WO2024023804A2

WO2024023804A2 - Genetically engineered immune cells having disrupted transporter associated with antigen processing binding protein (tapbp) gene

Info

Publication number: WO2024023804A2
Application number: PCT/IB2023/057729
Authority: WO
Inventors: Chandirasegaran Massilamany
Original assignee: Crispr Therapeutics Ag
Priority date: 2022-07-29
Filing date: 2023-07-28
Publication date: 2024-02-01
Also published as: WO2024023804A3

Abstract

A population of genetically engineered T cells, comprising a disrupted Transporter Associated with Antigen Processing Binding Protein (TAPBP) gene and optionally one or more additional gene edits, e.g., a disrupted TRAC gene, a disrupted CD70 gene, a disrupted TGFBRII gene, a disrupted Reg-1 gene, and/or a disrupted CBLB gene. Also provided herein are methods for making such genetically engineered T cells and therapeutic uses thereof.

Description

GENETICALLY ENGINEERED IMMUNE CELLS HAVING DISRUPTED TRANSPORTER ASSOCIATED WITH ANTIGEN PROCESSING BINDING PROTEIN (TAPBP) GENE CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of U.S. Provisional Application No. 63/393,804, filed July 29, 2022, the entire contents of which are incorporated by reference herein. SEQUENCE LISTING The instant application contains a Sequence Listing that has been filed electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on July 21, 2023, is named “095136-0769-072WO1_SEQ.XML” and is 168,462 bytes in size. BACKGROUND OF THE INVENTION Chimeric antigen receptor (CAR) T-cell therapy uses genetically-modified T cells to more specifically and efficiently target and kill cancer cells. After T cells have been collected from the blood, the cells are engineered to include CARs on their surface. The CARs may be introduced into the T cells using CRISPR/Cas9 gene editing technology. When these allogeneic CAR T cells are injected into a patient, the receptors enable the T cells to kill cancer cells. Despite efforts from researchers and medical professionals worldwide to develop CAR T therapy, which has given rise to breakthroughs in treating hematological malignancies, there remains a long-felt need to develop safe and effective universal donor cells in support of cell therapy treatment for suitable indications, including immune-oncology related indications. SUMMARY OF THE INVENTION The present disclosure is based, at least in part, on the development of genetically engineered T cells (e.g., T cells expressing a chimeric antigen receptor or CAR-T cells) comprising a disrupted Transporter Associated with Antigen Processing Binding Protein (TAPBP) gene, optionally in combination additional gene edits (e.g., a disrupted T cell receptor constant region or TRAC gene, a disrupted CD70 gene, or a disrupted CD19 gene). It was observed that disruption of the TAPBP gene reduced, but did not knock out, the expression of MHC Class I molecules, thereby providing protection against host T cell-mediated response but does not induce ‘missing self’ recognition by host NK cells. A single deletion of TAPBP in CAR T cells resulted in up to 40-45% protection from NK cell-mediated lysis. Further, disruption of the TAPBP gene showed little or no impact on CAR-T cell cytotoxic activity against target cells. Accordingly, provided herein are populations of genetically engineered T cells comprising a disrupted TAPBP gene and optionally one or more additional gene edits, methods for preparing such genetically engineered T cells, and methods of using such genetically engineered T cells to eliminate undesired target cells (e.g., cancer cells), as well as components such as guide RNAs and gene editing systems comprising such for use in genetic editing the TAPBP gene. In some aspects, the present disclosure features a population of genetically engineered T cells, comprising a disrupted Transporter Associated with Antigen Processing Binding Protein (TAPBP) gene. In some embodiments, the genetically engineered T cells may be further engineered to express a chimeric antigen receptor (CAR). In some embodiments, the genetically engineered T cells disclosed herein may comprise a disrupted TAPBP gene, which is genetically edited in exon 1 or exon 2 of the TAPBP gene. In some embodiments, wherein the disrupted TAPBP gene is genetically edited by CRISPR/Cas-mediated gene editing. In some specific embodiments, the CRISPR/Cas- mediated gene editing may comprise a guide RNA (gRNA) targeting a site in the TAPBP gene that comprises a nucleotide sequence of any one of SEQ ID NOs:.1-10 In some specific embodiments, the gRNA comprises a nucleotide sequence of any one of SEQ ID NOs: 22, 24, 26, 28, 30, 32, 34, 36, 38 and 40. In some instances, the gRNA targets a site in the TAPBP gene that comprises the nucleotide sequence of any one of SEQ ID NOs: 2, 4 and 6. Such an gRNA may comprise a spacer set forth as SEQ ID NO: 24, 28 or 32. In some embodiments, the population of genetically engineered T cells as disclosed herein may further comprise: (i) a disrupted T cell receptor alpha chain constant region (TRAC) gene, (ii) a disrupted CD70 gene, (iii) a disrupted transforming growth factor beta receptor II (TGFbRII) gene, (iv) a disrupted Regnase-1 (Reg1) gene, (v) a disrupted Casitas B-Lineage Lymphoma Proto-Oncogene-B (CBLB) gene, or (vi) a combination of any one of (i)-(iv). Any of the genetically engineered T cells may be derived from primary T cells of one or more human donors. The disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Reg1 gene, and/or the disrupted CBLB gene can be genetically edited by a CRISPR/Cas-mediated gene editing system. Any of the genetically engineered T cells disclosed herein may comprise a nucleic acid encoding the CAR. In some embodiments, the nucleic acid is inserted in a genomic locus of the T cells. For example, the nucleic acid can be inserted in a genomic locus within a safe harbor gene. Alternatively, the nucleic acid can be inserted in any one of the disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Reg-1 gene, and the disrupted CBLB gene. In one example, the disrupted TRAC gene comprises the nucleic acid encoding the CAR. In that case, the nucleic acid encoding the CAR may replace a fragment in the disrupted TRAC gene. In specific example, the nucleic acid encoding the CAR replaces the fragment of the TRAC gene is set forth as SEQ ID NO: 86. In some embodiments, the CAR comprises an extracellular antigen binding domain specific to a tumor antigen, a co-stimulatory signaling domain of 4-1BB or CD28, and a cytoplasmic signaling domain of CD3ζ. In some embodiments, the tumor antigen can be CD19, BCMA, or CD70. In some examples, the extracellular antigen binding domain of a CAR as disclosed herein is a single chain variable fragment (scFv) that binds CD19. Such an scFv may comprises the amino acid sequence of SEQ ID NO: 110. In specific examples, the anti-CD19 CAR may comprise the amino acid sequence of SEQ ID NO: 111. In some examples, the extracellular antigen binding domain of a CAR as disclosed herein is a single chain variable fragment (scFv) that binds CD70. Such an scFv may comprises the amino acid sequence of SEQ ID NO: 120 or 121. In specific examples, the anti- CD70 CAR may comprise the amino acid sequence of SEQ ID NO: 122. In some examples, the extracellular antigen binding domain of a CAR as disclosed herein is a single chain variable fragment (scFv) that binds BCMA. Such an scFv may comprises the amino acid sequence of SEQ ID NO: 131. In specific examples, the anti-BCMA CAR may comprise the amino acid sequence of SEQ ID NO: 132. In other aspects, the present disclosure features a method for preparing the population of genetically engineered T cells as disclosed herein. Such a method may comprise: (a) providing a plurality of cells, which are T cells or precursor cells thereof; (b) genetically editing the TAPBP gene; and (c) producing the population of genetically engineered T cells having a disrupted TAPBP gene. The T cells of step (a) are or derived from primary T cells of one or more human donors. In some embodiments, the plurality of T cells in step (a) comprises one or more of the following genetic modifications: (i) engineered to express a chimeric antigen receptor (CAR); (ii) has a disrupted T cell receptor alpha chain constant region (TRAC) gene; (iii) has a disrupted CD70 gene; (iv) has a disrupted TGFBRII gene; (v) has a disrupted Reg-1 gene; and (vi) has a disrupted CBLB gene. In some embodiments, step (b) is performed by delivering to the plurality of cells an RNA-guided nuclease and a gRNA targeting the TAPBP gene. In some instances, the gRNA targeting TAPBP is specific to exon 1 or exon 2 of the TAPBP gene. For example, the gRNA targeting the TAPBP gene may comprise a nucleotide sequence of any one of SEQ ID NOs: 1- 10. In some specific embodiments, the gRNA may comprise a spacer sequence set forth as any one of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 36, 38 and 40. In some specific embodiments, the gRNA may comprise the nucleotide sequence of any one of SEQ ID NOs: 21, 41, 23, 43, 25, 45, 27, 47, 29, 49, 31, 51, 33, 53, 35, 55, 37, 57, 39 and 59. In some instances, the gRNA targets a site of the TAPBP gene that comprises the nucleotide sequence of any one of SEQ ID NOs: 2, 4 and 6. Such an gRNA may comprise a spacer set forth as SEQ ID NO: 24, 28 or 32. In specific examples, the gRNA may comprise the nucleotide sequence of SEQ ID NO: 23, 43, 27, 47, 31, or 51. In some embodiments, the method disclosed herein may further comprise: (i) delivering to the T cells a nucleic acid encoding a chimeric antigen receptor (CAR); (ii) genetically editing a TRAC gene to disrupt its expression; (iii) genetically editing a CD70 gene to disrupt its expression; (iv) genetically editing a TGFBRII gene to disrupt its expression; (v) genetically editing a Reg-1 gene to disrupt its expression; (vi) genetically editing a CBLB gene to disrupt its expression; or (vii) a combination thereof. In some examples, one or more of (i)-(iv) are performed by CRISPR/Cas-mediated gene editing comprising one or more RNA-guided nucleases and one or more gRNAs targeting the TRAC gene, the CD70 gene; the TGFBRII gene, the Reg-1 gene, and/or the CBLB gene. In some instances, the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 62. In some instances, the gRNA targeting the CD70 gene comprises the nucleotide sequence of SEQ ID NO: 70. In some instances, the gRNA targeting the TGFBRII gene comprises the nucleotide sequence of SEQ ID NO: 64. In some instances, the gRNA targeting the Reg-1 gene comprises the nucleotide sequence of SEQ ID NO: 66. In some instances, the gRNA targeting the CBLB gene comprises the nucleotide sequence of SEQ ID NO: 68. Any of the methods disclosed herein may comprise delivering to the T cells one or more ribonucleoprotein particles (RNP), comprising the RNA-guided nuclease, one or more of the gRNAs, and the nucleic acid encoding the CAR. In some embodiments, the RNA-guided nuclease is a Cas9 nuclease. In one example, the Cas9 nuclease is a S. pyogenes Cas9 nuclease. In some embodiments, the nucleic acid encoding the CAR is in an AAV vector. In some instances, the nucleic acid encoding the CAR comprises a left homology arm and a right homology arm flanking the nucleotide sequence encoding the CAR. The left homology arm and the right homology arm are homologous to a genomic locus in the T cells, allowing for insertion of the nucleic acid into the genomic locus. In some examples, the genomic locus is a target site of a guide RNA, and wherein insertion of the nucleic acid encoding the CAR at the genomic locus results in deletion and/or mutation of the target site of the guide RNA. In some examples, the genomic locus is in a safe harbor gene. In other examples, the genomic locus is in any of the disrupted genes, for example, in the TRAC gene, in the CD70 gene, in the TGFBRII gene, in the Reg-1 gene, or in the CBLB gene. In one specific example, the method comprises disrupting the TRAC gene by CRISPR/Cas-mediated gene editing comprising a gRNA targeting a TRAC gene site comprising nucleotide sequence of SEQ ID NO: 86 and the nucleic acid encoding the CAR is inserted at the TRAC gene site targeted by the gRNA. In some embodiments, the method disclosed herein comprises delivering to the T cells a nucleic acid encoding a CAR, which is specific to CD70, and genetically editing the CD70 gene to disrupt its expression. A population of genetically engineered T cells produced by any of the methods disclosed herein is also within the scope of the present disclosure. Further, provided herein is a method for eliminating undesired cells in a subject, the method comprising administering to a subject in need thereof T cells expressing a disrupted TAPBP gene and a chimeric antigen receptor targeting the undesired cells. Any of the genetically engineered T cells as disclosed herein can be used in such a method. In some examples, the T cells are allogenic to the subject. In some instances, the undesired cells are cancer cells. In some examples, the cancer cells are CD19⁺, BCMA⁺, or CD70⁺. In addition, the present disclosure also features a guide RNA (gRNA) targeting a TAPBP gene, comprising a nucleotide sequence specific to a fragment in exon 1 or exon 2 of the TAPBP gene. Such a gRNA may comprise a spacer of any one of SEQ ID NOs: 22, 24, 26, 28, 30, 32, 34, 36, 38 and 40. In some examples, the gRNA may comprise a spacer set forth as SEQ ID NO: 24, 28 or 32. The gRNAs disclosed herein may further comprise a scaffold sequence. In some embodiments, the gRNA disclosed herein may comprise one or more modified nucleotides. For example, the gRNA comprises one or more 2’-O-methyl phosphorothioate residues at the 5’ and/or 3’ terminus of the gRNA. In specific examples, the gRNA may comprise the nucleotide sequence of any one of SEQ ID NOs: 21, 41, 23, 43, 25, 45, 27, 47, 29, 49, 31, 51, 33, 53, 35, 55, 37, 57, 39 and 59. For example, the gRNA may comprise the nucleotide sequence of SEQ ID NO:23, 43, 27, 47, 31 or 51. Also within the scope of the present disclosure are any of the genetically engineered T cells disclosed herein for use in eliminating undesired cells such as cancer cells and uses of such genetically engineered T cells for manufacturing a medicament for use in eliminating the undesired cells. The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following drawings and detailed description of several embodiments, and also from the appended claims. BRIEF DESCRIPTION OF THE DRAWINGS The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to the drawing in combination with the detailed description of specific embodiments presented herein. FIGs. 1A-1B are western blot results showing disruption of TAPBP (FIG. 1A) and β- actin loading control (FIG. 1B). FIGs. 2A-2E include diagrams showing reduction of MHC Class I expression by disrupting the TAPBP gene via the CRISPR/Cas-mediated gene editing system with various guide RNAs (gRNAs). FIG. 2A: gRNAs TAPBP_Ex1_T1 (left panel) and TAPBP_Ex1_T3 (right panel). FIG. 2B: gRNAs TAPBP_Ex2_T1 (left panel) and TAPBP_Ex2_T2 (right panel). FIG. 2C: TAPBP_Ex2_T3 (left panel) and TAPBP_Ex2_T4 (right panel). FIG. 2D: gRNAs TAPBP_Ex2_T8 (left panel) and TAPBP_Ex2_T11 (right panel). FIG. 2E: TAPBP_Ex2_T13 (left panel) and TAPBP_Ex2_T18 (right panel). DETAILED DESCRIPTION OF THE INVENTION The present disclosure aims at establishing genetically engineered T cells having protections against elimination by host immune cells such as natural killer (NK) cells while maintaining CAR-T cell functionality for use in allogenic cell therapy. The genetically engineered T cells may also exhibit one or more of the following superior features: improved cell growth activity; enhanced persistence; reduced T cell exhaustion; resistant to inhibitory effects induced by TGF-β; enhanced cell killing capacity; and resistant to inhibitory effects by fibroblasts and/or inhibitory factors secreted thereby. The genetically engineered T cells having a disrupted Transporter Associated with Antigen Processing Binding Protein (TAPBP) gene, and optionally one or more additional genetic edits, for example, a disrupted TRAC gene, a disrupted CD70 gene, a disrupted CD19 gene, a disrupted transforming growth factor beta receptor II (TGFbRII) gene, a disrupted Regnase-1 (Reg1) gene, and a disrupted Casitas B-Lineage Lymphoma Proto-Oncogene-B (CBLB) gene. Any of the genetically engineered T cells disclosed herein may also comprise a nucleic acid coding for a chimeric antigen receptor (CAR). In some instances, the nucleic acid encoding the CAR may be inserted into the genome of the T cells at a genetic locus of interest, for example, within a safe harbor gene or within any of the disrupted genes (e.g., inserted into the disrupted TRAC gene). Unexpectedly, T cells having a disrupted TAPBP gene showed advantageous features disclosed herein, for example, reduced MHC Class I molecule expression, leading to protection against host T cell-mediated responses but does not induce “missing self” recognition by host NK cells (which would result in NK cell-mediated cell lysis). Given such advantageous features, the genetically engineered T cells (e.g., CAR-T cells) disclosed herein, having a disrupted TAPBP gene and optionally other genetic edits as disclosed herein, would be expected to exhibit superior therapeutic effects, for example, superior anti-tumor effects in allogeneic cell therapy. Accordingly, provided herein are genetically engineered T cells (e.g., CAR-T cells) having a disrupted TAPBP gene and optionally one or more additional genetic edits, e.g., a disrupted TRAC gene, a disrupted CD70 gene, a disrupted TGFBRII gene, a disrupted Reg-1 gene, a disrupted CBLB gene, or a combination thereof; compositions comprising such; and therapeutic uses of such genetically engineered T cells, for example, in tumor treatment. Components and processes (e.g., the CRISPR approach for gene editing and components used therein) for making the T cells disclosed herein are also within the scope of the present disclosure. I. Genetically Engineered T Cells In some aspects, provided herein are genetically engineered T cells having a disrupted TAPBP gene, and optionally one or more additional genetic edits as disclosed herein. As shown by the studies disclosed herein, such genetically engineered T cells show improved features as disclosed herein. See, e.g., Examples below. The genetically engineered T cells may be derived from parent T cells (e.g., non-edited wild-type T cells) obtained from a suitable source, for example, one or more mammal donors. In some examples, the parent T cells are primary T cells (e.g., non-transformed and terminally differentiated T cells) obtained from one or more human donors (e.g., healthy donors). Alternatively, the parent T cells may be differentiated from precursor T cells obtained from one or more suitable donor or stem cells such as hematopoietic stem cells or inducible pluripotent stem cells (iPSC), which may be cultured in vitro. In other examples, T cells from a T cell bank can be used as the starting material for preparing the genetically engineered T cells disclosed herein. In some embodiments, the genetically engineered T cells carry a disrupted TAPBP gene, and optionally, one or more disrupted genes to improve cell persistence, growth/expansion, and/or to reduce T cell exhaustion (e.g., CD70, TGFBRII, Reg-1, and/or CBLB). Such genetically engineered T cells may further comprise one or more disrupted genes, for example, TRAC to, e.g., reduce graft-versus-host effects. Any of the genetically engineered T cells may be generated via gene editing (including genomic editing), a type of genetic engineering, in which nucleotide(s)/nucleic acid(s) is/are inserted, deleted, and/or substituted in a DNA sequence, such as in the genome of a targeted cell. Targeted gene editing enables insertion, deletion, and/or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or targeted DNA sequence). When a sequence of an endogenous gene is edited, for example by deletion, insertion or substitution of nucleotide(s)/nucleic acid(s), the endogenous gene comprising the affected sequence may be knocked-out due to the sequence alteration. Therefore, targeted editing may be used to disrupt endogenous gene expression. “Targeted integration” refers to a process involving insertion of one or more exogenous sequences, with or without deletion of an endogenous sequence at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing an exogenous sequence is present. (a) Genetically Edited Genes In some aspects, the present disclosure provides genetically engineered T cells (e.g., CAR-T cells) that comprise a disrupted TAPBP gene. In some instances, the genetically engineered T cells disclosed herein may further comprise a disrupted CD70 gene, a disrupted a disrupted TRAC gene, a disrupted TGFBRII gene, a disrupted Reg-1 gene, a disrupted CBLB gene, or a combination thereof. As used herein, a “disrupted gene” refers to a gene comprising an insertion, deletion or substitution relative to an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. As used herein, “disrupting a gene” refers to a method of inserting, deleting or substituting at least one nucleotide/nucleic acid in an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. Methods of disrupting a gene are known to those of skill in the art and described herein. In some embodiments, a cell that comprises a disrupted gene does not express (e.g., at the cell surface) a detectable level (e.g., in an immune assay using an antibody binding to the encoded protein or by flow cytometry) of the protein encoded by the gene. A cell that does not express a detectable level of the protein may be referred to as a knockout cell. TAPBP Gene Editing In some embodiments, the genetically engineered T cells may comprise a disrupted TAPBP gene, which encodes the TAPBP protein. The TAPBP gene encodes a transmembrane glycoprotein that mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum (ER) membrane. This interaction facilitates optimal peptide loading on the MHC class I molecule. Structure of TAPBP genes are known in the art. For example, human TAPBP gene is located on chromosome 6p21.32. The gene contains 8 exons. Additional information can be found in GenBank under Gene ID: 6892. In some examples, the genetically engineered T cells may comprise a disrupted TAPBP gene such that the expression of the TAPBP protein in the T cells is substantially reduced or eliminated completely. The disrupted TAPBP gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the TAPBP gene. Such target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells. Exemplary target sites for the genetic edits may include any one of exons 1-8, or a combination thereof. In some examples, one or more genetic editing may occur in exon 1. In other examples, one or more genetic editing may occur in exon 2. Such genetic editing may be induced by a gene editing technology, (e.g., the CRISPR/Cas technology) using a suitable guide RNA, for example, those targeting the TAPBP sites listed in Table 19. Exemplary TAPBP-targeting guide RNAs are provided in Table 20, which are also within the scope of the present disclosure. CD70 Gene Editing T cell exhaustion is a process of stepwise and progressive loss of T cell functions, which may be induced by prolonged antigen stimulation or other factors. Genes involved in T cell exhaustion refer to those that either positively regulate or negatively regulate this biological process. The genetically engineered T cells disclosed herein may comprise genetic editing of a gene that positively regulates T cell exhaustion to disrupt its expression. Alternatively or in addition, the genetically engineered T cells may comprise genetic editing of a gene that negatively regulates T cell exhaustion to enhance its expression and/or biologic activity of the gene product. In some embodiments, the genetically engineered T cells may comprise an edited gene involved in T cell exhaustion, e.g., disruption of a gene that positively regulates T cell exhaustion. Such a gene may be a Cluster of Differentiation 70 (CD70) gene. CD70 is a member of the tumor necrosis factor superfamily and its expression is restricted to activated T and B lymphocytes and mature dendritic cells. CD70 is implicated in tumor cell and regulatory T cell survival through interaction with its ligand, CD27. CD70 and its receptor CD27 have multiple roles in immune function in multiple cell types including T cells (activated and T_reg cells), and B cells. In other embodiments, an edited CD70 gene may have a nucleic acid encoding a CAR (e.g., those disclosed herein) inserted, leading to disruption of the CD70 gene expression. It was also found that disrupting the CD70 gene in immune cells engineered to express an antigen targeting moiety enhanced anti-tumor efficacy against large tumors and induced a durable anti-cancer memory response. Specifically, the anti-cancer memory response prevented tumor growth upon re-challenge. Further, it has been demonstrated disrupting the CD70 gene results in enhanced cytotoxicity of immune cells engineered to express an antigen targeting moiety at lower ratios of engineered immune cells to target cells, indicating the potential efficacy of low doses of engineered immune cells. See, e.g., WO2019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein. Structures of CD70 genes are known in the art. For example, human CD70 gene is located on chromosome 19p13.3. The gene contains four protein encoding exons. Additional information can be found in GenBank under Gene ID: 970. In some examples, the genetically engineered T cells may comprise a disrupted CD70 gene such that the expression of CD70 in the T cells is substantially reduced or eliminated completely. The disrupted CD70 gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the CD70 gene. Such target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells. Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, or a combination thereof. See also WO2019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein. Exemplary CD70 targeting locus and corresponding gRNA can be found in Table 21 below. TRAC Gene Edit In some embodiments, the genetically engineered T cells as disclosed herein may further comprise a disrupted TRAC gene. This disruption leads to loss of function of the TCR and renders the engineered T cell non-alloreactive and suitable for allogeneic transplantation, minimizing the risk of graft versus host disease. In some embodiments, expression of the endogenous TRAC gene is eliminated to prevent a graft-versus-host response. See also WO2019097305, the relevant disclosures of which are incorporated by reference herein for the purpose and subject matter referenced herein. In other embodiments, an edited TRAC gene may have a nucleic acid encoding a CAR (e.g., those disclosed herein) inserted, leading to disruption of the TRAC gene expression. It should be understood that more than one suitable target site/gRNA can be used for each target gene disclosed herein, for example, those known in the art or disclosed herein. Additional examples can be found in, e.g., WO2019097305, the relevant disclosures of which are incorporated by reference herein for the purpose and subject matter referenced herein. The genetically engineered T cells disclosed herein may further comprise one or more additional gene edits (e.g., gene knock-in or knock-out) to improve T cell function. Examples include knock-in or knock-out genes to improve target cell lysis, knock-in or knock-out genes to enhance performance of therapeutic T cells such as CAR-T cells prepared from the genetically engineered T cells. Exemplary TRAC targeting locus and corresponding gRNA can be found in Table 21 below. Reg1 Gene Editing In some embodiments, the genetically engineered T cells may comprise a disrupted gene involved in mRNA decay. Such a gene may be Reg1. Reg1 contains a zinc finger motif, binds RNA and exhibits ribonuclease activity. Reg1 plays roles in both immune and non- immune cells and its expression can be rapidly induced under diverse conditions including microbial infections, treatment with inflammatory cytokines and chemical or mechanical stimulation. Human Reg1 gene is located on chromosome 1p34.3. Additional information can be found in GenBank under Gene ID: 80149. In some examples, the genetically engineered T cells may comprise a disrupted Reg1 gene such that the expression of Reg1 in the T cells is substantially reduced or eliminated completely. The disrupted Reg1 gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the Reg1 gene. Such target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells. Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or a combination thereof. In some examples, one or more genetic editing may occur in exon 2 or exon 4. Such genetic editing may be induced by the CRISPR/Cas technology using a suitable guide RNA, for example, those listed in Table 21. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. Disruption of the Reg1 gene can enhance long-term-persistence and maintain robust effector function, thereby improving T cell functionality. TGFBRII Gene Editing In some embodiments, the genetically engineered T cells may comprise a disrupted TGFBRII gene, which encodes Transforming Growth Factor Receptor Type II (TGFBRII). TGFBRII receptors are a family of serine/threonine kinase receptors involved in the TGFβ signaling pathway. These receptors bind growth factor and cytokine signaling proteins in the TGFβ family, for example, TGFβs (TGFβ1, TGFβ2, and TGFβ3), bone morphogenetic proteins (BMPs), growth differentiation factors (GDFs), activin and inhibin, myostatin, anti-Müllerian hormone (AMH), and NODAL. In some examples, the genetically engineered T cells may comprise a disrupted TGFBRII gene such that the expression of TGFBRII in the T cells is substantially reduced or eliminated completely. The disrupted TGFBRII gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the TGFBRII gene. Such target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells. Exemplary target sites for the genetic edits may include exon 1, exon 2, exon 3, exon 4, exon 5, or a combination thereof. In some examples, one or more genetic editing may occur in exon 4 and/or exon 5. Such genetic editing may be induced by a gene editing technology, (e.g., the CRISPR/Cas technology) using a suitable guide RNA, for example, those listed in Table 21. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. Disruption of the TGFBRII gene can eliminate surface expression of TGFBRII and reduce the immunosuppressive effect of transforming growth factor beta (TFG-β) in the tumor microenvironment. CBLB Gene Editing In some embodiments, the genetically engineered T cells may comprise a disrupted Cbl proto-oncogene B (CBLB) gene. The CBLB protein contains a zinc finger motif, binds RNA and exhibits ribonuclease activity. CBLB plays roles in both immune and non-immune cells and its expression can be rapidly induced under diverse conditions including microbial infections, treatment with inflammatory cytokines and chemical or mechanical stimulation. Human cbl-b gene is located on chromosome GRCh38.p13. Additional information can be found in GenBank under Gene ID: 868. In some examples, the genetically engineered T cells may comprise a disrupted cbl-b gene such that the expression of cbl-b in the T cells is substantially reduced or eliminated completely. The disrupted cbl-b gene may comprise one or more genetic edits at one or more suitable target sites (e.g., in coding regions or in non-coding regulatory regions such as promoter regions) that disrupt expression of the cbl-b gene. Such target sites may be identified based on the gene editing approach for use in making the genetically engineered T cells. Exemplary target sites for the genetic edits may include exon 2, exon 7, exon 9, exon 11, exon 12, or a combination thereof. In some examples, one or more genetic editing may occur in exon 2. In other examples, one or more genetic editing may occur in exon 7. In yet other examples, one or more genetic editing may occur in exon 9. Such genetic editing may be induced by the CRISPR/Cas technology using a suitable guide RNA, for example, those listed in Table 21. See also WO2023/119201, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. (b) Methods of Making Genetically Engineered T cells The genetically engineered T cells disclosed herein can be prepared by genetic editing of parent T cells or precursor cells thereof via a conventional gene editing method or those described herein. (i) T cells Any of the genetically engineered T cells disclosed herein may use bona fide T cells as the starting material, for example, non-transformed T cells, terminally differentiated T cells, T cells having stable genome, and/or T cells that depend on cytokines and growth factors for proliferation and expansion. Alternatively, such T cells may use T cells generated from precursor cells such as hematopoietic stem cells (e.g., iPSCs), e.g., in vitro culture. The T cells disclosed herein may confer one or more benefits in CAR-T cell clinical applications. In some embodiments, T cells for generating the genetically engineered T cells disclosed herein can be derived from one or more suitable mammals, for example, one or more human donors. T cells can be obtained from a number of sources, including, but not limited to, peripheral blood mononuclear cells, bone marrow, lymph nodes tissue, cord blood, thymus issue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled person, such as sedimentation, e.g., FICOLL™ separation. In some instances, the T cell population comprises primary T cells isolated from one or more human donors. Such T cells are terminally differentiated, not transformed, depend on cytokines and/or growth factors for growth, and/or have stable genomes. In some examples, T cells can be isolated from a mixture of immune cells (e.g., those described herein) to produce an isolated T cell population. For example, after isolation of peripheral blood mononuclear cells (PBMC), both cytotoxic and helper T lymphocytes can be sorted into naive, memory, and effector T cell subpopulations either before or after activation, expansion, and/or genetic modification. A specific subpopulation of T cells, expressing one or more of the following cell surface markers: TCRαβ, CD3, CD4, CD8, CD27 CD28, CD38 CD45RA, CD45RO, CD62L, CD127, CD122, CD95, CD197, CCR7, KLRG1, MCH-I proteins and/or MCH-II proteins, can be further isolated by positive or negative selection techniques. In some embodiments, a specific subpopulation of T cells, expressing one or more of the markers selected from the group consisting of TCRαβ, CD4 and/or CD8, is further isolated by positive or negative selection techniques. In some embodiments, subpopulations of T cells may be isolated by positive or negative selection prior to genetic engineering and/or post genetic engineering. An isolated population of T cells may express one or more of the T cell markers, including, but not limited to a CD3+, CD4+, CD8+, or a combination thereof. In some embodiments, the T cells are isolated from a donor, or subject, and first activated and stimulated to proliferate in vitro prior to undergoing gene editing. In other embodiments, the T cells for use in generating the genetically engineered T cells disclosed herein may be derived from a T cell bank. A T cell bank may comprise T cells with genetic editing of certain genes (e.g., genes involved in cell self-renewal, apoptosis, and/or T cell exhaustion or replicative senescence) to improve T cell persistence in cell culture. A T cell bank may be produced from bona fide T cells, for example, non-transformed T cells, terminally differentiated T cells, T cells having stable genome, and/or T cells that depend on cytokines and growth factors for proliferation and expansion. Alternatively, such a T cell bank may be produced from precursor cells such as hematopoietic stem cells (e.g., iPSCs), e.g., in vitro culture. In some examples, the T cells in the T cell bank may comprise genetic editing of one or more genes involved in cell self-renewal, one or more genes involved in apoptosis, and/or one or more genes involved in T cell exhaustion, so as to disrupt or reduce expression of such genes, leading to improved persistence in culture. Examples of the edited genes in a T cell bank include, but are not limited to, Tet2, Fas, CD70, Reg1, or a combination thereof. Compared with the non-edited T counterpart, T cells in a T cell bank may have enhanced expansion capacity in culture, enhanced proliferation capacity, greater T cell activation, and/or reduced apoptosis levels. Additional information of T cell bank may be found in International Application No. PCT/IB2020/058280, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. In yet other embodiments, the T cells for generating the genetically engineered T cells disclosed herein may be derived from stem cells (e.g., HSCs or iPSCs) via in vitro differentiation. T cells from any suitable source (e.g., those disclosed herein) can be subjected to one or more rounds of stimulation, activation and/or expansion. T cells can be activated and expanded generally using methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041. In some embodiments, T cells can be activated and expanded for about 1 day to about 4 days, about 1 day to about 3 days, about 1 day to about 2 days, about 2 days to about 3 days, about 2 days to about 4 days, about 3 days to about 4 days, or about 1 day, about 2 days, about 3 days, or about 4 days prior to introduction of the genome editing compositions into the T cells. In some embodiments, T cells can be activated and expanded for about 4 hours, about 6 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, or about 72 hours prior to introduction of the gene editing compositions into the T cells. In some embodiments, T cells are activated at the same time that genome editing compositions are introduced into the T cells. In some instances, the T cell population can be expanded and/or activated after the genetic editing as disclosed herein. T cell populations or isolated T cells generated by any of the gene editing methods described herein are also within the scope of the present disclosure. (ii) Gene Editing Methods Any of the genetically engineered T cells can be prepared using conventional gene editing methods or those described herein to edit one or more of the target genes disclosed herein (targeted editing). Targeted editing can be achieved either through a nuclease- independent approach, or through a nuclease-dependent approach. In the nuclease-independent targeted editing approach, homologous recombination is guided by homologous sequences flanking an exogenous polynucleotide to be introduced into an endogenous sequence through the enzymatic machinery of the host cell. The exogenous polynucleotide may introduce deletions, insertions or replacement of nucleotides in the endogenous sequence. Alternatively, the nuclease-dependent approach can achieve targeted editing with higher frequency through the specific introduction of double strand breaks (DSBs) by specific rare-cutting nucleases (e.g., endonucleases). Such nuclease-dependent targeted editing also utilizes DNA repair mechanisms, for example, non-homologous end joining (NHEJ), which occurs in response to DSBs. DNA repair by NHEJ often leads to random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ mediated repair, repair can also occur by a homology directed repair (HDR). When a donor template containing exogenous genetic material flanked by a pair of homology arms is present, the exogenous genetic material can be introduced into the genome by HDR, which results in targeted integration of the exogenous genetic material. In some embodiments, gene disruption may occur by deletion of a genomic sequence using two guide RNAs. Methods of using CRISPR-Cas gene editing technology to create a genomic deletion in a cell (e.g., to knock out a gene in a cell) are known (Bauer DE et al. Vis. Exp. 2015; 95:e52118). Available endonucleases capable of introducing specific and targeted DSBs include, but not limited to, zinc-finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and RNA-guided CRISPR-Cas9 nuclease (CRISPR/Cas9; Clustered Regular Interspaced Short Palindromic Repeats Associated 9). Additionally, DICE (dual integrase cassette exchange) system utilizing phiC31 and Bxb1 integrases may also be used for targeted integration. Some exemplary approaches are disclosed in detail below. CRISPR-Cas9 Gene Editing System The CRISPR-Cas9 system is a naturally-occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA-targeting platform used for gene editing. It relies on the DNA nuclease Cas9, and two noncoding RNAs, crisprRNA (crRNA) and trans- activating RNA (tracrRNA), to target the cleavage of DNA. CRISPR is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats, a family of DNA sequences found in the genomes of bacteria and archaea that contain fragments of DNA (spacer DNA) with similarity to foreign DNA previously exposed to the cell, for example, by viruses that have infected or attacked the prokaryote. These fragments of DNA are used by the prokaryote to detect and destroy similar foreign DNA upon re-introduction, for example, from similar viruses during subsequent attacks. Transcription of the CRISPR locus results in the formation of an RNA molecule comprising the spacer sequence, which associates with and targets Cas (CRISPR-associated) proteins able to recognize and cut the foreign, exogenous DNA. Numerous types and classes of CRISPR/Cas systems have been described (see, e.g., Koonin et al., (2017) Curr Opin Microbiol 37:67-78). crRNA drives sequence recognition and specificity of the CRISPR-Cas9 complex through Watson-Crick base pairing typically with a 20 nucleotide (nt) sequence in the target DNA. Changing the sequence of the 5’ 20nt in the crRNA allows targeting of the CRISPR- Cas9 complex to specific loci. The CRISPR-Cas9 complex only binds DNA sequences that contain a sequence match to the first 20 nt of the crRNA, if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM). tracrRNA hybridizes with the 3’ end of crRNA to form an RNA-duplex structure that is bound by the Cas9 endonuclease to form the catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA. Once the CRISPR-Cas9 complex is bound to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB), where both strands of the DNA terminate in a base pair (a blunt end). After binding of CRISPR-Cas9 complex to DNA at a specific target site and formation of the site-specific DSB, the next key step is repair of the DSB. Cells use two main DNA repair pathways to repair the DSB: non-homologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ is a robust repair mechanism that appears highly active in the majority of cell types, including non-dividing cells. NHEJ is error-prone and can often result in the removal or addition of between one and several hundred nucleotides at the site of the DSB, though such modifications are typically < 20 nt. The resulting insertions and deletions (indels) can disrupt coding or noncoding regions of genes. Alternatively, HDR uses a long stretch of homologous donor DNA, provided endogenously or exogenously, to repair the DSB with high fidelity. HDR is active only in dividing cells and occurs at a relatively low frequency in most cell types. In many embodiments of the present disclosure, NHEJ is utilized as the repair operant. Endonuclease for use in CRISPR In some embodiments, the Cas9 (CRISPR associated protein 9) endonuclease is used in a CRISPR method for making the genetically engineered T cells as disclosed herein. The Cas9 enzyme may be one from Streptococcus pyogenes, although other Cas9 homologs may also be used. It should be understood, that wild-type Cas9 may be used or modified versions of Cas9 may be used (e.g., evolved versions of Cas9, or Cas9 orthologues or variants), as provided herein. In some embodiments, Cas9 may be substituted with another RNA-guided endonuclease, such as Cpf1 (of a class II CRISPR/Cas system). In some embodiments, the CRISPR/Cas system comprises components derived from a Type-I, Type-II, or Type-III system. Updated classification schemes for CRISPR/Cas loci define Class 1 and Class 2 CRISPR/Cas systems, having Types I to V or VI (Makarova et al., (2015) Nat Rev Microbiol, 13(11):722-36; Shmakov et al., (2015) Mol Cell, 60:385-397). Class 2 CRISPR/Cas systems have single protein effectors. Cas proteins of Types II, V, and VI are single-protein, RNA-guided endonucleases, herein called “Class 2 Cas nucleases.” Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins. The Cpf1 nuclease (Zetsche et al., (2015) Cell 163:1-13) is homologous to Cas9 and contains a RuvC- like nuclease domain. In some embodiments, the Cas nuclease is from a Type-II CRISPR/Cas system (e.g., a Cas9 protein from a CRISPR/Cas9 system). In some embodiments, the Cas nuclease is from a Class 2 CRISPR/Cas system (a single-protein Cas nuclease such as a Cas9 protein or a Cpf1 protein). The Cas9 and Cpf1 family of proteins are enzymes with DNA endonuclease activity, and they can be directed to cleave a desired nucleic acid target by designing an appropriate guide RNA, as described further herein. In some embodiments, a Cas nuclease may comprise more than one nuclease domain. For example, a Cas9 nuclease may comprise at least one RuvC-like nuclease domain (e.g., Cpf1) and at least one HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 nuclease introduces a DSB in the target sequence. In some embodiments, the Cas9 nuclease is modified to contain only one functional nuclease domain. For example, the Cas9 nuclease is modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the Cas9 nuclease is modified to contain no functional RuvC-like nuclease domain. In other embodiments, the Cas9 nuclease is modified to contain no functional HNH-like nuclease domain. In some embodiments in which only one of the nuclease domains is functional, the Cas9 nuclease is a nickase that is capable of introducing a single-stranded break (a “nick”) into the target sequence. In some embodiments, a conserved amino acid within a Cas9 nuclease domain is substituted to reduce or alter a nuclease activity. In some embodiments, the Cas nuclease nickase comprises an amino acid substitution in the RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 nuclease). In some embodiments, the nickase comprises an amino acid substitution in the HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 nuclease). The amino acid sequence of an exemplary S. pyogenes Cas9 nuclease is provided in Table 21 (SEQ ID NO: 94). In some embodiments, the Cas nuclease is from a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease is a component of the Cascade complex of a Type-I CRISPR/Cas system. For example, the Cas nuclease is a Cas3 nuclease. In some embodiments, the Cas nuclease is derived from a Type-III CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from Type-IV CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-V CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-VI CRISPR/Cas system. Guide RNAs (gRNAs) The CRISPR technology involves the use of a genome-targeting nucleic acid that can direct the endonuclease to a specific target sequence within a target gene for gene editing at the specific target sequence. The genome-targeting nucleic acid can be a RNA. A genome- targeting RNA is referred to as a “guide RNA” or “gRNA” herein. A guide RNA comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence within a target gene for editing, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a second RNA called the tracrRNA sequence. In the Type II gRNA, the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V gRNA, the crRNA forms a duplex. In both systems, the duplex binds a site-directed polypeptide, such that the guide RNA and site- direct polypeptide form a complex. In some embodiments, the genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid thus directs the activity of the site-directed polypeptide. As is understood by the person of ordinary skill in the art, each guide RNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et al., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011). In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a double- molecule guide RNA. A double-molecule guide RNA comprises two strands of RNA molecules. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a single- molecule guide RNA. A single-molecule guide RNA (referred to as a “sgRNA”) in a Type II system comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins. A single-molecule guide RNA in a Type V system comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence. A spacer sequence in a gRNA is a sequence (e.g., a 20-nucleotide sequence) that defines the target sequence (e.g., a DNA target sequences, such as a genomic target sequence) of a target gene of interest. In some embodiments, the spacer sequence may range from 15 to 30 nucleotides. For example, the spacer sequence may contain 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, a spacer sequence contains 20 nucleotides. The “target sequence” is in a target gene that is adjacent to a PAM sequence and is the sequence to be modified by an RNA-guided nuclease (e.g., Cas9). The “target sequence” is on the so-called PAM-strand in a “target nucleic acid,” which is a double-stranded molecule containing the PAM-strand and a complementary non-PAM strand. One of skill in the art recognizes that the gRNA spacer sequence hybridizes to the complementary sequence located in the non-PAM strand of the target nucleic acid of interest. Thus, the gRNA spacer sequence is the RNA equivalent of the target sequence. For example, if the target sequence is 5′- AGAGCAACAGTGCTGTGGCC**-3′ (SEQ ID NO: 86), then the gRNA spacer sequence is 5′-AGAGCAACAGUGCUGUGGCC**-3′ (SEQ ID NO: 62). The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer thus varies depending on the target sequence of the target nucleic acid of interest. In a CRISPR/Cas system herein, the spacer sequence is designed to hybridize to a region of the target nucleic acid that is located 5' of a PAM recognizable by a Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence. In some embodiments, the target nucleic acid sequence has 20 nucleotides in length. In some embodiments, the target nucleic acid has less than 20 nucleotides in length. In some embodiments, the target nucleic acid has more than 20 nucleotides in length. In some embodiments, the target nucleic acid has at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid has at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides in length. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5'- NNNNNNNNNNNNNNNNNNNNNRG-3', the target nucleic acid can be the sequence that corresponds to the Ns, wherein N can be any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM. The guide RNA disclosed herein may target any sequence of interest via the spacer sequence in the crRNA. In some embodiments, the degree of complementarity between the spacer sequence of the guide RNA and the target sequence in the target gene can be about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene is 100% complementary. In other embodiments, the spacer sequence of the guide RNA and the target sequence in the target gene may contain up to 10 mismatches, e.g., up to 9, up to 8, up to 7, up to 6, up to 5, up to 4, up to 3, up to 2, or up to 1 mismatch. For any of the gRNA sequences provided herein, those that do not explicitly indicate modifications are meant to encompass both unmodified sequences and sequences having any suitable modifications. The length of the spacer sequence in any of the gRNAs disclosed herein may depend on the CRISPR/Cas9 system and components used for editing any of the target genes also disclosed herein. For example, different Cas9 proteins from different bacterial species have varying optimal spacer sequence lengths. Accordingly, the spacer sequence may have 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides in length. In some embodiments, the spacer sequence may have 18-24 nucleotides in length. In some embodiments, the targeting sequence may have 19- 21 nucleotides in length. In some embodiments, the spacer sequence may comprise 20 nucleotides in length. In some embodiments, the gRNA can be an sgRNA, which may comprise a 20- nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA may comprise a less than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA may comprise a more than 20 nucleotide spacer sequence at the 5’ end of the sgRNA sequence. In some embodiments, the sgRNA comprises a variable length spacer sequence with 17-30 nucleotides at the 5’ end of the sgRNA sequence. Examples are provided in Table 21 below. In these exemplary sequences, the fragment of “n” refers to the spacer sequence at the 5’ end. In some embodiments, the sgRNA comprises comprise no uracil at the 3’ end of the sgRNA sequence. In other embodiments, the sgRNA may comprise one or more uracil at the 3’ end of the sgRNA sequence. For example, the sgRNA can comprise 1-8 uracil residues, at the 3’ end of the sgRNA sequence, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 uracil residues at the 3’ end of the sgRNA sequence. Any of the gRNAs disclosed herein, including any of the sgRNAs, may be unmodified. Alternatively, it may contain one or more modified nucleotides and/or modified backbones. For example, a modified gRNA such as an sgRNA can comprise one or more 2'-O-methyl phosphorothioate nucleotides, which may be located at either the 5’ end, the 3’ end, or both. In certain embodiments, more than one guide RNAs can be used with a CRISPR/Cas nuclease system. Each guide RNA may contain a different targeting sequence, such that the CRISPR/Cas system cleaves more than one target nucleic acid. In some embodiments, one or more guide RNAs may have the same or differing properties such as activity or stability within the Cas9 RNP complex. Where more than one guide RNA is used, each guide RNA can be encoded on the same or on different vectors. The promoters used to drive expression of the more than one guide RNA is the same or different. In some embodiments, the gRNAs disclosed herein target a TAPBP gene, for example, target a site within any one of exons 1-8, for example, exon 1 or exon 2 of the TAPBP gene. Such a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 1 or exon 2 of a TAPBP gene, or a fragment thereof. In specific examples, the gRNA may comprise a spacer sequence complementary to a target sequence in exon 2 of a TAPBP gene. Exemplary target sequences of TAPBP and exemplary gRNA sequences are provided in Table 19 and Table 20 below: In some embodiments, the gRNAs disclosed herein target a CD70 gene, for example, target a site within exon 1 or exon 3 of a CD70 gene. Such a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 1 or exon 3 of a CD70 gene, or a fragment thereof. Exemplary target sequences in a CD70 gene and exemplary gRNAs specific to the CD70 gene are provided in Table 21 below. See also WO2019/215500, the relevant disclosures of which are incorporated by reference for the purpose and subject matter referenced herein. In some embodiments, the gRNAs disclosed herein target a Reg1 gene, for example, target a site within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the Reg1 gene. Such a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 2 or exon 4 of a Reg1 gene, or a fragment thereof. Exemplary target sequences of Reg1 and exemplary gRNA sequences are provided in Table 21 below. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. In some embodiments, the gRNAs disclosed herein target a TGFBRII gene, for example, target a site within exon 1, exon 2, exon 3, exon 4, exon 5, or exon 6 of the TGFBRII gene. Such a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 4 or exon 5 of a TGFBRII gene, or a fragment thereof. Exemplary target sequences of TGFBRII and exemplary gRNA sequences are provided in Table 21 below. See also WO/2022/064428, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. In some embodiments, the gRNAs disclosed herein target a CBLB gene, for example, target a site within exon 2, exon 7, exon 9, exon 11, or exon 12 of the CBLB gene. Such a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 2 of a CBLB gene, or a fragment thereof. In other examples, a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 7 of a CBLB gene, or a fragment thereof. Alternatively, a gRNA may comprise a spacer sequence complementary (complete or partially) to the target sequences in exon 9 of a CBLB gene, or a fragment thereof. Exemplary target sequences in a CBLB gene and exemplary gRNA sequences are provided in Table 21 below. See also WO2023/119201, the relevant disclosures of which are incorporated by reference for the subject matter and purpose referenced herein. In some embodiments, the gRNAs disclosed herein target a TRAC gene. See also WO2019097305, the relevant disclosures of which are incorporated by reference herein for the subject matter and purpose referenced herein. Other gRNA sequences may be designed using the TRAC gene sequence located on chromosome 14 (GRCh38: chromosome 14: 22,547,506- 22,552,154; Ensembl; ENSG00000277734). In some embodiments, gRNAs targeting the TRAC genomic region and RNA-guided nuclease create breaks in the TRAC genomic region resulting Indels in the TRAC gene disrupting expression of the mRNA or protein. Exemplary spacer sequences and gRNAs targeting a TRAC gene are provided in Table 21 below. By way of illustration, guide RNAs used in the CRISPR/Cas/Cpf1 system, or other smaller RNAs can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpf1 endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art. In some examples, the gRNAs of the present disclosure can be produced in vitro transcription (IVT), synthetic and/or chemical synthesis methods, or a combination thereof. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods are utilized. In one embodiment, the gRNAs are made using IVT enzymatic synthesis methods. Methods of making polynucleotides by IVT are known in the art and are described in WO2013/151666. Accordingly, the present disclosure also includes polynucleotides, e.g., DNA, constructs and vectors are used to in vitro transcribe a gRNA described herein. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art. In some embodiments, non-natural modified nucleobases can be introduced into any of the gRNAs disclosed herein during synthesis or post-synthesis. In certain embodiments, modifications are on internucleoside linkages, purine or pyrimidine bases, or sugar. In some embodiments, a modification is introduced at the terminal of a gRNA with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in WO2013/052523. Synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998). In some embodiments, enzymatic or chemical ligation methods can be used to conjugate polynucleotides or their regions with different functional moieties, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc. Conjugates of polynucleotides and modified polynucleotides are reviewed in Goodchild, Bioconjugate Chemistry, vol. 1(3), 165-187 (1990). In some embodiments of the present disclosure, a CRISPR/Cas nuclease system for use in genetically editing any of the target genes disclosed here may include at least one guide RNA. In some examples, the CRISPR/Cas nuclease system may contain multiple gRNAs, for example, 2, 3, or 4 gRNAs. Such multiple gRNAs may target different sites in a same target gene. Alternatively, the multiple gRNAs may target different genes. In some embodiments, the guide RNA(s) and the Cas protein may form a ribonucleoprotein (RNP), e.g., a CRISPR/Cas complex. The guide RNA(s) may guide the Cas protein to a target sequence(s) on one or more target genes as those disclosed herein, where the Cas protein cleaves the target gene at the target site. In some embodiments, the CRISPR/Cas complex is a Cpf1/guide RNA complex. In some embodiments, the CRISPR complex is a Type-II CRISPR/Cas9 complex. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the CRISPR/Cas9 complex is a Cas9/guide RNA complex. In some embodiments, the indel frequency (editing frequency) of a particular CRISPR/Cas nuclease system, comprising one or more specific gRNAs, may be determined using a TIDE analysis, which can be used to identify highly efficient gRNA molecules for editing a target gene. In some embodiments, a highly efficient gRNA yields a gene editing frequency of higher than 80%. For example, a gRNA is considered to be highly efficient if it yields a gene editing frequency of at least 80%, at least 85%, at least 90%, at least 95%, or 100%. Delivery of Guide RNAs and Nucleases to T Cells The CRISPR/Cas nuclease system disclosed herein, comprising one or more gRNAs and at least one RNA-guided nuclease, optionally a donor template as disclosed below, can be delivered to a target cell (e.g., a T cell) for genetic editing of a target gene, via a conventional method. In some embodiments, components of a CRISPR/Cas nuclease system as disclosed herein may be delivered to a target cell separately, either simultaneously or sequentially. In other embodiments, the components of the CRISPR/Cas nuclease system may be delivered into a target together, for example, as a complex. In some instances, gRNA and a RNA-guided nuclease can be pre-complexed together to form a ribonucleoprotein (RNP), which can be delivered into a target cell. RNPs are useful for gene editing, at least because they minimize the risk of promiscuous interactions in a nucleic acid-rich cellular environment and protect the RNA from degradation. Methods for forming RNPs are known in the art. In some embodiments, an RNP containing an RNA-guided nuclease (e.g., a Cas nuclease, such as a Cas9 nuclease) and one or more gRNAs targeting one or more genes of interest can be delivered a cell (e.g., a T cell). In some embodiments, an RNP can be delivered to a T cell by electroporation. In some embodiments, an RNA-guided nuclease can be delivered to a cell in a DNA vector that expresses the RNA-guided nuclease in the cell. In other examples, an RNA-guided nuclease can be delivered to a cell in an RNA that encodes the RNA-guided nuclease and expresses the nuclease in the cell. Alternatively or in addition, a gRNA targeting a gene can be delivered to a cell as a RNA, or a DNA vector that expresses the gRNA in the cell. Delivery of an RNA-guided nuclease, gRNA, and/or an RNP may be through direct injection or cell transfection using known methods, for example, electroporation or chemical transfection. Other cell transfection methods may be used. Other Gene Editing Methods Besides the CRISPR method disclosed herein, additional gene editing methods as known in the art can also be used in making the genetically engineered T cells disclosed herein. Some examples include gene editing approaching involve zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN), restriction endonucleases, meganucleases homing endonucleases, and the like. ZFNs are targeted nucleases comprising a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that binds DNA in a sequence-specific manner through one or more zinc fingers. A zinc finger is a domain of about 30 amino acids within the zinc finger binding domain whose structure is stabilized through coordination of a zinc ion. Examples of zinc fingers include, but not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. A designed zinc finger domain is a domain not occurring in nature whose design/composition results principally from rational criteria, e.g., application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO 98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496. A selected zinc finger domain is a domain not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. ZFNs are described in greater detail in U.S. Pat. No. 7,888,121 and U.S. Pat. No. 7,972,854. The most recognized example of a ZFN is a fusion of the FokI nuclease with a zinc finger DNA binding domain. A TALEN is a targeted nuclease comprising a nuclease fused to a TAL effector DNA binding domain. A “transcription activator-like effector DNA binding domain”, “TAL effector DNA binding domain”, or “TALE DNA binding domain” is a polypeptide domain of TAL effector proteins that is responsible for binding of the TAL effector protein to DNA. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the nucleus of the plant cell, bind effector-specific DNA sequences via their DNA binding domain, and activate gene transcription at these sequences via their transactivation domains. TAL effector DNA binding domain specificity depends on an effector-variable number of imperfect 34 amino acid repeats, which comprise polymorphisms at select repeat positions called repeat variable-diresidues (RVD). TALENs are described in greater detail in US Patent Application No. 2011/0145940. The most recognized example of a TALEN in the art is a fusion polypeptide of the FokI nuclease to a TAL effector DNA binding domain. Additional examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxb1, phiC31, R4, PhiBT1, and Wβ/SPBc/TP901-1, whether used individually or in combination. Any of the nucleases disclosed herein may be delivered using a vector system, including, but not limited to, plasmid vectors, DNA minicircles, retroviral vectors, lentiviral vectors, adenovirus vectors, poxvirus vectors; herpesvirus vectors and adeno-associated virus vectors, and combinations thereof. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids encoding nucleases and donor templates in cells (e.g., T cells). Non-viral vector delivery systems include DNA plasmids, DNA minicircles, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. Methods of non-viral delivery of nucleic acids include electroporation, lipofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, naked RNA, capped RNA, artificial virions, and agent-enhanced uptake of DNA. Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar) can also be used for delivery of nucleic acids. Some specific examples are provided below. II. Genetically Engineered T Cells Expressing a Chimeric Antigen Receptor (CAR) The genetically engineered T cells having a disrupted TAPBP gene and optionally one or more of additional disrupted genes, e.g., TRAC, CD70, TGFBRII, Reg-1, CBLB, or a combination thereof as disclosed herein, may further express a chimeric antigen receptor (CAR) targeting an antigen of interest or cells expressing such an antigen. (a) Chimeric Antigen Receptor (CAR) A chimeric antigen receptor (CAR) refers to an artificial immune cell receptor that is engineered to recognize and bind to an antigen expressed by undesired cells, for example, disease cells such as cancer cells. A T cell that expresses a CAR polypeptide is referred to as a CAR T cell. CARs have the ability to redirect T-cell specificity and reactivity toward a selected target in a non-MHC-restricted manner. The non-MHC-restricted antigen recognition gives CAR-T cells the ability to recognize an antigen independent of antigen processing, thus bypassing a major mechanism of tumor escape. Moreover, when expressed on T-cells, CARs advantageously do not dimerize with endogenous T-cell receptor (TCR) alpha and beta chains. There are various generations of CARs, each of which contains different components. First generation CARs join an antibody-derived scFv to the CD3zeta (ζ or z) intracellular signaling domain of the T-cell receptor through hinge and transmembrane domains. Second generation CARs incorporate an additional co-stimulatory domain, e.g., CD28, 4-1BB (41BB), or ICOS, to supply a costimulatory signal. Third-generation CARs contain two costimulatory domains (e.g., a combination of CD27, CD28, 4-1BB, ICOS, or OX40) fused with the TCR CD3ζ chain. Maude et al., Blood. 2015; 125(26):4017-4023; Kakarla and Gottschalk, Cancer J. 2014; 20(2):151-155). Any of the various generations of CAR constructs is within the scope of the present disclosure. Generally, a CAR is a fusion polypeptide comprising an extracellular domain that recognizes a target antigen (e.g., a single chain fragment (scFv) of an antibody or other antibody fragment) and an intracellular domain comprising a signaling domain of the T-cell receptor (TCR) complex (e.g., CD3ζ) and, in most cases, a co-stimulatory domain. (Enblad et al., Human Gene Therapy. 2015; 26(8):498-505). A CAR construct may further comprise a hinge and transmembrane domain between the extracellular domain and the intracellular domain, as well as a signal peptide at the N-terminus for surface expression. Examples of signal peptides include those provided in provided in Table 22 below. Other signal peptides may be used. (i) Antigen Binding Extracellular Domain The antigen-binding extracellular domain is the region of a CAR polypeptide that is exposed to the extracellular fluid when the CAR is expressed on cell surface. In some instances, a signal peptide may be located at the N-terminus to facilitate cell surface expression. In some embodiments, the antigen binding domain can be a single-chain variable fragment (scFv, which may include an antibody heavy chain variable region (VH) and an antibody light chain variable region (V_L) (in either orientation). In some instances, the V_H and V_L fragment may be linked via a peptide linker. The linker, in some embodiments, includes hydrophilic residues with stretches of glycine and serine for flexibility as well as stretches of glutamate and lysine for added solubility. The scFv fragment retains the antigen-binding specificity of the parent antibody, from which the scFv fragment is derived. In some embodiments, the scFv may comprise humanized VH and/or VL domains. In other embodiments, the VH and/or VL domains of the scFv are fully human. The antigen-binding extracellular domain may be specific to a target antigen of interest, for example, a pathologic antigen such as a tumor antigen (e.g., a solid tumor antigen). In some embodiments, a tumor antigen is a “tumor associated antigen,” referring to an immunogenic molecule, such as a protein, that is generally expressed at a higher level in tumor cells than in non-tumor cells, in which it may not be expressed at all, or only at low levels. In some embodiments, tumor-associated structures, which are recognized by the immune system of the tumor-harboring host, are referred to as tumor-associated antigens. In some embodiments, a tumor-associated antigen is a universal tumor antigen, if it is broadly expressed by most types of tumors. In some embodiments, tumor-associated antigens are differentiation antigens, mutational antigens, overexpressed cellular antigens or viral antigens. In some embodiments, a tumor antigen is a “tumor specific antigen” or “TSA,” referring to an immunogenic molecule, such as a protein, that is unique to a tumor cell. Tumor specific antigens are exclusively expressed in tumor cells, for example, in a specific type of tumor cells. Exemplary tumor antigens include, but are not limited to, CD19, BCMA, and CD70. Any known antibodies specific to such tumor antigens, for example, those approved for marketing and those in clinical trials, can be used for making the CAR constructs disclosed herein. Non-limiting examples of CAR constructs are provided in WO2019097305 and WO2019215500, and WO2020/095107, the relevant disclosures of which are herein incorporated by reference for the purposes and subject matter referenced herein. (ii) Transmembrane Domain The CAR polypeptide disclosed herein may contain a transmembrane domain, which can be a hydrophobic alpha helix that spans the membrane. As used herein, a “transmembrane domain” refers to any protein structure that is thermodynamically stable in a cell membrane, preferably a eukaryotic cell membrane. The transmembrane domain can provide stability of the CAR containing such. In some embodiments, the transmembrane domain of a CAR as provided herein can be a CD8 transmembrane domain. In other embodiments, the transmembrane domain can be a CD28 transmembrane domain. In yet other embodiments, the transmembrane domain is a chimera of a CD8 and CD28 transmembrane domain. Other transmembrane domains may be used as provided herein. In some embodiments, the transmembrane domain is a CD8a transmembrane domain containing the sequence provided below in Table 22 below. Other transmembrane domains may be used. (iii) Hinge Domain In some embodiments, a hinge domain may be located between an extracellular domain (comprising the antigen binding domain) and a transmembrane domain of a CAR, or between a cytoplasmic domain and a transmembrane domain of the CAR. A hinge domain can be any oligopeptide or polypeptide that functions to link the transmembrane domain to the extracellular domain and/or the cytoplasmic domain in the polypeptide chain. A hinge domain may function to provide flexibility to the CAR, or domains thereof, or to prevent steric hindrance of the CAR, or domains thereof. In some embodiments, a hinge domain may comprise up to 300 amino acids (e.g., 10 to 100 amino acids, or 5 to 20 amino acids). In some embodiments, one or more hinge domain(s) may be included in other regions of a CAR. In some embodiments, the hinge domain may be a CD8 hinge domain. Examples are provided in Table 22 below. Other hinge domains may be used. (iv) Intracellular Signaling Domains Any of the CAR constructs contain one or more intracellular signaling domains (e.g., CD3ζ, and optionally one or more co-stimulatory domains), which are the functional end of the receptor. Following antigen recognition, receptors cluster and a signal is transmitted to the cell. CD3ζ is the cytoplasmic signaling domain of the T cell receptor complex. CD3ζ contains three (3) immunoreceptor tyrosine-based activation motif (ITAM)s, which transmit an activation signal to the T cell after the T cell is engaged with a cognate antigen. In many cases, CD3ζ provides a primary T cell activation signal but not a fully competent activation signal, which requires a co-stimulatory signaling. In some embodiments, the CAR polypeptides disclosed herein may further comprise one or more co-stimulatory signaling domains. For example, the co-stimulatory domains of CD28 and/or 4-1BB may be used to transmit a full proliferative/survival signal, together with the primary signaling mediated by CD3ζ. In some examples, the CAR disclosed herein comprises a CD28 co-stimulatory molecule. In other examples, the CAR disclosed herein comprises a 4-1BB co-stimulatory molecule. In some embodiments, a CAR includes a CD3ζ signaling domain and a CD28 co-stimulatory domain. In other embodiments, a CAR includes a CD3ζ signaling domain and 4-1BB co-stimulatory domain. In still other embodiments, a CAR includes a CD3ζ signaling domain, a CD28 co-stimulatory domain, and a 4-1BB co- stimulatory domain. Table 22 provides examples of signaling domains derived from 4-1BB, CD28 and CD3-zeta that may be used herein. In specific examples, the anti-CD19 CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 111. In other examples, the anti-BCMA CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 132. In other examples, the anti-CD70 CAR disclosed herein may comprise the amino acid sequence of SEQ ID NO: 122. See sequence Table 22 provided below. (b) Delivery of CAR Construct to T Cells In some embodiments, a nucleic acid encoding a CAR can be introduced into any of the genetically engineered T cells disclosed herein by methods known to those of skill in the art. For example, a coding sequence of the CAR may be cloned into a vector, which may be introduced into the genetically engineered T cells for expression of the CAR. A variety of different methods known in the art can be used to introduce any of the nucleic acids or expression vectors disclosed herein into an immune effector cell. Non-limiting examples of methods for introducing nucleic acid into a cell include: lipofection, transfection (e.g., calcium phosphate transfection, transfection using highly branched organic compounds, transfection using cationic polymers, dendrimer-based transfection, optical transfection, particle-based transfection (e.g., nanoparticle transfection), or transfection using liposomes (e.g., cationic liposomes)), microinjection, electroporation, cell squeezing, sonoporation, protoplast fusion, impalefection, hydrodynamic delivery, gene gun, magnetofection, viral transfection, and nucleofection. In specific examples, a nucleic acid encoding a CAR construct can be delivered to a cell using an adeno-associated virus (AAV). AAVs are small viruses which integrate site- specifically into the host genome and can therefore deliver a transgene, such as CAR. Inverted terminal repeats (ITRs) are present flanking the AAV genome and/or the transgene of interest and serve as origins of replication. Also present in the AAV genome are rep and cap proteins which, when transcribed, form capsids which encapsulate the AAV genome for delivery into target cells. Surface receptors on these capsids which confer AAV serotype, which determines which target organs the capsids will primarily bind and thus what cells the AAV will most efficiently infect. There are twelve currently known human AAV serotypes. In some embodiments, the AAV for use in delivering the CAR-coding nucleic acid is AAV serotype 6 (AAV6). Adeno-associated viruses are among the most frequently used viruses for gene therapy for several reasons. First, AAVs do not provoke an immune response upon administration to mammals, including humans. Second, AAVs are effectively delivered to target cells, particularly when consideration is given to selecting the appropriate AAV serotype. Finally, AAVs have the ability to infect both dividing and non-dividing cells because the genome can persist in the host cell without integration. This trait makes them an ideal candidate for gene therapy. A nucleic acid encoding a CAR can be designed to insert into a genomic site of interest in the host T cells. In some embodiments, the target genomic site can be in a safe harbor locus. In some embodiments, a nucleic acid encoding a CAR (e.g., via a donor template, which can be carried by a viral vector such as an adeno-associated viral (AAV) vector) can be designed such that it can insert into a genomic site of interest. In some instances, the nucleic acid may comprise a left homologous arm and a right homologous arm flanking the nucleotide sequence encoding the CAR. The left and right homologous arms are homologous to the upstream and downstream sequences of the genomic site where the CAR-coding sequence is to be inserted. In some examples, the genomic site where the CAR-coding sequence is to be inserted is also the target site of a guide RNA such that the CAR-coding nucleic acid can be inserted at the guide RNA targeting site. In some examples, the left homologous arm and the right homologous arm may be homologous to the sequences immediately flank the guide RNA targeting site. In some instances, the guide RNA targeting site can be deleted and replaced by the CAR-encoding nucleic acid after gene editing. In some embodiments, a nucleic acid encoding a CAR (e.g., via a donor template, which can be carried by a viral vector such as an adeno-associated viral (AAV) vector) can be designed such that it can insert into a location within a genomic site of interest. In some instances, the genomic site of interest is within a safe harbor gene, which are regions of the host (e.g., human) genome that have been identified as safe sites for incorporation of exogenous genes such as therapeutic genes. Human AAVS1 locus is one example. Alternatively, the genomic locus of interest may be within one of the disrupted genes disclosed herein. In some examples, the nucleic acid encoding the CAR may be inserted into the TRAC gene to disrupt the TRAC gene in the genetically engineered T cells and express the CAR polypeptide. Disruption of TRAC leads to loss of function of the endogenous TCR. For example, a disruption in the TRAC gene can be created with an endonuclease such as those described herein and one or more gRNAs targeting one or more TRAC genomic regions. Any of the gRNAs specific to a TRAC gene and the target regions disclosed herein can be used for this purpose. In some examples, a genomic deletion in the TRAC gene and replacement by a CAR coding segment can be created by homology directed repair or HDR (e.g., using a donor template, which may be part of a viral vector such as an adeno-associated viral (AAV) vector). In some embodiments, a disruption in the TRAC gene can be created with an endonuclease as those disclosed herein and one or more gRNAs targeting one or more TRAC genomic regions and inserting a CAR coding segment into the TRAC gene. A donor template as disclosed herein can contain a coding sequence for a CAR. In some examples, the CAR-coding sequence may be flanked by two regions of homology to allow for efficient HDR at a genomic location of interest, for example, at a TRAC gene using a gene editing method known in the art. In some examples, a CRISPR-based method can be used. In this case, both strands of the DNA at the target locus can be cut by a CRISPR Cas9 enzyme guided by gRNAs specific to the target locus. HDR then occurs to repair the double- strand break (DSB) and insert the donor DNA coding for the CAR. For this to occur correctly, the donor sequence is designed with flanking residues which are complementary to the sequence surrounding the DSB site in the target gene (hereinafter “homology arms”), such as the TRAC gene. These homology arms serve as the template for DSB repair and allow HDR to be an essentially error-free mechanism. The rate of homology directed repair (HDR) is a function of the distance between the mutation and the cut site so choosing overlapping or nearby target sites is important. Templates can include extra sequences flanked by the homologous regions or can contain a sequence that differs from the genomic sequence, thus allowing sequence editing. In other embodiments, the nucleic acid encoding the CAR may be inserted at a different genomic site, for example, at the disrupted CD70 locus, at the disrupted TGFBRII locus, at the disrupted Reg-1 locus, or at the disrupted CBLB locus, via the same CRISPR/Cas9-mediated gene editing and homologous recombination approach disclosed above. Alternatively, a donor template may have no regions of homology to the targeted location in the DNA and may be integrated by NHEJ-dependent end joining following cleavage at the target site. A donor template can be DNA or RNA, single-stranded and/or double-stranded, and can be introduced into a cell in linear or circular form. If introduced in linear form, the ends of the donor sequence can be protected (e.g., from exonucleolytic degradation) by methods known to those of skill in the art. For example, one or more dideoxynucleotide residues are added to the 3' terminus of a linear molecule and/or self-complementary oligonucleotides are ligated to one or both ends. See, for example, Chang et al., (1987) Proc. Natl. Acad. Sci. USA 84:4959-4963; Nehls et al., (1996) Science 272:886-889. Additional methods for protecting exogenous polynucleotides from degradation include, but are not limited to, addition of terminal amino group(s) and the use of modified internucleotide linkages such as, for example, phosphorothioates, phosphoramidates, and O-methyl ribose or deoxyribose residues. A donor template can be introduced into a cell as part of a vector molecule having additional sequences such as, for example, replication origins, promoters and genes encoding antibiotic resistance. Moreover, a donor template can be introduced into a cell as naked nucleic acid, as nucleic acid complexed with an agent such as a liposome or poloxamer, or can be delivered by viruses (e.g., adenovirus, AAV, herpesvirus, retrovirus, lentivirus and integrase defective lentivirus (IDLV)). A donor template, in some embodiments, can be inserted at a site nearby an endogenous prompter (e.g., downstream or upstream) so that its expression can be driven by the endogenous promoter. In other embodiments, the donor template may comprise an exogenous promoter and/or enhancer, for example, a constitutive promoter, an inducible promoter, or tissue-specific promoter to control the expression of the CAR gene. In some embodiments, the exogenous promoter is an EF1α promoter, see, e.g., SEQ ID NO: 139 provided in Table 23 below. Other promoters may be used. Furthermore, exogenous sequences may also include transcriptional or translational regulatory sequences, for example, promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and/or polyadenylation signals. When needed, additional gene editing (e.g., gene knock-in or knock-out) can be introduced into therapeutic T cells as disclosed herein to improve T cell function and therapeutic efficacy. For example, if β2M knockout can be performed to reduce the risk of or prevent a host-versus-graft response. Other examples include knock-in or knock-out genes to improve target cell lysis, knock-in or knock-out genes to enhance performance of therapeutic T cells such as CAR-T cells. In some embodiments, a donor template for delivering an anti-CD19 CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti- CD19 CAR, and optionally regulatory sequences for expression of the anti-CD19 CAR (e.g., a promoter such as the EF1a promoter provided in the sequence Table), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest. In some examples, the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene. In specific examples, the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 86). In some specific examples, the donor template for delivering the anti-CD19 CAR may comprise a nucleotide sequence of SEQ ID NO: 140, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 86. In some embodiments, a donor template for delivering an anti-BCMA CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti- BCMA CAR, and optionally regulatory sequences for expression of the anti- BCMA CAR (e.g., a promoter such as the EF1a promoter provided in the sequence Table), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest. In some examples, the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene. In specific examples, the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of SEQ ID NO: 86. In some specific examples, the donor template for delivering the anti- BCMA CAR may comprise a nucleotide sequence of SEQ ID NO: 142, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 86. In some embodiments, a donor template for delivering an anti-CD70 CAR may be an AAV vector inserted with a nucleic acid fragment comprising the coding sequence of the anti- CD70 CAR, and optionally regulatory sequences for expression of the anti-CD70 CAR (e.g., a promoter such as the EF1a promoter provided in Table 23 below), which can be flanked by homologous arms for inserting the coding sequence and the regulatory sequences into a genomic locus of interest. In some examples, the nucleic acid fragment is inserted in the endogenous TRAC gene locus, thereby disrupting expression of the TRAC gene. In specific examples, the nucleic acid may replace a fragment in the TRAC gene, for example, a fragment comprising the nucleotide sequence of SEQ ID NO: 86. In some specific examples, the donor template for delivering the anti-CD70 CAR may comprise a nucleotide sequence of SEQ ID NO: 141, which can be inserted into a disrupted TRAC gene, for example, replacing the fragment of SEQ ID NO: 86. The genetically engineered T cells having a disrupted TAPBP gene, one or more additional disrupted genes, e.g., TRAC, CD70, TGFBRII, Reg-1, and/or CBLB and further expressing a chimeric antigen receptor (CAR) can be produced by sequential targeting of the genes of interest. (c) Exemplary Genetically Engineered T Cells Expressing a Chimeric Antigen Receptor It should be understood that gene disruption encompasses gene modification through gene editing (e.g., using CRISPR/Cas gene editing to insert or delete one or more nucleotides). A disrupted gene may contain one or more mutations (e.g., insertion, deletion, or nucleotide substitution, etc.) relative to the wild-type counterpart so as to substantially reduce or completely eliminate the activity of the encoded gene product. The one or more mutations may be located in a non-coding region, for example, a promoter region, a regulatory region that regulates transcription or translation; or an intron region. Alternatively, the one or more mutations may be located in a coding region (e.g., in an exon). In some instances, the disrupted gene does not express or expresses a substantially reduced level of the encoded protein. In other instances, the disrupted gene expresses the encoded protein in a mutated form, which is either not functional or has substantially reduced activity. In some embodiments, a disrupted gene is a gene that does not encode functional protein. In some embodiments, a cell that comprises a disrupted gene does not express (e.g., at the cell surface) a detectable level (e.g., by antibody, e.g., by flow cytometry) of the protein encoded by the gene. A cell that does not express a detectable level of the protein may be referred to as a knockout cell. For example, a cell having a TRAC gene edit may be considered a TRAC knockout cell if the TRAC protein cannot be detected at the cell surface using an antibody that specifically binds the TRAC protein. In some embodiments, the genetically engineered immune cells (e.g., T cells such as human T cells) may comprise a disrupted TAPBP gene, a disrupted TRAC gene, and express an anti-CD19 CAR, e.g., those disclosed herein (anti-CD19 CAR-T cells). In some examples, the population of anti-CD19 CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA. In some examples, the anti-CD19 CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells. For example, the anti-CD19 CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 86) in the TRAC gene. This fragment can be replaced by the nucleic acid encoding the anti-CD19 CAR (e.g., SEQ ID NO: 140). See also WO 2019/097305A2, and WO2019215500, the relevant disclosures of each of which are incorporated by reference for the subject matter and purpose referenced herein. In some embodiments, the genetically engineered immune cells (e.g., T cells such as human T cells) may comprise a disrupted TAPBP gene, a disrupted TRAC gene, and express an anti-BCMA CAR, e.g., those disclosed herein (anti-BCMA CAR-T cells). In some examples, the population of anti-BCMA CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA. In some examples, the anti-BCMA CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells. For example, the anti-BCMA CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 86) in the TRAC gene. This fragment can be replaced by the nucleic acid encoding the anti-BCMA CAR (e.g., SEQ ID NO: 142). See also WO 2019/097305A2, and WO2019215500, the relevant disclosures of each of which are incorporated by reference for the subject matter and purpose referenced herein. In some embodiments, the genetically engineered immune cells (e.g., T cells such as human T cells) may comprise a disrupted TAPBP gene, a disrupted TRAC gene, a disrupted CD70 gene, and express an anti-CD70 CAR, e.g., those disclosed herein (anti-CD70 CAR-T cells). In some examples, the population of anti-CD70 CAR T cells may comprise a disrupted TRAC gene via the CRISPR/Cas technology using the TA-1 TRAC gRNA. In some examples, the anti-BCMA CAR T cells may comprise a deletion in the TRAC gene relative to unmodified T cells. For example, the anti-CD70 CAR T cells may comprise a deletion of the fragment AGAGCAACAGTGCTGTGGCC (SEQ ID NO: 86) in the TRAC gene. This fragment can be replaced by the nucleic acid encoding the anti-CD70 CAR (e.g., SEQ ID NO: 141). See also WO 2019/097305A2, and WO2019215500, the relevant disclosures of each of which are incorporated by reference for the subject matter and purpose referenced herein. Further, the population of anti-CD70 CAR T cells may comprise a disrupted CD70 gene via CRISPR/Cas9 technology using a gRNA targeting the CD70 locus, for example, CD70-7. See Table 21. See also WO2019215500, the relevant disclosures of each of which are incorporated by reference for the subject matter and purpose referenced herein. III. Therapeutic Applications The therapeutic T cells disclosed herein can be administered to a subject for therapeutic purposes, for example, treatment of a tumor such as a solid tumor targeted by the CAR construct expressed by the therapeutic CAR-T cells. As reported herein, disruption of the TAPBP gene led to improved T cell persistence, increased cytokine secretion, enhanced CAR potency and/or CAR copy numbers, etc., leading to improved anti-tumor efficacy as observed in animal models. The step of administering may include the placement (e.g., transplantation) of the therapeutic T cells into a subject by a method or route that results in at least partial localization of the therapeutic T cells at a desired site, such as a tumor site, such that a desired effect(s) can be produced. Therapeutic T cells can be administered by any appropriate route that results in delivery to a desired location in the subject where at least a portion of the implanted cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g., twenty-four hours, to a few days, to as long as several years, or even the lifetime of the subject, i.e., long-term engraftment. For example, in some aspects, an effective amount of the therapeutic T cells can be administered via a systemic route of administration, such as an intraperitoneal or intravenous route. In some embodiments, the therapeutic T cells are administered systemically, which refers to the administration of a population of cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject's circulatory system and, thus, is subject to metabolism and other like processes. Suitable modes of administration include injection, infusion, instillation, or ingestion. Injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. A subject may be any subject for whom diagnosis, treatment, or therapy is desired. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some instances, the human patient has a cancer involving CD19⁺ cancer cells (e.g., B cell malignancy such as B-cell leukemia, non-Hodgkin lymphoma, e.g., diffuse large B cell lymphoma (DLBCL), B cell lymphoma, or transformed follicular lymphoma, or T cell malignancy). CAR-T cells expressing an anti-CD19 CAR (e.g., disclosed herein) may be used to treat such a patient. In some instances, the human patient has a cancer involving BCMA⁺ cancer cells (e.g., multiple myeloma). CAR-T cells expressing an anti-BCMA CAR (e.g., disclosed herein) may be used to treat such a patient. In some instances, the human patient has a CD70⁺ hematological tumor (e.g., cutaneous T cell lymphoma, peripheral T-cell lymphoma, or T cell leukemia) or a solid tumor (e.g., renal cell carcinoma). CAR-T cells expressing an anti-CD70 CAR (e.g., disclosed herein) may be used to treat such a patient. In some instances, the therapeutic T cells may be autologous (“self”) to the subject, i.e., the cells are from the same subject. Alternatively, the therapeutic T cells can be non- autologous (“non-self,” e.g., allogeneic, syngeneic or xenogeneic) to the subject. “Allogeneic” means that the therapeutic T cells are not derived from the subject who receives the treatment but from different individuals (donors) of the same species as the subject. A donor is an individual who is not the subject being treated. A donor is an individual who is not the patient. In some embodiments, a donor is an individual who does not have or is not suspected of having the cancer being treated. In some embodiments, multiple donors, e.g., two or more donors, are used. In some embodiments, an engineered T cell population being administered according to the methods described herein comprises allogeneic T cells obtained from one or more donors. Allogeneic refers to a cell, cell population, or biological samples comprising cells, obtained from one or more different donors of the same species, where the genes at one or more loci are not identical to the recipient (e.g., subject). For example, an engineered T cell population, being administered to a subject can be derived from one or more unrelated donors, or from one or more non-identical siblings. In some embodiments, syngeneic cell populations may be used, such as those obtained from genetically identical donors, (e.g., identical twins). In some embodiments, the cells are autologous cells; that is, the engineered T cells are obtained or isolated from a subject and administered to the same subject, i.e., the donor and recipient are the same. An effective amount refers to the amount of a population of engineered T cells needed to prevent or alleviate at least one or more signs or symptoms of a medical condition (e.g., cancer), and relates to a sufficient amount of a composition to provide the desired effect, e.g., to treat a subject having a medical condition. An effective amount also includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation. The efficacy of a treatment using the therapeutic T cells disclosed herein can be determined by the skilled clinician. A treatment is considered “effective”, if any one or all of the signs or symptoms of, as but one example, levels of functional target are altered in a beneficial manner (e.g., increased by at least 10%), or other clinically accepted symptoms or markers of disease (e.g., cancer) are improved or ameliorated. Efficacy can also be measured by failure of a subject to worsen as assessed by hospitalization or need for medical interventions (e.g., progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein. Treatment includes any treatment of a disease in subject and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms. Combination therapies are also encompassed by the present disclosure. For example, the therapeutic T cells disclosed herein may be co-used with other therapeutic agents, for treating the same indication, or for enhancing efficacy of the therapeutic T cells and/or reducing side effects of the therapeutic T cells. IV. KITS The present disclosure also provides kits for use in producing the genetically engineered T cells, the therapeutic T cells, and for therapeutic uses, In some embodiments, a kit provided herein may comprise components for performing genetic edit of a TAPBP gene, and optionally components for editing one or more additional genes, including TRAC gene, CD70 gene, TGFBRII gene, Reg-1 gene, and CBLB gene. The kit may also comprise a population of immune cells to which the genetic editing will be performed (e.g., a leukopak or a T cell bank). A leukopak sample may be an enriched leukapheresis product collected from peripheral blood. It typically contains a variety of blood cells including monocytes, lymphocytes, platelets, plasma, and red cells. The components for genetically editing one or more of the target genes may comprise a suitable endonuclease such as an RNA- guided endonuclease and one or more nucleic acid guides, which direct cleavage of one or more suitable genomic sites by the endonuclease. For example, the kit may comprise a Cas enzyme such as Cas 9 and one or more gRNAs targeting TAPBP, and optionally gRNAs targeting TRAC, CD70, TGFBRII, Reg-1, and/or CBLB. Any of the gRNAs specific to these target genes can be included in the kit. In some embodiments, a kit provided herein may comprise a population of genetically engineered T cells as disclosed herein, and one or more components for producing the therapeutic T cells as also disclosed herein. Such components may comprise an endonuclease suitable for gene editing and a nucleic acid coding for a CAR construct of interest. The CAR- coding nucleic acid may be part of a donor template as disclosed herein, which may contain homologous arms flanking the CAR-coding sequence. In some instances, the donor template may be carried by a viral vector such as an AAV vector. The kit may further comprise gRNAs specific to any of the genomic site of interest, for example, the TRAC gene, for inserting the CAR-coding sequence into the genomic site of interest. In yet other embodiments, the kit disclosed herein may comprise a population of therapeutic T cells as disclosed for the intended therapeutic purposes. Any of the kit disclosed herein may further comprise instructions for making the therapeutic T cells, or therapeutic applications of the therapeutic T cells. In some examples, the included instructions may comprise a description of using the gene editing components to genetically engineer one or more of the target genes (e.g., TRAC, CD70, TGFBRII, Reg-1, CBLB, or a combination thereof). In other examples, the included instructions may comprise a description of how to introduce a nucleic acid encoding a CAR construction into the T cells for making therapeutic T cells. In some embodiments, a kit as disclosed herein may comprise a population of genetically engineered T cells (e.g., CAR-T cells) for use to eliminate undesired cells targeted by the CAR construct (e.g., for treatment of cancer such as a solid tumor). Such a kit may comprise one or more containers in which the genetically engineered T cells can be placed. The kit may further comprise instructions for administration of the therapeutic T cells as disclosed herein to achieve the intended activity, e.g., eliminating disease cells targeted by the CAR expressed on the therapeutic T cells. Alternatively or in addition, the kit may further comprise a description of selecting a subject suitable for treatment based on identifying whether the subject is in need of the treatment. The instructions relating to the use of the therapeutic T cells described herein generally include information as to dosage, dosing schedule, and route of administration for the intended treatment. The containers may be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions supplied in the kits of the disclosure are typically written instructions on a label or package insert. The label or package insert indicates that the therapeutic T cells are used for treating, delaying the onset, and/or alleviating a disease or disorder in a subject. The kits provided herein are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like. Also contemplated are packages for use in combination with a specific device, such as an infusion device for administration of the therapeutic T cells. A kit may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The container may also have a sterile access port. Kits optionally may provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. In some embodiment, the disclosure provides articles of manufacture comprising contents of the kits described above. General techniques The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M. J. Gait, ed. 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J. E. Cellis, ed., 1989) Academic Press; Animal Cell Culture (R. I. Freshney, ed. 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P. E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J. B. Griffiths, and D. G. Newell, eds. 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir and C. C. Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (J. M. Miller and M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel, et al. eds. 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994); Current Protocols in Immunology (J. E. Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (C. A. Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and J. D. Capra, eds. Harwood Academic Publishers, 1995); DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985); Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds.(1985»; Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984»; Animal Cell Culture (R.I. Freshney, ed. (1986»; Immobilized Cells and Enzymes (lRL Press, (1986»; and B. Perbal, A practical Guide To Molecular Cloning (1984); F.M. Ausubel et al. (eds.). Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purposes or subject matter referenced herein. EXAMPLES Some aspects of the embodiments discussed above are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the present disclosure. Example 1. Modulation of MHC class I Pathway by TAPBP Disruption Expression levels of MHC class I molecules was altered by disrupting the Transporter Associated with Antigen Processing Binding Protein (TAPBP or tapasin) gene. The initial screening consisted of 10 sgRNAs that targeted the TAPBP gene. Briefly, PBMCs were thawed and activated with TransAct™. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes to generate TAPBP⁻ T cells. The sgRNAs, which form RNPs with the Cas9 enzyme, were introduced into the T cells in a single electroporation event. Cells were then maintained in the culture for a week. MHC Class I expression on the CAR-T cell surface were evaluated in the cell populations by flow cytometry and the editing efficiencies were assessed. Deletion of TAPBP was measured by western analysis, as shown in FIGs. 1A-1B, Downregulation of MHC class I expression was measured by FACS analysis, as shown in FIGs. 2A-2E and Table 1 below, and correlated well with the western blot data. In general, unmodified or modified versions of the sgRNAs may be used. Exemplary gRNA sequences are shown in Table 20. Table 1. MHC Class I Downregulation in Edited T Cells with TAPBP Deletion g^{RNA used HLA ABC} D_{ecrease (%)} TABP_Ex1_T1 0 TAPBP_Ex1_T3 26 TAPBP_Ex2_T1 0 TAPBP_Ex2_T2 27 TAPBP_Ex2_T3 14 TAPBP_Ex2_T4 31

Example 2: Production and Characterization of Anti-CD70 CAR⁺ T Cells with Deletion of TAPBP This example describes generation and characterization of allogeneic human T cells that lack expression of the TRAC gene, the CD70 gene, and the TAPBP gene, and which expresses an anti-CD70 CAR. Generation of Anti-CD70 CAR-T Cells PBMCs were thawed and activated with TransAct™. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes and transduced with adeno-associated adenoviral vectors (AAVs) to generate genetically engineered TRAC¯ /CD70¯ /TAPBP⁻/anti- CD70 CAR⁺ T cells, in which the nucleic acid encoding the anti-CD70 CAR is inserted at the TRAC locus. The sgRNAs, which form RNPs with the Cas9 enzyme, were introduced into the T cells in single or multiple electroporation events. After the electroporation, the cells were transduced with recombinant AAVs to introduce the donor template encoding the anti-CD70 CAR. Recombinant AAV serotype 6 (AAV6) comprising one of the nucleotide sequences encoding an anti-CD70 CAR listed in Table 22 was delivered with Cas9:sgRNA RNPs (1 µM Cas9, 5 µM gRNA) to activated human T cells. The following sgRNAs were used: TRAC (SEQ ID NO: 71), CD70 (SEQ ID NO: 79) and TAPBP (SEQ ID NO: 51). Assessment of CAR Expression and Editing Efficiency CAR expression was assessed by flow cytometry using biotinylated CD70 antigen (1 µg), followed by incubation with APC-conjugated streptavidin (200 ng). As shown in Table 2, CD70 CAR expression was similar across all the conditions including the TAPBP- deficient CAR T cells. Table 2. CAR Expression

Editing efficiency for TRAC knockout was assessed by flow cytometry analysis and was about 98% across all CAR T cell populations. Assessment of CD4:CD8 T Cell Ratios The frequency of CD4 and CD8 T cells in these cell cohorts, as well as differential profiles of the CAR T cells, were also determined by flow cytometry. As shown in Table 3, there were no significant changes in CD4⁺ to CD8⁺ cell ratios in any of the CAR T cell populations. Table 3. CD4⁺/CD8⁺ Frequency in the CAR T Cell Populations

In Vitro Cytotoxicity Anti-CD70 CAR T cells with or without TAPBP deletion were plated at different ratios with Caki-1 target cells that have high CD70 expression. One day later, the number of viable target cells and T cells were counted. As shown in Table 4, TAPBP deletion had minimal impact of the CAR T cell potency. Table 4. Target Cell Lysis by CAR T Cells of CD70⁺ Caki-1 Cells

Example 3. Production and Characterization of Anti-CD19 CAR⁺ T Cells with Deletion of TAPBP This example describes generation and characterization of allogeneic human T cells that lack expression of the TRAC gene, the CD19 gene, and the TAPBP gene, and which expresses an anti-CD19 CAR. Generation of Anti-CD19 CAR-T Cells PBMCs were thawed and activated with TransAct™. After 0-3 days, the cells were electroporated with Cas9:sgRNA RNP complexes and transduced with adeno-associated adenoviral vectors (AAVs) to generate genetically engineered TRAC¯ /CD19¯ /TAPBP⁻/anti- CD19 CAR⁺ T cells, in which the nucleic acid encoding the anti-CD19 CAR is inserted at the TRAC locus. A control TRAC^¯ /CD19^¯ / β2M⁻ /anti-CD19 CAR⁺ T cells cell group was also generated. The sgRNAs, which form RNPs with the Cas9 enzyme, were introduced into the T cells in single or multiple electroporation events. After the electroporation, the cells were transduced with recombinant AAVs to introduce the donor template encoding the anti-CD19 CAR. Recombinant AAV serotype 6 (AAV6) comprising one of the nucleotide sequences encoding an anti-CD19 CAR listed in Table 22 was delivered with Cas9:sgRNA RNPs (1 µM Cas9, 5 µM gRNA) to activated human T cells. The following sgRNAs were used: TRAC (SEQ ID NO: 71), CD70 (SEQ ID NO: 79) and TAPBP (SEQ ID NO: 51). In general, unmodified or modified versions of the sgRNAs may be used. Assessment of CAR Expression and Editing Efficiency CAR expression was assessed by flow cytometry using biotinylated CD19 antigen (1 µg), followed by incubation with APC-conjugated streptavidin (200 ng). As shown in Table 5, CD19 CAR expression was similar across all anti-CD19 CAR constructs. Table 5. CAR Expression

Editing efficiency for TRAC knockouts was assessed by flow cytometry and TIDE analysis and is presented in Table 6 below. Similar levels of editing efficiency for TAPBP genes were observed in CAR-T cells by western blot analysis. Table 6. Editing Efficiency of TRAC (%)

Assessment of CD4:CD8 T Cell Ratios The frequency of CD4 and CD8 T cells in these cell cohorts, as well as differential profiles of the CAR T cells, were also determined by flow cytometry. As shown in Table 7 below, there were no significant changes in CD4⁺ to CD8⁺ cell ratios in any of the CAR T cell populations. Table 7. CD4 and CD8 Frequency (%)

Assessment of MHC Class I expression MHC Class I expression on the CAR-T cell surface were evaluated in the cell populations by flow cytometry. Deletion of TAPBP downregulated MHC Class I expression in two different donors, as seen in the Table 8 below. Table 8. Mean Fluorescent Intensity of HLA ABC (%)

In Vitro Cytotoxicity Anti-CD19 CAR T cells with or without TAPBP deletion were plated at different ratios with K562 target cells that expressed CD19 or not. After 24 hours, the remaining viable target cells were assessed by measuring the relative luminescence units using CellTiter-Glo^® assay. As shown in Tables 9-12 below, TAPBP deletion had minimal impact of the CAR T cell potency and were specific for target cells that expressed the CD19 antigen. Table 9. Target Cell Lysis by CAR T Cells of CD19⁺ K562 Cells (Donor 1)

Table 10. Cell Lysis by CAR T Cells of CD19⁻ K562 Cells (Donor 1)

Table 11. Target Cell Lysis by CAR T Cells of CD19⁺ K562 Cells (Donor 2)

Table 12. Cell Lysis by CAR T Cells of CD19⁻ K562 Cells (Donor 2)

Example 4. Deletion of TAPBP in CAR T Cells Leads to Protection from NK Cell- Mediated Lysis This example shows that CAR T cells with TAPBP deletion described in Examples 1 and 2 leads to protection from NK cell-mediated lysis. Anti-CD70 CAR T cells Anti-CD70 CAR T cells with TAPBP deletion were labeled with fluorescent dye and plated at different ratios with NK cells 7 days after electroporation. After 20 hours, the cells were stained, and cell lysis was assessed by flow cytometry. As shown in Tables 13-16, anti- CD70 CAR T cells that have TAPBP knockout were protected from NK cell-mediated lysis. The data also demonstrate the protection from NK cell-mediated lysis that the single deletion of TAPBP provided. Table 13. % CAR T Cell Lysis on Co-Culture with Allogeneic NK Cells (Donor 1)

Table 14. % CAR T Cell Lysis on Co-Culture with Allogeneic NK Cells (Donor 2)

Table 15. % Protection from NK Cell-Mediated Lysis (Donor 1)

Table 16. % Protection from NK Cell-Mediated Lysis (Donor 2)

Anti-CD19 CAR T cells Anti-CD19 CAR T cells with TAPBP deletion were labeled with fluorescent dye and plated at different ratios with NK cells either from the same donor (i.e., autologous condition) or from a different donor (i.e., allogeneic condition). After 20 hours, the cells were stained, and cell lysis was assessed by flow cytometry. As shown in Tables 17-18, anti-CD19 CAR T cells that have TAPBP knockout were protected from NK cell-mediated lysis. Table 17. % CAR T Cell Lysis on Co-Culture with Autologous NK Cells

Table 18. % CAR T Cell Lysis on Co-Culture with Allogeneic NK Cells

Overall, the results indicate that knocking out TAPBP reduced CAR T cell lysis by NK cells significantly better than β2M knockout. Sequence Tables The following tables provide details for the various nucleotide and amino acid sequences disclosed herein. Table 19. TAPBP gRNA Target Sequences

Table 20. sgRNA Sequences for TAPBP

* indicates a nucleotide with a 2′-O-methyl phosphorothioate modification. Table 21. sgRNA Sequences and Target Gene Sequences for TRAC, CD70, Reg-1, TGFBRII, and CBLB Genes

* indicates a nucleotide with a 2′-O-methyl phosphorothioate modification. “n” refers to the spacer sequence at the 5′ end. Table 22. Chimeric Antigen Receptor Sequences

Table 23. AAV Donor Template Sequences

OTHER EMBODIMENTS All of the features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, one skilled in the art can easily ascertain the essential characteristics of the present invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Thus, other embodiments are also within the claims. EQUIVALENTS While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision a variety of other means and/or structures for performing the function and/or obtaining the results and/or one or more of the advantages described herein, and each of such variations and/or modifications is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary and that the actual parameters, dimensions, materials, and/or configurations will depend upon the specific application or applications for which the inventive teachings is/are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. It is, therefore, to be understood that the foregoing embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and/or methods, if such features, systems, articles, materials, kits, and/or methods are not mutually inconsistent, is included within the inventive scope of the present disclosure. All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and/or ordinary meanings of the defined terms. All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document. The indefinite articles “a” and “an,” as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean “at least one.” The phrase “and/or,” as used herein in the specification and in the claims, should be understood to mean “either or both” of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Multiple elements listed with “and/or” should be construed in the same fashion, i.e., “one or more” of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the “and/or” clause, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc. As used herein in the specification and in the claims, “or” should be understood to have the same meaning as “and/or” as defined above. For example, when separating items in a list, “or” or “and/or” shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as “only one of” or “exactly one of,” or, when used in the claims, “consisting of,” will refer to the inclusion of exactly one element of a number or list of elements. In general, the term “or” as used herein shall only be interpreted as indicating exclusive alternatives (i.e. “one or the other but not both”) when preceded by terms of exclusivity, such as “either,” “one of,” “only one of,” or “exactly one of.” “Consisting essentially of,” when used in the claims, shall have its ordinary meaning as used in the field of patent law. The term “about” as used herein means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within an acceptable standard deviation, per the practice in the art. Alternatively, “about” can mean a range of up to ± 20 %, preferably up to ± 10 %, more preferably up to ± 5 %, and more preferably still up to ± 1 % of a given value. Where particular values are described in the application and claims, unless otherwise stated, the term “about” is implicit and in this context means within an acceptable error range for the particular value. As used herein in the specification and in the claims, the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements. This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, “at least one of A and B” (or, equivalently, “at least one of A or B,” or, equivalently “at least one of A and/or B”) can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc. It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

Claims

What Is Claimed Is: 1. A population of genetically engineered T cells, comprising: a disrupted Transporter Associated with Antigen Processing Binding Protein (TAPBP) gene.

2. The population of genetically engineered T cells of claim 1, wherein the T cells are further engineered to express a chimeric antigen receptor (CAR).

3. The population of genetically engineered T cells of claim 1 or claim 2, wherein the disrupted TAPBP gene is genetically edited in exon 1 or exon 2 of the TAPBP gene.

4. The population of genetically engineered T cells of any one of claims 1-3, wherein the disrupted TAPBP gene is genetically edited by a CRISPR/Cas-mediated gene editing system.

5. The population of genetically engineered T cells of claim 4, wherein the CRISPR/Cas-mediated gene editing comprises a guide RNA (gRNA) targeting a site in the TAPBP gene that comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-10.

6. The population of genetically engineered T cells of claim 5, wherein the gRNA comprises a spacer sequence selected from the group consisting of SEQ ID NOs: 22, 24, 26, 28, 30, 32, 34, 36, 38 and 40; optionally wherein the gRNA comprises a spacer sequence set forth as SEQ ID NO: 24, 28 or 32.

7. The population of genetically engineered T cells of any one of claims 1-6, wherein the T cells further comprise: (i) a disrupted T cell receptor alpha chain constant region (TRAC) gene, (ii) a disrupted CD70 gene, (iii) a disrupted transforming growth factor beta receptor II (TGFbRII) gene, (iv) a disrupted Regnase-1 (Reg1) gene, (v) a disrupted Casitas B-Lineage Lymphoma Proto-Oncogene-B (CBLB) gene, or (vi) a combination of any one of (i)-(iv).

8. The population of genetically engineered T cells of claim 7, wherein the disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Reg1 gene, the disrupted CBLB gene, or a combination thereof, is genetically edited by a CRISPR/Cas-mediated gene editing system.

9. The population of genetically engineered T cells of any one of claims 2-8, wherein the T cells comprise a nucleic acid encoding the CAR.

10. The population of genetically engineered T cells of claim 9, wherein the nucleic acid is inserted in a genomic locus of the T cells.

11. The population of genetically engineered T cells of claim 10, wherein the genomic locus in which the nucleic acid encoding the CAR is inserted is within a safe harbor gene, the disrupted TRAC gene, the disrupted CD70 gene, the disrupted TGFBRII gene, the disrupted Reg-1 gene, or the disrupted CBLB gene.

12. The population of genetically engineered T cells of claim 11, wherein the disrupted TRAC gene comprises the nucleic acid encoding the CAR.

13. The population of genetically engineered T cells of claim 12, wherein the nucleic acid encoding the CAR replaces a fragment in the disrupted TRAC gene; optionally wherein the replaced fragment of the TRAC gene is set forth as SEQ ID NO: 86.

14. The population of genetically engineered T cells of claims 2-13, wherein the CAR comprises an extracellular antigen binding domain specific to a tumor antigen, a co- stimulatory signaling domain of 4-1BB or CD28, and a cytoplasmic signaling domain of CD3ζ.

15. The population of genetically engineered T cells of claim 14, wherein the tumor antigen is CD19, BCMA, or CD70.

16. The population of genetically engineered T cells of claim 15, wherein the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds CD19, and wherein the scFv comprises the amino acid sequence of SEQ ID NO: 110.

17. The population of genetically engineered T cells of claim 16, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 111.

18. The population of genetically engineered T cells of claim 15, wherein the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds CD70, and wherein the scFv comprises the amino acid sequence of SEQ ID NO: 120 or 121.

19. The population of genetically engineered T cells of claim 18, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 122.

20. The population of genetically engineered T cells of claim 15, wherein the extracellular antigen binding domain is a single chain variable fragment (scFv) that binds BCMA, and wherein the scFv comprises the amino acid sequence of SEQ ID NO: 131.

21. The population of genetically engineered T cells of claim 20, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 132.

22. The population of genetically engineered T cells of any one of claims 1-21, wherein the genetically engineered T cells are derived from primary T cells of one or more human donors.

23. A method for preparing the population of genetically engineered T cells of claim 1, the method comprising: (a) providing a plurality of cells, which are T cells or precursor cells thereof; (b) genetically editing the TAPBP gene; and (c) producing the population of genetically engineered T cells having a disrupted TAPBP gene.

24. The method of claim 23, wherein step (b) is performed by delivering to the plurality of cells an RNA-guided nuclease and a gRNA targeting the TAPBP gene.

25. The method of claim 24, wherein the gRNA targeting TAPBP is specific to exon 1 or exon 2 of the TAPBP gene.

26. The method of claim 25, wherein the gRNA targeting the TAPBP gene comprises a nucleotide sequence of SEQ ID NO: 1-10.

27. The method of claim 26, wherein the gRNA comprises a spacer sequence set forth as SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, or 42; optionally wherein the gRNA comprises a spacer set forth as SEQ ID NO: 24, 28 or 32.

28. The method of claim 27, wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 21, 41, 23, 43, 25, 45, 27, 47, 29, 49, 31, 51, 33, 53, 35, 55, 37, 57, 39, or 59; optionally wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 23, 43, 27, 47, 31, or 51.

29. The method of any one of claims 23-28, wherein the plurality of T cells in step (a) comprises one or more of the following genetic modifications: (i) engineered to express a chimeric antigen receptor (CAR); (ii) has a disrupted T cell receptor alpha chain constant region (TRAC) gene; (iii) has a disrupted CD70 gene; (iv) has a disrupted TGFBRII gene; (v) has a disrupted Reg-1 gene; and (vi) has a disrupted CBLB gene.

30. The method of any one of claims 23-28, wherein the method further comprises: (i) delivering to the T cells a nucleic acid encoding a chimeric antigen receptor (CAR); (ii) genetically editing a TRAC gene to disrupt its expression; (iii) genetically editing a CD70 gene to disrupt its expression; (iv) genetically editing a TGFBRII gene to disrupt its expression; (v) genetically editing a Reg-1 gene to disrupt its expression; (vi) genetically editing a CBLB gene to disrupt its expression; or (vii) a combination thereof.

31. The method of claim 30, wherein one or more of (i)-(iv) are performed by CRISPR/Cas-mediated gene editing comprising one or more RNA-guided nucleases and one or more gRNAs targeting the TRAC gene, the CD70 gene; the TGFBRII gene, the Reg-1 gene, and/or the CBLB gene.

32. The method of claim 31, wherein the gRNA targeting the TRAC gene comprises the nucleotide sequence of SEQ ID NO: 62.

33. The method of any one of claims 30-32, wherein the gRNA targeting the CD70 gene comprises the nucleotide sequence of SEQ ID NO: 70.

34. The method of any one of claims 30-33, wherein the gRNA targeting the TGFBRII gene comprises the nucleotide sequence of SEQ ID NO: 64.

35. The method of any one of claims 30-34, wherein the gRNA targeting the Reg-1 gene comprises the nucleotide sequence of SEQ ID NO: 66.

36. The method of any one of claims 30-35, wherein the gRNA targeting the CBLB gene comprises the nucleotide sequence of SEQ ID NO: 68.

37. The method of any one of claims 23-36, wherein the method comprises delivering to the T cells one or more ribonucleoprotein particles (RNP), comprising the RNA- guided nuclease, one or more of the gRNAs, and the nucleic acid encoding the CAR.

38. The method of any one of claims 23-37, wherein the RNA-guided nuclease is a Cas9 nuclease.

39. The method of claim 38, wherein the Cas9 nuclease is a S. pyogenes Cas9 nuclease.

40. The method of any one of claims 30-39, wherein the nucleic acid encoding the CAR is in an AAV vector.

41. The method of any one of claims 30-40, wherein the nucleic acid encoding the CAR comprises a left homology arm and a right homology arm flanking the nucleotide sequence encoding the CAR; and wherein the left homology arm and the right homology arm are homologous to a genomic locus in the T cells, allowing for insertion of the nucleic acid into the genomic locus.

42. The method of claim 41, wherein the genomic locus is a target site of a guide RNA, and wherein insertion of the nucleic acid encoding the CAR at the genomic locus results in deletion and/or mutation of the target site of the guide RNA.

43. The method of claim 41 or claim 42, wherein the genomic locus is in a safe harbor gene, in the TRAC gene, in the CD70 gene, in the TGFBRII gene, in the Reg-1 gene, or in the CBLB gene.

44. The method of claim 43, wherein the method comprises disrupting the TRAC gene by CRISPR/Cas-mediated gene editing comprising a gRNA targeting a TRAC gene site comprising nucleotide sequence of SEQ ID NO: 86 and the nucleic acid encoding the CAR is inserted at the TRAC gene site targeted by the gRNA.

45. The method of claim 43, wherein the method comprising delivering to the T cells a nucleic acid encoding a CAR, which is specific to CD70, and genetically editing the CD70 gene to disrupt its expression.

46. The method of any one of claims 23-45, wherein the T cells of step (a) are or derived from primary T cells of one or more human donors.

47. A population of genetically engineered T cells, which is prepared by a method of any one of claims 23-46.

48. A method for eliminating undesired cells in a subject, the method comprising administering to a subject in need thereof T cells expressing a disrupted TAPBP gene and a chimeric antigen receptor targeting the undesired cells.

49. The method of claim 48, wherein the T cells are set forth in any one of claims 2- 22 and 47.

50. The method of claim 48 or claim 49, wherein the undesired cells are cancer cells.

51. The method of claim 50, wherein the cancer cells are CD19⁺, BCMA⁺, or CD70⁺.

52. The method of any one of claims 48-51, wherein the T cells are allogenic to the subject.

53. A guide RNA (gRNA) targeting a TAPBP gene, comprising a nucleotide sequence specific to a fragment in exon 1 or exon 2 of the TAPBP gene.

54. The gRNA of claim 53, wherein the gRNA comprises a spacer selected from the group consisting of SEQ ID NO: 22, 24, 26, 28, 30, 32, 34, 36, 38 and 40, optionally wherein the gRNA comprises a spacer set forth as SEQ ID NO: 24, 28 or 32.

55. The gRNA of claim 53 or claim 54, wherein the gRNA further comprises a scaffold sequence.

56. The gRNA of any one of claims 53-55, wherein the gRNA comprises one or more modified nucleotides.

57. The gRNA of claim 56, wherein the gRNA comprises one or more 2’-O-methyl phosphorothioate residues at the 5’ and/or 3’ terminus of the gRNA.

58. The gRNA of claim 57, which comprises the nucleotide sequence of any one of SEQ ID NOs: 21, 41, 23, 43, 25, 45, 27, 47, 29, 49, 31, 51, 33, 53, 35, 55, 37, 57, 39 and 59; optionally wherein the gRNA comprises the nucleotide sequence of SEQ ID NO: 23, 43, 27, 47, 31, or 51.