memory” against past infections. Memory cells may be either CD4⁺ or CD8⁺. Memory T cells typically express the cell surface protein CD45RO. [0077] Regulatory T cells (T_reg cells), formerly known as suppressor T cells, are crucial for the maintenance of immunological tolerance. Their major role is to shut down T cell- mediated immunity toward the end of an immune reaction and to suppress auto-reactive T cells that escaped the process of negative selection in the thymus. Two major classes of CD4⁺ T_reg cells have been described — naturally occurring T_reg cells and adaptive T_reg cells. [0078] Natural killer T (NKT) cells (not to be confused with natural killer (NK) cells) bridge the adaptive immune system with the innate immune system. Unlike conventional T cells that recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glycolipid antigen presented by a molecule called CD1d. [0079] In some embodiments, the T cells comprise a mixture of CD4+ cells. In other embodiments, the T cells are enriched for one or more subsets based on cell surface expression. For example, in some cases, the T comprise are cytotoxic CD8⁺ T lymphocytes. In some embodiments, the T cells comprise Ȗį T cells, which possess a distinct T-cell receptor (TCR) having one Ȗ chain and one į chain instead of Į and ȕ chains. [0080] Natural-killer (NK) cells are CD56⁺CD3^– large granular lymphocytes that can kill virally infected and transformed cells, and constitute a critical cellular subset of the innate immune system (Godfrey J, et al. Leuk Lymphoma 201253:1666–1676). Unlike cytotoxic CD8⁺ T lymphocytes, NK cells launch cytotoxicity against tumor cells without the requirement for prior sensitization, and can also eradicate MHC-I-negative cells (Narni-Mancinelli E, et al. Int Immunol 201123:427–431). NK cells are safer effector cells, as they may avoid the potentially lethal complications of cytokine storms (Morgan RA, et al. Mol Ther 201018:843–851), tumor lysis syndrome (Porter DL, et al. N Engl J Med 2011365:725–733), and on-target, off-tumor effects. Although NK cells have a well-known role as killers of cancer cells, and NK cell impairment has been extensively documented as crucial for progression of MM (Godfrey J, et al. Leuk Lymphoma 201253:1666–1676; Fauriat C, et al. Leukemia 200620:732–733), the means by which one might enhance NK cell-mediated anti-MM activity has been largely unexplored prior to the disclosed CARs. Therapeutic Methods [0081] Immune effector cells expressing the disclosed chimeric receptors can elicit an anti-tumor immune response against cancer cells. The anti-tumor immune response elicited by the disclosed chimeric cells may be an active or a passive immune response. In addition, the immune response may be part of an adoptive immunotherapy approach in which chimeric cells induce an immune response specific to the target antigen. [0082] Adoptive transfer of immune effector cells expressing chimeric receptors is a promising anti-cancer therapeutic. Following the collection of a patient’s immune effector cells, the cells may be genetically engineered to express the disclosed chimeric receptors while ablating Sirt2 according to the disclosed methods, then infused back into the patient. [0083] The disclosed chimeric effector cells may be administered either alone, or as a pharmaceutical composition in combination with diluents and/or with other components such as IL-2, IL-15, or other cytokines or cell populations. Briefly, pharmaceutical compositions may comprise a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions for use in the disclosed methods are in some embodiments formulated for intravenous administration. Pharmaceutical compositions may be administered in any manner appropriate treat tumors. The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the severity of the patient's disease, although appropriate dosages may be determined by clinical trials. [0084] When “an immunologically effective amount”, “an anti-tumor effective amount”, “an tumor-inhibiting effective amount”, or “therapeutic amount” is indicated, the precise amount of the compositions of the present invention to be administered can be determined by a physician with consideration of individual differences in age, weight, tumor size, extent of infection or metastasis, and condition of the patient (subject). It can generally be stated that a pharmaceutical composition comprising the T cells described herein may be administered at a dosage of 10⁴ to 10⁹ cells/kg body weight, such as 10⁵ to 10⁶ cells/kg body weight, including all integer values within those ranges. T cell compositions may also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly. [0085] In certain embodiments, it may be desired to administer activated T cells to a subject and then subsequently re-draw blood (or have an apheresis performed), activate T cells therefrom according to the disclosed methods, and reinfuse the patient with these activated and expanded T cells. This process can be carried out multiple times every few weeks. In certain embodiments, T cells can be activated from blood draws of from 10 cc to 400 cc. In certain embodiments, T cells are activated from blood draws of 20 cc, 30 cc, 40 cc, 50 cc, 60 cc, 70 cc, 80 cc, 90 cc, or 100 cc. Using this multiple blood draw/multiple reinfusion protocol may serve to select out certain populations of T cells. [0086] The administration of the disclosed compositions may be carried out in any convenient manner, including by injection, transfusion, or implantation. The compositions described herein may be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. In some embodiments, the disclosed compositions are administered to a patient by intradermal or subcutaneous injection. In some embodiments, the disclosed compositions are administered by i.v. injection. The compositions may also be injected directly into a tumor, lymph node, or site of infection. [0087] In certain embodiments, the disclosed chimeric cells are administered to a patient in conjunction with (e.g., before, simultaneously or following) any number of relevant treatment modalities, including but not limited to thalidomide, dexamethasone, bortezomib, and lenalidomide. In further embodiments, the chimeric cells may be used in combination with chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytoxin, fludaribine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and irradiation. In some embodiments, the CAR-modified immune effector cells are administered to a patient in conjunction with (e.g., before, simultaneously or following) bone marrow transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external-beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another embodiment, the cell compositions of the present invention are administered following B-cell ablative therapy such as agents that react with CD20, e.g., Rituxan. For example, in some embodiments, subjects may undergo standard treatment with high dose chemotherapy followed by peripheral blood stem cell transplantation. In certain embodiments, following the transplant, subjects receive an infusion of the expanded immune cells of the present invention. In an additional embodiment, expanded cells are administered before or following surgery. [0088] The cancer of the disclosed methods can be any cell in a subject undergoing unregulated growth, invasion, or metastasis. In some aspects, the cancer can be any neoplasm or tumor for which radiotherapy is currently used. Alternatively, the cancer can be a neoplasm or tumor that is not sufficiently sensitive to radiotherapy using standard methods. Thus, the cancer can be a sarcoma, lymphoma, leukemia, carcinoma, blastoma, or germ cell tumor. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat include lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma/glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, endometrial cancer, cervical cancer, cervical carcinoma, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon and rectal cancers, prostatic cancer, and pancreatic cancer. [0089] The disclosed chimeric cells can be used in combination with any compound, moiety or group which has a cytotoxic or cytostatic effect. Drug moieties include chemotherapeutic agents, which may function as microtubulin inhibitors, mitosis inhibitors, topoisomerase inhibitors, or DNA intercalators, and particularly those which are used for cancer therapy. [0090] The disclosed chimeric cells can be used in combination with a checkpoint inhibitor. The two known inhibitory checkpoint pathways involve signaling through the cytotoxic T-lymphocyte antigen-4 (CTLA-4) and programmed-death 1 (PD-1) receptors. These proteins are members of the CD28-B7 family of cosignaling molecules that play important roles throughout all stages of T cell function. The PD-1 receptor (also known as CD279) is expressed on the surface of activated T cells. Its ligands, PD-L1 (B7-H1; CD274) and PD-L2 (B7-DC; CD273), are expressed on the surface of APCs such as dendritic cells or macrophages. PD-L1 is the predominant ligand, while PD-L2 has a much more restricted expression pattern. When the ligands bind to PD-1, an inhibitory signal is transmitted into the T cell, which reduces cytokine production and suppresses T-cell proliferation. Checkpoint inhibitors include, but are not limited to antibodies that block PD-1 (Nivolumab (BMS-936558 or MDX1106), CT-011, MK- 3475), PD-L1 (MDX-1105 (BMS-936559), MPDL3280A, MSB0010718C), PD-L2 (rHIgM12B7), CTLA-4 (Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (MGA271), B7-H4, TIM3, LAG-3 (BMS-986016). [0091] Human monoclonal antibodies to programmed death 1 (PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics are described in U.S. Patent No.8,008,449, which is incorporated by reference for these antibodies. Anti-PD-L1 antibodies and uses therefor are described in U.S. Patent No.8,552,154, which is incorporated by reference for these antibodies. Anticancer agent comprising anti-PD-1 antibody or anti-PD-L1 antibody are described in U.S. Patent No. 8,617,546, which is incorporated by reference for these antibodies. [0092] In some embodiments, the PDL1 inhibitor comprises an antibody that specifically binds PDL1, such as BMS-936559 (Bristol-Myers Squibb) or MPDL3280A (Roche). In some embodiments, the PD1 inhibitor comprises an antibody that specifically binds PD1, such as lambrolizumab (Merck), nivolumab (Bristol-Myers Squibb), or MEDI4736 (AstraZeneca). Human monoclonal antibodies to PD-1 and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics are described in U.S. Patent No. 8,008,449, which is incorporated by reference for these antibodies. Anti-PD-L1 antibodies and uses therefor are described in U.S. Patent No.8,552,154, which is incorporated by reference for these antibodies. Anticancer agent comprising anti-PD-1 antibody or anti-PD-L1 antibody are described in U.S. Patent No.8,617,546, which is incorporated by reference for these antibodies. [0093] The disclosed chimeric cells can be used in combination with other cancer immunotherapies. There are two distinct types of immunotherapy: passive immunotherapy uses components of the immune system to direct targeted cytotoxic activity against cancer cells, without necessarily initiating an immune response in the patient, while active immunotherapy actively triggers an endogenous immune response. Passive strategies include the use of the monoclonal antibodies (mAbs) produced by B cells in response to a specific antigen. The development of hybridoma technology in the 1970s and the identification of tumor-specific antigens permitted the pharmaceutical development of mAbs that could specifically target tumor cells for destruction by the immune system. Thus far, mAbs have been the biggest success story for immunotherapy; the top three best-selling anticancer drugs in 2012 were mAbs. Among them is rituximab (Rituxan, Genentech), which binds to the CD20 protein that is highly expressed on the surface of B cell malignancies such as non-Hodgkin’s lymphoma (NHL). Rituximab is approved by the FDA for the treatment of NHL and chronic lymphocytic leukemia (CLL) in combination with chemotherapy. Another important mAb is trastuzumab (Herceptin; Genentech), which revolutionized the treatment of HER2 (human epidermal growth factor receptor 2)-positive breast cancer by targeting the expression of HER2. [0094] Generating optimal “killer” CD8 T cell responses also requires T cell receptor activation plus co-stimulation, which can be provided through ligation of tumor necrosis factor receptor family members, including OX40 (CD134) and 4-1BB (CD137). OX40 is of particular interest as treatment with an activating (agonist) anti-OX40 mAb augments T cell differentiation and cytolytic function leading to enhanced anti-tumor immunity against a variety of tumors. [0095] In some embodiments, such an additional therapeutic agent may be selected from an antimetabolite, such as methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil, decarbazine, hydroxyurea, asparaginase, gemcitabine or cladribine. [0096] In some embodiments, such an additional therapeutic agent may be selected from an alkylating agent, such as mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, dacarbazine (DTIC), procarbazine, mitomycin C, cisplatin and other platinum derivatives, such as carboplatin. [0097] In some embodiments, such an additional therapeutic agent is a targeted agent, such as ibrutinib or idelalisib. [0098] In some embodiments, such an additional therapeutic agent is an epigenetic modifier such as azacitdine or vidaza. [0099] In some embodiments, such an additional therapeutic agent may be selected from an anti-mitotic agent, such as taxanes, for instance docetaxel, and paclitaxel, and vinca alkaloids, for instance vindesine, vincristine, vinblastine, and vinorelbine. [0100] In some embodiments, such an additional therapeutic agent may be selected from a topoisomerase inhibitor, such as topotecan or irinotecan, or a cytostatic drug, such as etoposide and teniposide. [0101] In some embodiments, such an additional therapeutic agent may be selected from a growth factor inhibitor, such as an inhibitor of ErbBl (EGFR) (such as an EGFR antibody, e.g. zalutumumab, cetuximab, panitumumab or nimotuzumab or other EGFR inhibitors, such as gefitinib or erlotinib), another inhibitor of ErbB2 (HER2/neu) (such as a HER2 antibody, e.g. trastuzumab, trastuzumab-DM l or pertuzumab) or an inhibitor of both EGFR and HER2, such as lapatinib). [0102] In some embodiments, such an additional therapeutic agent may be selected from a tyrosine kinase inhibitor, such as imatinib (Glivec, Gleevec STI571) or lapatinib. [0103] Therefore, in some embodiments, a disclosed antibody is used in combination with ofatumumab, zanolimumab, daratumumab, ranibizumab, nimotuzumab, panitumumab, hu806, daclizumab (Zenapax), basiliximab (Simulect), infliximab (Remicade), adalimumab (Humira), natalizumab (Tysabri), omalizumab (Xolair), efalizumab (Raptiva), and/or rituximab. [0104] In some embodiments, a therapeutic agent for use in combination with chimeric cells for treating the disorders as described above may be an anti-cancer cytokine, chemokine, or combination thereof. Examples of suitable cytokines and growth factors include IFNy, IL-2, IL- 4, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, IL-18, IL-23, IL-24, IL-27, IL-28a, IL-28b, IL-29, KGF, IFNa (e.g., INFa2b), IFN , GM-CSF, CD40L, Flt3 ligand, stem cell factor, ancestim, and TNFa. Suitable chemokines may include Glu-Leu-Arg (ELR)- negative chemokines such as IP-10, MCP-3, MIG, and SDF-la from the human CXC and C-C chemokine families. Suitable cytokines include cytokine derivatives, cytokine variants, cytokine fragments, and cytokine fusion proteins. [0105] In some embodiments, a therapeutic agent for use in combination with chimeric cells for treating the disorders as described above may be a cell cycle control/apoptosis regulator (or "regulating agent"). A cell cycle control/apoptosis regulator may include molecules that target and modulate cell cycle control/apoptosis regulators such as (i) cdc-25 (such as NSC 663284), (ii) cyclin-dependent kinases that overstimulate the cell cycle (such as flavopiridol (L868275, HMR1275), 7-hydroxystaurosporine (UCN-01, KW-2401), and roscovitine (R- roscovitine, CYC202)), and (iii) telomerase modulators (such as BIBR1532, SOT-095, GRN163 and compositions described in for instance US 6,440,735 and US 6,713,055) . Non-limiting examples of molecules that interfere with apoptotic pathways include TNF-related apoptosis- inducing ligand (TRAIL)/apoptosis-2 ligand (Apo-2L), antibodies that activate TRAIL receptors, IFNs, and anti-sense Bcl-2. [0106] In some embodiments, a therapeutic agent for use in combination with chimeric cells for treating the disorders as described above may be a hormonal regulating agent, such as agents useful for anti-androgen and anti-estrogen therapy. Examples of such hormonal regulating agents are tamoxifen, idoxifene, fulvestrant, droloxifene, toremifene, raloxifene, diethylstilbestrol, ethinyl estradiol/estinyl, an antiandrogene (such as flutaminde/eulexin), a progestin (such as such as hydroxyprogesterone caproate, medroxy- progesterone/provera, megestrol acepate/megace), an adrenocorticosteroid (such as hydrocortisone, prednisone), luteinizing hormone-releasing hormone (and analogs thereof and other LHRH agonists such as buserelin and goserelin), an aromatase inhibitor (such as anastrazole/arimidex, aminoglutethimide/cytraden, exemestane) or a hormone inhibitor (such as octreotide/sandostatin). [0107] In some embodiments, a therapeutic agent for use in combination with chimeric cells for treating the disorders as described above may be an anti-cancer nucleic acid or an anti- cancer inhibitory RNA molecule. [0108] Combined administration, as described above, may be simultaneous, separate, or sequential. For simultaneous administration the agents may be administered as one composition or as separate compositions, as appropriate. [0109] In some embodiments, the disclosed chimeric cells are administered in combination with radiotherapy. Radiotherapy may comprise radiation or associated administration of radiopharmaceuticals to a patient is provided. The source of radiation may be either external or internal to the patient being treated (radiation treatment may, for example, be in the form of external beam radiation therapy (EBRT) or brachytherapy (BT)). Radioactive elements that may be used in practicing such methods include, e.g., radium, cesium-137, iridium-192, americium-241, gold-198, cobalt-57, copper-67, technetium-99, iodide-123, iodide- 131, and indium-111. [0110] In some embodiments, the disclosed chimeric cells are administered in combination with surgery. [0111] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims. EXAMPLES Example 1: [0112] FIGs.1A and 1B show design, validation, and testing of the strategy for KIR2DL2/3 abrogation in primary human T cells. A strategy was designed for the abrogation of KIR2DL2/3 expression during CAR-T cell manufacturing. It was validated using an in vivo model of NSG mice bearing acute lymphoblastic leukemia grafts. FIG.1A is a schematic representation of the gene editing validation protocol. First, the KIR2DL2 and KIR2DL3 loci were analyzed for the presence of guide RNAs (gRNAs) with the highest cutting score (1). Due to the low expression of KIR2DL2 within PBMCs, the KIR2DL2/3+ population was enriched by fluorescent activated cell sorting (2). KIR2DL2+ T cells were then nucleofected (Neon Transfection System, Thermo Fisher Scientific) with either a non-targeting guide RNA (NTC gRNA) or a gRNA targeting KIR2DL2 exon 1 (3). KIR2DL2/3 expression was analyzed 48 hours after nucleofection by flow cytometry (4). FIG.1B is a flow cytometry histogram of a representative experiment (left panel) and KIR2DL2/3 mean fluorescence intensity (MFI, right panel) comparisons between pre-sorted, unedited (NTC) and KIR2DL2/3-ablated T cells. Data are shown as a mean ± SD of three independent experiments. [0113] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference. [0114] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

CLAIMS 1. A method for enhancing anti-tumor activity of lymphocytes, comprising treating the lymphocytes with a KIR2DL2 and/or KIR2DL3 inhibitor or genetically modifying the lymphocytes to inhibit or ablate KIR2DL2 and/or KIR2DL3 expression. 2. A method, comprising: (a) collecting lymphocytes from a subject with cancer; (b) treating the lymphocytes with a KIR2DL2 and/or KIR2DL3 inhibitor or genetically modifying the lymphocytes to inhibit or ablate KIR2DL2 and/or KIR2DL3 expression. 3. The method of claim 1 or 2, wherein the KIR2DL2 and/or KIR2DL3 inhibitor is an siRNA, antisense, gRNA, or crRNA oligonucleotide. 4. The method of claim 1 or 2, wherein the lymphocytes are genetically modified by inserting a chimeric receptor into the genome of the cell at a location that disrupts expression or activity of an endogenous KIR2DL2 and/or KIR2DL3 protein. 5. The method cell of claim 5, wherein the chimeric receptor is a chimeric antigen receptor (CAR) polypeptide. 6. The method of any one of claims 1 to 5, wherein the lymphocytes are selected from the group consisting of alpha-beta T cells, gamma-delta T cells, Natural Killer (NK) cells, Natural Killer T (NKT) cells, innate lymphoid cells (ILCs), cytokine induced killer (CIK) cells, cytotoxic T lymphocytes (CTLs), lymphokine activated killer (LAK) cells, and regulatory T (Treg) cells. 7. A therapeutic cell produced by the method of any one of claims 1 to 6. 8. A method of providing an anti-cancer immunity in a subject, comprising administering to the subject an effective amount of the therapeutic cells of claim 6, thereby providing an anti- tumor immunity in the subject. 9. The method of claim 7, wherein the subject is HLA-C1+. 10. The method of claim 7 or 8, further comprising administering to the subject a checkpoint inhibitor. 11. The method of claim 9, wherein the checkpoint inhibitor comprises an anti-PD-1 antibody, anti-PD-L1 antibody, anti-CTLA-4 antibody, or a combination thereof.