WO2024010105A1 - Pharmaceutical composition for preventing or treating acute renal injury - Google Patents

Abstract

The present invention pertains to: a pharmaceutical composition for preventing or treating acute renal injury, the pharmaceutical composition containing vascular endothelial progenitor cells; and a health functional food for preventing or treating acute renal injury. Vascular endothelial progenitor cells reduce apoptosis, oxidative stress, inflammation regulatory complex activity, inflammation-related immune cell infiltration, and renal fibrosis, thereby improving renal dysfunction and tissue damage, and thus can have the effect of preventing, treating, or improving acute renal injury.

Description

Pharmaceutical composition for preventing or treating acute kidney injury

The present invention relates to a pharmaceutical composition for preventing or treating acute kidney injury.

Blood plays a role in transporting oxygen and nutrients to each tissue or cell in the body. Ischemia is a condition in which blood vessels supplying blood to body organs, tissues, or parts are narrowed or constricted, or normal blood vessels are not formed sufficiently, resulting in insufficient blood supply resulting in oxygen deficiency. Ischemia irreversibly damages cells and leads to tissue necrosis. When ischemia occurs in tissue, a series of processes called the ischemic cascade are triggered, resulting in permanent tissue damage. To prevent tissue damage, the return of blood flow after ischemia is called reperfusion.

Conventional treatment for ischemia and resulting hypoxia is to restore blood flow and oxygen delivery to normal levels by increasing systemic oxygenation or removing the cause of vascular blockage. However, as blood flow and oxygen delivery are restored, there is a problem that additional cell death or loss of function occurs regardless of the damage caused by ischemia. This is known as ischemia-reperfusion injury.

Ischemia-reperfusion injury is the most common cause of acute renal injury and progression to chronic kidney disease. Ischemic acute kidney injury is not only the most common type of acute kidney injury occurring in normal kidneys, but also causes delayed graft function (DGF) in kidney transplant recipients and increases the risk of graft rejection. It is known to reduce the long-term survival rate of transplanted kidneys. The pathophysiology of ischemic acute kidney injury is the result of immune and inflammatory processes involving endothelial and epithelial cell damage. In particular, renal inflammation is a major pathophysiology of ischemic acute renal injury. Ischemia-reperfusion injury induces swelling, destroys endothelial cells, and stimulates inflammatory responses.

Although much research has been conducted on the mechanism of ischemic acute kidney injury, there is still no specific treatment, so treatment of ischemic acute kidney injury relies on conservative treatment and dialysis treatment. Considering that the immunological inflammatory response is the main pathophysiology that causes and progresses ischemic acute kidney injury, there is a need to develop a treatment that can fundamentally block this inflammatory response.

The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating acute kidney injury and a health functional food for preventing or improving acute kidney injury.

1. A pharmaceutical composition for preventing or treating acute kidney injury containing endothelial progenitor cells.

2. The pharmaceutical composition for preventing or treating acute renal injury according to 1 above, wherein the acute renal injury is caused by ischemia-reperfusion injury.

3. Health functional food for preventing or improving acute kidney injury containing endothelial progenitor cells.

4. The health functional food for preventing or improving acute renal injury according to 3 above, wherein the acute renal injury is caused by ischemia-reperfusion injury.

The pharmaceutical composition of the present invention can significantly reduce renal dysfunction and tissue damage caused by ischemia-reperfusion injury, and can prevent or treat acute renal injury by reducing apoptosis, oxidative stress, expression of inflammatory complexes, fibrosis, etc.

The health functional food of the present invention can significantly reduce kidney dysfunction and tissue damage caused by ischemia-reperfusion damage, and can prevent or improve acute kidney injury by reducing apoptosis, oxidative stress, expression of inflammatory complexes, fibrosis, etc. there is.

Figure 1 shows micrographs of cell clusters of EPCs differentiated from PBMNC and the vWF staining results of EPCs.

Figure 2 shows the effect of EPC on kidney function and morphological changes during IRI through graphs and H&E staining photographs.

Figure 3 shows the effect of EPC on IRI-induced apoptosis through TUNEL analysis photos and graphs.

Figure 4 shows the effect of EPC on IRI-induced oxidative stress through 8-OhdG staining photographs and graphs.

Figure 5 shows immunoblotting results and graphs showing the effect of EPC on the expression pattern of IRI-induced inflammatory regulatory complex.

Figure 6 shows the effect of EPC on IRI-induced inflammation by immunomodulation using immunohistochemical staining photographs and graphs.

Figure 7 shows immunohistochemical staining photographs and graphs showing the effect of EPC on IRI-induced renal fibrosis.

Hereinafter, the present invention will be described in detail.

The present invention relates to a pharmaceutical composition for preventing or treating acute kidney injury containing endothelial progenitor cells.

Vascular endothelial progenitor cells play an important role in maintaining vascular continuity and repairing endothelial damage, and are cells involved in angiogenesis in various diseases such as ischemic disease, cancer formation, or retinopathy.

The vascular endothelial progenitor cells may be derived from adult peripheral blood, bone marrow, or tissue-resident cells. For example, they may be differentiated from peripheral blood mononuclear cells (PBMNC), and specifically, they may be human vascular endothelial progenitor cells differentiated from human peripheral blood mononuclear cells, but are not limited thereto.

“Acute kidney injury” is a condition in which the kidneys' ability to filter metabolic wastes from the blood is drastically reduced (over a period of days to weeks). It commonly appears as a comorbidity in seriously ill patients and is a major cause of death with a high risk of progression to chronic kidney disease.

Causes of the above-mentioned acute kidney injury include, for example, bleeding, severe vomiting or diarrhea, low blood pressure, heart failure, use of nephrotoxic anti-inflammatory drugs, decreased blood flow to the kidneys, renal vascular abnormalities, malignant hypertension, acute glomerulonephritis, vasculitis, This may be due to damage to the kidney itself due to use of nephrotoxic antibiotics or anticancer drugs that are harmful to the kidney, enlarged prostate, abnormal bladder nerve control, or obstruction of urine discharge from the kidney due to a tumor, etc., but is not limited to this.

As a specific example, the acute renal injury may be due to ischemia-reperfusion injury. The ischemia-reperfusion damage is accompanied by additional damage, such as aggravated tissue damage such as decreased vascular endothelial function, during the process of reperfusion to suppress tissue damage caused by ischemia (a condition in which blood supply to the tissue is insufficient). It can be a common cause of acute kidney injury and progression to chronic kidney disease.

The term “prevention” refers to any action that inhibits or delays acute kidney injury.

The term “treatment” refers to any action that improves or beneficially changes the symptoms of an individual with suspected or developing acute kidney injury.

Vascular endothelial progenitor cells have the effect of preventing or treating acute kidney injury by preventing renal dysfunction or tissue damage by reducing and alleviating apoptosis, oxidative stress, activation of the inflammatory regulatory complex, infiltration of inflammation-related immune cells, and renal fibrosis. It can be expressed.

The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and injections.

The pharmaceutical composition of the present invention may contain the active ingredient alone, or may further include one or more pharmaceutically acceptable carriers, excipients, or diluents.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavorings, etc. for oral administration, and buffers, preservatives, analgesics, etc. for injections. Solubilizers, isotonic agents, stabilizers, etc. can be mixed and used, and for topical administration, bases, excipients, lubricants, preservatives, etc. can be used.

The formulation of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier. For example, for oral administration, it can be used in tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. It can be manufactured in the form of an injection, and in the case of an injection, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. Additionally, the dosage form of the pharmaceutical composition of the present invention may be prepared as a solution, suspension, tablet, capsule, sustained-release preparation, etc.

Carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, It may be microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, filler, anti-coagulant, lubricant, wetting agent, fragrance, emulsifier or preservative.

The route of administration of the pharmaceutical composition of the present invention may be oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal. Not limited.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and when administered parenterally, external injection through the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection may be selected.

The dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, degree of disease, drug form, administration route and period, but can be appropriately selected by a person skilled in the art.

For example, the pharmaceutical composition of the present invention can be administered at 0.0001 to 1000 mg/kg or 0.001 to 700 mg/kg, preferably 0.01 to 500 mg/kg per day. The pharmaceutical composition of the present invention can be administered once a day, or may be administered several times. The dosage can be appropriately selected by a person skilled in the art depending on the administration route, number of administrations, degree of disease, patient condition, etc., and the dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention may be a cell therapy product containing the above cells.

The present invention provides a health functional food for preventing or improving acute kidney injury containing vascular endothelial progenitor cells.

Vascular endothelial progenitor cells can be derived from adult peripheral blood, bone marrow, or tissue-resident cells. For example, they may be differentiated from peripheral blood mononuclear cells (PBMNC), and specifically, they may be human vascular endothelial progenitor cells differentiated from human peripheral blood mononuclear cells, but are not limited thereto.

Acute kidney injury may be within the range described above.

For example, the acute kidney injury may be due to ischemia reperfusion injury. The ischemia-reperfusion damage is accompanied by additional damage, such as aggravated tissue damage such as decreased vascular endothelial function, during the process of reperfusion to suppress tissue damage caused by ischemia (a condition in which blood supply to the tissue is insufficient). It can be a common cause of acute kidney injury and progression to chronic kidney disease.

The health functional food of the present invention may further include one or more of carriers, diluents, excipients, and additives, and may be used in tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, bars, films, etc. It can be manufactured and processed in the form of.

Health functional foods refer to foods manufactured and processed using raw materials or ingredients with functionality useful to the human body in accordance with Act No. 6727 on Health Functional Foods, and that regulate nutrients for the structure and function of the human body or regulate physiological function. It means ingestion for the purpose of obtaining useful health effects such as medical effects.

Health functional foods may contain common food additives, and their suitability as a food additive is determined by the specifications and standards for the item in accordance with the general provisions and general test methods of the food additive code approved by the Food and Drug Administration, unless otherwise specified. It is decided by .

Items listed in the Food Additives Code include, for example, chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as dark pigment, licorice extract, crystalline cellulose, high-quality pigment, and guar gum; It includes, but is not limited to, mixed preparations such as L-glutamate sodium preparations, noodle added alkaline preparations, preservative preparations, and tar coloring preparations.

For example, health functional foods in the form of tablets are made by granulating a mixture of vascular endothelial progenitor cells with excipients, binders, disintegrants, and other additives in a conventional manner, then adding a lubricant, etc., and compression molding the mixture. Can be directly compression molded. In addition, the health functional food in the form of tablets may contain flavoring agents, etc., if necessary.

Among health functional foods in capsule form, hard capsules can be manufactured by filling a regular hard capsule with a mixture of vascular endothelial progenitor cells mixed with excipients and other additives, while soft capsules can be manufactured by filling vascular endothelial progenitor cells with additives such as excipients. It can be manufactured by filling the mixture with a capsule base such as gelatin. The soft capsule may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, etc., if necessary.

Health functional foods in the form of pills can be prepared by molding a mixture of vascular endothelial progenitor cells and excipients, binders, disintegrants, etc. using a known method. If necessary, they can be coated with white sugar or other coating agents. Alternatively, the surface can be coated with substances such as starch or talc.

Health functional foods in the form of granules can be manufactured into granules using a mixture of vascular endothelial progenitor cells and excipients, binders, disintegrants, etc., using a known method. If necessary, they can contain flavoring agents, flavoring agents, etc. there is.

Additives that can be included in health functional foods include natural carbohydrates, flavors, nutrients, vitamins, minerals (electrolytes), flavors (synthetic flavors, natural flavors, etc.), colorants, fillers (cheese, chocolate, etc.), pectic acid, and At least one ingredient selected from the group consisting of its salts, alginine and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, antioxidants, glycerin, alcohol, carbonating agents and pulp can be used. Natural carbohydrates include monosaccharides, such as glucose, fructose, etc.; Disaccharides such as maltose, sucrose, etc.; and polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugars such as xylitol, sorbitol, and erythritol. The flavoring agent may be a natural flavoring agent (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and a synthetic flavoring agent (saccharin, aspartame, etc.).

Health functional foods may include beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes, and health supplements.

Health functional foods include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavors, colorants and fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, It may contain protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

The health functional food of the present invention can be applied orally as a nutritional supplement, and the form of application is not particularly limited. For example, when administered orally, the daily intake is preferably 5000 mg or less, more preferably 3000 mg or less, and most preferably 10 mg to 3000 mg per day. When formulated as a capsule or tablet, one tablet can be administered once a day with water.

Hereinafter, the present invention will be described in detail with reference to examples.

Example.

1. Experimental materials and methods

(1) Isolation and culture of EPCs from human PBMNCs

All blood samples were processed within 2 hours of blood collection. Peripheral blood mononuclear cells (PBMNCs) were isolated by Ficoll density gradient centrifugation (Sigma, St. Louis, MO, USA) at 2300 rpm for 25 minutes and then washed three times in phosphate-buffered saline. Cells were plated on culture dishes coated with human fibronectin (Sigma) and cultured in endothelial cell growth medium (EGM-2; Clontech, Mountain View, CA, USA) containing EGM Single-Quots. After 3 days, non-attached cells were removed and new culture medium was applied. On day 14, cells (1Х10 ⁵ ) were stained with von Willebrand factor (vWF). All cell cultures were performed in a humidified atmosphere, 5% CO ₂ , and 37°C.

PBMNCs were cultured in endothelial cell culture conditions and within 3 days, several clusters appeared, typical features of EPCs with spindle-shaped cells at the border (Figure 1A). The morphology of early and late EPCs was observed on days 7 and 14, respectively (Figure 1B, 1C). EPC differentiation was assessed by the appearance of cobblestone-shaped cells (Figure 1C), and the vWF-positive population was considered to have typical endothelial function (Figure 1D).

(2) acute kidney injury induced by ischemia-reperfusion injury;

Ten-week-old male C57BL/6 mice were maintained on a 12-hour/12-hour light/dark cycle in a temperature and humidity controlled facility. Standard mice were provided with food and water ad libitum. Mice were divided into Sham group (Sham), EPC group, IRI only group (IR), and IRI group treated with EPC (IR + EPC) (n=10 per group).

Mice were anesthetized by intraperitoneal injection of Avertin (2,2,2-tribromoethanol, Sigma). After midline incision, renal pedicles were fixed bilaterally with microaneurysm clamps for 40 minutes. The ischemia time was chosen to obtain a reversible model of ischemic acute kidney injury (AKI) and to avoid death. Endothelial Progenitor Cells (EPCs) (5Х10 ⁵ cells, tail vein) were administered 5 minutes before reperfusion. After removing the clamp, blood flow was restored and the kidney was observed to return to its original color. The sham surgery consisted of the same surgical procedure without the use of clamps. Animals were maintained at 29°C in an incubator for the first 24 hours of reperfusion. Animals were sacrificed 72 hours after ischemia, and blood and kidney tissue were harvested. All experiments were performed in triplicate.

(3) Histopathology

Tissues were fixed with 4% paraformaldehyde in 0.1M phosphate-buffered saline, embedded in paraffin, and cut into 5-μm sections. Sections were stained with hematoxylin and eosin (H&E). A semi-quantitative score for H&E staining is based on the degree of interstitial damage, assigning points (0-3) for the degree of interstitial fibrosis and renal tubular atrophy (defined as luminal dilatation, loss of brush borders, and flat tubular epithelial cells). did. Tissue damage was scored by grading the percentage of cells affected in the high-power field (Х400): 0, 0%; 1, <30%; 2, 31-60%; 3, 61-100%. All scores were summed and displayed as average values on the graph, and signals were analyzed using NIS-Elements BR 3.2 (Nikon, Tokyo, Japan).

(4) TUNEL analysis

The degree of apoptosis was assessed using TUNEL analysis. DNA fragmentation was detected using a kit from Roche Applied Sciences (Indianapolis, IN, USA). Semi-quantitative analysis was performed by counting the number of TUNEL-positive cells per field in kidney tissue at Х400 magnification. At least 10 regions were randomly selected from the cortex per slide, and the average number of brown cells in these regions was expressed as the density of TUNEL-positive cells.

(5) Immunoblotting

Kidney samples were obtained for immunoblotting and homogenized in RIPA buffer (Thermo Scientific, Waltham, MA, USA). Protein amount was measured using the BCA assay kit (Pierce, Rockford, IL, USA). Protein samples (50 μg) were electrophoresed by SDS-polyacrylamide electrophoresis (SDS-PAGE) and transferred to membranes for blotting. Blots were labeled with NLRP-3 (Abcam, Cambridge, UK), c-Casp-1 (Abcam), p-NF-κB (Santa Cruz Biotechnology, Santa Cruz, CA, USA), or p-p38 (Cell Signaling Technology, Danvers; MA, USA) was treated overnight at 4°C with a monoclonal primary antibody. Primary antibody binding was visualized with a secondary antibody and ECL kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA), and β-actin antibody (Sigma) was used as a control. Densitometric analysis was performed for quantitative analysis of the data.

(6) Immunohistochemistry

After deparaffinization, sections were incubated with monoclonal antibodies against ICAM-1 (BD Bioscience, Franklin Lakes, NJ, USA) or α-SMA (Sigma) or F4/80 (Santa Cruz Biotechnology) or 8-OHdG (Abcam). After incubation with polyclonal antibodies against biotin-conjugated secondary IgG (diluted 1:200; Vector Laboratories, Burlingame, CA, USA), avidin-biotin-peroxidase complex (ABC Elite Kit; Vector Laboratories), and DAB. was incubated with. Next, sections were visualized under a light microscope, and digital images were captured and analyzed using NIS-Elements BR 3.2. Semi-quantitative analysis was performed by counting the number of immunohistochemically stained positive cells per field in kidney tissue at Х400 magnification.

(7) Quantitative real-time polymerase chain reaction (PCR)

Kidney samples were collected for quantitative real-time PCR. Total RNA was isolated from frozen kidney tissue using TRzol (Invitrogen, Carlsbad, CA, USA). Purified RNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). ViiA7 Real-Time System (Applied Biosystems Inc., Foster City, CA, USA), Power SYBR Green PCR Master Mix (Applied Biosystems) and IL-1β, IL-18, CX3CL1, CX3CR1, RORγt, IL-17RA, TGF- 1, Quantitative cDNA amplification was performed using gene-specific primers for α-SMA, Twist, and Snail. GADPH was used as an internal control to confirm that the same amount of RNA was used. The sequences of the primers are shown in Table 1. Relative gene expression levels in each sample were quantified using the 2DDCt method.

Gene	Forward	Reverse
IL-1β	CTTCAGGCAGGCAGTATCACTCAT (SEQ ID NO: 1)	TCTAATGGGAACGTCACACACCAG (SEQ ID NO: 2)
IL-18	GCTTGACCCTCTCTGTGAA (SEQ ID NO: 3)	GGCAAGCAAGAAAGTGTCCT (SEQ ID NO: 4)
CX3CL1	ATTGGAAGACCTTGCTTTGG (SEQ ID NO: 5)	GCTCGGAAGTTTGAGAGAGA (SEQ ID NO: 6)
CX3CR1	CACCATTAGTCTGGCGTCT (SEQ ID NO: 7)	GATGCGGAAGTAGCAAAAGC (SEQ ID NO: 8)
RORγt	AGCTTTGTGCAGATCTAAGG (SEQ ID NO: 9)	TGTCCTCCTCAGTAGGGTAG (SEQ ID NO: 10)
TGF-1	TGCGCTTGCAGAGATTAAAA (SEQ ID NO: 11)	CGTCAAAAGACAGCCACTCA (SEQ ID NO: 12)
Twist	CTCGGACAAGCTGAGCAAG (SEQ ID NO: 13)	CAGCTTGCCATCTTGGAGTC (SEQ ID NO: 14)
Snail	CTTGTGTCTGCACGACCTGT (SEQ ID NO: 15)	CTTCACATCCGAGTGGGTTT (SEQ ID NO: 16)
GADPH	ACTCCACTCACGGCAAATTC (SEQ ID NO: 17)	TCTCCATGGTTGGTGAAGACA (SEQ ID NO: 18)
IL-17RA	Taqman, Mm.00434214
α-SMA	Taqman, Mm.00725412

(8) Statistical analysis

Statistical analyzes were performed using GraphPad Prism software (version 8.0; GraphPad Sofrware Inc., La Jolla, CA, USA). Data were evaluated using one-way analysis of variance and Turkey's multiple comparison test (for all group comparisons). A p value of less than 0.05 was considered statistically significant.

2. Experimental results

(1) Confirmation of the effect of EPCs on improving kidney dysfunction and tissue damage caused by IRI

Serum blood urea nitrogen (BUN) and serum creatinine (Cr) levels were significantly increased in the IR group. IRI mice treated with EPC showed significant attenuation of renal dysfunction associated with IRI (Figure 2A). Hematoxylin and eosin (H&E) staining was performed to confirm tissue damage caused by IRI with a scale bar of 100 μm. Analysis of renal pathology in IRI mice showed extensive renal tubular damage characterized by renal tubular atrophy, cast formation, and brush border loss (Figure 2B). These pathological changes were significantly attenuated in EPC-treated IRI mice (Figure 2C).

(2) Reduced IRI-induced apoptosis by EPCs

Apoptotic death contributes to the pathogenesis of IRI-induced AKI. The degree of apoptosis was evaluated by TUNEL analysis (scale bar 50 μm). Cell death due to apoptosis was significantly reduced in tubular epithelial cells of IRI mice treated with EPC (Figure 3).

(3) Attenuation of oxidative stress caused by IRI by EPCs

To investigate the effect of EPC on IRI-induced oxidative stress, immunohistochemical staining with 8-OHdG was performed on kidney tissue (scale bar 50 μm). 8-OhdG-positive reactions were detected in the nuclei of tubular epithelial cells in the IRI group (arrows in Figure 4). This response was significantly reduced in EPC-treated IRI mice (Figure 4).

(4) Reduced inflammation control complex (inflammasome) activation by EPCs

The expression patterns of factors related to the inflammatory regulatory complex were investigated. A significant increase in NLRP-3 expression was observed in the kidneys of IRI mice, and this increase was significantly reduced in IRI mice treated with EPC. Cleaved caspase-1 (c-Casp-1), phosphorylated nuclear factor kappa B (p-NF-κB), and phosphorylated p38 (p-p38) expression were also reduced in EPC-treated IRI mice (Figure 5A).

To determine the effect of EPC on inactivation of the inflammasome in IRI mice, the mRNA expression levels of IL-1β and IL-18, proinflammatory cytokines associated with the NLRP3 inflammasome, were examined. The mRNA expression levels of IL-1β and IL-18 were increased in IRI mice and decreased in EPC-treated IRI mice (Figure 5B).

(5) Reduced inflammation-related immune cell infiltration by EPCs

F4/80 immunohistochemical staining (scale bar 50 μm), a marker for macrophages, showed that EPC administration significantly reduced macrophage infiltration compared to IRI-only mice ( Fig. 6A ). Intracellular adhesion molecule-1 (ICAM-1) was significantly decreased in IRI mice treated with EPC (Figure 6B). The mRNA expression levels of C-X3-C motif chemokine ligand 1 (CX3CL1), C-X3-C motif chemokine receptor (CX3XR1), transcription factor RAR-related orphan receptor gamma T (RORγT), and IL-17RA were significantly increased in EPC-treated IRI. It was significantly reduced in mice (Figures 6C,D).

(6) The effect of EPCs on reducing IRI-induced renal fibrosis through the EMT pathway

Immunohistochemical staining of the myofibroblast marker α-SMA was performed to confirm fibrosis (scale bar 50 μm). α-SMA-positive reactions were found in the tubulointerstitial region of kidneys undergoing IRI, and the number of these positive reactions and the mRNA expression level of α-SMA were significantly reduced in EPC-treated IRI mice (Figures 7A,B). . Expression levels of transforming growth factor (TGF)-β1, Twist, and Snail mRNA (i.e., epithelial-mesenchymal transition [EMT]-specific biomarkers) were significantly reduced in EPC-treated IRI mice (Figure 7B ).

Claims (4)

1. A pharmaceutical composition for preventing or treating acute kidney injury containing endothelial progenitor cells.
2. The pharmaceutical composition for preventing or treating acute renal injury according to claim 1, wherein the acute renal injury is caused by ischemia-reperfusion injury.
3. A health functional food for preventing or improving acute kidney injury containing endothelial progenitor cells.
4. The health functional food for preventing or improving acute renal injury according to claim 3, wherein the acute renal injury is caused by ischemia-reperfusion injury.

Images